Cloning of nascent monkey DNA synthesized early in the cell cycle.
Kaufmann, G; Zannis-Hadjopoulos, M; Martin, R G
1985-04-01
To study the structure and complexity of animal cell replication origins, we have isolated and cloned nascent DNA from the onset of S phase as follows: African green monkey kidney cells arrested in G1 phase were serum stimulated in the presence of the DNA replication inhibitor aphidicolin. After 18 h, the drug was removed, and DNA synthesis was allowed to proceed in vivo for 1 min. Nuclei were then prepared, and DNA synthesis was briefly continued in the presence of Hg-dCTP. The mercury-labeled nascent DNA was purified in double-stranded form by extrusion (M. Zannis-Hadjopoulos, M. Perisco, and R. G. Martin, Cell 27:155-163, 1981) followed by sulfhydryl-agarose affinity chromatography. Purified nascent DNA (ca. 500 to 2,000 base pairs) was treated with mung bean nuclease to remove single-stranded ends and inserted into the NruI site of plasmid pBR322. The cloned fragments were examined for their time of replication by hybridization to cellular DNA fractions synthesized at various intervals of the S phase. Among five clones examined, four hybridized preferentially with early replicating fractions.
Base pairing and base mis-pairing in nucleic acids
NASA Technical Reports Server (NTRS)
Wang, A. H. J.; Rich, A.
1986-01-01
In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.
NASA Astrophysics Data System (ADS)
Sumida, David Shuji
PO(X('2)(PI)) is produced via the collision-free infrared multiple photon dissociation (IRMPD) of volatile organophosphorus molecules, and is detected by 2-frequency 2-photon ionization, using the B('2)(SIGMA)('+) state to provide a spectral signature from which X('2)(PI) populations are obtained. Sequential dissociations occur during the IR laser photolysis, in which nascent fragments continue to undergo IRMPD, and PO(X('2)(PI)) accrues from a series of bond fission reactions. Nascent vibrational, rotational, and translational excitations are in sensible accord with this mechanism, except for a few rotational states near J = 19.5. Unlike the nuclear degrees of freedom, the PO(X('2)(PI)) spin-orbit states are populated quite selectively. The ('2)(PI)(,3/2) state, lying only 224 cm('-1) above the ('2)(PI)(,1/2) ground state, contains only (TURN)11% of the population, compared to 34% for a 300K sample. This result is unambiguous; it persists with all precursors, laser fluences, etc., and is verified by comparisons to spectra obtained using a microwave discharge, a flame, and when thermalizing nascent excitations with an inert diluent. This result underscores the sanctity of the separate potential surfaces which correlate to the product spin -orbit states, and the small amount of ('2)(PI)(,3/2) population can be accounted for by non-adiabatic coupling during dissociation, and/or 'freezing' the amount of S(,1) character in an excited precursor in which S(,0) and S(,1) are coupled non-radiatively. We note that such electronic specificity should be dealt with in the analogous recombination reactions. (Copies available exclusively from Micrographics Department, Doheny Library, USC, Los Angeles, CA 90089.).
Accelerators as Authentic Training Experiences for Nascent Entrepreneurs
ERIC Educational Resources Information Center
Miles, Morgan P.; de Vries, Huibert; Harrison, Geoff; Bliemel, Martin; de Klerk, Saskia; Kasouf, Chick J.
2017-01-01
Purpose: The purpose of this paper is to address the role of accelerators as authentic learning-based entrepreneurial training programs. Accelerators facilitate the development and assessment of entrepreneurial competencies in nascent entrepreneurs through the process of creating a start-up venture. Design/methodology/approach: Survey data from…
Nascent-Seq reveals novel features of mouse circadian transcriptional regulation
Menet, Jerome S; Rodriguez, Joseph; Abruzzi, Katharine C; Rosbash, Michael
2012-01-01
A substantial fraction of the metazoan transcriptome undergoes circadian oscillations in many cells and tissues. Based on the transcription feedback loops important for circadian timekeeping, it is commonly assumed that this mRNA cycling reflects widespread transcriptional regulation. To address this issue, we directly measured the circadian dynamics of mouse liver transcription using Nascent-Seq (genome-wide sequencing of nascent RNA). Although many genes are rhythmically transcribed, many rhythmic mRNAs manifest poor transcriptional rhythms, indicating a prominent contribution of post-transcriptional regulation to circadian mRNA expression. This analysis of rhythmic transcription also showed that the rhythmic DNA binding profile of the transcription factors CLOCK and BMAL1 does not determine the transcriptional phase of most target genes. This likely reflects gene-specific collaborations of CLK:BMAL1 with other transcription factors. These insights from Nascent-Seq indicate that it should have broad applicability to many other gene expression regulatory issues. DOI: http://dx.doi.org/10.7554/eLife.00011.001 PMID:23150795
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Report on Pairing-based Cryptography.
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.
Report on Pairing-based Cryptography
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435
Seipin is required for converting nascent to mature lipid droplets
Wang, Huajin; Becuwe, Michel; Housden, Benjamin E; Chitraju, Chandramohan; Porras, Ashley J; Graham, Morven M; Liu, Xinran N; Thiam, Abdou Rachid; Savage, David B; Agarwal, Anil K; Garg, Abhimanyu; Olarte, Maria-Jesus; Lin, Qingqing; Fröhlich, Florian; Hannibal-Bach, Hans Kristian; Upadhyayula, Srigokul; Perrimon, Norbert; Kirchhausen, Tomas; Ejsing, Christer S; Walther, Tobias C; Farese, Robert V
2016-01-01
How proteins control the biogenesis of cellular lipid droplets (LDs) is poorly understood. Using Drosophila and human cells, we show here that seipin, an ER protein implicated in LD biology, mediates a discrete step in LD formation—the conversion of small, nascent LDs to larger, mature LDs. Seipin forms discrete and dynamic foci in the ER that interact with nascent LDs to enable their growth. In the absence of seipin, numerous small, nascent LDs accumulate near the ER and most often fail to grow. Those that do grow prematurely acquire lipid synthesis enzymes and undergo expansion, eventually leading to the giant LDs characteristic of seipin deficiency. Our studies identify a discrete step of LD formation, namely the conversion of nascent LDs to mature LDs, and define a molecular role for seipin in this process, most likely by acting at ER-LD contact sites to enable lipid transfer to nascent LDs. DOI: http://dx.doi.org/10.7554/eLife.16582.001 PMID:27564575
How Messenger RNA and Nascent Chain Sequences Regulate Translation Elongation.
Choi, Junhong; Grosely, Rosslyn; Prabhakar, Arjun; Lapointe, Christopher P; Wang, Jinfan; Puglisi, Joseph D
2018-06-20
Translation elongation is a highly coordinated, multistep, multifactor process that ensures accurate and efficient addition of amino acids to a growing nascent-peptide chain encoded in the sequence of translated messenger RNA (mRNA). Although translation elongation is heavily regulated by external factors, there is clear evidence that mRNA and nascent-peptide sequences control elongation dynamics, determining both the sequence and structure of synthesized proteins. Advances in methods have driven experiments that revealed the basic mechanisms of elongation as well as the mechanisms of regulation by mRNA and nascent-peptide sequences. In this review, we highlight how mRNA and nascent-peptide elements manipulate the translation machinery to alter the dynamics and pathway of elongation.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs
2017-01-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980
Pervasive Targeting of Nascent Transcripts by Hfq.
Kambara, Tracy K; Ramsey, Kathryn M; Dove, Simon L
2018-05-01
Hfq is an RNA chaperone and an important post-transcriptional regulator in bacteria. Using chromatin immunoprecipitation coupled with high-throughput DNA sequencing (ChIP-seq), we show that Hfq associates with hundreds of different regions of the Pseudomonas aeruginosa chromosome. These associations are abolished when transcription is inhibited, indicating that they reflect Hfq binding to transcripts during their synthesis. Analogous ChIP-seq analyses with the post-transcriptional regulator Crc reveal that it associates with many of the same nascent transcripts as Hfq, an activity we show is Hfq dependent. Our findings indicate that Hfq binds many transcripts co-transcriptionally in P. aeruginosa, often in concert with Crc, and uncover direct regulatory targets of these proteins. They also highlight a general approach for studying the interactions of RNA-binding proteins with nascent transcripts in bacteria. The binding of post-transcriptional regulators to nascent mRNAs may represent a prevalent means of controlling translation in bacteria where transcription and translation are coupled. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
(O' Lee, Dominic J.
2018-02-01
At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan
2017-01-01
Abstract The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson–Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. PMID:28369621
Cotranslational structure acquisition of nascent polypeptides monitored by NMR spectroscopy.
Eichmann, Cédric; Preissler, Steffen; Riek, Roland; Deuerling, Elke
2010-05-18
The folding of proteins in living cells may start during their synthesis when the polypeptides emerge gradually at the ribosomal exit tunnel. However, our current understanding of cotranslational folding processes at the atomic level is limited. We employed NMR spectroscopy to monitor the conformation of the SH3 domain from alpha-spectrin at sequential stages of elongation via in vivo ribosome-arrested (15)N,(13)C-labeled nascent polypeptides. These nascent chains exposed either the entire SH3 domain or C-terminally truncated segments thereof, thus providing snapshots of the translation process. We show that nascent SH3 polypeptides remain unstructured during elongation but fold into a compact, native-like beta-sheet assembly when the entire sequence information is available. Moreover, the ribosome neither imposes major conformational constraints nor significantly interacts with exposed unfolded nascent SH3 domain moieties. Our data provide evidence for a domainwise folding of the SH3 domain on ribosomes without significant population of folding intermediates. The domain follows a thermodynamically favorable pathway in which sequential folding units are stabilized, thus avoiding kinetic traps during the process of cotranslational folding.
Bell, Maria Elizabeth; Bourne, Jennifer N.; Chirillo, Michael A.; Mendenhall, John M.; Kuwajima, Masaaki; Harris, Kristen M.
2014-01-01
Nascent zones and active zones are adjacent synaptic regions that share a postsynaptic density, but nascent zones lack the presynaptic vesicles found at active zones. Here dendritic spine synapses were reconstructed through serial section electron microscopy (3DEM) and EM tomography to investigate nascent zone dynamics during long-term potentiation (LTP) in mature rat hippocampus. LTP was induced with theta-burst stimulation and comparisons were made to control stimulation in the same hippocampal slices at 5 minutes, 30 minutes, and 2 hours post-induction and to perfusion-fixed hippocampus in vivo. Nascent zones were present at the edges of ~35% of synapses in perfusion-fixed hippocampus and as many as ~50% of synapses in some hippocampal slice conditions. By 5 minutes, small dense core vesicles known to transport active zone proteins moved into more presynaptic boutons. By 30 minutes, nascent zone area decreased without significant change in synapse area, suggesting that presynaptic vesicles were recruited to pre-existing nascent zones. By 2 hours, both nascent and active zones were enlarged. Immunogold labeling revealed that glutamate receptors can be found in nascent zones; however, average distances from nascent zones to docked presynaptic vesicles ranged from 170±5 nm in perfusion-fixed hippocampus to 251±4 nm at enlarged synapses by 2 hours during LTP. Prior stochastic modeling suggests that falloff in glutamate concentration reduces the probability of glutamate receptor activation from 0.4 at the center of release to 0.1 just 200 nm away. Thus, conversion of nascent zones to functional active zones likely requires the recruitment of presynaptic vesicles during LTP. PMID:25043676
Mossabeb, Roschanak; Seiberler, Susanne; Mittermann, Irene; Reininger, Renate; Spitzauer, Susanne; Natter, Susanne; Verdino, Petra; Keller, Walter; Kraft, Dietrich; Valenta, Rudolf
2002-10-01
The nascent polypeptide-associated complex is required for intracellular translocation of newly synthesized polypeptides in eukaryotic cells. It may also act as a transcriptional coactivator in humans and various eukaryotic organisms and binds to nucleic acids. Recently, we provided evidence that a component of nascent polypeptide-associated complex, alpha-nascent polypeptide-associated complex, represents an IgE-reactive autoantigen for atopic dermatitis patients. By oligonucleotide screening we isolated a complete cDNA coding for a so far unknown alpha-nascent polypeptide-associated complex isoform from a human epithelial cDNA library. Southern blot hybridization experiments provided further evidence that alpha-nascent polypeptide-associated complex is encoded by a gene family. Recombinant alpha-nascent polypeptide-associated complex was expressed in Escherichia coli as a soluble, His-tagged protein, and purified via nickel affinity chromatography. By circular dichroism analysis it is demonstrated that purified recombinant alpha-nascent polypeptide-associated complex represents a folded protein of mixed alpha-helical and beta-sheet conformation with unusual high thermal stability and remarkable refolding capacity. Complete recombinant alpha-nascent polypeptide-associated complex (215 amino acids) and its 86 amino acid C-terminal fragment specifically bound IgE autoantibodies. Recombinant alpha-nascent polypeptide-associated complex also inhibited IgE binding to natural alpha-nascent polypeptide-associated complex, demonstrating the presence of common IgE epitopes between the recombinant and natural protein. Furthermore, recombinant alpha-nascent polypeptide-associated complex induced specific lymphoproliferative responses in peripheral blood mononuclear cells of a sensitized atopic dermatitis patient. As has been proposed for environmental allergens it is possible that T cell responses to IgE-defined autoantigens may contribute to the chronic skin manifestations
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert
2017-06-20
The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Radical-pair based avian magnetoreception
NASA Astrophysics Data System (ADS)
Procopio, Maria; Ritz, Thorsten
2014-03-01
Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.
NASA Astrophysics Data System (ADS)
Lieb, Sydnie Marie
Soot released to the atmosphere is a dangerous pollutant for human health and the environment. Understanding the physical properties and surface properties of these particles is important to properly explaining the growth of soot particles in flames as well as their interactions with other particles and gases in the environment. Particles below 15 nm in diameter, nascent soot particles, dominate the early growth stages of soot formation; previously these particles were characterized as hard graphitic spheres. New evidence derived from the current dissertation work, to a large extent, challenges this prior characterization. This dissertation study begins by revisiting the use of atomic force microscope (AFM) as a tool to investigate the structural properties of nascent soot. The impact of tip artifacts, which are known to complicate measurements of features below 10 nm in diameter, are carefully considered so as to provide a concise interpretation of the morphology of nascent soot as seen by AFM. The results of the AFM morphology collaborate with earlier photo- and thermal-fragmentation particle mass spectrometry and Fourier transform infrared spectroscopy that nascent soot is not a graphitized carbon material and that they are not spherical. Furthermore, phase mode imaging is introduced as a method to investigate the physical properties of nascent soot particles in a greater detail and finer resolution. The helium ion microscope (HIM) has been identified as a useful technique for the imaging of nascent soot. Using this imaging method nascent soot particles were imaged with a high resolution that had not been obtained by prior techniques. The increased contrast provides a closer look at the nascent soot particles and further suggested that these particles are not as structurally homogeneous as previously thought. Geometric shape analysis was performed to characterize the particles in terms of sphericity, circularity, and fractal dimension. The geometric analysis
Nascent RNA kinetics: Transient and steady state behavior of models of transcription
NASA Astrophysics Data System (ADS)
Choubey, Sandeep
2018-02-01
Regulation of transcription is a vital process in cells, but mechanistic details of this regulation still remain elusive. The dominant approach to unravel the dynamics of transcriptional regulation is to first develop mathematical models of transcription and then experimentally test the predictions these models make for the distribution of mRNA and protein molecules at the individual cell level. However, these measurements are affected by a multitude of downstream processes which make it difficult to interpret the measurements. Recent experimental advancements allow for counting the nascent mRNA number of a gene as a function of time at the single-inglr cell level. These measurements closely reflect the dynamics of transcription. In this paper, we consider a general mechanism of transcription with stochastic initiation and deterministic elongation and probe its impact on the temporal behavior of nascent RNA levels. Using techniques from queueing theory, we derive exact analytical expressions for the mean and variance of the nascent RNA distribution as functions of time. We apply these analytical results to obtain the mean and variance of nascent RNA distribution for specific models of transcription. These models of initiation exhibit qualitatively distinct transient behaviors for both the mean and variance which further allows us to discriminate between them. Stochastic simulations confirm these results. Overall the analytical results presented here provide the necessary tools to connect mechanisms of transcription initiation to single-cell measurements of nascent RNA.
Topographic control on the nascent Mediterranean outflow
NASA Astrophysics Data System (ADS)
Gasser, M.; Pelegrí, J. L.; Nash, J. D.; Peters, H.; García-Lafuente, J.
2011-12-01
Data collected during a 12-day cruise in July 2009 served to examine the structure of the nascent Mediterranean Outflow Water (MOW) immediately west of the Espartel Sill, the westernmost sill in the Strait of Gibraltar. The MOW is characterized by high salinities (>37.0 and reaching 38.3) and high velocities (exceeding 1 m s-1 at 100 m above the seafloor), and follows a submerged valley along a 30 km stretch, the natural western extension of the strait. It is approx. 150 m thick and 10 km wide, and experiences a substantial drop from 420 to 530 m over a distance of some 3 km between two relatively flat regions. Measurements indicate that the nascent MOW behaves as a gravity current with nearly maximal traveling speed; if this condition is maintained, then the maximum MOW velocity would decrease slowly with distance from the Espartel Sill, remaining significantly high until the gravity current excess density is only a small fraction of its original value. The sharp pycnocline between the Mediterranean and the overlying North Atlantic Central waters is dynamically unstable, particularly where the flow interacts with the 100 m decrease in bottom depth. Here, subcritical gradient Richardson numbers coincide with the development of large interfacial undulations and billows. The very energetic downslope flow is likely responsible for the development of a narrow V-shaped channel downstream of the seafloor drop along the axis of the submerged valley, this probably being the very first erosional scour produced by the nascent MOW. The coincidence of subcritical gradient Richardson numbers with relatively high turbidity values above the channel flanks suggests it may be undergoing upstream erosion.
Nucleic acid duplexes incorporating a dissociable covalent base pair
NASA Technical Reports Server (NTRS)
Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)
1999-01-01
We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.
Nucleic acid duplexes incorporating a dissociable covalent base pair
Gao, Kui; Orgel, Leslie E.
1999-01-01
We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299
Entrepreneurial Identity and Role Expectations in Nascent Entrepreneurship
ERIC Educational Resources Information Center
Lundqvist, Mats; Middleton, Karen Williams; Nowell, Pamela
2015-01-01
Entrepreneurship has been defined as an individual?new value creation dialogic. To study how entrepreneurial identity evolves, this article, drawing on entrepreneurial learning theory, adds an entrepreneurial role expectations dialogic. Longitudinal evidence from nascent entrepreneurs working in venture teams on invention disclosures offers an…
Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses
2005-01-01
Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305
Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses
2005-01-01
Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.
Molecular switching behavior in isosteric DNA base pairs.
Jissy, A K; Konar, Sukanya; Datta, Ayan
2013-04-15
The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Layer-Based Approach for Image Pair Fusion.
Son, Chang-Hwan; Zhang, Xiao-Ping
2016-04-20
Recently, image pairs, such as noisy and blurred images or infrared and noisy images, have been considered as a solution to provide high-quality photographs under low lighting conditions. In this paper, a new method for decomposing the image pairs into two layers, i.e., the base layer and the detail layer, is proposed for image pair fusion. In the case of infrared and noisy images, simple naive fusion leads to unsatisfactory results due to the discrepancies in brightness and image structures between the image pair. To address this problem, a local contrast-preserving conversion method is first proposed to create a new base layer of the infrared image, which can have visual appearance similar to another base layer such as the denoised noisy image. Then, a new way of designing three types of detail layers from the given noisy and infrared images is presented. To estimate the noise-free and unknown detail layer from the three designed detail layers, the optimization framework is modeled with residual-based sparsity and patch redundancy priors. To better suppress the noise, an iterative approach that updates the detail layer of the noisy image is adopted via a feedback loop. This proposed layer-based method can also be applied to fuse another noisy and blurred image pair. The experimental results show that the proposed method is effective for solving the image pair fusion problem.
Nonenzymatic Role for WRN in Preserving Nascent DNA Strands after Replication Stress
Su, Fengtao; Mukherjee, Shibani; Yang, Yanyong; ...
2014-11-20
WRN, the protein defective in Werner syndrome (WS), is a multifunctional nuclease involved in DNA damage repair, replication, and genome stability maintenance. It was assumed that the nuclease activities of WRN were critical for these functions. Here, we report a nonenzymatic role for WRN in preserving nascent DNA strands following replication stress. We found that lack of WRN led to shortening of nascent DNA strands after replication stress. Furthermore, we discovered that the exonuclease activity of MRE11 was responsible for the shortening of newly replicated DNA in the absence of WRN. Mechanistically, the N-terminal FHA domain of NBS1 recruits WRNmore » to replication-associated DNA double-stranded breaks to stabilize Rad51 and to limit the nuclease activity of its C-terminal binding partner MRE11. Thus, this previously unrecognized nonenzymatic function of WRN in the stabilization of nascent DNA strands sheds light on the molecular reason for the origin of genome instability in WS individuals.« less
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Elastic Coupling of Nascent apCAM Adhesions to Flowing Actin Networks
Mejean, Cecile O.; Schaefer, Andrew W.; Buck, Kenneth B.; Kress, Holger; Shundrovsky, Alla; Merrill, Jason W.; Dufresne, Eric R.; Forscher, Paul
2013-01-01
Adhesions are multi-molecular complexes that transmit forces generated by a cell’s acto-myosin networks to external substrates. While the physical properties of some of the individual components of adhesions have been carefully characterized, the mechanics of the coupling between the cytoskeleton and the adhesion site as a whole are just beginning to be revealed. We characterized the mechanics of nascent adhesions mediated by the immunoglobulin-family cell adhesion molecule apCAM, which is known to interact with actin filaments. Using simultaneous visualization of actin flow and quantification of forces transmitted to apCAM-coated beads restrained with an optical trap, we found that adhesions are dynamic structures capable of transmitting a wide range of forces. For forces in the picoNewton scale, the nascent adhesions’ mechanical properties are dominated by an elastic structure which can be reversibly deformed by up to 1 µm. Large reversible deformations rule out an interface between substrate and cytoskeleton that is dominated by a number of stiff molecular springs in parallel, and favor a compliant cross-linked network. Such a compliant structure may increase the lifetime of a nascent adhesion, facilitating signaling and reinforcement. PMID:24039928
Nascent body ego: metapsychological and neurophysiological aspects.
Lehtonen, Johannes; Partanen, Juhani; Purhonen, Maija; Valkonen-Korhonen, Minna; Kononen, Mervi; Saarikoski, Seppo; Launiala, Kari
2006-10-01
For Freud, body ego was the organizing basis of the structural theory. He defined it as a psychic projection of the body surface. Isakower's and Lewin's classical findings suggest that the body surface experiences of nursing provide the infant with sensory-affective stimulation that initiates a projection of sensory processes towards the psychic realm. During nursing, somato-sensory, gustatory and olfactory modalities merge with a primitive somatic affect of satiation, whereas auditory modality is involved more indirectly and visual contact more gradually. Repeated regularly, such nascent experiences are likely to play a part in the organization of the primitive protosymbolic mental experience. In support of this hypothesis, the authors review findings from a neurophysiological study of infants before, during and after nursing. Nursing is associated with a significant amplitude change in the newborn electroencephalogram (EEG), which wanes before the age of 3 months, and is transformed at the age of 6 months into rhythmic 3-5 Hz hedonic theta-activity. Sucking requires active physiological work, which is shown in a regular rise in heart rate. The hypothesis of a sensory-affective organization of the nascent body ego, enhanced by nursing and active sucking, seems concordant with neurophysiological phenomena related to nursing.
Structure of nascent replicative form DNA of coliphage M13
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dasgupta, S.; Mitra, S.
Nascent replicative form type II (RFII) DNA of coliphage M13 synthesized in an Escherichia coli mutant deficient in the 5' ..-->.. 3' exonuclease associated with DNA polymerase I contains ribonucleotides that are retained in the covalently closed RFI DNA sealed in vitro by the joint action of T5 phage DNA polymerase and T4 phage DNA ligase. These RFI molecules are labile to alkali and RNase H, unlike the RFI produced either in vivo or from RFII with E. coli DNA polymerase I and E. coli DNA ligase. The ribonucleotides are located at one site and predominantly in one strand ofmore » the nascent RF DNA. Furthermore, these molecules contain multiple small gaps, randomly located, and one large gap in the intracistronic region.« less
An ensemble of SVM classifiers based on gene pairs.
Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin
2013-07-01
In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Yang, Bo; Rodgers, M. T.
2015-08-01
Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.
CAT-tailing as a fail-safe mechanism for efficient degradation of stalled nascent polypeptides
Kostova, Kamena K.; Hickey, Kelsey L.; Osuna, Beatriz A.; Hussmann, Jeffrey A.; Frost, Adam; Weinberg, David E.; Weissman, Jonathan S.
2017-01-01
Ribosome stalling leads to recruitment of the Ribosome Quality control Complex (RQC), which targets the partially synthesized polypeptide for proteasomal degradation through the action of the ubiquitin ligase Ltn1p. A second core RQC component, Rqc2p, modifies the nascent polypeptide by adding a Carboxy-terminal Alanine and Threonine (CAT) tail through a non-canonical elongation reaction. Here we explore the role of CATtailing in nascent-chain degradation in budding yeast. We show that Ltn1p can efficiently access only nascent chain lysines immediately proximal to the ribosome exit tunnel. For substrates without Ltn1p-accessible lysines, CAT-tailing enables degradation by exposing lysines sequestered in the ribosome exit tunnel. Thus, CAT-tails do not serve as a degron, but rather provide a fail-safe mechanism that expands the range of RQC-degradable substrates. PMID:28751611
Three-dimensional organization of nascent rod outer segment disk membranes.
Volland, Stefanie; Hughes, Louise C; Kong, Christina; Burgess, Barry L; Linberg, Kenneth A; Luna, Gabriel; Zhou, Z Hong; Fisher, Steven K; Williams, David S
2015-12-01
The vertebrate photoreceptor cell contains an elaborate cilium that includes a stack of phototransductive membrane disks. The disk membranes are continually renewed, but how new disks are formed remains poorly understood. Here we used electron microscope tomography to obtain 3D visualization of the nascent disks of rod photoreceptors in three mammalian species, to gain insight into the process of disk morphogenesis. We observed that nascent disks are invariably continuous with the ciliary plasma membrane, although, owing to partial enclosure, they can appear to be internal in 2D profiles. Tomographic analyses of the basal-most region of the outer segment show changes in shape of the ciliary plasma membrane indicating an invagination, which is likely a first step in disk formation. The invagination flattens to create the proximal surface of an evaginating lamella, as well as membrane protrusions that extend between adjacent lamellae, thereby initiating a disk rim. Immediately distal to this initiation site, lamellae of increasing diameter are evident, indicating growth outward from the cilium. In agreement with a previous model, our data indicate that mature disks are formed once lamellae reach full diameter, and the growth of a rim encloses the space between adjacent surfaces of two lamellae. This study provides 3D data of nascent and mature rod photoreceptor disk membranes at unprecedented z-axis depth and resolution, and provides a basis for addressing fundamental questions, ranging from protein sorting in the photoreceptor cilium to photoreceptor electrophysiology.
Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.
Paukku, Y; Hill, G
2011-05-12
Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.
Prefoldin–Nascent Chain Complexes in the Folding of Cytoskeletal Proteins
Hansen, William J.; Cowan, Nicholas J.; Welch, William J.
1999-01-01
In vitro transcription/translation of actin cDNA and analysis of the translation products by native-PAGE was used to study the maturation pathway of actin. During the course of actin synthesis, several distinct actin-containing species were observed and the composition of each determined by immunological procedures. After synthesis of the first ∼145 amino acids, the nascent ribosome-associated actin chain binds to the recently identified heteromeric chaperone protein, prefoldin (PFD). PFD remains bound to the relatively unfolded actin polypeptide until its posttranslational delivery to cytosolic chaperonin (CCT). We show that α- and β-tubulin follow a similar maturation pathway, but to date find no evidence for an interaction between PFD and several noncytoskeletal proteins. We conclude that PFD functions by selectively targeting nascent actin and tubulin chains pending their transfer to CCT for final folding and/or assembly. PMID:10209023
Long-read sequencing of nascent RNA reveals coupling among RNA processing events.
Herzel, Lydia; Straube, Korinna; Neugebauer, Karla M
2018-06-14
Pre-mRNA splicing is accomplished by the spliceosome, a megadalton complex that assembles de novo on each intron. Because spliceosome assembly and catalysis occur cotranscriptionally, we hypothesized that introns are removed in the order of their transcription in genomes dominated by constitutive splicing. Remarkably little is known about splicing order and the regulatory potential of nascent transcript remodeling by splicing, due to the limitations of existing methods that focus on analysis of mature splicing products (mRNAs) rather than substrates and intermediates. Here, we overcome this obstacle through long-read RNA sequencing of nascent, multi-intron transcripts in the fission yeast Schizosaccharomyces pombe Most multi-intron transcripts were fully spliced, consistent with rapid cotranscriptional splicing. However, an unexpectedly high proportion of transcripts were either fully spliced or fully unspliced, suggesting that splicing of any given intron is dependent on the splicing status of other introns in the transcript. Supporting this, mild inhibition of splicing by a temperature-sensitive mutation in prp2 , the homolog of vertebrate U2AF65, increased the frequency of fully unspliced transcripts. Importantly, fully unspliced transcripts displayed transcriptional read-through at the polyA site and were degraded cotranscriptionally by the nuclear exosome. Finally, we show that cellular mRNA levels were reduced in genes with a high number of unspliced nascent transcripts during caffeine treatment, showing regulatory significance of cotranscriptional splicing. Therefore, overall splicing of individual nascent transcripts, 3' end formation, and mRNA half-life depend on the splicing status of neighboring introns, suggesting crosstalk among spliceosomes and the polyA cleavage machinery during transcription elongation. © 2018 Herzel et al.; Published by Cold Spring Harbor Laboratory Press.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
CAT-tailing as a fail-safe mechanism for efficient degradation of stalled nascent polypeptides.
Kostova, Kamena K; Hickey, Kelsey L; Osuna, Beatriz A; Hussmann, Jeffrey A; Frost, Adam; Weinberg, David E; Weissman, Jonathan S
2017-07-28
Ribosome stalling leads to recruitment of the ribosome quality control complex (RQC), which targets the partially synthesized polypeptide for proteasomal degradation through the action of the ubiquitin ligase Ltn1p. A second core RQC component, Rqc2p, modifies the nascent polypeptide by adding a carboxyl-terminal alanine and threonine (CAT) tail through a noncanonical elongation reaction. Here we examined the role of CAT-tailing in nascent-chain degradation in budding yeast. We found that Ltn1p efficiently accessed only nascent-chain lysines immediately proximal to the ribosome exit tunnel. For substrates without Ltn1p-accessible lysines, CAT-tailing enabled degradation by exposing lysines sequestered in the ribosome exit tunnel. Thus, CAT-tails do not serve as a degron, but rather provide a fail-safe mechanism that expands the range of RQC-degradable substrates. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Recombination Proteins Mediate Meiotic Spatial Chromosome Organization and Pairing
Storlazzi, Aurora; Gargano, Silvana; Ruprich-Robert, Gwenael; Falque, Matthieu; David, Michelle; Kleckner, Nancy; Zickler, Denise
2010-01-01
SUMMARY Meiotic chromosome pairing involves not only recognition of homology but also juxtaposition of entire chromosomes in a topologically regular way. Analysis of filamentous fungus Sordaria macrospora reveals that recombination proteins Mer3, Msh4 and Mlh1 play direct roles in all of these aspects, in advance of their known roles in recombination. Absence of Mer3 helicase results in interwoven chromosomes, thereby revealing the existence of features that specifically ensure “entanglement avoidance”. Entanglements that remain at zygotene, i.e. “interlockings”, require Mlh1 for resolution, likely to eliminate constraining recombinational connections. Patterns of Mer3 and Msh4 foci along aligned chromosomes show that the double-strand breaks mediating homologous alignment have spatially separated ends, one localized to each partner axis, and that pairing involves interference among developing interhomolog interactions. We propose that Mer3, Msh4 and Mlh1 execute all of these roles during pairing by modulating the state of nascent double-strand break/partner DNA contacts within axis-associated recombination complexes. PMID:20371348
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Database of non-canonical base pairs found in known RNA structures
NASA Technical Reports Server (NTRS)
Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.
2000-01-01
Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.
Structural landscape of base pairs containing post-transcriptional modifications in RNA
Seelam, Preethi P.; Sharma, Purshotam
2017-01-01
Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704
Cassaignau, Anaïs M E; Launay, Hélène M M; Karyadi, Maria-Evangelia; Wang, Xiaolin; Waudby, Christopher A; Deckert, Annika; Robertson, Amy L; Christodoulou, John; Cabrita, Lisa D
2016-08-01
During biosynthesis on the ribosome, an elongating nascent polypeptide chain can begin to fold, in a process that is central to all living systems. Detailed structural studies of co-translational protein folding are now beginning to emerge; such studies were previously limited, at least in part, by the inherently dynamic nature of emerging nascent chains, which precluded most structural techniques. NMR spectroscopy is able to provide atomic-resolution information for ribosome-nascent chain complexes (RNCs), but it requires large quantities (≥10 mg) of homogeneous, isotopically labeled RNCs. Further challenges include limited sample working concentration and stability of the RNC sample (which contribute to weak NMR signals) and resonance broadening caused by attachment to the large (2.4-MDa) ribosomal complex. Here, we present a strategy to generate isotopically labeled RNCs in Escherichia coli that are suitable for NMR studies. Uniform translational arrest of the nascent chains is achieved using a stalling motif, and isotopically labeled RNCs are produced at high yield using high-cell-density E. coli growth conditions. Homogeneous RNCs are isolated by combining metal affinity chromatography (to isolate ribosome-bound species) with sucrose density centrifugation (to recover intact 70S monosomes). Sensitivity-optimized NMR spectroscopy is then applied to the RNCs, combined with a suite of parallel NMR and biochemical analyses to cross-validate their integrity, including RNC-optimized NMR diffusion measurements to report on ribosome attachment in situ. Comparative NMR studies of RNCs with the analogous isolated proteins permit a high-resolution description of the structure and dynamics of a nascent chain during its progressive biosynthesis on the ribosome.
The electrostatic characteristics of G·U wobble base pairs
Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.
2007-01-01
G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525
Nascent starbursts: a missing link in galaxy evolution
NASA Astrophysics Data System (ADS)
Roussel, Helene; Beck, Rainer; Condon, Jim; Helou, George; Smith, John-David
2005-06-01
We have identified a rare category of galaxies characterized by an extreme deficiency in synchro- tron radiation, relative to dust emission, and very high dust temperatures. We studied in detail the most extreme such object, and concluded in favor of a starburst just breaking out, less than one megayear old, in a galaxy having undergone no major star formation episode in the last 100 Myr. Such systems offer a perfect setting to study the initial conditions and early dynamics of starbursts and understand better the regulation of the infrared-radio continuum correlation in galaxies. For the prototypical nascent starburst, the mid-infrared spectrum is quite peculiar, suggesting tran- sient dust species and high optical depth; tracers of dust and molecular gas are the only indicators of unusual activity, and the active regions are likely very compact and dust-bounded, suppressing ionization. Only Spitzer data can provide the needed physical diagnostics for such regions. A sample of 25 nascent starbursts was drawn from the cross-correlation of the IRAS Faint Source Catalog and the NVSS VLA radio survey, and carefully selected based on our multi-wavelength VLA maps to span a range of infrared to radio ratios and luminosities. This sample allows a first step beyond studying prototypes toward a statistical analysis addressing systematic physical pro- perties, classification and search for starburst development sequences. We propose imaging and spectroscopic observations from 3 to 160 microns to characterize the state of the interstellar medium and the gas and dust excitation origin. Our aim is to learn from these unique systems how a star formation burst may develop in its very earliest phases, how it affects the fueling material and the host galaxy. Acquired observations of the radio continuum, cold molecular gas and tracers of shocks and HII regions will help us interpret the rich Spitzer data set and extract a coherent picture of the interstellar medium in our targets.
Zajaczkowski, Esmi L; Zhao, Qiong-Yi; Zhang, Zong Hong; Li, Xiang; Wei, Wei; Marshall, Paul R; Leighton, Laura J; Nainar, Sarah; Feng, Chao; Spitale, Robert C; Bredy, Timothy W
2018-06-15
Transcriptome-wide expression profiling of neurons has provided important insights into the underlying molecular mechanisms and gene expression patterns that transpire during learning and memory formation. However, there is a paucity of tools for profiling stimulus-induced RNA within specific neuronal cell populations. A bioorthogonal method to chemically label nascent (i.e., newly transcribed) RNA in a cell-type-specific and temporally controlled manner, which is also amenable to bioconjugation via click chemistry, was recently developed and optimized within conventional immortalized cell lines. However, its value within a more fragile and complicated cellular system such as neurons, as well as for transcriptome-wide expression profiling, has yet to be demonstrated. Here, we report the visualization and sequencing of activity-dependent nascent RNA derived from neurons using this labeling method. This work has important implications for improving transcriptome-wide expression profiling and visualization of nascent RNA in neurons, which has the potential to provide valuable insights into the mechanisms underlying neural plasticity, learning, and memory.
Envisaging quantum transport phenomenon in a muddled base pair of DNA
NASA Astrophysics Data System (ADS)
Vohra, Rajan; Sawhney, Ravinder Singh
2018-05-01
The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
2016-01-01
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825
Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...
2015-01-29
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less
Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas
2013-01-01
We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439
The recruitment of the U5 snRNP to nascent transcripts requires internal loop 1 of U5 snRNA.
Kim, Rebecca; Paschedag, Joshua; Novikova, Natalya; Bellini, Michel
2012-12-01
In this study, we take advantage of the high spatial resolution offered by the nucleus and lampbrush chromosomes of the amphibian oocyte to investigate the mechanisms that regulate the intranuclear trafficking of the U5 snRNP and its recruitment to nascent transcripts. We monitor the fate of newly assembled fluorescent U5 snRNP in Xenopus oocytes depleted of U4 and/or U6 snRNAs and demonstrate that the U4/U6.U5 tri-snRNP is not required for the association of U5 snRNP with Cajal bodies, splicing speckles, and nascent transcripts. In addition, using a mutational analysis, we show that a non-functional U5 snRNP can associate with nascent transcripts, and we further characterize internal loop structure 1 of U5 snRNA as a critical element for licensing U5 snRNP to target both nascent transcripts and splicing speckles. Collectively, our data support the model where the recruitment of snRNPs onto pre-mRNAs is independent of spliceosome assembly and suggest that U5 snRNP may promote the association of the U4/U6.U5 tri-snRNP with nascent transcripts.
Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko
2015-10-12
A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling.
Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal
2017-01-01
Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein-EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here.
A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling
Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal
2017-01-01
Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein–EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here. PMID:28099529
Role of the visual experience-dependent nascent proteome in neuronal plasticity
Liu, Han-Hsuan; McClatchy, Daniel B; Schiapparelli, Lucio; Shen, Wanhua; Yates, John R
2018-01-01
Experience-dependent synaptic plasticity refines brain circuits during development. To identify novel protein synthesis-dependent mechanisms contributing to experience-dependent plasticity, we conducted a quantitative proteomic screen of the nascent proteome in response to visual experience in Xenopus optic tectum using bio-orthogonal metabolic labeling (BONCAT). We identified 83 differentially synthesized candidate plasticity proteins (CPPs). The CPPs form strongly interconnected networks and are annotated to a variety of biological functions, including RNA splicing, protein translation, and chromatin remodeling. Functional analysis of select CPPs revealed the requirement for eukaryotic initiation factor three subunit A (eIF3A), fused in sarcoma (FUS), and ribosomal protein s17 (RPS17) in experience-dependent structural plasticity in tectal neurons and behavioral plasticity in tadpoles. These results demonstrate that the nascent proteome is dynamic in response to visual experience and that de novo synthesis of machinery that regulates RNA splicing and protein translation is required for experience-dependent plasticity. PMID:29412139
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
NASA Technical Reports Server (NTRS)
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Theory of Force Regulation by Nascent Adhesion Sites
Bruinsma, Robijn
2005-01-01
The mechanical coupling of a cell with the extracellular matrix relies on adhesion sites, clusters of membrane-associated proteins that communicate forces generated along the F-Actin filaments of the cytoskeleton to connecting tissue. Nascent adhesion sites have been shown to regulate these forces in response to tissue rigidity. Force-regulation by substrate rigidity of adhesion sites with fixed area is not possible for stationary adhesion sites, according to elasticity theory. A simple model is presented to describe force regulation by dynamical adhesion sites. PMID:15849245
Understanding the kinetic mechanism of RNA single base pair formation
Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie
2016-01-01
RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466
Rqc2p and 60S ribosomal subunits mediate mRNA-independent elongation of nascent chains
Shen, Peter S.; Park, Joseph; Qin, Yidan; Li, Xueming; Parsawar, Krishna; Larson, Matthew H.; Cox, James; Cheng, Yifan; Lambowitz, Alan M.; Weissman, Jonathan S.; Brandman, Onn; Frost, Adam
2015-01-01
In Eukarya, stalled translation induces 40S dissociation and recruitment of the Ribosome Quality control Complex (RQC) to the 60S subunit, which mediates nascent chain degradation. Here, we report cryoEM structures revealing that the RQC components Rqc2p (YPL009C/Tae2) and Ltn1p (YMR247C/Rkr1) bind to the 60S at sites exposed after 40S dissociation, placing the Ltn1p RING domain near the exit channel and Rqc2p over the P-site tRNA. We further demonstrate that Rqc2p recruits alanine and threonine charged tRNA to the A-site and directs elongation of nascent chains independently of mRNA or 40S subunits. Our work uncovers an unexpected mechanism of protein synthesis in which a protein—not an mRNA—determines tRNA recruitment and the tagging of nascent chains with Carboxy-terminal Ala and Thr extensions (“CAT tails”). PMID:25554787
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Orbital selective pairing and gap structures of iron-based superconductors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.
We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less
Orbital selective pairing and gap structures of iron-based superconductors
Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...
2017-05-08
We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less
An Annotation Agnostic Algorithm for Detecting Nascent RNA Transcripts in GRO-Seq.
Azofeifa, Joseph G; Allen, Mary A; Lladser, Manuel E; Dowell, Robin D
2017-01-01
We present a fast and simple algorithm to detect nascent RNA transcription in global nuclear run-on sequencing (GRO-seq). GRO-seq is a relatively new protocol that captures nascent transcripts from actively engaged polymerase, providing a direct read-out on bona fide transcription. Most traditional assays, such as RNA-seq, measure steady state RNA levels which are affected by transcription, post-transcriptional processing, and RNA stability. GRO-seq data, however, presents unique analysis challenges that are only beginning to be addressed. Here, we describe a new algorithm, Fast Read Stitcher (FStitch), that takes advantage of two popular machine-learning techniques, hidden Markov models and logistic regression, to classify which regions of the genome are transcribed. Given a small user-defined training set, our algorithm is accurate, robust to varying read depth, annotation agnostic, and fast. Analysis of GRO-seq data without a priori need for annotation uncovers surprising new insights into several aspects of the transcription process.
Ullers, Ronald S.; Houben, Edith N.G.; Raine, Amanda; ten Hagen-Jongman, Corinne M.; Ehrenberg, Måns; Brunner, Joseph; Oudega, Bauke; Harms, Nellie; Luirink, Joen
2003-01-01
As newly synthesized polypeptides emerge from the ribosome, they interact with chaperones and targeting factors that assist in folding and targeting to the proper location in the cell. In Escherichia coli, the chaperone trigger factor (TF) binds to nascent polypeptides early in biosynthesis facilitated by its affinity for the ribosomal proteins L23 and L29 that are situated around the nascent chain exit site on the ribosome. The targeting factor signal recognition particle (SRP) interacts specifically with the signal anchor (SA) sequence in nascent inner membrane proteins (IMPs). Here, we have used photocross-linking to map interactions of the SA sequence in a short, in vitro–synthesized, nascent IMP. Both TF and SRP were found to interact with the SA with partially overlapping binding specificity. In addition, extensive contacts with L23 and L29 were detected. Both purified TF and SRP could be cross-linked to L23 on nontranslating ribosomes with a competitive advantage for SRP. The results suggest a role for L23 in the targeting of IMPs as an attachment site for TF and SRP that is close to the emerging nascent chain. PMID:12756233
Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.
Nonin, S; Leroy, J L; Guéron, M
1995-08-22
We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].
Sequence dependency of canonical base pair opening in the DNA double helix
Villa, Alessandra
2017-01-01
The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121
Sequence-dependent base pair stepping dynamics in XPD helicase unwinding
Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R
2013-01-01
Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615
Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri
2010-01-01
It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719
Physics of base-pairing dynamics in DNA
NASA Astrophysics Data System (ADS)
Manghi, Manoel; Destainville, Nicolas
2016-05-01
As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.
Mechanisms of nascent fiber formation during avian skeletal muscle hypertrophy
NASA Technical Reports Server (NTRS)
McCormick, K. M.; Schultz, E.
1992-01-01
This study examined two putative mechanisms of new fiber formation in postnatal skeletal muscle, namely longitudinal fragmentation of existing fibers and de novo formation. The relative contributions of these two mechanisms to fiber formation in hypertrophying anterior latissimus dorsi (ALD) muscle were assessed by quantitative analysis of their nuclear populations. Muscle hypertrophy was induced by wing-weighting for 1 week. All nuclei formed during the weighting period were labeled by continuous infusion of 5-bromo-2'-deoxyuridine (BrdU), a thymidine analog, and embryonic-like fibers were identified using an antibody to ventricular-like embryonic (V-EMB) myosin. The number of BrdU-labeled and unlabeled nuclei in V-EMB-positive fibers were counted. Wing-weighting resulted in significant muscle enlargement and the appearance of many V-EMB+ fibers. The majority of V-EMB+ fibers were completely independent of mature fibers and had a nuclear density characteristics of developing fibers. Furthermore, nearly 100% of the nuclei in independent V-EMB+ fibers were labeled. These findings strongly suggest that most V-EMB+ fibers were nascent fibers formed de novo during the weighting period by satellite cell activation and fusion. Nascent fibers were found primarily in the space between fascicles where they formed a complex anastomosing network of fibers running at angles to one another. Although wing-weighting induced an increase in the number of branched fibers, there was no evidence that V-EMB+ fibers were formed by longitudinal fragmentation. The location of newly formed fibers in wing-weighted and regenerating ALD muscle was compared to determine whether satellite cells in the ALD muscle were unusual in that, if stimulated to divide, they would form fibers in the inter- and intrafascicular space. In contrast to wing-weighted muscle, nascent fibers were always found closely associated with necrotic fibers. These results suggest that wing-weighting is not simply another
The Fate of Nascent APP in Hippocampal Neurons: A Live Cell Imaging Study.
DelBove, Claire E; Deng, Xian-Zhen; Zhang, Qi
2018-06-21
Amyloid precursor protein (APP) is closely associated with Alzheimer's disease (AD) because its proteolytic products form amyloid plaques and its mutations are linked to familial AD patients. As a membrane protein, APP is involved in neuronal development and plasticity. However, it remains unclear how nascent APP is distributed and transported to designated membrane compartments to execute its diverse functions. Here, we employed a dual-tagged APP fusion protein in combination with a synaptic vesicle marker to study the surface trafficking and cleavage of APP in hippocampal neurons immediately after its synthesis. Using long-term time-lapse imaging, we found that a considerable amount of nascent APP was directly transported to the somatodendritic surface, from which it propagates to distal neurites. Some APP in the plasma membrane was endocytosed and some was cleaved by α-secretase. Hence, we conclude that surface transportation of APP is a major step preceding its proteolytic processing and neuritic distribution.
Error simulation of paired-comparison-based scaling methods
NASA Astrophysics Data System (ADS)
Cui, Chengwu
2000-12-01
Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.
RNA polymerase pausing and nascent RNA structure formation are linked through clamp domain movement
Hein, Pyae P.; Kolb, Kellie E.; Windgassen, Tricia; Bellecourt, Michael J.; Darst, Seth A.; Mooney, Rachel A.; Landick, Robert
2014-01-01
The rates of RNA synthesis and nascent RNA folding into biologically active structures are linked via pausing by RNA polymerase (RNAP). Structures that form within the RNA exit channel can increase pausing by interacting with bacterial RNAP or decrease pausing by preventing backtracking. Conversely, pausing is required for proper folding of some RNAs. Opening of the RNAP clamp domain is proposed to mediate some effects of nascent RNA structures. However, the connections among RNA structure formation, clamp movement, and catalytic activity remain uncertain. We assayed exit-channel structure formation in Escherichia coli RNAP together with disulfide crosslinks that favor closed or open clamp conformations and found that clamp position directly influences RNA structure formation and catalytic activity. We report that exit-channel RNA structures slow pause escape by favoring clamp opening and through interactions with the flap that slow translocation. PMID:25108353
Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.
1998-01-01
Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994
Substantial Goodness and Nascent Human Life.
Floyd, Shawn
2015-09-01
Many believe that moral value is--at least to some extent--dependent on the developmental states necessary for supporting rational activity. My paper rejects this view, but does not aim simply to register objections to it. Rather, my essay aims to answer the following question: if a human being's developmental state and occurrent capacities do not bequeath moral standing, what does? The question is intended to prompt careful consideration of what makes human beings objects of moral value, dignity, or (to employ my preferred term) goodness. Not only do I think we can answer this question, I think we can show that nascent human life possesses goodness of precisely this sort. I appeal to Aquinas's metaethics to establish the conclusion that the goodness of a human being--even if that being is an embryo or fetus--resides at the substratum of her existence. If she possesses goodness, it is because human existence is good.
Multi-hop teleportation based on W state and EPR pairs
NASA Astrophysics Data System (ADS)
Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang
2016-05-01
Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).
Method for sequencing DNA base pairs
Sessler, Andrew M.; Dawson, John
1993-01-01
The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.
Method for sequencing DNA base pairs
Sessler, A.M.; Dawson, J.
1993-12-14
The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.
Signature scheme based on bilinear pairs
NASA Astrophysics Data System (ADS)
Tong, Rui Y.; Geng, Yong J.
2013-03-01
An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
NASA Astrophysics Data System (ADS)
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
Reactive uptake of HOCl to laboratory generated sea salt particles and nascent sea-spray aerosol
NASA Astrophysics Data System (ADS)
Campbell, N. R.; Ryder, O. S.; Bertram, T. H.
2013-12-01
Field observations suggest that the reactive uptake of HOCl on marine aerosol particles is an important source of chlorine radicals, particularly under low NOx conditions. However to date, laboratory measurements disagree on the magnitude of the reactive uptake coefficient for HOCl by a factor of 5 (γ(HOCl) ranges between 0.0004 and 0.0018), and there are no measurements of γ(HOCl) on nascent sea-spray aerosol. Here, we present measurements of the reactive uptake of HOCl to laboratory generated sodium chloride and sea-spray aerosol particles generated in a novel Marine Aerosol Reference Tank (MART), coupled to an entrained aerosol flow reactor and Chemical Ionization Mass Spectrometer (CIMS). Measurements of γ(HOCl) retrieved here are compared against those in the literature, and the role of organic coatings on nascent sea-spray aerosol is explored.
Vallerga, María Belén; Mansilla, Sabrina F.; Federico, María Belén; Bertolin, Agustina P.; Gottifredi, Vanesa
2015-01-01
After UV irradiation, DNA polymerases specialized in translesion DNA synthesis (TLS) aid DNA replication. However, it is unclear whether other mechanisms also facilitate the elongation of UV-damaged DNA. We wondered if Rad51 recombinase (Rad51), a factor that escorts replication forks, aids replication across UV lesions. We found that depletion of Rad51 impairs S-phase progression and increases cell death after UV irradiation. Interestingly, Rad51 and the TLS polymerase polη modulate the elongation of nascent DNA in different ways, suggesting that DNA elongation after UV irradiation does not exclusively rely on TLS events. In particular, Rad51 protects the DNA synthesized immediately before UV irradiation from degradation and avoids excessive elongation of nascent DNA after UV irradiation. In Rad51-depleted samples, the degradation of DNA was limited to the first minutes after UV irradiation and required the exonuclease activity of the double strand break repair nuclease (Mre11). The persistent dysregulation of nascent DNA elongation after Rad51 knockdown required Mre11, but not its exonuclease activity, and PrimPol, a DNA polymerase with primase activity. By showing a crucial contribution of Rad51 to the synthesis of nascent DNA, our results reveal an unanticipated complexity in the regulation of DNA elongation across UV-damaged templates. PMID:26627254
PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA
NASA Technical Reports Server (NTRS)
Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto
2003-01-01
Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.
2016-04-01
DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator
Nascent Transcription Affected by RNA Polymerase IV in Zea mays
Erhard, Karl F.; Talbot, Joy-El R. B.; Deans, Natalie C.; McClish, Allison E.; Hollick, Jay B.
2015-01-01
All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3ʹ-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance. PMID:25653306
Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.
Nonin, S; Jiang, F; Patel, D J
1997-05-02
We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.
Configurations of base-pair complexes in solutions. [nucleotide chemistry
NASA Technical Reports Server (NTRS)
Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.
1978-01-01
A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
Design and Applications of Noncanonical DNA Base Pairs.
Jissy, A K; Datta, Ayan
2014-01-02
While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.
Takahara, Michiyo; Sakaue, Haruka; Onishi, Yukiko; Yamagishi, Marifu; Kida, Yuichiro; Sakaguchi, Masao
2013-01-11
Nascent chain release from membrane-bound ribosomes by the termination codon was investigated using a cell-free translation system from rabbit supplemented with rough microsomal membrane vesicles. Chain release was extremely slow when mRNA ended with only the termination codon. Tail extension after the termination codon enhanced the release of the nascent chain. Release reached plateau levels with tail extension of 10 bases. This requirement was observed with all termination codons: TAA, TGA and TAG. Rapid release was also achieved by puromycin even in the absence of the extension. Efficient translation termination cannot be achieved in the presence of only a termination codon on the mRNA. Tail extension might be required for correct positioning of the termination codon in the ribosome and/or efficient recognition by release factors. Copyright © 2012. Published by Elsevier Inc.
The Fluid Dynamics of Nascent Biofilms
NASA Astrophysics Data System (ADS)
Farthing, Nicola; Snow, Ben; Wilson, Laurence; Bees, Martin
2017-11-01
Many anti-biofilm approaches target mature biofilms with biochemical or physio-chemical interventions. We investigate the mechanics of interventions at an early stage that aim to inhibit biofilm maturation, focusing on hydrodynamics as cells transition from planktonic to surface-attached. Surface-attached cells generate flow fields that are relatively long-range compared with cells that are freely-swimming. We look at the effect of these flows on the biofilm formation. In particular, we use digital inline holographic microscopy to determine the three-dimensional flow due to a surface-attached cell and the effect this flow has on both tracers and other cells in the fluid. We compare experimental data with two models of cells on boundaries. The first approach utilizes slender body theory and captures many of the features of the experimental field. The second model develops a simple description in terms of singularity solutions of Stokes' flow, which produces qualitatively similar dynamics to both the experiments and more complex model but with significant computational savings. The range of validity of multiple cell arrangements is investigated. These two descriptions can be used to investigate the efficacy of actives developed by Unilever on nascent biofilms.
McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F
2015-01-01
Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.
SWI/SNF Associates with Nascent Pre-mRNPs and Regulates Alternative Pre-mRNA Processing
Tyagi, Anu; Ryme, Jessica; Brodin, David; Östlund Farrants, Ann Kristin; Visa, Neus
2009-01-01
The SWI/SNF chromatin remodeling complexes regulate the transcription of many genes by remodeling nucleosomes at promoter regions. In Drosophila, SWI/SNF plays an important role in ecdysone-dependent transcription regulation. Studies in human cells suggest that Brahma (Brm), the ATPase subunit of SWI/SNF, regulates alternative pre-mRNA splicing by modulating transcription elongation rates. We describe, here, experiments that study the association of Brm with transcribed genes in Chironomus tentans and Drosophila melanogaster, the purpose of which was to further elucidate the mechanisms by which Brm regulates pre-mRNA processing. We show that Brm becomes incorporated into nascent Balbiani ring pre-mRNPs co-transcriptionally and that the human Brm and Brg1 proteins are associated with RNPs. We have analyzed the expression profiles of D. melanogaster S2 cells in which the levels of individual SWI/SNF subunits have been reduced by RNA interference, and we show that depletion of SWI/SNF core subunits changes the relative abundance of alternative transcripts from a subset of genes. This observation, and the fact that a fraction of Brm is not associated with chromatin but with nascent pre-mRNPs, suggest that SWI/SNF affects pre-mRNA processing by acting at the RNA level. Ontology enrichment tests indicate that the genes that are regulated post-transcriptionally by SWI/SNF are mostly enzymes and transcription factors that regulate postembryonic developmental processes. In summary, the data suggest that SWI/SNF becomes incorporated into nascent pre-mRNPs and acts post-transcriptionally to regulate not only the amount of mRNA synthesized from a given promoter but also the type of alternative transcript produced. PMID:19424417
Probing the Role of Nascent Helicity in p27 Function as a Cell Cycle Regulator
Otieno, Steve; Kriwacki, Richard
2012-01-01
p27 regulates the activity of Cdk complexes which are the principal governors of phase transitions during cell division. Members of the p27 family of proteins, which also includes p21 and p57, are called the Cip/Kip cyclin-dependent kinase regulators (CKRs). Interestingly, the Cip/Kip CKRs play critical roles in cell cycle regulation by being intrinsically unstructured, a characteristic contrary to the classical structure-function paradigm. They exhibit nascent helicity which has been localized to a segment referred to as sub-domain LH. The nascent helicity of this sub-domain is conserved and we hypothesize that it is an important determinant of their functional properties. To test this hypothesis, we successfully designed and prepared p27 variants in which domain LH was either more or less helical with respect to the wild-type protein. Thermal denaturation experiments showed that the ternary complexes of the p27 variants bound to Cdk2/Cyclin A were less stable compared to the wild-type complex. Isothermal titration calorimetry experiments showed a decrease in the enthalpy of binding for all the mutants with respect to p27. The free energies of binding varied within a much narrower range. In vitro Cdk2 inhibition assays showed that the p27 variants exhibited disparate inhibitory potencies. Furthermore, when over-expressed in NIH 3T3 mouse fibroblast cells, the less helical p27 variants were less effective in causing cell cycle arrest relative to the wild-type p27. Our results indicate that the nascent helicity of sub-domain LH plays a key role mediating the biological function of p27. PMID:23071750
Guyochin, Aurélia; Maenner, Sylvain; Chu, Erin Tsi-Jia; Hentati, Asma; Attia, Mikael; Avner, Philip; Clerc, Philippe
2014-01-01
Random X-chromosome inactivation ensures dosage compensation in mammals through the transcriptional silencing of one of the two X chromosomes present in each female cell. Silencing is initiated in the differentiating epiblast of the mouse female embryos through coating of the nascent inactive X chromosome by the non-coding RNA Xist, which subsequently recruits the Polycomb Complex PRC2 leading to histone H3-K27 methylation. Here we examined in mouse ES cells the early steps of the transition from naive ES cells towards epiblast stem cells as a model for inducing X chromosome inactivation in vitro. We show that these conditions efficiently induce random XCI. Importantly, in a transient phase of this differentiation pathway, both X chromosomes are coated with Xist RNA in up to 15% of the XX cells. In an attempt to determine the dynamics of this process, we designed a strategy aimed at visualizing the nascent inactive X-chromosome in live cells. We generated transgenic female XX ES cells expressing the PRC2 component Ezh2 fused to the fluorescent protein Venus. The fluorescent fusion protein was expressed at sub-physiological levels and located in nuclei of ES cells. Upon differentiation of ES cell towards epiblast stem cell fate, Venus-fluorescent territories appearing in interphase nuclei were identified as nascent inactive X chromosomes by their association with Xist RNA. Imaging of Ezh2-Venus for up to 24 hours during the differentiation process showed survival of some cells with two fluorescent domains and a surprising dynamics of the fluorescent territories across cell division and in the course of the differentiation process. Our data reveal a strategy for visualizing the nascent inactive X chromosome and suggests the possibility for a large plasticity of the nascent inactive X chromosome. PMID:25546018
Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi
2014-01-01
The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.
2015-01-01
Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079
NASA Astrophysics Data System (ADS)
Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing
2018-01-01
The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X
2012-08-14
Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial
Yusupov, Marat; Yusupova, Gulnara
2014-01-01
The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
A Primer on the Pathway to Scholarly Writing: Helping Nascent Writers to Unlearn Conditioned Habits
ERIC Educational Resources Information Center
McDougall, Dennis; Ornelles, Cecily; Rao, Kavita
2015-01-01
In this article, we identify eight common error patterns of nascent writers when they attempt to navigate the pathway to scholarly writing. We illustrate each error pattern via examples and counter-examples (corrections). We also describe how to identify such patterns, why those patterns might occur and persist, and why each pattern is…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eliav, E.; Kaldor, U.; Ishikawa, Y.
1994-12-31
Relativistic pair correlation energies of Xe were computed by employing a recently developed relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian. The matrix Dirac-Fock-Breit SCF and relativistic coupled cluster calculations were performed by means of expansion in basis sets of well-tempered Gaussian spinors. A detailed study of the pair correlation energies in Xe is performed, in order to investigate the effects of the low-frequency Breit interaction on the correlation energies of Xe. Nonadditivity of correlation and relativistic (particularly Breit) effects is discussed.
Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs
Lee, Alex H. F.; Kool, Eric T.
2008-01-01
A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396
Lyssenko, Nicholas N.; Brubaker, Gregory; Smith, Bradley D.; Smith, Jonathan D.
2011-01-01
Objective Nascent high-density lipoprotein (HDL) particles form from cellular lipids and extracellular lipid-free apolipoprotein AI (apoAI) in a process mediated by ATP-binding cassette transporter A1 (ABCA1). We have sought out compounds that inhibit nascent HDL biogenesis without affecting ABCA1 activity. Methods and Results Reconstituted HDL (rHDL) formation and cellular cholesterol efflux assays were used to show that two compounds that bond via hydrogen with phospholipids inhibit rHDL and nascent HDL production. In rHDL formation assays, the inhibitory effect of compound 1 (methyl 3α-acetoxy-7α,12α-di[(phenylaminocarbonyl)amino]-5β-cholan-24-oate), the more active of the two, depended on its ability to associate with phospholipids. In cell assays, compound 1 suppressed ABCA1-mediated cholesterol efflux to apoAI, the 18A peptide, and taurocholate with high specificity, without affecting ABCA1-independent cellular cholesterol efflux to HDL and endocytosis of acetylated low-density lipoprotein (AcLDL) and transferrin. Furthermore, compound 1 did not affect ABCA1 activity adversely, as ABCA1-mediated shedding of microparticles proceeded unabated and apoAI binding to ABCA1-expressing cells increased in its presence. Conclusions The inhibitory effects of compound 1 support a three-step model of nascent HDL biogenesis: plasma membrane remodeling by ABCA1, apoAI binding to ABCA1, and lipoprotein particle assembly. The compound inhibits the final step, causing accumulation of apoAI in ABCA1-expressing cells. PMID:21836073
Becker, Annemarie H.; Oh, Eugene; Weissman, Jonathan S.; Kramer, Günter; Bukau, Bernd
2014-01-01
A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors, and enzymes. Many factors act cotranslationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling, RP), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor–RNC interactions are stabilized by crosslinking, the resulting factor–RNC adducts are then nuclease-treated to generate monosomes, and affinity-purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor and is readily adaptable to other cotranslationally acting factors, including eukaryotic factors. Factor–RNC purification and sequencing library preparation takes 7–8 days, sequencing and data analysis can be completed in 5–6 days. PMID:24136347
Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore
NASA Technical Reports Server (NTRS)
Vercoutere, Wenonah; DeGuzman, Veronica
2003-01-01
The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family
Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.
2015-02-27
The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Synthesis, base pairing and structure studies of geranylated RNA
Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia
2016-01-01
Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604
Liu, Ning; Tian, Ru; Loeb, Daniel D.
2003-01-01
Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983
Liu, Ning; Tian, Ru; Loeb, Daniel D
2003-02-18
Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.
Hur, Junho K.; Luo, Yicheng; Moon, Sungjin; Ninova, Maria; Marinov, Georgi K.; Chung, Yun D.; Aravin, Alexei A.
2016-01-01
The conserved THO/TREX (transcription/export) complex is critical for pre-mRNA processing and mRNA nuclear export. In metazoa, TREX is loaded on nascent RNA transcribed by RNA polymerase II in a splicing-dependent fashion; however, how TREX functions is poorly understood. Here we show that Thoc5 and other TREX components are essential for the biogenesis of piRNA, a distinct class of small noncoding RNAs that control expression of transposable elements (TEs) in the Drosophila germline. Mutations in TREX lead to defects in piRNA biogenesis, resulting in derepression of multiple TE families, gametogenesis defects, and sterility. TREX components are enriched on piRNA precursors transcribed from dual-strand piRNA clusters and colocalize in distinct nuclear foci that overlap with sites of piRNA transcription. The localization of TREX in nuclear foci and its loading on piRNA precursor transcripts depend on Cutoff, a protein associated with chromatin of piRNA clusters. Finally, we show that TREX is required for accumulation of nascent piRNA precursors. Our study reveals a novel splicing-independent mechanism for TREX loading on nascent RNA and its importance in piRNA biogenesis. PMID:27036967
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
Concealed d -wave pairs in the s ± condensate of iron-based superconductors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less
Concealed d -wave pairs in the s ± condensate of iron-based superconductors
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
2016-05-02
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less
Concealed d-wave pairs in the s± condensate of iron-based superconductors.
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
2016-05-17
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.
Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.
De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao
2018-06-05
Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Li, Hai; Zhao, Yuan Yuan
2017-11-22
In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.
Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.
Nakano, Shu-ichi; Sugimoto, Naoki
2014-08-05
The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.
Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J
2004-05-01
In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).
Synthesis, base pairing and structure studies of geranylated RNA.
Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia
2016-07-27
Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Petrenko, Y M
2015-01-01
Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.
Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)
2014-12-11
Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
Gravitational radiation from rapidly rotating nascent neutron stars
NASA Technical Reports Server (NTRS)
Lai, Dong; Shapiro, Stuart L.
1995-01-01
We study the secular evolution and gravitational wave signature of a newly formed, rapidly rotating neutron star. The neutron star may arise from core collapse in a massive star or from the accretion-induced collapse of a white dwarf. After a brief dynamical phase, the nascent neutron star settles into an axisymmetric, secularly unstable state. Gravitational radiation drives the star to a nonaxisymmetric, stationary equilibrium configuration via the bar-mode instability. The emitted quasi-periodic gravitational waves have a unique signature: the wave frequency sweeps downward from a few hundred Hertz to zero, while the wave amplitude increase from zero to a maximum and then decays back to zero. Such a wave signal could detected by broadband gravitational wave interferometers currently being constructed. We also characterize two other types of gravitational wave signals that could arise in principle from a rapidly rotating, secularly unstable neutron star: a high-frequency (f greater than or approximately = 1000 Hz) wave which increases the pattern-speed of the star, and a wave that actually increases the angular momentum of the star.
Social Networks-Based Adaptive Pairing Strategy for Cooperative Learning
ERIC Educational Resources Information Center
Chuang, Po-Jen; Chiang, Ming-Chao; Yang, Chu-Sing; Tsai, Chun-Wei
2012-01-01
In this paper, we propose a grouping strategy to enhance the learning and testing results of students, called Pairing Strategy (PS). The proposed method stems from the need of interactivity and the desire of cooperation in cooperative learning. Based on the social networks of students, PS provides members of the groups to learn from or mimic…
ERIC Educational Resources Information Center
Lourenço, Fernando; Sappleton, Natalie; Cheng, Ranis
2015-01-01
The authors examined the following questions: Does gender influence the ethicality of enterprise students to a greater extent than it does nascent entrepreneurs? If this is the case, then is it due to factors associated with adulthood such as age, work experience, marital status, and parental status? Sex-role socialization theory and moral…
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course
ERIC Educational Resources Information Center
Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun
2010-01-01
This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…
Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.
2013-01-01
Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567
NASA Astrophysics Data System (ADS)
Schill, S.; Zimmermann, K.; Ryder, O. S.; Campbell, N.; Collins, D. B.; Gianneschi, N.; Bertram, T. H.
2013-12-01
Spontaneous self-assembly of marine exudate particles has previously been observed in filtered seawater samples. The chemicophysical properties of these particles may alter the chemical composition and CCN properties of nascent marine aerosol, yet to date simultaneous measurement of seawater exudate particle formation rates and number distributions, with aerosol particle formation rates and CCN activity are lacking. Here, we use a novel Marine Aerosol Reference Tank (MART) system to experimentally mimic a phytoplankton bloom via sequential addition of biological surrogates, including sterol, galactose, lipopolysaccharide, BSA protein, and dipalmitoylphosphatidylcholine. Nascent sea-spray aerosol are generated in the MART system via a continuous plunging waterfall. Exudate particle assembly in the water is monitored via dynamic light scattering (DLS) and transmission electron microscopy (TEM) to obtain both the assembly kinetics of the particles as well as particle number distributions Simultaneous characterization of both particle production rates and super-saturated particle hygroscopicity are also discussed. This study permits analysis of the controlling role of the molecular composition of dissolved organic carbon in setting the production rates of colloidal material in the surface oceans.
Identification of Nascent Memory CD8 T Cells and Modeling of Their Ontogeny.
Crauste, Fabien; Mafille, Julien; Boucinha, Lilia; Djebali, Sophia; Gandrillon, Olivier; Marvel, Jacqueline; Arpin, Christophe
2017-03-22
Primary immune responses generate short-term effectors and long-term protective memory cells. The delineation of the genealogy linking naive, effector, and memory cells has been complicated by the lack of phenotypes discriminating effector from memory differentiation stages. Using transcriptomics and phenotypic analyses, we identify Bcl2 and Mki67 as a marker combination that enables the tracking of nascent memory cells within the effector phase. We then use a formal approach based on mathematical models describing the dynamics of population size evolution to test potential progeny links and demonstrate that most cells follow a linear naive→early effector→late effector→memory pathway. Moreover, our mathematical model allows long-term prediction of memory cell numbers from a few early experimental measurements. Our work thus provides a phenotypic means to identify effector and memory cells, as well as a mathematical framework to investigate their genealogy and to predict the outcome of immunization regimens in terms of memory cell numbers generated. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Hessle, Viktoria; Björk, Petra; Sokolowski, Marcus; de Valdivia, Ernesto González; Silverstein, Rebecca; Artemenko, Konstantin; Tyagi, Anu; Maddalo, Gianluca; Ilag, Leopold; Helbig, Roger; Zubarev, Roman A.
2009-01-01
Eukaryotic cells have evolved quality control mechanisms to degrade aberrant mRNA molecules and prevent the synthesis of defective proteins that could be deleterious for the cell. The exosome, a protein complex with ribonuclease activity, is a key player in quality control. An early quality checkpoint takes place cotranscriptionally but little is known about the molecular mechanisms by which the exosome is recruited to the transcribed genes. Here we study the core exosome subunit Rrp4 in two insect model systems, Chironomus and Drosophila. We show that a significant fraction of Rrp4 is associated with the nascent pre-mRNPs and that a specific mRNA-binding protein, Hrp59/hnRNP M, interacts in vivo with multiple exosome subunits. Depletion of Hrp59 by RNA interference reduces the levels of Rrp4 at transcription sites, which suggests that Hrp59 is needed for the exosome to stably interact with nascent pre-mRNPs. Our results lead to a revised mechanistic model for cotranscriptional quality control in which the exosome is constantly recruited to newly synthesized RNAs through direct interactions with specific hnRNP proteins. PMID:19494042
Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays
NASA Technical Reports Server (NTRS)
Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.
2003-01-01
The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.
Binding of transcription termination protein nun to nascent RNA and template DNA.
Watnick, R S; Gottesman, M E
1999-12-17
The amino-terminal arginine-rich motif of coliphage HK022 Nun binds phage lambda nascent transcript, whereas the carboxyl-terminal domain interacts with RNA polymerase (RNAP) and blocks transcription elongation. RNA binding is inhibited by zinc (Zn2+) and stimulated by Escherichia coli NusA. To study these interactions, the Nun carboxyl terminus was extended by a cysteine residue conjugated to a photochemical cross-linker. The carboxyl terminus contacted NusA and made Zn2+-dependent intramolecular contacts. When Nun was added to a paused transcription elongation complex, it cross-linked to the DNA template. Nun may arrest transcription by anchoring RNAP to DNA.
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.
Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P
1997-05-16
The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.
Time series regression-based pairs trading in the Korean equities market
NASA Astrophysics Data System (ADS)
Kim, Saejoon; Heo, Jun
2017-07-01
Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding
2013-07-16
Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.
Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes
Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.
2014-01-01
Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333
Efficient and provable secure pairing-free security-mediated identity-based identification schemes.
Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W
2014-01-01
Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
Damage mechanism of hydroxyl radicals toward adenine—thymine base pair
NASA Astrophysics Data System (ADS)
Tan, Rong-Ri; Wang, Dong-Qi; Zhang, Feng-Shou
2014-02-01
The adenine—thymine base pair was studied in the presence of hydroxyl radicals in order to probe the hydrogen bond effect. The results show that the hydrogen bonds have little effect on the hydroxylation and dehydrogenation happened at the sites, which are not involved in a hydrogen bond, while at the sites involved in hydrogen bond formation in the base pair, the reaction becomes more difficult, both in view of the free energy barrier and the exothermicity. With a 6-311++G(d,p) level of description, both B3LYP and MP2 methods confirm that the C8 site of isolated adenine has the highest possibility to form covalent bond with the hydroxyl radicals, though with different energetics: B3LYP predicts a barrierless pathway, while MP2 finds a transition state with an energy of 106.1 kJ/mol. For the dehydrogenation reactions, B3LYP method predicts that the free energy barrier increases in the order of HN9 < HN61 < HN62 < H2 < H8.
NASA Astrophysics Data System (ADS)
Nagasawa, M.; Lin, D. N. C.; Ida, S.
2003-04-01
Most extrasolar planets are observed to have eccentricities much larger than those in the solar system. Some of these planets have sibling planets, with comparable masses, orbiting around the same host stars. In these multiple planetary systems, eccentricity is modulated by the planets' mutual secular interaction as a consequence of angular momentum exchange between them. For mature planets, the eigenfrequencies of this modulation are determined by their mass and semimajor axis ratios. However, prior to the disk depletion, self-gravity of the planets' nascent disks dominates the precession eigenfrequencies. We examine here the initial evolution of young planets' eccentricity due to the apsidal libration or circulation induced by both the secular interaction between them and the self-gravity of their nascent disks. We show that as the latter effect declines adiabatically with disk depletion, the modulation amplitude of the planets' relative phase of periapsis is approximately invariant despite the time-asymmetrical exchange of angular momentum between planets. However, as the young planets' orbits pass through a state of secular resonance, their mean eccentricities undergo systematic quantitative changes. For applications, we analyze the eccentricity evolution of planets around υ Andromedae and HD 168443 during the epoch of protostellar disk depletion. We find that the disk depletion can change the planets' eccentricity ratio. However, the relatively large amplitude of the planets' eccentricity cannot be excited if all the planets had small initial eccentricities.
Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.
Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei
2017-11-03
Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
Using Pair Programming to Teach CAD Based Engineering Graphics
ERIC Educational Resources Information Center
Leland, Robert P.
2010-01-01
Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…
Experimental extraction of an entangled photon pair from two identically decohered pairs.
Yamamoto, Takashi; Koashi, Masato; Ozdemir, Sahin Kaya; Imoto, Nobuyuki
2003-01-23
Entanglement is considered to be one of the most important resources in quantum information processing schemes, including teleportation, dense coding and entanglement-based quantum key distribution. Because entanglement cannot be generated by classical communication between distant parties, distribution of entangled particles between them is necessary. During the distribution process, entanglement between the particles is degraded by the decoherence and dissipation processes that result from unavoidable coupling with the environment. Entanglement distillation and concentration schemes are therefore needed to extract pairs with a higher degree of entanglement from these less-entangled pairs; this is accomplished using local operations and classical communication. Here we report an experimental demonstration of extraction of a polarization-entangled photon pair from two decohered photon pairs. Two polarization-entangled photon pairs are generated by spontaneous parametric down-conversion and then distributed through a channel that induces identical phase fluctuations to both pairs; this ensures that no entanglement is available as long as each pair is manipulated individually. Then, through collective local operations and classical communication we extract from the two decohered pairs a photon pair that is observed to be polarization-entangled.
A Proteomic Characterization of Factors Enriched at Nascent DNA Molecules
Lopez-Contreras, Andres J.; Ruppen, Isabel; Nieto-Soler, Maria; Murga, Matilde; Rodriguez-Acebes, Sara; Remeseiro, Silvia; Rodrigo-Perez, Sara; Rojas, Ana M.; Mendez, Juan; Muñoz, Javier; Fernandez-Capetillo, Oscar
2013-01-01
SUMMARY DNA replication is facilitated by multiple factors that concentrate in the vicinity of replication forks. Here, we developed an approach that combines the isolation of proteins on nascent DNA chains with mass spectrometry (iPOND-MS), allowing a comprehensive proteomic characterization of the human replisome and replisome-associated factors. In addition to known replisome components, we provide a broad list of proteins that reside in the vicinity of the replisome, some of which were not previously associated with replication. For instance, our data support a link between DNA replication and the Williams-Beuren syndrome and identify ZNF24 as a replication factor. In addition, we reveal that SUMOylation is wide-spread for factors that concentrate near replisomes, which contrasts with lower UQylation levels at these sites. This resource provides a panoramic view of the proteins that concentrate in the surroundings of the replisome, which should facilitate future investigations on DNA replication and genome maintenance. PMID:23545495
Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit
NASA Astrophysics Data System (ADS)
Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen
This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok
2015-11-30
In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.
NASA Technical Reports Server (NTRS)
Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert
2002-01-01
(3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.
Alexandrova, Antonina Y.; Arnold, Katya; Schaub, Sébastien; Vasiliev, Jury M.; Meister, Jean-Jacques; Bershadsky, Alexander D.; Verkhovsky, Alexander B.
2008-01-01
Dynamic actin network at the leading edge of the cell is linked to the extracellular matrix through focal adhesions (FAs), and at the same time it undergoes retrograde flow with different dynamics in two distinct zones: the lamellipodium (peripheral zone of fast flow), and the lamellum (zone of slow flow located between the lamellipodium and the cell body). Cell migration involves expansion of both the lamellipodium and the lamellum, as well as formation of new FAs, but it is largely unknown how the position of the boundary between the two flow zones is defined, and how FAs and actin flow mutually influence each other. We investigated dynamic relationship between focal adhesions and the boundary between the two flow zones in spreading cells. Nascent FAs first appeared in the lamellipodium. Within seconds after the formation of new FAs, the rate of actin flow decreased locally, and the lamellipodium/lamellum boundary advanced towards the new FAs. Blocking fast actin flow with cytochalasin D resulted in rapid dissolution of nascent FAs. In the absence of FAs (spreading on poly-L-lysine-coated surfaces) retrograde flow was uniform and the velocity transition was not observed. We conclude that formation of FAs depends on actin dynamics, and in its turn, affects the dynamics of actin flow by triggering transition from fast to slow flow. Extension of the cell edge thus proceeds through a cycle of lamellipodium protrusion, formation of new FAs, advance of the lamellum, and protrusion of the lamellipodium from the new base. PMID:18800171
Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo
2015-01-01
The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Xing, Pengwei; Su, Ran; Guo, Fei; Wei, Leyi
2017-04-01
N6-methyladenosine (m6A) refers to methylation of the adenosine nucleotide acid at the nitrogen-6 position. It plays an important role in a series of biological processes, such as splicing events, mRNA exporting, nascent mRNA synthesis, nuclear translocation and translation process. Numerous experiments have been done to successfully characterize m6A sites within sequences since high-resolution mapping of m6A sites was established. However, as the explosive growth of genomic sequences, using experimental methods to identify m6A sites are time-consuming and expensive. Thus, it is highly desirable to develop fast and accurate computational identification methods. In this study, we propose a sequence-based predictor called RAM-NPPS for identifying m6A sites within RNA sequences, in which we present a novel feature representation algorithm based on multi-interval nucleotide pair position specificity, and use support vector machine classifier to construct the prediction model. Comparison results show that our proposed method outperforms the state-of-the-art predictors on three benchmark datasets across the three species, indicating the effectiveness and robustness of our method. Moreover, an online webserver implementing the proposed predictor has been established at http://server.malab.cn/RAM-NPPS/. It is anticipated to be a useful prediction tool to assist biologists to reveal the mechanisms of m6A site functions.
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2012-11-21
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.
NASA Astrophysics Data System (ADS)
Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos
2018-03-01
In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.
Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel
2004-12-01
Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.
Ling, Feng; Shibata, Takehiko
2002-09-02
Yeast mhr1-1 was isolated as a defective mutation in mitochondrial DNA (mtDNA) recombination. About half of mhr1-1 cells lose mtDNA during growth at a higher temperature. Here, we show that mhr1-1 exhibits a defect in the partitioning of nascent mtDNA into buds and is a base-substitution mutation in MHR1 encoding a mitochondrial matrix protein. We found that the Mhr1 protein (Mhr1p) has activity to pair single-stranded DNA and homologous double-stranded DNA to form heteroduplex joints in vitro, and that mhr1-1 causes the loss of this activity, indicating its role in homologous mtDNA recombination. While the majority of the mtDNA in the mother cells consists of head-to-tail concatemers, more than half of the mtDNA in the buds exists as genome-sized monomers. The mhr1-1 deltacce1 double mutant cells do not maintain any mtDNA, indicating the strict dependence of mtDNA maintenance on recombination functions. These results suggest a mechanism for mtDNA inheritance similar to that operating in the replication and packaging of phage DNA.
Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.
Sua, Yong Meng; Malowicki, John; Lee, Kim Fook
2014-08-15
We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.
Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian
2011-12-01
We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.
Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.
Calvet, J P; Meyer, L M; Pederson, T
1982-07-30
Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.
Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre
2012-01-01
The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274
Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie
2017-10-06
In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W
1997-01-01
The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659
Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators
NASA Astrophysics Data System (ADS)
Andreozzi, F.; Covello, A.; Gargano, A.; Ye, Liu Jian; Porrino, A.
1985-07-01
The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v=0, v=1, and v=2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states.
Splicing and transcription touch base: co-transcriptional spliceosome assembly and function
Herzel, Lydia; Ottoz, Diana S. M.; Alpert, Tara; Neugebauer, Karla M.
2018-01-01
Several macromolecular machines collaborate to produce eukaryotic messenger RNA. RNA polymerase II (Pol II) translocates along genes that are up to millions of base pairs in length and generates a flexible RNA copy of the DNA template. This nascent RNA harbours introns that are removed by the spliceosome, which is a megadalton ribonucleoprotein complex that positions the distant ends of the intron into its catalytic centre. Emerging evidence that the catalytic spliceosome is physically close to Pol II in vivo implies that transcription and splicing occur on similar timescales and that the transcription and splicing machineries may be spatially constrained. In this Review, we discuss aspects of spliceosome assembly, transcription elongation and other co-transcriptional events that allow the temporal coordination of co-transcriptional splicing. PMID:28792005
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2013-01-01
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027
Kanda, Shoichiro; Tanigawa, Shunsuke; Ohmori, Tomoko; Taguchi, Atsuhiro; Kudo, Kuniko; Suzuki, Yutaka; Sato, Yuki; Hino, Shinjiro; Sander, Maike; Perantoni, Alan O.; Sugano, Sumio; Nakao, Mitsuyoshi
2014-01-01
The balanced self-renewal and differentiation of nephron progenitors are critical for kidney development and controlled, in part, by the transcription factor Six2, which antagonizes canonical Wnt signaling-mediated differentiation. A nuclear factor, Sall1, is expressed in Six2-positive progenitors as well as differentiating nascent nephrons, and it is essential for kidney formation. However, the molecular functions and targets of Sall1, especially the functions and targets in the nephron progenitors, remain unknown. Here, we report that Sall1 deletion in Six2-positive nephron progenitors results in severe progenitor depletion and apoptosis of the differentiating nephrons in mice. Analysis of mice with an inducible Sall1 deletion revealed that Sall1 activates genes expressed in progenitors while repressing genes expressed in differentiating nephrons. Sall1 and Six2 co-occupied many progenitor-related gene loci, and Sall1 bound to Six2 biochemically. In contrast, Sall1 did not bind to the Wnt4 locus suppressed by Six2. Sall1-mediated repression was also independent of its binding to DNA. Thus, Sall1 maintains nephron progenitors and their derivatives by a unique mechanism, which partly overlaps but is distinct from that of Six2: Sall1 activates progenitor-related genes in Six2-positive nephron progenitors and represses gene expression in Six2-negative differentiating nascent nephrons. PMID:24744442
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamura, Ayaka, E-mail: atamura@hiroshima-u.ac.jp; Matsumoto, Ayumu; Nishi, Naoya
2015-05-07
We investigate the effects of pulse duration on the dynamics of the nascent plasma and bubble induced by laser ablation in water. To examine the relationship between the nascent plasma and the bubble without disturbed by shot-to-shot fluctuation, we observe the images of the plasma and the bubble simultaneously by using two intensified charge coupled device detectors. We successfully observe the images of the plasma and bubble during the pulsed-irradiation, when the bubble size is as small as 20 μm. The light-emitting region of the plasma during the laser irradiation seems to exceed the bubble boundary in the case of themore » short-pulse (30-ns pulse) irradiation, while the size of the plasma is significantly smaller than that of the bubble in the case of the long-pulse (100-ns pulse) irradiation. The results suggest that the extent of the plasma quenching in the initial stage significantly depends on the pulse duration. Also, we investigate how the plasma-bubble relationship in the very early stage affects the shape of the atomic spectral lines observed at the later delay time of 600 ns. The present work gives important information to obtain high quality spectra in the application of underwater laser-induced breakdown spectroscopy, as well as to clarify the mechanism of liquid-phase laser ablation.« less
Efficient Implementation of the Pairing on Mobilephones Using BREW
NASA Astrophysics Data System (ADS)
Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki
Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.
Ding, Yuxiao; Huang, Xing; Yi, Xianfeng; Qiao, Yunxiang; Sun, Xiaoyan; Zheng, Anmin; Su, Dang Sheng
2018-06-04
Designing heterogeneous metal-free catalysts for hydrogenation is a long-standing challenge in catalysis. Nanodiamond-based carbon materials were prepared that are surface-doped with electron-rich nitrogen and electron-deficient boron. The two heteroatoms are directly bonded to each other to form unquenched Lewis pairs with infinite π-electron donation from the surrounding graphitic structure. Remarkably, these Lewis pairs can split H 2 to form H + /H - pairs, which subsequently serve as the active species for hydrogenation of different substrates. This unprecedented finding sheds light on the uptake of H 2 across carbon-based materials and suggests that dual Lewis acidity-basicity on the carbon surface may be used to heterogeneously activate a variety of small molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The solvability of quantum k-pair network in a measurement-based way.
Li, Jing; Xu, Gang; Chen, Xiu-Bo; Qu, Zhiguo; Niu, Xin-Xin; Yang, Yi-Xian
2017-12-01
Network coding is an effective means to enhance the communication efficiency. The characterization of network solvability is one of the most important topic in this field. However, for general network, the solvability conditions are still a challenge. In this paper, we consider the solvability of general quantum k-pair network in measurement-based framework. For the first time, a detailed account of measurement-based quantum network coding(MB-QNC) is specified systematically. Differing from existing coding schemes, single qubit measurements on a pre-shared graph state are the only allowed coding operations. Since no control operations are concluded, it makes MB-QNC schemes more feasible. Further, the sufficient conditions formulating by eigenvalue equations and stabilizer matrix are presented, which build an unambiguous relation among the solvability and the general network. And this result can also analyze the feasibility of sharing k EPR pairs task in large-scale networks. Finally, in the presence of noise, we analyze the advantage of MB-QNC in contrast to gate-based way. By an instance network [Formula: see text], we show that MB-QNC allows higher error thresholds. Specially, for X error, the error threshold is about 30% higher than 10% in gate-based way. In addition, the specific expressions of fidelity subject to some constraint conditions are given.
To pair or not to pair: chromosome pairing and evolution.
Moore, G
1998-04-01
Chromosome pairing in wild-type wheat closely resembles the process in both yeast and Drosophila. The recent characterisation of a mutant Ph1 wheat and the observation that chromosome pairing in the absence of Ph1 more closely resembles that of mammals and maize has shed light on the evolution of chromosome pairing in the cereals.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.
2016-01-01
The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
A two-way street: regulatory interplay between RNA polymerase and nascent RNA structure
Zhang, Jinwei; Landick, Robert
2016-01-01
The vectorial (5′-to-3′ at varying velocity) synthesis of RNA by cellular RNA polymerases creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNA polymerase and nascent RNA structure. We categorize and attempt to rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. PMID:26822487
A Two-Way Street: Regulatory Interplay between RNA Polymerase and Nascent RNA Structure.
Zhang, Jinwei; Landick, Robert
2016-04-01
The vectorial (5'-to-3' at varying velocity) synthesis of RNA by cellular RNA polymerases (RNAPs) creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived, pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here, we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNAP and nascent RNA structure. We categorize and rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi
2007-02-15
Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.
Triman, K L
1995-01-01
Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481
Array-Based Discovery of Aptamer Pairs
2014-12-11
affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such constructs, because they can be linked via...standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult to generate, primarily because...conventional selection methods preferentially yield aptamers that recognize a dominant “hot spot” epitope. Our 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND
Young, J.A.; Smith, D.R.; Snyder, C.D.; Lemarie, D.P.
2002-01-01
Biodiversity surveys are often hampered by the inability to control extraneous sources of variability introduced into comparisons of populations across a heterogenous landscape. If not specifically accounted for a priori, this noise can weaken comparisons between sites, and can make it difficult to draw inferences about specific ecological processes. We developed a terrain-based, paired-site sampling design to analyze differences in aquatic biodiversity between streams draining eastern hemlock (Tsuga canadensis) forests, and those draining mixed hardwood forests in Delaware Water Gap National Recreation Area (USA). The goal of this design was to minimize variance due to terrain influences on stream communities, while representing the range of hemlock dominated stream environments present in the park. We used geographic information systems (GIS) and cluster analysis to define and partition hemlock dominated streams into terrain types based on topographic variables and stream order. We computed similarity of forest stands within terrain types and used this information to pair hemlock-dominated streams with hardwood counterparts prior to sampling. We evaluated the effectiveness of the design through power analysis and found that power to detect differences in aquatic invertebrate taxa richness was highest when sites were paired and terrain type was included as a factor in the analysis. Precision of the estimated difference in mean richness was nearly doubled using the terrain-based, paired site design in comparison to other evaluated designs. Use of this method allowed us to sample stream communities representative of park-wide forest conditions while effectively controlling for landscape variability.
Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.
Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M
2005-01-01
Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.
NASA Astrophysics Data System (ADS)
Brancolini, Giorgia; Di Felice, Rosa
2011-05-01
Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.
2011-01-01
Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lintner, Nathanael G.; McClure, Kim F.; Petersen, Donna; Londregan, Allyn T.; Piotrowski, David W.; Wei, Liuqing; Xiao, Jun; Bolt, Michael; Loria, Paula M.; Maguire, Bruce; Geoghegan, Kieran F.; Huang, Austin; Rolph, Tim; Liras, Spiros; Doudna, Jennifer A.; Dullea, Robert G.
2017-01-01
Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a key role in regulating the levels of plasma low-density lipoprotein cholesterol (LDL-C). Here, we demonstrate that the compound PF-06446846 inhibits translation of PCSK9 by inducing the ribosome to stall around codon 34, mediated by the sequence of the nascent chain within the exit tunnel. We further show that PF-06446846 reduces plasma PCSK9 and total cholesterol levels in rats following oral dosing. Using ribosome profiling, we demonstrate that PF-06446846 is highly selective for the inhibition of PCSK9 translation. The mechanism of action employed by PF-06446846 reveals a previously unexpected tunability of the human ribosome that allows small molecules to specifically block translation of individual transcripts. PMID:28323820
Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones
Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter
2015-01-01
Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation. PMID:26112308
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Detection of figure and caption pairs based on disorder measurements
NASA Astrophysics Data System (ADS)
Faure, Claudie; Vincent, Nicole
2010-01-01
Figures inserted in documents mediate a kind of information for which the visual modality is more appropriate than the text. A complete understanding of a figure often necessitates the reading of its caption or to establish a relationship with the main text using a numbered figure identifier which is replicated in the caption and in the main text. A figure and its caption are closely related; they constitute single multimodal components (FC-pair) that Document Image Analysis cannot extract with text and graphics segmentation. We propose a method to go further than the graphics and text segmentation in order to extract FC-pairs without performing a full labelling of the page components. Horizontal and vertical text lines are detected in the pages. The graphics are associated with selected text lines to initiate the detector of FC-pairs. Spatial and visual disorders are introduced to define a layout model in terms of properties. It enables to cope with most of the numerous spatial arrangements of graphics and text lines. The detector of FC-pairs performs operations in order to eliminate the layout disorder and assigns a quality value to each FC-pair. The processed documents were collected in medic@, the digital historical collection of the BIUM (Bibliothèque InterUniversitaire Médicale). A first set of 98 pages constitutes the design set. Then 298 pages were collected to evaluate the system. The performances are the result of a full process, from the binarisation of the digital images to the detection of FC-pairs.
Determination of the pairing-strength constants in the isovector plus isoscalar pairing case
NASA Astrophysics Data System (ADS)
Mokhtari, D.; Fellah, M.; Allal, N. H.
2016-05-01
A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.
THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides
NASA Astrophysics Data System (ADS)
Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua
2018-07-01
The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.
Electron pairing without superconductivity
NASA Astrophysics Data System (ADS)
Levy, Jeremy
Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.
Prospective very young asteroid pairs
NASA Astrophysics Data System (ADS)
Galád, A.; Vokrouhlický, D.; Zizka, J.
2014-07-01
Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair
Kim, Kyung Lock; Sung, Gihyun; Sim, Jaehwan; Murray, James; Li, Meng; Lee, Ara; Shrinidhi, Annadka; Park, Kyeng Min; Kim, Kimoon
2018-04-27
Here we report ultrastable synthetic binding pairs between cucurbit[7]uril (CB[7]) and adamantyl- (AdA) or ferrocenyl-ammonium (FcA) as a supramolecular latching system for protein imaging, overcoming the limitations of protein-based binding pairs. Cyanine 3-conjugated CB[7] (Cy3-CB[7]) can visualize AdA- or FcA-labeled proteins to provide clear fluorescence images for accurate and precise analysis of proteins. Furthermore, controllability of the system is demonstrated by treating with a stronger competitor guest. At low temperature, this allows us to selectively detach Cy3-CB[7] from guest-labeled proteins on the cell surface, while leaving Cy3-CB[7] latched to the cytosolic proteins for spatially conditional visualization of target proteins. This work represents a non-protein-based bioimaging tool which has inherent advantages over the widely used protein-based techniques, thereby demonstrating the great potential of this synthetic system.
Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai
2017-01-01
Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA. PMID:28938011
Zhang, X; Gottlieb, P A
1995-01-01
Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate
NASA Astrophysics Data System (ADS)
Grotheer, H.-H.; Wolf, K.; Hoffmann, K.
2011-08-01
Premixed laminar flat ethylene flames were investigated for nascent nanoparticles through photoionization mass spectrometry (PIMS). Using an atmospheric McKenna burner and ethylene air flames coupled to an atmospheric sampling system, within a relatively narrow C/O range two modes of these particles were found, which can be clearly distinguished with regard to their temperature dependence, their reactivity, and their ionization behaviour. Behind a diesel engine the same particles were observed. These results were corroborated using a low pressure ethylene-O2 flame coupled to a high resolution mass spectrometer. In this case, due to a special inlet system, it was possible to operate the flame in a fairly wide C/O range without clogging of the inlet nozzles. This allowed pursuing the development of particle size distribution functions (PSDF) well into the regime of mature soot. In addition, on the low mass side of the particle spectra measurements with unity resolution were possible and this allowed gaining information concerning their growth mechanism and structure. Finally, in an attempt to mimic Laser Induced Incandescence (LII) experiments the soot-laden molecular beam was exposed to IR irradiation. This resulted in a near complete destruction of nascent particles under LII typical fluences. Small C clusters between 3 and 17 C atoms were found. In addition and with much higher intensities, clusters comprising several hundreds of C atoms were also detected, the latter even at very low fluences when small clusters were totally absent.
RNA editing in nascent RNA affects pre-mRNA splicing
Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Yang, Yun; Lin, Xianzhi; Tran, Stephen; Yang, Ei-Wen; Quinones-Valdez, Giovanni
2018-01-01
In eukaryotes, nascent RNA transcripts undergo an intricate series of RNA processing steps to achieve mRNA maturation. RNA editing and alternative splicing are two major RNA processing steps that can introduce significant modifications to the final gene products. By tackling these processes in isolation, recent studies have enabled substantial progress in understanding their global RNA targets and regulatory pathways. However, the interplay between individual steps of RNA processing, an essential aspect of gene regulation, remains poorly understood. By sequencing the RNA of different subcellular fractions, we examined the timing of adenosine-to-inosine (A-to-I) RNA editing and its impact on alternative splicing. We observed that >95% A-to-I RNA editing events occurred in the chromatin-associated RNA prior to polyadenylation. We report about 500 editing sites in the 3′ acceptor sequences that can alter splicing of the associated exons. These exons are highly conserved during evolution and reside in genes with important cellular function. Furthermore, we identified a second class of exons whose splicing is likely modulated by RNA secondary structures that are recognized by the RNA editing machinery. The genome-wide analyses, supported by experimental validations, revealed remarkable interplay between RNA editing and splicing and expanded the repertoire of functional RNA editing sites. PMID:29724793
Przybilski, Rita; Hammann, Christian
2007-01-01
Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711
High quality image-pair-based deblurring method using edge mask and improved residual deconvolution
NASA Astrophysics Data System (ADS)
Cui, Guangmang; Zhao, Jufeng; Gao, Xiumin; Feng, Huajun; Chen, Yueting
2017-04-01
Image deconvolution problem is a challenging task in the field of image process. Using image pairs could be helpful to provide a better restored image compared with the deblurring method from a single blurred image. In this paper, a high quality image-pair-based deblurring method is presented using the improved RL algorithm and the gain-controlled residual deconvolution technique. The input image pair includes a non-blurred noisy image and a blurred image captured for the same scene. With the estimated blur kernel, an improved RL deblurring method based on edge mask is introduced to obtain the preliminary deblurring result with effective ringing suppression and detail preservation. Then the preliminary deblurring result is served as the basic latent image and the gain-controlled residual deconvolution is utilized to recover the residual image. A saliency weight map is computed as the gain map to further control the ringing effects around the edge areas in the residual deconvolution process. The final deblurring result is obtained by adding the preliminary deblurring result with the recovered residual image. An optical experimental vibration platform is set up to verify the applicability and performance of the proposed algorithm. Experimental results demonstrate that the proposed deblurring framework obtains a superior performance in both subjective and objective assessments and has a wide application in many image deblurring fields.
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.
Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua
2018-07-05
The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J
2013-12-12
The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.
Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing
2017-09-01
Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.
Flagellar central pair assembly in Chlamydomonas reinhardtii
2013-01-01
Background Most motile cilia and flagella have nine outer doublet and two central pair (CP) microtubules. Outer doublet microtubules are continuous with the triplet microtubules of the basal body, are templated by the basal body microtubules, and grow by addition of new subunits to their distal (“plus”) ends. In contrast, CP microtubules are not continuous with basal body microtubules, raising the question of how these microtubules are assembled and how their polarity is established. Methods CP assembly in Chlamydomonas reinhardtii was analyzed by electron microscopy and wide-field and super-resolution immunofluorescence microscopy. To analyze CP assembly independently from flagellar assembly, the CP-deficient katanin mutants pf15 or pf19 were mated to wild-type cells. HA-tagged tubulin and the CP-specific protein hydin were used as markers to analyze de novo CP assembly inside the formerly mutant flagella. Results In regenerating flagella, the CP and its projections assemble near the transition zone soon after the onset of outer doublet elongation. During de novo CP assembly in full-length flagella, the nascent CP was first apparent in a subdistal region of the flagellum. The developing CP replaces a fibrous core that fills the axonemal lumen of CP-deficient flagella. The fibrous core contains proteins normally associated with the C1 CP microtubule and proteins involved in intraflagellar transport (IFT). In flagella of the radial spoke-deficient mutant pf14, two pairs of CPs are frequently present with identical correct polarities. Conclusions The temporal separation of flagellar and CP assembly in dikaryons formed by mating CP-deficient gametes to wild-type gametes revealed that the formation of the CP does not require proximity to the basal body or transition zone, or to the flagellar tip. The observations on pf14 provide further support that the CP self-assembles without a template and eliminate the possibility that CP polarity is established by interaction
Exploiting Bounded Signal Flow for Graph Orientation Based on Cause-Effect Pairs
NASA Astrophysics Data System (ADS)
Dorn, Britta; Hüffner, Falk; Krüger, Dominikus; Niedermeier, Rolf; Uhlmann, Johannes
We consider the following problem: Given an undirected network and a set of sender-receiver pairs, direct all edges such that the maximum number of "signal flows" defined by the pairs can be routed respecting edge directions. This problem has applications in communication networks and in understanding protein interaction based cell regulation mechanisms. Since this problem is NP-hard, research so far concentrated on polynomial-time approximation algorithms and tractable special cases. We take the viewpoint of parameterized algorithmics and examine several parameters related to the maximum signal flow over vertices or edges. We provide several fixed-parameter tractability results, and in one case a sharp complexity dichotomy between a linear-time solvable case and a slightly more general NP-hard case. We examine the value of these parameters for several real-world network instances. For many relevant cases, the NP-hard problem can be solved to optimality. In this way, parameterized analysis yields both deeper insight into the computational complexity and practical solving strategies.
Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu
2018-06-15
Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
An efficient and near linear scaling pair natural orbital based local coupled cluster method.
Riplinger, Christoph; Neese, Frank
2013-01-21
In previous publications, it was shown that an efficient local coupled cluster method with single- and double excitations can be based on the concept of pair natural orbitals (PNOs) [F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009)]. The resulting local pair natural orbital-coupled-cluster single double (LPNO-CCSD) method has since been proven to be highly reliable and efficient. For large molecules, the number of amplitudes to be determined is reduced by a factor of 10(5)-10(6) relative to a canonical CCSD calculation on the same system with the same basis set. In the original method, the PNOs were expanded in the set of canonical virtual orbitals and single excitations were not truncated. This led to a number of fifth order scaling steps that eventually rendered the method computationally expensive for large molecules (e.g., >100 atoms). In the present work, these limitations are overcome by a complete redesign of the LPNO-CCSD method. The new method is based on the combination of the concepts of PNOs and projected atomic orbitals (PAOs). Thus, each PNO is expanded in a set of PAOs that in turn belong to a given electron pair specific domain. In this way, it is possible to fully exploit locality while maintaining the extremely high compactness of the original LPNO-CCSD wavefunction. No terms are dropped from the CCSD equations and domains are chosen conservatively. The correlation energy loss due to the domains remains below <0.05%, which implies typically 15-20 but occasionally up to 30 atoms per domain on average. The new method has been given the acronym DLPNO-CCSD ("domain based LPNO-CCSD"). The method is nearly linear scaling with respect to system size. The original LPNO-CCSD method had three adjustable truncation thresholds that were chosen conservatively and do not need to be changed for actual applications. In the present treatment, no additional truncation parameters have been introduced. Any additional truncation is performed on
ERIC Educational Resources Information Center
Miller, Pat
2005-01-01
Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Teplova,M.; Yuan, Y.; Phan, A.
2006-01-01
The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUUOH 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the {beta} sheet edge,more » rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.« less
Foulk, Michael S.; Urban, John M.; Casella, Cinzia; Gerbi, Susan A.
2015-01-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand–independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo–controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na+ instead of K+ in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. PMID:25695952
Zakharova, Maria V; Masoumifard, Nima; Hu, Yimu; Han, Jongho; Kleitz, Freddy; Fontaine, Frédéric-Georges
2018-04-18
Conventional amines and phosphines, such as diethylenetriamine, diphenylpropylphosphine, triethylamine, and tetramethylpiperidine, were grafted or impregnated on the surface of metalated SBA-15 materials, such as Ti-, Al-, and Zr-SBA-15, to generate air-stable solid-supported Lewis acid-base pairs. The Lewis acidity of the metalated materials before and after the introduction of Lewis bases was verified by means of pyridine adsorption-Fourier transform infrared spectroscopy. Detailed characterization of the materials was achieved by solid-state 13 C and 31 P MAS NMR spectroscopy, low-temperature N 2 physisorption, X-ray photoelectron spectroscopy, and energy-dispersive X-ray mapping analyses. Study of their potential interactions with CO 2 was performed using CO 2 adsorption isotherm experiments, which provided new insights into their applicability as solid CO 2 adsorbents. A correlation between solid-supported Lewis acid-base pair strength and the resulting affinity to CO 2 is discussed based on the calculation of isosteric enthalpy of adsorption.
Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen
2016-12-01
The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cotton, R G; Rodrigues, N R; Campbell, R D
1988-01-01
The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032
Centromere pairing precedes meiotic chromosome pairing in plants.
Zhang, Jing; Han, Fangpu
2017-11-01
Meiosis is a specialized eukaryotic cell division, in which diploid cells undergo a single round of DNA replication and two rounds of nuclear division to produce haploid gametes. In most eukaryotes, the core events of meiotic prophase I are chromosomal pairing, synapsis and recombination. To ensure accurate chromosomal segregation, homologs have to identify and align along each other at the onset of meiosis. Although much progress has been made in elucidating meiotic processes, information on the mechanisms underlying chromosome pairing is limited in contrast to the meiotic recombination and synapsis events. Recent research in many organisms indicated that centromere interactions during early meiotic prophase facilitate homologous chromosome pairing, and functional centromere is a prerequisite for centromere pairing such as in maize. Here, we summarize the recent achievements of chromosome pairing research on plants and other organisms, and outline centromere interactions, nuclear chromosome orientation, and meiotic cohesin, as main determinants of chromosome pairing in early meiotic prophase.
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
RNA editing in nascent RNA affects pre-mRNA splicing.
Hsiao, Yun-Hua Esther; Bahn, Jae Hoon; Yang, Yun; Lin, Xianzhi; Tran, Stephen; Yang, Ei-Wen; Quinones-Valdez, Giovanni; Xiao, Xinshu
2018-06-01
In eukaryotes, nascent RNA transcripts undergo an intricate series of RNA processing steps to achieve mRNA maturation. RNA editing and alternative splicing are two major RNA processing steps that can introduce significant modifications to the final gene products. By tackling these processes in isolation, recent studies have enabled substantial progress in understanding their global RNA targets and regulatory pathways. However, the interplay between individual steps of RNA processing, an essential aspect of gene regulation, remains poorly understood. By sequencing the RNA of different subcellular fractions, we examined the timing of adenosine-to-inosine (A-to-I) RNA editing and its impact on alternative splicing. We observed that >95% A-to-I RNA editing events occurred in the chromatin-associated RNA prior to polyadenylation. We report about 500 editing sites in the 3' acceptor sequences that can alter splicing of the associated exons. These exons are highly conserved during evolution and reside in genes with important cellular function. Furthermore, we identified a second class of exons whose splicing is likely modulated by RNA secondary structures that are recognized by the RNA editing machinery. The genome-wide analyses, supported by experimental validations, revealed remarkable interplay between RNA editing and splicing and expanded the repertoire of functional RNA editing sites. © 2018 Hsiao et al.; Published by Cold Spring Harbor Laboratory Press.
Kumar, Anil; Sevilla, Michael D.
2009-01-01
On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319
NASA Astrophysics Data System (ADS)
Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.
2017-07-01
Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.
NASA Astrophysics Data System (ADS)
Abebe-Akele, Feseha
Life is inconceivable in the absence of interactions which could be cooperative, antagonistic or neutral. Interactions are in constant flux because on one hand it is often difficult to demarcate where one form of interaction ends and the other begins on the other hand what is cooperative at one point in time could evolve into antagonistic or neutral or vice versa. Thus, organisms, as a consequence of mutation, adaptation and natural selection would inevitably enter into natural associations from which they emerge as mutual partners, inveterate enemies or passive cohabitants. Entomopathogenic nematode (EPN) partnerships are tripartite interactions where a nematode-bacteria symbiont duo attacks a third organism -an insect or insect larva-for the mutual benefit of the attacking partners and the detriment of the insect they invade. All three participants in the interaction---the nematode worms with their symbiont bacteria and the target insect host-are among the most ancient, diverse and abundant species on earth, however, these EPN partnerships are not as common as circumstances would suggest. EPN associations, which are arguably at the peak of evolutionary co adaptations, where two primitive forms of life cooperate to take advantage of a larger species are not only fascinating but immensely important for humans. The biological and molecular mechanisms underlying entomopathogenesis have been studied in great detail for decades for their potential as biological control agents against invasive insects. In spite of intense research in The EPN field, the evolutionary history of EPN associations are largely unknown because there are no known intermediate forms. In this thesis, a nascent EPN partnership is described between Caenorhabditid nematodes and Serratia sp. SCBI. Comparative analysis of this association with other EPNs suggests that crucial aspect of EPN associations may be the ability of partners to co-exist without killing each other and that the end results of
Teplova, Marianna; Yuan, Yu-Ren; Phan, Anh Tuân; Malinina, Lucy; Ilin, Serge; Teplov, Alexei; Patel, Dinshaw J
2006-01-06
The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUU(OH) 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the beta sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUU(OH) 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.
A New Scheme for the Design of Hilbert Transform Pairs of Biorthogonal Wavelet Bases
NASA Astrophysics Data System (ADS)
Shi, Hongli; Luo, Shuqian
2010-12-01
In designing the Hilbert transform pairs of biorthogonal wavelet bases, it has been shown that the requirements of the equal-magnitude responses and the half-sample phase offset on the lowpass filters are the necessary and sufficient condition. In this paper, the relationship between the phase offset and the vanishing moment difference of biorthogonal scaling filters is derived, which implies a simple way to choose the vanishing moments so that the phase response requirement can be satisfied structurally. The magnitude response requirement is approximately achieved by a constrained optimization procedure, where the objective function and constraints are all expressed in terms of the auxiliary filters of scaling filters rather than the scaling filters directly. Generally, the calculation burden in the design implementation will be less than that of the current schemes. The integral of magnitude response difference between the primal and dual scaling filters has been chosen as the objective function, which expresses the magnitude response requirements in the whole frequency range. Two design examples illustrate that the biorthogonal wavelet bases designed by the proposed scheme are very close to Hilbert transform pairs.
Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A
2015-05-01
Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.
Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W
1987-01-01
We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602
Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara
2015-01-01
2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
An Intelligent Model for Pairs Trading Using Genetic Algorithms
Hsu, Chi-Jen; Chen, Chi-Chung; Li, Chen-An
2015-01-01
Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice. PMID:26339236
An Intelligent Model for Pairs Trading Using Genetic Algorithms.
Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An
2015-01-01
Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
NASA Astrophysics Data System (ADS)
Zhou, Fei; Sadigh, Babak; Erhart, Paul; Åberg, Daniel
2016-08-01
The excellent light yield proportionality of europium-doped strontium iodide (SrI2:Eu) has resulted in state-of-the-art γ-ray detectors with remarkably high-energy resolution, far exceeding that of most halide compounds. In this class of materials, the formation of self-trapped hole polarons is very common. However, polaron formation is usually expected to limit carrier mobilities and has been associated with poor scintillator light-yield proportionality and resolution. Here using a recently developed first-principles method, we perform an unprecedented study of polaron transport in SrI2, both for equilibrium polarons, as well as nascent polarons immediately following a self-trapping event. We propose a rationale for the unexpected high-energy resolution of SrI2. We identify nine stable hole polaron configurations, which consist of dimerised iodine pairs with polaron-binding energies of up to 0.5 eV. They are connected by a complex potential energy landscape that comprises 66 unique nearest-neighbour migration paths. Ab initio molecular dynamics simulations reveal that a large fraction of polarons is born into configurations that migrate practically barrier free at room temperature. Consequently, carriers created during γ-irradiation can quickly diffuse away reducing the chance for non-linear recombination, the primary culprit for non-proportionality and resolution reduction. We conclude that the flat, albeit complex, landscape for polaron migration in SrI2 is a key for understanding its outstanding performance. This insight provides important guidance not only for the future development of high-performance scintillators but also of other materials, for which large polaron mobilities are crucial such as batteries and solid-state ionic conductors.
Magnetic field homogeneity of a conical coaxial coil pair.
Salazar, F J; Nieves, F J; Bayón, A; Gascón, F
2017-09-01
An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.
Magnetic field homogeneity of a conical coaxial coil pair
NASA Astrophysics Data System (ADS)
Salazar, F. J.; Nieves, F. J.; Bayón, A.; Gascón, F.
2017-09-01
An analytical study of the magnetic field created by a double-conical conducting sheet is presented. The analysis is based on the expansion of the magnetic field in terms of Legendre polynomials. It is demonstrated analytically that the angle of the conical surface that produces a nearly homogeneous magnetic field coincides with that of a pair of loops that fulfills the Helmholtz condition. From the results obtained, we propose an electric circuit formed by pairs of isolated conducting loops tightly wound around a pair of conical surfaces, calculating numerically the magnetic field produced by this system and its heterogeneity. An experimental setup of the proposed circuit was constructed and its magnetic field was measured. The results were compared with those obtained by numerical calculation, finding a good agreement. The numerical results demonstrate a significant improvement in homogeneity in the field of the proposed pair of conical coils compared with that achieved with a simple pair of Helmholtz loops or with a double solenoid. Moreover, a new design of a double pair of conical coils based on Braunbek's four loops is also proposed to achieve greater homogeneity. Regarding homogeneity, the rating of the analyzed configurations from best to worst is as follows: (1) double pair of conical coils, (2) pair of conical coils, (3) Braunbek's four loops, (4) Helmholtz pair, and (5) solenoid pair.
NASA Astrophysics Data System (ADS)
Gesuele, F.; JJ Nivas, J.; Fittipaldi, R.; Altucci, C.; Bruzzese, R.; Maddalena, P.; Amoruso, S.
2018-02-01
We report a correlative imaging analysis of a crystalline silicon target after irradiation with a low number of 1055 nm, 850 fs laser pulses with several microscopy techniques (e.g., scanning electron microscopy, atomic force microscopy, Raman micro-imaging and confocal optical microscopy). The analysis is carried out on samples irradiated both in high vacuum and at atmospheric pressure conditions, evidencing interesting differences induced by the ambient environment. In high-vacuum conditions, the results evidence the formation of a halo, which is constituted by alternate stripes of amorphous and crystalline silicon, around the nascent ablation crater. In air, such an effect is drastically reduced, due to the significant back-deposition of nanoparticulate material induced by the larger ambient pressure.
Orbital-selective pairing and superconductivity in iron selenides
NASA Astrophysics Data System (ADS)
Nica, Emilian M.; Yu, Rong; Si, Qimiao
2017-12-01
An important challenge in condensed matter physics is understanding iron-based superconductors. Among these systems, the iron selenides hold the record for highest superconducting transition temperature and pose especially striking puzzles regarding the nature of superconductivity. The pairing state of the alkaline iron selenides appears to be of d-wave type based on the observation of a resonance mode in neutron scattering, while it seems to be of s-wave type from the nodeless gaps observed everywhere on the Fermi surface. Here we propose an orbital-selective pairing state, dubbed sτ3, as a natural explanation of these disparate properties. The pairing function, containing a matrix τ3 in the basis of 3d-electron orbitals, does not commute with the kinetic part of the Hamiltonian. This dictates the existence of both intraband and interband pairing terms in the band basis. A spin resonance arises from a d-wave-type sign change in the intraband pairing component, whereas the quasiparticle excitation is fully gapped on the FS due to an s-wave-like form factor associated with the addition in quadrature of the intraband and interband pairing terms. We demonstrate that this pairing state is energetically favored when the electron correlation effects are orbitally selective. More generally, our results illustrate how the multiband nature of correlated electrons affords unusual types of superconducting states, thereby shedding new light not only on the iron-based materials but also on a broad range of other unconventional superconductors such as heavy fermion and organic systems.
NASA Astrophysics Data System (ADS)
Fan, Cang; Liaw, P. K.; Wilson, T. W.; Choo, H.; Gao, Y. F.; Liu, C. T.; Proffen, Th.; Richardson, J. W.
2006-12-01
Contrary to reported results on structural relaxation inducing brittleness in amorphous alloys, the authors found that structural relaxation actually caused an increase in the strength of Zr55Cu35Al10 bulk metallic glass (BMG) without changing the plasticity. Three dimensional models were rebuilt for the as-cast and structurally relaxed BMGs by reverse Monte Carlo (RMC) simulations based on the pair distribution function (PDF) measured by neutron scattering. Only a small portion of the atom pairs was found to change to more dense packing. The concept of free volume was defined based on the PDF and RMC studies, and the mechanism of mechanical behavior was discussed.
Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.
Renneberg, Dorte; Dervan, Peter B
2003-05-14
The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.
Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey
2014-10-01
Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.
A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.
Sawada, Tomohisa; Fujita, Makoto
2010-05-26
Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.
Nascent life cycles and the emergence of higher-level individuality.
Ratcliff, William C; Herron, Matthew; Conlin, Peter L; Libby, Eric
2017-12-05
Evolutionary transitions in individuality (ETIs) occur when formerly autonomous organisms evolve to become parts of a new, 'higher-level' organism. One of the first major hurdles that must be overcome during an ETI is the emergence of Darwinian evolvability in the higher-level entity (e.g. a multicellular group), and the loss of Darwinian autonomy in the lower-level units (e.g. individual cells). Here, we examine how simple higher-level life cycles are a key innovation during an ETI, allowing this transfer of fitness to occur 'for free'. Specifically, we show how novel life cycles can arise and lead to the origin of higher-level individuals by (i) mitigating conflicts between levels of selection, (ii) engendering the expression of heritable higher-level traits and (iii) allowing selection to efficiently act on these emergent higher-level traits. Further, we compute how canonical early life cycles vary in their ability to fix beneficial mutations via mathematical modelling. Life cycles that lack a persistent lower-level stage and develop clonally are far more likely to fix 'ratcheting' mutations that limit evolutionary reversion to the pre-ETI state. By stabilizing the fragile first steps of an evolutionary transition in individuality, nascent higher-level life cycles may play a crucial role in the origin of complex life.This article is part of the themed issue 'Process and pattern in innovations from cells to societies'. © 2017 The Author(s).
An allosteric Sec61 inhibitor traps nascent transmembrane helices at the lateral gate
MacKinnon, Andrew L; Paavilainen, Ville O; Sharma, Ajay; Hegde, Ramanujan S; Taunton, Jack
2014-01-01
Membrane protein biogenesis requires the coordinated movement of hydrophobic transmembrane domains (TMD) from the cytosolic vestibule of the Sec61 channel into the lipid bilayer. Molecular insight into TMD integration has been hampered by the difficulty of characterizing intermediates during this intrinsically dynamic process. In this study, we show that cotransin, a substrate-selective Sec61 inhibitor, traps nascent TMDs in the cytosolic vestibule, permitting detailed interrogation of an early pre-integration intermediate. Site-specific crosslinking revealed the pre-integrated TMD docked to Sec61 near the cytosolic tip of the lateral gate. Escape from cotransin-arrest depends not only on cotransin concentration, but also on the biophysical properties of the TMD. Genetic selection of cotransin-resistant cancer cells uncovered multiple mutations clustered near the lumenal plug of Sec61α, thus revealing cotransin’s likely site of action. Our results suggest that TMD/lateral gate interactions facilitate TMD transfer into the membrane, a process that is allosterically modulated by cotransin binding to the plug. DOI: http://dx.doi.org/10.7554/eLife.01483.001 PMID:24497544
Been, M D; Perrotta, A T
1995-01-01
A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561
NASA Astrophysics Data System (ADS)
Yan, Xing-Yu; Gong, Li-Hua; Chen, Hua-Ying; Zhou, Nan-Run
2018-05-01
A theoretical quantum key distribution scheme based on random hybrid quantum channel with EPR pairs and GHZ states is devised. In this scheme, EPR pairs and tripartite GHZ states are exploited to set up random hybrid quantum channel. Only one photon in each entangled state is necessary to run forth and back in the channel. The security of the quantum key distribution scheme is guaranteed by more than one round of eavesdropping check procedures. It is of high capacity since one particle could carry more than two bits of information via quantum dense coding.
NASA Astrophysics Data System (ADS)
Chou, Jim-Son; Sumida, David S.; Wittig, C.
1985-02-01
PO (X 2Π) is produced via the collision-free infrared multiple photon dissociation (IRMPD) of volatile organophosphorous molecules, and is detected by two-frequency two-photon ionization, using the B 2Σ+ state to provide a spectral signature from which X 2Π populations are obtained. Sequential dissociations occur during the IR laser photolysis, in which nascent fragments continue to undergo IRMPD, and PO (X 2Π) accrues from a series of bond fission reactions. Nascent vibrational, rotational, and translational excitations are in sensible accord with this mechanism, except for a few rotational states near J=19.5. Unlike the nuclear degrees of freedom, the PO (X 2Π) spin-orbit states are populated quite selectively. The 2Π3/2 state, lying only 224 cm-1 above the 2Π1/2 ground state, contains only ˜11% of the population, compared to 34% for a 300 K sample. This result is unambiguous; it persists with all precursors, laser fluences, etc., and is verified by comparisons to spectra obtained using a microwave discharge, a flame, and when thermalizing nascent excitations with an inert diluent. This result underscores the importance of the separate potential surfaces which correlate to the product spin-orbit states, and the small amount of 2Π3/2 population can be accounted for by nonadiabatic coupling during dissociation, and/or ``freezing'' the amount of S1 character in an excited precursor in which S0 and S1 are coupled nonradiatively. We note that such electronic specificity should be dealt with in the analogous recombination reactions.
Kolinjivadi, Arun Mouli; Sannino, Vincenzo; De Antoni, Anna; Zadorozhny, Karina; Kilkenny, Mairi; Técher, Hervé; Baldi, Giorgio; Shen, Rong; Ciccia, Alberto; Pellegrini, Luca; Krejci, Lumir; Costanzo, Vincenzo
2017-09-07
Brca2 deficiency causes Mre11-dependent degradation of nascent DNA at stalled forks, leading to cell lethality. To understand the molecular mechanisms underlying this process, we isolated Xenopus laevis Brca2. We demonstrated that Brca2 protein prevents single-stranded DNA gap accumulation at replication fork junctions and behind them by promoting Rad51 binding to replicating DNA. Without Brca2, forks with persistent gaps are converted by Smarcal1 into reversed forks, triggering extensive Mre11-dependent nascent DNA degradation. Stable Rad51 nucleofilaments, but not RPA or Rad51 T131P mutant proteins, directly prevent Mre11-dependent DNA degradation. Mre11 inhibition instead promotes reversed fork accumulation in the absence of Brca2. Rad51 directly interacts with the Pol α N-terminal domain, promoting Pol α and δ binding to stalled replication forks. This interaction likely promotes replication fork restart and gap avoidance. These results indicate that Brca2 and Rad51 prevent formation of abnormal DNA replication intermediates, whose processing by Smarcal1 and Mre11 predisposes to genome instability. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Characterizing a Wake-Free Safe Zone for the Simplified Aircraft-Based Paired Approach Concept
NASA Technical Reports Server (NTRS)
Guerreiro, Nelson M.; Neitzke, Kurt W.; Johnson, Sally C.; Stough, H. Paul, III; McKissick, Burnell T.; Syed, Hazari I.
2010-01-01
The Federal Aviation Administration (FAA) has proposed a concept of operations geared towards achieving increased arrival throughput at U.S. Airports, known as the Simplified Aircraft-based Paired Approach (SAPA) concept. In this study, a preliminary characterization of a wake-free safe zone (WFSZ) for the SAPA concept has been performed. The experiment employed Monte-Carlo simulations of varying approach profiles by aircraft pairs to closely-spaced parallel runways. Three different runway lateral spacings were investigated (750 ft, 1000 ft and 1400 ft), along with no stagger and 1500 ft stagger between runway thresholds. The paired aircraft were flown in a leader/trailer configuration with potential wake encounters detected using a wake detection surface translating with the trailing aircraft. The WFSZ is characterized in terms of the smallest observed initial in-trail distance leading to a wake encounter anywhere along the approach path of the aircraft. The results suggest that the WFSZ can be characterized in terms of two primary altitude regions, in ground-effect (IGE) and out of ground-effect (OGE), with the IGE region being the limiting case with a significantly smaller WFSZ. Runway stagger was observed to only modestly reduce the WFSZ size, predominantly in the OGE region.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses
2002-01-01
An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638
Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes
Watkins, Norman E.; SantaLucia, John
2005-01-01
Nearest-neighbor thermodynamic parameters of the ‘universal pairing base’ deoxyinosine were determined for the pairs I·C, I·A, I·T, I·G and I·I adjacent to G·C and A·T pairs. Ultraviolet absorbance melting curves were measured and non-linear regression performed on 84 oligonucleotide duplexes with 9 or 12 bp lengths. These data were combined with data for 13 inosine containing duplexes from the literature. Multiple linear regression was used to solve for the 32 nearest-neighbor unknowns. The parameters predict the Tm for all sequences within 1.2°C on average. The general trend in decreasing stability is I·C > I·A > I·T ≈ I· G > I·I. The stability trend for the base pair 5′ of the I·X pair is G·C > C·G > A·T > T·A. The stability trend for the base pair 3′ of I·X is the same. These trends indicate a complex interplay between H-bonding, nearest-neighbor stacking, and mismatch geometry. A survey of 14 tandem inosine pairs and 8 tandem self-complementary inosine pairs is also provided. These results may be used in the design of degenerate PCR primers and for degenerate microarray probes. PMID:16264087
Thiry, Marc; Ploton, Dominique
2008-01-01
Here we describe a new, rapid method for isolating nucleoli from Ehrlich tumor cells that preserves their morphological integrity and high transcriptional activity. Until now, methods for isolation of nucleoli were generally assumed to empty one of their three main compartments, the fibrillar center, of its contents. This new method consists of sonicating cells in an isotonic medium containing MgSO(4), spermidine, and spermine, followed by separation of nucleoli through a Percoll density gradient. Using the nonisotopic approach of labelling with BrUTP, we have further investigated the dynamics of nascent ribosomal RNAs (rRNAs) within morphologically intact isolated nucleoli at the electron microscope level. We show that ribosomal transcripts are elongated in the cortex of the fibrillar center and then enter the surrounding dense fibrillar component.
Acid-induced exchange of the imino proton in G.C pairs.
Nonin, S; Leroy, J L; Gueron, M
1996-01-01
Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298
Acid-induced exchange of the imino proton in G.C pairs.
Nonin, S; Leroy, J L; Gueron, M
1996-02-15
Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.
Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.
Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M
1997-01-01
RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620
Multi-user distribution of polarization entangled photon pairs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trapateau, J.; Orieux, A.; Diamanti, E.
We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on themore » demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.« less
Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A
2018-06-22
Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.
Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G
To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.
Mondal Roy, Sutapa
2018-08-01
The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.
Error-correcting pairs for a public-key cryptosystem
NASA Astrophysics Data System (ADS)
Pellikaan, Ruud; Márquez-Corbella, Irene
2017-06-01
Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t-bounded decoding algorithms which is achieved in the case the code has a t-error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t-ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t-error correcting pair.
Akram, Pakeeza; Liao, Li
2017-12-06
Identification of common genes associated with comorbid diseases can be critical in understanding their pathobiological mechanism. This work presents a novel method to predict missing common genes associated with a disease pair. Searching for missing common genes is formulated as an optimization problem to minimize network based module separation from two subgraphs produced by mapping genes associated with disease onto the interactome. Using cross validation on more than 600 disease pairs, our method achieves significantly higher average receiver operating characteristic ROC Score of 0.95 compared to a baseline ROC score 0.60 using randomized data. Missing common genes prediction is aimed to complete gene set associated with comorbid disease for better understanding of biological intervention. It will also be useful for gene targeted therapeutics related to comorbid diseases. This method can be further considered for prediction of missing edges to complete the subgraph associated with disease pair.
Guo, Xiurong; Seela, Frank
2017-09-04
α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan
2014-01-10
Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.
Position-specific binding of FUS to nascent RNA regulates mRNA length
Masuda, Akio; Takeda, Jun-ichi; Okuno, Tatsuya; Okamoto, Takaaki; Ohkawara, Bisei; Ito, Mikako; Ishigaki, Shinsuke; Sobue, Gen
2015-01-01
More than half of all human genes produce prematurely terminated polyadenylated short mRNAs. However, the underlying mechanisms remain largely elusive. CLIP-seq (cross-linking immunoprecipitation [CLIP] combined with deep sequencing) of FUS (fused in sarcoma) in neuronal cells showed that FUS is frequently clustered around an alternative polyadenylation (APA) site of nascent RNA. ChIP-seq (chromatin immunoprecipitation [ChIP] combined with deep sequencing) of RNA polymerase II (RNAP II) demonstrated that FUS stalls RNAP II and prematurely terminates transcription. When an APA site is located upstream of an FUS cluster, FUS enhances polyadenylation by recruiting CPSF160 and up-regulates the alternative short transcript. In contrast, when an APA site is located downstream from an FUS cluster, polyadenylation is not activated, and the RNAP II-suppressing effect of FUS leads to down-regulation of the alternative short transcript. CAGE-seq (cap analysis of gene expression [CAGE] combined with deep sequencing) and PolyA-seq (a strand-specific and quantitative method for high-throughput sequencing of 3' ends of polyadenylated transcripts) revealed that position-specific regulation of mRNA lengths by FUS is operational in two-thirds of transcripts in neuronal cells, with enrichment in genes involved in synaptic activities. PMID:25995189
Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping
2016-02-22
We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.
McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F
2014-04-01
Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A
McCoy, Allison B.; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J.; Sittig, Dean F.
2014-01-01
Background Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. Objective We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. Approach We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Results Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of
An interatomic pair potential for cadmium selenide
NASA Astrophysics Data System (ADS)
Rabani, Eran
2002-01-01
We have developed a set of interatomic pair potentials for cadmium selenide based on a form similar to the Born-Mayer model. We show that this simple form of the pair potential, which has been used to describe the properties of alkali halides in the sixfold-coordinate structure, provides a realistic description of the properties of cadmium selenide in all three crystal structures: wurtzite, zinc blende, and rocksalt. Using the new pair potential we have studied the pressure-induced phase transition from the fourfold-coordinate wurtzite structure to the sixfold-coordinate rocksalt structure. The pressure transformation and the equation of state are in good agreement with experimental observations. Using the dispersion term in our pair potential we have also calculated the Hamaker constant for cadmium selenide within the framework of the original microscopic approach due to Hamaker. The results indicate that for ionic materials many-body terms that are included in the Lifshitz theory are well captured by the simple pair potential.
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric
2005-03-10
Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
AUCTSP: an improved biomarker gene pair class predictor.
Kagaris, Dimitri; Khamesipour, Alireza; Yiannoutsos, Constantin T
2018-06-26
The Top Scoring Pair (TSP) classifier, based on the concept of relative ranking reversals in the expressions of pairs of genes, has been proposed as a simple, accurate, and easily interpretable decision rule for classification and class prediction of gene expression profiles. The idea that differences in gene expression ranking are associated with presence or absence of disease is compelling and has strong biological plausibility. Nevertheless, the TSP formulation ignores significant available information which can improve classification accuracy and is vulnerable to selecting genes which do not have differential expression in the two conditions ("pivot" genes). We introduce the AUCTSP classifier as an alternative rank-based estimator of the magnitude of the ranking reversals involved in the original TSP. The proposed estimator is based on the Area Under the Receiver Operating Characteristic (ROC) Curve (AUC) and as such, takes into account the separation of the entire distribution of gene expression levels in gene pairs under the conditions considered, as opposed to comparing gene rankings within individual subjects as in the original TSP formulation. Through extensive simulations and case studies involving classification in ovarian, leukemia, colon, breast and prostate cancers and diffuse large b-cell lymphoma, we show the superiority of the proposed approach in terms of improving classification accuracy, avoiding overfitting and being less prone to selecting non-informative (pivot) genes. The proposed AUCTSP is a simple yet reliable and robust rank-based classifier for gene expression classification. While the AUCTSP works by the same principle as TSP, its ability to determine the top scoring gene pair based on the relative rankings of two marker genes across all subjects as opposed to each individual subject results in significant performance gains in classification accuracy. In addition, the proposed method tends to avoid selection of non-informative (pivot
NASA Astrophysics Data System (ADS)
Pinski, Peter; Neese, Frank
2018-01-01
Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
2004-01-01
With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests
Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M
2013-10-01
The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.
2018-01-01
Abstract Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element–target gene pairs (E–G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. PMID:29140525
Keepers, Joe W.; Kollman, Peter A.; Weiner, Paul K.; James, Thomas L.
1982-01-01
Molecular mechanics studies have been carried out on “B-DNA-like” structures of [d(C-G-C-G-A-A-T-T-C-G-C-G)]2 and [d(A)]12·[d(T)]12. Each of the backbone torsion angles (ψ, φ, ω, ω′, φ′) has been “forced” to alternative values from the normal B-DNA values (g+, t, g-, g-, t conformations). Compensating torsion angle changes preserve most of the base stacking energy in the double helix. In a second part of the study, one purine N3-pyrimidine N1 distance at a time has been forced to a value of 6 Å in an attempt to simulate the base opening motions required to rationalize proton exchange data for DNA. When the 6-Å constraint is removed, many of the structures revert to the normal Watson-Crick hydrogen-bonded structure, but a number are trapped in structures ≈5 kcal/mol higher in energy than the starting B-DNA structure. The relative energy of these structures, some of which involve a non-Watson-Crick thymine C2(carbonyl)[unk]adenine 6NH2 hydrogen bond, are qualitatively consistent with the ΔH for a “base pair-open state” suggested by Mandal et al. of 4-6 kcal/mol [Mandal, C., Kallenbach, N. R. & Englander, S. W. (1979) J. Mol. Biol. 135, 391-411]. The picture of DNA flexibility emerging from this study depicts the backbone as undergoing rapid motion between local torsional minima on a nanosecond time scale. Backbone motion is mainly localized within a dinucleoside segment and generally not conformationally coupled along the chain or across the base pairs. Base motions are much smaller in magnitude than backbone motions. Base sliding allows imino N—H exchange, but it is localized, and only a small fraction of the N—H groups is exposed at any one time. Stacking and hydrogen bonding cause a rigid core of bases in the center of the molecule accounting for the hydrodynamic properties of DNA. PMID:6957879
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Ponderomotive effects in multiphoton pair production
NASA Astrophysics Data System (ADS)
Kohlfürst, Christian; Alkofer, Reinhard
2018-02-01
The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.
Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions
NASA Astrophysics Data System (ADS)
Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang
2018-01-01
We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
NASA Astrophysics Data System (ADS)
Gajewski, Andrzej; Kolenderski, Piotr L.
2016-10-01
There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the
Ma, Wenbin; Zhang, Yi; Vigneron, Nathalie; Stroobant, Vincent; Thielemans, Kris; van der Bruggen, Pierre; Van den Eynde, Benoît J
2016-02-15
Cross-presentation enables dendritic cells to present on their MHC class I molecules antigenic peptides derived from exogenous material, through a mechanism that remains partly unclear. It is particularly efficient with long peptides, which are used in cancer vaccines. We studied the mechanism of long-peptide cross-presentation using human dendritic cells and specific CTL clones against melanoma Ags gp100 and Melan-A/MART1. We found that cross-presentation of those long peptides does not depend on the proteasome or the transporter associated with Ag processing, and therefore follows a vacuolar pathway. We also observed that it makes use of newly synthesized MHC class I molecules, through peptide exchange in vesicles distinct from the endoplasmic reticulum and classical secretory pathway, in an SEC22b- and CD74-independent manner. Our results indicate a nonclassical secretion pathway followed by nascent HLA-I molecules that are used for cross-presentation of those long melanoma peptides in the vacuolar pathway. Our results may have implications for the development of vaccines based on long peptides. Copyright © 2016 by The American Association of Immunologists, Inc.
Experimental many-pairs nonlocality
NASA Astrophysics Data System (ADS)
Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian
2017-08-01
Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.
A Macroscopic Analogue of the Nuclear Pairing Potential
ERIC Educational Resources Information Center
Dunlap, Richard A.
2013-01-01
A macroscopic system involving permanent magnets is used as an analogue to nucleons in a nucleus to illustrate the significance of the pairing interaction. This illustrates that the view of the total nuclear energy based only on the nucleon occupancy of the energy levels can yield erroneous results and it is only when the pairing interaction is…
Introducing Hurst exponent in pair trading
NASA Astrophysics Data System (ADS)
Ramos-Requena, J. P.; Trinidad-Segovia, J. E.; Sánchez-Granero, M. A.
2017-12-01
In this paper we introduce a new methodology for pair trading. This new method is based on the calculation of the Hurst exponent of a pair. Our approach is inspired by the classical concepts of co-integration and mean reversion but joined under a unique strategy. We will show how Hurst approach presents better results than classical Distance Method and Correlation strategies in different scenarios. Results obtained prove that this new methodology is consistent and suitable by reducing the drawdown of trading over the classical ones getting as a result a better performance.
1988-01-01
Biotinylated nucleotides (bio-11-dCTP, bio-11-dUTP, and bio-7-dATP) were microinjected into unfertilized and fertilized Xenopus laevis eggs. The amounts introduced were comparable to in vivo deoxy- nucleoside triphosphate pools. At various times after microinjection, DNA was extracted from eggs or embryos and subjected to electrophoresis on agarose gels. Newly synthesized biotinylated DNA was analyzed by Southern transfer and visualized using either the BluGENE or Detek-hrp streptavidin-based nucleic acid detection systems. Quantitation of the amount of biotinylated DNA observed at various times showed that the microinjected biotinylated nucleotides were efficiently incorporated in vivo, both into replicating endogenous chromosomal DNA and into replicating microinjected exogenous plasmid DNA. At least one biotinylated nucleotide could be incorporated in vivo for every eight nucleotides of DNA synthesized. Control experiments also showed that heavily biotinylated DNA was not subjected to detectable DNA repair during early embryogenesis (for at least 5 h after activation of the eggs). The incorporated biotinylated nucleotides were visualized by electron microscopy by using streptavidin-colloidal gold or streptavidin-ferritin conjugates to bind specifically to the biotin groups projecting from the newly replicated DNA. The incorporated biotinylated nucleotides were thus made visible as electron-dense spots on the underlying DNA molecules. Biotinylated nucleotides separated by 20-50 bases could be resolved. We conclude that nascent DNA synthesized in vivo in Xenopus laevis eggs can be visualized efficiently and specifically using the techniques described. PMID:3392102
Cross, Sheree E; Thompson, Melanie J; Roberts, Michael S
2003-02-01
As reductions in dermal clearance increase the residence time of solutes in the skin and underlying tissues we compared the topical penetration of potentially useful vasoconstrictors (VCs) through human epidermis as both free bases and ion-pairs with salicylic acid (SA). We determined the in vitro epidermal flux of ephedrine, naphazoline, oxymetazoline, phenylephrine, and xylometazoline applied as saturated solutions in propylene glycol:water (1:1) and of ephedrine, naphazoline and tetrahydrozoline as 10% solutions of 1:1 molar ratio ion-pairs with SA in liquid paraffin. As free bases, ephedrine had the highest maximal flux, Jmax = 77.4 +/- 11.7 microg/cm2/h, being 4-fold higher than tetrahydrozoline and xylometazoline, 6-fold higher than phenylephrine, 10-fold higher than naphazoline and 100-fold higher than oxymetazoline. Stepwise regression of solute physicochemical properties identified melting point as the most significant predictor of flux. As ion-pairs with SA, ephedrine and naphazoline had similar fluxes (11.5 +/- 2.3 and 12.0 +/- 1.6 microg/cm2/h respectively), whereas tetrahydrozoline was approximately 3-fold slower. Corresponding fluxes of SA from the ion-pairs were 18.6 +/- 0.6, 7.8+/- 0.8 and 1.1 +/- 0.1 respectively. Transdermal transport of VC's is discussed. Epidermal retention of VCs and SA did not correspond to their molar ratio on application and confirmed that following partitioning into the stratum corneum, ion-pairs separate and further penetration is governed by individual solute characteristics.
Life Detection Using Glucose and Tetrasaccharide Enantiomer Pairs
NASA Astrophysics Data System (ADS)
Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E.
2009-04-01
A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 × 107 cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 × 107 cells/ml or better for the glucose pair and 5.0 × 108 cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.
Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R
1998-09-23
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.
Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.
2005-01-01
The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections
ERIC Educational Resources Information Center
Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.
2007-01-01
The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…
Hughes, J M
1996-06-21
The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.
Dyllick-Brenzinger, C; Sullivan, G R; Pang, P P; Roberts, J D
1980-01-01
The self-association of guanosine, cytidine, and adenosine and base pairing between guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide have been investigated by the variation of their 15N NMR chemical shifts with concentration and temperature. Guanosine, cytidine, and adenosine all showed evidence of self-association by hydrogen bonding. In guanosine/cytidine mixtures, a hydrogen-bonded dimer is formed; however, no base pairing could be detected with adenosine/cytidine or adenosine/uridine mixtures. PMID:6932658
Seismic Imaging of a Nascent Batholith in the Central Andes
NASA Astrophysics Data System (ADS)
Ward, K. M.; Zandt, G.; Beck, S. L.; Christensen, D. H.; Mcfarlin, H. L.
2013-12-01
Cordilleran mountain belts, such as the modern central Andes and Mesozoic western North American Cordillera formed in regions of significant upper plate compression and were punctuated by high flux magmatic events that coalesced into large composite batholiths. Unlike the North American Cordillera, compressive mountain building is still active in the central Andes and any large modern batholith still at depth must be inferred from surface volcanics and geophysical data. In the Andes it has been suggested that a modern batholith exists beneath the Altiplano-Puna Volcanic Complex (APVC), the location of a 11-1 Ma ignimbrite flare-up, however, the magmatic underpinnings has only been geophysically investigated in a few widely spaced locations and a migmatite zone of crustal melt with minimal mantle input remains a viable competing interpretation. We present new high-resolution 3-D seismic images of the APVC crust based on a joint inversion of ambient noise surface-wave dispersion data and receiver functions from broadband stations and identify a shallow (<20 km depth) low-velocity body that we interpret as a magmatic mush zone, the Altiplano-Puna Mush Body (APMB). Below the APMB, we observe near-vertical zones of low velocity that bifurcate near the base of the crust with one arm of low velocity migrating under the main volcanic arc and a second separate arm of low velocity below the voluminous backarc volcanism. Previous attenuation tomography studies have traced these zones through the mantle where they intersect the top of the subducting Nazca slab at locations with elevated seismic activity, providing strong evidence that the deeper near-vertical zones of low velocity we are imaging are related to dewatering of the slab and associated mantle-sourced melt pathways. Based on these considerations, we suggest the ~200 km diameter and ~20 km thick body is a nascent silicic batholith compatible with the magma mush model of batholith formation. The direct imaging of this
Graph-based surface reconstruction from stereo pairs using image segmentation
NASA Astrophysics Data System (ADS)
Bleyer, Michael; Gelautz, Margrit
2005-01-01
This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.
Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng
2015-03-28
A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).
Guo, Liyuan; Wang, Jing
2018-01-04
Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
Jalili, Seifollah; Karami, Leila; Schofield, Jeremy
2013-06-01
Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.
Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair
Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda
2015-01-01
An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology. PMID:26703625
Constance, William D; Mukherjee, Amrita; Fisher, Yvette E; Pop, Sinziana; Blanc, Eric; Toyama, Yusuke
2018-01-01
Building arborisations of the right size and shape is fundamental for neural network function. Live imaging in vertebrate brains strongly suggests that nascent synapses are critical for branch growth during development. The molecular mechanisms underlying this are largely unknown. Here we present a novel system in Drosophila for studying the development of complex arborisations live, in vivo during metamorphosis. In growing arborisations we see branch dynamics and localisations of presynaptic proteins very similar to the ‘synaptotropic growth’ described in fish/frogs. These accumulations of presynaptic proteins do not appear to be presynaptic release sites and are not paired with neurotransmitter receptors. Knockdowns of either evoked or spontaneous neurotransmission do not impact arbor growth. Instead, we find that axonal branch growth is regulated by dynamic, focal localisations of Neurexin and Neuroligin. These adhesion complexes provide stability for filopodia by a ‘stick-and-grow’ based mechanism wholly independent of synaptic activity. PMID:29504935
Pair-correlations in swimmer suspensions
NASA Astrophysics Data System (ADS)
Nambiar, Sankalp; Subramanian, Ganesh
2017-11-01
Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r << L to a far-field decay of O(1/r2) for r >> L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.
Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D
1984-06-19
The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George
2013-01-01
SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Life detection using glucose and tetrasaccharide enantiomer pairs.
Warmflash, David; Chu, Huanyi; Siefert, Johnathan; Fox, George E
2009-04-01
A life-detection system based on the expectation that any viable organism will utilize stereoisomers of a given compound asymmetrically is examined. Aqueous extracts of common soil, Mars regolith simulant JSC Mars-1, and suspensions of E. coli and S. cerevisiae were incubated with stereoisomer pairs. The enantiomeric pairs were either D- and L-glucose or a pair of chiral tetrasaccharides. Following an incubation period of 10 days, stereoisomeric selectivity is detectable with the glucose pair by mass spectrometry in extracts made from soil at 0.5 g/ml, in extracts made from JSC Mars-1 at 2.5 g/ml, and in cell suspensions down to 1.0 x 10(7) cells/ml. For the tetrasaccharide pair, stereoisomeric selectivity was detected in extracts made from 0.5 g/ml or more of common soil but not in JSC Mars-1 simulant. The effective sensitivity in extracts was 2.5 x 10(7) cells/ml or better for the glucose pair and 5.0 x 10(8) cells/ml or better for the tetrasaccharide pair. The sensitivity of the glucose pair was such that it could detect life in samples that would be found to be devoid of organic matter by the GCMS system carried by the Viking landers. The results demonstrate the utility of the approach in the search for biological activity on Mars. However, sensitivity is a function of the enantiomer pair used, and this might also be different for hypothetical martian organisms. Therefore, it will be necessary to characterize additional stereoisomeric pairs and, ultimately, to include several in a single test environment.
Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul
2012-11-01
Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.
Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs
2016-01-01
Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general. PMID:27195654
ReLiance: a machine learning and literature-based prioritization of receptor—ligand pairings
Iacucci, Ernesto; Tranchevent, Léon-Charles; Popovic, Dusan; Pavlopoulos, Georgios A.; De Moor, Bart; Schneider, Reinhard; Moreau, Yves
2012-01-01
Motivation: The prediction of receptor—ligand pairings is an important area of research as intercellular communications are mediated by the successful interaction of these key proteins. As the exhaustive assaying of receptor—ligand pairs is impractical, a computational approach to predict pairings is necessary. We propose a workflow to carry out this interaction prediction task, using a text mining approach in conjunction with a state of the art prediction method, as well as a widely accessible and comprehensive dataset. Among several modern classifiers, random forests have been found to be the best at this prediction task. The training of this classifier was carried out using an experimentally validated dataset of Database of Ligand-Receptor Partners (DLRP) receptor—ligand pairs. New examples, co-cited with the training receptors and ligands, are then classified using the trained classifier. After applying our method, we find that we are able to successfully predict receptor—ligand pairs within the GPCR family with a balanced accuracy of 0.96. Upon further inspection, we find several supported interactions that were not present in the Database of Interacting Proteins (DIPdatabase). We have measured the balanced accuracy of our method resulting in high quality predictions stored in the available database ReLiance. Availability: http://homes.esat.kuleuven.be/~bioiuser/ReLianceDB/index.php Contact: yves.moreau@esat.kuleuven.be; ernesto.iacucci@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22962483
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.
Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F
2016-04-19
What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.
Grandmothering life histories and human pair bonding.
Coxworth, James E; Kim, Peter S; McQueen, John S; Hawkes, Kristen
2015-09-22
The evolution of distinctively human life history and social organization is generally attributed to paternal provisioning based on pair bonds. Here we develop an alternative argument that connects the evolution of human pair bonds to the male-biased mating sex ratios that accompanied the evolution of human life history. We simulate an agent-based model of the grandmother hypothesis, compare simulated sex ratios to data on great apes and human hunter-gatherers, and note associations between a preponderance of males and mate guarding across taxa. Then we explore a recent model that highlights the importance of mating sex ratios for differences between birds and mammals and conclude that lessons for human evolution cannot ignore mammalian reproductive constraints. In contradiction to our claim that male-biased sex ratios are characteristically human, female-biased ratios are reported in some populations. We consider the likelihood that fertile men are undercounted and conclude that the mate-guarding hypothesis for human pair bonds gains strength from explicit links with our grandmothering life history.
1982-05-01
including multidimensional scaling. Applications have arisen in many areas, but most notably in food technolog, marketing research, and sports ... competition .- An extensive bibliography on paired comparisons by Davidson and Farquhar (1976) contains some 400 references. - Paired comparisons have been...consideration of chess competition . Ford (1957) pro- posed the model independently. Both Zermelo and Ford concentrated on solution of normal equations for
NASA Astrophysics Data System (ADS)
Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki
2013-04-01
We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.
Liao, Hongwei; Ji, Fang; Geng, Xinwei; Xing, Meichun; Li, Wen; Chen, Zhihua; Shen, Huahao; Ying, Songmin
2017-01-01
Cyclin dependent kinase 1 (CDK1) is essential for cell viability and plays a vital role in many biological events including cell cycle control, DNA damage repair, and checkpoint activation. Here, we identify an unanticipated role for CDK1 in promoting nascent DNA synthesis during S-phase. We report that a short duration of CDK1 inhibition, which does not perturb cell cycle progression, triggers a replication-associated DNA damage response (DDR). This DDR is associated with a disruption of replication fork progression and leads to genome instability. Moreover, we show that compromised CDK1 activity dramatically increases the efficacy of chemotherapeutic agents that kill cancer cells through perturbing DNA replication, including Olaparib, an FDA approved PARP inhibitor. Our study has revealed an important role for CDK1 in the DNA replication program, and suggests that the therapeutic targeting CDK1 may be a novel approach for combination chemotherapy. PMID:29207595
Savic, Velibor
2013-01-01
In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions.
Zhou, Ru; Zhong, Dexing; Han, Jiuqiang
2013-01-01
The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT) descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1) the similar patterns of parallel ridges; and (2) high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD) to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM), is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA) achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements. PMID:23467056
Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system
NASA Astrophysics Data System (ADS)
Jiang, Cheng; Chen, Bin; Li, Jin-Jin; Zhu, Ka-Di
2011-10-01
Nanomechanical resonators (NRs) with very high frequency have a great potential for mass sensing with unprecedented sensitivity. In this study, we propose a scheme for mass sensing based on the NR capacitively coupled to a Cooper-pair box (CPB) driven by two microwave currents. The accreted mass landing on the resonator can be measured conveniently by tracking the resonance frequency shifts because of mass changes in the signal absorption spectrum. We demonstrate that frequency shifts induced by adsorption of ten 1587 bp DNA molecules can be well resolved in the absorption spectrum. Integration with the CPB enables capacitive readout of the mechanical resonance directly on the chip.
Additional hydrogen bonds and base-pair kinetics in the symmetrical AMP-DNA aptamer complex.
Nonin-Lecomte, S; Lin, C H; Patel, D J
2001-01-01
The solution structure of an adenosine monophosphate (AMP)-DNA aptamer complex has been determined previously [Lin, C. H., and Patel, D. J. (1997) Chem. Biol. 4:817-832]. On a symmetrical aptamer complex containing the same binding loop, but with better resolved spectra, we have identified two additional hydrogen bond-mediated associations in the binding loop. One of these involves a rapidly exchanging G imino proton. The phosphate group of the AMP ligand was identified as the acceptor by comparison with other aptamer complexes. Imino proton exchange measurements also yielded the dissociation constants of the stem and binding loop base pairs. This study shows that nuclear magnetic resonance-based imino proton exchange is a good probe for detection of weak hydrogen-bond associations. PMID:11721004
Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt
1998-01-01
This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668
Terminal Area Procedures for Paired Runways
NASA Technical Reports Server (NTRS)
Lozito, Sandy
2011-01-01
Parallel Runway operations have been found to increase capacity within the National Airspace (NAS) however, poor visibility conditions reduce this capacity [1]. Much research has been conducted to examine the concepts and procedures related to parallel runways however, there has been no investigation of the procedures associated with the strategic and tactical pairing of aircraft for these operations. This study developed and examined the pilot and controller procedures and information requirements for creating aircraft pairs for parallel runway operations. The goal was to achieve aircraft pairing with a temporal separation of 15s(+/- 10s error) at a coupling point that is about 12 nmi from the runway threshold. Two variables were explored for the pilot participants: Two levels of flight deck automation (current-day flight deck automation, and a prototype future automation) as well as two flight deck displays that assisted in pilot conformance monitoring. The controllers were also provided with automation to help create and maintain aircraft pairs. Data showed that the operations in this study were found to be acceptable and safe. Workload when using the pairing procedures and tools was generally low for both controllers and pilots, and situation awareness (SA) was typically moderate to high. There were some differences based upon the display and automation conditions for the pilots. Future research should consider the refinement of the concepts and tools for pilot and controller displays and automation for parallel runway concepts.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
Practical sliced configuration spaces for curved planar pairs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sacks, E.
1999-01-01
In this article, the author presents a practical configuration-space computation algorithm for pairs of curved planar parts, based on the general algorithm developed by Bajaj and the author. The general algorithm advances the theoretical understanding of configuration-space computation, but is too slow and fragile for some applications. The new algorithm solves these problems by restricting the analysis to parts bounded by line segments and circular arcs, whereas the general algorithm handles rational parametric curves. The trade-off is worthwhile, because the restricted class handles most robotics and mechanical engineering applications. The algorithm reduces run time by a factor of 60 onmore » nine representative engineering pairs, and by a factor of 9 on two human-knee pairs. It also handles common special pairs by specialized methods. A survey of 2,500 mechanisms shows that these methods cover 90% of pairs and yield an additional factor of 10 reduction in average run time. The theme of this article is that application requirements, as well as intrinsic theoretical interest, should drive configuration-space research.« less
Two-photon production of dilepton pairs in peripheral heavy ion collisions
NASA Astrophysics Data System (ADS)
Klein, Spencer R.
2018-05-01
The STAR collaboration has observed an excess production of e+e- pairs in relativistic heavy ion collisions, over the expectations from hadronic production models. The excess pairs have transverse momenta pT<150 MeV /c and are most prominent in peripheral gold-gold and uranium-uranium collisions. The pairs exhibit a peak at the J /ψ mass, but include a wide continuum, with pair invariant masses from 400 MeV/c 2 up to 2.6 GeV/c 2 . The ALICE Collaboration observes a similar excess in peripheral lead-lead collisions, but only at the J /ψ mass, without a corresponding continuum. This paper presents a calculation of the cross section and kinematic for two-photon production of e+e- pairs, and find general agreement with the STAR data. The calculation is based on the starlight simulation code, which is based on the Weizsäcker-Williams virtual photon approach. The STAR continuum observations are compatible with two-photon production of e+e- pairs. The ALICE analysis required individual muon pT be greater than 1 GeV/c; this eliminated almost all of the pairs from two-photon interactions, while leaving most of the J /ψ decays.
The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis
Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert
2015-01-01
During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414
Simplified Aircraft-Based Paired Approach: Concept Definition and Initial Analysis
NASA Technical Reports Server (NTRS)
Johnson, Sally C.; Lohr, Gary W.; McKissick, Burnell T.; Abbott, Terence S.; Geurreiro, Nelson M.; Volk, Paul
2013-01-01
Simplified Aircraft-based Parallel Approach (SAPA) is an advanced concept proposed by the Federal Aviation Administration (FAA) to support dependent parallel approach operations to runways with lateral spacing closer than 2500 ft. At the request of the FAA, NASA performed an initial assessment of the potential performance and feasibility of the SAPA concept, including developing and assessing an operational implementation of the concept and conducting a Monte Carlo wake simulation study to examine the longitudinal spacing requirements. The SAPA concept was shown to have significant operational advantages in supporting the pairing of aircraft with dissimilar final approach speeds. The wake simulation study showed that support for dissimilar final approach speeds could be significantly enhanced through the use of a two-phased altitudebased longitudinal positioning requirement, with larger longitudinal positioning allowed for higher altitudes out of ground effect and tighter longitudinal positioning defined for altitudes near and in ground effect. While this assessment is preliminary and there are a number of operational issues still to be examined, it has shown the basic SAPA concept to be technically and operationally feasible.
Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P
2018-05-01
The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.
NASA Astrophysics Data System (ADS)
Fyta, Maria; Netz, Roland R.
2012-03-01
Using molecular dynamics (MD) simulations in conjunction with the SPC/E water model, we optimize ionic force-field parameters for seven different halide and alkali ions, considering a total of eight ion-pairs. Our strategy is based on simultaneous optimizing single-ion and ion-pair properties, i.e., we first fix ion-water parameters based on single-ion solvation free energies, and in a second step determine the cation-anion interaction parameters (traditionally given by mixing or combination rules) based on the Kirkwood-Buff theory without modification of the ion-water interaction parameters. In doing so, we have introduced scaling factors for the cation-anion Lennard-Jones (LJ) interaction that quantify deviations from the standard mixing rules. For the rather size-symmetric salt solutions involving bromide and chloride ions, the standard mixing rules work fine. On the other hand, for the iodide and fluoride solutions, corresponding to the largest and smallest anion considered in this work, a rescaling of the mixing rules was necessary. For iodide, the experimental activities suggest more tightly bound ion pairing than given by the standard mixing rules, which is achieved in simulations by reducing the scaling factor of the cation-anion LJ energy. For fluoride, the situation is different and the simulations show too large attraction between fluoride and cations when compared with experimental data. For NaF, the situation can be rectified by increasing the cation-anion LJ energy. For KF, it proves necessary to increase the effective cation-anion Lennard-Jones diameter. The optimization strategy outlined in this work can be easily adapted to different kinds of ions.
Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs
NASA Astrophysics Data System (ADS)
Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.
2018-02-01
For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.
Schwalb, Nina K; Michalak, Thomas; Temps, Friedrich
2009-12-24
The optically excited electronic states of hydrogen-bonded homo- and heterodimers of guanosine (G) and deoxycytidine (C) were investigated by femtosecond fluorescence up-conversion spectroscopy. The base pairs were prepared in CHCl(3) solution by employing tert-butyldimethylsilyl (TBDMS) groups at the OH positions of the ribose (G) or deoxyribose (C) moieties to enhance the solubilities of the nucleosides in organic solvents. The H-bonded complexes that were obtained were characterized by FTIR spectroscopy. Fluorescence lifetime measurements were performed following electronic excitation at a series of UV wavelengths from lambda(pump) = 294 nm, close to the electronic origins of the bases, to lambda(pump) = 262 nm, where significant excess vibronic energy is deposited in the molecules, at nucleoside concentrations of c(0) = 0.1 and 1.0 mM. The experimental results revealed the existence of an ultrafast deactivation pathway for the optically prepared electronically excited state(s) of the G.C Watson-Crick base pair, which was found to have a lifetime of tau(GC) = 0.30(3) ps (with 2sigma error limits) irrespective of the pump wavelength. A similar short decay time, tau(GG) = 0.32(2) ps, was observed for the respective excited G.G homodimer. In contrast, the excited G monomer displayed a significantly longer-lived and wavelength-dependent deactivation, requiring three time constants, between 0.43(6) ps < or = tau(G,1) < or = 1.2(1) ps, 4.2(8) ps < or = tau(G,2) < or = 8(1) ps, and tau(G,3) = 195(32) ps. Self-complexation of C, on the other hand, led to a longer-lived excited state with a lifetime estimated between 1 ps < or = tau(CC) < or = 10 ps, compared to the dominant initial subpicosecond decay time of the C monomer of tau(C,1) = 0.80(4) ps.
Pair-instability supernovae of fast rotating stars
NASA Astrophysics Data System (ADS)
Chen, Ke-Jung
2015-01-01
We present 2D simulations of pair-instability supernovae considering rapid rotation during their explosion phases. Recent studies of the Population III (Pop III) star formation suggested that these stars could be born with a mass scale about 100 M⊙ and with a strong rotation. Based on stellar evolution models, these massive Pop III stars might have died as highly energetic pair-instability supernovae. We perform 2D calculations to investigate the impact of rotation on pair-instability supernovae. Our results suggest that rotation leads to an aspherical explosion due to an anisotropic collapse. If the first stars have a 50% of keplerian rotational rate of the oxygen core before their pair-instability explosions, the overall 56Ni production can be significantly reduced by about two orders of magnitude. An extreme case of 100% keplerian rotational rate shows an interesting feature of fluid instabilities along the equatorial plane caused by non-synchronized and non-isotropic ignitions of explosions, so that the shocks run into the in-falling gas and generate the Richtmyer-Meshkov instability.
The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections
Solberg, Katherine M; Hanley, Gregory P; Layer, Stacy A; Ingvarsson, Einar T
2007-01-01
The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once the snack paired with reinforcement was selected most frequently, the three types of reinforcement were systematically faded. Frequent selections of the previously less preferred snack option were produced with paired reinforcement, but were disrupted for all children as the paired reinforcement was reduced to low levels. These data showed that paired reinforcement was initially effective in increasing preference for the originally less preferred snack options, but more permanent changes in the value of the snack options were not achieved. Conditions for producing persistent changes in children's snack choices are discussed. PMID:18189095
biobambam: tools for read pair collation based algorithms on BAM files
2014-01-01
Background Sequence alignment data is often ordered by coordinate (id of the reference sequence plus position on the sequence where the fragment was mapped) when stored in BAM files, as this simplifies the extraction of variants between the mapped data and the reference or of variants within the mapped data. In this order paired reads are usually separated in the file, which complicates some other applications like duplicate marking or conversion to the FastQ format which require to access the full information of the pairs. Results In this paper we introduce biobambam, a set of tools based on the efficient collation of alignments in BAM files by read name. The employed collation algorithm avoids time and space consuming sorting of alignments by read name where this is possible without using more than a specified amount of main memory. Using this algorithm tasks like duplicate marking in BAM files and conversion of BAM files to the FastQ format can be performed very efficiently with limited resources. We also make the collation algorithm available in the form of an API for other projects. This API is part of the libmaus package. Conclusions In comparison with previous approaches to problems involving the collation of alignments by read name like the BAM to FastQ or duplication marking utilities our approach can often perform an equivalent task more efficiently in terms of the required main memory and run-time. Our BAM to FastQ conversion is faster than all widely known alternatives including Picard and bamUtil. Our duplicate marking is about as fast as the closest competitor bamUtil for small data sets and faster than all known alternatives on large and complex data sets.
James Valles
2017-12-09
Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.Â
A chaotic micromixer using obstruction-pairs
NASA Astrophysics Data System (ADS)
Park, Jang Min; Duck Seo, Kyoung; Kwon, Tai Hun
2010-01-01
A micromixer is one of the most important components for a chemical and/or diagnostic analysis in microfluidic devices such as a micro-total-analysis-system and a lab-on-a-chip. In this paper, a novel chaotic micromixer is developed in a simple design by introducing obstruction-pairs on the bottom of a microchannel. An obstruction-pair, which is composed of two hexahedron blocks arranged in an asymmetric manner, can induce a rotational flow along the down-channel direction due to the anisotropy of flow resistance. By utilizing this characteristic of the obstruction-pair, four mixing units are designed in such a way that three obstruction-pairs induce three rotational flows which result in a down-welling and a hyperbolic point in the channel cross-section. There can be a variety of micromixer geometries by arranging the mixing units in various sequences along the microchannel, and their mixing performances will differ from each other due to different flow characteristics. In this regard, numerical investigations are carried out to predict and characterize the mixing performances of various micromixers. Also experimental verifications are carried out by a flow visualization technique using phenolphthalein and sodium hydroxide solutions in a polydimethylsiloxane-based micromixer.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.
Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D
2014-05-01
The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.
A Metacognitive Approach to Pair Programming: Influence on Metacognitive Awareness
ERIC Educational Resources Information Center
Breed, Betty; Mentz, Elsa; van der Westhuizen, Gert
2014-01-01
Introduction: The research focused on metacognition in a collaborative learning setting. Based on a comprehensive literature study the researchers designed a metacognitive teaching-learning strategy for pair programmers. Our purpose was to investigate the influence of this metacognitive teaching-learning strategy during pair programming in an…
Fung, J C; Marshall, W F; Dernburg, A; Agard, D A; Sedat, J W
1998-04-06
The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less
Updates on Pairing Issues with the US Antarctic Meteorite Collection
NASA Technical Reports Server (NTRS)
Righter, K.; Satterwhite, C.; Schutt, J.
2015-01-01
The US Antarctic meteorite program has re-covered >21,000 meteorites since 1976, with thousands of those recovered from several icefields over multiple seasons, some-times spanning over a decade [1]. Pairing is assigned as best as possible at the time of classification, based on information from the field team, macro-scale hand sample features in the lab, and petrography, but later focused studies can reveal details that suggest re-evaluation of pairing groups. As a result, pairing groups are revealed over time, and must be continuously updated. Here we examine a few groups with known issues and give an update on some of the larger or more significant pairing groups.
Understanding Fomalhaut as a Cooper pair
NASA Astrophysics Data System (ADS)
Feng, F.; Jones, H. R. A.
2018-03-01
Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.
A Comparison of the Results of Many-Facet Rasch Analyses Based on Crossed and Judge Pair Designs
ERIC Educational Resources Information Center
Ilhan, Mustafa
2016-01-01
The aim of this study was to compare the results of many-facet Rasch analyses based on crossed and judge pair designs. The study was conducted with 168 eighth grade students and five judges. The study data were collected using an achievement test with open-ended questions and a holistic rubric that was used to rate the responses. In the data…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koiller, Jair; Boatto, Stefanella
2009-05-06
A pair of infinitesimally close opposite vortices moving on a curved surface moves along a geodesic, according to a conjecture by Kimura. We outline a proof. Numerical simulations are presented for a pair of opposite vortices at a close but nonzero distance on a surface of revolution, the catenoid. We conjecture that the vortex pair system on a triaxial ellipsoid is a KAM perturbation of Jacobi's geodesic problem. We outline some preliminary calculations required for this study. Finding the surfaces for which the vortex pair system is integrable is in order.
Savic, Velibor
2013-01-01
In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions. PMID:23882282
Sequence-similar, structure-dissimilar protein pairs in the PDB.
Kosloff, Mickey; Kolodny, Rachel
2008-05-01
It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We
Strongly exchange-coupled triplet pairs in an organic semiconductor
NASA Astrophysics Data System (ADS)
Weiss, Leah R.; Bayliss, Sam L.; Kraffert, Felix; Thorley, Karl J.; Anthony, John E.; Bittl, Robert; Friend, Richard H.; Rao, Akshay; Greenham, Neil C.; Behrends, Jan
2017-02-01
From biological complexes to devices based on organic semiconductors, spin interactions play a key role in the function of molecular systems. For instance, triplet-pair reactions impact operation of organic light-emitting diodes as well as photovoltaic devices. Conventional models for triplet pairs assume they interact only weakly. Here, using electron spin resonance, we observe long-lived, strongly interacting triplet pairs in an organic semiconductor, generated via singlet fission. Using coherent spin manipulation of these two-triplet states, we identify exchange-coupled (spin-2) quintet complexes coexisting with weakly coupled (spin-1) triplets. We measure strongly coupled pairs with a lifetime approaching 3 μs and a spin coherence time approaching 1 μs, at 10 K. Our results pave the way for the utilization of high-spin systems in organic semiconductors.
Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G
1995-01-01
A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070
Universal quantum gates for Single Cooper Pair Box based quantum computing
NASA Technical Reports Server (NTRS)
Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.
2000-01-01
We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.
Wang, Qian; Xie, Xiao-Ying; Han, Juan; Cui, Ganglong
2017-11-22
Semisynthetic alphabet can potentially increase the genetic information stored in DNA through the formation of unusual base pairs such as d5SICS:dNaM. However, recent experiments show that near-visible-light irradiation on the d5SICS and dNaM chromophores could lead to genetic mutations and damages. Until now, their photophysical mechanisms remain elusive. Herein, we have employed MS-CASPT2//CASSCF and QM(MS-CASPT2//CASSCF)/MM methods to explore the spectroscopic properties and excited-state relaxation mechanisms of d5SICS, dNaM, and d5SICS:dNaM in DNA. We have found that (1) the S 2 state of d5SICS, the S 1 state of dNaM, and the S 2 state of d5SICS:dNaM are initially populated upon near-visible-light irradiation and (2) for d5SICS and d5SICS:dNaM, there are several parallel relaxation pathways to populate the lowest triplet state, but for dNaM, a main relaxation pathway is uncovered. Moreover, we have found that the excited-state relaxation mechanism of d5SICS:dNaM in DNA is similar to that of the isolated d5SICS chromophore. These mechanistic insights contribute to the understanding of photophysics and photochemistry of unusual base pairs and to the design of better semisynthetic genetic alphabet.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-01-01
The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied
Sharma, Kishor; Tollervey, David
1999-01-01
The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548
Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo
2009-01-01
We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yandell, Margaret A.; King, Sarah B.; Neumark, Daniel M., E-mail: dneumark@berkeley.edu
2014-05-14
Decay dynamics of nascent dipole bound states of acetonitrile and nitromethane are examined using time-resolved photoelectron imaging of iodide-acetonitrile (I{sup −}·CH{sub 3}CN) and iodide-nitromethane (I{sup −}·CH{sub 3}NO{sub 2}) complexes. Dipole-bound anions are created by UV-initiated electron transfer to the molecule of interest from the associated iodide ion at energies just below the vertical detachment energy of the halide-molecule complex. The acetonitrile anion is observed to decay biexponentially with time constants in the range of 4–900 ps. In contrast, the dipole bound state of nitromethane decays rapidly over 400 fs to form the valence bound anion. The nitromethane valence anion speciesmore » then decays biexponentially with time constants of 2 ps and 1200 ps. The biexponential decay dynamics in acetonitrile are interpreted as iodine atom loss and autodetachment from the excited dipole-bound anion, followed by slower autodetachment of the relaxed metastable ion, while the dynamics of the nitromethane system suggest that a dipole-bound anion to valence anion transition proceeds via intramolecular vibrational energy redistribution to nitro group modes in the vicinity of the iodine atom.« less
Yandell, Margaret A; King, Sarah B; Neumark, Daniel M
2014-05-14
Decay dynamics of nascent dipole bound states of acetonitrile and nitromethane are examined using time-resolved photoelectron imaging of iodide-acetonitrile (I(-)·CH3CN) and iodide-nitromethane (I(-)·CH3NO2) complexes. Dipole-bound anions are created by UV-initiated electron transfer to the molecule of interest from the associated iodide ion at energies just below the vertical detachment energy of the halide-molecule complex. The acetonitrile anion is observed to decay biexponentially with time constants in the range of 4-900 ps. In contrast, the dipole bound state of nitromethane decays rapidly over 400 fs to form the valence bound anion. The nitromethane valence anion species then decays biexponentially with time constants of 2 ps and 1200 ps. The biexponential decay dynamics in acetonitrile are interpreted as iodine atom loss and autodetachment from the excited dipole-bound anion, followed by slower autodetachment of the relaxed metastable ion, while the dynamics of the nitromethane system suggest that a dipole-bound anion to valence anion transition proceeds via intramolecular vibrational energy redistribution to nitro group modes in the vicinity of the iodine atom.
Statistical deprojection of galaxy pairs
NASA Astrophysics Data System (ADS)
Nottale, Laurent; Chamaraux, Pierre
2018-06-01
Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.
Sobolewski, Andrzej L.; Domcke, Wolfgang; Hättig, C.
2005-01-01
The UV spectra of three different conformers of the guanine/cytosine base pair were recorded recently with UV-IR double-resonance techniques in a supersonic jet [Abo-Riziq, A., Grace, L., Nir, E., Kabelac, M., Hobza, P. & de Vries, M. S. (2005) Proc. Natl. Acad. Sci. USA 102, 20–23]. The spectra provide evidence for a very efficient excited-state deactivation mechanism that is specific for the Watson–Crick structure and may be essential for the photostability of DNA. Here we report results of ab initio electronic-structure calculations for the excited electronic states of the three lowest-energy conformers of the guanine/cytosine base pair. The calculations reveal that electron-driven interbase proton-transfer processes play an important role in the photochemistry of these systems. The exceptionally short lifetime of the UV-absorbing states of the Watson–Crick conformer is tentatively explained by the existence of a barrierless reaction path that connects the spectroscopic 1π π * excited state with the electronic ground state via two electronic curve crossings. For the non-Watson–Crick structures, the photochemically reactive state is located at higher energies, resulting in a barrier for proton transfer and, thus, a longer lifetime of the UV-absorbing 1π π * state. The computational results support the conjecture that the photochemistry of hydrogen bonds plays a decisive role for the photostability of the molecular encoding of the genetic information in isolated DNA base pairs. PMID:16330778
Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie
2013-01-01
This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156
Fung, Jennifer C.; Marshall, Wallace F.; Dernburg, Abby; Agard, David A.; Sedat, John W.
1998-01-01
The dynamics by which homologous chromosomes pair is currently unknown. Here, we use fluorescence in situ hybridization in combination with three-dimensional optical microscopy to show that homologous pairing of the somatic chromosome arm 2L in Drosophila occurs by independent initiation of pairing at discrete loci rather than by a processive zippering of sites along the length of chromosome. By evaluating the pairing frequencies of 11 loci on chromosome arm 2L over several timepoints during Drosophila embryonic development, we show that all 11 loci are paired very early in Drosophila development, within 13 h after egg deposition. To elucidate whether such pairing occurs by directed or undirected motion, we analyzed the pairing kinetics of histone loci during nuclear cycle 14. By measuring changes of nuclear length and correlating these changes with progression of time during cycle 14, we were able to express the pairing frequency and distance between homologous loci as a function of time. Comparing the experimentally determined dynamics of pairing to simulations based on previously proposed models of pairing motion, we show that the observed pairing kinetics are most consistent with a constrained random walk model and not consistent with a directed motion model. Thus, we conclude that simple random contacts through diffusion could suffice to allow pairing of homologous sites. PMID:9531544
NASA Astrophysics Data System (ADS)
Dunning, Thom H.; Xu, Lu T.; Takeshita, Tyler Y.
2015-01-01
The number of singly occupied orbitals in the ground-state atomic configuration of an element defines its nominal valence. For carbon and sulfur, with two singly occupied orbitals in their 3P ground states, the nominal valence is two. However, in both cases, it is possible to form more bonds than indicated by the nominal valence—up to four bonds for carbon and six bonds for sulfur. In carbon, the electrons in the 2s lone pair can participate in bonding, and in sulfur the electrons in both the 3p and 3s lone pairs can participate. Carbon 2s and sulfur 3p recoupled pair bonds are the basis for the tetravalence of carbon and sulfur, and 3s recoupled pair bonds enable sulfur to be hexavalent. In this paper, we report generalized valence bond as well as more accurate calculations on the a4Σ- states of CF and SF, which are archetypal examples of molecules that possess recoupled pair bonds. These calculations provide insights into the fundamental nature of recoupled pair bonds and illustrate the key differences between recoupled pair bonds formed with the 2s lone pair of carbon, as a representative of the early p-block elements, and recoupled pair bonds formed with the 3p lone pair of sulfur, as a representative of the late p-block elements.
Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors
NASA Astrophysics Data System (ADS)
Allan, Milan P.
2013-03-01
The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple
Dynamics and couplings of N-H stretching excitations of guanosine-cytidine base pairs in solution.
Yang, Ming; Szyc, Łukasz; Röttger, Katharina; Fidder, Henk; Nibbering, Erik T J; Elsaesser, Thomas; Temps, Friedrich
2011-05-12
N-H stretching vibrations of hydrogen-bonded guanosine-cytidine (G·C) base pairs in chloroform solution are studied with linear and ultrafast nonlinear infrared (IR) spectroscopy. Assignment of the IR-active bands in the linear spectrum is made possible by combining structural information on the hydrogen bonds in G·C base pairs with literature results of density functional theory calculations, and empirical relations connecting frequency shifts and intensity of the IR-active vibrations. A local mode representation of N-H stretching vibrations is adopted, consisting of ν(G)(NH(2))(f) and ν(C)(NH(2))(f) modes for free NH groups of G and C, and of ν(G)(NH(2))(b), ν(G)(NH), and ν(C)(NH(2))(b) modes associated with N-H stretching motions of hydrogen-bonded NH groups. The couplings and relaxation dynamics of the N-H stretching excitations are studied with femtosecond mid-infrared two-dimensional (2D) and pump-probe spectroscopy. The N-H stretching vibrations of the free NH groups of G and C have an average population lifetime of 2.4 ps. Besides a vibrational population lifetime shortening to subpicosecond values observed for the hydrogen-bonded N-H stretching vibrations, the 2D spectra reveal vibrational excitation transfer from the ν(G)(NH(2))(b) mode to the ν(G)(NH) and/or ν(C)(NH(2))(b) modes. The underlying intermode vibrational couplings are on the order of 10 cm(-1).
Asteroid Systems: Binaries, Triples, and Pairs
NASA Astrophysics Data System (ADS)
Margot, J.-L.; Pravec, P.; Taylor, P.; Carry, B.; Jacobson, S.
In the past decade, the number of known binary near-Earth asteroids has more than quadrupled and the number of known large main-belt asteroids with satellites has doubled. Half a dozen triple asteroids have been discovered, and the previously unrecognized populations of asteroid pairs and small main-belt binaries have been identified. The current observational evidence confirms that small (≲20 km) binaries form by rotational fission and establishes that the Yarkovsky-O'Keefe-Radzievskii-Paddack (YORP) effect powers the spin-up process. A unifying paradigm based on rotational fission and post-fission dynamics can explain the formation of small binaries, triples, and pairs. Large (>~20 km) binaries with small satellites are most likely created during large collisions.
Mechanical Modulation of Nascent Stem Cell Lineage Commitment in Tissue Engineering Scaffolds
Song, Min Jae; Dean, David; Tate, Melissa L. Knothe
2013-01-01
Taking inspiration from tissue morphogenesis in utero, this study tests the concept of using tissue engineering scaffolds as delivery devices to modulate emergent structure-function relationships at early stages of tissue genesis. We report on the use of a combined computational fluid dynamics (CFD) modeling, advanced manufacturing methods, and experimental fluid mechanics (micro-piv and strain mapping) for the prospective design of tissue engineering scaffold geometries that deliver spatially resolved mechanical cues to cells seeded within. When subjected to a constant magnitude global flow regime, the local scaffold geometry dictates the magnitudes of mechanical stresses and strains experienced by a given cell, and in a spatially resolved fashion, similar to patterning during morphogenesis. In addition, early markers of mesenchymal stem cell lineage commitment relate significantly to the local mechanical environment of the cell. Finally, by plotting the range of stress-strain states for all data corresponding to nascent cell lineage commitment (95% CI), we begin to “map the mechanome”, defining stress-strain states most conducive to targeted cell fates. In sum, we provide a library of reference mechanical cues that can be delivered to cells seeded on tissue engineering scaffolds to guide target tissue phenotypes in a temporally and spatially resolved manner. Knowledge of these effects allows for prospective scaffold design optimization using virtual models prior to prototyping and clinical implementation. Finally, this approach enables the development of next generation scaffolds cum delivery devices for genesis of complex tissues with heterogenous properties, e.g., organs, joints or interface tissues such as growth plates. PMID:23660249
Mechanical modulation of nascent stem cell lineage commitment in tissue engineering scaffolds.
Song, Min Jae; Dean, David; Knothe Tate, Melissa L
2013-07-01
Taking inspiration from tissue morphogenesis in utero, this study tests the concept of using tissue engineering scaffolds as delivery devices to modulate emergent structure-function relationships at early stages of tissue genesis. We report on the use of a combined computational fluid dynamics (CFD) modeling, advanced manufacturing methods, and experimental fluid mechanics (micro-piv and strain mapping) for the prospective design of tissue engineering scaffold geometries that deliver spatially resolved mechanical cues to stem cells seeded within. When subjected to a constant magnitude global flow regime, the local scaffold geometry dictates the magnitudes of mechanical stresses and strains experienced by a given cell, and in a spatially resolved fashion, similar to patterning during morphogenesis. In addition, early markers of mesenchymal stem cell lineage commitment relate significantly to the local mechanical environment of the cell. Finally, by plotting the range of stress-strain states for all data corresponding to nascent cell lineage commitment (95% CI), we begin to "map the mechanome", defining stress-strain states most conducive to targeted cell fates. In sum, we provide a library of reference mechanical cues that can be delivered to cells seeded on tissue engineering scaffolds to guide target tissue phenotypes in a temporally and spatially resolved manner. Knowledge of these effects allows for prospective scaffold design optimization using virtual models prior to prototyping and clinical implementation. Finally, this approach enables the development of next generation scaffolds cum delivery devices for genesis of complex tissues with heterogenous properties, e.g., organs, joints or interface tissues such as growth plates. Copyright © 2013 Elsevier Ltd. All rights reserved.
2011-01-01
As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.
As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less
NASA Astrophysics Data System (ADS)
Lagrosas, N.; Tan, F.; Antioquia, C. T.
2014-12-01
Fabricated all sky imagers are efficient and cost effective instruments for cloud detection and classification. Continuous operation of this instrument can result in the determination of cloud occurrence and cloud base heights for the paired system. In this study, a fabricated paired sky imaging system - consisting two commercial digital cameras (Canon Powershot A2300) enclosed in weatherproof containers - is developed in Manila Observatory for the purpose of determining cloud base heights at the Manila Observatory area. One of the cameras is placed on the rooftop of Manila Observatory and the other is placed on the rooftop of the university dormitory, 489m from the first camera. The cameras are programmed to simultaneously gather pictures every 5 min. Continuous operation of these cameras were implemented since the end of May of 2014 but data collection started end of October 2013. The data were processed following the algorithm proposed by Kassianov et al (2005). The processing involves the calculation of the merit function that determines the area of overlap of the two pictures. When two pictures are overlapped, the minimum of the merit function corresponds to the pixel column positions where the pictures have the best overlap. In this study, pictures of overcast sky prove to be difficult to process for cloud base height and were excluded from processing. The figure below shows the initial results of the hourly average of cloud base heights from data collected from November 2013 to July 2014. Measured cloud base heights ranged from 250m to 1.5km. These are the heights of cumulus and nimbus clouds that are dominant in this part of the world. Cloud base heights are low in the early hours of the day indicating low convection process during these times. However, the increase in the convection process in the atmosphere can be deduced from higher cloud base heights in the afternoon. The decrease of cloud base heights after 15:00 follows the trend of decreasing solar
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Bauer, Christophe; Abid, Jean-Pierre; Fermin, David; Girault, Hubert H
2004-05-15
The use of 4.2 nm gold nanoparticles wrapped in an adsorbates shell and embedded in a TiO2 metal oxide matrix gives the opportunity to investigate ultrafast electron-electron scattering dynamics in combination with electronic surface phenomena via the surface plasmon lifetimes. These gold nanoparticles (NPs) exhibit a large nonclassical broadening of the surface plasmon band, which is attributed to a chemical interface damping. The acceleration of the loss of surface plasmon phase coherence indicates that the energy and the momentum of the collective electrons can be dissipated into electronic affinity levels of adsorbates. As a result of the preparation process, gold NPs are wrapped in a shell of sulfate compounds that gives rise to a large density of interfacial molecules confined between Au and TiO2, as revealed by Fourier-transform-infrared spectroscopy. A detailed analysis of the transient absorption spectra obtained by broadband femtosecond transient absorption spectroscopy allows separating electron-electron and electron-phonon interaction. Internal thermalization times (electron-electron scattering) are determined by probing the decay of nascent nonthermal electrons (NNEs) and the build-up of the Fermi-Dirac electron distribution, giving time constants of 540 to 760 fs at 0.42 and 0.34 eV from the Fermi level, respectively. Comparison with literature data reveals that lifetimes of NNEs measured for these small gold NPs are more than four times longer than for silver NPs with similar sizes. The surprisingly long internal thermalization time is attributed to an additional decay mechanism (besides the classical e-e scattering) for the energy loss of NNEs, identified as the ultrafast chemical interface scattering process. NNEs experience an inelastic resonant scattering process into unoccupied electronic states of adsorbates, that directly act as an efficient heat bath, via the excitation of molecular vibrational modes. The two-temperature model is no longer
Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda
2018-05-02
Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact
Zimmerman, Tammy M.; Breen, Kevin J.
2012-01-01
Pesticide concentration data for waters from selected carbonate-rock aquifers in agricultural areas of Pennsylvania were collected in 1993–2009 for occurrence and distribution assessments. A set of 30 wells was visited once in 1993–1995 and again in 2008–2009 to assess concentration changes. The data include censored matched pairs (nondetections of a compound in one or both samples of a pair). A potentially improved approach for assessing concentration changes is presented where (i) concentrations are adjusted with models of matrix-spike recovery and (ii) area-wide temporal change is tested by use of the paired Prentice-Wilcoxon (PPW) statistical test. The PPW results for atrazine, simazine, metolachlor, prometon, and an atrazine degradate, deethylatrazine (DEA), are compared using recovery-adjusted and unadjusted concentrations. Results for adjusted compared with unadjusted concentrations in 2008–2009 compared with 1993–1995 were similar for atrazine and simazine (significant decrease; 95% confidence level) and metolachlor (no change) but differed for DEA (adjusted, decrease; unadjusted, increase) and prometon (adjusted, decrease; unadjusted, no change). The PPW results were different on recovery-adjusted compared with unadjusted concentrations. Not accounting for variability in recovery can mask a true change, misidentify a change when no true change exists, or assign a direction opposite of the true change in concentration that resulted from matrix influences on extraction and laboratory method performance. However, matrix-based models of recovery derived from a laboratory performance dataset from multiple studies for national assessment, as used herein, rather than time- and study-specific recoveries may introduce uncertainty in recovery adjustments for individual samples that should be considered in assessing change.
The coevolution of long-term pair bonds and cooperation.
Song, Z; Feldman, M W
2013-05-01
The evolution of social traits may not only depend on but also change the social structure of the population. In particular, the evolution of pairwise cooperation, such as biparental care, depends on the pair-matching distribution of the population, and the latter often emerges as a collective outcome of individual pair-bonding traits, which are also under selection. Here, we develop an analytical model and individual-based simulations to study the coevolution of long-term pair bonds and cooperation in parental care, where partners play a Snowdrift game in each breeding season. We illustrate that long-term pair bonds may coevolve with cooperation when bonding cost is below a threshold. As long-term pair bonds lead to assortative interactions through pair-matching dynamics, they may promote the prevalence of cooperation. In addition to the pay-off matrix of a single game, the evolutionarily stable equilibrium also depends on bonding cost and accidental divorce rate, and it is determined by a form of balancing selection because the benefit from pair-bond maintenance diminishes as the frequency of cooperators increases. Our findings highlight the importance of ecological factors affecting social bonding cost and stability in understanding the coevolution of social behaviour and social structures, which may lead to the diversity of biological social systems. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.
Suh, E R; Waring, R B
1990-01-01
It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465
Romero, Eduardo E; Hernandez, Florencio E
2018-01-03
Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.
ERIC Educational Resources Information Center
Foot, Michael C.
1999-01-01
Discusses the practice of paired testing of oral languages, noting the lack of published research evidence and of results from the monitoring of these tests to support their introduction into wider use. Questions whether paired testing is more effective than, and a valid alternative to, the more traditional candidate/examiner model. (SM)
Mutagen Synergy: Hypermutability Generated by Specific Pairs of Base Analogs
Ang, Jocelyn; Song, Lisa Yun; D'Souza, Sara; Hong, Irene L.; Luhar, Rohan; Yung, Madeline
2016-01-01
ABSTRACT We tested pairwise combinations of classical base analog mutagens in Escherichia coli to study possible mutagen synergies. We examined the cytidine analogs zebularine (ZEB) and 5-azacytidine (5AZ), the adenine analog 2-aminopurine (2AP), and the uridine/thymidine analog 5-bromodeoxyuridine (5BrdU). We detected a striking synergy with the 2AP plus ZEB combination, resulting in hypermutability, a 35-fold increase in mutation frequency (to 53,000 × 10−8) in the rpoB gene over that with either mutagen alone. A weak synergy was also detected with 2AP plus 5AZ and with 5BrdU plus ZEB. The pairing of 2AP and 5BrdU resulted in suppression, lowering the mutation frequency of 5BrdU alone by 6.5-fold. Sequencing the mutations from the 2AP plus ZEB combination showed the predominance of two new hot spots for A·T→G·C transitions that are not well represented in either single mutagen spectrum, and one of which is not found even in the spectrum of a mismatch repair-deficient strain. The strong synergy between 2AP and ZEB could be explained by changes in the dinucleoside triphosphate (dNTP) pools. IMPORTANCE Although mutagens have been widely studied, the mutagenic effects of combinations of mutagens have not been fully researched. Here, we show that certain pairwise combinations of base analog mutagens display synergy or suppression. In particular, the combination of 2-aminopurine and zebularine, analogs of adenine and cytidine, respectively, shows a 35-fold increased mutation frequency compared with that of either mutagen alone. Understanding the mechanism of synergy can lead to increased understanding of mutagenic processes. As combinations of base analogs are used in certain chemotherapy regimens, including those involving ZEB and 5AZ, these results indicate that testing the mutagenicity of all drug combinations is prudent. PMID:27457718
NASA Astrophysics Data System (ADS)
Onoue, Masafusa; Kashikawa, Nobunari; Uchiyama, Hisakazu; Akiyama, Masayuki; Harikane, Yuichi; Imanishi, Masatoshi; Komiyama, Yutaka; Matsuoka, Yoshiki; Nagao, Tohru; Nishizawa, Atsushi J.; Oguri, Masamune; Ouchi, Masami; Tanaka, Masayuki; Toba, Yoshiki; Toshikawa, Jun
2018-01-01
We investigate the galaxy overdensity around proto-cluster scale quasar pairs at high (z > 3) and low (z ˜ 1) redshift based on the unprecedentedly wide and deep optical survey of the Hyper Suprime-Cam Subaru Strategic Program (HSC-SSP). Using the first-year survey data covering effectively ˜121 deg2 with the 5σ depth of i ˜ 26.4 and the SDSS DR12Q catalog, we find two luminous pairs at z ˜ 3.3 and 3.6 which reside in >5σ overdensity regions of g-dropout galaxies at i < 25. The projected separations of the two pairs are R⊥ = 1.75 and 1.04 proper Mpc (pMpc), and their velocity offsets are ΔV = 692 and 1448 km s-1, respectively. This result is in clear contrast to the average z ˜ 4 quasar environments as discussed in Uchiyama et al. (2018, PASJ 70, S32) and implies that the quasar activities of the pair members are triggered via major mergers in proto-clusters, unlike the vast majority of isolated quasars in general fields that may turn on via non-merger events such as bar and disk instabilities. At z ˜ 1, we find 37 pairs with R⊥ < 2 pMpc and ΔV < 2300 km s-1 in the current HSC-Wide coverage, including four from Hennawi et al. (2006, AJ, 131, 1). The distribution of the peak overdensity significance within two arcminutes around the pairs has a long tail toward high-density (>4σ) regions. Thanks to the large sample size, we find statistical evidence that this excess is unique to the pair environments when compared to single-quasar and randomly selected galaxy environments at the same redshift range. Moreover, there are nine small-scale (R⊥ < 1 pMpc) pairs, two of which are found to reside in cluster fields. Our results demonstrate that <2 pMpc scale quasar pairs at both redshift ranges tend to occur in massive haloes, although perhaps not the most massive ones, and that they are useful in searching for rare density peaks.
Same-sex partner preference in zebra finches: pairing flexibility and choice.
Tomaszycki, Michelle L; Zatirka, Brendon P
2014-11-01
This study examined flexibility and choice in same-sex pair-bonding behavior in adult zebra finches (Taeniopygia guttata). Zebra finches form life-long monogamous relationships and extra pair behavior is very low, making them an ideal species in which to study same-sex pairing. We examined same-sex behaviors using both semi-naturalistic choice paradigms and skewed sex ratios. In the first experiment, we allowed zebra finches to pair in aviaries with equal sex ratios as part of multiple experiments. On average, 6.4% (N = 78) of unmanipulated pairs were same-sex: all but one was female-female. In a second experiment, we identified pairs from same-sex cages and selected 20 total same-sex pairs (10 of each sex). We then gave pairs a chance to court and pair with members of the opposite sex and observed their behavior for three days. Females did not retain their partner, but most paired with males. In contrast, some males did retain their partner. Similarly, females were more likely to engage in pairing behaviors with males than with their partners or other females whereas males were equally likely to engage in same-sex and opposite-sex pairing behaviors. These findings suggest that same-sex partnerships in zebra finches can be facultative, based on the sex ratio of the group in which they live, but can also be a choice, when opportunities to pair with opposite-sex individuals are possible. Furthermore, it is possible that females are more flexible in this choice of same-sex partnerships than are males.
Multiprocessor switch with selective pairing
Gara, Alan; Gschwind, Michael K; Salapura, Valentina
2014-03-11
System, method and computer program product for a multiprocessing system to offer selective pairing of processor cores for increased processing reliability. A selective pairing facility is provided that selectively connects, i.e., pairs, multiple microprocessor or processor cores to provide one highly reliable thread (or thread group). Each paired microprocessor or processor cores that provide one highly reliable thread for high-reliability connect with a system components such as a memory "nest" (or memory hierarchy), an optional system controller, and optional interrupt controller, optional I/O or peripheral devices, etc. The memory nest is attached to a selective pairing facility via a switch or a bus
Heterospecific pairing and hybridization between Nasutitermes corniger and N. ephratae
NASA Astrophysics Data System (ADS)
Hartke, Tamara R.; Rosengaus, Rebeca B.
2011-09-01
The sympatric neotropical termites Nasutitermes corniger and Nasutitermes ephratae are clearly distinguishable based on morphology, nest architecture, defensive secretion composition, and molecular markers. However, given the extensive ecological, geographical, and behavioral overlap of these closely related species, the potential for interbreeding may exist. To explore this possibility, heterospecific pairs were formed experimentally to examine courtship and colony-establishment behaviors, and reproductive potential. Courtship and nest construction behavior occurred in heterospecific pairs in a similar manner to that of conspecific pairs. Survival of pairs depended upon the species of the female partner. N. ephratae females paired with N. corniger males produced as many offspring as conspecific pairs. N. corniger females mated to N. ephratae males, however, produced significantly fewer offspring at 60 days post-establishment than the reciprocal cross or conspecific N. ephratae or N. corniger pairs. This was also the only pairing in which any aggression was observed. Heterospecific pairs and groups formed in mate choice mesocosms, suggesting that species recognition between these two termites is not an important aspect of mate choice. Overall, species mismatch tolerance and hybrid offspring viability are high. The present data, together with previous evidence from defensive secretions and isozyme analysis, suggest that hybridization may periodically occur in nature, and that reproductive barriers between these two species may be incomplete. Hybridization could provide a rare but important source of genetic diversity and may ensure mating opportunities for the more abundant sex of alates in each species.
Molecular electrostatics for probing lone pair-π interactions.
Mohan, Neetha; Suresh, Cherumuttathu H; Kumar, Anmol; Gadre, Shridhar R
2013-11-14
An electrostatics-based approach has been proposed for probing the weak interactions between lone pair containing molecules and π deficient molecular systems. For electron-rich molecules, the negative minima in molecular electrostatic potential (MESP) topography give the location of electron localization and the MESP value at the minimum (Vmin) quantifies the electron-rich character of that region. Interactive behavior of a lone pair bearing molecule with electron deficient π-systems, such as hexafluorobenzene, 1,3,5-trinitrobenzene, 2,4,6-trifluoro-1,3,5-triazine and 1,2,4,5-tetracyanobenzene explored within DFT brings out good correlation of the lone pair-π interaction energy (E(int)) with the Vmin value of the electron-rich system. Such interaction is found to be portrayed well with the Electrostatic Potential for Intermolecular Complexation (EPIC) model. On the basis of the precise location of MESP minimum, a prediction for the orientation of a lone pair bearing molecule with an electron deficient π-system is possible in the majority of the cases studied.
Zhang, Cui-Ying; Ren, Wei-Guang
2017-06-01
Herb pairs are usual clinical compatibility forms and one of compound prescription sources in Chinese medicine. Pharmacokinetic research in vivo is one of the important items in elucidating the mechanism for synergistic and attenuated mechanisms of herb pairs. The paper comprehensively summarized and systemized the pharmacokinetic researches of marker-ingredients about Danshen-Honghua and Danshen-Bingpian in order to elucidate the rationality and scientificity of herb pairs and provide some feasible suggestions on the pharmacokinetics of drugs in the future. In view of complicated system of Traditional Chinese medicines and a chemical system that is not separated from its natural state, comparative pharmacokinetic researches on marker-ingredients from the herb pairs are reasonable to elucidate the synergistic and attenuated mechanisms of monarch-subjects compatible herbs and monarch-guide compatible herbs. Such pharmacokinetic research can better explain the mechanism of drug compatibility, while the pharmacokinetic researches based on the monomer chemical compositions and marker-ingredients that have been separated from complex chemical environment of traditional Chinese Medicine are still unreasonable and should be discussed deeply. Copyright© by the Chinese Pharmaceutical Association.
Mesoscopic pairing without superconductivity
NASA Astrophysics Data System (ADS)
Hofmann, Johannes
2017-12-01
We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.
Comparison of Interaural Electrode Pairing Methods for Bilateral Cochlear Implants
Dietz, Mathias
2015-01-01
In patients with bilateral cochlear implants (CIs), pairing matched interaural electrodes and stimulating them with the same frequency band is expected to facilitate binaural functions such as binaural fusion, localization, and spatial release from masking. Because clinical procedures typically do not include patient-specific interaural electrode pairing, it remains the case that each electrode is allocated to a generic frequency range, based simply on the electrode number. Two psychoacoustic techniques for determining interaurally paired electrodes have been demonstrated in several studies: interaural pitch comparison and interaural time difference (ITD) sensitivity. However, these two methods are rarely, if ever, compared directly. A third, more objective method is to assess the amplitude of the binaural interaction component (BIC) derived from electrically evoked auditory brainstem responses for different electrode pairings; a method has been demonstrated to be a potential candidate for bilateral CI users. Here, we tested all three measures in the same eight CI users. We found good correspondence between the electrode pair producing the largest BIC and the electrode pair producing the maximum ITD sensitivity. The correspondence between the pairs producing the largest BIC and the pitch-matched electrode pairs was considerably weaker, supporting the previously proposed hypothesis that whilst place pitch might adapt over time to accommodate mismatched inputs, sensitivity to ITDs does not adapt to the same degree. PMID:26631108
Bang, Yunkyu; Stewart, G. R.
2016-02-01
The strong power law behavior of the specific heat jumpmore » $${\\rm{\\Delta }}C\\;$$ versus T c $$({\\rm{\\Delta }}C/{T}_{{\\rm{c}}}\\sim {T}_{{\\rm{c}}}^{\\alpha },\\alpha \\approx 2)$$, first observed by Bud'ko et al (2009 Phys. Rev. B 79 220516), has been confirmed with several families of the Fe-based superconducting compounds with various dopings. We tested a minimal two band BCS model to understand this anomalous behavior and showed that this non-BCS relation between $${\\rm{\\Delta }}C\\;$$ versus T c is a generic property of the multiband superconducting state paired by a dominant interband interaction ($${V}_{\\mathrm{inter}}\\gt {V}_{\\mathrm{intra}}$$) reflecting the relation $$\\frac{{{\\rm{\\Delta }}}_{{\\rm{h}}}}{{{\\rm{\\Delta }}}_{{\\rm{e}}}}\\sim \\sqrt{\\frac{{N}_{{\\rm{e}}}}{{N}_{{\\rm{h}}}}}$$ near T c, as in the $${S}_{\\pm }$$-wave pairing state. We also found that this $${\\rm{\\Delta }}C\\;$$ versus T c power law can continuously change from the ideal BNC scaling to a considerable deviation by a moderate variation of the impurity scattering rate $${{\\rm{\\Gamma }}}_{0}$$ (non-pair-breaking). Finally, as a result, our model provides a consistent explanation why the electron-doped Fe-based superconductors follow the ideal BNC scaling very well while the hole-doped systems often show varying degree of deviations.« less
A comparative review of methods for comparing means using partially paired data.
Guo, Beibei; Yuan, Ying
2017-06-01
In medical experiments with the objective of testing the equality of two means, data are often partially paired by design or because of missing data. The partially paired data represent a combination of paired and unpaired observations. In this article, we review and compare nine methods for analyzing partially paired data, including the two-sample t-test, paired t-test, corrected z-test, weighted t-test, pooled t-test, optimal pooled t-test, multiple imputation method, mixed model approach, and the test based on a modified maximum likelihood estimate. We compare the performance of these methods through extensive simulation studies that cover a wide range of scenarios with different effect sizes, sample sizes, and correlations between the paired variables, as well as true underlying distributions. The simulation results suggest that when the sample size is moderate, the test based on the modified maximum likelihood estimator is generally superior to the other approaches when the data is normally distributed and the optimal pooled t-test performs the best when the data is not normally distributed, with well-controlled type I error rates and high statistical power; when the sample size is small, the optimal pooled t-test is to be recommended when both variables have missing data and the paired t-test is to be recommended when only one variable has missing data.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dunning, Thom H., E-mail: thdjr@uw.edu; Xu, Lu T.; Takeshita, Tyler Y.
2015-01-21
The number of singly occupied orbitals in the ground-state atomic configuration of an element defines its nominal valence. For carbon and sulfur, with two singly occupied orbitals in their {sup 3}P ground states, the nominal valence is two. However, in both cases, it is possible to form more bonds than indicated by the nominal valence—up to four bonds for carbon and six bonds for sulfur. In carbon, the electrons in the 2s lone pair can participate in bonding, and in sulfur the electrons in both the 3p and 3s lone pairs can participate. Carbon 2s and sulfur 3p recoupled pairmore » bonds are the basis for the tetravalence of carbon and sulfur, and 3s recoupled pair bonds enable sulfur to be hexavalent. In this paper, we report generalized valence bond as well as more accurate calculations on the a{sup 4}Σ{sup −} states of CF and SF, which are archetypal examples of molecules that possess recoupled pair bonds. These calculations provide insights into the fundamental nature of recoupled pair bonds and illustrate the key differences between recoupled pair bonds formed with the 2s lone pair of carbon, as a representative of the early p-block elements, and recoupled pair bonds formed with the 3p lone pair of sulfur, as a representative of the late p-block elements.« less
ERIC Educational Resources Information Center
Fells, Stephanie
2012-01-01
The design of online or distributed problem-based learning (dPBL) is a nascent, complex design problem. Instructional designers are challenged to effectively unite the constructivist principles of problem-based learning (PBL) with appropriate media in order to create quality dPBL environments. While computer-mediated communication (CMC) tools and…
McKee, B. D.; Habera, L.; Vrana, J. A.
1992-01-01
In Drosophila melanogaster males, X-Y meiotic chromosome pairing is mediated by the nucleolus organizers (NOs) which are located in the X heterochromatin (Xh) and near the Y centromere. Deficiencies for Xh disrupt X-Y meiotic pairing and cause high frequencies of X-Y nondisjunction. Insertion of cloned rRNA genes on an Xh(-) chromosome partially restores normal X-Y pairing and disjunction. To map the sequences within an inserted, X-linked rRNA gene responsible for stimulating X-Y pairing, partial deletions were generated by P element-mediated destabilization of the insert. Complete deletions of the rRNA transcription unit did not interfere with the ability to stimulate X-Y pairing as long as most of the intergenic spacer (IGS) remained. Within groups of deletions that lacked the entire transcription unit and differed only in length of residual IGS material, pairing ability was proportional to the dose of 240-bp intergenic spacer repeats. Deletions of the complete rRNA transcription unit or of the 28S sequences alone blocked nucleolus formation, as determined by binding of an antinucleolar antibody, yet did not interfere with pairing ability, suggesting that X-Y pairing may not be mechanistically related to nucleolus formation. A model for achiasmatic pairing in Drosophila males based upon the combined action of topoisomerase I and a strand transferase is proposed. PMID:1330825
The Simplified Aircraft-Based Paired Approach With the ALAS Alerting Algorithm
NASA Technical Reports Server (NTRS)
Perry, Raleigh B.; Madden, Michael M.; Torres-Pomales, Wilfredo; Butler, Ricky W.
2013-01-01
This paper presents the results of an investigation of a proposed concept for closely spaced parallel runways called the Simplified Aircraft-based Paired Approach (SAPA). This procedure depends upon a new alerting algorithm called the Adjacent Landing Alerting System (ALAS). This study used both low fidelity and high fidelity simulations to validate the SAPA procedure and test the performance of the new alerting algorithm. The low fidelity simulation enabled a determination of minimum approach distance for the worst case over millions of scenarios. The high fidelity simulation enabled an accurate determination of timings and minimum approach distance in the presence of realistic trajectories, communication latencies, and total system error for 108 test cases. The SAPA procedure and the ALAS alerting algorithm were applied to the 750-ft parallel spacing (e.g., SFO 28L/28R) approach problem. With the SAPA procedure as defined in this paper, this study concludes that a 750-ft application does not appear to be feasible, but preliminary results for 1000-ft parallel runways look promising.
Pair production of scalar dyons in Kerr-Newman black holes
NASA Astrophysics Data System (ADS)
Chen, Chiang-Mei; Kim, Sang Pyo; Sun, Jia-Rui; Tang, Fu-Yi
2018-06-01
We study the spontaneous pair production of scalar dyons in the near extremal dyonic Kerr-Newman (KN) black hole, which contains a warped AdS3 structure in the near horizon region. The leading term contribution of the pair production rate and the absorption cross section ratio are also calculated using the Hamilton-Jacobi approach and the thermal interpretation is given. In addition, the holographic dual conformal field theories (CFTs) descriptions of the pair production rate and absorption cross section ratios are analyzed both in the J-, Q- and P-pictures respectively based on the threefold dyonic KN/CFTs dualities.
The role of the AT pairs in the acid denaturation of DNA.
Hermann, P; Fredericq, E
1977-01-01
It has been determined previously that the protonation of the GC pairs induces a DNA conformation change which leads to a "metastable" structure. The role of the AT pairs, however, is no well known because the protonation does not modify their spectral properties. By means of an indirect method based on the binding of proflavine, it has been determined that the AT pairs are protonated before the acid-induced denaturation and that they seem to be unable to assume a conformation change when protonated. These results would indicate that the protonated AT pairs may be responsible for the induction of the acid denaturation and not the GC pairs as it was thought previously. PMID:20604
Villagrán, Martha Y Suárez; Miller, John H
2015-08-27
We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.
Properties of isoscalar-pair condensates
Van Isacker, P.; Macchiavelli, A. O.; Fallon, P.; ...
2016-08-17
In this work, it is pointed out that the ground state of $n$ neutrons and n protons in a single-$j$ shell, interacting through an isoscalar ($T=0$) pairing force, is not paired, $J=0$, but rather spin aligned, $J=n$. This observation is explained in the context of a model of isoscalar $P(J=1)$ pairs, which is mapped onto a system of $p$ bosons, leading to an approximate analytic solution of the isoscalar-pairing limit in $jj$ coupling.
Two monozygotic twin pairs discordant for female-to-male transsexualism.
Segal, Nancy L
2006-06-01
Two monozygotic female twin pairs discordant for transsexualism are described. These reports double the number of such case studies in the current scientific literature. Interviews with the twins and their families indicated that unusual medical and life history factors did not play causal roles. However, inspection of medical records for one transsexual twin suggested that some early life experiences may have exacerbated tendencies toward male gender identification. In both pairs, the twins' gender identity differences emerged early, consistent with, but not proof of, co-twin differences in prenatal hormonal influences. The identification of additional discordant MZ female twin pairs can advance biological and psychological understanding of transsexualism. Suggestions for future research, based upon findings from these two twin pairs and from studies of female-to-male transsexuals, are provided.
NASA Astrophysics Data System (ADS)
Neese, Frank; Wennmohs, Frank; Hansen, Andreas
2009-03-01
Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Møller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol-1. Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500
Neese, Frank; Wennmohs, Frank; Hansen, Andreas
2009-03-21
Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Moller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol(-1). Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500
Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao
2017-08-01
To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood
Sharp Transition from Nonmetallic Au246 to Metallic Au279 with Nascent Surface Plasmon Resonance.
Higaki, Tatsuya; Zhou, Meng; Lambright, Kelly J; Kirschbaum, Kristin; Sfeir, Matthew Y; Jin, Rongchao
2018-05-02
The optical properties of metal nanoparticles have attracted wide interest. Recent progress in controlling nanoparticles with atomic precision (often called nanoclusters) provide new opportunities for investigating many fundamental questions, such as the transition from excitonic to plasmonic state, which is a central question in metal nanoparticle research because it provides insights into the origin of surface plasmon resonance (SPR) as well as the formation of metallic bond. However, this question still remains elusive because of the extreme difficulty in preparing atomically precise nanoparticles larger than 2 nm. Here we report the synthesis and optical properties of an atomically precise Au 279 (SR) 84 nanocluster. Femtosecond transient absorption spectroscopic analysis reveals that the Au 279 nanocluster shows a laser power dependence in its excited state lifetime, indicating metallic state of the particle, in contrast with the nonmetallic electronic structure of the Au 246 (SR) 80 nanocluster. Steady-state absorption spectra reveal that the nascent plasmon band of Au 279 at 506 nm shows no peak shift even down to 60 K, consistent with plasmon behavior. The sharp transition from nonmetallic Au 246 to metallic Au 279 is surprising and will stimulate future theoretical work on the transition and many other relevant issues.
Gut microbiomes of Malawian twin pairs discordant for kwashiorkor
Smith, Michelle I.; Yatsunenko, Tanya; Manary, Mark J.; Trehan, Indi; Mkakosya, Rajhab; Cheng, Jiye; Kau, Andrew L.; Rich, Stephen S.; Concannon, Patrick; Mychaleckyj, Josyf C.; Liu, Jie; Houpt, Eric; Li, Jia V.; Holmes, Elaine; Nicholson, Jeremy; Knights, Dan; Ursell, Luke K.; Knight, Rob; Gordon, Jeffrey I.
2013-01-01
Kwashiorkor, an enigmatic form of severe acute malnutrition, is the consequence of inadequate nutrient intake plus additional environmental insults. To investigate the role of the gut microbiome, we studied 317 Malawian twin pairs during the first 3 years of life. During this time, half of the twin pairs remained well-nourished, while 43% became discordant and 7% manifested concordance for acute malnutrition. Both children in twin pairs discordant for kwashiorkor were treated with a peanut-based, ready-to-use therapeutic food (RUTF). Time-series metagenomic studies revealed that RUTF produced a transient maturation of metabolic functions in kwashiorkor microbiomes that regressed when RUTF was stopped. Previously frozen fecal communities from several discordant pairs were each transplanted into gnotobiotic mice. The combination of Malawian diet and kwashiorkor microbiome produced marked weight loss in recipient mice, accompanied by perturbations in amino acid, carbohydrate and intermediary metabolism that were only transiently ameliorated with RUTF. These findings implicate the gut microbiome as a causal factor in kwashiorkor. PMID:23363771
Paired peer review of university classroom teaching in a school of nursing and midwifery.
Bennett, Paul N; Parker, Steve; Smigiel, Heather
2012-08-01
Peer review of university classroom teaching can increase the quality of teaching but is not universally practiced in Australian universities. To report an evaluation of paired peer-review process using both paper and web based teaching evaluation tools. Twenty university teachers in one metropolitan Australian School of Nursing and Midwifery were randomly paired and then randomly assigned to a paper based or web-based peer review tool. Each teacher reviewed each other's classroom teaching as part of a peer review program. The participants then completed an 18 question survey evaluating the peer review tool and paired evaluation process. Responses were analyzed using frequencies and percentages. Regardless of the tool used, participants found this process of peer review positive (75%), collegial (78%), supportive (61%) and non-threatening (71%). Participants reported that the peer review will improve their own classroom delivery (61%), teaching evaluation (61%) and planning (53%). The web-based tool was found to be easier to use and allowed more space than the paper-based tool. Implementation of a web-based paired peer review system can be a positive method of peer review of university classroom teaching. Pairing of teachers to review each other's classroom teaching is a promising strategy and has the potential to improve teaching in teaching universities. Copyright © 2011 Elsevier Ltd. All rights reserved.
A motion deblurring method with long/short exposure image pairs
NASA Astrophysics Data System (ADS)
Cui, Guangmang; Hua, Weiping; Zhao, Jufeng; Gong, Xiaoli; Zhu, Liyao
2018-01-01
In this paper, a motion deblurring method with long/short exposure image pairs is presented. The long/short exposure image pairs are captured for the same scene under different exposure time. The image pairs are treated as the input of the deblurring method and more information could be used to obtain a deblurring result with high image quality. Firstly, the luminance equalization process is carried out to the short exposure image. And the blur kernel is estimated with the image pair under the maximum a posteriori (MAP) framework using conjugate gradient algorithm. Then a L0 image smoothing based denoising method is applied to the luminance equalized image. And the final deblurring result is obtained with the gain controlled residual image deconvolution process with the edge map as the gain map. Furthermore, a real experimental optical system is built to capture the image pair in order to demonstrate the effectiveness of the proposed deblurring framework. The long/short image pairs are obtained under different exposure time and camera gain control. Experimental results show that the proposed method could provide a superior deblurring result in both subjective and objective assessment compared with other deblurring approaches.
Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A
2011-03-07
Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.
Lone pairs: an electrostatic viewpoint.
Kumar, Anmol; Gadre, Shridhar R; Mohan, Neetha; Suresh, Cherumuttathu H
2014-01-16
A clear-cut definition of lone pairs has been offered in terms of characteristics of minima in molecular electrostatic potential (MESP). The largest eigenvalue and corresponding eigenvector of the Hessian at the minima are shown to distinguish lone pair regions from the other types of electron localization (such as π bonds). A comparative study of lone pairs as depicted by various other scalar fields such as the Laplacian of electron density and electron localization function is made. Further, an attempt has been made to generalize the definition of lone pairs to the case of cations.
Evaluation of new collision-pair selection models in DSMC
NASA Astrophysics Data System (ADS)
Akhlaghi, Hassan; Roohi, Ehsan
2017-10-01
The current paper investigates new collision-pair selection procedures in a direct simulation Monte Carlo (DSMC) method. Collision partner selection based on the random procedure from nearest neighbor particles and deterministic selection of nearest neighbor particles have already been introduced as schemes that provide accurate results in a wide range of problems. In the current research, new collision-pair selections based on the time spacing and direction of the relative movement of particles are introduced and evaluated. Comparisons between the new and existing algorithms are made considering appropriate test cases including fluctuations in homogeneous gas, 2D equilibrium flow, and Fourier flow problem. Distribution functions for number of particles and collisions in cell, velocity components, and collisional parameters (collision separation, time spacing, relative velocity, and the angle between relative movements of particles) are investigated and compared with existing analytical relations for each model. The capability of each model in the prediction of the heat flux in the Fourier problem at different cell numbers, numbers of particles, and time steps is examined. For new and existing collision-pair selection schemes, the effect of an alternative formula for the number of collision-pair selections and avoiding repetitive collisions are investigated via the prediction of the Fourier heat flux. The simulation results demonstrate the advantages and weaknesses of each model in different test cases.
Past, present and future of kidney paired donation transplantation in India
Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L
2017-01-01
One third of healthy willing living kidney donors are rejected due to ABO blood group incompatibility and donor specific antibody. This increases pre-transplant dialysis duration leading to increased morbidity and mortality on the kidney transplantation waiting list. Over the last decade kidney paired donation is most rapidly increased source of living kidney donors. In a kidney transplantation program dominated by living donor kidney transplantation, kidney paired donation is a legal and valid alternative strategy to increase living donor kidney transplantation. This is more useful in countries with limited resources where ABO incompatible kidney transplantation or desensitization protocol is not feasible because of costs/infectious complications and deceased donor kidney transplantation is in initial stages. The matching allocation, ABO blood type imbalance, reciprocity, simultaneity, geography were the limitation for the expansion of kidney paired donation. Here we describe different successful ways to increase living donor kidney transplantation through kidney paired donation. Compatible pairs, domino chain, combination of kidney paired donation with desensitization or ABO incompatible transplantation, international kidney paired donation, non-simultaneous, extended, altruistic donor chain and list exchange are different ways to expand the donor pool. In absence of national kidney paired donation program, a dedicated kidney paired donation team will increase access to living donor kidney transplantation in individual centres with team work. Use of social networking sites to expand donor pool, HLA based national kidney paired donation program will increase quality and quantity of kidney paired donation transplantation. Transplant centres should remove the barriers to a broader implementation of multicentre, national kidney paired donation program to further optimize potential of kidney paired donation to increase transplantation of O group and sensitized
Past, present and future of kidney paired donation transplantation in India.
Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L
2017-04-24
One third of healthy willing living kidney donors are rejected due to ABO blood group incompatibility and donor specific antibody. This increases pre-transplant dialysis duration leading to increased morbidity and mortality on the kidney transplantation waiting list. Over the last decade kidney paired donation is most rapidly increased source of living kidney donors. In a kidney transplantation program dominated by living donor kidney transplantation, kidney paired donation is a legal and valid alternative strategy to increase living donor kidney transplantation. This is more useful in countries with limited resources where ABO incompatible kidney transplantation or desensitization protocol is not feasible because of costs/infectious complications and deceased donor kidney transplantation is in initial stages. The matching allocation, ABO blood type imbalance, reciprocity, simultaneity, geography were the limitation for the expansion of kidney paired donation. Here we describe different successful ways to increase living donor kidney transplantation through kidney paired donation. Compatible pairs, domino chain, combination of kidney paired donation with desensitization or ABO incompatible transplantation, international kidney paired donation, non-simultaneous, extended, altruistic donor chain and list exchange are different ways to expand the donor pool. In absence of national kidney paired donation program, a dedicated kidney paired donation team will increase access to living donor kidney transplantation in individual centres with team work. Use of social networking sites to expand donor pool, HLA based national kidney paired donation program will increase quality and quantity of kidney paired donation transplantation. Transplant centres should remove the barriers to a broader implementation of multicentre, national kidney paired donation program to further optimize potential of kidney paired donation to increase transplantation of O group and sensitized
Ion Pairing and Diffusion in Magnesium Electrolytes Based on Magnesium Borohydride.
Samuel, Devon; Steinhauser, Carl; Smith, Jeffrey G; Kaufman, Aaron; Radin, Maxwell D; Naruse, Junichi; Hiramatsu, Hidehiko; Siegel, Donald J
2017-12-20
One obstacle to realizing a practical, rechargeable magnesium-ion battery is the development of efficient Mg electrolytes. Electrolytes based on simple Mg(BH 4 ) 2 salts suffer from poor salt solubility and/or low conductivity, presumably due to strong ion pairing. Understanding the molecular-scale processes occurring in these electrolytes would aid in overcoming these performance limitations. Toward this goal, the present study examines the solvation, agglomeration, and transport properties of a family of Mg electrolytes based on the Mg(BH 4 ) 2 salt using classical molecular dynamics. These properties were examined across five different solvents (tetrahydrofuran and the glymes G1-G4) and at four salt concentrations ranging from the dilute limit up to 0.4 M. Significant and irreversible salt agglomeration was observed in all solvents at all nondilute Mg(BH 4 ) 2 concentrations. The degree of clustering observed in these divalent Mg systems is much larger than that reported for electrolytes containing monovalent cations, such as Li. The salt agglomeration rate and diffusivity of Mg 2+ were both observed to correlate with solvent self-diffusivity: electrolytes using longer- (shorter-) chain solvents had the lowest (highest) Mg 2+ diffusivity and agglomeration rates. Incorporation of Mg 2+ into Mg 2+ -BH 4 - clusters significantly reduces the diffusivity of Mg 2+ by restricting displacements to localized motion within largely immobile agglomerates. Consequently, diffusion is increasingly impeded with increasing Mg(BH 4 ) 2 concentration. These data are consistent with the solubility limitations observed experimentally for Mg(BH 4 ) 2 -based electrolytes and highlight the need for strategies that minimize salt agglomeration in electrolytes containing divalent cations.
Beisel, Chase L.; Storz, Gisela
2011-01-01
SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161
s± pairing near a Lifshitz transition
Mishra, Vivek; Scalapino, Douglas J.; Maier, Thomas A.
2016-08-26
Observations of robust superconductivity in some of the iron based superconductors in the vicinity of a Lifshitz point where a spin density wave instability is suppressed as the hole band drops below the Fermi energy raise questions for spin-fluctuation theories. In this paper we discuss spin-fluctuation pairing for a bilayer Hubbard model, which goes through such a Lifshitz transition. Our results show s± pairing with a transition temperature that peaks beyond the Lifshitz point and a gap function that has essentially the same magnitude but opposite sign on the incipient hole band as it does on the electron band thatmore » has a Fermi surface.« less
Parietal lesion effects on cued recall following pair associate learning.
Ben-Zvi, Shir; Soroker, Nachum; Levy, Daniel A
2015-07-01
We investigated the involvement of the posterior parietal cortex in episodic memory in a lesion-effects study of cued recall following pair-associate learning. Groups of patients who had experienced first-incident stroke, generally in middle cerebral artery territory, and exhibited damage that included lateral posterior parietal regions, were tested within an early post-stroke time window. In three experiments, patients and matched healthy comparison groups executed repeated study and cued recall test blocks of pairs of words (Experiment 1), pairs of object pictures (Experiment 2), or pairs of object pictures and environmental sounds (Experiment 3). Patients' brain CT scans were subjected to quantitative analysis of lesion volumes. Behavioral and lesion data were used to compute correlations between area lesion extent and memory deficits, and to conduct voxel-based lesion-symptom mapping. These analyses implicated lateral ventral parietal cortex, especially the angular gyrus, in cued recall deficits, most pronouncedly in the cross-modal picture-sound pairs task, though significant parietal lesion effects were also found in the unimodal word pairs and picture pairs tasks. In contrast to an earlier study in which comparable parietal lesions did not cause deficits in item recognition, these results indicate that lateral posterior parietal areas make a substantive contribution to demanding forms of recollective retrieval as represented by cued recall, especially for complex associative representations. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roy, Santanu; Baer, Marcel D.; Mundy, Christopher J.
We present a theory for ion pair dissociation and association, motivated by the concepts of the Marcus theory of electron transfer. Despite the extensive research on ion-pairing in many chemical and biological processes, much can be learned from the exploration of collective reaction coordinates. To this end, we explore two reaction coordinates, ion pair distance and coordination number. The study of the correlation between these reaction coordinates provides a new insight into the mechanism and kinetics of ion pair dissociation and association in water. The potential of mean force on these 2D-surfaces computed from molecular dynamics simulations of different monovalentmore » ion pairs reveal a Marcus-like mechanism for ion-pairing: Water molecules rearrange forming an activated coordination state prior to ion pair dissociation or association, followed by relaxation of the coordination state due to further water rearrangement. Like Marcus theory, we find the existence of an inverted region where the transition rates are slower with increasing exergonicity. This study provides a new perspective for the future investigations of ion-pairing and transport. SR, CJM, and GKS were supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences, and Biosciences. MDB was supported by MS3 (Materials Synthesis and Simulation Across Scales) Initiative, a Laboratory Directed Research and Development Program at Pacific Northwest National Laboratory (PNNL). The research was performed using PNNL Institutional Computing. PNNL is a multi-program national laboratory operated by Battelle for the U.S. Department of Energy.« less
Formation of ion-pairs in aqueous solutions of diclofenac salts.
Fini, A; Fazio, G; Gonzalez-Rodriguez, M; Cavallari, C; Passerini, N; Rodriguez, L
1999-10-05
In this work we studied the ability of the diclofenac anion to form ion-pairs in aqueous solution in the presence of organic and inorganic cations: ion-pairs have a polarity and hydrophobicity more suitable to the partition than each ion considered separately and can be extracted by a lipid phase. The cations considered were those of the organic bases diethylamine, diethanolamine, pyrrolidine, N-(2-hydroxyethyl) pyrrolidine and N-(2-hydroxyethyl) piperidine; the inorganic cations studied were Li(+), Na(+), K(+), Rb(+), Cs(+). Related to each cation we determined the equilibrium constant (K(XD)) for the ion-pair formation with the diclofenac anion in aqueous solution and the water/n-octanol partition coefficient (P(XD)) for each type of ion-pair formed. Among the alkali metal cations, only Li(+) shows some interaction with the diclofenac anion, in agreement with its physiological behaviour of increasing clearance during the administration of diclofenac. The influence of the ionic radius and desolvation enthalpy of the alkali metal cations on the ion-pair formation and partition was briefly discussed. Organic cations promote the formation of ion-pairs with the diclofenac anion better than the inorganic ones, and improve the partition of the ion-pair according to their hydrophobicity. The values of the equilibrium parameters for the formation and partition of ion-pairs are not high enough to allow the direct detection of their presence in the aqueous solution. Their formation can be appreciated in the presence of a lipid phase that continuously extracts the ion-pair. Extraction constants (E(XD)=P(XD) times K(XD)) increase passing from inorga to organic cations. This study could help to clarify the mechanism of the percutaneous absorption of diclofenac in the form of a salt, a route where the formation of ion-pairs appears to play an important role.
Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components
NASA Astrophysics Data System (ADS)
Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik
2015-03-01
We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.
Zhang, Degang
2009-10-30
The energy band structure of FeAs-based superconductors is fitted by a tight-binding model with two Fe ions per unit cell and two degenerate orbitals per Fe ion. Based on this, superconductivity with extended s-wave pairing symmetry of the form cosk(x)+cosk(y) is examined. The local density of states near an impurity is also investigated by using the T-matrix approach. For the nonmagnetic scattering potential, we found that there exist two major resonances inside the gap. The height of the resonance peaks depends on the strength of the impurity potential. These in-gap resonances are originated in the Andreev's bound states due to the quasiparticle scattering between the hole Fermi surfaces around Gamma point with positive order parameter and the electron Fermi surfaces around M point with negative order parameter.
Galactic Pairs in the Early Universe
NASA Astrophysics Data System (ADS)
Kohler, Susanna
2018-02-01
,000 objects. They find that roughly 50 have a redshift of z 7, and 22 have a redshift of z 8. None of the galaxies at z 7 are in pairs, but the sample at z 8 includes three groups for which the distance between galaxies is less than 1 arcsecond.But are these three pairs actual merging galaxies?Conclusions from StatisticsTop: Gas density at z 7.7 in the authors simulation output. Bottom: Mock observations of this output withHubbles WFC3 (left) and JWSTs NIRCam (right). [Adapted from Chaikin et al. 2018]To answer this question, the authors next perform numerical simulations of galaxy formation and produce mock observations showing what the simulatedfield would look like in an equivalent deep Hubble exposure.Based on their simulation statistics, Chaikin and collaborators argue that the three pairs at z 8 do represent an unusually high merger fraction but projection coincidences or lensing are far less likely scenarios to account for all three pairs. If the three pairs are indeed all merging galaxies, it could indicate that this Hubble field corresponds to a local overdensity at a redshift of z 8.Looking AheadThe best way to improve on these measurements is to repeat this study with more advanced telescopes. Chaikin and collaborators demonstrate the superiority of the observations that the upcoming James Webb Space Telescope (JWST) will provide. They also point out the potential power of the Wide Field Infrared Survey Telescope (WFIRST) currently under threat under the proposed 2019 federal budget to extend the observational horizon well into the epoch of reionization.Continued studies backed by the power of these future telescopes are sure to discover a wealth of additional distant galactic duos, helping us to characterize the universe in its early stages.CitationEvgenii A. Chaikin et al 2018 ApJ 853 81. doi:10.3847/1538-4357/aaa196
Zolot, Alexander M; Dagdigian, Paul J; Nesbitt, David J
2008-11-21
Exothermic chemical reaction dynamics at the gas-liquid interface have been investigated by colliding a supersonic beam of F atoms [E(com)=0.7(3) kcalmol] with a continuously refreshed liquid hydrocarbon (squalane) surface under high vacuum conditions. Absolute HF(v,J) product densities are determined by infrared laser absorption spectroscopy, with velocity distributions along the probe axis derived from high resolution Dopplerimetry. Nascent HF(v
NASA Astrophysics Data System (ADS)
Zolot, Alexander M.; Dagdigian, Paul J.; Nesbitt, David J.
2008-11-01
Exothermic chemical reaction dynamics at the gas-liquid interface have been investigated by colliding a supersonic beam of F atoms [Ecom=0.7(3)kcal/mol] with a continuously refreshed liquid hydrocarbon (squalane) surface under high vacuum conditions. Absolute HF(v,J) product densities are determined by infrared laser absorption spectroscopy, with velocity distributions along the probe axis derived from high resolution Dopplerimetry. Nascent HF(v ⩽3) products are formed in a highly nonequilibrium (inverted) vibrational distribution [⟨Evib⟩=13.2(2)kcal/mol], reflecting insufficient time for complete thermal accommodation with the surface prior to desorption. Colder, but still non-Boltzmann, rotational state populations [⟨Erot⟩=1.0(1)kcal/mol] indicate that some fraction of molecules directly scatter into the gas phase without rotationally equilibrating with the surface. Nascent HF also recoils from the liquid surface with excess translational energy, resulting in Doppler broadened linewidths that increase systematically with internal HF excitation. The data are consistent with microscopic branching in HF-surface dynamics following the reactive event, with (i) a direct reactive scattering fraction of newly formed product molecules leaving the surface promptly and (ii) a trapping desorption fraction that accommodates rotationally (though still not vibrationally) with the bulk liquid. Comparison with analogous gas phase F +hydrocarbon processes reveals that the liquid acts as a partial "heat sink" for vibrational energy flow on the time scale of the chemical reaction event.
Majorana edge States in atomic wires coupled by pair hopping.
Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P
2013-10-25
We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.
Kim, Yune; Kim, Nam; Chung, Youngjoo; Paek, Un-Chul; Han, Won-Taek
2004-02-23
We propose a new fiber-type all-optical switching device based on the optical nonlinearity of Yb(3+) doped fiber and a long-period fiber gratings(LPG) pair. The all-optical ON-OFF switching with the continuous wave laser signal at ~1556nm in the LPG pair including the 25.5cm long Yb(3+) doped fiber was demonstrated up to ~200Hz upon pumping with the modulated square wave pulses at 976nm, where a full optical switching with the ~18dB extinction ratio was obtained at the launched pump power of ~35mW.
The influence of arene-ring size on stacking interaction with canonical base pairs
NASA Astrophysics Data System (ADS)
Formánek, Martin; Burda, Jaroslav V.
2014-04-01
Stacking interactions between aromatic molecules (benzene, p-cymene, biphenyl, and di- and tetra-hydrogen anthracene) and G.C and A.T canonical Watson-Crick (WC) base pairs are explored. Two functionals with dispersion corrections: ω-B97XD and B3LYP-D3 are used. For a comparison also the MP2 and B3LYP-D3/PCM methods were used for the most stable p-cymene…WC geometries. It was found that the stacking interaction increases with the size of π-conjugation system. Its extent is in agreement with experimental finding on anticancer activity of Ru(II) piano-stool complexes where intercalation of these aromatic molecules should play an important role. The explored structures are considered as ternary system so that decomposition of the interaction energy to pairwise and non-additivity contributions is also examined.
Influence of oxidized purine processing on strand directionality of mismatch repair.
Repmann, Simone; Olivera-Harris, Maite; Jiricny, Josef
2015-04-17
Replicative DNA polymerases are high fidelity enzymes that misincorporate nucleotides into nascent DNA with a frequency lower than [1/10(5)], and this precision is improved to about [1/10(7)] by their proofreading activity. Because this fidelity is insufficient to replicate most genomes without error, nature evolved postreplicative mismatch repair (MMR), which improves the fidelity of DNA replication by up to 3 orders of magnitude through correcting biosynthetic errors that escaped proofreading. MMR must be able to recognize non-Watson-Crick base pairs and excise the misincorporated nucleotides from the nascent DNA strand, which carries by definition the erroneous genetic information. In eukaryotes, MMR is believed to be directed to the nascent strand by preexisting discontinuities such as gaps between Okazaki fragments in the lagging strand or breaks in the leading strand generated by the mismatch-activated endonuclease of the MutL homologs PMS1 in yeast and PMS2 in vertebrates. We recently demonstrated that the eukaryotic MMR machinery can make use also of strand breaks arising during excision of uracils or ribonucleotides from DNA. We now show that intermediates of MutY homolog-dependent excision of adenines mispaired with 8-oxoguanine (G(O)) also act as MMR initiation sites in extracts of human cells or Xenopus laevis eggs. Unexpectedly, G(O)/C pairs were not processed in these extracts and failed to affect MMR directionality, but extracts supplemented with exogenous 8-oxoguanine DNA glycosylase (OGG1) did so. Because OGG1-mediated excision of G(O) might misdirect MMR to the template strand, our findings suggest that OGG1 activity might be inhibited during MMR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Origin and domestication of papaya Yh chromosome
USDA-ARS?s Scientific Manuscript database
Sex in papaya is controlled by a pair of nascent sex chromosomes. Females are XX, and two slightly different Y chromosomes distinguish males (XY) and hermaphrodites (XYh). The hermaphrodite-specific region of the Yh chromosome (HSY) and its X chromosome counterpart were sequenced and analyzed previo...
Quantifying inbreeding avoidance through extra-pair reproduction
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin
2015-01-01
Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females’ alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females’ within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. PMID:25346331
Quantifying inbreeding avoidance through extra-pair reproduction.
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin
2015-01-01
Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females' alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females' within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.
Zhu, Hong; Xu, Xiaohan; Ahn, Chul
2017-01-01
Paired experimental design is widely used in clinical and health behavioral studies, where each study unit contributes a pair of observations. Investigators often encounter incomplete observations of paired outcomes in the data collected. Some study units contribute complete pairs of observations, while the others contribute either pre- or post-intervention observations. Statistical inference for paired experimental design with incomplete observations of continuous outcomes has been extensively studied in literature. However, sample size method for such study design is sparsely available. We derive a closed-form sample size formula based on the generalized estimating equation approach by treating the incomplete observations as missing data in a linear model. The proposed method properly accounts for the impact of mixed structure of observed data: a combination of paired and unpaired outcomes. The sample size formula is flexible to accommodate different missing patterns, magnitude of missingness, and correlation parameter values. We demonstrate that under complete observations, the proposed generalized estimating equation sample size estimate is the same as that based on the paired t-test. In the presence of missing data, the proposed method would lead to a more accurate sample size estimate comparing with the crude adjustment. Simulation studies are conducted to evaluate the finite-sample performance of the generalized estimating equation sample size formula. A real application example is presented for illustration.
Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B
2001-11-09
Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They
Mlynski, David T.; James, Richard; Croft, Darren P.
2017-01-01
The early social environment can influence the health and behaviour of animals, with effects lasting into adulthood. In Europe, around 60% of dairy calves are reared individually during their first eight weeks of life, while others may be housed in pairs or small groups. This study assessed the effects of varying degrees of social contact on weaning stress, health and production during pen rearing, and on the social networks that calves later formed when grouped. Forty female Holstein-Friesian calves were allocated to one of three treatments: individually housed (I, n = 8), pair-housed from day five (P5, n = 8 pairs), and pair-housed from day 28 (P28, n = 8 pairs). From day 48, calves were weaned by gradual reduction of milk over three days, and vocalisations were recorded as a measure of stress for three days before, during and after weaning. Health and production (growth rate and concentrate intakes) were not affected by treatment during the weaning period or over the whole study. Vocalisations were highest post-weaning, and were significantly higher in I calves than pair-reared calves. Furthermore, P28 calves vocalised significantly more than P5 calves. The social network of calves was measured for one month after all calves were grouped in a barn, using association data from spatial proximity loggers. We tested for week-week stability, social differentiation and assortment in the calf network. Additionally, we tested for treatment differences in: coefficient of variation (CV) in association strength, percentage of time spent with ex-penmate (P5 and P28 calves only) and weighted degree centrality (the sum of the strength of an individual’s associations). The network was relatively stable from weeks one to four and was significantly differentiated, with individuals assorting based on prior familiarity. P5 calves had significantly higher CV in association strength than I calves in week one (indicating more heterogeneous social associations) but there were no
Bolt, Sarah L; Boyland, Natasha K; Mlynski, David T; James, Richard; Croft, Darren P
2017-01-01
The early social environment can influence the health and behaviour of animals, with effects lasting into adulthood. In Europe, around 60% of dairy calves are reared individually during their first eight weeks of life, while others may be housed in pairs or small groups. This study assessed the effects of varying degrees of social contact on weaning stress, health and production during pen rearing, and on the social networks that calves later formed when grouped. Forty female Holstein-Friesian calves were allocated to one of three treatments: individually housed (I, n = 8), pair-housed from day five (P5, n = 8 pairs), and pair-housed from day 28 (P28, n = 8 pairs). From day 48, calves were weaned by gradual reduction of milk over three days, and vocalisations were recorded as a measure of stress for three days before, during and after weaning. Health and production (growth rate and concentrate intakes) were not affected by treatment during the weaning period or over the whole study. Vocalisations were highest post-weaning, and were significantly higher in I calves than pair-reared calves. Furthermore, P28 calves vocalised significantly more than P5 calves. The social network of calves was measured for one month after all calves were grouped in a barn, using association data from spatial proximity loggers. We tested for week-week stability, social differentiation and assortment in the calf network. Additionally, we tested for treatment differences in: coefficient of variation (CV) in association strength, percentage of time spent with ex-penmate (P5 and P28 calves only) and weighted degree centrality (the sum of the strength of an individual's associations). The network was relatively stable from weeks one to four and was significantly differentiated, with individuals assorting based on prior familiarity. P5 calves had significantly higher CV in association strength than I calves in week one (indicating more heterogeneous social associations) but there were no
A Variant of the Mukai Pairing via Deformation Quantization
NASA Astrophysics Data System (ADS)
Ramadoss, Ajay C.
2012-06-01
Let X be a smooth projective complex variety. The Hochschild homology HH•( X) of X is an important invariant of X, which is isomorphic to the Hodge cohomology of X via the Hochschild-Kostant-Rosenberg isomorphism. On HH•( X), one has the Mukai pairing constructed by Caldararu. An explicit formula for the Mukai pairing at the level of Hodge cohomology was proven by the author in an earlier work (following ideas of Markarian). This formula implies a similar explicit formula for a closely related variant of the Mukai pairing on HH•( X). The latter pairing on HH•( X) is intimately linked to the study of Fourier-Mukai transforms of complex projective varieties. We give a new method to prove a formula computing the aforementioned variant of Caldararu's Mukai pairing. Our method is based on some important results in the area of deformation quantization. In particular, we use part of the work of Kashiwara and Schapira on Deformation Quantization modules together with an algebraic index theorem of Bressler, Nest and Tsygan. Our new method explicitly shows that the "Noncommutative Riemann-Roch" implies the classical Riemann-Roch. Further, it is hoped that our method would be useful for generalization to settings involving certain singular varieties.
An improved CCA-secure conditional proxy re-encryption without pairings
NASA Astrophysics Data System (ADS)
Chang, Yanni; He, Mingxing; Li, Xiao; Xing, Pengfei
2014-10-01
In order to solve fine-grained delegation, the definition of conditional proxy re-encryption was proposed and soon draws a lot of attention in recent years. All of the existing schemes except one are based on bilinear pairings, which computation is costly. We point out that the only one existing conditional proxy re-encryption scheme without pairings can not solve fine-grained delegation essentially. Then we propose a new property of conditional proxy re-encryption scheme, that is non-diffusibility, that means if the proxy with a re-encryption key under one condition conclude with delegatee, they can obtain the re-encryption keys under any other conditions. We also propose a concrete CCA-secure conditional proxy re-encryption scheme without pairings. To the best of our knowledge, this is the first CCA-secure conditional proxy re-encryption scheme without pairings, which satisfies the non-diffusibility property.
Using Dictionary Pair Learning for Seizure Detection.
Ma, Xin; Yu, Nana; Zhou, Weidong
2018-02-13
Automatic seizure detection is extremely important in the monitoring and diagnosis of epilepsy. The paper presents a novel method based on dictionary pair learning (DPL) for seizure detection in the long-term intracranial electroencephalogram (EEG) recordings. First, for the EEG data, wavelet filtering and differential filtering are applied, and the kernel function is performed to make the signal linearly separable. In DPL, the synthesis dictionary and analysis dictionary are learned jointly from original training samples with alternating minimization method, and sparse coefficients are obtained by using of linear projection instead of costly [Formula: see text]-norm or [Formula: see text]-norm optimization. At last, the reconstructed residuals associated with seizure and nonseizure sub-dictionary pairs are calculated as the decision values, and the postprocessing is performed for improving the recognition rate and reducing the false detection rate of the system. A total of 530[Formula: see text]h from 20 patients with 81 seizures were used to evaluate the system. Our proposed method has achieved an average segment-based sensitivity of 93.39%, specificity of 98.51%, and event-based sensitivity of 96.36% with false detection rate of 0.236/h.
Pairing versus phase coherence of doped holes in distinct quantum spin backgrounds
NASA Astrophysics Data System (ADS)
Zhu, Zheng; Sheng, D. N.; Weng, Zheng-Yu
2018-03-01
We examine the pairing structure of holes injected into two distinct spin backgrounds: a short-range antiferromagnetic phase versus a symmetry protected topological phase. Based on density matrix renormalization group (DMRG) simulation, we find that although there is a strong binding between two holes in both phases, phase fluctuations can significantly influence the pair-pair correlation depending on the spin-spin correlation in the background. Here the phase fluctuation is identified as an intrinsic string operator nonlocally controlled by the spins. We show that while the pairing amplitude is generally large, the coherent Cooper pairing can be substantially weakened by the phase fluctuation in the symmetry-protected topological phase, in contrast to the short-range antiferromagnetic phase. It provides an example of a non-BCS mechanism for pairing, in which the paring phase coherence is determined by the underlying spin state self-consistently, bearing an interesting resemblance to the pseudogap physics in the cuprate.
Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S
2018-04-01
Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.
Olfactory Interference during Inhibitory Backward Pairing in Honey Bees
Dacher, Matthieu; Smith, Brian H.
2008-01-01
Background Restrained worker honey bees are a valuable model for studying the behavioral and neural bases of olfactory plasticity. The proboscis extension response (PER; the proboscis is the mouthpart of honey bees) is released in response to sucrose stimulation. If sucrose stimulation is preceded one or a few times by an odor (forward pairing), the bee will form a memory for this association, and subsequent presentations of the odor alone are sufficient to elicit the PER. However, backward pairing between the two stimuli (sucrose, then odor) has not been studied to any great extent in bees, although the vertebrate literature indicates that it elicits a form of inhibitory plasticity. Methodology/Principal Findings If hungry bees are fed with sucrose, they will release a long lasting PER; however, this PER can be interrupted if an odor is presented 15 seconds (but not 7 or 30 seconds) after the sucrose (backward pairing). We refer to this previously unreported process as olfactory interference. Bees receiving this 15 second backward pairing show reduced performance after a subsequent single forward pairing (excitatory conditioning) trial. Analysis of the results supported a relationship between olfactory interference and a form of backward pairing-induced inhibitory learning/memory. Injecting the drug cimetidine into the deutocerebrum impaired olfactory interference. Conclusions/Significance Olfactory interference depends on the associative link between odor and PER, rather than between odor and sucrose. Furthermore, pairing an odor with sucrose can lead either to association of this odor to PER or to the inhibition of PER by this odor. Olfactory interference may provide insight into processes that gate how excitatory and inhibitory memories for odor-PER associations are formed. PMID:18946512
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oshiro, Chikara; Takasu, Nobuyuki; Wakugami, Tamio
1995-08-01
Mutation of the cytochrome P450c17 (CYP17) gene causes 17{alpha}-hydroxylase deficiency (170HD). Recently, several researchers have elucidated the molecular basis of 170HD by gene analysis. We experienced a case of 170HD and intended to reveal the abnormality of the CYP17 gene in this Japanese female with 170HD. Leukocytes were obtained from the patient, her mother and sister, and normal control subjects. We amplified the CYP17 gene using polymerase chain reaction and performed the sequence analysis using the dideoxy terminator method and restriction enzyme analysis. We found that the patient had one base-pair deletion at the position of amino acid 438. Anmore » indentical result was obtained with restriction enzyme analysis. This G deletion altered the reading frame and resulted in a premature stop codon at position 443; the ligand of heme iron (Cys: cystine 442) was absent. This small mutation may account for the patient`s clinical manifestations of 170HD. This is the first case of 170HD with only one base pair deletion of the CYP17 gene. 18 refs., 3 figs.« less
Suárez, Martha Y.; Villagrán; Miller, John H.
2015-01-01
We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pairing induced superconductivity in holography
NASA Astrophysics Data System (ADS)
Bagrov, Andrey; Meszena, Balazs; Schalm, Koenraad
2014-09-01
We study pairing induced superconductivity in large N strongly coupled systems at finite density using holography. In the weakly coupled dual gravitational theory the mechanism is conventional BCS theory. An IR hard wall cut-off is included to ensure that we can controllably address the dynamics of a single confined Fermi surface. We address in detail the interplay between the scalar order parameter field and fermion pairing. Adding an explicitly dynamical scalar operator with the same quantum numbers as the fermion-pair, the theory experiences a BCS/BEC crossover controlled by the relative scaling dimensions. We find the novel result that this BCS/BEC crossover exposes resonances in the canonical expectation value of the scalar operator. This occurs not only when the scaling dimension is degenerate with the Cooper pair, but also with that of higher derivative paired operators. We speculate that a proper definition of the order parameter which takes mixing with these operators into account stays finite nevertheless.
[Paired kidneys in transplant].
Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús
2009-02-01
Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.
ERIC Educational Resources Information Center
Edwards, Fleur
2012-01-01
This paper explores the nascent field of risk management in higher education, which is of particular relevance in Australia currently, as the Commonwealth Government implements its plans for a risk-based approach to higher education regulation and quality assurance. The literature outlines the concept of risk management and risk-based approaches…
Dual origin of pairing in nuclei
NASA Astrophysics Data System (ADS)
Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.
2016-11-01
The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.
New Common Proper-Motion Pairs with R.A. Between 00h and 01h
NASA Astrophysics Data System (ADS)
Caballero, Rafael
2015-07-01
This paper presents 37 new common proper-motion pairs. The new pairs have been obtained employing a semi-automatic procedure based on the inspection of images using the tool Aladin, completed with information obtained from the catalogs available at VizieR. All the pairs fulfill the Halbwachs criteria, employed to increase the probability of a physical bond between the two components.
Paired Learning: Tutoring by Non-Teachers. Incorporating "The Paired Reading Bulletin" No. 5.
ERIC Educational Resources Information Center
Paired Reading Bulletin, 1989
1989-01-01
The eight papers constituting the Proceedings of the fourth National Paired Reading Conference are published in an annual bulletin of the Paired Reading Project, together with seven papers constituting the Supplementary Proceedings of the Peer Tutoring Conference, and nine feature articles, as follows: (1) "Whole-School Policy on Parental…
Adler, Adam S.; Bedinger, Daniel; Adams, Matthew S.; Asensio, Michael A.; Edgar, Robert C.; Leong, Renee; Leong, Jackson; Mizrahi, Rena A.; Spindler, Matthew J.; Bandi, Srinivasa Rao; Huang, Haichun; Brams, Peter; Johnson, David S.
2018-01-01
ABSTRACT Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of “randomly paired” scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs. PMID:29376776
NASA Technical Reports Server (NTRS)
Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.
2002-01-01
The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.
Pair correlations in low-lying T =0 states of odd-odd nuclei with six nucleons
NASA Astrophysics Data System (ADS)
Fu, G. J.; Zhao, Y. M.; Arima, A.
2018-02-01
In this paper, we study pair correlations in low-lying T =0 states for two typical cases of odd-odd N =Z nuclei. The first case is six nucleons in a single j =9 /2 shell, for which we study the S -broken-pair approximation, the isoscalar spin-1 pair condensation, and the isoscalar spin-aligned pair condensation, with schematic interactions. In the second case, we study pair approximations and correlation energies for 22Na, 34Cl, 46V, 62Ga, and 94Ag in multi-j shells with effective interactions. A few T =0 states are found to be well represented by isoscalar nucleon pairs. The isoscalar spin-aligned pairs play an important role for the yrast T =0 states with I ˜2 j and I ˜Imax in 22Na, 46V, and 94Ag. The overlap between the isoscalar J =1 pair wave function and the shell-model wave function is around 0.5 for the I =1 ,3 states of 34Cl and the I =1 state of 94Ag. The I =9 state of 62Ga is very well described by the isoscalar J =3 pair condensation. The broken-pair approximation (which is similar to the 2-quasiparticle excitation of the isovector pair condensation) is appropriate for quite few states, such as the I =1 -3 states of 34Cl and the I =5 state of 62Ga. The correlation energies are presented in this paper. It is noted that the picture based on nucleon-pair wave functions is not always in agreement with the picture based on correlation energies.
Rouvinski, Alexander; Karniely, Sharon; Kounin, Maria; Moussa, Sanaa; Goldberg, Miri D.; Warburg, Gabriela; Lyakhovetsky, Roman; Papy-Garcia, Dulce; Kutzsche, Janine; Korth, Carsten; Carlson, George A.; Godsave, Susan F.; Peters, Peter J.; Luhr, Katarina; Kristensson, Krister
2014-01-01
Mammalian prions refold host glycosylphosphatidylinositol-anchored PrPC into β-sheet–rich PrPSc. PrPSc is rapidly truncated into a C-terminal PrP27-30 core that is stable for days in endolysosomes. The nature of cell-associated prions, their attachment to membranes and rafts, and their subcellular locations are poorly understood; live prion visualization has not previously been achieved. A key obstacle has been the inaccessibility of PrP27-30 epitopes. We overcame this hurdle by focusing on nascent full-length PrPSc rather than on its truncated PrP27-30 product. We show that N-terminal PrPSc epitopes are exposed in their physiological context and visualize, for the first time, PrPSc in living cells. PrPSc resides for hours in unexpected cell-surface, slow moving strings and webs, sheltered from endocytosis. Prion strings observed by light and scanning electron microscopy were thin, micrometer-long structures. They were firmly cell associated, resisted phosphatidylinositol-specific phospholipase C, aligned with raft markers, fluoresced with thioflavin, and were rapidly abolished by anti-prion glycans. Prion strings and webs are the first demonstration of membrane-anchored PrPSc amyloids. PMID:24493590
Zhang, Laibin; Li, Huifang; Li, Jilai; Chen, Xiaohua; Bu, Yuxiang
2010-03-01
A comprehensive theoretical study of electronic transitions of naphtho-homologated base analogs, namely, yy-T, yy-C, yy-A, and yy-G, was performed. The nature of the low-lying excited states is discussed, and the results are compared with those from experiment and also with those of y-bases. Geometrical characteristics of the lowest excited singlet pipi* and npi* states were explored using the CIS method, and the effects of methanol solution and paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were examined. The calculated excitation and emission energies agree well with the measured data, where experimental results are available. In methanol solution, the fluorescence from yy-A and yy-G would be expected to occur around 539 and 562 nm, respectively, suggesting that yy-A is a green-colored fluorophore, whereas yy-G is a yellow-colored fluorophore. The methanol solution was found to red-shift both the absorption and emission maxima of yy-A, yy-T, and yy-C, but blue-shift those for yy-G. Generally, though base pairing has no significant effects on the absorption and fluorescence maxima of yy-A, yy-C, and yy-T, it blue-shifts those for yy-G. (c) 2009 Wiley Periodicals, Inc.
Evidence for a Nascent Rift in South Sudan: Westward Extension of the East African Rift System?
NASA Astrophysics Data System (ADS)
Maceira, M.; Van Wijk, J. W.; Coblentz, D. D.; Modrak, R. T.
2013-12-01
Joint inversion of seismic and gravity data of eastern Africa reveals a low seismic wave velocity arm stretching from the southern Main Ethiopian rift westward in an east-west direction that has not been noticed in earlier work. The zone of low velocities is located in the upper mantle and is not overlain by a known structural rift expression. We analyzed the local pattern of seismicity and the stresses in the African plate to interpret this low velocity arm. The zone of low velocities is located within the Central African Fold Belt, which dissects the northern and southern portions of the African continent. It is seismically active with small to intermediate sized earthquakes occurring in the crust. Seven earthquake solutions indicate (oblique) normal faulting and low-angle normal faulting with a NS to NNW-SSE opening direction, as well as strike-slip faulting. This pattern of deformation is typically associated with rifting. The present day stress field in northeastern Africa reveals a tensional state of stress at the location of the low velocity arm with an opening direction that corresponds to the earthquake data. We propose that the South Sudan low velocity zone and seismic center are part of an undeveloped, nascent rift arm. The arm stretches from the East African Rift system westward.
Ren, Shanshan; Bertels, Koen; Al-Ars, Zaid
2018-01-01
GATK HaplotypeCaller (HC) is a popular variant caller, which is widely used to identify variants in complex genomes. However, due to its high variants detection accuracy, it suffers from long execution time. In GATK HC, the pair-HMMs forward algorithm accounts for a large percentage of the total execution time. This article proposes to accelerate the pair-HMMs forward algorithm on graphics processing units (GPUs) to improve the performance of GATK HC. This article presents several GPU-based implementations of the pair-HMMs forward algorithm. It also analyzes the performance bottlenecks of the implementations on an NVIDIA Tesla K40 card with various data sets. Based on these results and the characteristics of GATK HC, we are able to identify the GPU-based implementations with the highest performance for the various analyzed data sets. Experimental results show that the GPU-based implementations of the pair-HMMs forward algorithm achieve a speedup of up to 5.47× over existing GPU-based implementations.
An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs
Lee, Kwan -Soo; Spendelow, Jacob Schatz; Choe, Yoong -Kee; ...
2016-08-22
Here, fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100°C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180°C; however, these devices degrade when exposed to water below 140°C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibitmore » stable performance at 80–160°C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.« less
An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs
NASA Astrophysics Data System (ADS)
Lee, Kwan-Soo; Spendelow, Jacob S.; Choe, Yoong-Kee; Fujimoto, Cy; Kim, Yu Seung
2016-09-01
Fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100 ∘C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180 ∘C however, these devices degrade when exposed to water below 140 ∘C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibit stable performance at 80-160 ∘C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.
A DNA methylation map of human cancer at single base-pair resolution
Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M
2017-01-01
Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination. PMID:28581523
A DNA methylation map of human cancer at single base-pair resolution.
Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M
2017-10-05
Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination.
In response to a proposed vision and strategy for toxicity testing in the 21st century nascent high throughput toxicology (HTT) programs have tested thousands of chemicals in hundreds of pathway-based biological assays. Although, to date, use of HTT data for safety assessment of ...
Nam, HyungSoo; Choi, ByungGil; Oh, Daegun
2018-01-01
In this paper, a three-dimensional (3D)-subspace-based azimuth angle, elevation angle, and range estimation method with auto-pairing is proposed for frequency-modulated continuous waveform (FMCW) radar with an L-shaped array. The proposed method is designed to exploit the 3D shift-invariant structure of the stacked Hankel snapshot matrix for auto-paired azimuth angle, elevation angle, and range estimation. The effectiveness of the proposed method is verified through a variety of experiments conducted in a chamber. For the realization of the proposed method, K-band FMCW radar is implemented with an L-shaped antenna. PMID:29621193
Mondal Roy, Sutapa; Roy, Debesh R; Sahoo, Suban K
2015-11-01
The applicability of Density Functional Theory (DFT) based descriptors for the development of quantitative structure-toxicity relationships (QSTR) is assessed for two different series of toxic aromatic compounds, viz., polyhalogenated dibenzo-p-dioxins (PHDDs) and phenols (PHs). A series of 20 compounds each for PHDDs and PHs with their experimental toxicities (IC50 and IGC50) is chosen in the present study to develop DFT based efficient quantum chemical parameters (QCPs) for explaining the toxin potential of the considered compounds. A systematic analysis to find out the electron donation/acceptance nature of these selected compounds with the considered model biosystems, viz., nucleic acid (NA) bases and DNA base pairs, is performed to identify potential QCPs. Accordingly, PHDDs is found to be electron acceptors whereas phenols as donors, during their interaction with biosystems. Two parameter regression model is carried out comprising global charge transfer (ΔN), and local Fukui Function's for nucleophilic attack (fk(+)) for PHDDs and the same for electrophilic attack (fk(-)) in case of PHs. It is heartening to note that our chosen descriptors, viz, charge transfer (ΔN) and Fukui Function (fk(±)) plays a crucial role by explaining more than 90% of the observed toxic behavior (in terms of correlation-coefficient, R) of PHDDs and PHs. The developed QCPs, viz., ΔN and fk(±) can be added as the new descriptors in the QSTR parlance. Copyright © 2015 Elsevier Inc. All rights reserved.
Maximizing the significance in Higgs boson pair analyses [Mad-Maximized Higgs Pair Analyses
Kling, Felix; Plehn, Tilman; Schichtel, Peter
2017-02-22
Here, we study Higgs pair production with a subsequent decay to a pair of photons and a pair of bottoms at the LHC. We use the log-likelihood ratio to identify the kinematic regions which either allow us to separate the di-Higgs signal from backgrounds or to determine the Higgs self-coupling. We find that both regions are separate enough to ensure that details of the background modeling will not affect the determination of the self-coupling. Assuming dominant statistical uncertainties we determine the best precision with which the Higgs self-coupling can be probed in this channel. We finally comment on the samemore » questions at a future 100 TeV collider.« less
Maximizing the significance in Higgs boson pair analyses [Mad-Maximized Higgs Pair Analyses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kling, Felix; Plehn, Tilman; Schichtel, Peter
Here, we study Higgs pair production with a subsequent decay to a pair of photons and a pair of bottoms at the LHC. We use the log-likelihood ratio to identify the kinematic regions which either allow us to separate the di-Higgs signal from backgrounds or to determine the Higgs self-coupling. We find that both regions are separate enough to ensure that details of the background modeling will not affect the determination of the self-coupling. Assuming dominant statistical uncertainties we determine the best precision with which the Higgs self-coupling can be probed in this channel. We finally comment on the samemore » questions at a future 100 TeV collider.« less
NASA Astrophysics Data System (ADS)
Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz
2018-05-01
We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.
Khachatryan, Vardan
2015-04-24
Results are reported of a general search for pair production of heavy resonances decaying to pairs of hadronic jets in events with at least four jets. The study is based on up to 19.4 fb –1 of integrated luminosity from proton–proton collisions at a center-of-mass energy of 8 TeV, recorded with the CMS detector at the LHC. Limits are determined on the production of scalar top quarks (top squarks) in the framework of R-parity violating supersymmetry and on the production of color-octet vector bosons (colorons). First limits at the LHC are placed on top squark production for two scenarios. Themore » first assumes decay to a bottom quark and a light-flavor quark and is excluded for masses between 200 and 385 GeV, and the second assumes decay to a pair of light-flavor quarks and is excluded for masses between 200 and 350 GeV at 95% confidence level. Furthermore, previous limits on colorons decaying to light-flavor quarks are extended to exclude masses from 200 to 835 GeV.« less
Reid, J M; Arcese, P; Losdat, S
2014-01-01
The evolutionary trajectories of reproductive systems, including both male and female multiple mating and hence polygyny and polyandry, are expected to depend on the additive genetic variances and covariances in and among components of male reproductive success achieved through different reproductive tactics. However, genetic covariances among key components of male reproductive success have not been estimated in wild populations. We used comprehensive paternity data from socially monogamous but genetically polygynandrous song sparrows (Melospiza melodia) to estimate additive genetic variance and covariance in the total number of offspring a male sired per year outside his social pairings (i.e. his total extra-pair reproductive success achieved through multiple mating) and his liability to sire offspring produced by his socially paired female (i.e. his success in defending within-pair paternity). Both components of male fitness showed nonzero additive genetic variance, and the estimated genetic covariance was positive, implying that males with high additive genetic value for extra-pair reproduction also have high additive genetic propensity to sire their socially paired female's offspring. There was consequently no evidence of a genetic or phenotypic trade-off between male within-pair paternity success and extra-pair reproductive success. Such positive genetic covariance might be expected to facilitate ongoing evolution of polygyny and could also shape the ongoing evolution of polyandry through indirect selection. PMID:25186454
NASA Astrophysics Data System (ADS)
Barati, Fatemeh; Grossnickle, Max; Su, Shanshan; Lake, Roger K.; Aji, Vivek; Gabor, Nathaniel M.
2017-12-01
Strong electronic interactions can result in novel particle-antiparticle (electron-hole, e-h) pair generation effects, which may be exploited to enhance the photoresponse of nanoscale optoelectronic devices. Highly efficient e-h pair multiplication has been demonstrated in several important nanoscale systems, including nanocrystal quantum dots, carbon nanotubes and graphene. The small Fermi velocity and nonlocal nature of the effective dielectric screening in ultrathin layers of transition-metal dichalcogenides (TMDs) indicates that e-h interactions are very strong, so high-efficiency generation of e-h pairs from hot electrons is expected. However, such e-h pair multiplication has not been observed in 2D TMD devices. Here, we report the highly efficient multiplication of interlayer e-h pairs in 2D semiconductor heterostructure photocells. Electronic transport measurements of the interlayer I-VSD characteristics indicate that layer-indirect e-h pairs are generated by hot-electron impact excitation at temperatures near T = 300 K. By exploiting this highly efficient interlayer e-h pair multiplication process, we demonstrate near-infrared optoelectronic devices that exhibit 350% enhancement of the optoelectronic responsivity at microwatt power levels. Our findings, which demonstrate efficient carrier multiplication in TMD-based optoelectronic devices, make 2D semiconductor heterostructures viable for a new class of ultra-efficient photodetectors based on layer-indirect e-h excitations.
Heteroditopic receptors for ion-pair recognition.
McConnell, Anna J; Beer, Paul D
2012-05-21
Ion-pair recognition is a new field of research emerging from cation and anion coordination chemistry. Specific types of heteroditopic receptor designs for ion pairs and the complexity of ion-pair binding are discussed to illustrate key concepts such as cooperativity. The importance of this area of research is reflected by the wide variety of potential applications of ion-pair receptors, including applications as membrane transport and salt solubilization agents and sensors. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Properties of Decameter IIIb-III Pairs
NASA Astrophysics Data System (ADS)
Melnik, V. N.; Brazhenko, A. I.; Frantsuzenko, A. V.; Dorovskyy, V. V.; Rucker, H. O.
2018-02-01
A large number of Type IIIb-III pairs, in which the first component is a Type IIIb burst and the second one is a Type III burst, are often recorded during decameter Type III burst storms. From the beginning of their observation, the question of whether the components of these pairs are the first and the second harmonics of radio emission or not has remained open. We discuss properties of decameter IIIb-III pairs in detail to answer this question. The components of these pairs, Type IIIb bursts and Type III bursts, have essentially different durations and polarizations. At the same time their frequency drift rates are rather close, provided that the drift rates of Type IIIb bursts are a little larger those of Type III bursts at the same frequency. Frequency ratios of the bursts at the same moment are close to two. This points at a harmonic connection of the components in IIIb-III pairs. At the same time there was a serious difficulty, namely why the first harmonic had fine frequency structure in the form of striae and the second harmonic did not have it. Recently Loi, Cairns, and Li ( Astrophys. J. 790, 67, 2014) succeeded in solving this problem. The physical aspects of observational properties of decameter IIIb-III pairs are discussed and pros and cons of harmonic character of Type IIIb bursts and Type III bursts in IIIb-III pairs are presented. We conclude that practically all properties of the IIIb-III pair components can be understood in the framework of the harmonic relation of the components of the IIIb-III pairs.
Monte Carlo investigation of thrust imbalance of solid rocket motor pairs
NASA Technical Reports Server (NTRS)
Sforzini, R. H.; Foster, W. A., Jr.
1976-01-01
The Monte Carlo method of statistical analysis is used to investigate the theoretical thrust imbalance of pairs of solid rocket motors (SRMs) firing in parallel. Sets of the significant variables are selected using a random sampling technique and the imbalance calculated for a large number of motor pairs using a simplified, but comprehensive, model of the internal ballistics. The treatment of burning surface geometry allows for the variations in the ovality and alignment of the motor case and mandrel as well as those arising from differences in the basic size dimensions and propellant properties. The analysis is used to predict the thrust-time characteristics of 130 randomly selected pairs of Titan IIIC SRMs. A statistical comparison of the results with test data for 20 pairs shows the theory underpredicts the standard deviation in maximum thrust imbalance by 20% with variability in burning times matched within 2%. The range in thrust imbalance of Space Shuttle type SRM pairs is also estimated using applicable tolerances and variabilities and a correction factor based on the Titan IIIC analysis.
Implementing Diffie-Hellman key exchange using quantum EPR pairs
NASA Astrophysics Data System (ADS)
Mandal, Sayonnha; Parakh, Abhishek
2015-05-01
This paper implements the concepts of perfect forward secrecy and the Diffie-Hellman key exchange using EPR pairs to establish and share a secret key between two non-authenticated parties and transfer messages between them without the risk of compromise. Current implementations of quantum cryptography are based on the BB84 protocol, which is susceptible to siphoning attacks on the multiple photons emitted by practical laser sources. This makes BB84-based quantum cryptography protocol unsuitable for network computing environments. Diffie-Hellman does not require the two parties to be mutually authenticated to each other, yet it can provide a basis for a number of authenticated protocols, most notably the concept of perfect forward secrecy. The work proposed in this paper provides a new direction in utilizing quantum EPR pairs in quantum key exchange. Although, classical cryptography boasts of efficient and robust protocols like the Diffie-Hellman key exchange, in the current times, with the advent of quantum computing they are very much vulnerable to eavesdropping and cryptanalytic attacks. Using quantum cryptographic principles, however, these classical encryption algorithms show more promise and a more robust and secure structure for applications. The unique properties of quantum EPR pairs also, on the other hand, go a long way in removing attacks like eavesdropping by their inherent nature of one particle of the pair losing its state if a measurement occurs on the other. The concept of perfect forward secrecy is revisited in this paper to attribute tighter security to the proposed protocol.
Wang, Maocai; Dai, Guangming; Choo, Kim-Kwang Raymond; Jayaraman, Prem Prakash; Ranjan, Rajiv
2016-01-01
Information confidentiality is an essential requirement for cyber security in critical infrastructure. Identity-based cryptography, an increasingly popular branch of cryptography, is widely used to protect the information confidentiality in the critical infrastructure sector due to the ability to directly compute the user's public key based on the user's identity. However, computational requirements complicate the practical application of Identity-based cryptography. In order to improve the efficiency of identity-based cryptography, this paper presents an effective method to construct pairing-friendly elliptic curves with low hamming weight 4 under embedding degree 1. Based on the analysis of the Complex Multiplication(CM) method, the soundness of our method to calculate the characteristic of the finite field is proved. And then, three relative algorithms to construct pairing-friendly elliptic curve are put forward. 10 elliptic curves with low hamming weight 4 under 160 bits are presented to demonstrate the utility of our approach. Finally, the evaluation also indicates that it is more efficient to compute Tate pairing with our curves, than that of Bertoni et al.
Dai, Guangming
2016-01-01
Information confidentiality is an essential requirement for cyber security in critical infrastructure. Identity-based cryptography, an increasingly popular branch of cryptography, is widely used to protect the information confidentiality in the critical infrastructure sector due to the ability to directly compute the user’s public key based on the user’s identity. However, computational requirements complicate the practical application of Identity-based cryptography. In order to improve the efficiency of identity-based cryptography, this paper presents an effective method to construct pairing-friendly elliptic curves with low hamming weight 4 under embedding degree 1. Based on the analysis of the Complex Multiplication(CM) method, the soundness of our method to calculate the characteristic of the finite field is proved. And then, three relative algorithms to construct pairing-friendly elliptic curve are put forward. 10 elliptic curves with low hamming weight 4 under 160 bits are presented to demonstrate the utility of our approach. Finally, the evaluation also indicates that it is more efficient to compute Tate pairing with our curves, than that of Bertoni et al. PMID:27564373
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
Josephson Parametric Amplifer Based on a Cavity-Embedded Cooper Pair Transistor
NASA Astrophysics Data System (ADS)
Li, Juliang; Rimberg, A. J.
In this experiment a cavity-embedded Cooper-pair transistor (cCPT) is used as a Josephson parametric amplifier. The cCPT consists of a Cooper pair transistor placed at the voltage antinode of a 5.7 GHz shorted quarter-wave resonator so that the CPT provides a galvanic connection between the cavity's central conductor and ground plane, which forms a SQUID loop. Both the flux threading the loop as well as the gate charge can be modulated, and each can provide the parametric pumping. The reflected signal from the cCPT is further amplified by both SLUG and HEMT amplifiers for characterizing the parametric amplification. A first application of the parametric amplification is to improve the charge sensitivity of a single electron charge detector. This can be done either by pumping on a side band or by shifting the charge state of the cCPT near a bifurcation point. Stimulated emission has been also observed when the cCPT is pumped at twice the resonant frequency in the absence of an input signal. This could allow investigation of the dynamic Casimir effect as well as generation of non-classical photon states. Supported by Grants ARO W911NF-13-10377 and NSF DMR 1507400.