Sample records for negatively regulates human

  1. Human myostatin negatively regulates human myoblast growth and differentiation.


    McFarlane, Craig; Hui, Gu Zi; Amanda, Wong Zhi Wei; Lau, Hiu Yeung; Lokireddy, Sudarsanareddy; Xiaojia, Ge; Mouly, Vincent; Butler-Browne, Gillian; Gluckman, Peter D; Sharma, Mridula; Kambadur, Ravi


    Myostatin, a member of the transforming growth factor-β superfamily, has been implicated in the potent negative regulation of myogenesis in murine models. However, little is known about the mechanism(s) through which human myostatin negatively regulates human skeletal muscle growth. Using human primary myoblasts and recombinant human myostatin protein, we show here that myostatin blocks human myoblast proliferation by regulating cell cycle progression through targeted upregulation of p21. We further show that myostatin regulates myogenic differentiation through the inhibition of key myogenic regulatory factors including MyoD, via canonical Smad signaling. In addition, we have for the first time demonstrated the capability of myostatin to regulate the Notch signaling pathway during inhibition of human myoblast differentiation. Treatment with myostatin results in the upregulation of Hes1, Hes5, and Hey1 expression during differentiation; moreover, when we interfere with Notch signaling, through treatment with the γ-secretase inhibitor L-685,458, we find enhanced myotube formation despite the presence of excess myostatin. Therefore, blockade of the Notch pathway relieves myostatin repression of differentiation, and myostatin upregulates Notch downstream target genes. Immunoprecipitation studies demonstrate that myostatin treatment of myoblasts results in enhanced association of Notch1-intracellular domain with Smad3, providing an additional mechanism through which myostatin targets and represses the activity of the myogenic regulatory factor MyoD. On the basis of these results, we suggest that myostatin function and mechanism of action are very well conserved between species, and that myostatin regulation of postnatal myogenesis involves interactions with numerous downstream signaling mediators, including the Notch pathway. PMID:21508334

  2. TET2 Negatively Regulates Nestin Expression in Human Melanoma.


    Gomes, Camilla B F; Zechin, Karina G; Xu, Shuyun; Stelini, Rafael F; Nishimoto, Ines N; Zhan, Qian; Xu, Ting; Qin, Gungwei; Treister, Nathaniel S; Murphy, George F; Lian, Christine G


    Although melanoma is an aggressive cancer, the understanding of the virulence-conferring pathways involved remains incomplete. We have demonstrated that loss of ten-eleven translocation methylcytosine dioxygenase (TET2)-mediated 5-hydroxymethylcytosine (5-hmC) is an epigenetic driver of melanoma growth and a biomarker of clinical virulence. We also have determined that the intermediate filament protein nestin correlates with tumorigenic and invasive melanoma growth. Here we examine the relationships between these two biomarkers. Immunohistochemistry staining of nestin and 5-hmC in 53 clinically annotated primary and metastatic patient melanomas revealed a significant negative correlation. Restoration of 5-hmC, as assessed in a human melanoma cell line by introducing full-length TET2 and TET2-mutated constructs, decreased nestin gene and protein expression in vitro. Genome-wide mapping using hydroxymethylated DNA immunoprecipitation sequencing disclosed significantly less 5-hmC binding in the 3' untranslated region of the nestin gene in melanoma compared to nevi, and 5-hmC binding in this region was significantly increased after TET2 overexpression in human melanoma cells in vitro. Our findings provide evidence suggesting that nestin regulation is negatively controlled epigenetically by TET2 via 5-hmC binding at the 3' untranslated region of the nestin gene, providing one potential pathway for understanding melanoma growth characteristics. Studies are now indicated to further define the interplay between 5-hmC, nestin expression, and melanoma virulence. PMID:27102770

  3. Cardiovascular regulation in humans in response to oscillatory lower body negative pressure

    NASA Technical Reports Server (NTRS)

    Levenhagen, D. K.; Evans, J. M.; Wang, M.; Knapp, C. F.


    The frequency response characteristics of human cardiovascular regulation during hypotensive stress have not been determined. We therefore exposed 10 male volunteers to seven frequencies (0.004-0.1 Hz) of oscillatory lower body negative pressure (OLBNP; 0-50 mmHg). Fourier spectra of arterial pressure (AP), central venous pressure (CVP), stroke volume (SV), cardiac output (CO), heart rate (HR), and total peripheral resistance (TPR) were determined and first harmonic mean, amplitude, and phase angles with respect to OLBNP are presented. AP was relatively well regulated as demonstrated by small oscillations in half amplitude (3.5 mmHg) that were independent of OLBNP frequency and similar to unstressed control spectra. Due to the biomechanics of the system, the magnitudes of oscillations in calf circumference (CC) and CVP decreased with increasing frequency; therefore, we normalized responses by these indexes of the fluid volume shifted. The ratios of oscillations in AP to oscillations in CC increased by an order of magnitude, whereas oscillations in CVP to oscillations in CC and oscillations in AP to oscillations in CVP both tripled between 0.004 and 0.1 Hz. Therefore, even though the amount of fluid shifted by OLBNP decreased with increasing frequency, the magnitude of both CVP and AP oscillations per volume of fluid shifted increased (peaking at 0.08 Hz). The phase relationships between variables, particularly the increasing lags in SV and TPR, but not CVP, indicated that efferent responses with lags of 5-6 s could account for the observed responses. We conclude that, at frequencies below 0.02 Hz, the neural system of humans functioned optimally in regulating AP; OLBNP-induced decreases in SV (by as much as 50%) were counteracted by appropriate oscillations in HR and TPR responses. As OLBNP frequency increased, SV, TPR, and HR oscillations increasingly lagged the input and became less optimally timed for AP regulation.

  4. CD84 negatively regulates IgE high affinity receptor signaling in human mast cells

    PubMed Central

    Álvarez-Errico, Damiana; Oliver-Vila, Irene; Aínsua-Enrich, Erola; Gilfillan, Alasdair M.; Picado, César; Sayós, Joan; Martín, Margarita


    CD84 is a self-binding receptor from the CD150 family that is broadly expressed in hematopoietic cells. It has been described that the adaptors SAP and EAT-2 are critical for CD150 family members signaling and function. We observed that human mast cells express CD84 but lack SAP or EAT-2, that CD84 is tyrosine phosphorylated upon FcεRI engagement, and that the release of granule contents is reduced when FcεRI is co-engaged with CD84 in LAD2 and human CD34+-derived mast cells (huMCs). In addition, we observed that the release of IL-8 and GM-CSF was also reduced in FcεRI/CD84 costimulated cells as compared to FcεRI/Ig control. In order to understand how CD84 down-regulates FcεRI-mediated function, we analyzed signaling pathways affected by CD84 in human mast cells. Our results showed that CD84 dampens FcεRI-mediated calcium mobilization after its co-crosslinking with the receptor. Furthermore, FcεRI-mediated Syk-LAT-PLCγ1 axis activity is down-regulated after CD84 stimulation, compared to FcεRI/Ig control. The inhibitory kinase Fes phosphorylates mainly the inhibitory motif for CD84. Moreover Fes, which has been described to become phosphorylated after substrate binding, also gets phosphorylated when co-expressed with CD84. Consistently, Fes was observed to be more phosphorylated after CD84 and FcεRI co-crosslinking. The phosphorylation of the protein phosphatase SHP-1 also increases after CD84 and FcεRI coengagement. Taken together, our results show that CD84 is highly expressed in mast cells and that it contributes to the regulation of FcεRI signaling in a SAP and EAT-2 independent and Fes and SHP-1 dependent mechanisms. PMID:22068234

  5. TNF-related apoptosis-inducing ligand (TRAIL) as a negative regulator of normal human erythropoiesis.


    Zamai, L; Secchiero, P; Pierpaoli, S; Bassini, A; Papa, S; Alnemri, E S; Guidotti, L; Vitale, M; Zauli, G


    The impact of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) on normal hematopoietic development was investigated using adult peripheral blood CD34(+) hematopoietic progenitor cells, induced to differentiate along the erythroid, megakaryocytic, granulocytic, and monocytic lineages by the addition of specific cytokine cocktails. TRAIL selectively reduced the number of erythroblasts, showing intermediate levels of glycophorin A (glycophorin A(interm)) surface expression, which appeared in liquid cultures supplemented with stem cell factor + interleukin 3 + erythropoietin at days 7-10. However, neither immature (day 4) glycophorin A(dim) erythroid cells nor mature (day 14) glycophorin A(bright) erythroblasts were sensitive to TRAIL-mediated apoptosis. Moreover, pre-exposure to TRAIL significantly decreased the number and size of erythroid colonies in semisolid assays. These adverse effects of TRAIL were selective for erythropoiesis, as TRAIL did not significantly influence the survival of cells differentiating along the megakaryocytic, granulocytic, or monocytic lineages. Furthermore, TRAIL was detected by Western blot analysis in lysates obtained from normal bone marrow mononuclear cells. These findings indicate that TRAIL acts in a lineage- and stage of differentiation-specific manner, as a negative regulator of normal erythropoiesis. (Blood. 2000;95:3716-3724) PMID:10845902

  6. Cortical regions associated with autonomic cardiovascular regulation during lower body negative pressure in humans.


    Kimmerly, Derek S; O'Leary, Deborah D; Menon, Ravi S; Gati, Joseph S; Shoemaker, J Kevin


    The purpose of the present study was to determine the cortical structures involved with integrated baroreceptor-mediated modulation of autonomic cardiovascular function in conscious humans independent of changes in arterial blood pressure. We assessed the brain regions associated with lower body negative pressure (LBNP)-induced baroreflex control using functional magnetic resonance imaging with blood oxygen level-dependent (BOLD) contrast in eight healthy male volunteer subjects. The levels of LBNP administered were 5, 15 and 35 mmHg. Heart rate (HR; representing the cardiovascular response) and LBNP (representing the baroreceptor activation level) were simultaneously monitored during the scanning period. In addition, estimated central venous pressure (CVP), arterial blood pressure (ABP) and muscle sympathetic nerve activity were recorded on a separate session. Random effects analyses (SPM2) were used to evaluate significant (P < 0.05) BOLD signal changes that correlated separately with both LBNP and HR (15- and 35-mmHg versus 5-mmHg LBNP). Compared to baseline, steady-state LBNP at 15 and 35 mmHg decreased CVP (from 7 +/- 1 to 5 +/- 1 and 4 +/- 1 mmHg, respectively) and increased MSNA (from 12 +/- 1 to 23 +/- 3 and 36 +/- 4 bursts min(-1), respectively, both P < 0.05 versus baseline). Furthermore, steady-state LBNP elevated HR from 54 +/- 2 beats min(-1) at baseline to 64 +/- 2 beats min(-1) at 35-mmHg suction. Both mean arterial and pulse pressure were not different between rest and any level of LBNP. Cortical regions demonstrating increased activity that correlated with higher HR and greater LBNP included the right superior posterior insula, frontoparietal cortex and the left cerebellum. Conversely, using the identical statistical paradigm, bilateral anterior insular cortices, the right anterior cingulate, orbitofrontal cortex, amygdala, midbrain and mediodorsal nucleus of the thalamus showed decreased neural activation. These data corroborate previous

  7. CYP2S1 is negatively regulated by corticosteroids in human cell lines.


    Bebenek, Ilona G; Solaimani, Parrisa; Bui, Peter; Hankinson, Oliver


    Cytochrome P450s are monooxygenase proteins involved in the metabolism of both exogenous and endogenous compounds. CYP2S1 can metabolize eicosanoids in the absence of both NADPH and NADPH cytochrome P450 reductase, and can also activate the anticancer agent 1 AQ4N [1,4-bis{[2-(dimethylamino-N-oxide)ethyl]amino}-5,8-dihydroxy anthracene-9,10-dione]. CYP2S1 is mainly expressed in extrahepatic tissues such as the trachea, lung, stomach, small intestine, spleen, skin, breast, kidney and placenta. Furthermore, increased expression of CYP2S1 occurs in several tumors of epithelial origin, making the characterization of CYP2S1 regulation relevant to the treatment of disease. We report that the synthetic glucocorticoid receptor ligand dexamethasone (DEX) represses CYP2S1 expression. The ED(50) is between 1 nM and 3 nM and maximal repression is reached by 48 h. Other corticosteroids are also effective at repressing CYP2S1. We show that repression by DEX is mediated by the glucocorticoid receptor and requires histone deacetylase activity.

  8. Negative growth regulation in a glioblastoma tumor cell line that conditionally expresses human wild-type p53

    SciTech Connect

    Mercer, W.E.; Shields, M.T.; Amin, M.; Sauve, G.J. ); Appella, E.; Romano, J.W.; Ullrich, S.J. )


    To investigate the effect that human wild-type p53 (wt-p53) expression has on cell proliferation the authors constructed a recombinant plasmid, pM47, in which wt-p53 cDNA is under transcriptional control of the hormone-inducible mouse mammary tumor virus promoter linked to the dominant biochemical selection marker gene Eco gpt. The pM47 plasmid was introduced into T98G cells derived from a human glioblastomas multiforme tumor, and a stable clonal cell line, GM47.23, was derived that conditionally expressed wt-p53 following exposure to dexamethasone. The authors show that induction of wt-p53 expression in exponentially growing cells inhibits cell cycle progression and that the inhibitory effect is reversible upon removal of the inducer or infection with simian virus 40. Moreover, when growth-arrested cells are stimulated to proliferate, induction of wt-p53 expression inhibits G{sub 0}/G{sub 1} progression into S phase and the cells accumulate with a DNA content equivalent to cells arrested in the G{sub 0}/G{sub 1} phase of the cell cycle. Taken together, these studies suggest that wt-p53 may play a negative role in growth regulation.

  9. A novel human aquaporin-4 splice variant exhibits a dominant-negative activity: a new mechanism to regulate water permeability

    PubMed Central

    De Bellis, Manuela; Pisani, Francesco; Mola, Maria Grazia; Basco, Davide; Catalano, Francesco; Nicchia, Grazia Paola; Svelto, Maria; Frigeri, Antonio


    Two major isoforms of aquaporin-4 (AQP4) have been described in human tissue. Here we report the identification and functional analysis of an alternatively spliced transcript of human AQP4, AQP4-Δ4, that lacks exon 4. In transfected cells AQP4-Δ4 is mainly retained in the endoplasmic reticulum and shows no water transport properties. When AQP4-Δ4 is transfected into cells stably expressing functional AQP4, the surface expression of the full-length protein is reduced. Furthermore, the water transport activity of the cotransfectants is diminished in comparison to transfectants expressing only AQP4. The observed down-regulation of both the expression and water channel activity of AQP4 is likely to originate from a dominant-negative effect caused by heterodimerization between AQP4 and AQP4-Δ4, which was detected in coimmunoprecipitation studies. In skeletal muscles, AQP4-Δ4 mRNA expression inversely correlates with the level of AQP4 protein and is physiologically associated with different types of skeletal muscles. The expression of AQP4-Δ4 may represent a new regulatory mechanism through which the cell-surface expression and therefore the activity of AQP4 can be physiologically modulated. PMID:24356448

  10. CRNDE affects the malignant biological characteristics of human glioma stem cells by negatively regulating miR-186

    PubMed Central

    Zheng, Jian; Li, Xiao-dong; Wang, Ping; Liu, Xiao-bai; Xue, Yi-xue; Hu, Yi; Li, Zhen; Li, Zhi-qing; Wang, Zhen-hua; Liu, Yun-hui


    The long non-coding RNA Colorectal neoplasia differentially expressed (CRNDE) is a novel gene that activated early in colorectal neoplasia, but it is also up-regulated in many other solid tumors. Herein, the function and underlying mechanism of CRNDE in regulating glioma stem cells (GSCs) were investigated. We found that CRNDE expression was up-regulated while miR-186 expression was down-regulated in GSCs. Overexpression of CRNDE could promote the cellular proliferation, migration, invasion and inhibit the apoptosis in GSCs. Overexpression of miR-186 exerted functions of inhibiting the proliferation, migration and invasion of GSCs and promoting apoptosis. And CRNDE decreased the expression levels of XIAP and PAK7 by binding to miR-186 and negatively regulating it. In addition, miR-186 binded to XIAP and PAK7 3′UTR region, and decrease the expression of them, thus regulating the expression levels of downstream target proteins such as caspase 3, BAD, cyclin D1 and MARK2. The in vivo effect of CRNDE and miR-186 showed that the tumor formation rate was minimum in tumor-bearing nude mice with the knockdown of CRNDE and the overexpression of miR-186. In conclusion, CRNDE played an oncogenic role of GSCs through the negative regulation of miR-186. Both CRNDE and miR-186 could be regarded as potential targets in the glioma therapy. PMID:26231038

  11. Negative regulators of cell proliferation

    NASA Technical Reports Server (NTRS)

    Johnson, T. C.; Spooner, B. S. (Principal Investigator)


    Cell proliferation is governed by the influence of both mitogens and inhibitors. Although cell contact has long been thought to play a fundamental role in cell cycling regulation, and negative regulators have long been suspected to exist, their isolation and purification has been complicated by a variety of technical difficulties. Nevertheless, over recent years an ever-expanding list of putative negative regulators have emerged. In many cases, their biological inhibitory activities are consistent with density-dependent growth inhibition. Most likely their interactions with mitogenic agents, at an intracellular level, are responsible for either mitotic arrest or continued cell cycling. A review of naturally occurring cell growth inhibitors is presented with an emphasis on those factors shown to be residents of the cell surface membrane. Particular attention is focused on a cell surface sialoglycopeptide, isolated from intact bovine cerebral cortex cells, which has been shown to inhibit the proliferation of an unusually wide range of target cells. The glycopeptide arrest cells obtained from diverse species, both fibroblasts and epithelial cells, and a broad variety of transformed cells. Signal transduction events and a limited spectrum of cells that are refractory to the sialoglycopeptide have provided insight into the molecular events mediated by this cell surface inhibitor.

  12. Myostatin acts as an autocrine/paracrine negative regulator in myoblast differentiation from human induced pluripotent stem cells

    SciTech Connect

    Gao, Fei; Kishida, Tsunao; Ejima, Akika; Gojo, Satoshi; Mazda, Osam


    Highlights: ► iPS-derived cells express myostatin and its receptor upon myoblast differentiation. ► Myostatin inhibits myoblast differentiation by inhibiting MyoD and Myo5a induction. ► Silencing of myostatin promotes differentiation of human iPS cells into myoblasts. -- Abstract: Myostatin, also known as growth differentiation factor (GDF-8), regulates proliferation of muscle satellite cells, and suppresses differentiation of myoblasts into myotubes via down-regulation of key myogenic differentiation factors including MyoD. Recent advances in stem cell biology have enabled generation of myoblasts from pluripotent stem cells, but it remains to be clarified whether myostatin is also involved in regulation of artificial differentiation of myoblasts from pluripotent stem cells. Here we show that the human induced pluripotent stem (iPS) cell-derived cells that were induced to differentiate into myoblasts expressed myostatin and its receptor during the differentiation. An addition of recombinant human myostatin (rhMyostatin) suppressed induction of MyoD and Myo5a, resulting in significant suppression of myoblast differentiation. The rhMyostatin treatment also inhibited proliferation of the cells at a later phase of differentiation. RNAi-mediated silencing of myostatin promoted differentiation of human iPS-derived embryoid body (EB) cells into myoblasts. These results strongly suggest that myostatin plays an important role in regulation of myoblast differentiation from iPS cells of human origin. The present findings also have significant implications for potential regenerative medicine for muscular diseases.

  13. Myostatin acts as an autocrine/paracrine negative regulator in myoblast differentiation from human induced pluripotent stem cells.


    Gao, Fei; Kishida, Tsunao; Ejima, Akika; Gojo, Satoshi; Mazda, Osam


    Myostatin, also known as growth differentiation factor (GDF-8), regulates proliferation of muscle satellite cells, and suppresses differentiation of myoblasts into myotubes via down-regulation of key myogenic differentiation factors including MyoD. Recent advances in stem cell biology have enabled generation of myoblasts from pluripotent stem cells, but it remains to be clarified whether myostatin is also involved in regulation of artificial differentiation of myoblasts from pluripotent stem cells. Here we show that the human induced pluripotent stem (iPS) cell-derived cells that were induced to differentiate into myoblasts expressed myostatin and its receptor during the differentiation. An addition of recombinant human myostatin (rhMyostatin) suppressed induction of MyoD and Myo5a, resulting in significant suppression of myoblast differentiation. The rhMyostatin treatment also inhibited proliferation of the cells at a later phase of differentiation. RNAi-mediated silencing of myostatin promoted differentiation of human iPS-derived embryoid body (EB) cells into myoblasts. These results strongly suggest that myostatin plays an important role in regulation of myoblast differentiation from iPS cells of human origin. The present findings also have significant implications for potential regenerative medicine for muscular diseases. PMID:23291166

  14. Global functional profiling of human ubiquitome identifies E3 ubiquitin ligase DCST1 as a novel negative regulator of Type-I interferon signaling

    PubMed Central

    Nair, Sajith; Bist, Pradeep; Dikshit, Neha; Krishnan, Manoj N


    Type I interferon (IFN-I) mediated innate immune response controls virus infections by inducing the expression of interferon stimulated genes (ISGs). Although ubiquitination plays key roles in immune signaling regulation, a human genome-wide understanding of the role of E3 ubiquitin ligases in interferon mediated ISG induction is lacking. Here, we report a genome-wide profiling of the effect of ectopic expression of 521 E3 ubiquitin ligases and substrate recognition subunits encoded in the human genome (which constitutes 84.4% of all ubiquitination related genes encoded in the human genome, hereafter termed Human Ubiquitome) on IFNβ mediated induction of interferon stimulated DNA response element (ISRE) driven reporter activity. We identified 96 and 42 genes of the human ubiquitome as novel negative and positive regulators of interferon signaling respectively. Furthermore, we characterized DCST1 as a novel E3 ubiquitin ligase negatively regulating interferon response. Ectopic expression and gene silencing of DCST1 respectively attenuated and increased ISRE reporter activity. DCST1 regulated Type I interferon signaling by interacting with and promoting ubiquitination-mediated degradation of STAT2, an essential component of antiviral gene induction. In summary, this study provided a systems level view on the role of human ubiquitination associated genes in Type I interferon response. PMID:27782195

  15. Leukocyte-associated immunoglobulin-like receptor-1 is expressed on human megakaryocytes and negatively regulates the maturation of primary megakaryocytic progenitors and cell line

    SciTech Connect

    Xue, Jiangnan; Zhang, Xiaoshu; Zhao, Haiya; Fu, Qiang; Cao, Yanning; Wang, Yuesi; Feng, Xiaoying; Fu, Aili


    Research highlights: {yields} LAIR-1 is expressed on human megakaryocytes from an early stage. {yields} Up-regulation of LAIR-1 negatively regulates megakaryocytic differentiation of cell line. {yields} LAIR-1 negatively regulates the differentiation of primary megakaryocytic progenitors. -- Abstract: Leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) is an inhibitory collagen receptor which belongs to the immunoglobulin (Ig) superfamily. Although the inhibitory function of LAIR-1 has been extensively described in multiple leukocytes, its role in megakaryocyte (MK) has not been explored so far. Here, we show that LAIR-1 is expressed on human bone marrow CD34{sup +}CD41a{sup +} and CD41a{sup +}CD42b{sup +} cells. LAIR-1 is also detectable in a fraction of human cord blood CD34{sup +} cell-derived MK that has morphological characteristics of immature MK. In megakaryoblastic cell line Dami, the membrane protein expression of LAIR-1 is up-regulated significantly when cells are treated with phorbol ester phorbol 12-myristate 13-acetate (PMA). Furthermore, cross-linking of LAIR-1 in Dami cells with its natural ligand or anti-LAIR-1 antibody leads to the inhibition of cell proliferation and PMA-promoted differentiation when examined by the MK lineage-specific markers (CD41a and CD42b) and polyploidization. In addition, we also observed that cross-linking of LAIR-1 results in decreased MK generation from primary human CD34{sup +} cells cultured in a cytokines cocktail that contains TPO. These results suggest that LAIR-1 is a likely candidate for an early marker of MK differentiation, and provide initial evidence indicating that LAIR-1 serves as a negative regulator of megakaryocytopoiesis.

  16. FZD6 expression is negatively regulated by miR-199a-5p in human colorectal cancer

    PubMed Central

    Kim, Bong-Kyu; Yoo, Hye-In; Kim, Injung; Park, Jongkeun; Yoon, Sungjoo Kim


    Colorectal cancer (CRC), the third most common cancer worldwide, also has the highest rate of cancer-related morbidity and mortality. WNT signaling is initiated by binding of WNT to various receptors, including frizzleds (FZDs), and plays a critical role in CRC and other tumor development by regulating proliferation, differentiation, migration, apoptosis, and polarity. Among the members of the FZD family, FZD6 is broadly expressed in various tissues, and its overexpression has been reported in several cancers, suggesting an important role in cancer development. In this study, we investigated the expression of FZD6 in patients with CRC and found it to be increased in tumors, as compared to paired adjacent non-tumor tissues. Additionally, we found that FZD6 expression was negatively regulated by miR199a5p in CRC cells. These results suggest that overexpression of FZD6, mediated by reduced expression of miR-199a-5p, may play an important role in the development of CRC. [BMB Reports 2015; 48(6): 360-366] PMID:25772759

  17. Measuring Generalized Expectancies for Negative Mood Regulation.

    ERIC Educational Resources Information Center

    Catanzaro, Salvatore J.; Mearns, Jack

    Research has suggested the utility of studying individual differences in the regulation of negative mood states. Generalized response expectancies for negative mood regulation were defined as expectancies that some overt behavior or cognition would alleviate negative mood states as they occur across situations. The Generalized Expectancy for…

  18. A double-negative feedback loop between E2F3b and miR- 200b regulates docetaxel chemosensitivity of human lung adenocarcinoma cells

    PubMed Central

    Gao, Yanping; Chen, Longbang; Song, Haizhu; Chen, Yitian; Wang, Rui; Feng, Bing


    MicroRNAs (miRNAs) are non-coding small RNAs which negatively regulate gene expressions mainly through 3′-untranslated region (3′-UTR) binding of target mRNAs. Recent studies have highlighted the feedback loops between miRNAs and their target genes in physiological and pathological processes including chemoresistance of cancers. Our previous study identified miR-200b/E2F3 axis as a chemosensitivity restorer of human lung adenocarcinoma (LAD) cells. Moreover, E2F3b was bioinformatically proved to be a potential transcriptional regulator of pre-miR-200b gene promoter. The existance of this double-negative feedback minicircuitry comprising E2F3b and miR-200b was confirmed by chromatin immunoprecipitation (ChIP) assay, site-specific mutation and luciferase reporter assay. And the underlying regulatory mechanisms of this feedback loop on docetaxel resistance of LAD cells were further investigated by applying in vitro chemosensitivity assay, colony formation assay, flow cytometric analysis of cell cycle and apoptosis, as well as mice xenograft model. In conclusion, our results suggest that the double-negative feedback loop between E2F3b and miR-200b regulates docetaxel chemosensitivity of human LAD cells mainly through cell proliferation, cell cycle distribution and apoptosis. PMID:27027446

  19. The 3' flanking region of the human ABO histo-blood group gene is involved in negative regulation of gene expression.


    Sano, Rie; Nakajima, Tamiko; Takahashi, Keiko; Kubo, Rieko; Yazawa, Shin; Kominato, Yoshihiko


    Gene expression is driven by promoters, enhancers, silencers, and other cis-regulatory elements upstream and downstream of the gene. Previous studies of the regulation of human ABO gene transcription have focused mainly on the 5' region, including the core promoter and the region proximal to it. However, as the involvement of the 3' flanking region in transcriptional regulation has not yet been examined, we focused on this issue. The 3' region approximately 2.2kb downstream of the ABO gene was PCR-amplified and inserted into a cloning vector, followed by sequence determination and preparation of luciferase reporter vectors. Transient transfections into KATOIII and K562 cells were performed using various reporter plasmids containing the 3' region. The 3' region of the ABO gene, which was characterized by a high degree of sequence repetition, was effectively cloned by a single-copy cloning method. Transfections in KATOIII and K562 cells showed that negative elements were demonstrable within the 3' region. These observations suggest that negative regulatory elements seem to be present in the 3' region of ABO in both epithelial and erythroid lineages. As we had observed a negative region just upstream of the ABO promoter, transcription from ABO could be negatively regulated by repressive regions just upstream of the promoter and downstream of the gene. Further studies of the enhancer will be required for elucidating the molecular basis of ABO gene expression. PMID:21144789

  20. G-CSF regulates macrophage phenotype and associates with poor overall survival in human triple-negative breast cancer

    PubMed Central

    Hollmén, Maija; Karaman, Sinem; Schwager, Simon; Lisibach, Angela; Christiansen, Ailsa J.; Maksimow, Mikael; Varga, Zsuzsanna; Jalkanen, Sirpa; Detmar, Michael


    ABSTRACT Tumor-associated macrophages (TAMs) have been implicated in the promotion of breast cancer growth and metastasis, and a strong infiltration by TAMs has been associated with estrogen receptor (ER)-negative tumors and poor prognosis. However, the molecular mechanisms behind these observations are unclear. We investigated macrophage activation in response to co-culture with several breast cancer cell lines (T47D, MCF-7, BT-474, SKBR-3, Cal-51 and MDA-MB-231) and found that high granulocyte colony-stimulating factor (G-CSF) secretion by the triple-negative breast cancer (TNBC) cell line MDA-MB-231 gave rise to immunosuppressive HLA-DRlo macrophages that promoted migration of breast cancer cells via secretion of TGF-α. In human breast cancer samples (n = 548), G-CSF was highly expressed in TNBC (p < 0.001) and associated with CD163+ macrophages (p < 0.0001), poorer overall survival (OS) (p = 0.021) and significantly increased numbers of TGF-α+ cells. While G-CSF blockade in the 4T1 mammary tumor model promoted maturation of MHCIIhi blood monocytes and TAMs and significantly reduced lung metastasis, anti-CSF-1R treatment promoted MHCIIloF4/80hiMRhi anti-inflammatory TAMs and enhanced lung metastasis in the presence of high G-CSF levels. Combined anti-G-CSF and anti-CSF-1R therapy significantly increased lymph node metastases, possibly via depletion of the so-called “gate-keeper” subcapsular sinus macrophages. These results indicate that G-CSF promotes the anti-inflammatory phenotype of tumor-induced macrophages when CSF-1R is inhibited and therefore caution against the use of M-CSF/CSF-1R targeting agents in tumors with high G-CSF expression. PMID:27141367

  1. MicroRNA-544 down-regulates both Bcl6 and Stat3 to inhibit tumor growth of human triple negative breast cancer.


    Zhu, Zhengzhi; Wang, Shengying; Zhu, Jinhai; Yang, Qifeng; Dong, Huiming; Huang, Jiankang


    Triple negative breast cancer lacking estrogen receptor (ER), progesterone receptor and Her2 account for account for the majority of the breast cancer deaths, due to the lack of specific gene targeted therapy. Our current study aimed to investigate the role of miR-544 in triple negative breast cancer. Endogenous levels of miR-544 were significantly lower in breast cancer cell lines than in human breast non-tumorigenic and mammary epithelial cell lines. We found that miR-544 directly targeted the 3'-untranslated region (UTR) on both Bcl6 and Stat3 mRNAs, and overexpression of miR-544 in triple negative breast cancer cells significantly down-regulated expressions of Bcl6 and Stat3, which in turn severely inhibited cancer cell proliferation, migration and invasion in vitro. Employing a mouse xenograft model to examine the in vivo function of miR-544, we found that expression of miR-544 significantly repressed the growth of xenograft tumors. Our current study reported miR-544 as a tumor-suppressor microRNA particularly in triple negative breast cancer. Our data supported the role of miR-544 as a potential biomarker in developing gene targeted therapies in the clinical treatment of triple negative breast cancer.

  2. Integrated mRNA-MicroRNA Profiling of Human NK Cell Differentiation Identifies MiR-583 as a Negative Regulator of IL2Rγ Expression

    PubMed Central

    Kim, Jung Min; Lee, Hyun-Jun; Song, Hae Young; Kim, Young Kyeung; Jung, Haiyoung; Park, Young-Jun; Yoon, Suk Ran; Oh, Sei-Ryang; Kim, Tae-Don; Choi, Inpyo


    Natural killer (NK) cells are innate immune effector cells that protect against cancer and some viral infections. Until recently, most studies have investigated the molecular signatures of human or mouse NK cells to identify genes that are specifically expressed during NK cell development. However, the mechanism regulating NK cell development remains unclear. Here, we report a regulatory network of potential interactions during in vitro differentiation of human NK cells, identified using genome-wide mRNA and miRNA databases through hierarchical clustering analysis, gene ontology analysis and a miRNA target prediction program. The microRNA (miR)-583, which demonstrated the largest ratio change in mature NK cells, was highly correlated with IL2 receptor gamma (IL2Rγ) expression. The overexpression of miR-583 had an inhibitory effect on NK cell differentiation. In a reporter assay, the suppressive effect of miR-583 was ablated by mutating the putative miR-583 binding site of the IL2Rγ 3′ UTR. Therefore, we show that miR-583 acts as a negative regulator of NK cell differentiation by silencing IL2Rγ. Additionally, we provide a comprehensive database of genome-wide mRNA and miRNA expression during human NK cell differentiation, offering a better understanding of basic human NK cell biology for the application of human NK cells in immunotherapy. PMID:25313504

  3. Identification of a novel human kinase supporter of Ras (hKSR-2) that functions as a negative regulator of Cot (Tpl2) signaling.


    Channavajhala, Padma L; Wu, Leeying; Cuozzo, John W; Hall, J Perry; Liu, Wei; Lin, Lih-Ling; Zhang, Yuhua


    Kinase suppressor of Ras (KSR) is an integral and conserved component of the Ras signaling pathway. Although KSR is a positive regulator of the Ras/mitogen-activated protein (MAP) kinase pathway, the role of KSR in Cot-mediated MAPK activation has not been identified. The serine/threonine kinase Cot (also known as Tpl2) is a member of the MAP kinase kinase kinase (MAP3K) family that is known to regulate oncogenic and inflammatory pathways; however, the mechanism(s) of its regulation are not precisely known. In this report, we identify an 830-amino acid novel human KSR, designated hKSR-2, using predictions from genomic data base mining based on the structural profile of the KSR kinase domain. We show that, similar to the known human KSR, hKSR-2 co-immunoprecipitates with many signaling components of the Ras/MAPK pathway, including Ras, Raf, MEK-1, and ERK-1/2. In addition, we demonstrate that hKSR-2 co-immunoprecipitates with Cot and that co-expression of hKSR-2 with Cot significantly reduces Cot-mediated MAPK and NF-kappaB activation. This inhibition is specific to Cot, because Ras-induced ERK and IkappaB kinase-induced NF-kappaB activation are not significantly affected by hKSR-2 co-expression. Moreover, Cot-induced interleukin-8 production in HeLa cells is almost completely inhibited by the concurrent expression of hKSR-2, whereas transforming growth factor beta-activated kinase 1 (TAK1)/TAK1-binding protein 1 (TAB1)-induced interleukin-8 production is not affected by hKSR-2 co-expression. Taken together, these results indicate that hKSR-2, a new member of the KSR family, negatively regulates Cot-mediated MAP kinase and NF-kappaB pathway signaling. PMID:12975377

  4. Host response during Yersinia pestis infection of human bronchial epithelial cells involves negative regulation of autophagy and suggests a modulation of survival-related and cellular growth pathways

    PubMed Central

    Alem, Farhang; Yao, Kuan; Lane, Douglas; Calvert, Valerie; Petricoin, Emanuel F.; Kramer, Liana; Hale, Martha L.; Bavari, Sina; Panchal, Rekha G.; Hakami, Ramin M.


    Yersinia pestis (Yp) causes the re-emerging disease plague, and is classified by the CDC and NIAID as a highest priority (Category A) pathogen. Currently, there is no approved human vaccine available and advances in early diagnostics and effective therapeutics are urgently needed. A deep understanding of the mechanisms of host response to Yp infection can significantly advance these three areas. We employed the Reverse Phase Protein Microarray (RPMA) technology to reveal the dynamic states of either protein level changes or phosphorylation changes associated with kinase-driven signaling pathways during host cell response to Yp infection. RPMA allowed quantitative profiling of changes in the intracellular communication network of human lung epithelial cells at different times post infection and in response to different treatment conditions, which included infection with the virulent Yp strain CO92, infection with a derivative avirulent strain CO92 (Pgm-, Pst-), treatment with heat inactivated CO92, and treatment with LPS. Responses to a total of 111 validated antibodies were profiled, leading to discovery of 12 novel protein hits. The RPMA analysis also identified several protein hits previously reported in the context of Yp infection. Furthermore, the results validated several proteins previously reported in the context of infection with other Yersinia species or implicated for potential relevance through recombinant protein and cell transfection studies. The RPMA results point to strong modulation of survival/apoptosis and cell growth pathways during early host response and also suggest a model of negative regulation of the autophagy pathway. We find significant cytoplasmic localization of p53 and reduced LC3-I to LC3-II conversion in response to Yp infection, consistent with negative regulation of autophagy. These studies allow for a deeper understanding of the pathogenesis mechanisms and the discovery of innovative approaches for prevention, early diagnosis, and

  5. Schistosoma mansoni Soluble Egg Antigens Induce Expression of the Negative Regulators SOCS1 and SHP1 in Human Dendritic Cells via Interaction with the Mannose Receptor

    PubMed Central

    Klaver, Elsenoor J.; Kuijk, Loes M.; Lindhorst, Thisbe K.; Cummings, Richard D.; van Die, Irma


    Schistosomiasis is a common debilitating human parasitic disease in (sub)tropical areas, however, schistosome infections can also protect against a variety of inflammatory diseases. This has raised broad interest in the mechanisms by which Schistosoma modulate the immune system into an anti-inflammatory and regulatory state. Human dendritic cells (DCs) show many phenotypic changes upon contact with Schistosoma mansoni soluble egg antigens (SEA). We here show that oxidation of SEA glycans, but not heat-denaturation, abrogates the capacity of SEA to suppress both LPS-induced cytokine secretion and DC proliferation, indicating an important role of SEA glycans in these processes. Remarkably, interaction of SEA glycans with DCs results in a strongly increased expression of Suppressor Of Cytokine Signalling1 (SOCS1) and SH2-containing protein tyrosine Phosphatase-1 (SHP1), important negative regulators of TLR4 signalling. In addition, SEA induces the secretion of transforming growth factor β (TGF-β), and the surface expression of the costimulatory molecules Programmed Death Ligand-1 (PD-L1) and OX40 ligand (OX40L), which are known phenotypic markers for the capacity of DCs to polarize naïve T cells into Th2/Treg cell subsets. Inhibition of mannose receptor (MR)-mediated internalization of SEA into DCs by blocking with allyl α-D-mannoside or anti-MR antibodies, significantly reduced SOCS1 and SHP1 expression. In conclusion, we demonstrate that SEA glycans are essential for induction of enhanced SOCS1 and SHP1 levels in DCs via the MR. Our data provide novel mechanistic evidence for the potential of S. mansoni SEA glycans to modulate human DCs, which may contribute to the capacity of SEA to down-regulate inflammatory responses. PMID:25897665

  6. Schistosoma mansoni Soluble Egg Antigens Induce Expression of the Negative Regulators SOCS1 and SHP1 in Human Dendritic Cells via Interaction with the Mannose Receptor.


    Klaver, Elsenoor J; Kuijk, Loes M; Lindhorst, Thisbe K; Cummings, Richard D; van Die, Irma


    Schistosomiasis is a common debilitating human parasitic disease in (sub)tropical areas, however, schistosome infections can also protect against a variety of inflammatory diseases. This has raised broad interest in the mechanisms by which Schistosoma modulate the immune system into an anti-inflammatory and regulatory state. Human dendritic cells (DCs) show many phenotypic changes upon contact with Schistosoma mansoni soluble egg antigens (SEA). We here show that oxidation of SEA glycans, but not heat-denaturation, abrogates the capacity of SEA to suppress both LPS-induced cytokine secretion and DC proliferation, indicating an important role of SEA glycans in these processes. Remarkably, interaction of SEA glycans with DCs results in a strongly increased expression of Suppressor Of Cytokine Signalling1 (SOCS1) and SH2-containing protein tyrosine Phosphatase-1 (SHP1), important negative regulators of TLR4 signalling. In addition, SEA induces the secretion of transforming growth factor β (TGF-β), and the surface expression of the costimulatory molecules Programmed Death Ligand-1 (PD-L1) and OX40 ligand (OX40L), which are known phenotypic markers for the capacity of DCs to polarize naïve T cells into Th2/Treg cell subsets. Inhibition of mannose receptor (MR)-mediated internalization of SEA into DCs by blocking with allyl α-D-mannoside or anti-MR antibodies, significantly reduced SOCS1 and SHP1 expression. In conclusion, we demonstrate that SEA glycans are essential for induction of enhanced SOCS1 and SHP1 levels in DCs via the MR. Our data provide novel mechanistic evidence for the potential of S. mansoni SEA glycans to modulate human DCs, which may contribute to the capacity of SEA to down-regulate inflammatory responses. PMID:25897665

  7. The Bel1 protein of human foamy virus contains one positive and two negative control regions which regulate a distinct activation domain of 30 amino acids.

    PubMed Central

    Lee, C W; Chang, J; Lee, K J; Sung, Y C


    The Bel1 transactivator is essential for the replication of human foamy virus (HFV). To define the functional domains of HFV Bel1, we generated random missense mutations throughout the entire coding sequence of Bel1. Functional analyses of 24 missense mutations have revealed the presence of at least two functional domains in Bel1. One domain corresponds to a basic amino acid-rich motif which acts as a bipartite nuclear targeting sequence. A second, central domain corresponds to a presumed effector region which, when mutated, leads to dominant-negative mutants and/or lacks transactivating ability. In addition, deletion analyses and domain-swapping experiments further showed that Bel1 protein contains a strong carboxy-terminal activation domain. The activating region is also capable of functioning as a transcription-activating domain in yeast cells, although it does not bear any significant sequence homology to the well-characterized acidic activation domain which is known to function only in yeast and mammalian cells. We also demonstrated that the regions of Bel1 from residues 1 to 76 and from residues 153 to 225 repressed transcriptional activation exerted by the Bel1 activation domain. In contrast, the region from residues 82 to 150 appears to overcome an inhibitory effect. These results indicate that Bel1 contains one positive and two negative regulatory domains that modulate a distinct activation domain of Bel1. These regulatory domains of Bel1 cannot affect the function of the VP16 activation domain, suggesting that these domains specifically regulate the activation domain of Bel1. Furthermore, in vivo competition experiments showed that the positive regulatory domain acts in trans. Thus, our results demonstrate that Bel1-mediated transactivation appears to undergo a complex regulatory pathway which provides a novel mode of regulation for a transcriptional activation domain. Images PMID:8139046

  8. microRNA-497 induces cell apoptosis by negatively regulating Bcl-2 protein expression at the posttranscriptional level in human breast cancer

    PubMed Central

    Wei, Chuankui; Luo, Qifeng; Sun, Xiaoguo; Li, Dengfeng; Song, Hongming; Li, Xiaoyu; Song, Jialu; Hua, Kaiyao; Fang, Lin


    Many studies have demonstrated that microRNAs (miRNAs) may play vital roles in the development of breast cancer. The aim of this study was to examine the expression levels of miR-497 in human breast cancer and investigate whether its potential roles involved targeting Bcl-2. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to examine the expression levels of miR-497 in 48 breast cancer specimens and six breast cancer cell lines. MTT assay, colony formation assay, and flow cytometry were conducted to explore the potential functions of miR-497 in human MDA-MB-231 breast cancer cells. Correlation analysis and dual-luciferase reporter assay were performed to validate whether Bcl-2 was a direct target of miR-497. The effects of modulating miR-497 on endogenous levels of Bcl-2 were subsequently confirmed via qRT-PCR and western blot. MTT assay, colony formation assay and flow cytometry were used to indicate the roles of endogenous Bcl-2 in breast cancer cells. miR-497 expression levels were significantly decreased in human breast cancer specimens and cell lines (P<0.05). Overexpression of miR-497 in breast cancer cells suppressed cell proliferation and induced apoptosis. Correlation analysis indicated that miR-497 was highly inversely correlated with Bcl-2 protein expression in breast cancer specimens. Dual-luciferase reporter assays confirmed that Bcl-2 was a direct target of miR-497. qRT-PCR and western blot showed that miR-497 negatively regulated Bcl-2 protein expression but had no impact on mRNA expression of Bcl-2. Knockdown of Bcl-2 expression in MDA-MB-231 cells significantly suppressed cell proliferation and promoted apoptosis. Our study suggests that miR-497 may act as a breast cancer suppressor through negative regulation of Bcl-2 protein expression at the posttranscriptional levels. Therefore, targeting miR-497 may provide a novel strategy for the diagnosis and treatment of patients with this lethal disease. PMID

  9. Purinergic P2Y2 Receptor Control of Tissue Factor Transcription in Human Coronary Artery Endothelial Cells: NEW AP-1 TRANSCRIPTION FACTOR SITE AND NEGATIVE REGULATOR.


    Liu, Yiwei; Zhang, Lingxin; Wang, Chuan; Roy, Shama; Shen, Jianzhong


    We recently reported that the P2Y2 receptor (P2Y2R) is the predominant nucleotide receptor expressed in human coronary artery endothelial cells (HCAEC) and that P2Y2R activation by ATP or UTP induces dramatic up-regulation of tissue factor (TF), a key initiator of the coagulation cascade. However, the molecular mechanism of this P2Y2R-TF axis remains unclear. Here, we report the role of a newly identified AP-1 consensus sequence in the TF gene promoter and its original binding components in P2Y2R regulation of TF transcription. Using bioinformatics tools, we found that a novel AP-1 site at -1363 bp of the human TF promoter region is highly conserved across multiple species. Activation of P2Y2R increased TF promoter activity and mRNA expression in HCAEC. Truncation, deletion, and mutation of this distal AP-1 site all significantly suppressed TF promoter activity in response to P2Y2R activation. EMSA and ChIP assays further confirmed that upon P2Y2R activation, c-Jun, ATF-2, and Fra-1, but not the typical c-Fos, bound to the new AP-1 site. In addition, loss-of-function studies using siRNAs confirmed a positive transactivation role of c-Jun and ATF-2 but unexpectedly revealed a strong negative role of Fra-1 in P2Y2R-induced TF up-regulation. Furthermore, we found that P2Y2R activation promoted ERK1/2 phosphorylation through Src, leading to Fra-1 activation, whereas Rho/JNK mediated P2Y2R-induced activation of c-Jun and ATF-2. These findings reveal the molecular basis for P2Y G protein-coupled receptor control of endothelial TF expression and indicate that targeting the P2Y2R-Fra-1-TF pathway may be an attractive new strategy for controlling vascular inflammation and thrombogenicity associated with endothelial dysfunction.

  10. Placental endoplasmic reticulum stress negatively regulates transcription of placental growth factor via ATF4 and ATF6β: implications for the pathophysiology of human pregnancy complications.


    Mizuuchi, Masahito; Cindrova-Davies, Tereza; Olovsson, Matts; Charnock-Jones, D Stephen; Burton, Graham J; Yung, Hong Wa


    Low maternal circulating concentrations of placental growth factor (PlGF) are one of the hallmarks of human pregnancy complications, including fetal growth restriction (FGR) and early-onset pre-eclampsia (PE). Currently, PlGF is used clinically with other biomarkers to screen for high-risk cases, although the mechanisms underlying its regulation are largely unknown. Placental endoplasmic reticulum (ER) stress has recently been found to be elevated in cases of FGR, and to an even greater extent in early-onset PE complicated with FGR. ER stress activates the unfolded protein response (UPR); attenuation of protein translation and a reduction in cell growth and proliferation play crucial roles in the pathophysiology of these complications of pregnancy. In this study, we further identified that ER stress regulates release of PlGF. We first observed that down-regulation of PlGF protein was associated with nuclear localization of ATF4, ATF6α and ATF6β in the syncytiotrophoblast of placentae from PE patients. Transcript analysis showed a decrease of PlGF mRNA, and an increase from genes encoding those UPR transcription factors in placentae from cases of early-onset PE, but not of late-onset (>34 weeks) PE, compared to term controls. Further investigations indicated a strong correlation between ATF4 and PlGF mRNA levels only (r = - 0.73, p < 0.05). These results could be recapitulated in trophoblast-like cells exposed to chemical inducers of ER stress or hypoxia-reoxygenation. The stability of PlGF transcripts was unchanged. The use of small interfering RNA specific for transcription factors in the UPR pathways revealed that ATF4 and ATF6β, but not ATF6α, modulate PlGF transcription. To conclude, ATF4 and ATF6β act synergistically in the negative regulation of PlGF mRNA expression, resulting in reduced PlGF secretion by the trophoblast in response to stress. Therefore, these results further support the targeting of placental ER stress as a potential new therapeutic

  11. Rhizobial gibberellin negatively regulates host nodule number

    PubMed Central

    Tatsukami, Yohei; Ueda, Mitsuyoshi


    In legume–rhizobia symbiosis, the nodule number is controlled to ensure optimal growth of the host. In Lotus japonicus, the nodule number has been considered to be tightly regulated by host-derived phytohormones and glycopeptides. However, we have discovered a symbiont-derived phytohormonal regulation of nodule number in Mesorhizobium loti. In this study, we found that M. loti synthesized gibberellic acid (GA) under symbiosis. Hosts inoculated with a GA-synthesis-deficient M. loti mutant formed more nodules than those inoculated with the wild-type form at four weeks post inoculation, indicating that GA from already-incorporated rhizobia prevents new nodule formation. Interestingly, the genes for GA synthesis are only found in rhizobial species that inhabit determinate nodules. Our findings suggest that the already-incorporated rhizobia perform GA-associated negative regulation of nodule number to prevent delayed infection by other rhizobia. PMID:27307029

  12. Negative regulation and developmental competence in Aspergillus

    PubMed Central

    Lee, Mi-Kyung; Kwon, Nak-Jung; Lee, Im-Soon; Jung, Seunho; Kim, Sun-Chang; Yu, Jae-Hyuk


    Asexual development (conidiation) in the filamentous fungus Aspergillus nidulans is governed by orchestrated gene expression. The three key negative regulators of conidiation SfgA, VosA, and NsdD act at different control point in the developmental genetic cascade. Here, we have revealed that NsdD is a key repressor affecting the quantity of asexual spores in Aspergillus. Moreover, nullifying both nsdD and vosA results in abundant formation of the development specific structure conidiophores even at 12 h of liquid culture, and near constitutive activation of conidiation, indicating that acquisition of developmental competence involves the removal of negative regulation exerted by both NsdD and VosA. NsdD’s role in repressing conidiation is conserved in other aspergilli, as deleting nsdD causes enhanced and precocious activation of conidiation in Aspergillus fumigatus or Aspergillus flavus. In vivo NsdD-DNA interaction analyses identify three NsdD binding regions in the promoter of the essential activator of conidiation brlA, indicating a direct repressive role of NsdD in conidiation. Importantly, loss of flbC or flbD encoding upstream activators of brlA in the absence of nsdD results in delayed activation of brlA, suggesting distinct positive roles of FlbC and FlbD in conidiation. A genetic model depicting regulation of conidiation in A. nidulans is presented. PMID:27364479

  13. Weight Loss Upregulates the Small GTPase DIRAS3 in Human White Adipose Progenitor Cells, Which Negatively Regulates Adipogenesis and Activates Autophagy via Akt–mTOR Inhibition

    PubMed Central

    Ejaz, Asim; Mitterberger, Maria C.; Lu, Zhen; Mattesich, Monika; Zwierzina, Marit E.; Hörl, Susanne; Kaiser, Andreas; Viertler, Hans-Peter; Rostek, Ursula; Meryk, Andreas; Khalid, Sana; Pierer, Gerhard; Bast, Robert C.; Zwerschke, Werner


    Long-term weight-loss (WL) interventions reduce insulin serum levels, protect from obesity, and postpone age-associated diseases. The impact of long-term WL on adipose-derived stromal/progenitor cells (ASCs) is unknown. We identified DIRAS3 and IGF-1 as long-term WL target genes up-regulated in ASCs in subcutaneous white adipose tissue of formerly obese donors (WLDs). We show that DIRAS3 negatively regulates Akt, mTOR and ERK1/2 signaling in ASCs undergoing adipogenesis and acts as a negative regulator of this pathway and an activator of autophagy. Studying the IGF-1–DIRAS3 interaction in ASCs of WLDs, we demonstrate that IGF-1, although strongly up-regulated in these cells, hardly activates Akt, while ERK1/2 and S6K1 phosphorylation is activated by IGF-1. Overexpression of DIRAS3 in WLD ASCs completely inhibits Akt phosphorylation also in the presence of IGF-1. Phosphorylation of ERK1/2 and S6K1 is lesser reduced under these conditions. In conclusion, our key findings are that DIRAS3 down-regulates Akt–mTOR signaling in ASCs of WLDs. Moreover, DIRAS3 inhibits adipogenesis and activates autophagy in these cells. PMID:27211557

  14. Nitric oxide negatively regulates mammalian adult neurogenesis

    NASA Astrophysics Data System (ADS)

    Packer, Michael A.; Stasiv, Yuri; Benraiss, Abdellatif; Chmielnicki, Eva; Grinberg, Alexander; Westphal, Heiner; Goldman, Steven A.; Enikolopov, Grigori


    Neural progenitor cells are widespread throughout the adult central nervous system but only give rise to neurons in specific loci. Negative regulators of neurogenesis have therefore been postulated, but none have yet been identified as subserving a significant role in the adult brain. Here we report that nitric oxide (NO) acts as an important negative regulator of cell proliferation in the adult mammalian brain. We used two independent approaches to examine the function of NO in adult neurogenesis. In a pharmacological approach, we suppressed NO production in the rat brain by intraventricular infusion of an NO synthase inhibitor. In a genetic approach, we generated a null mutant neuronal NO synthase knockout mouse line by targeting the exon encoding active center of the enzyme. In both models, the number of new cells generated in neurogenic areas of the adult brain, the olfactory subependyma and the dentate gyrus, was strongly augmented, which indicates that division of neural stem cells in the adult brain is controlled by NO and suggests a strategy for enhancing neurogenesis in the adult central nervous system.

  15. Negative regulation of Yap during neuronal differentiation

    PubMed Central

    Zhang, Huanqing; Deo, Monika; Thompson, Robert C.; Uhler, Michael D.; Turner, David L.


    Regulated proliferation and cell cycle exit are essential aspects of neurogenesis. The Yap transcriptional coactivator controls proliferation in a variety of tissues during development, and this activity is negatively regulated by kinases in the Hippo signaling pathway. We find that Yap is expressed in mitotic mouse retinal progenitors and it is downregulated during neuronal differentiation. Forced expression of Yap prolongs proliferation in the postnatal mouse retina, whereas inhibition of Yap by RNA interference (RNAi) decreases proliferation and increases differentiation. We show Yap is subject to post-translational inhibition in the retina, and also downregulated at the level of mRNA expression. Using a cell culture model, we find that expression of the proneural basic helix-loop-helix (bHLH) transcription factors Neurog2 or Ascl1 downregulates Yap mRNA levels, and simultaneously inhibits Yap protein via activation of the Lats1 and/or Lats2 kinases. Conversely, overexpression of Yap prevents proneural bHLH proteins from initiating cell cycle exit. We propose that mutual inhibition between proneural bHLH proteins and Yap is an important regulator of proliferation and cell cycle exit during mammalian neurogenesis. PMID:22037235

  16. FOXM1 regulates expression of eukaryotic elongation factor 2 kinase and promotes proliferation, invasion and tumorgenesis of human triple negative breast cancer cells

    PubMed Central

    Hamurcu, Zuhal; Ashour, Ahmed; Kahraman, Nermin; Ozpolat, Bulent


    Eukaryotic elongation factor 2 kinase (eEF2K), an emerging molecular target for cancer therapy, contributes to cancer proliferation, cell survival, tumorigenesis, and invasion, disease progression and drug resistance. Although eEF2K is highly up-regulated in various cancers, the mechanism of gene regulation has not been elucidated. In this study, we examined the role of Forkhead Box M1 (FOXM1) proto-oncogenic transcription factor in triple negative breast cancer (TNBC) cells and the regulation of eEF2K. We found that FOXM1 is highly upregulated in TNBC and its knockdown by RNA interference (siRNA) significantly inhibited eEF2K expression and suppressed cell proliferation, colony formation, migration, invasion and induced apoptotic cell death, recapitulating the effects of eEF2K inhibition. Knockdown of FOXM1 inhibited regulators of cell cycle, migration/invasion and survival, including cyclin D1, Src and MAPK-ERK signaling pathways, respectively. We also demonstrated that FOXM1 (1B and 1C isoforms) directly binds to and transcriptionally regulates eEF2K gene expression by chromatin immunoprecipitation (ChIP) and luciferase gene reporter assays. Furthermore, in vivo inhibition of FOXM1 by liposomal siRNA-nanoparticles suppressed growth of MDA-MB-231 TNBC tumor xenografts in orthotopic models. In conclusion, our study provides the first evidence about the transcriptional regulation of eEF2K in TNBC and the role of FOXM1 in mediating breast cancer cell proliferation, survival, migration/invasion, progression and tumorgenesis and highlighting the potential of FOXM1/eEF2K axis as a molecular target in breast and other cancers. PMID:26918606

  17. Susi, a negative regulator of Drosophila PI3-kinase.


    Wittwer, Franz; Jaquenoud, Malika; Brogiolo, Walter; Zarske, Marcel; Wüstemann, Philipp; Fernandez, Rafael; Stocker, Hugo; Wymann, Matthias P; Hafen, Ernst


    The Phosphatidylinositol-3 kinase/Protein Kinase B (PI3K/PKB) signaling pathway controls growth, metabolism, and lifespan in animals, and deregulation of its activity is associated with diabetes and cancer in humans. Here, we describe Susi, a coiled-coil domain protein that acts as a negative regulator of insulin signaling in Drosophila. Whereas loss of Susi function increases body size, overexpression of Susi reduces growth. We provide genetic evidence that Susi negatively regulates dPI3K activity. Susi directly binds to dP60, the regulatory subunit of dPI3K. Since Susi has no overt similarity to known inhibitors of PI3K/PKB signaling, it defines a novel mechanism by which this signaling cascade is kept in check. The fact that Susi is expressed in a circadian rhythm, with highest levels during the night, suggests that Susi attenuates insulin signaling during the fasting period.

  18. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.


    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  19. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.


    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  20. Human choice under schedules of negative reinforcement.


    Alessandri, Jérôme; Cançado, Carlos R X


    The generalized matching equation provides a good description of response allocation in concurrent schedules of positive reinforcement in nonhumans as well as in humans. The present experiment was conducted to further investigate the allocation of responding under concurrent schedules of negative reinforcement (i.e., timeouts from pressing a force cell) in humans. Each of three participants was exposed to different reinforcement ratios (9:1, 1:1 and 1:9) in the terminal links of a concurrent-chains schedule of negative reinforcement. The allocation of responding under this schedule was well described by the generalized matching equation, for each participant. These results replicate previous findings obtained with nonhumans and humans under concurrent schedules of positive reinforcement. In addition, they extend the results reported by Alessandri and Rivière (2013) showing that human behavior maintained by timeouts from an effortful response is sensitive to changes in relative reinforcement ratios as well as relative delays of reinforcement. PMID:26518610

  1. Human choice under schedules of negative reinforcement.


    Alessandri, Jérôme; Cançado, Carlos R X


    The generalized matching equation provides a good description of response allocation in concurrent schedules of positive reinforcement in nonhumans as well as in humans. The present experiment was conducted to further investigate the allocation of responding under concurrent schedules of negative reinforcement (i.e., timeouts from pressing a force cell) in humans. Each of three participants was exposed to different reinforcement ratios (9:1, 1:1 and 1:9) in the terminal links of a concurrent-chains schedule of negative reinforcement. The allocation of responding under this schedule was well described by the generalized matching equation, for each participant. These results replicate previous findings obtained with nonhumans and humans under concurrent schedules of positive reinforcement. In addition, they extend the results reported by Alessandri and Rivière (2013) showing that human behavior maintained by timeouts from an effortful response is sensitive to changes in relative reinforcement ratios as well as relative delays of reinforcement.

  2. Cultural differences in hedonic emotion regulation after a negative event.


    Miyamoto, Yuri; Ma, Xiaoming; Petermann, Amelia G


    Beliefs about emotions can influence how people regulate their emotions. The present research examined whether Eastern dialectical beliefs about negative emotions lead to cultural differences in how people regulate their emotions after experiencing a negative event. We hypothesized that, because of dialectical beliefs about negative emotions prevalent in Eastern culture, Easterners are less motivated than Westerners to engage in hedonic emotion regulation-up-regulation of positive emotions and down-regulation of negative emotions. By assessing online reactions to a recent negative event, Study 1 found that European Americans are more motivated to engage in hedonic emotion regulation. Furthermore, consistent with the reported motivation to regulate emotion hedonically, European Americans show a steeper decline in negative emotions 1 day later than do Asians. By examining retrospective memory of reactions to a past negative event, Study 2 further showed that cultural differences in hedonic emotion regulation are mediated by cultural differences in dialectical beliefs about motivational and cognitive utility of negative emotions, but not by personal deservingness or self-efficacy beliefs. These findings demonstrate the role of cultural beliefs in shaping emotion regulation and emotional experiences. PMID:24708499

  3. Cultural differences in hedonic emotion regulation after a negative event.


    Miyamoto, Yuri; Ma, Xiaoming; Petermann, Amelia G


    Beliefs about emotions can influence how people regulate their emotions. The present research examined whether Eastern dialectical beliefs about negative emotions lead to cultural differences in how people regulate their emotions after experiencing a negative event. We hypothesized that, because of dialectical beliefs about negative emotions prevalent in Eastern culture, Easterners are less motivated than Westerners to engage in hedonic emotion regulation-up-regulation of positive emotions and down-regulation of negative emotions. By assessing online reactions to a recent negative event, Study 1 found that European Americans are more motivated to engage in hedonic emotion regulation. Furthermore, consistent with the reported motivation to regulate emotion hedonically, European Americans show a steeper decline in negative emotions 1 day later than do Asians. By examining retrospective memory of reactions to a past negative event, Study 2 further showed that cultural differences in hedonic emotion regulation are mediated by cultural differences in dialectical beliefs about motivational and cognitive utility of negative emotions, but not by personal deservingness or self-efficacy beliefs. These findings demonstrate the role of cultural beliefs in shaping emotion regulation and emotional experiences.

  4. Glycogen Synthase Kinase-3β (GSK3β) Negatively Regulates PTTG1/Human Securin Protein Stability, and GSK3β Inactivation Correlates with Securin Accumulation in Breast Tumors*

    PubMed Central

    Mora-Santos, Mar; Limón-Mortés, M. Cristina; Giráldez, Servando; Herrero-Ruiz, Joaquín; Sáez, Carmen; Japón, Miguel Á.; Tortolero, Maria; Romero, Francisco


    PTTG1, also known as securin, is an inactivating partner of separase, the major effector for chromosome segregation during mitosis. At the metaphase-to-anaphase transition, securin is targeted for proteasomal destruction by the anaphase-promoting complex or cyclosome, allowing activation of separase. In addition, securin is overexpressed in metastatic or genomically instable tumors, suggesting a relevant role for securin in tumor progression. Stability of securin is regulated by phosphorylation; some phosphorylated forms are degraded out of mitosis, by the action of the SKP1-CUL1-F-box protein (SCF) complex. The kinases targeting securin for proteolysis have not been identified, and mechanistic insight into the cause of securin accumulation in human cancers is lacking. Here, we demonstrate that glycogen synthase kinase-3β (GSK3β) phosphorylates securin to promote its proteolysis via SCFβTrCP E3 ubiquitin ligase. Importantly, a strong correlation between securin accumulation and GSK3β inactivation was observed in breast cancer tissues, indicating that GSK3β inactivation may account for securin accumulation in breast cancers. PMID:21757741

  5. RelA-Induced Interferon Response Negatively Regulates Proliferation

    PubMed Central

    Kochupurakkal, Bose S.; Wang, Zhigang C.; Hua, Tony; Culhane, Aedin C.; Rodig, Scott J.; Rajkovic-Molek, Koraljka; Lazaro, Jean-Bernard; Richardson, Andrea L.; Biswas, Debajit K.; Iglehart, J. Dirk


    Both oncogenic and tumor-suppressor activities are attributed to the Nuclear Factor kappa B (NF-kB) pathway. Moreover, NF-kB may positively or negatively regulate proliferation. The molecular determinants of these opposing roles of NF-kB are unclear. Using primary human mammary epithelial cells (HMEC) as a model, we show that increased RelA levels and consequent increase in basal transcriptional activity of RelA induces IRF1, a target gene. Induced IRF1 upregulates STAT1 and IRF7, and in consort, these factors induce the expression of interferon response genes. Activation of the interferon pathway down-regulates CDK4 and up-regulates p27 resulting in Rb hypo-phosphorylation and cell cycle arrest. Stimulation of HMEC with IFN-γ elicits similar phenotypic and molecular changes suggesting that basal activity of RelA and IFN-γ converge on IRF1 to regulate proliferation. The anti-proliferative RelA-IRF1-CDK4 signaling axis is retained in ER+/HER2- breast tumors analyzed by The Cancer Genome Atlas (TCGA). Using immuno-histochemical analysis of breast tumors, we confirm the negative correlation between RelA levels and proliferation rate in ER+/HER2- breast tumors. These findings attribute an anti-proliferative tumor-suppressor role to basal RelA activity. Inactivation of Rb, down-regulation of RelA or IRF1, or upregulation of CDK4 or IRF2 rescues the RelA-IRF1-CDK4 induced proliferation arrest in HMEC and are points of disruption in aggressive tumors. Activity of the RelA-IRF1-CDK4 axis may explain favorable response to CDK4/6 inhibition observed in patients with ER+ Rb competent tumors. PMID:26460486

  6. Negative transfer in human associative learning.


    Griffiths, Oren; Johnson, Ameika M; Mitchell, Chris J


    Models of attentional allocation in associative learning are typically structured according to one of two guiding principles: the predictiveness principle, which posits that attention is paid to cues that have reliably predicted an outcome in the past, or the uncertainty principle, which states that attention is paid to cues about which little is known. Both principles are well supported by studies of animals. However, in studies of human learning, there is very little direct empirical support for the uncertainty principle. In the study reported here, we addressed this gap by investigating negative transfer, a phenomenon that may provide unique support for the uncertainty principle. In two human learning experiments using an allergist task, we replicated the primary findings of previous research on animal learning. We believe that these data provide the first direct evidence for the uncertainty principle in human associative learning.

  7. The calcineurin-NFAT pathway negatively regulates megakaryopoiesis.


    Zaslavsky, Alexander; Chou, Stella T; Schadler, Keri; Lieberman, Allyson; Pimkin, Maxim; Kim, Yeo Jung; Baek, Kwan-Hyuck; Aird, William C; Weiss, Mitchell J; Ryeom, Sandra


    The calcium regulated calcineurin-nuclear factor of activated T cells (NFAT) pathway modulates the physiology of numerous cell types, including hematopoietic. Upon activation, calcineurin dephosphorylates NFAT family transcription factors, triggering their nuclear entry and activation or repression of target genes. NFATc1 and c2 isoforms are expressed in megakaryocytes. Moreover, human chromosome 21 (Hsa21) encodes several negative regulators of calcineurin-NFAT, candidates in the pathogenesis of Down syndrome (trisomy 21)-associated transient myeloproliferative disorder and acute megakaryoblastic leukemia. To investigate the role of calcineurin-NFAT in megakaryopoiesis, we examined wild-type mice treated with the calcineurin inhibitor cyclosporin A and transgenic mice expressing a targeted single extra copy of Dscr1, an Hsa21-encoded calcineurin inhibitor. Both murine models exhibited thrombocytosis with increased megakaryocytes and megakaryocyte progenitors. Pharmacological or genetic inhibition of calcineurin in mice caused accumulation of megakaryocytes exhibiting enhanced 5-bromo-2'-deoxyuridine uptake and increased expression of messenger RNAs encoding CDK4 and G1 cyclins, which promote cell division. Additionally, human megakaryocytes with trisomy 21 show increased proliferation and decreased NFAT activation compared with euploid controls. Our data indicate that inhibition of calcineurin-NFAT drives proliferation of megakaryocyte precursors by de-repressing genes that drive cell division, providing insights into mechanisms of normal megakaryopoiesis and megakaryocytic abnormalities that accompany Down syndrome.

  8. Transcriptional regulation of the human mu opioid receptor (hMOR) gene: evidence of positive and negative cis-acting elements in the proximal promoter and presence of a distal promoter.


    Xu, Y; Carr, L G


    The mu opioid receptor (MOR), the primary binding site for morphine, is an important target for treating pain and drug addiction. The MOR gene is tightly regulated at the level of transcription, and potential polymorphisms in its 5' regulatory region can cause individual variation in MOR gene expression, nociception, and opiate responses. To study the 5' regulatory region of the human MOR gene (hMOR), we further investigated our previous finding of two regulatory regions and have localized a 40-bp positive cis-acting element and a 35-bp negative cis-acting element that regulate hMOR transcription in SK-N-SH cells. Electromobility shift assays and methylation interference assay with the 40-bp probe suggested that protein contacts were made with the core recognition sequence GCC (-510 to -508). The 35-bp sequence (-694 to -660) was the hMOR homolog of the mMOR negative regulatory element, and it suppressed proximal promoter activity of the hMOR gene. Additionally, the presence of an hMOR distal promoter was confirmed using RT-PCR. However, the activity of the distal promoter construct (-2325 to -777) was weak compared with the activity of the proximal promoter construct (-776 to -212).

  9. HAND1 gene expression is negatively regulated by the High Mobility Group A1 proteins and is drastically reduced in human thyroid carcinomas.


    Martinez Hoyos, J; Ferraro, A; Sacchetti, S; Keller, S; De Martino, I; Borbone, E; Pallante, P; Fedele, M; Montanaro, D; Esposito, F; Cserjesi, P; Chiariotti, L; Troncone, G; Fusco, A


    HMGA1 proteins exert their major physiological function during embryonic development and play a critical role in neoplastic transformation. Here, we show that Hand1 gene, which codes for a transcription factor crucial for differentiation of trophoblast giant cells and heart development, is upregulated in hmga1 minus embryonic stem cells. We demonstrate that HMGA1 proteins bind directly to Hand1 promoter both in vitro and in vivo and inhibit Hand1 promoter activity. We have also investigated HAND1 expression in human thyroid carcinoma cell lines and tissues, in which HMGA proteins are overexpressed, with respect to normal thyroid; an inverse correlation between HMGA1 and HAND1 expression was found in all thyroid tumor histotypes. A correlation between HAND1 gene repression and promoter hypermethylation was found in anaplastic carcinomas but not in other thyroid tumor histotypes. Therefore, we can hypothesize that HMGA1 overexpression plays a key role on HAND1 silencing in differentiated thyroid carcinomas and that promoter hypermethylation occurs in later stages of thyroid tumor progression. Finally, the restoration of the HAND1 gene expression reduces the clonogenic ability of two human thyroid carcinoma-derived cell lines, suggesting that HAND1 downregulation may have a role in the process of thyroid carcinogenesis.

  10. Tumor-infiltrating NY-ESO-1-specific CD8+ T cells are negatively regulated by LAG-3 and PD-1 in human ovarian cancer.


    Matsuzaki, Junko; Gnjatic, Sacha; Mhawech-Fauceglia, Paulette; Beck, Amy; Miller, Austin; Tsuji, Takemasa; Eppolito, Cheryl; Qian, Feng; Lele, Shashikant; Shrikant, Protul; Old, Lloyd J; Odunsi, Kunle


    NY-ESO-1 is a "cancer-testis" antigen frequently expressed in epithelial ovarian cancer (EOC) and is among the most immunogenic tumor antigens defined to date. In an effort to understand in vivo tolerance mechanisms, we assessed the phenotype and function of NY-ESO-1-specific CD8(+) T cells derived from peripheral blood lymphocytes (PBLs), tumor-infiltrating lymphocytes (TILs), and tumor-associated lymphocytes (TALs) of EOC patients with NY-ESO-1-expressing tumors, with or without humoral immunity to NY-ESO-1. Whereas NY-ESO-1-specific CD8(+) T cells were readily detectable ex vivo with tetramers in TILs and TALs of seropositive patients, they were only detectable in PBLs following in vitro stimulation. Compared with PBLs, tumor-derived NY-ESO-1-specific CD8(+) T cells demonstrated impaired effector function, preferential usage of dominant T-cell receptor, and enriched coexpression of inhibitory molecules LAG-3 and PD-1. Expression of LAG-3 and PD-1 on CD8(+) T cells was up-regulated by IL-10, IL-6 (cytokines found in tumor ascites), and tumor-derived antigen-presenting cells. Functionally, CD8(+)LAG-3(+)PD-1(+) T cells were more impaired in IFN-gamma/TNF-alpha production compared with LAG-3(+)PD-1(-) or LAG-3(-)PD-1(-) subsets. Dual blockade of LAG-3 and PD-1 during T-cell priming efficiently augmented proliferation and cytokine production by NY-ESO-1-specific CD8(+) T cells, indicating that antitumor function of NY-ESO-1-specific CD8(+) T cells could potentially be improved by therapeutic targeting of these inhibitory receptors.

  11. Berberine Decreased Inducible Nitric Oxide Synthase mRNA Stability through Negative Regulation of Human Antigen R in Lipopolysaccharide-Induced Macrophages.


    Shin, Ji-Sun; Choi, Hye-Eun; Seo, SeungHwan; Choi, Jung-Hye; Baek, Nam-In; Lee, Kyung-Tae


    Berberine, a major isoquinoline alkaloid found in medicinal herbs, has been reported to possess anti-inflammatory effects; however, the underlying mechanisms responsible for its actions are poorly understood. In the present study, we investigated the inhibitory effects of berberine and the molecular mechanisms involved in lipopolysaccharide (LPS)-treated RAW 264.7 and THP-1 macrophages and its effects in LPS-induced septic shock in mice. In both macrophage cell types, berberine inhibited the LPS-induced nitric oxide (NO) production and inducible NO synthase (iNOS) protein expression, but it had no effect on iNOS mRNA transcription. Suppression of LPS-induced iNOS protein expression by berberine occurred via a human antigen R (HuR)-mediated reduction of iNOS mRNA stability. Molecular data revealed that the suppression on the LPS-induced HuR binding to iNOS mRNA by berberine was accompanied by a reduction in nucleocytoplasmic HuR shuttling. Pretreatment with berberine reduced LPS-induced iNOS protein expression and the cytoplasmic translocation of HuR in liver tissues and increased the survival rate of mice with LPS-induced endotoxemia. These results show that the suppression of iNOS protein expression by berberine under LPS-induced inflammatory conditions is associated with a reduction in iNOS mRNA stability resulting from inhibition of the cytoplasmic translocation of HuR. PMID:27189969

  12. GATA4 negatively regulates bone sialoprotein expression in osteoblasts

    PubMed Central

    Song, Insun; Jeong, Byung-chul; Choi, Yong Jun; Chung, Yoon-Sok; Kim, Nacksung


    GATA4 has been reported to act as a negative regulator in osteoblast differentiation by inhibiting the Dlx5 transactivation of Runx2 via the attenuation of the binding ability of Dlx5 to the Runx2 promoter region. Here, we determine the role of GATA4 in the regulation of bone sialoprotein (Bsp) in osteoblasts. We observed that the overexpression of Runx2 or Sox9 induced the Bsp expression in osteoblastic cells. Silencing GATA4 further enhanced the Runx2- and Sox9-mediated Bsp promoter activity, whereas GATA4 overexpression down-regulated Bsp promoter activity mediated by Runx2 and Sox9. GATA4 also interacted with Runx2 and Sox9, by attenuating the binding ability of Runx2 and Sox9 to the Bsp promoter region. Our data suggest that GATA4 acts as a negative regulator of Bsp expression in osteoblasts. [BMB Reports 2016; 49(6): 343-348] PMID:26973342

  13. Architecture and regulation of negative-strand viral enzymatic machinery

    PubMed Central

    Kranzusch, Philip J.; Whelan, Sean P.J.


    Negative-strand (NS) RNA viruses initiate infection with a unique polymerase complex that mediates both mRNA transcription and subsequent genomic RNA replication. For nearly all NS RNA viruses, distinct enzymatic domains catalyzing RNA polymerization and multiple steps of 5′ mRNA cap formation are contained within a single large polymerase protein (L). While NS RNA viruses include a variety of emerging human and agricultural pathogens, the enzymatic machinery driving viral replication and gene expression remains poorly understood. Recent insights with Machupo virus and vesicular stomatitis virus have provided the first structural information of viral L proteins, and revealed how the various enzymatic domains are arranged into a conserved architecture shared by both segmented and nonsegmented NS RNA viruses. In vitro systems reconstituting RNA synthesis from purified components provide new tools to understand the viral replicative machinery, and demonstrate the arenavirus matrix protein regulates RNA synthesis by locking a polymerase–template complex. Inhibition of gene expression by the viral matrix protein is a distinctive feature also shared with influenza A virus and nonsegmented NS RNA viruses, possibly illuminating a conserved mechanism for coordination of viral transcription and polymerase packaging PMID:22767259

  14. Architecture and regulation of negative-strand viral enzymatic machinery.


    Kranzusch, Philip J; Whelan, Sean P J


    Negative-strand (NS) RNA viruses initiate infection with a unique polymerase complex that mediates both mRNA transcription and subsequent genomic RNA replication. For nearly all NS RNA viruses, distinct enzymatic domains catalyzing RNA polymerization and multiple steps of 5' mRNA cap formation are contained within a single large polymerase protein (L). While NS RNA viruses include a variety of emerging human and agricultural pathogens, the enzymatic machinery driving viral replication and gene expression remains poorly understood. Recent insights with Machupo virus and vesicular stomatitis virus have provided the first structural information of viral L proteins, and revealed how the various enzymatic domains are arranged into a conserved architecture shared by both segmented and nonsegmented NS RNA viruses. In vitro systems reconstituting RNA synthesis from purified components provide new tools to understand the viral replicative machinery, and demonstrate the arenavirus matrix protein regulates RNA synthesis by locking a polymerase-template complex. Inhibition of gene expression by the viral matrix protein is a distinctive feature also shared with influenza A virus and nonsegmented NS RNA viruses, possibly illuminating a conserved mechanism for coordination of viral transcription and polymerase packaging.

  15. Autophagy triggered by magnolol derivative negatively regulates angiogenesis

    PubMed Central

    Kumar, S; Guru, S K; Pathania, A S; Kumar, A; Bhushan, S; Malik, F


    Angiogenesis has a key role in the tumor progression and metastasis; targeting endothelial cell proliferation has emerged as a promising therapeutic strategy for the prevention of cancer. Previous studies have revealed a complex association between the process of angiogenesis and autophagy and its outcome on tumorigenesis. Autophagy, also known as type-II cell death, has been identified as an alternative way of cell killing in apoptotic-resistant cancer cells. However, its involvement in chemoresistance and tumor promotion is also well known. In this study, we used a derivate of natural product magnolol (Ery5), a potent autophagy inducer, to study the association between the autophagy and angiogenesis in both in vitro and in vivo model system. We found that the robust autophagy triggered by Ery5, inhibited angiogenesis and caused cell death independent of the apoptosis in human umbilical cord vein endothelial cells and PC-3 cells. Ery5 induced autophagy effectively inhibited cell proliferation, migration, invasion and tube formation. We further demonstrated that Ery5-mediated autophagy and subsequent inhibition of angiogenesis was reversed when autophagy was inhibited through 3-methyl adenine and knocking down of key autophagy proteins ATG7 and microtubule-associated protein light chain 3. While evaluating the negative regulation of autophagy on angiogenesis, it was interesting to find that angiogenic environment produced by the treatment of VEGF and CoCl2 remarkably downregulated the autophagy and autophagic cell death induced by Ery5. These studies, while disclosing the vital role of autophagy in the regulation of angiogenesis, also suggest that the potent modulators of autophagy can lead to the development of effective therapeutics in apoptosis-resistant cancer. PMID:24176847

  16. Spontaneous Emotion Regulation to Positive and Negative Stimuli

    ERIC Educational Resources Information Center

    Volokhov, Rachael N.; Demaree, Heath A.


    The ability to regulate one's emotions is an integral part of human social behavior. One antecedent emotion regulation strategy, known as reappraisal, is characterized by cognitively evaluating an emotional stimulus to alter its emotional impact and one response-focused strategy, suppression, is aimed at reducing behavioral output. People are…

  17. PECAM-1 ligation negatively regulates TLR4 signaling in macrophages.


    Rui, Yuxiang; Liu, Xingguang; Li, Nan; Jiang, Yingming; Chen, Guoyou; Cao, Xuetao; Wang, Jianli


    Uncontrolled TLR4 signaling may induce excessive production of proinflammatory cytokines and lead to harmful inflammation; therefore, negative regulation of TLR4 signaling attracts much attention now. PECAM-1, a member of Ig-ITIM family, can mediate inhibitory signals in T cells and B cells. However, the role and the mechanisms of PECAM-1 in the regulation of TLR4-mediated LPS response in macrophages remain unclear. In this study, we demonstrate that PECAM-1 ligation with CD38-Fc fusion protein negatively regulates LPS-induced proinflammatory cytokine TNF-alpha, IL-6, and IFN-beta production by inhibiting JNK, NF-kappaB, and IFN regulatory factor 3 activation in macrophages. In addition, PECAM-1 ligation-recruited Src homology region 2 domain-containing phosphatase 1 (SHP-1) and Src homology region 2 domain-containing phosphatase 2 (SHP-2) may be involved in the inhibitory effect of PECAM-1 on TLR4 signaling. Consistently, silencing of PECAM-1 enhances the macrophage response to LPS stimulation. Taken together with the data that PECAM-1 is constitutively expressed in macrophages and its expression is up-regulated by LPS stimulation, PECAM-1 might function as a feedback negative regulator of LPS inflammatory response in macrophages. This study may provide a potential target for intervention of inflammatory diseases. PMID:18025177

  18. Transcription dynamics of inducible genes modulated by negative regulations.


    Li, Yanyan; Tang, Moxun; Yu, Jianshe


    Gene transcription is a stochastic process in single cells, in which genes transit randomly between active and inactive states. Transcription of many inducible genes is also tightly regulated: It is often stimulated by extracellular signals, activated through signal transduction pathways and later repressed by negative regulations. In this work, we study the nonlinear dynamics of the mean transcription level of inducible genes modulated by the interplay of the intrinsic transcriptional randomness and the repression by negative regulations. In our model, we integrate negative regulations into gene activation process, and make the conventional assumption on the production and degradation of transcripts. We show that, whether or not the basal transcription is temporarily terminated when cells are stimulated, the mean transcription level grows in the typical up and down pattern commonly observed in immune response genes. With the help of numerical simulations, we clarify the delicate impact of the system parameters on the transcription dynamics, and demonstrate how our model generates the distinct temporal gene-induction patterns in mouse fibroblasts discerned in recent experiments.

  19. Negative regulation of quorum-sensing systems in Pseudomonas aeruginosa by ATP-dependent Lon protease.


    Takaya, Akiko; Tabuchi, Fumiaki; Tsuchiya, Hiroko; Isogai, Emiko; Yamamoto, Tomoko


    Lon protease, a member of the ATP-dependent protease family, regulates numerous cellular systems by degrading specific substrates. Here, we demonstrate that Lon is involved in the regulation of quorum-sensing (QS) signaling systems in Pseudomonas aeruginosa, an opportunistic human pathogen. The organism has two acyl-homoserine lactone (HSL)-mediated QS systems, LasR/LasI and RhlR/RhlI. Many reports have demonstrated that these two systems are regulated and interconnected by global regulators. We found that lon-disrupted cells overproduce pyocyanin, the biosynthesis of which depends on the RhlR/RhlI system, and show increased levels of a transcriptional regulator, RhlR. The QS systems are organized hierarchically: the RhlR/RhlI system is subordinate to LasR/LasI. To elucidate the mechanism by which Lon negatively regulates RhlR/RhlI, we examined the effect of lon disruption on the LasR/LasI system. We found that Lon represses the expression of LasR/LasI by degrading LasI, an HSL synthase, leading to negative regulation of the RhlR/RhlI system. RhlR/RhlI was also shown to be regulated by Lon independently of LasR/LasI via regulation of RhlI, an HSL synthase. In view of these findings, it is suggested that Lon protease is a powerful negative regulator of both HSL-mediated QS systems in P. aeruginosa.

  20. Integrating Negative Affect Measures in a Measurement Model: Assessing the Function of Negative Affect as Interference to Self-Regulation

    ERIC Educational Resources Information Center

    Magno, Carlo


    The present study investigated the composition of negative affect and its function as inhibitory to thought processes such as self-regulation. Negative affect in the present study were composed of anxiety, worry, thought suppression, and fear of negative evaluation. These four factors were selected based on the criteria of negative affect by…

  1. Regulations against the human nature

    NASA Astrophysics Data System (ADS)

    Elizondo-Garza, Fernando J.


    The discussion around the concept of the addiction to noise has evidenced the importance of noise for the human being and explains why in some cases the regulations fail to control the noise in cities. In this presentation the different uses, consciously or unconsciously, of the noise will be analyzed, uses that go from habits to maybe addictions. Also discussed are the implications of establishing regulations against the human nature as well as the importance of education to manage the noise and design acoustically instead of trying to ban the noise in some social circumstances.

  2. RAGE, receptor of advanced glycation endoproducts, negatively regulates chondrocytes differentiation.


    Kosaka, Tatsuya; Fukui, Rino; Matsui, Mio; Kurosaka, Yuko; Nishimura, Haruka; Tanabe, Motoki; Takakura, Yuuki; Iwai, Keisuke; Waki, Takuya; Fujita, Takashi


    RAGE, receptor for advanced glycation endoproducts (AGE), has been characterized as an activator of osteoclastgenesis. However, whether RAGE directly regulates chondrocyte proliferation and differentiation is unclear. Here, we show that RAGE has an inhibitory role in chondrocyte differentiation. RAGE expression was observed in chondrocytes from the prehypertrophic to hypertrophic regions. In cultured cells, overexpression of RAGE or dominant-negative-RAGE (DN-RAGE) demonstrated that RAGE inhibited cartilaginous matrix production, while DN-RAGE promoted production. Additionally, RAGE regulated Ihh and Col10a1 negatively but upregulated PTHrP receptor. Ihh promoter analysis and real-time PCR analysis suggested that downregulation of Cdxs was the key for RAGE-induced inhibition of chondrocyte differentiation. Overexpression of the NF-κB inhibitor I-κB-SR inhibited RAGE-induced NF-κB activation, but did not influence inhibition of cartilaginous matrix production by RAGE. The inhibitory action of RAGE was restored by the Rho family GTPases inhibitor Toxin B. Furthermore, inhibitory action on Ihh, Col10a1 and Cdxs was reproduced by constitutively active forms, L63RhoA, L61Rac, and L61Cdc42, but not by I-κB-SR. Cdx1 induced Ihh and Col10a1 expressions and directly interacted with Ihh promoter. Retinoic acid (RA) partially rescued the inhibitory action of RAGE. These data combined suggests that RAGE negatively regulates chondrocyte differentiation at the prehypertrophic stage by modulating NF-κB-independent and Rho family GTPases-dependent mechanisms.

  3. RAGE, Receptor of Advanced Glycation Endoproducts, Negatively Regulates Chondrocytes Differentiation

    PubMed Central

    Kurosaka, Yuko; Nishimura, Haruka; Tanabe, Motoki; Takakura, Yuuki; Iwai, Keisuke; Waki, Takuya; Fujita, Takashi


    RAGE, receptor for advanced glycation endoproducts (AGE), has been characterized as an activator of osteoclastgenesis. However, whether RAGE directly regulates chondrocyte proliferation and differentiation is unclear. Here, we show that RAGE has an inhibitory role in chondrocyte differentiation. RAGE expression was observed in chondrocytes from the prehypertrophic to hypertrophic regions. In cultured cells, overexpression of RAGE or dominant-negative-RAGE (DN-RAGE) demonstrated that RAGE inhibited cartilaginous matrix production, while DN-RAGE promoted production. Additionally, RAGE regulated Ihh and Col10a1 negatively but upregulated PTHrP receptor. Ihh promoter analysis and real-time PCR analysis suggested that downregulation of Cdxs was the key for RAGE-induced inhibition of chondrocyte differentiation. Overexpression of the NF-κB inhibitor I-κB-SR inhibited RAGE-induced NF-κB activation, but did not influence inhibition of cartilaginous matrix production by RAGE. The inhibitory action of RAGE was restored by the Rho family GTPases inhibitor Toxin B. Furthermore, inhibitory action on Ihh, Col10a1 and Cdxs was reproduced by constitutively active forms, L63RhoA, L61Rac, and L61Cdc42, but not by I-κB-SR. Cdx1 induced Ihh and Col10a1 expressions and directly interacted with Ihh promoter. Retinoic acid (RA) partially rescued the inhibitory action of RAGE. These data combined suggests that RAGE negatively regulates chondrocyte differentiation at the prehypertrophic stage by modulating NF-κB-independent and Rho family GTPases-dependent mechanisms. PMID:25275461

  4. Neuraminidase 1 is a Negative Regulator of Lysosomal Exocytosis

    PubMed Central

    Yogalingam, Gouri; Bonten, Erik J.; van de Vlekkert, Diantha; Hu, Huimin; Moshiach, Simon; Connell, Samuel A.; d’Azzo, Alessandra


    SUMMARY Lysosomal exocytosis is a Ca2+-regulated mechanism that involves proteins responsible for cytoskeletal attachment and fusion of lysosomes with the plasma membrane. However, whether luminal lysosomal enzymes contribute to this process remains unknown. Here we show that neuraminidase Neu1 negatively regulates lysosomal exocytosis in hematopoietic cells by processing the sialic acids on the lysosomal membrane protein Lamp-1. In macrophages from Neu1-deficient mice, a model of the disease sialidosis, and in patients’ fibroblasts, oversialylated Lamp-1 enhances lysosomal exocytosis. Silencing of Lamp-1 reverts this phenotype by interfering with the docking of lysosomes at the plasma membrane. In Neu1-/- mice the excessive exocytosis of serine proteases in the bone niche leads to inactivation of extracellular serpins, premature degradation of VCAM-1, and loss of bone marrow retention. Our findings uncover an unexpected mechanism influencing lysosomal exocytosis and argue that exacerbations of this process form the basis for certain genetic diseases. PMID:18606142

  5. Making sense of plant autoimmunity and 'negative regulators'.


    Rodriguez, Eleazar; El Ghoul, Hassan; Mundy, John; Petersen, Morten


    Genetics studies the structure/function of genes via the characterization of their mutant phenotypes. In plants, a readily scorable mutant phenotype comprises macroscopic lesions symptomatic of disease in the absence of pathogens. Such mutants therefore exhibit autoimmune phenotypes. Many of these mutants are considered to be associated with immunity and the corresponding genes have been described as 'negative regulators' of immunity and/or cell death. Pathogens deliver effectors into host cells to increase infectivity by modifying or removing host proteins. Plants detect effectors via nucleotide-binding, leucine-rich repeat (NLR) immune receptors, which monitor host effector targets. In response to effector-mediated target tampering, NLR proteins potentiate immunity. The guard hypothesis proposes that NLRs 'guard' host 'guardees' targeted by pathogen effectors. An obvious corollary to this guard model is that forms of plant autoimmunity are a result of inappropriate NLR protein activation. In this review, we discuss what is known about some of the 'negative regulators' of immunity, and propose simple strategies that may help to characterize autoimmune mutants.

  6. Ca(2+)(cyt) negatively regulates the initiation of oocyte maturation.


    Sun, Lu; Machaca, Khaled


    Ca(2+) is a ubiquitous intracellular messenger that is important for cell cycle progression. Genetic and biochemical evidence support a role for Ca(2+) in mitosis. In contrast, there has been a long-standing debate as to whether Ca(2+) signals are required for oocyte meiosis. Here, we show that cytoplasmic Ca(2+) (Ca(2+)(cyt)) plays a dual role during Xenopus oocyte maturation. Ca(2+) signals are dispensable for meiosis entry (germinal vesicle breakdown and chromosome condensation), but are required for the completion of meiosis I. Interestingly, in the absence of Ca(2+)(cyt) signals oocytes enter meiosis more rapidly due to faster activation of the MAPK-maturation promoting factor (MPF) kinase cascade. This Ca(2+)-dependent negative regulation of the cell cycle machinery (MAPK-MPF cascade) is due to Ca(2+)(cyt) acting downstream of protein kinase A but upstream of Mos (a MAPK kinase kinase). Therefore, high Ca(2+)(cyt) delays meiosis entry by negatively regulating the initiation of the MAPK-MPF cascade. These results show that Ca(2+) modulates both the cell cycle machinery and nuclear maturation during meiosis.

  7. Arabidopsis RGL1 encodes a negative regulator of gibberellin responses.


    Wen, Chi-Kuang; Chang, Caren


    In Arabidopsis, the DELLA subfamily of GRAS regulatory genes consists of GAI, RGA, RGA-LIKE1 (RGL1), RGL2, and RGL3. GAI and RGA are known to be negative regulators of gibberellin (GA) responses. We found that RGL1 is a similar repressor of GA responses, as revealed by RGL1 gain-of-function and loss-of-function phenotypes. Repression of GA responses in Arabidopsis was conferred by a dominant 35S-rgl1 transgene carrying a DELLA domain deletion analogous to the GA-insensitive gai-1 mutation. As in GA-deficient Arabidopsis, the transgenic plants were dark green dwarfs with underdeveloped trichomes and flowers. Expression levels of GA4, a feedback-regulated GA biosynthetic gene, were increased correspondingly. Conversely, a loss-of-function rgl1 line had reduced GA4 expression and exhibited GA-independent activation of seed germination, leaf expansion, flowering, stem elongation, and floral development, as detected by resistance to the GA biosynthesis inhibitor paclobutrazol. RGL1 plays a greater role in seed germination than do GAI and RGA. The expression profile of RGL1 differed from those of the four other DELLA homologs. RGL1 message levels were predominant in flowers, with transcripts detected in developing ovules and anthers. As with RGA, green fluorescent protein (GFP)-tagged RGL1 protein was localized to the nucleus, but unlike GFP-RGA, there was no degradation after GA treatment. These findings indicate that RGL1 is a partially redundant, but distinct, negative regulator of GA responses and suggest that all DELLA subfamily members might possess separate as well as overlapping roles in GA signaling. PMID:11826301

  8. Physiological levels of ATP Negatively Regulate Proteasome Function

    PubMed Central

    Huang, Hongbiao; Zhang, Xiaoyan; Li, Shujue; Liu, Ningning; Lian, Wen; McDowell, Emily; Zhou, Ping; Zhao, Canguo; Guo, Haiping; Zhang, Change; Yang, Changshan; Wen, Guangmei; Dong, Xiaoxian; Lu, Li; Ma, Ningfang; Dong, Weihua; Dou, Q. Ping; Wang, Xuejun; Liu, Jinbao


    Intracellular protein degradation by the ubiquitin-proteasome system is ATP-dependent and the optimal ATP concentration to activate proteasome function in vitro is ~100 μM. Intracellular ATP levels are generally in the low millimolar range but ATP at a level within this range was shown to inhibit proteasome peptidase activities in vitro. Here we report new evidence that supports a hypothesis that intracellular ATP at the physiological levels bidirectionally regulates 26S proteasome proteolytic function in the cell. First, we confirmed that ATP exerted bidirectional regulation on the 26S proteasome in vitro, with the optimal ATP concentration (between 50–100 μM) stimulating proteasome chymotrypsin-like activities. Second, we found that manipulating intracellular ATP levels also led to bidirectional changes in the levels of proteasome-specific protein substrates in cultured cells. Finally, measures to increase intracellular ATP enhanced, while decreasing intracellular ATP attenuated, the ability of proteasome inhibition to induce cell death. These data strongly suggest that endogenous ATP within the physiological concentration range can exert a negative impact on proteasome activities, allowing the cell to rapidly up-regulate proteasome activity upon ATP reduction under stress conditions. PMID:20805844

  9. Negative regulation of DSS-induced experimental colitis by PILRα.


    Kishida, Kazuki; Kohyama, Masako; Kurashima, Yosuke; Kogure, Yuta; Wang, Jing; Hirayasu, Kouyuki; Suenaga, Tadahiro; Kiyono, Hiroshi; Kunisawa, Jun; Arase, Hisashi


    Inflammatory bowel disease is thought to be a complex multifactorial disease, in which an increased inflammatory response plays an important role. Paired immunoglobulin-like type 2 receptor α (PILRα), well conserved in almost all mammals, is an inhibitory receptor containing immunoreceptor tyrosine-based inhibitory motifs in the cytoplasmic domain. PILRα is mainly expressed on myeloid cells and plays an important role in the regulation of inflammation. In the present study, we investigated the function of PILRα in inflammatory bowel disease using PILRα-deficient mice. When mice were orally administered dextran sulfate sodium (DSS), colonic mucosal injury and inflammation were significantly exacerbated in DSS-treated PILRα-deficient mice compared with wild-type (WT) mice. Flow cytometric analysis revealed that neutrophil and macrophage cell numbers were higher in the colons of DSS-treated PILRα-deficient mice than in those of WT mice. Blockade of CXCR2 expressed on neutrophils using a CXCR2 inhibitor decreased the severity of colitis observed in PILRα-deficient mice. These results suggest that PILRα negatively regulates inflammatory colitis by regulating the infiltration of inflammatory cells such as neutrophils and macrophages.

  10. When death is not a problem: Regulating implicit negative affect under mortality salience.


    Lüdecke, Christina; Baumann, Nicola


    Terror management theory assumes that death arouses existential anxiety in humans which is suppressed in focal attention. Whereas most studies provide indirect evidence for negative affect under mortality salience by showing cultural worldview defenses and self-esteem strivings, there is only little direct evidence for implicit negative affect under mortality salience. In the present study, we assume that this implicit affective reaction towards death depends on people's ability to self-regulate negative affect as assessed by the personality dimension of action versus state orientation. Consistent with our expectations, action-oriented participants judged artificial words to express less negative affect under mortality salience compared to control conditions whereas state-oriented participants showed the reversed pattern. PMID:26335149

  11. Cell cycle regulation of human WEE1.

    PubMed Central

    McGowan, C H; Russell, P


    WEE1 kinase negatively regulates entry into mitosis by catalyzing the inhibitory tyrosine phosphorylation of CDC2/cyclin B kinase. We report here an investigation of human WEE1. Endogenous WEE1 migrates as an approximately 94 kDa protein in SDS-PAGE, substantially larger than the 49 kDa protein encoded by the original human WEE1 cDNA clone that was truncated at the 5'-end. Antibody depletion experiments demonstrate that WEE1 accounts for most of the activity that phosphorylates CDC2 on Tyr15 in an in vitro assay of HeLa cell lysates, hence it is likely to have an important role in the mitotic control of human cells. WEE1 activity was not found to be elevated in HeLa cells arrested in S phase, suggesting that unreplicated DNA does not delay M phase by hyperactivating WEE1. WEE1 activity is strongly suppressed during M phase, suggesting that negative regulation of WEE1 could be part of the mechanism by which activation of CDC2/cyclin B kinase is promoted during the G2/M transition. M phase WEE1 is re-activated in samples prepared in the absence of protein phosphatase inhibitors, demonstrating that WEE1 is inhibited by a mechanism that requires protein phosphorylation. Images PMID:7774574

  12. Negative regulation of lymphocyte activation by the adaptor protein LAX.


    Zhu, Minghua; Granillo, Olivia; Wen, Renren; Yang, Kaiyong; Dai, Xuezhi; Wang, Demin; Zhang, Weiguo


    The membrane-associated adaptor protein LAX is a linker for activation of T cells (LAT)-like molecule that is expressed in lymphoid tissues. Upon stimulation of T or B cells, it is phosphorylated and interacts with Grb2 and the p85 subunit of PI3K. LAX, however, is not capable of replacing LAT in the TCR signaling pathway. In this study we report that upon T or B cell activation, the LAX protein was up-regulated dramatically. Although disruption of the LAX gene by homologous recombination had no major impact on lymphocyte development, it caused a significant reduction in CD23 expression on mature B cells. Interestingly, naive LAX(-/-) mice had spontaneous germinal center formation. Compared with normal T and B cells, LAX(-/-) T and B cells were hyperresponsive and had enhanced calcium flux, protein tyrosine phosphorylation, MAPK and Akt activation, and cell survival upon engagement of the T or B AgRs. Our data demonstrate that LAX functions as a negative regulator in lymphocyte signaling.

  13. Negative Regulation of Cytoplasmic RNA-Mediated Antiviral Signaling

    PubMed Central

    Komuro, Akihiko; Bamming, Darja


    The recent, rapid progress in our understanding of cytoplasmic RNA-mediated antiviral innate immune signaling was initiated by the discovery of retinoic acid-inducible gene I (RIG-I) as a sensor of viral RNA [1]. It is now widely recognized that RIG-I and related RNA helicases, melanoma differentiated-associated gene-5 (MDA5) and laboratory of genetics and physiology-2 (LGP2), can initiate and/or regulate RNA and virus -mediated type I IFN production and antiviral responses. As with other cytokine systems, production of type I IFN is a transient process, and can be hazardous to the host if unregulated, resulting in chronic cellular toxicity or inflammatory and autoimmune diseases [2-9]. In addition, the RIG-I-like receptor (RLR) system is a fundamental target for virus-encoded immune suppression, with many indirect and direct examples of interference described. In this article, we review the current understanding of endogenous negative regulation in RLR signaling and explore direct inhibition of RLR signaling by viruses as a host immune evasion strategy. PMID:18703349

  14. SMN and coilin negatively regulate dyskerin association with telomerase RNA

    PubMed Central

    Poole, Aaron R.


    ABSTRACT Telomerase is a ribonucleoprotein comprising telomerase RNA and associated proteins. The formation of the telomerase holoenzyme takes place in the Cajal body (CB), a subnuclear domain that participates in the formation of ribonucleoproteins. CBs also contribute to the delivery of telomerase to telomeres. The protein WRAP53 is enriched within the CB and is instrumental for the targeting of telomerase RNA to CBs. Two other CB proteins, SMN and coilin, are also suspected of taking part in some aspect of telomerase biogenesis. Here we demonstrate newly discovered associations between SMN and coilin with telomerase components, and further show that reduction of SMN or coilin is correlated with increased association of telomerase RNA with one these components, dyskerin. These findings argue that SMN and coilin may negatively regulate the formation of telomerase. Furthermore, clinically defined SMN mutants found in individuals with spinal muscular atrophy are altered in their association with telomerase complex proteins. Additionally, we observe that a coilin derivative also associates with dyskerin, and the amount of this protein in the complex is regulated by SMN, WRAP53 and coilin levels. Collectively, our findings bolster the link between SMN, coilin and the coilin derivative in the biogenesis of telomerase. PMID:27215323

  15. Cyclic AMP negatively regulates prodigiosin production by Serratia marcescens.


    Kalivoda, Eric J; Stella, Nicholas A; Aston, Marissa A; Fender, James E; Thompson, Paul P; Kowalski, Regis P; Shanks, Robert M Q


    Many Serratia marcescens strains produce the red pigment prodigiosin, which has antimicrobial and anti-tumor properties. Previous reports suggest that cyclic AMP (cAMP) is a positive regulator of prodigiosin production. Supporting this model, the addition of glucose to growth medium inhibited pigment production in rich and minimal media. Unexpectedly, we observed highly elevated levels of prodigiosin production in isogenic strains with mutations in genes involved in cAMP production (cyaA and crr) and in cAMP-dependent transcriptional signaling (crp). Multicopy expression of the Escherichia coli cAMP-phosphodiesterase gene, cpdA, also conferred a striking increase in prodigiosin production. Exogenous cAMP decreased both pigment production and pigA-lacZ transcription in the wild-type (WT) strain, and pigA-lacZ transcription was significantly increased in a crp mutant relative to WT. Suppressor and epistasis analysis indicate that the hyperpigment phenotype was dependent upon pigment biosynthetic genes (pigA, pigB, pigC, pigD and pigM). These experiments establish cAMP as a negative regulator of prodigiosin production in S. marcescens.

  16. Architecture and RNA binding of the human negative elongation factor

    PubMed Central

    Vos, Seychelle M; Pöllmann, David; Caizzi, Livia; Hofmann, Katharina B; Rombaut, Pascaline; Zimniak, Tomasz; Herzog, Franz; Cramer, Patrick


    Transcription regulation in metazoans often involves promoter-proximal pausing of RNA polymerase (Pol) II, which requires the 4-subunit negative elongation factor (NELF). Here we discern the functional architecture of human NELF through X-ray crystallography, protein crosslinking, biochemical assays, and RNA crosslinking in cells. We identify a NELF core subcomplex formed by conserved regions in subunits NELF-A and NELF-C, and resolve its crystal structure. The NELF-AC subcomplex binds single-stranded nucleic acids in vitro, and NELF-C associates with RNA in vivo. A positively charged face of NELF-AC is involved in RNA binding, whereas the opposite face of the NELF-AC subcomplex binds NELF-B. NELF-B is predicted to form a HEAT repeat fold, also binds RNA in vivo, and anchors the subunit NELF-E, which is confirmed to bind RNA in vivo. These results reveal the three-dimensional architecture and three RNA-binding faces of NELF. DOI: PMID:27282391

  17. MEIS1 functions as a potential AR negative regulator

    SciTech Connect

    Cui, Liang; Yang, Yutao; Hang, Xingyi; Cui, Jiajun; Gao, Jiangping


    The androgen receptor (AR) plays critical roles in human prostate carcinoma progression and transformation. However, the activation of AR is regulated by co-regulators. MEIS1 protein, the homeodomain transcription factor, exhibited a decreased level in poor-prognosis prostate tumors. In this study, we investigated a potential interaction between MEIS1 and AR. We found that overexpression of MEIS1 inhibited the AR transcriptional activity and reduced the expression of AR target gene. A potential protein–protein interaction between AR and MEIS1 was identified by the immunoprecipitation and GST pull-down assays. Furthermore, MEIS1 modulated AR cytoplasm/nucleus translocation and the recruitment to androgen response element in prostate specific antigen (PSA) gene promoter sequences. In addition, MEIS1 promoted the recruitment of NCoR and SMRT in the presence of R1881. Finally, MEIS1 inhibited the proliferation and anchor-independent growth of LNCaP cells. Taken together, our data suggests that MEIS1 functions as a novel AR co-repressor. - Highlights: • A potential interaction was identified between MEIS1 and AR signaling. • Overexpression of MEIS1 reduced the expression of AR target gene. • MEIS1 modulated AR cytoplasm/nucleus translocation. • MEIS1 inhibited the proliferation and anchor-independent growth of LNCaP cells.

  18. Organelle acidification negatively regulates vacuole membrane fusion in vivo

    PubMed Central

    Desfougères, Yann; Vavassori, Stefano; Rompf, Maria; Gerasimaite, Ruta; Mayer, Andreas


    The V-ATPase is a proton pump consisting of a membrane-integral V0 sector and a peripheral V1 sector, which carries the ATPase activity. In vitro studies of yeast vacuole fusion and evidence from worms, flies, zebrafish and mice suggested that V0 interacts with the SNARE machinery for membrane fusion, that it promotes the induction of hemifusion and that this activity requires physical presence of V0 rather than its proton pump activity. A recent in vivo study in yeast has challenged these interpretations, concluding that fusion required solely lumenal acidification but not the V0 sector itself. Here, we identify the reasons for this discrepancy and reconcile it. We find that acute pharmacological or physiological inhibition of V-ATPase pump activity de-acidifies the vacuole lumen in living yeast cells within minutes. Time-lapse microscopy revealed that de-acidification induces vacuole fusion rather than inhibiting it. Cells expressing mutated V0 subunits that maintain vacuolar acidity were blocked in this fusion. Thus, proton pump activity of the V-ATPase negatively regulates vacuole fusion in vivo. Vacuole fusion in vivo does, however, require physical presence of a fusion-competent V0 sector. PMID:27363625

  19. Organelle acidification negatively regulates vacuole membrane fusion in vivo.


    Desfougères, Yann; Vavassori, Stefano; Rompf, Maria; Gerasimaite, Ruta; Mayer, Andreas


    The V-ATPase is a proton pump consisting of a membrane-integral V0 sector and a peripheral V1 sector, which carries the ATPase activity. In vitro studies of yeast vacuole fusion and evidence from worms, flies, zebrafish and mice suggested that V0 interacts with the SNARE machinery for membrane fusion, that it promotes the induction of hemifusion and that this activity requires physical presence of V0 rather than its proton pump activity. A recent in vivo study in yeast has challenged these interpretations, concluding that fusion required solely lumenal acidification but not the V0 sector itself. Here, we identify the reasons for this discrepancy and reconcile it. We find that acute pharmacological or physiological inhibition of V-ATPase pump activity de-acidifies the vacuole lumen in living yeast cells within minutes. Time-lapse microscopy revealed that de-acidification induces vacuole fusion rather than inhibiting it. Cells expressing mutated V0 subunits that maintain vacuolar acidity were blocked in this fusion. Thus, proton pump activity of the V-ATPase negatively regulates vacuole fusion in vivo. Vacuole fusion in vivo does, however, require physical presence of a fusion-competent V0 sector.

  20. Negative Regulation of Phosphate Starvation-Induced Genes1

    PubMed Central

    Mukatira, Uthappa T.; Liu, Chunming; Varadarajan, Deepa K.; Raghothama, Kashchandra G.


    Phosphate (Pi) deficiency is a major nutritional problem faced by plants in many agro-ecosystems. This deficiency results in altered gene expression leading to physiological and morphological changes in plants. Altered gene expression is presumed to be due to interaction of regulatory sequences (cis-elements) present in the promoters with DNA binding factors (trans-factors). In this study, we analyzed the expression and DNA-protein interaction of promoter regions of Pi starvation-induced genes AtPT2 and TPSI1. AtPT2 encodes the high-affinity Pi transporter in Arabidopsis, whereas TPSI1 codes for a novel gene induced in the Pi-starved tomato (Lycopersicon esculentum). Expression of AtPT2 was induced rapidly under Pi deficiency and increased with decreasing concentrations of Pi. Abiotic stresses except Pi starvation had no affect on the expression of TPSI1. DNA mobility-shift assays indicated that specific sequences of AtPT2 and TPSI1 promoter interact with nuclear protein factors. Two regions of AtPT2 and TPSI1 promoters specifically bound nuclear protein factors from Pi-sufficient plants. Interestingly, the DNA binding activity disappeared during Pi starvation, leading to the hypothesis that Pi starvation-induced genes may be under negative regulation. PMID:11743129

  1. MicroRNA-146a-5p Negatively Regulates Pro-Inflammatory Cytokine Secretion and Cell Activation in Lipopolysaccharide Stimulated Human Hepatic Stellate Cells through Inhibition of Toll-Like Receptor 4 Signaling Pathways

    PubMed Central

    Chen, Yuhan; Zeng, Zhaochong; Shen, Xiaoyun; Wu, Zhifeng; Dong, Yinying; Cheng, Jason Chia-Hsien


    Lipopolysaccharide (LPS)/toll-like receptor 4 (TLR4) signaling pathway is demonstrated to be involved in the hepatic fibrosis. MicroRNA (miR)-146a-5p is a key regulator of the innate immune response. The functional significance of miR-146a-5p during the LPS/TLR4 mediated hepatic fibrosis process remains unclear. In this study, we found that TLR4 and α-smooth muscle actin (α-SMA) were up-regulated and miR-146a-5p was down-regulated in human hepatic stellate cell (HSC) line LX2 after LPS stimulation. Overexpression of miR-146a-5p inhibited LPS induced pro-inflammatory cytokines secretion through down-regulating the expression levels of TLR-4, IL-1 receptor-associated kinase 1 (IRAK1), TNF receptor associated factor-6 (TRAF6) and phosphorylation of nuclear factor-kappa B (NF-κB). Knockdown of IRAK1 and TRAF6 also suppressed pro-inflammatory cytokine production by inhibiting NF-κB phosphorylation. In addition, miR-146a-5p mimic blocked LPS induced TRAF6 dependent c-Jun N-terminal kinase (JNK) and Smad2 activation as well as α-SMA production. Taken together, these results suggest that miR-146a-5p suppresses pro-inflammatory cytokine secretion and cell activation of HSC through inhibition of TLR4/NF-κB and TLR4/TRAF6/JNK pathway. PMID:27399683

  2. p53 negatively regulates Aurora A via both transcriptional and posttranslational regulation

    PubMed Central

    Wu, Chun-Chi; Yang, Tsung-Ying; Yu, Chang-Tze Ricky; Phan, Liem; Ivan, Cristina; Sood, Anil K.; Hsu, Shih-Lan; Lee, Mong-Hong


    p53 plays an important role in mitotic checkpoint, but what its role is remains enigmatic. Aurora A is a Ser/Thr kinase involved in correcting progression of mitosis. Here, we show that p53 is a negative regulator for Aurora A. We found that p53 deficiency leads to Aurora A elevation. Ectopic expression of p53 or DNA damage-induced expression of p53 can suppress the expression of Aurora A. Mechanistic studies show that p53 is a negative regulator for Aurora A expression through both transcriptional and posttranslational regulation. p53 knockdown in cancer cells reduces the level of p21, which, in turn, increases the activity of CDK2 followed by induction of Rb1 hyperphosphorylation and its dissociation with transcriptional factor E2F3. E2F3 can bind to Aurora A gene promoter, potentiating Aurora A gene expression and p53 deficiency, enhancing the binding of E2F3 on Aurora A promoter. Also, p53 deficiency leads to decelerating Aurora A’s turnover rate, due to the fact that p53 deficiency causes the downregulation of Fbw7α, a component of E3 ligase of Aurora A. Consistently, p53 knockdown-mediated Aurora A elevation is mitigated when Fbw7α is ectopically expressed. Thus, p53-mediated Aurora A degradation requires Fbw7α expression. Significantly, inverse correlation between p53 and Aurora A elevation is translated into the deregulation of centrosome amplification. p53 knockdown leads to high percentages of cells with abnormal amplification of centrosome. These data suggest that p53 is an important negative regulator of Aurora A, and that loss of p53 in many types of cancer could lead to abnormal elevation of Aurora A and dysregulated mitosis, which provides a growth advantage for cancer cells. PMID:22894933

  3. MDM2/MDMX: Master negative regulators for p53 and RB.


    Hu, Linshan; Zhang, Haibo; Bergholz, Johann; Sun, Shengnan; Xiao, Zhi-Xiong Jim


    MDM2 (mouse double minute 2 homolog) and MDMX (double minute X human homolog, also known as MDM4) are critical negative regulators of tumor protein p53. Our recent work shows that MDMX binds to and promotes degradation of retinoblastoma protein (RB) in an MDM2-dependent manner. In a xenograft tumor growth mouse model, silencing of MDMX results in inhibition of p53-deficient tumor growth, which can be effectively reversed by concomitant RB silencing. Thus, MDMX exerts its oncogenic activity via suppression of RB.

  4. MDM2/MDMX: Master negative regulators for p53 and RB.


    Hu, Linshan; Zhang, Haibo; Bergholz, Johann; Sun, Shengnan; Xiao, Zhi-Xiong Jim


    MDM2 (mouse double minute 2 homolog) and MDMX (double minute X human homolog, also known as MDM4) are critical negative regulators of tumor protein p53. Our recent work shows that MDMX binds to and promotes degradation of retinoblastoma protein (RB) in an MDM2-dependent manner. In a xenograft tumor growth mouse model, silencing of MDMX results in inhibition of p53-deficient tumor growth, which can be effectively reversed by concomitant RB silencing. Thus, MDMX exerts its oncogenic activity via suppression of RB. PMID:27308631

  5. Simultaneous positive and negative external mechanical work in human walking.


    Donelan, J Maxwell; Kram, Rodger; Kuo, Arthur D


    In human walking, the center of mass motion is similar to an inverted pendulum. Viewing double support as a transition from one inverted pendulum to the next, we hypothesized that the leading leg performs negative work to redirect the center of mass velocity, while simultaneously, the trailing leg performs positive work to replace the lost energy. To test this hypothesis, we developed a method to quantify the external mechanical work performed by each limb (individual limbs method). Traditional measures of external mechanical work use the sum of the ground reaction forces acting on the limbs (combined limbs method) allowing for the mathematical cancellation of simultaneous positive and negative work during multiple support periods. We expected to find that the traditional combined limbs method underestimates external mechanical work by a substantial amount. We used both methods to measure the external mechanical work performed by humans walking over a range of speeds. We found that during double support, the legs perform a substantial amount of positive and negative external work simultaneously. The combined limbs measures of positive and negative external work were approximately 33% less than those calculated using the individual limbs method. At all speeds, the trailing leg performs greater than 97% of the double support positive work while the leading leg performs greater than 94% of the double support negative work. PMID:11747890

  6. Human testis-specific genes are under relaxed negative selection.


    Pierron, Denis; Razafindrazaka, Harilanto; Rocher, Christophe; Letellier, Thierry; Grossman, Lawrence I


    Recent studies have suggested that selective forces and constraints acting on genes varied during human evolution depending on the organ in which they are expressed. To gain insight into the evolution of organ determined negative selection forces, we compared the non-synonymous SNP diversity of genes expressed in different organs. Based on a HAPMAP dataset, we determined for each SNP its frequency in 11 human populations and, in each case, predicted whether or not the change it produces is deleterious. We have shown that, for all organs under study, SNPs predicted to be deleterious are present at a significantly lower frequency than SNPs predicted to be tolerated. However, testis-specific genes contain a higher proportion of deleterious SNPs than other organs. This study shows that negative selection is acting on the whole human genome, but that the action of negative selection is relaxed on testis-specific genes. This result adds to and expands the hypothesis of a recent evolutionary change in the human male reproductive system and its behavior.

  7. PINK1 Is a Negative Regulator of Growth and the Warburg Effect in Glioblastoma.


    Agnihotri, Sameer; Golbourn, Brian; Huang, Xi; Remke, Marc; Younger, Susan; Cairns, Rob A; Chalil, Alan; Smith, Christian A; Krumholtz, Stacey-Lynn; Mackenzie, Danielle; Rakopoulos, Patricia; Ramaswamy, Vijay; Taccone, Michael S; Mischel, Paul S; Fuller, Gregory N; Hawkins, Cynthia; Stanford, William L; Taylor, Michael D; Zadeh, Gelareh; Rutka, James T


    Proliferating cancer cells are characterized by high rates of glycolysis, lactate production, and altered mitochondrial metabolism. This metabolic reprogramming provides important metabolites for proliferation of tumor cells, including glioblastoma. These biological processes, however, generate oxidative stress that must be balanced through detoxification of reactive oxygen species (ROS). Using an unbiased retroviral loss-of-function screen in nontransformed human astrocytes, we demonstrate that mitochondrial PTEN-induced kinase 1 (PINK1) is a regulator of the Warburg effect and negative regulator of glioblastoma growth. We report that loss of PINK1 contributes to the Warburg effect through ROS-dependent stabilization of hypoxia-inducible factor-1A and reduced pyruvate kinase muscle isozyme 2 activity, both key regulators of aerobic glycolysis. Mechanistically, PINK1 suppresses ROS and tumor growth through FOXO3a, a master regulator of oxidative stress and superoxide dismutase 2. These findings highlight the importance of PINK1 and ROS balance in normal and tumor cells. PINK1 loss was observed in a significant number of human brain tumors including glioblastoma (n > 900) and correlated with poor patient survival. PINK1 overexpression attenuates in vivo glioblastoma growth in orthotopic mouse xenograft models and a transgenic glioblastoma model in Drosophila Cancer Res; 76(16); 4708-19. ©2016 AACR. PMID:27325644

  8. Long noncoding RNA LINP1 regulates double strand DNA break repair in triple negative breast cancer

    PubMed Central

    Zhang, Youyou; He, Qun; Hu, Zhongyi; Feng, Yi; Fan, Lingling; Tang, Zhaoqing; Yuan, Jiao; Shan, Weiwei; Li, Chunsheng; Hu, Xiaowen; Tanyi, Janos L; Fan, Yi; Huang, Qihong; Montone, Kathleen; Dang, Chi V; Zhang, Lin


    Long noncoding RNAs (lncRNAs), which are transcripts that are larger than 200 nucleotides but do not appear to have protein-coding potential, play critical roles during tumorigenesis by functioning as scaffolds to regulate protein-protein, protein-DNA or protein-RNA interactions. Using a clinically guided genetic screening approach, we identified (lncRNA in Non-homologous end joining [NHEJ] pathway 1) as a lncRNA that is overexpressed in human triple-negative breast cancer. We found that LINP1 enhances double-strand DNA break repair by serving as a scaffold that links Ku80 and DNA-PKcs, thereby coordinating the NHEJ pathway. Importantly, blocking LINP1, which is regulated by the p53 and epidermal growth factor receptor (EGFR) signaling, increases sensitivity of tumor cell response to radiotherapy in breast cancer. PMID:27111890

  9. Mechanisms of JAK/STAT pathway negative regulation by the short coreceptor Eye Transformer/Latran.


    Fisher, Katherine H; Stec, Wojciech; Brown, Stephen; Zeidler, Martin P


    Transmembrane receptors interact with extracellular ligands to transduce intracellular signaling cascades, modulate target gene expression, and regulate processes such as proliferation, apoptosis, differentiation, and homeostasis. As a consequence, aberrant signaling events often underlie human disease. Whereas the vertebrate JAK/STAT signaling cascade is transduced via multiple receptor combinations, the Drosophila pathway has only one full-length signaling receptor, Domeless (Dome), and a single negatively acting receptor, Eye Transformer/Latran (Et/Lat). Here we investigate the molecular mechanisms underlying Et/Lat activity. We demonstrate that Et/Lat negatively regulates the JAK/STAT pathway activity and can bind to Dome, thus reducing Dome:Dome homodimerization by creating signaling-incompetent Dome:Et/Lat heterodimers. Surprisingly, we find that Et/Lat is able to bind to both JAK and STAT92E but, despite the presence of putative cytokine-binding motifs, does not detectably interact with pathway ligands. We find that Et/Lat is trafficked through the endocytic machinery for lysosomal degradation but at a much slower rate than Dome, a difference that may enhance its ability to sequester Dome into signaling-incompetent complexes. Our data offer new insights into the molecular mechanism and regulation of Et/Lat in Drosophila that may inform our understanding of how short receptors function in other organisms.

  10. Suppressor of IKKɛ is an essential negative regulator of pathological cardiac hypertrophy

    PubMed Central

    Deng, Ke-Qiong; Wang, Aibing; Ji, Yan-Xiao; Zhang, Xiao-Jing; Fang, Jing; Zhang, Yan; Zhang, Peng; Jiang, Xi; Gao, Lu; Zhu, Xue-Yong; Zhao, Yichao; Gao, Lingchen; Yang, Qinglin; Zhu, Xue-Hai; Wei, Xiang; Pu, Jun; Li, Hongliang


    Although pathological cardiac hypertrophy represents a leading cause of morbidity and mortality worldwide, our understanding of the molecular mechanisms underlying this disease is still poor. Here, we demonstrate that suppressor of IKKɛ (SIKE), a negative regulator of the interferon pathway, attenuates pathological cardiac hypertrophy in rodents and non-human primates in a TANK-binding kinase 1 (TBK1)/AKT-dependent manner. Sike-deficient mice develop cardiac hypertrophy and heart failure, whereas Sike-overexpressing transgenic (Sike-TG) mice are protected from hypertrophic stimuli. Mechanistically, SIKE directly interacts with TBK1 to inhibit the TBK1-AKT signalling pathway, thereby achieving its anti-hypertrophic action. The suppression of cardiac remodelling by SIKE is further validated in rats and monkeys. Collectively, these findings identify SIKE as a negative regulator of cardiac remodelling in multiple animal species due to its inhibitory regulation of the TBK1/AKT axis, suggesting that SIKE may represent a therapeutic target for the treatment of cardiac hypertrophy and heart failure. PMID:27249321

  11. Children's Negative Emotionality Combined with Poor Self-Regulation Affects Allostatic Load in Adolescence

    ERIC Educational Resources Information Center

    Dich, Nadya; Doan, Stacey; Evans, Gary


    The present study examined the concurrent and prospective, longitudinal effects of childhood negative emotionality and self-regulation on allostatic load (AL), a physiological indicator of chronic stress. We hypothesized that negative emotionality in combination with poor self-regulation would predict elevated AL. Mothers reported on children's…

  12. Identification of cis-acting repressive sequences within the negative regulatory element of human immunodeficiency virus type 1.

    PubMed Central

    Lu, Y C; Touzjian, N; Stenzel, M; Dorfman, T; Sodroski, J G; Haseltine, W A


    The negative regulatory element of human immunodeficiency virus type 1 is a 260-nucleotide-long sequence that decreases the rate of RNA transcription initiation specified by the long terminal repeat. This region has the potential to bind several cellular transcription factors. Here it is shown that sequences which recognize the NFAT-1 and USF cellular transcription factors contribute to this negative regulatory effect. The sequences within the negative regulatory element which resemble the AP-1 site and the URS do not negatively regulate human immunodeficiency virus long terminal repeat transcription initiation. PMID:2398545

  13. Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM

    SciTech Connect

    Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim


    Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations.

  14. All-trans retinoic acid negatively regulates cytotoxic activities of nature killer cell line 92

    SciTech Connect

    Li Ang . E-mail:; He Meilan; Wang Hui; Qiao Bin; Chen Ping; Gu Hua; Zhang Mengjie; He Shengxiang


    NK cells are key components of innate immune systems and their activities are regulated by cytokines and hormones. All-trans retinoic acid (ATRA), as a metabolite of vitamin A and an immunomodulatory hormone, plays an important role in regulating immune responses. In the present study, we investigated the effect of ATRA on human NK cell line NK92. We found that ATRA dose-dependently suppressed cytotoxic activities of NK92 cells without affecting their proliferation. To explore the mechanisms underlying the ATRA influence on NK92 cells, we examined the production of cytokines (TNF-{alpha}, IFN-{gamma}), gene expression of cytotoxic-associated molecules (perforin, granzyme B, nature killer receptors (NCRs), and NKG2D), and the activation of NF-{kappa}B pathways related with immune response. Our results demonstrated that ATRA suppressed NF-{kappa}B activity and prevented I{kappa}B{alpha} degradation in a dose-dependent way, inhibited IFN-{gamma} production and gene expression of granzyme B and NKp46. Our findings suggest that ATRA is a negative regulator of NK92 cell activation and may act as a potential regulator of anti-inflammatory functions in vivo.

  15. Muscles do more positive than negative work in human locomotion

    PubMed Central

    DeVita, Paul; Helseth, Joseph; Hortobagyi, Tibor


    Summary Muscle work during level walking and ascent and descent ramp and stairway walking was assessed in order to explore the proposition that muscles perform more positive than negative work during these locomotion tasks. Thirty four healthy human adults were tested while maintaining a constant average walking velocity in the five gait conditions. Ground reaction force and sagittal plane kinematic data were obtained during the stance phases of these gaits and used in inverse dynamic analyses to calculate joint torques and powers at the hip, knee and ankle. Muscle work was derived as the area under the joint power vs time curves and was partitioned into positive, negative and net components. Dependent t-tests were used to compare positive and negative work in level walking and net joint work between ascent and descent gaits on the ramp and stairs (P<0.010). Total negative and positive work in level walking was −34 J and 50 J, respectively, with the difference in magnitude being statistically significant (P<0.001). Level walking was therefore performed with 16 J of net positive muscle work per step. The magnitude of the net work in ramp ascent was 25% greater than the magnitude of net work in ramp descent (89 vs −71 J m−1, P<0.010). Similarly, the magnitude of the net work in stair ascent was 43% greater than the magnitude of net work in stair descent (107 vs −75 J step−1, P<0.000). We identified three potential causes for the reduced negative vs positive work in these locomotion tasks: (1) the larger magnitude of the accelerations induced by the larger ground reaction forces in descending compared to ascending gaits elicited greater energy dissipation in non-muscular tissues, (2) the ground reaction force vector was directed closer to the joint centers in ramp and stair descent compared to ascent, which reduced the load on the muscular tissues and their energy dissipating response, and (3) despite the need to produce negative muscle work in descending

  16. Negative regulation of mTOR activation by diacylglycerol kinases

    PubMed Central

    Gorentla, Balachandra K.; Wan, Chi-Keung


    The engagement of TCR induces T-cell activation, which initiates multiple characteristic changes such as increase in cell size, cell division, and the production of cytokines and other effector molecules. The mammalian target of rapamycin (mTOR) regulates protein synthesis, transcription, cell survival, and autophagy. Critical roles of mTOR in T-cell activation and effector/memory differentiation have been revealed using chemical inhibitors or by genetic ablation of mTOR in T cells. However, the connection between mTOR signaling and other signaling cascades downstream of TCR is unclear. We demonstrate that diacylglycerol (DAG) and TCR engagement activate signaling in both mTOR complexes 1 and 2 through the activation of the Ras–mitogen-activated protein kinase/extracellular signal–regulated kinase 1/2 (Mek1/2)–extracellular signal–regulated kinase 1/2 (Erk1/2)–activator protein 1 (AP-1), known collectively as the Ras-Mek1/2-Erk1/2-AP-1 pathway. Deficiency of RasGRP1 or inhibition of Mek1/2 activity drastically decreases TCR-induced mTOR activation, whereas constitutively active Ras or Mek1 promotes mTOR activation. Although constitutively active Akt promotes TCR-induced mTOR activation, such activation is attenuated by Mek1/2 inhibition. We demonstrated further that DAG kinases (DGKs) α and ζ, which terminate DAG-mediated signaling, synergistically inhibit TCR-induced mTOR activation by inhibiting the Ras-Mek1/2-Erk/12 pathway. These observations provide novel insights into the regulation of mTOR activation. PMID:21310925

  17. Negative reciprocal regulation between Sirt1 and Per2 modulates the circadian clock and aging

    PubMed Central

    Wang, Rui-Hong; Zhao, Tingrui; Cui, Kairong; Hu, Gangqing; Chen, Qiang; Chen, Weiping; Wang, Xin-Wei; Soto-Gutierrez, Alejandro; Zhao, Keji; Deng, Chu-Xia


    Sirtuin 1 (SIRT1) is involved in both aging and circadian-clock regulation, yet the link between the two processes in relation to SIRT1 function is not clear. Using Sirt1-deficient mice, we found that Sirt1 and Period 2 (Per2) constitute a reciprocal negative regulation loop that plays important roles in modulating hepatic circadian rhythmicity and aging. Sirt1-deficient mice exhibited profound premature aging and enhanced acetylation of histone H4 on lysine16 (H4K16) in the promoter of Per2, the latter of which leads to its overexpression; in turn, Per2 suppresses Sirt1 transcription through binding to the Sirt1 promoter at the Clock/Bmal1 site. This negative reciprocal relationship between SIRT1 and PER2 was also observed in human hepatocytes. We further demonstrated that the absence of Sirt1 or the ectopic overexpression of Per2 in the liver resulted in a dysregulated pace of the circadian rhythm. The similar circadian rhythm was also observed in aged wild type mice. The interplay between Sirt1 and Per2 modulates aging gene expression and circadian-clock maintenance. PMID:27346580

  18. Fisetin, a bioactive flavonol, attenuates allergic airway inflammation through negative regulation of NF-κB.


    Goh, Fera Y; Upton, Nadine; Guan, Shouping; Cheng, Chang; Shanmugam, Muthu K; Sethi, Gautam; Leung, Bernard P; Wong, W S Fred


    Persistent activation of nuclear factor-κB (NF-κB) has been associated with the development of asthma. Fisetin (3,7,3',4'-tetrahydroxyflavone), a naturally occurring bioactive flavonol, has been shown to inhibit NF-κB activity. We hypothesized that fisetin may attenuate allergic asthma via negative regulation of the NF-κB activity. Female BALB/c mice sensitized and challenged with ovalbumin developed airway inflammation. Bronchoalveolar lavage fluid was assessed for total and differential cell counts, and cytokine and chemokine levels. Lung tissues were examined for cell infiltration and mucus hypersecretion, and the expression of inflammatory biomarkers. Airway hyperresponsiveness was monitored by direct airway resistance analysis. Fisetin dose-dependently inhibited ovalbumin-induced increases in total cell count, eosinophil count, and IL-4, IL-5 and IL-13 levels recovered in bronchoalveolar lavage fluid. It attenuated ovalbumin-induced lung tissue eosinophilia and airway mucus production, mRNA expression of adhesion molecules, chitinase, IL-17, IL-33, Muc5ac and inducible nitric oxide synthase in lung tissues, and airway hyperresponsiveness to methacholine. Fisetin blocked NF-κB subunit p65 nuclear translocation and DNA-binding activity in the nuclear extracts from lung tissues of ovalbumin-challenged mice. In normal human bronchial epithelial cells, fisetin repressed TNF-α-induced NF-κB-dependent reporter gene expression. Our findings implicate a potential therapeutic value of fisetin in the treatment of asthma through negative regulation of NF-κB pathway.

  19. Parental reactions to children's negative emotions: relationships with emotion regulation in children with an anxiety disorder.


    Hurrell, Katherine E; Hudson, Jennifer L; Schniering, Carolyn A


    Research has demonstrated that parental reactions to children's emotions play a significant role in the development of children's emotion regulation (ER) and adjustment. This study compared parent reactions to children's negative emotions between families of anxious and non-anxious children (aged 7-12) and examined associations between parent reactions and children's ER. Results indicated that children diagnosed with an anxiety disorder had significantly greater difficulty regulating a range of negative emotions and were regarded as more emotionally negative and labile by their parents. Results also suggested that mothers of anxious children espoused less supportive parental emotional styles when responding to their children's negative emotions. Supportive and non-supportive parenting reactions to children's negative emotions related to children's emotion regulation skills, with father's non-supportive parenting showing a unique relationship to children's negativity/lability.

  20. Parental reactions to children's negative emotions: relationships with emotion regulation in children with an anxiety disorder.


    Hurrell, Katherine E; Hudson, Jennifer L; Schniering, Carolyn A


    Research has demonstrated that parental reactions to children's emotions play a significant role in the development of children's emotion regulation (ER) and adjustment. This study compared parent reactions to children's negative emotions between families of anxious and non-anxious children (aged 7-12) and examined associations between parent reactions and children's ER. Results indicated that children diagnosed with an anxiety disorder had significantly greater difficulty regulating a range of negative emotions and were regarded as more emotionally negative and labile by their parents. Results also suggested that mothers of anxious children espoused less supportive parental emotional styles when responding to their children's negative emotions. Supportive and non-supportive parenting reactions to children's negative emotions related to children's emotion regulation skills, with father's non-supportive parenting showing a unique relationship to children's negativity/lability. PMID:25527899

  1. Quantum structure of negation and conjunction in human thought.


    Aerts, Diederik; Sozzo, Sandro; Veloz, Tomas


    We analyze in this paper the data collected in a set of experiments investigating how people combine natural concepts. We study the mutual influence of conceptual conjunction and negation by measuring the membership weights of a list of exemplars with respect to two concepts, e.g., Fruits and Vegetables, and their conjunction Fruits And Vegetables, but also their conjunction when one or both concepts are negated, namely, Fruits And Not Vegetables, Not Fruits And Vegetables, and Not Fruits And Not Vegetables. Our findings sharpen and advance existing analysis on conceptual combinations, revealing systematic deviations from classical (fuzzy set) logic and probability theory. And, more important, our results give further considerable evidence to the validity of our quantum-theoretic framework for the combination of two concepts. Indeed, the representation of conceptual negation naturally arises from the general assumptions of our two-sector Fock space model, and this representation faithfully agrees with the collected data. In addition, we find a new significant and a priori unexpected deviation from classicality, which can exactly be explained by assuming that human reasoning is the superposition of an "emergent reasoning" and a "logical reasoning," and that these two processes are represented in a Fock space algebraic structure. PMID:26483715

  2. Quantum structure of negation and conjunction in human thought

    PubMed Central

    Aerts, Diederik; Sozzo, Sandro; Veloz, Tomas


    We analyze in this paper the data collected in a set of experiments investigating how people combine natural concepts. We study the mutual influence of conceptual conjunction and negation by measuring the membership weights of a list of exemplars with respect to two concepts, e.g., Fruits and Vegetables, and their conjunction Fruits And Vegetables, but also their conjunction when one or both concepts are negated, namely, Fruits And Not Vegetables, Not Fruits And Vegetables, and Not Fruits And Not Vegetables. Our findings sharpen and advance existing analysis on conceptual combinations, revealing systematic deviations from classical (fuzzy set) logic and probability theory. And, more important, our results give further considerable evidence to the validity of our quantum-theoretic framework for the combination of two concepts. Indeed, the representation of conceptual negation naturally arises from the general assumptions of our two-sector Fock space model, and this representation faithfully agrees with the collected data. In addition, we find a new significant and a priori unexpected deviation from classicality, which can exactly be explained by assuming that human reasoning is the superposition of an “emergent reasoning” and a “logical reasoning,” and that these two processes are represented in a Fock space algebraic structure. PMID:26483715

  3. Negative regulation of the innate antiviral immune response by TRIM62 from orange spotted grouper.


    Yang, Ying; Huang, Youhua; Yu, Yepin; Zhou, Sheng; Wang, Shaowen; Yang, Min; Qin, Qiwei; Huang, Xiaohong


    Increased reports uncovered that mammalian tripartite motif-containing 62 (TRIM62) exerts crucial roles in cancer and innate immune response. However, the roles of fish TRIM62 in antiviral immune response remained uncertain. In this study, a TRIM62 gene was cloned from orange spotted grouper (EcTRIM62) and its roles in grouper RNA virus infection was elucidated in vitro. EcTRIM62 shared 99% and 83% identity to bicolor damselfish (Stegastes partitus) and human (Homo sapiens), respectively. Sequence alignment indicated that EcTRIM62 contained three domains, including a RING-finger domain, a B-box domain and a SPRY domain. In healthy grouper, the transcript of EcTRIM62 was predominantly detected in brain and liver, followed by heart, skin, spleen, fin, gill, intestine, and stomach. Subcellular localization analysis indicated that bright fluorescence spots were observed in the cytoplasm of EcTRIM62-transfected grouper spleen (GS) cells. During red-spotted grouper nervous necrosis (RGNNV) infection, overexpression of EcTRIM62 significantly enhanced the severity of CPE and increased viral gene transcriptions. Furthermore, the ectopic expression of EcTRIM62 significantly decreased the transcription level of interferon signaling molecules, including interferon regulatory factor 3 (IRF3), IRF7, interferon-stimulated gene 15 (ISG15), melanoma differentiation-associated protein 5 (MDA5), myxovirus resistance gene MXI, and MXII, suggesting that the negative regulation of interferon immune response by EcTRIM62 might directly contributed to its enhancing effect on RGNNV replication. Furthermore, our results also demonstrated that overexpression of EcTRIM62 was able to differently regulate the expression levels of pro-inflammation cytokines. In addition, we found the ectopic expression of EcTIRM62 negatively regulated MDA5-, but not mediator of IRF3 activation (MITA)-induced interferon immune response. Further studies showed that the deletion of RING domain and SPRY domain

  4. Negative regulation of the innate antiviral immune response by TRIM62 from orange spotted grouper.


    Yang, Ying; Huang, Youhua; Yu, Yepin; Zhou, Sheng; Wang, Shaowen; Yang, Min; Qin, Qiwei; Huang, Xiaohong


    Increased reports uncovered that mammalian tripartite motif-containing 62 (TRIM62) exerts crucial roles in cancer and innate immune response. However, the roles of fish TRIM62 in antiviral immune response remained uncertain. In this study, a TRIM62 gene was cloned from orange spotted grouper (EcTRIM62) and its roles in grouper RNA virus infection was elucidated in vitro. EcTRIM62 shared 99% and 83% identity to bicolor damselfish (Stegastes partitus) and human (Homo sapiens), respectively. Sequence alignment indicated that EcTRIM62 contained three domains, including a RING-finger domain, a B-box domain and a SPRY domain. In healthy grouper, the transcript of EcTRIM62 was predominantly detected in brain and liver, followed by heart, skin, spleen, fin, gill, intestine, and stomach. Subcellular localization analysis indicated that bright fluorescence spots were observed in the cytoplasm of EcTRIM62-transfected grouper spleen (GS) cells. During red-spotted grouper nervous necrosis (RGNNV) infection, overexpression of EcTRIM62 significantly enhanced the severity of CPE and increased viral gene transcriptions. Furthermore, the ectopic expression of EcTRIM62 significantly decreased the transcription level of interferon signaling molecules, including interferon regulatory factor 3 (IRF3), IRF7, interferon-stimulated gene 15 (ISG15), melanoma differentiation-associated protein 5 (MDA5), myxovirus resistance gene MXI, and MXII, suggesting that the negative regulation of interferon immune response by EcTRIM62 might directly contributed to its enhancing effect on RGNNV replication. Furthermore, our results also demonstrated that overexpression of EcTRIM62 was able to differently regulate the expression levels of pro-inflammation cytokines. In addition, we found the ectopic expression of EcTIRM62 negatively regulated MDA5-, but not mediator of IRF3 activation (MITA)-induced interferon immune response. Further studies showed that the deletion of RING domain and SPRY domain

  5. Cortical electrical stimulation in humans. The negative motor areas.


    Lüders, H O; Dinner, D S; Morris, H H; Wyllie, E; Comair, Y G


    Summarizing, we have presented evidence in humans for two "negative motor areas" which we had speculated play a significant role in the planning of voluntary motor movements. A review of the more recent experimental literature shows that histological, physiological, and electrical stimulation studies in animals reveal the existence of two frontal regions that from the experimental data also seem to play an essential role in the preparation (as opposed to execution) of voluntary movements. Current available evidence suggests that these two areas (areas F5 and F6 of Rizzolatti et al.) correspond to the negative motor areas we have described in human studies. Also of interest is that Broca's area in the dominant hemisphere overlaps the corresponding negative motor area. This observation suggests that Broca's area has evolved from area F5 of monkeys specializing in the planning of fine movements necessary for speech production. We feel that current evidence suggests the existence of three mechanisms by which cortical stimulation (by electrical stimulation or by epileptic activation) can generate negative motor phenomena: 1. The "silent period," which is consistently contralateral, has a somatotopic distribution, and tends to affect predominantly muscles involved in fine movements. It is of relatively short duration and seems to be generated by the activation of cortical areas in the primary sensorimotor region. The H-reflex is not inhibited during the silent period, suggesting that the silent period is generated by a decrease in the excitatory input through direct corticospinal neurons on the spinal alpha motoneurons. It is possible that in normal individuals this system is used for fine tuning of fine distal movements. The negative myoclonus seen in some patients with focal cortical epilepsy is probably generated by this mechanism. The primary and supplementary "negative motor areas" described in this chapter. This effect also has a somatotopic distribution but can

  6. Glycosylation of CD44 negatively regulates its recognition of hyaluronan

    PubMed Central


    Although CD44 is expressed on a wide variety of cell types, few of them use it to recognize the ligand hyaluronan (HA). A glycosylation- defective clone of Chinese hamster ovary cells (Lec 8) bound HA, demonstrating that complete processing of glycoproteins with addition of a full complement of sialic acid is not required. On the contrary, subsequent findings revealed that complex sugars on CD44 can actually inhibit ligand recognition. Two subclones of wild-type Chinese hamster ovary cells with similar amounts of surface CD44 were isolated on the basis of HA binding and found to differ with respect to CD44 size as well as staining with fluorescent lectins. Treatment of the nonbinding clone with tunicamycin reduced the size of the protein and allowed the cells to recognize HA via CD44. This function was also induced by treatment with deglycosylating enzymes (either a mixture of endoglycosidase F and N-glycosidase F or neuraminidase alone). A possible role for glycosylation in regulation of adhesion was then sought with a series of normal and transformed murine cells. Disruption of glycosylation or treatment with deglycosylating enzymes did not induce ligand binding in an interleukin 7-dependent pre-B cell line, and splenic B cells also appeared to be in an inactive state. Some normal B cells acquired the ability to recognize HA after stimulation with lipopolysaccharide or interleukin 5 and had distinctive surface characteristics (loss of immunoglobulin D and acquisition of CD43). An additional subset of activated cells might have been in a transitional state, because the cells bound ligand after neuraminidase treatment. The ligand-binding ability of a purified CD44-immunoglobulin fusion protein dramatically increased after neuraminidase treatment. Thus, differential glycosylation of this molecule is sufficient to influence its recognition function. Cell adhesion involving HA can be regulated by multiple mechanisms, one of which involves variable glycosylation of CD

  7. The trans-kingdom identification of negative regulators of pathogen hypervirulence.


    Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E


    Modern society and global ecosystems are increasingly under threat from pathogens, which cause a plethora of human, animal, invertebrate and plant diseases. Of increasing concern is the trans-kingdom tendency for increased pathogen virulence that is beginning to emerge in natural, clinical and agricultural settings. The study of pathogenicity has revealed multiple examples of convergently evolved virulence mechanisms. Originally described as rare, but increasingly common, are interactions where a single gene deletion in a pathogenic species causes hypervirulence. This review utilised the pathogen-host interaction database ( to identify 112 hypervirulent mutations from 37 pathogen species, and subsequently interrogates the trans-kingdom, conserved, molecular, biochemical and cellular themes that cause hypervirulence. This study investigates 22 animal and 15 plant pathogens including 17 bacterial and 17 fungal species. Finally, the evolutionary significance and trans-kingdom requirement for negative regulators of hypervirulence and the implication of pathogen hypervirulence and emerging infectious diseases on society are discussed.

  8. LRIG1 is a triple threat: ERBB negative regulator, intestinal stem cell marker and tumour suppressor.


    Wang, Y; Poulin, E J; Coffey, R J


    In baseball parlance, a triple threat is a person who can run, hit and throw with aplomb. Leucine-rich repeats and immunoglobulin-like domains 1 (LRIG1) is a cell surface protein that antagonises ERBB receptor signalling by downregulating receptor levels. Over 10 years ago, Hedman et al postulated that LRIG1 might be a tumour suppressor. Recently, Powell et al provided in vivo evidence substantiating that claim by demonstrating that Lrig1 loss in mice leads to spontaneously arising, highly penetrant intestinal adenomas. Interestingly, Lrig1 also marks stem cells in the gut, suggesting a potential role for Lrig1 in maintaining intestinal epithelial homeostasis. In this review, we will discuss the ability of LRIG1 to act as a triple threat: pan-ERBB negative regulator, intestinal stem cell marker and tumour suppressor. We will summarise studies of LRIG1 expression in human cancers and discuss possible related roles for LRIG2 and LRIG3.

  9. Muscle Lim Protein isoform negatively regulates striated muscle actin dynamics and differentiation

    PubMed Central

    Vafiadaki, Elizabeth; Arvanitis, Demetrios A.; Papalouka, Vasiliki; Terzis, Gerasimos; Roumeliotis, Theodoros I.; Spengos, Konstantinos; Garbis, Spiros D.; Manta, Panagiota; Kranias, Evangelia G.; Sanoudou, Despina


    Muscle Lim Protein (MLP) has emerged as a critical regulator of striated muscle physiology and pathophysiology. Mutations in cysteine and glycine-rich protein 3 (CSRP3), the gene encoding MLP, have been directly associated with human cardiomyopathies, while aberrant expression patterns are reported in human cardiac and skeletal muscle diseases. Increasing evidence suggests that MLP has an important role in both myogenic differentiation and myocyte cytoarchitecture, although the full spectrum of its intracellular roles has not been delineated. We report the discovery of an alternative splice variant of MLP, designated as MLP-b, showing distinct expression in neuromuscular disease and direct roles in actin dynamics and muscle differentiation. This novel isoform originates by alternative splicing of exons 3 and 4. At the protein level, it contains the N-terminus first half LIM domain of MLP and a unique sequence of 22 amino acids. Physiologically it is expressed during early differentiation, whereas its overexpression reduces C2C12 differentiation and myotube formation. This may be mediated through its inhibition of MLP/CFL2-mediated F-actin dynamics. In differentiated striated muscles, MLP-b localizes to the sarcomeres and binds directly to Z-disc components including α-actinin, T-cap and MLP. Our findings unveil a novel player in muscle physiology and pathophysiology that is implicated in myogenesis as a negative regulator of myotube formation, and in differentiated striated muscles as a contributor to sarcomeric integrity. PMID:24860983

  10. The Deubiquitinase OTULIN Is an Essential Negative Regulator of Inflammation and Autoimmunity.


    Damgaard, Rune Busk; Walker, Jennifer A; Marco-Casanova, Paola; Morgan, Neil V; Titheradge, Hannah L; Elliott, Paul R; McHale, Duncan; Maher, Eamonn R; McKenzie, Andrew N J; Komander, David


    Methionine-1 (M1)-linked ubiquitin chains regulate the activity of NF-κB, immune homeostasis, and responses to infection. The importance of negative regulators of M1-linked chains in vivo remains poorly understood. Here, we show that the M1-specific deubiquitinase OTULIN is essential for preventing TNF-associated systemic inflammation in humans and mice. A homozygous hypomorphic mutation in human OTULIN causes a potentially fatal autoinflammatory condition termed OTULIN-related autoinflammatory syndrome (ORAS). Four independent OTULIN mouse models reveal that OTULIN deficiency in immune cells results in cell-type-specific effects, ranging from over-production of inflammatory cytokines and autoimmunity due to accumulation of M1-linked polyubiquitin and spontaneous NF-κB activation in myeloid cells to downregulation of M1-polyubiquitin signaling by degradation of LUBAC in B and T cells. Remarkably, treatment with anti-TNF neutralizing antibodies ameliorates inflammation in ORAS patients and rescues mouse phenotypes. Hence, OTULIN is critical for restraining life-threatening spontaneous inflammation and maintaining immune homeostasis. PMID:27523608

  11. PKC{eta} is a negative regulator of AKT inhibiting the IGF-I induced proliferation

    SciTech Connect

    Shahaf, Galit; Rotem-Dai, Noa; Koifman, Gabriela; Raveh-Amit, Hadas; Frost, Sigal A.; Livneh, Etta


    The PI3K-AKT pathway is frequently activated in human cancers, including breast cancer, and its activation appears to be critical for tumor maintenance. Some malignant cells are dependent on activated AKT for their survival; tumors exhibiting elevated AKT activity show sensitivity to its inhibition, providing an Achilles heel for their treatment. Here we show that the PKC{eta} isoform is a negative regulator of the AKT signaling pathway. The IGF-I induced phosphorylation on Ser473 of AKT was inhibited by the PKC{eta}-induced expression in MCF-7 breast adenocarcinoma cancer cells. This was further confirmed in shRNA PKC{eta}-knocked-down MCF-7 cells, demonstrating elevated phosphorylation on AKT Ser473. While PKC{eta} exhibited negative regulation on AKT phosphorylation it did not alter the IGF-I induced ERK phosphorylation. However, it enhanced ERK phosphorylation when stimulated by PDGF. Moreover, its effects on IGF-I/AKT and PDGF/ERK pathways were in correlation with cell proliferation. We further show that both PKC{eta} and IGF-I confer protection against UV-induced apoptosis and cell death having additive effects. Although the protective effect of IGF-I involved activation of AKT, it was not affected by PKC{eta} expression, suggesting that PKC{eta} acts through a different route to increase cell survival. Hence, our studies show that PKC{eta} provides negative control on AKT pathway leading to reduced cell proliferation, and further suggest that its presence/absence in breast cancer cells will affect cell death, which could be of therapeutic value.

  12. CRTAM is negatively regulated by ZEB1 in T cells.


    Rojas-Marquez, C; Valle-Rios, R; Lopez-Bayghen, E; Ortiz-Navarrete, V


    T cell activation leads to the induction of genes that are required for appropriate immune responses. This includes CRTAM (Class-I MHC-restricted T cell associated molecule), a protein that plays a key role in T cell development, proliferation, and generating cell polarity during activation. We previously characterized the CRTAM promoter and described how AP-1 family members are important for inducing CRTAM expression upon antigenic activation. Here, we show that CRTAM is a molecular target for ZEB1 (zinc finger E-box-binding protein), a homeodomain/Zn finger transcription factor. Overexpression of ZEB1 repressed CRTAM promoter activity, as well as endogenous CRTAM levels in human T cells. ZEB1-mediated transcriptional repression was abolished when E-box-like elements in the CRTAM promoter are mutated. In summary, ZEB1 functions as a transcriptional repressor for the CRTAM gene in both non-stimulated and stimulated T cells, thereby modulating adaptive immune responses.

  13. Temperature: Human Regulating, Ants Conforming

    ERIC Educational Resources Information Center

    Clopton, Joe R.


    Biological processes speed up as temperature rises. Procedures for demonstrating this with ants traveling on trails, and data gathered by students on the Argentine ant ("Linepithema humile") are presented. The concepts of temperature regulation and conformity are detailed with a focus on the processes rather than on terms that label the organisms.

  14. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell

    PubMed Central

    Luo, Yumei; Chen, Zikai; Zhu, Detu; Tu, Haitao; Pan, Shen Quan


    The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT) can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C); knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells. PMID:26425545

  15. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell.


    Luo, Yumei; Chen, Zikai; Zhu, Detu; Tu, Haitao; Pan, Shen Quan


    The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT) can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C); knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells. PMID:26425545

  16. SMARCAL1 Negatively Regulates C-Myc Transcription By Altering The Conformation Of The Promoter Region

    PubMed Central

    Sharma, Tapan; Bansal, Ritu; Haokip, Dominic Thangminlen; Goel, Isha; Muthuswami, Rohini


    SMARCAL1, a member of the SWI2/SNF2 protein family, stabilizes replication forks during DNA damage. In this manuscript, we provide the first evidence that SMARCAL1 is also a transcriptional co-regulator modulating the expression of c-Myc, a transcription factor that regulates 10–15% genes in the human genome. BRG1, SMARCAL1 and RNAPII were found localized onto the c-myc promoter. When HeLa cells were serum starved, the occupancy of SMARCAL1 on the c-myc promoter increased while that of BRG1 and RNAPII decreased correlating with repression of c-myc transcription. Using Active DNA-dependent ATPase A Domain (ADAAD), the bovine homolog of SMARCAL1, we show that the protein can hydrolyze ATP using a specific region upstream of the CT element of the c-myc promoter as a DNA effector. The energy, thereby, released is harnessed to alter the conformation of the promoter DNA. We propose that SMARCAL1 negatively regulates c-myc transcription by altering the conformation of its promoter region during differentiation. PMID:26648259

  17. Chondroitin sulfate addition to CD44H negatively regulates hyaluronan binding

    SciTech Connect

    Ruffell, Brian; Johnson, Pauline . E-mail:


    CD44 is a widely expressed cell adhesion molecule that binds hyaluronan, an extracellular matrix glycosaminoglycan, in a tightly regulated manner. This regulated interaction has been implicated in inflammation and tumor metastasis. CD44 exists in the standard form, CD44H, or as higher molecular mass isoforms due to alternative splicing. Here, we identify serine 180 in human CD44H as the site of chondroitin sulfate addition and show that lack of chondroitin sulfate addition at this site enhances hyaluronan binding by CD44. A CD44H-immunoglobulin fusion protein expressed in HEK293 cells, and CD44H expressed in murine L fibroblast cells were modified by chondroitin sulfate, as determined by reduced sulfate incorporation after chondroitinase ABC treatment. Mutation of serine 180 or glycine 181 in CD44H reduced chondroitin sulfate addition and increased hyaluronan binding, indicating that serine 180 is the site for chondroitin sulfate addition in CD44H and that this negatively regulates hyaluronan binding.

  18. SMARCAL1 Negatively Regulates C-Myc Transcription By Altering The Conformation Of The Promoter Region.


    Sharma, Tapan; Bansal, Ritu; Haokip, Dominic Thangminlen; Goel, Isha; Muthuswami, Rohini


    SMARCAL1, a member of the SWI2/SNF2 protein family, stabilizes replication forks during DNA damage. In this manuscript, we provide the first evidence that SMARCAL1 is also a transcriptional co-regulator modulating the expression of c-Myc, a transcription factor that regulates 10-15% genes in the human genome. BRG1, SMARCAL1 and RNAPII were found localized onto the c-myc promoter. When HeLa cells were serum starved, the occupancy of SMARCAL1 on the c-myc promoter increased while that of BRG1 and RNAPII decreased correlating with repression of c-myc transcription. Using Active DNA-dependent ATPase A Domain (ADAAD), the bovine homolog of SMARCAL1, we show that the protein can hydrolyze ATP using a specific region upstream of the CT element of the c-myc promoter as a DNA effector. The energy, thereby, released is harnessed to alter the conformation of the promoter DNA. We propose that SMARCAL1 negatively regulates c-myc transcription by altering the conformation of its promoter region during differentiation.

  19. Yeast Actin-Related Protein ARP6 Negatively Regulates Agrobacterium-Mediated Transformation of Yeast Cell.


    Luo, Yumei; Chen, Zikai; Zhu, Detu; Tu, Haitao; Pan, Shen Quan


    The yeasts, including Saccharomyces cerevisiae and Pichia pastoris, are single-cell eukaryotic organisms that can serve as models for human genetic diseases and hosts for large scale production of recombinant proteins in current biopharmaceutical industry. Thus, efficient genetic engineering tools for yeasts are of great research and economic values. Agrobacterium tumefaciens-mediated transformation (AMT) can transfer T-DNA into yeast cells as a method for genetic engineering. However, how the T-DNA is transferred into the yeast cells is not well established yet. Here our genetic screening of yeast knockout mutants identified a yeast actin-related protein ARP6 as a negative regulator of AMT. ARP6 is a critical member of the SWR1 chromatin remodeling complex (SWR-C); knocking out some other components of the complex also increased the transformation efficiency, suggesting that ARP6 might regulate AMT via SWR-C. Moreover, knockout of ARP6 led to disruption of microtubule integrity, higher uptake and degradation of virulence proteins, and increased DNA stability inside the cells, all of which resulted in enhanced transformation efficiency. Our findings have identified molecular and cellular mechanisms regulating AMT and a potential target for enhancing the transformation efficiency in yeast cells.

  20. Staphylococcus aureus CodY Negatively Regulates Virulence Gene Expression▿

    PubMed Central

    Majerczyk, Charlotte D.; Sadykov, Marat R.; Luong, Thanh T.; Lee, Chia; Somerville, Greg A.; Sonenshein, Abraham L.


    CodY is a global regulatory protein that was first discovered in Bacillus subtilis, where it couples gene expression to changes in the pools of critical metabolites through its activation by GTP and branched-chain amino acids. Homologs of CodY can be found encoded in the genomes of nearly all low-G+C gram-positive bacteria, including Staphylococcus aureus. The introduction of a codY-null mutation into two S. aureus clinical isolates, SA564 and UAMS-1, through allelic replacement, resulted in the overexpression of several virulence genes. The mutant strains had higher levels of hemolytic activity toward rabbit erythrocytes in their culture fluid, produced more polysaccharide intercellular adhesin (PIA), and formed more robust biofilms than did their isogenic parent strains. These phenotypes were associated with derepressed levels of RNA for the hemolytic alpha-toxin (hla), the accessory gene regulator (agr) (RNAII and RNAIII/hld), and the operon responsible for the production of PIA (icaADBC). These data suggest that CodY represses, either directly or indirectly, the synthesis of a number of virulence factors of S. aureus. PMID:18156263

  1. Expression of Tyrosine Hydroxylase is Negatively Regulated Via Prion Protein.


    da Luz, Marcio Henrique Mello; Glezer, Isaias; Xavier, Andre Machado; da Silva, Marcelo Alberti Paiva; Pino, Jessica Monteiro Volejnik; Zamith, Thiago Panaro; Vieira, Taynara Fernanda; Antonio, Bruno Brito; Antunes, Hanna Karen Moreira; Martins, Vilma Regina; Lee, Kil Sun


    Cellular prion protein (PrP(C)) is a glycoprotein of the plasma membrane that plays pleiotropic functions by interacting with multiple signaling complexes at the cell surface. Recently, a number of studies have reported the involvement of PrP(C) in dopamine metabolism and signaling, including its interactions with tyrosine hydroxylase (TH) and dopamine receptors. However, the outcomes reported by independent studies are still debatable. Therefore in this study, we investigated the effects of PrP(C) on the TH expression during the differentiation of N2a cells with dibutyryl-cAMP, a well-known cAMP analog that activates TH transcription. Upon differentiation, TH was induced with concomitant reduction of PrP(C) at protein level, but not at mRNA level. shRNA-mediated PrP(C) reduction increased the basal level of TH at both mRNA and protein levels without dibutyryl-cAMP treatment. This phenotype was reversed by re-expression of PrP(C). PrP(C) knockdown also potentiated the effect of dibutyryl-cAMP on TH expression. Our findings suggest that PrP(C) has suppressive effects on TH expression. As a consequence, altered PrP(C) functions may affect the regulation of dopamine metabolism and related neurological disorders.

  2. SPTLC1 binds ABCA1 to negatively regulate trafficking and cholesterol efflux activity of the transporter.


    Tamehiro, Norimasa; Zhou, Suiping; Okuhira, Keiichiro; Benita, Yair; Brown, Cari E; Zhuang, Debbie Z; Latz, Eicke; Hornemann, Thorsten; von Eckardstein, Arnold; Xavier, Ramnik J; Freeman, Mason W; Fitzgerald, Michael L


    ABCA1 transport of cholesterol and phospholipids to nascent HDL particles plays a central role in lipoprotein metabolism and macrophage cholesterol homeostasis. ABCA1 activity is regulated both at the transcriptional level and at the post-translational level. To explore mechanisms involved in the post-translational regulation of the transporter, we have used affinity purification and mass spectrometry to identify proteins that bind ABCA1 and influence its activity. Previously, we demonstrated that an interaction between beta1-syntrophin stimulated ABCA1 activity, at least in part, be slowing the degradation of the transporter. This work demonstrates that one subunit of the serine palmitoyltransferase enzyme, SPTLC1, but not subunit 2 (SPTLC2), is copurified with ABCA1 and negatively regulates its function. In human THP-I macrophages and in mouse liver, the ABCA1-SPTLC1 complex was detected by co-immunoprecipitation, demonstrating that the interaction occurs in cellular settings where ABCA1 activity is critical for HDL genesis. Pharmacologic inhibition of SPTLC1 with myriocin, which resulted in the disruption of the SPTLC1-ABCA1 complex, and siRNA knockdown of SPTLC1 expression both stimulated ABCA1 efflux by nearly 60% ( p < 0.05). In contrast, dominant-negative mutants of SPTLC1 inhibited ABCA1 efflux, indicating that a reduced level of sphingomyelin synthesis could not explain the effect of myriocin on ABCA1 activity. In 293 cells, the SPTLC1 inhibition of ABCA1 activity led to the blockade of the exit of ABCA1 from the endoplasmic reticulum. In contrast, myriocin treatment of macrophages increased the level of cell surface ABCA1. In composite, these results indicate that the physical interaction of ABCA1 and SPTLC1 results in reduction of ABCA1 activity and that inhibition of this interaction produces enhanced cholesterol efflux. PMID:18484747

  3. Anandamide-derived prostamide F2α negatively regulates adipogenesis.


    Silvestri, Cristoforo; Martella, Andrea; Poloso, Neil J; Piscitelli, Fabiana; Capasso, Raffaele; Izzo, Angelo; Woodward, David F; Di Marzo, Vincenzo


    Lipid mediators variedly affect adipocyte differentiation. Anandamide stimulates adipogenesis via CB1 receptors and peroxisome proliferator-activated receptor γ. Anandamide may be converted by PTGS2 (COX2) and prostaglandin F synthases, such as prostamide/prostaglandin F synthase, to prostaglandin F2α ethanolamide (PGF2αEA), of which bimatoprost is a potent synthetic analog. PGF2αEA/bimatoprost act via prostaglandin F2αFP receptor/FP alt4 splicing variant heterodimers. We investigated whether prostamide signaling occurs in preadipocytes and controls adipogenesis. Exposure of mouse 3T3-L1 or human preadipocytes to PGF2αEA/bimatoprost during early differentiation inhibits adipogenesis. PGF2αEA is produced from anandamide in preadipocytes and much less so in differentiating adipocytes, which express much less PTGS2, FP, and its alt4 splicing variant. Selective antagonism of PGF2αEA receptors counteracts prostamide effects on adipogenesis, as does inhibition of ERK1/2 phosphorylation. Selective inhibition of PGF2αEA versus prostaglandin F2α biosynthesis accelerates adipogenesis. PGF2αEA levels are reduced in the white adipose tissue of high fat diet-fed mice where there is a high requirement for new adipocytes. Prostamides also inhibit zebrafish larval adipogenesis in vivo. We propose that prostamide signaling in preadipocytes is a novel anandamide-derived antiadipogenic mechanism. PMID:23801328

  4. Anandamide-derived Prostamide F2α Negatively Regulates Adipogenesis

    PubMed Central

    Silvestri, Cristoforo; Martella, Andrea; Poloso, Neil J.; Piscitelli, Fabiana; Capasso, Raffaele; Izzo, Angelo; Woodward, David F.; Di Marzo, Vincenzo


    Lipid mediators variedly affect adipocyte differentiation. Anandamide stimulates adipogenesis via CB1 receptors and peroxisome proliferator-activated receptor γ. Anandamide may be converted by PTGS2 (COX2) and prostaglandin F synthases, such as prostamide/prostaglandin F synthase, to prostaglandin F2α ethanolamide (PGF2αEA), of which bimatoprost is a potent synthetic analog. PGF2αEA/bimatoprost act via prostaglandin F2αFP receptor/FP alt4 splicing variant heterodimers. We investigated whether prostamide signaling occurs in preadipocytes and controls adipogenesis. Exposure of mouse 3T3-L1 or human preadipocytes to PGF2αEA/bimatoprost during early differentiation inhibits adipogenesis. PGF2αEA is produced from anandamide in preadipocytes and much less so in differentiating adipocytes, which express much less PTGS2, FP, and its alt4 splicing variant. Selective antagonism of PGF2αEA receptors counteracts prostamide effects on adipogenesis, as does inhibition of ERK1/2 phosphorylation. Selective inhibition of PGF2αEA versus prostaglandin F2α biosynthesis accelerates adipogenesis. PGF2αEA levels are reduced in the white adipose tissue of high fat diet-fed mice where there is a high requirement for new adipocytes. Prostamides also inhibit zebrafish larval adipogenesis in vivo. We propose that prostamide signaling in preadipocytes is a novel anandamide-derived antiadipogenic mechanism. PMID:23801328

  5. Testosterone negatively regulates right ventricular load stress responses in mice.


    Hemnes, Anna R; Maynard, Karen B; Champion, Hunter C; Gleaves, Linda; Penner, Niki; West, James; Newman, John H


    Right ventricular (RV) function is the major determinant of mortality in pulmonary arterial hypertension and male sex is a strong predictor of mortality in this disease. The effects of testosterone on RV structure and function in load stress are presently unknown. We tested whether testosterone levels affect RV hypertrophic responses, fibrosis, and function. Male C57BL/6 mice underwent castration or sham followed by pulmonary artery banding (PAB) or sham. After recovery, testosterone pellets were placed in a subset of the castrated mice and mice were maintained for at least two weeks, when they underwent hemodynamic measurements and tissues were harvested. Plasma levels of testosterone were reduced by castration and repleted by testosterone administration. In PAB, castration resulted in lower right ventricle/left ventricle + septum (RV/LV+S), and myocyte diameter (P < 0.05). Replacement of testosterone normalized these parameters and increased RV fibrosis (P < 0.05). Two weeks of PAB resulted in increased RV systolic pressure in all groups with decreased markers of RV systolic and diastolic function, specifically reduced ejection fraction and increased time constant, and dPdt minimum (P < 0.05), though there was minimal effect of testosterone on hemodynamic parameters. Survival was improved in mice that underwent castration with PAB compared with PAB alone (P < 0.05). Testosterone affects RV hypertrophic response to load stress through increased myocyte size and increased fibrosis in mice. Castration and testosterone replacement are not accompanied by significant alterations in RV in vivo hemodynamics, but testosterone deprivation appears to improve survival in PAB. Further study of the role of testosterone in RV dysfunction is warranted to better understand these findings in the context of human disease.

  6. The recurrence of negatively reinforced responding of humans.


    Alessandri, Jérôme; Lattal, Kennon A; Cançado, Carlos R X


    The recurrence of negatively reinforced responding of humans was studied in three experiments. In each experiment during Baseline, key-pressing produced 3-s timeouts from a requirement to exert finger pressure on a force cell according to variable- or fixed-ratio schedules of reinforcement. In Experiment 1, resurgence was studied by arranging a differential-reinforcement-of-other-behavior schedule in the second phase, and extinction in the Test phase. In Experiment 2, ABA renewal was studied by extinguishing responding in the second phase in a different context and, in the Test phase, by presenting the Baseline-phase context when extinction still was in effect. In Experiment 3, reinstatement was studied by arranging extinction in the second phase, followed by the delivery of response-independent timeouts in the Test phase. Resurgence and renewal occurred consistently for each participant in Experiments 1 and 2, respectively. In Experiment 3, reinstatement was observed less consistently in four participants. The results of these experiments replicate and extend to negatively reinforced responding previous findings of the resurgence and renewal of positively reinforced responding obtained mainly with nonhuman animals. PMID:26676180

  7. The recurrence of negatively reinforced responding of humans.


    Alessandri, Jérôme; Lattal, Kennon A; Cançado, Carlos R X


    The recurrence of negatively reinforced responding of humans was studied in three experiments. In each experiment during Baseline, key-pressing produced 3-s timeouts from a requirement to exert finger pressure on a force cell according to variable- or fixed-ratio schedules of reinforcement. In Experiment 1, resurgence was studied by arranging a differential-reinforcement-of-other-behavior schedule in the second phase, and extinction in the Test phase. In Experiment 2, ABA renewal was studied by extinguishing responding in the second phase in a different context and, in the Test phase, by presenting the Baseline-phase context when extinction still was in effect. In Experiment 3, reinstatement was studied by arranging extinction in the second phase, followed by the delivery of response-independent timeouts in the Test phase. Resurgence and renewal occurred consistently for each participant in Experiments 1 and 2, respectively. In Experiment 3, reinstatement was observed less consistently in four participants. The results of these experiments replicate and extend to negatively reinforced responding previous findings of the resurgence and renewal of positively reinforced responding obtained mainly with nonhuman animals.

  8. Toddler Emotion Regulation with Mothers and Fathers: Temporal Associations between Negative Affect and Behavioral Strategies

    ERIC Educational Resources Information Center

    Ekas, Naomi V.; Braungart-Rieker, Julia M.; Lickenbrock, Diane M.; Zentall, Shannon R.; Maxwell, Scott M.


    The present study investigated temporal associations between putative emotion regulation strategies and negative affect in 20-month-old toddlers. Toddlers' parent-focused, self-distraction, and toy-focused strategies, as well as negative affect, were rated on a second-by-second basis during laboratory parent-toddler interactions. Longitudinal…

  9. The Role of Depression and Negative Affect Regulation Expectancies in Tobacco Smoking among College Students

    ERIC Educational Resources Information Center

    Schleicher, Holly E.; Harris, Kari Jo; Catley, Delwyn; Nazir, Niaman


    Objective: Expectancies about nicotine's ability to alleviate negative mood states may play a role in the relationship between smoking and depression. The authors examined the role of negative affect regulation expectancies as a potential mediator of depression (history of depression and depressive symptoms) and smoking among college students.…

  10. Mothers' responses to children's negative emotions and child emotion regulation: the moderating role of vagal suppression.


    Perry, Nicole B; Calkins, Susan D; Nelson, Jackie A; Leerkes, Esther M; Marcovitch, Stuart


    The current study examined the moderating effect of children's cardiac vagal suppression on the association between maternal socialization of negative emotions (supportive and nonsupportive responses) and children's emotion regulation behaviors. One hundred and ninety-seven 4-year-olds and their mothers participated. Mothers reported on their reactions to children's negative emotions and children's regulatory behaviors. Observed distraction, an adaptive self-regulatory strategy, and vagal suppression were assessed during a laboratory task designed to elicit frustration. Results indicated that children's vagal suppression moderated the association between mothers' nonsupportive emotion socialization and children's emotion regulation behaviors such that nonsupportive reactions to negative emotions predicted lower observed distraction and lower reported emotion regulation behaviors when children displayed lower levels of vagal suppression. No interaction was found between supportive maternal emotion socialization and vagal suppression for children's emotion regulation behaviors. Results suggest physiological regulation may serve as a buffer against nonsupportive emotion socialization.

  11. PCDH10 Interacts With hTERT and Negatively Regulates Telomerase Activity

    PubMed Central

    Zhou, Li-Na; Hua, Xing; Deng, Wu-Quan; Wu, Qi-Nan; Mei, Hao; Chen, Bing


    Abstract Telomerase catalyzes telomeric DNA synthesis, an essential process to maintain the length of telomere for continuous cell proliferation and genomic stability. Telomerase is activated in gametes, stem cells, and most tumor cells, and its activity is tightly controlled by a catalytic human telomerase reverse transcriptase (hTERT) subunit and a collection of associated proteins. In the present work, normal human testis tissue was used for the first time to identify proteins involved in the telomerase regulation under normal physiological conditions. Immunoprecipitation was performed using total protein lysates from the normal testis tissue and the proteins of interest were identified by microfluidic high-performance liquid chromatography and tandem mass spectrometry (HPLC-Chip-MS/MS). The regulatory role of PCDH10 in telomerase activity was confirmed by a telomeric repeat amplification protocol (TRAP) assay, and the biological functions of it were characterized by in vitro proliferation, migration, and invasion assays. A new in vivo hTERT interacting protein, protocadherin 10 (PCDH10), was identified. Overexpression of PCDH10 in pancreatic cancer cells impaired telomere elongation by inhibiting telomerase activity while having no obvious effect on hTERT expression at mRNA and protein levels. As a result of this critical function in telomerase regulation, PCDH10 was found to inhibit cell proliferation, migration, and invasion, suggesting a tumor suppressive role of this protein. Our data suggested that PCDH10 played a critical role in cancer cell growth, by negatively regulating telomerase activity, implicating a potential value in future therapeutic development against cancer. PMID:26683936

  12. Regulating the market for human eggs.


    Resnik, D B


    This essay provides a rationale for a regulated market for human oocytes. Although the commodification of human oocytes raises important moral concerns, these concerns do not justify laws banning commerce in human eggs. Given the burgeoning ART industry and the growing oocyte market, the most prudent course of action is to develop regulations for the human oocyte market that are designed to protect and promote important social values, such as health, safety, liberty, and respect for human life. Other responses, such as banning the sale of eggs altogether or allowing donors to be compensated only for their services, would either create a black market or would lead to corruption and abuse. Society still needs to debate specific rules and policies that should govern the human egg market, but further discussion of that important task is best left to legislative bodies and other commentators.

  13. Bacterial lipopolysaccharide activates CD57-negative human NK cells.


    Kanevskiy, L M; Erokhina, S A; Streltsova, M A; Telford, W G; Sapozhnikov, A M; Kovalenko, E I


    NK cells play an important regulatory role in sepsis by induction and augmentation of proinflammatory reactions in early stages of the septic process and by suppression of immune response in later stages of inflammation. The present work was aimed at the effect of bacterial lipopolysaccharide (LPS), the main pathogenic factor of sepsis development, on human NK cells ex vivo. We show that LPS activates immature CD57-negative NK cells, which typically constitute less than half of the normal NK cell population in human peripheral blood. Under conditions of NK cell stimulation with IL-2, addition of LPS provokes an increase in IFN-γ production. However, LPS both increased and inhibited NK cell cytotoxic activity. It is important to note that the activation of NK cells on LPS addition was observed in the absence of TLR4 on the NK cell surface. These results confirm our previous data arguing for a direct interaction of LPS with NK cells and evidence an atypical mechanism of LPS-induced NK cell activation without the involvement of surface TLR4.

  14. N-cadherin negatively regulates collective Drosophila glial migration through actin cytoskeleton remodeling.


    Kumar, Arun; Gupta, Tripti; Berzsenyi, Sara; Giangrande, Angela


    Cell migration is an essential and highly regulated process. During development, glia cells and neurons migrate over long distances - in most cases collectively - to reach their final destination and build the sophisticated architecture of the nervous system, the most complex tissue of the body. Collective migration is highly stereotyped and efficient, defects in the process leading to severe human diseases that include mental retardation. This dynamic process entails extensive cell communication and coordination, hence, the real challenge is to analyze it in the entire organism and at cellular resolution. We here investigate the impact of the N-cadherin adhesion molecule on collective glial migration, by using the Drosophila developing wing and cell-type specific manipulation of gene expression. We show that N-cadherin timely accumulates in glial cells and that its levels affect migration efficiency. N-cadherin works as a molecular brake in a dosage-dependent manner, by negatively controlling actin nucleation and cytoskeleton remodeling through α/β catenins. This is the first in vivo evidence for N-cadherin negatively and cell autonomously controlling collective migration.

  15. A CaMKII/PDE4D negative feedback regulates cAMP signaling

    PubMed Central

    Mika, Delphine; Richter, Wito; Conti, Marco


    cAMP production and protein kinase A (PKA) are the most widely studied steps in β-adrenergic receptor (βAR) signaling in the heart; however, the multifunctional Ca2+/calmodulin-dependent protein kinase II (CaMKII) is also activated in response to βAR stimulation and is involved in the regulation of cardiac excitation-contraction coupling. Its activity and expression are increased during cardiac hypertrophy, in heart failure, and under conditions that promote arrhythmias both in animal models and in the human heart, underscoring the clinical relevance of CaMKII in cardiac pathophysiology. Both CaMKII and PKA phosphorylate a number of protein targets critical for Ca2+ handling and contraction with similar, but not always identical, functional consequences. How these two pathways communicate with each other remains incompletely understood, however. To maintain homeostasis, cyclic nucleotide levels are regulated by phosphodiesterases (PDEs), with PDE4s predominantly responsible for cAMP degradation in the rodent heart. Here we have reassessed the interaction between cAMP/PKA and Ca2+/CaMKII signaling. We demonstrate that CaMKII activity constrains basal and βAR-activated cAMP levels. Moreover, we show that these effects are mediated, at least in part, by CaMKII regulation of PDE4D. This regulation establishes a negative feedback loop necessary to maintain cAMP/CaMKII homeostasis, revealing a previously unidentified function for PDE4D as a critical integrator of cAMP/PKA and Ca2+/CaMKII signaling. PMID:25646485

  16. Mothers' Socialization of Emotion Regulation: The Moderating Role of Children's Negative Emotional Reactivity

    ERIC Educational Resources Information Center

    Mirabile, Scott P.; Scaramella, Laura V.; Sohr-Preston, Sara L.; Robison, Sarah D.


    During the toddler period, children begin to shift from being primarily dependent on parents to regulate their emotions to managing their emotions independently. The present study considers how children's propensity towards negative emotional arousal interacts with mothers' efforts to socialize emotion regulation. Fifty-five low income mothers and…

  17. Tetraspanin CD151 Is a Negative Regulator of FcεRI-Mediated Mast Cell Activation

    PubMed Central

    Abdala-Valencia, Hiam; Bryce, Paul J.; Schleimer, Robert P.; Wechsler, Joshua B.; Loffredo, Lucas F.; Cook-Mills, Joan M.; Hsu, Chia-Lin; Berdnikovs, Sergejs


    Mast cells are critical in the pathogenesis of allergic disease due to the release of preformed and newly synthesized mediators, yet the mechanisms controlling mast cell activation are not well understood. Members of the tetraspanin family are recently emerging as modulators of FcεRI-mediated mast cell activation; however, mechanistic understanding of their function is currently lacking. The tetraspanin CD151 is a poorly understood member of this family and is specifically induced on mouse and human mast cells upon FcεRI aggregation but its functional effects are unknown. In this study, we show that CD151 deficiency significantly exacerbates the IgE-mediated late phase inflammation in a murine model of passive cutaneous anaphylaxis. Ex vivo, FcεRI stimulation of bone marrow–derived mast cells from CD151−/− mice resulted in significantly enhanced expression of proinflammatory cytokines IL-4, IL-13, and TNF-α compared with wild-type controls. However, FcεRI -induced mast cell degranulation was unaffected. At the molecular signaling level, CD151 selectively regulated IgE-induced activation of ERK1/2 and PI3K, associated with cytokine production, but had no effect on the phospholipase Cγ1 signaling, associated with degranulation. Collectively, our data indicate that CD151 exerts negative regulation over IgE-induced late phase responses and cytokine production in mast cells. PMID:26136426

  18. ERK8 is a negative regulator of O-GalNAc glycosylation and cell migration.


    Chia, Joanne; Tham, Keit Min; Gill, David James; Bard-Chapeau, Emilie Anne; Bard, Frederic A


    ER O-glycosylation can be induced through relocalisation GalNAc-Transferases from the Golgi. This process markedly stimulates cell migration and is constitutively activated in more than 60% of breast carcinomas. How this activation is achieved remains unclear. Here, we screened 948 signalling genes using RNAi and imaging. We identified 12 negative regulators of O-glycosylation that all control GalNAc-T sub-cellular localisation. ERK8, an atypical MAPK with high basal kinase activity, is a strong hit and is partially localised at the Golgi. Its inhibition induces the relocation of GalNAc-Ts, but not of KDEL receptors, revealing the existence of two separate COPI-dependent pathways. ERK8 down-regulation, in turn, activates cell motility. In human breast and lung carcinomas, ERK8 expression is reduced while ER O-glycosylation initiation is hyperactivated. In sum, ERK8 appears as a constitutive brake on GalNAc-T relocalisation, and the loss of its expression could drive cancer aggressivity through increased cell motility. DOI:

  19. ERK8 is a negative regulator of O-GalNAc glycosylation and cell migration

    PubMed Central

    Chia, Joanne; Tham, Keit Min; Gill, David James; Bard-Chapeau, Emilie Anne; Bard, Frederic A


    ER O-glycosylation can be induced through relocalisation GalNAc-Transferases from the Golgi. This process markedly stimulates cell migration and is constitutively activated in more than 60% of breast carcinomas. How this activation is achieved remains unclear. Here, we screened 948 signalling genes using RNAi and imaging. We identified 12 negative regulators of O-glycosylation that all control GalNAc-T sub-cellular localisation. ERK8, an atypical MAPK with high basal kinase activity, is a strong hit and is partially localised at the Golgi. Its inhibition induces the relocation of GalNAc-Ts, but not of KDEL receptors, revealing the existence of two separate COPI-dependent pathways. ERK8 down-regulation, in turn, activates cell motility. In human breast and lung carcinomas, ERK8 expression is reduced while ER O-glycosylation initiation is hyperactivated. In sum, ERK8 appears as a constitutive brake on GalNAc-T relocalisation, and the loss of its expression could drive cancer aggressivity through increased cell motility. DOI: PMID:24618899

  20. Identification of osteoblast stimulating factor 5 as a negative regulator in the B-lymphopoietic niche.


    Fujita, Natsuko; Ichii, Michiko; Maeda, Tetsuo; Saitoh, Norimitsu; Yokota, Takafumi; Yamawaki, Kengo; Kakitani, Makoto; Tomizuka, Kazuma; Oritani, Kenji; Kanakura, Yuzuru


    Recent studies have revealed the crucial role of the niche which supports B-lymphocyte differentiation from hematopoietic stem cells. In this study, we aimed to identify a novel regulator of B lymphopoiesis secreted in the specific niche using the signal sequence trap method. Among the identified proteins from MS5 stromal cells, expression of pleiotrophin, placental proliferin 2, and osteoblast stimulating factor 5 (OSF-5) was dominantly high in several stromal cell lines. We found that OSF-5 suppressed early B lymphopoiesis in transgenic mice producing the target protein. The number of pre-B and immature B cells was reduced by more than half compared with control in the transgenic mice. In vitro studies showed that a secreted variant of OSF-5 inhibited the proliferation and colony formation of pre-B cells, whereas cell-intrinsic form had no influence on B lymphopoiesis. The main components of the B-lymphopoietic niche, osteoblasts in mice and mesenchymal cells in humans, are primary producers of OSF-5. These results define a novel mechanism of B lymphopoiesis in bone marrow. In the specific niche, B-lymphocyte differentiation is fine-tuned by negative regulators as well as supportive factors. PMID:26213229

  1. Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene.


    Venugopal, R; Jaiswal, A K


    Twenty-four base pairs of the human antioxidant response element (hARE) are required for high basal transcription of the NAD(P)H:quinone oxidoreductase1 (NQO1) gene and its induction in response to xenobiotics and antioxidants. hARE is a unique cis-element that contains one perfect and one imperfect AP1 element arranged as inverse repeats separated by 3 bp, followed by a "GC" box. We report here that Jun, Fos, Fra, and Nrf nuclear transcription factors bind to the hARE. Overexpression of cDNA derived combinations of the nuclear proteins Jun and Fos or Jun and Fra1 repressed hARE-mediated chloramphenicol acetyltransferase (CAT) gene expression in transfected human hepatoblastoma (Hep-G2) cells. Further experiments suggested that this repression was due to overexpression of c-Fos and Fra1, but not due to Jun proteins. The Jun (c-Jun, Jun-B, and Jun-D) proteins in all the possible combinations were more or less ineffective in repression or upregulation of hARE-mediated gene expression. Interestingly, overexpression of Nrf1 and Nrf2 individually in Hep-G2 and monkey kidney (COS1) cells significantly increased CAT gene expression from reporter plasmid hARE-thymidine kinase-CAT in transfected cells that were inducible by beta-naphthoflavone and teri-butyl hydroquinone. These results indicated that hARE-mediated expression of the NQO1 gene and its induction by xenobiotics and antioxidants are mediated by Nrf1 and Nrf2. The hARE-mediated basal expression, however, is repressed by overexpression of c-Fos and Fra1. PMID:8962164

  2. Automatic control of negative emotions: evidence that structured practice increases the efficiency of emotion regulation.


    Christou-Champi, Spyros; Farrow, Tom F D; Webb, Thomas L


    Emotion regulation (ER) is vital to everyday functioning. However, the effortful nature of many forms of ER may lead to regulation being inefficient and potentially ineffective. The present research examined whether structured practice could increase the efficiency of ER. During three training sessions, comprising a total of 150 training trials, participants were presented with negatively valenced images and asked either to "attend" (control condition) or "reappraise" (ER condition). A further group of participants did not participate in training but only completed follow-up measures. Practice increased the efficiency of ER as indexed by decreased time required to regulate emotions and increased heart rate variability (HRV). Furthermore, participants in the ER condition spontaneously regulated their negative emotions two weeks later and reported being more habitual in their use of ER. These findings indicate that structured practice can facilitate the automatic control of negative emotions and that these effects persist beyond training.

  3. Metacognitive emotion regulation: children's awareness that changing thoughts and goals can alleviate negative emotions.


    Davis, Elizabeth L; Levine, Linda J; Lench, Heather C; Quas, Jodi A


    Metacognitive emotion regulation strategies involve deliberately changing thoughts or goals to alleviate negative emotions. Adults commonly engage in this type of emotion regulation, but little is known about the developmental roots of this ability. Two studies were designed to assess whether 5- and 6-year-old children can generate such strategies and, if so, the types of metacognitive strategies they use. In Study 1, children described how story protagonists could alleviate negative emotions. In Study 2, children recalled times that they personally had felt sad, angry, and scared and described how they had regulated their emotions. In contrast to research suggesting that young children cannot use metacognitive regulation strategies, the majority of children in both studies described such strategies. Children were surprisingly sophisticated in their suggestions for how to cope with negative emotions and tailored their regulatory responses to specific emotional situations.

  4. Automatic control of negative emotions: Evidence that structured practice increases the efficiency of emotion regulation

    PubMed Central

    Christou-Champi, Spyros; Farrow, Tom F. D.; Webb, Thomas L.


    Emotion regulation (ER) is vital to everyday functioning. However, the effortful nature of many forms of ER may lead to regulation being inefficient and potentially ineffective. The present research examined whether structured practice could increase the efficiency of ER. During three training sessions, comprising a total of 150 training trials, participants were presented with negatively valenced images and asked either to “attend” (control condition) or “reappraise” (ER condition). A further group of participants did not participate in training but only completed follow-up measures. Practice increased the efficiency of ER as indexed by decreased time required to regulate emotions and increased heart rate variability (HRV). Furthermore, participants in the ER condition spontaneously regulated their negative emotions two weeks later and reported being more habitual in their use of ER. These findings indicate that structured practice can facilitate the automatic control of negative emotions and that these effects persist beyond training. PMID:24678930

  5. Cell cycle specific distribution of killin: evidence for negative regulation of both DNA and RNA synthesis.


    Qiao, Man; Luo, Dan; Kuang, Yi; Feng, Haiyan; Luo, Guangping; Liang, Peng


    p53 tumor-suppressor gene is a master transcription factor which controls cell cycle progression and apoptosis. killin was discovered as one of the p53 target genes implicated in S-phase control coupled to cell death. Due to its extreme proximity to pten tumor-suppressor gene on human chromosome 10, changes in epigenetic modification of killin have also been linked to Cowden syndrome as well as other human cancers. Previous studies revealed that Killin is a high-affinity DNA-binding protein with preference to single-stranded DNA, and it inhibits DNA synthesis in vitro and in vivo. Here, co-localization studies of RFP-Killin with either GFP-PCNA or endogenous single-stranded DNA binding protein RPA during S-phase show that Killin always adopts a mutually exclusive punctuated nuclear expression pattern with the 2 accessory proteins in DNA replication. In contrast, when cells are not in S-phase, RFP-Killin largely congregates in the nucleolus where rRNA transcription normally occurs. Both of these cell cycle specific localization patterns of RFP-Killin are stable under high salt condition, consistent with Killin being tightly associated with nucleic acids within cell nuclei. Together, these cell biological results provide a molecular basis for Killin in competitively inhibiting the formation of DNA replication forks during S-phase, as well as potentially negatively regulate RNA synthesis during other cell cycle phases.

  6. miRNA863-3p sequentially targets negative immune regulator ARLPKs and positive regulator SERRATE upon bacterial infection

    PubMed Central

    Niu, Dongdong; Lii, Yifan E.; Chellappan, Padmanabhan; Lei, Lei; Peralta, Karl; Jiang, Chunhao; Guo, Jianhua; Coaker, Gitta; Jin, Hailing


    Plant small RNAs play important roles in gene regulation during pathogen infection. Here we show that miR863-3p is induced by the bacterial pathogen Pseudomonas syringae carrying various effectors. Early during infection, miR863-3p silences two negative regulators of plant defence, atypical receptor-like pseudokinase1 (ARLPK1) and ARLPK2, both lacking extracellular domains and kinase activity, through mRNA degradation to promote immunity. ARLPK1 associates with, and may function through another negative immune regulator ARLPK1-interacting receptor-like kinase 1 (AKIK1), an active kinase with an extracellular domain. Later during infection, miR863-3p silences SERRATE, which is essential for miRNA accumulation and positively regulates defence, through translational inhibition. This results in decreased miR863-3p levels, thus forming a negative feedback loop to attenuate immune responses after successful defence. This is an example of a miRNA that sequentially targets both negative and positive regulators of immunity through two modes of action to fine-tune the timing and amplitude of defence responses. PMID:27108563

  7. The peripheral clock regulates human pigmentation.


    Hardman, Jonathan A; Tobin, Desmond J; Haslam, Iain S; Farjo, Nilofer; Farjo, Bessam; Al-Nuaimi, Yusur; Grimaldi, Benedetto; Paus, Ralf


    Although the regulation of pigmentation is well characterized, it remains unclear whether cell-autonomous controls regulate the cyclic on-off switching of pigmentation in the hair follicle (HF). As human HFs and epidermal melanocytes express clock genes and proteins, and given that core clock genes (PER1, BMAL1) modulate human HF cycling, we investigated whether peripheral clock activity influences human HF pigmentation. We found that silencing BMAL1 or PER1 in human HFs increased HF melanin content. Furthermore, tyrosinase expression and activity, as well as TYRP1 and TYRP2 mRNA levels, gp100 protein expression, melanocyte dendricity, and the number gp100+ HF melanocytes, were all significantly increased in BMAL1 and/or PER1-silenced HFs. BMAL1 or PER1 silencing also increased epidermal melanin content, gp100 protein expression, and tyrosinase activity in human skin. These effects reflect direct modulation of melanocytes, as BMAL1 and/or PER1 silencing in isolated melanocytes increased tyrosinase activity and TYRP1/2 expression. Mechanistically, BMAL1 knockdown reduces PER1 transcription, and PER1 silencing induces phosphorylation of the master regulator of melanogenesis, microphthalmia-associated transcription factor, thus stimulating human melanogenesis and melanocyte activity in situ and in vitro. Therefore, the molecular clock operates as a cell-autonomous modulator of human pigmentation and may be targeted for future therapeutic strategies. PMID:25310406

  8. The peripheral clock regulates human pigmentation.


    Hardman, Jonathan A; Tobin, Desmond J; Haslam, Iain S; Farjo, Nilofer; Farjo, Bessam; Al-Nuaimi, Yusur; Grimaldi, Benedetto; Paus, Ralf


    Although the regulation of pigmentation is well characterized, it remains unclear whether cell-autonomous controls regulate the cyclic on-off switching of pigmentation in the hair follicle (HF). As human HFs and epidermal melanocytes express clock genes and proteins, and given that core clock genes (PER1, BMAL1) modulate human HF cycling, we investigated whether peripheral clock activity influences human HF pigmentation. We found that silencing BMAL1 or PER1 in human HFs increased HF melanin content. Furthermore, tyrosinase expression and activity, as well as TYRP1 and TYRP2 mRNA levels, gp100 protein expression, melanocyte dendricity, and the number gp100+ HF melanocytes, were all significantly increased in BMAL1 and/or PER1-silenced HFs. BMAL1 or PER1 silencing also increased epidermal melanin content, gp100 protein expression, and tyrosinase activity in human skin. These effects reflect direct modulation of melanocytes, as BMAL1 and/or PER1 silencing in isolated melanocytes increased tyrosinase activity and TYRP1/2 expression. Mechanistically, BMAL1 knockdown reduces PER1 transcription, and PER1 silencing induces phosphorylation of the master regulator of melanogenesis, microphthalmia-associated transcription factor, thus stimulating human melanogenesis and melanocyte activity in situ and in vitro. Therefore, the molecular clock operates as a cell-autonomous modulator of human pigmentation and may be targeted for future therapeutic strategies.

  9. EphrinA5 suppresses colon cancer development by negatively regulating epidermal growth factor receptor stability.


    Wang, Tong-Hong; Chang, Junn-Liang; Ho, Jar-Yi; Wu, Hsiao-Chun; Chen, Tse-Ching


    Colon cancer is one of the most common human cancers worldwide. Owing to its aggressiveness and lethality, it is necessary to determine the mechanisms regulating the carcinogenesis of colon cancer. EphrinA5 has been reported to act as a putative tumor suppressor in glioma; however, little is known concerning the role of this protein in the context of colon cancer. To elucidate the biological significance of ephrinA5 in colon cancer, we examined ephrinA5 and epidermal growth factor receptor (EGFR) expression profiles in both colon cancer and normal tissues, using immunohistochemistry on a 96-spot tissue microarray. Gain-of-function and loss-of-function experiments were performed on the human colon cancer cell lines SW480 and WiDr to determine the biological effects of ephrinA5 in relation to cell proliferation, survival, and migration. It was found that ephrinA5 mRNA and protein levels were significantly reduced in colon cancer as compared with normal colon tissue specimens. EphrinA5 expression was also negatively associated with tumor differentiation and clinical stage. In colon cancer cell line models, ephrinA5 exerted an inhibitory effect on EGFR by promoting c-Cbl-mediated EGFR ubiquitination and degradation. EphrinA5 did not affect the transcriptional regulation of EGFR mRNA expression in colon cancer cells. Expression of ephrinA5 suppressed colon cancer cell proliferation, migration, and chemotherapeutic resistance. In conclusion, ephrinA5 inhibited colon cancer progression by promoting c-Cbl-mediated EGFR degradation. Our findings identify a novel mechanism that could be utilized to improve the therapeutic efficiency of EGFR-targeting strategies.

  10. C5orf30 is a negative regulator of tissue damage in rheumatoid arthritis

    PubMed Central

    Muthana, Munitta; Hawtree, Sarah; Wilshaw, Adam; Linehan, Eimear; Roberts, Hannah; Khetan, Sachin; Adeleke, Gbadebo; Wright, Fiona; Akil, Mohammed; Fearon, Ursula; Veale, Douglas; Ciani, Barbara; Wilson, Anthony G.


    The variant rs26232, in the first intron of the chromosome 5 open reading frame 30 (C5orf30) locus, has recently been associated with both risk of developing rheumatoid arthritis (RA) and severity of tissue damage. The biological activities of human C5orf30 are unknown, and neither the gene nor protein show significant homology to any other characterized human sequences. The C5orf30 gene is present only in vertebrate genomes with a high degree of conservation, implying a central function in these organisms. Here, we report that C5orf30 is highly expressed in the synovium of RA patients compared with control synovial tissue, and that it is predominately expressed by synovial fibroblast (RASF) and macrophages in the lining and sublining layer of the tissue. These cells play a central role in the initiation and perpetuation of RA and are implicated in cartilage destruction. RASFs lacking C5orf30 exhibit increased cell migration and invasion in vitro, and gene profiling following C5orf30 inhibition confirmed up-regulation of genes involved in cell migration, adhesion, angiogenesis, and immune and inflammatory pathways. Importantly, loss of C5orf30 contributes to the pathology of inflammatory arthritis in vivo, because inhibition of C5orf30 in the collagen-induced arthritis model markedly accentuated joint inflammation and tissue damage. Our study reveal C5orf30 to be a previously unidentified negative regulator of tissue damage in RA, and this protein may act by modulating the autoaggressive phenotype that is characteristic of RASFs. PMID:26316022

  11. MiR-146a negatively regulates TLR2-induced inflammatory responses in keratinocytes.


    Meisgen, Florian; Xu Landén, Ning; Wang, Aoxue; Réthi, Bence; Bouez, Charbel; Zuccolo, Michela; Gueniche, Audrey; Ståhle, Mona; Sonkoly, Enikö; Breton, Lionel; Pivarcsi, Andor


    Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response of keratinocytes. Toll-like receptor 2 (TLR2) stimulation of primary human keratinocytes resulted in an NF-κB- and mitogen-activated protein kinase-dependent upregulation of miR-146a expression, which was surprisingly long lasting, contrasting with the rapid and transient induction of inflammatory mediators. Overexpression of miR-146a significantly suppressed the production of IL-8, CCL20, and tumor necrosis factor-α, which functionally suppressed the chemotactic attraction of neutrophils by keratinocytes. Inhibition of endogenous miR-146a induced the production of inflammatory mediators even in nonstimulated keratinocytes, and potentiated the effect of TLR2 stimulation. Transcriptomic profiling revealed that miR-146a suppresses the expression of a large number of immune-related genes in keratinocytes. MiR-146a downregulated interleukin-1 receptor-associated kinase 1 and TNF receptor-associated factor 6, two key adapter molecules downstream of TLR signaling, and suppressed NF-κB promoter-binding activity as shown by promoter luciferase experiments. Together, these data identify miR-146a as a regulatory element in keratinocyte innate immunity, which prevents the production of inflammatory mediators under homeostatic conditions and serves as a potent negative feedback regulator after TLR2 stimulation. PMID:24670381

  12. Negative regulation of the oncogenic transcription factor FoxM1 by thiazolidinediones and mithramycin

    PubMed Central

    Petrovic, Vladimir; Costa, Robert H.; Lau, Lester F.; Raychaudhuri, Pradip; Tyner, Angela L.


    The Forkhead Box transcription factor FoxM1 regulates expression of genes that promote cell cycle progression, and it plays essential roles in the development of liver, lung, prostate and colorectal tumors. Thiazolidinediones (TZDs) activate the peroxisome proliferator-activated receptor gamma (PPARγ), a ligand-activated nuclear receptor transcription factor. We found that treatment of the human hepatoma cell lines HepG2 and PLC/PRF/5 cells with TZDs leads to inhibition of FoxM1 gene expression. No PPARγ/retinoid X receptor (RXR) consensus DNA binding sites were detected in the FoxM1 promoter extending to −10 kb upstream, and knockdown of PPARγ had no impact on TZD mediated downregulation of FoxM1 expression. Previously, others showed that PPARγ agonists inhibit the expression and DNA-binding activity of the Sp1 transcription factor. Here we show that Sp1 binds to the FoxM1 promoter region and positively regulates FoxM1 transcription, while mithramycin, a chemotherapy drug that specifically binds GC rich sequences in the DNA and inhibits activities of Sp1, inhibits expression of FoxM1. Our data suggest that TZD mediated suppression of Sp1 is responsible for downregulation of FoxM1 gene expression. Inhibition of FoxM1 expression by TZDs provides a new mechanism for TZD mediated negative regulation of cancer cell growth. FoxM1 expression and activity in cancer cells can be targeted using PPARγ agonists or the anti-neoplastic antibiotic mithramycin. PMID:20372080

  13. Negative Regulation of NADPH Oxidase 4 by Hydrogen Peroxide-inducible Clone 5 (Hic-5) Protein*

    PubMed Central

    Desai, Leena P.; Zhou, Yong; Estrada, Aida V.; Ding, Qiang; Cheng, Guangjie; Collawn, James F.; Thannickal, Victor J.


    Hydrogen peroxide-inducible clone 5 (Hic-5) is a focal adhesion adaptor protein induced by the profibrotic cytokine TGF-β1. We have demonstrated previously that TGF-β1 induces myofibroblast differentiation and lung fibrosis by activation of the reactive oxygen species-generating enzyme NADPH oxidase 4 (Nox4). Here we investigated a potential role for Hic-5 in regulating Nox4, myofibroblast differentiation, and senescence. In normal human diploid fibroblasts, TGF-β1 induces Hic-5 expression in a delayed manner relative to the induction of Nox4 and myofibroblast differentiation. Hic-5 silencing induced constitutive Nox4 expression and enhanced TGF-β1-inducible Nox4 levels. The induction of constitutive Nox4 protein in Hic-5-silenced cells was independent of transcription and translation and controlled by the ubiquitin-proteasomal system. Hic-5 associates with the ubiquitin ligase Cbl-c and the ubiquitin-binding protein heat shock protein 27 (HSP27). The interaction of these proteins is required for the ubiquitination of Nox4 and for maintaining low basal levels of this reactive oxygen species-generating enzyme. Our model suggests that TGF-β1-induced Hic-5 functions as a negative feedback mechanism to limit myofibroblast differentiation and senescence by promoting the ubiquitin-proteasomal system-mediated degradation of Nox4. Together, these studies indicate that endogenous Hic-5 suppresses senescence and profibrotic activities of myofibroblasts by down-regulating Nox4 protein expression. Additionally, these are the first studies, to our knowledge, to demonstrate posttranslational regulation of Nox4. PMID:24831009

  14. The neural correlates of regulating positive and negative emotions in medication-free major depression.


    Greening, Steven G; Osuch, Elizabeth A; Williamson, Peter C; Mitchell, Derek G V


    Depressive cognitive schemas play an important role in the emergence and persistence of major depressive disorder (MDD). The current study adapted emotion regulation techniques to reflect elements of cognitive behavioural therapy (CBT) and related psychotherapies to delineate neurocognitive abnormalities associated with modulating the negative cognitive style in MDD. Nineteen non-medicated patients with MDD and 19 matched controls reduced negative or enhanced positive feelings elicited by emotional scenes while undergoing functional magnetic resonance imaging. Although both groups showed significant emotion regulation success as measured by subjective ratings of affect, the controls were significantly better at modulating both negative and positive emotion. Both groups recruited regions of dorsolateral prefrontal cortex and ventrolateral prefrontal cortex (VLPFC) when regulating negative emotions. Only in controls was this accompanied by reduced activity in sensory cortices and amygdala. Similarly, both groups showed enhanced activity in VLPFC and ventral striatum when enhancing positive affect; however, only in controls was ventral striatum activity correlated with regulation efficacy. The results suggest that depression is associated with both a reduced capacity to achieve relief from negative affect despite recruitment of ventral and dorsal prefrontal cortical regions implicated in emotion regulation, coupled with a disconnect between activity in reward-related regions and subjective positive affect.

  15. The neural correlates of regulating positive and negative emotions in medication-free major depression

    PubMed Central

    Greening, Steven G.; Osuch, Elizabeth A.; Williamson, Peter C.


    Depressive cognitive schemas play an important role in the emergence and persistence of major depressive disorder (MDD). The current study adapted emotion regulation techniques to reflect elements of cognitive behavioural therapy (CBT) and related psychotherapies to delineate neurocognitive abnormalities associated with modulating the negative cognitive style in MDD. Nineteen non-medicated patients with MDD and 19 matched controls reduced negative or enhanced positive feelings elicited by emotional scenes while undergoing functional magnetic resonance imaging. Although both groups showed significant emotion regulation success as measured by subjective ratings of affect, the controls were significantly better at modulating both negative and positive emotion. Both groups recruited regions of dorsolateral prefrontal cortex and ventrolateral prefrontal cortex (VLPFC) when regulating negative emotions. Only in controls was this accompanied by reduced activity in sensory cortices and amygdala. Similarly, both groups showed enhanced activity in VLPFC and ventral striatum when enhancing positive affect; however, only in controls was ventral striatum activity correlated with regulation efficacy. The results suggest that depression is associated with both a reduced capacity to achieve relief from negative affect despite recruitment of ventral and dorsal prefrontal cortical regions implicated in emotion regulation, coupled with a disconnect between activity in reward-related regions and subjective positive affect. PMID:23482626

  16. On wildebeests and humans: the preferential detection of negative stimuli.


    Dijksterhuis, Ap; Aarts, Henk


    On the basis of a functional perspective, we hypothesized that negative stimuli are detected faster than positive stimuli. In Experiment 1, participants were subliminally presented with positive and negative words or with no words at all. After each presentation, participants were asked whether they had seen a word. They detected negative words more accurately than positive words. In Experiment 2, participants were subliminally presented with negative or positive words. After each presentation, they were asked whether the presented word was positive or negative. Negative words were correctly categorized more often than positive words. Experiment 3 showed that although participants correctly categorized negative words more often than positive words. they could not guess the meaning of the words better than would be expected by chance. The results are discussed against the background of recent findings on basic affective processes. PMID:12564748

  17. Negative afterimages and photopic luminance adaptation in human vision.


    Burbeck, C A


    Previous studies of the negative afterimage have reported that the process responsible for these aftereffects has a bandpass spatial characteristic. If this finding is correct, then negative afterimages cannot arise from a simple, local, adaptive process. I remeasure the spatial-frequency characteristic of the negative-afterimage process by using an afterimage contrast-matching procedure with retinally stabilized stimuli and find the spatial characteristic to be constant in the low-spatial-frequency region. This finding is consistent with the theory that the negative afterimage results from local luminance adaptation. As a test of the local adaptation explanation of the negative afterimage, the effect of the negative afterimage on the temporal contrast-sensitivity function (CSF) (measured down to 0.062 Hz) is determined. The apparent contrasts of the negative afterimages associated with very slowly (less than 0.5 Hz) flickering, threshold-contrast stimuli are calculated from power-function descriptions of the temporal development of the negative afterimage, and these afterimage contrasts are then subtracted from the temporal CSF's. The resulting curves are constant for temporal frequencies below 1 Hz, indicating that the decline in sensitivity at lower temporal frequencies is due entirely to the negative-afterimage process. Both the spatial and the temporal characteristics of the negative-afterimage process are consistent with its being a component of local luminance adaptation.

  18. Negative regulation of Toll-like receptor signaling plays an essential role in homeostasis of the intestine.


    Biswas, Amlan; Wilmanski, Jeanette; Forsman, Huamei; Hrncir, Tomas; Hao, Liming; Tlaskalova-Hogenova, Helena; Kobayashi, Koichi S


    A healthy intestinal tract is characterized by controlled homeostasis due to the balanced interaction between commensal bacteria and the host mucosal immune system. Human and animal model studies have supported the hypothesis that breakdown of this homeostasis may underlie the pathogenesis of inflammatory bowel diseases. However, it is not well understood how intestinal microflora stimulate the intestinal mucosal immune system and how such activation is regulated. Using a spontaneous, commensal bacteria-dependent colitis model in IL-10-deficient mice, we investigated the role of TLR and their negative regulation in intestinal homeostasis. In addition to IL-10(-/-) MyD88(-/-) mice, IL-10(-/-) TLR4(-/-) mice exhibited reduced colitis compared to IL-10(-/-) mice, indicating that TLR4 signaling plays an important role in inducing colitis. Interestingly, the expression of IRAK-M, a negative regulator of TLR signaling, is dependent on intestinal commensal flora, as IRAK-M expression was reduced in mice re-derived into a germ-free environment, and introduction of commensal bacteria into germ-free mice induced IRAK-M expression. IL-10(-/-) IRAK-M(-/-) mice exhibited exacerbated colitis with increased inflammatory cytokine gene expression. Therefore, this study indicates that intestinal microflora stimulate the colitogenic immune system through TLR and negative regulation of TLR signaling is essential in maintaining intestinal homeostasis.

  19. Beyond CTLA-4 and PD-1, the Generation Z of Negative Checkpoint Regulators

    PubMed Central

    Le Mercier, Isabelle; Lines, J. Louise; Noelle, Randolph J.


    In the last two years, clinical trials with blocking antibodies to the negative checkpoint regulators CTLA-4 and PD-1 have rekindled the hope for cancer immunotherapy. Multiple negative checkpoint regulators protect the host against autoimmune reactions but also restrict the ability of T cells to effectively attack tumors. Releasing these brakes has emerged as an exciting strategy for cancer treatment. Conversely, these pathways can be manipulated to achieve durable tolerance for treatment of autoimmune diseases and transplantation. In the future, treatment may involve combination therapy to target multiple cell types and stages of the adaptive immune responses. In this review, we describe the current knowledge on the recently discovered negative checkpoint regulators, future targets for immunotherapy. PMID:26347741

  20. Rethinking emotion: cognitive reappraisal is an effective positive and negative emotion regulation strategy in bipolar disorder.


    Gruber, June; Hay, Aleena C; Gross, James J


    Bipolar disorder involves difficulties with emotion regulation, yet the precise nature of these emotion regulatory difficulties is unclear. The current study examined whether individuals with remitted bipolar I disorder (n = 23) and healthy controls (n = 23) differ in their ability to use one effective and common form of emotion regulation, cognitive reappraisal. Positive, negative, and neutral films were used to elicit emotion, and participants were cued to watch the film carefully (i.e., uninstructed condition) or reappraise while measures of affect, behavior, and psychophysiology were obtained. Results showed that reappraisal was associated with reductions in emotion reactivity across subjective (i.e., positive and negative affect), behavioral (i.e., positive facial displays), and physiological (i.e., skin conductance) response domains across all participants. Results suggest that reappraisal may be an effective regulation strategy for both negative and positive emotion across both healthy adults and individuals with bipolar disorder. Discussion focuses on clinical and treatment implications for bipolar disorder.

  1. Negative transcriptional regulation of the interferon-gamma promoter by glucocorticoids and dominant negative mutants of c-Jun.


    Cippitelli, M; Sica, A; Viggiano, V; Ye, J; Ghosh, P; Birrer, M J; Young, H A


    Interferon-gamma (IFN-gamma) is an immunoregulatory cytokine expressed in large granular lymphocytes and T cells. However, the molecular mechanisms underlying IFN-gamma gene transcription have not been fully defined. Here, we analyze the mechanisms responsible for the inhibition of IFN-gamma promoter activity by the glucocorticoid hormone dexamethasone. Cotransfection assays performed in Jurkat T cells demonstrated that the activity of the initial 108 base pairs of the IFN-gamma promoter was down-regulated in the presence of dexamethasone. Furthermore, utilizing electrophoretic mobility shift analysis, we identified activator protein 1 AP-1-cAMP response element binding protein-activating transcription factor (CREB-ATF) binding elements situated in positions of the IFN-gamma promoter previously identified as essential for promoter activity. Moreover, dominant negative mutants of the c-Jun proto-oncogene were able to mimic the same down-regulatory effect exerted by dexamethasone, and mutations that abolished the binding of the AP-1 CREB-ATF factors were able to block the glucocorticoid effect. These results suggest a model involving the inhibition of IFN-gamma AP-1 CREB-ATF DNA binding complexes as one of the mechanisms involved in the negative regulatory action of glucocorticoids on IFN-gamma gene expression and support the relevance of AP-1 CREB-ATF binding factors during the transcriptional activation of the IFN-gamma promoter in T cells. PMID:7759501

  2. Emotion regulation in broadly defined anorexia nervosa: association with negative affective memory bias.


    Manuel, Amy; Wade, Tracey D


    Theoretical models in anorexia nervosa (AN) implicate difficulties with emotion regulation as a maintaining factor. To date little is known about how different factors might maintain these difficulties. Forty eight women were recruited, 24 receiving treatment for AN (called broadly defined AN) and 24 healthy controls. Self-report measures of difficulties with emotion regulation and current depression were used in addition to computerized tasks which provided measures of social attentional bias and anger-threat bias, as well negative affective memory and recognition bias. Compared to controls, women with AN had significantly higher levels of difficulties with emotion regulation, depression, and negative affective memory bias, as well as lower bias for anger-threat. Simultaneous examination of the two variables that met pre-conditions for mediation of the relationship between group membership and difficulties with emotion regulation (anger-threat bias and negative affective memory) indicated negative affective memory bias to be a mediator, accounting for around one-third of the total effect a diagnosis of AN has on difficulties with emotion regulation. The association of these variables with AN may indicate shared risk factors with depression, and the variety of therapeutic approaches found to be effective with depression may be useful to further incorporate into treatments for AN.

  3. 5-Lipoxygenase Negatively Regulates Th1 Response during Brucella abortus Infection in Mice

    PubMed Central

    Fahel, Júlia Silveira; de Souza, Mariana Bueno; Gomes, Marco Túlio Ribeiro; Corsetti, Patricia P.; Carvalho, Natalia B.; Marinho, Fabio A. V.; de Almeida, Leonardo A.; Caliari, Marcelo V.; Machado, Fabiana Simão


    Brucella abortus is a Gram-negative bacterium that infects humans and cattle, causing a chronic inflammatory disease known as brucellosis. A Th1-mediated immune response plays a critical role in host control of this pathogen. Recent findings indicate contrasting roles for lipid mediators in host responses against infections. 5-Lipoxygenase (5-LO) is an enzyme required for the production of the lipid mediators leukotrienes and lipoxins. To determine the involvement of 5-LO in host responses to B. abortus infection, we intraperitoneally infected wild-type and 5-LO-deficient mice and evaluated the progression of infection and concomitant expression of immune mediators. Here, we demonstrate that B. abortus induced the upregulation of 5-LO mRNA in wild-type mice. Moreover, this pathogen upregulated the production of the lipid mediators leukotriene B4 and lipoxin A4 in a 5-LO-dependent manner. 5-LO-deficient mice displayed lower bacterial burdens in the spleen and liver and less severe liver pathology, demonstrating an enhanced resistance to infection. Host resistance paralleled an increased expression of the proinflammatory mediators interleukin-12 (IL-12), gamma interferon (IFN-γ), and inducible nitric oxide synthase (iNOS) during the course of infection. Moreover, we demonstrated that 5-LO downregulated the expression of IL-12 in macrophages during B. abortus infection. Our results suggest that 5-LO has a major involvement in B. abortus infection, by functioning as a negative regulator of the protective Th1 immune responses against this pathogen. PMID:25583526

  4. No fear, no panic: probing negation as a means for emotion regulation.


    Herbert, Cornelia; Deutsch, Roland; Platte, Petra; Pauli, Paul


    This electroencephalographic study investigated if negating one's emotion results in paradoxical effects or leads to effective emotional downregulation. Healthy participants were asked to downregulate their emotions to happy and fearful faces by using negated emotional cue words (e.g., no fun, no fear). Cue words were congruent with the emotion depicted in the face and presented prior to each face. Stimuli were presented in blocks of happy and fearful faces. Blocks of passive stimulus viewing served as control condition. Active regulation reduced amplitudes of early event-related brain potentials (early posterior negativity, but not N170) and the late positive potential for fearful faces. A fronto-central negativity peaking at about 250 ms after target face onset showed larger amplitude modulations during downregulation of fearful and happy faces. Behaviorally, negating was more associated with reappraisal than with suppression. Our results suggest that in an emotional context, negation processing could be quite effective for emotional downregulation but that its effects depend on the type of the negated emotion (pleasant vs unpleasant). Results are discussed in the context of dual process models of cognition and emotion regulation. PMID:22490924

  5. A Dominant-Negative Isoform of IKAROS Expands Primitive Normal Human Hematopoietic Cells

    PubMed Central

    Beer, Philip A.; Knapp, David J.H.F.; Kannan, Nagarajan; Miller, Paul H.; Babovic, Sonja; Bulaeva, Elizabeth; Aghaeepour, Nima; Rabu, Gabrielle; Rostamirad, Shabnam; Shih, Kingsley; Wei, Lisa; Eaves, Connie J.


    Summary Disrupted IKAROS activity is a recurrent feature of some human leukemias, but effects on normal human hematopoietic cells are largely unknown. Here, we used lentivirally mediated expression of a dominant-negative isoform of IKAROS (IK6) to block normal IKAROS activity in primitive human cord blood cells and their progeny. This produced a marked (10-fold) increase in serially transplantable multipotent IK6+ cells as well as increased outputs of normally differentiating B cells and granulocytes in transplanted immunodeficient mice, without producing leukemia. Accompanying T/natural killer (NK) cell outputs were unaltered, and erythroid and platelet production was reduced. Mechanistically, IK6 specifically increased human granulopoietic progenitor sensitivity to two growth factors and activated CREB and its targets (c-FOS and Cyclin B1). In more primitive human cells, IK6 prematurely initiated a B cell transcriptional program without affecting the hematopoietic stem cell-associated gene expression profile. Some of these effects were species specific, thus identifying novel roles of IKAROS in regulating normal human hematopoietic cells. PMID:25418728

  6. The trans-kingdom identification of negative regulators of pathogen hypervirulence

    PubMed Central

    Brown, Neil A.; Urban, Martin; Hammond-Kosack, Kim E.


    Modern society and global ecosystems are increasingly under threat from pathogens, which cause a plethora of human, animal, invertebrate and plant diseases. Of increasing concern is the trans-kingdom tendency for increased pathogen virulence that is beginning to emerge in natural, clinical and agricultural settings. The study of pathogenicity has revealed multiple examples of convergently evolved virulence mechanisms. Originally described as rare, but increasingly common, are interactions where a single gene deletion in a pathogenic species causes hypervirulence. This review utilised the pathogen–host interaction database ( to identify 112 hypervirulent mutations from 37 pathogen species, and subsequently interrogates the trans-kingdom, conserved, molecular, biochemical and cellular themes that cause hypervirulence. This study investigates 22 animal and 15 plant pathogens including 17 bacterial and 17 fungal species. Finally, the evolutionary significance and trans-kingdom requirement for negative regulators of hypervirulence and the implication of pathogen hypervirulence and emerging infectious diseases on society are discussed. PMID:26468211

  7. MG53-induced IRS-1 ubiquitination negatively regulates skeletal myogenesis and insulin signalling.


    Yi, Jae-Sung; Park, Jun Sub; Ham, Young-Mi; Nguyen, Nga; Lee, Na-Rae; Hong, Jin; Kim, Bong-Woo; Lee, Hyun; Lee, Chang-Seok; Jeong, Byung-Cheon; Song, Hyun Kyu; Cho, Hana; Kim, Yoon Ki; Lee, Jae-Seon; Park, Kyong Soo; Shin, Haksub; Choi, Inho; Lee, Seung Hee; Park, Woo Jin; Park, Shi-Young; Choi, Cheol Soo; Lin, Peihui; Karunasiri, Malith; Tan, Tao; Duann, Pu; Zhu, Hua; Ma, Jianjie; Ko, Young-Gyu


    Mitsugumin 53 (MG53) negatively regulates skeletal myogenesis by targeting insulin receptor substrate 1 (IRS-1). Here, we show that MG53 is an ubiquitin E3 ligase that induces IRS-1 ubiquitination with the help of an E2-conjugating enzyme, UBE2H. Molecular manipulations that disrupt the E3-ligase function of MG53 abolish IRS-1 ubiquitination and enhance skeletal myogenesis. Skeletal muscles derived from the MG53-/- mice show an elevated IRS-1 level with enhanced insulin signalling, which protects the MG53-/- mice from developing insulin resistance when challenged with a high-fat/high-sucrose diet. Muscle samples derived from human diabetic patients and mice with insulin resistance show normal expression of MG53, indicating that altered MG53 expression does not serve as a causative factor for the development of metabolic disorders. Thus, therapeutic interventions that target the interaction between MG53 and IRS-1 may be a novel approach for the treatment of metabolic diseases that are associated with insulin resistance. PMID:23965929

  8. Negative regulation of TLR-signaling pathways by activating transcription factor-3.


    Whitmore, Mark M; Iparraguirre, Amaya; Kubelka, Lindsey; Weninger, Wolfgang; Hai, Tsonwin; Williams, Bryan R G


    Activating transcription factor-3 (ATF3) is rapidly induced by LPS in mouse macrophages and regulates TLR4 responses. We show that ATF3 is rapidly induced by various TLRs in mouse macrophages and plasmacytoid dendritic cells (DCs), as well as plasmacytoid and myeloid subsets of human DCs. In primary macrophages from mice with a targeted deletion of the atf3 gene (ATF3-knockout (KO)), TLR-stimulated levels of IL-12 and IL-6 were elevated relative to responses in wild-type macrophages. Similarly, targeted deletion of atf3 correlated with enhanced responsiveness of myeloid DCs to TLR activation as measured by IL-12 secretion. Ectopic expression of ATF3 antagonized TLR-stimulated IL-12p40 activation in a reporter assay. In vivo, CpG-oligodeoxynucleotide, a TLR9 agonist, given i.p. to ATF3-KO mice resulted in enhanced cytokine production from splenocytes. Furthermore, while ATF3-KO mice challenged with a sublethal dose of PR8 influenza virus were delayed in body weight recovery in comparison to wild type, the ATF3-KO mice showed higher titers of serum neutralizing Ab against PR8 5 mo postinfection. Thus, ATF3 behaves as a negative regulatory transcription factor in TLR pathways and, accordingly, deficiency in atf3 alters responses to immunological challenges in vivo. ATF3 dysregulation merits further exploration in diseases such as type I diabetes and cancer, where altered innate immunity has been implicated in their pathogenesis.

  9. Therapeutic Alliance, Negative Mood Regulation, and Treatment Outcome in Child Abuse-Related Posttraumatic Stress Disorder

    ERIC Educational Resources Information Center

    Cloitre, Marylene; Chase Stovall McClough,K.; Miranda, Regina; Chemtob, Claude M.


    This study examined the related contributions of the therapeutic alliance and negative mood regulation to the outcome of a 2-phase treatment for childhood abuse-related posttraumatic stress disorder (PTSD). Phase 1 focused on stabilization and preparatory skills building, whereas Phase 2 was comprised primarily of imaginal exposure to traumatic…

  10. Attachment's Links With Adolescents' Social Emotions: The Roles of Negative Emotionality and Emotion Regulation.


    Murphy, Tia Panfile; Laible, Deborah J; Augustine, Mairin; Robeson, Lindsay


    Recent research has attempted to explain the mechanisms through which parental attachment affects social and emotional outcomes (e.g., Burnette, Taylor, Worthington, & Forsyth, 2007 ; Panfile & Laible, 2012 ). The authors' goal was to examine negative emotionality and emotion regulation as mediators of the associations that attachment has with empathy, forgiveness, guilt, and jealousy. One hundred forty-eight adolescents reported their parental attachment security, general levels of negative emotionality and abilities to regulate emotional responses, and tendencies to feel empathy, forgiveness, guilt, and jealousy. Results revealed that attachment security was associated with higher levels of empathy, forgiveness, and guilt, but lower levels of jealousy. In addition, emotion regulation mediated the links attachment shared with both empathy and guilt, such that higher levels of attachment security were linked with greater levels of emotion regulation, which led to greater levels of empathy and guilt. Alternatively, negative emotionality mediated the links attachment shared with both forgiveness and jealousy, such that higher levels of attachment security were associated with lower levels of negative emotionality, which in turn was linked to lower levels of forgiveness and higher levels of jealousy. This study provides a general picture of how attachment security may play a role in shaping an individual's levels of social emotions. PMID:26244914

  11. Relationships among Burnout, Social Support, and Negative Mood Regulation Expectancies of Elementary School Teachers in Korea

    ERIC Educational Resources Information Center

    Kim, Mi Y.; Lee, Jee Y.; Kim, Jinsook


    The purposes of this study are as follows: (1) to determine whether burnout among elementary school teachers in Korea differs on selected demographic variables, (2) to investigate the relationship between burnout and negative mood regulation expectancies, as an internal variable, and social support, as an external variable, and (3) to examine the…

  12. Conflict Management with Friends and Romantic Partners: The Role of Attachment and Negative Mood Regulation Expectancies.

    ERIC Educational Resources Information Center

    Creasey, Gary; Kershaw, Kathy; Boston, Ada


    Studied the degree to which attachment orientations were related to negative mood regulation expectancies and conflict management strategies with best friends and romantic partners in a sample of 140 female college students. Discusses results in relation to previous research on attachment theory and implications for interventions. (SLD)

  13. Attachment's Links With Adolescents' Social Emotions: The Roles of Negative Emotionality and Emotion Regulation.


    Murphy, Tia Panfile; Laible, Deborah J; Augustine, Mairin; Robeson, Lindsay


    Recent research has attempted to explain the mechanisms through which parental attachment affects social and emotional outcomes (e.g., Burnette, Taylor, Worthington, & Forsyth, 2007 ; Panfile & Laible, 2012 ). The authors' goal was to examine negative emotionality and emotion regulation as mediators of the associations that attachment has with empathy, forgiveness, guilt, and jealousy. One hundred forty-eight adolescents reported their parental attachment security, general levels of negative emotionality and abilities to regulate emotional responses, and tendencies to feel empathy, forgiveness, guilt, and jealousy. Results revealed that attachment security was associated with higher levels of empathy, forgiveness, and guilt, but lower levels of jealousy. In addition, emotion regulation mediated the links attachment shared with both empathy and guilt, such that higher levels of attachment security were linked with greater levels of emotion regulation, which led to greater levels of empathy and guilt. Alternatively, negative emotionality mediated the links attachment shared with both forgiveness and jealousy, such that higher levels of attachment security were associated with lower levels of negative emotionality, which in turn was linked to lower levels of forgiveness and higher levels of jealousy. This study provides a general picture of how attachment security may play a role in shaping an individual's levels of social emotions.

  14. NLRX1 Sequesters STING to Negatively Regulate the Interferon Response, Thereby Facilitating the Replication of HIV-1 and DNA Viruses.


    Guo, Haitao; König, Renate; Deng, Meng; Riess, Maximilian; Mo, Jinyao; Zhang, Lu; Petrucelli, Alex; Yoh, Sunnie M; Barefoot, Brice; Samo, Melissa; Sempowski, Gregory D; Zhang, Aiping; Colberg-Poley, Anamaris M; Feng, Hui; Lemon, Stanley M; Liu, Yong; Zhang, Yanping; Wen, Haitao; Zhang, Zhigang; Damania, Blossom; Tsao, Li-Chung; Wang, Qi; Su, Lishan; Duncan, Joseph A; Chanda, Sumit K; Ting, Jenny P-Y


    Understanding the negative regulators of antiviral immune responses will be critical for advancing immune-modulated antiviral strategies. NLRX1, an NLR protein that negatively regulates innate immunity, was previously identified in an unbiased siRNA screen as required for HIV infection. We find that NLRX1 depletion results in impaired nuclear import of HIV-1 DNA in human monocytic cells. Additionally, NLRX1 was observed to reduce type-I interferon (IFN-I) and cytokines in response to HIV-1 reverse-transcribed DNA. NLRX1 sequesters the DNA-sensing adaptor STING from interaction with TANK-binding kinase 1 (TBK1), which is a requisite for IFN-1 induction in response to DNA. NLRX1-deficient cells generate an amplified STING-dependent host response to cytosolic DNA, c-di-GMP, cGAMP, HIV-1, and DNA viruses. Accordingly, Nlrx1(-/-) mice infected with DNA viruses exhibit enhanced innate immunity and reduced viral load. Thus, NLRX1 is a negative regulator of the host innate immune response to HIV-1 and DNA viruses.

  15. Affect intensity and negative mood regulation (NMR) expectancies: a preliminary Indian study.


    Mehrotra, Seema; Tripathi, Ravikesh


    Individuals differ in the intensity with which they typically experience affect as well as in their beliefs regarding their ability to alleviate negative mood states. These variables have been implicated in a range of clinical problems. Most studies utilize a single index of affect intensity. The differential correlates of positive and negative affect intensity, their association with negative mood regulation expectancy and their role as predictors of psychological outcomes have been insufficiently explored. This study aimed at exploring the relationship of affect intensity variables with negative mood regulation (NMR) expectancy, their association with age and gender and examining the role of affect intensity and NMR expectancy as predictors of stress and well being in a community sample of Indian adults. The sample consisted of 206 participants aged between 20 and 60 years. Higher age was associated with higher NMR expectancy but lower positive affect intensity. Positive and negative affect intensity showed differential patterns of association with NMR expectancy. Higher negative affect intensity was associated with lower NMR expectancy whereas higher positive affect intensity was associated with higher NMR expectancy. Affect intensity and NMR expectancy variables jointly predicted 30-39% of variance in perceived stress and well being. Implications for further research are discussed.

  16. Improved wound management by regulated negative pressure-assisted wound therapy and regulated, oxygen- enriched negative pressure-assisted wound therapy through basic science research and clinical assessment.


    Topaz, Moris


    Regulated negative pressure-assisted wound therapy (RNPT) should be regarded as a state-of-the-art technology in wound treatment and the most important physical, nonpharmaceutical, platform technology developed and applied for wound healing in the last two decades. RNPT systems maintain the treated wound's environment as a semi-closed, semi-isolated system applying external physical stimulations to the wound, leading to biological and biochemical effects, with the potential to substantially influence wound-host interactions, and when properly applied may enhance wound healing. RNPT is a simple, safe, and affordable tool that can be utilized in a wide range of acute and chronic conditions, with reduced need for complicated surgical procedures, and antibiotic treatment. This technology has been shown to be effective and safe, saving limbs and lives on a global scale. Regulated, oxygen-enriched negative pressure-assisted wound therapy (RO-NPT) is an innovative technology, whereby supplemental oxygen is concurrently administered with RNPT for their synergistic effect on treatment and prophylaxis of anaerobic wound infection and promotion of wound healing. Understanding the basic science, modes of operation and the associated risks of these technologies through their fundamental clinical mechanisms is the main objective of this review.

  17. Improved wound management by regulated negative pressure-assisted wound therapy and regulated, oxygen- enriched negative pressure-assisted wound therapy through basic science research and clinical assessment.


    Topaz, Moris


    Regulated negative pressure-assisted wound therapy (RNPT) should be regarded as a state-of-the-art technology in wound treatment and the most important physical, nonpharmaceutical, platform technology developed and applied for wound healing in the last two decades. RNPT systems maintain the treated wound's environment as a semi-closed, semi-isolated system applying external physical stimulations to the wound, leading to biological and biochemical effects, with the potential to substantially influence wound-host interactions, and when properly applied may enhance wound healing. RNPT is a simple, safe, and affordable tool that can be utilized in a wide range of acute and chronic conditions, with reduced need for complicated surgical procedures, and antibiotic treatment. This technology has been shown to be effective and safe, saving limbs and lives on a global scale. Regulated, oxygen-enriched negative pressure-assisted wound therapy (RO-NPT) is an innovative technology, whereby supplemental oxygen is concurrently administered with RNPT for their synergistic effect on treatment and prophylaxis of anaerobic wound infection and promotion of wound healing. Understanding the basic science, modes of operation and the associated risks of these technologies through their fundamental clinical mechanisms is the main objective of this review. PMID:23162229

  18. Improved wound management by regulated negative pressure-assisted wound therapy and regulated, oxygen- enriched negative pressure-assisted wound therapy through basic science research and clinical assessment

    PubMed Central

    Topaz, Moris


    Regulated negative pressure-assisted wound therapy (RNPT) should be regarded as a state-of-the-art technology in wound treatment and the most important physical, nonpharmaceutical, platform technology developed and applied for wound healing in the last two decades. RNPT systems maintain the treated wound's environment as a semi-closed, semi-isolated system applying external physical stimulations to the wound, leading to biological and biochemical effects, with the potential to substantially influence wound-host interactions, and when properly applied may enhance wound healing. RNPT is a simple, safe, and affordable tool that can be utilized in a wide range of acute and chronic conditions, with reduced need for complicated surgical procedures, and antibiotic treatment. This technology has been shown to be effective and safe, saving limbs and lives on a global scale. Regulated, oxygen-enriched negative pressure-assisted wound therapy (RO-NPT) is an innovative technology, whereby supplemental oxygen is concurrently administered with RNPT for their synergistic effect on treatment and prophylaxis of anaerobic wound infection and promotion of wound healing. Understanding the basic science, modes of operation and the associated risks of these technologies through their fundamental clinical mechanisms is the main objective of this review. PMID:23162229

  19. RRAD inhibits the Warburg effect through negative regulation of the NF-κB signaling

    PubMed Central

    Wu, Rui; Lin, Meihua; Liang, Yingjian; Liu, Jia; Wang, Xiaolong; Yang, Bo; Feng, Zhaohui


    Cancer cells preferentially use aerobic glycolysis to meet their increased energetic and biosynthetic demands, a phenomenon known as the Warburg effect. Its underlying mechanism is not fully understood. RRAD, a small GTPase, is a potential tumor suppressor in lung cancer. RRAD expression is frequently down-regulated in lung cancer, which is associated with tumor progression and poor prognosis. Recently, RRAD was reported to repress the Warburg effect, indicating that down-regulation of RRAD expression is an important mechanism contributing to the Warburg effect in lung cancer. However, the mechanism by which RRAD inhibits the Warburg effect remains unclear. Here, we found that RRAD negatively regulates the NF-κB signaling to inhibit the GLUT1 translocation and the Warburg effect in lung cancer cells. Mechanically, RRAD directly binds to the p65 subunit of the NF-κB complex and inhibits the nuclear translocation of p65, which in turn negatively regulates the NF-κB signaling to inhibit GLUT1 translocation and the Warburg effect. Blocking the NF-κB signaling largely abolishes the inhibitory effects of RRAD on the translocation of GLUT1 to the plasma membrane and the Warburg effect. Taken together, our results revealed a novel mechanism by which RRAD negatively regulates the Warburg effect in lung cancer cells. PMID:25893381

  20. Wheat CBL-interacting protein kinase 25 negatively regulates salt tolerance in transgenic wheat

    PubMed Central

    Jin, Xia; Sun, Tao; Wang, Xiatian; Su, Peipei; Ma, Jingfei; He, Guangyuan; Yang, Guangxiao


    CBL-interacting protein kinases are involved in plant responses to abiotic stresses, including salt stress. However, the negative regulating mechanism of this gene family in response to salinity is less reported. In this study, we evaluated the role of TaCIPK25 in regulating salt response in wheat. Under conditions of high salinity, TaCIPK25 expression was markedly down-regulated in roots. Overexpression of TaCIPK25 resulted in hypersensitivity to Na+ and superfluous accumulation of Na+ in transgenic wheat lines. TaCIPK25 expression did not decline in transgenic wheat and remained at an even higher level than that in wild-type wheat controls under high-salinity treatment. Furthermore, transmembrane Na+/H+ exchange was impaired in the root cells of transgenic wheat. These results suggested that TaCIPK25 negatively regulated salt response in wheat. Additionally, yeast-one-hybrid, β-glucuronidase activity and DNA-protein-interaction-enzyme-linked-immunosorbent assays showed that the transcription factor TaWRKY9 bound W-box in the TaCIPK25 promoter region. Quantitative real-time polymerase chain reaction assays showed concomitantly inverted expression patterns of TaCIPK25 and TaWRKY9 in wheat roots under salt treatment, ABA application and inhibition of endogenous ABA condition. Overall, based on our results, in a salt stress condition, the negative salt response in wheat involved TaCIPK25 with the expression regulated by TaWRKY9. PMID:27358166

  1. Wheat CBL-interacting protein kinase 25 negatively regulates salt tolerance in transgenic wheat.


    Jin, Xia; Sun, Tao; Wang, Xiatian; Su, Peipei; Ma, Jingfei; He, Guangyuan; Yang, Guangxiao


    CBL-interacting protein kinases are involved in plant responses to abiotic stresses, including salt stress. However, the negative regulating mechanism of this gene family in response to salinity is less reported. In this study, we evaluated the role of TaCIPK25 in regulating salt response in wheat. Under conditions of high salinity, TaCIPK25 expression was markedly down-regulated in roots. Overexpression of TaCIPK25 resulted in hypersensitivity to Na(+) and superfluous accumulation of Na(+) in transgenic wheat lines. TaCIPK25 expression did not decline in transgenic wheat and remained at an even higher level than that in wild-type wheat controls under high-salinity treatment. Furthermore, transmembrane Na(+)/H(+) exchange was impaired in the root cells of transgenic wheat. These results suggested that TaCIPK25 negatively regulated salt response in wheat. Additionally, yeast-one-hybrid, β-glucuronidase activity and DNA-protein-interaction-enzyme-linked-immunosorbent assays showed that the transcription factor TaWRKY9 bound W-box in the TaCIPK25 promoter region. Quantitative real-time polymerase chain reaction assays showed concomitantly inverted expression patterns of TaCIPK25 and TaWRKY9 in wheat roots under salt treatment, ABA application and inhibition of endogenous ABA condition. Overall, based on our results, in a salt stress condition, the negative salt response in wheat involved TaCIPK25 with the expression regulated by TaWRKY9.

  2. Wheat CBL-interacting protein kinase 25 negatively regulates salt tolerance in transgenic wheat.


    Jin, Xia; Sun, Tao; Wang, Xiatian; Su, Peipei; Ma, Jingfei; He, Guangyuan; Yang, Guangxiao


    CBL-interacting protein kinases are involved in plant responses to abiotic stresses, including salt stress. However, the negative regulating mechanism of this gene family in response to salinity is less reported. In this study, we evaluated the role of TaCIPK25 in regulating salt response in wheat. Under conditions of high salinity, TaCIPK25 expression was markedly down-regulated in roots. Overexpression of TaCIPK25 resulted in hypersensitivity to Na(+) and superfluous accumulation of Na(+) in transgenic wheat lines. TaCIPK25 expression did not decline in transgenic wheat and remained at an even higher level than that in wild-type wheat controls under high-salinity treatment. Furthermore, transmembrane Na(+)/H(+) exchange was impaired in the root cells of transgenic wheat. These results suggested that TaCIPK25 negatively regulated salt response in wheat. Additionally, yeast-one-hybrid, β-glucuronidase activity and DNA-protein-interaction-enzyme-linked-immunosorbent assays showed that the transcription factor TaWRKY9 bound W-box in the TaCIPK25 promoter region. Quantitative real-time polymerase chain reaction assays showed concomitantly inverted expression patterns of TaCIPK25 and TaWRKY9 in wheat roots under salt treatment, ABA application and inhibition of endogenous ABA condition. Overall, based on our results, in a salt stress condition, the negative salt response in wheat involved TaCIPK25 with the expression regulated by TaWRKY9. PMID:27358166

  3. Mitogen-activated protein kinase phosphatase 1 negatively regulates MAPK signaling in mouse hypothalamus.


    Adachi, Koichi; Goto, Motomitsu; Onoue, Takeshi; Tsunekawa, Taku; Shibata, Miyuki; Hagimoto, Shigeru; Ito, Yoshihiro; Banno, Ryoichi; Suga, Hidetaka; Sugimura, Yoshihisa; Oiso, Yutaka; Arima, Hiroshi


    Mitogen-activated protein kinase phosphatase 1 (MKP-1) is shown to negatively regulate MAPK signaling in various peripheral tissues as well as the central nervous system such as cortex, striatum and hippocampus. In this study, we examined whether MKP-1 regulates MAPK signaling in the mouse hypothalamus. Intraperitoneal injection of TNFα significantly increased MKP-1 mRNA expression in paraventricular and arcuate nuclei in the hypothalamus. TNFα treatment induced increases in MKP-1 expression at both mRNA and protein levels, accompanied by the inactivation of MAPK signaling in mouse hypothalamic explants. Inhibition of MKP-1 by its inhibitor or siRNA increased MAPK activity in the explants. Our data indicate that MKP-1 negatively regulates MAPK signaling in the mouse hypothalamus.

  4. Relationship of Maternal Negative Moods to Child Emotion Regulation during Family Interaction

    PubMed Central

    Dagne, Getachew A.; Snyder, James


    The relationship of maternal hostile and depressive moods to children’s down-regulation of unprovoked anger and sadness/fear was assessed in a community sample of 267 five year old boys and girls. The speed of children’s down-regulation of unprovoked anger and sadness/fear was based on real-time observations during mother-child interaction. The association of down-regulation with maternal mood was estimated using Bayesian event history analysis. As mothers reported higher depressive mood, both boys and girls were faster to down regulate anger displays as those displays accumulated during mother child interaction. The speed of boys’ down regulation of anger and of sadness/fear was not associated with maternal hostile mood. As mothers reported more hostile mood, girls were faster to down regulate displays of sadness/fear, but the speed of this down regulation slowed as those displays accumulated during ongoing mother-child interaction. These associations of child down regulation and maternal mood were observed after controlling for child adjustment. The data suggest frequent exposure to different negative maternal moods affect children’s expression and regulation of emotions in relatively specific ways, conditional on the type of maternal mood, the type of child emotion, and child gender. PMID:21262049

  5. Akt negatively regulates translation of the ternary complex factor Elk-1.


    Figueroa, Claudia; Vojtek, Anne B


    Cross-talk between signaling pathways plays an important role in regulation of cell growth, differentiation, survival, and death. Here, we show that Akt regulates the Elk-1 transcription factor, independent of its negative regulation of Raf kinases. Using a constitutively active Mek1 to bypass the regulation of Raf by Akt, we find that the Elk-1 and Sap1a proteins are dramatically decreased in the presence of activated Akt. Akt catalytic activity is required. Also, Mek-dependent activation of a TCF (Elk-1/Sap-1a)-dependent c-fos reporter is decreased by activated Akt. Neither the level of Elk-1 mRNA nor the stability of the Elk-1 protein is altered by activated Akt. Instead, the rate of incorporation of labeled methionine into Elk-1 protein is decreased in the presence of Akt. In addition, the level of the Elk-1 protein but not GFP is significantly decreased in the presence of activated Akt, when GFP is expressed from an IRES element in a bicistronic message with Elk-1. We conclude that Akt negatively regulates translation of the Elk-1 mRNA. A coding region determinant that maps within the first 279 nts of the Elk-1 message is necessary and sufficient for Akt-mediated regulation of Elk-1.

  6. [Regulation of Positive and Negative Emotions as Mediator between Maternal Emotion Socialization and Child Problem Behavior].


    Fäsche, Anika; Gunzenhauser, Catherine; Friedlmeier, Wolfgang; von Suchodoletz, Antje


    The present study investigated five to six year old children's ability to regulate negative and positive emotions in relation to psychosocial problem behavior (N=53). It was explored, whether mothers' supportive and nonsupportive strategies of emotion socialization influence children's problem behavior by shaping their emotion regulation ability. Mothers reported on children's emotion regulation and internalizing and externalizing problem behavior via questionnaire, and were interviewed about their preferences for socialization strategies in response to children's expression of negative affect. Results showed that children with more adaptive expression of adequate positive emotions had less internalizing behavior problems. When children showed more control of inadequate negative emotions, children were less internalizing as well as externalizing in their behavior. Furthermore, results indicated indirect relations of mothers' socialization strategies with children's problem behavior. Control of inadequate negative emotions mediated the link between non-supportive strategies on externalizing problem behavior. Results suggest that emotion regulatory processes should be part of interventions to reduce the development of problematic behavior in young children. Parents should be trained in dealing with children's emotions in a constructive way. PMID:26032031

  7. [Regulation of Positive and Negative Emotions as Mediator between Maternal Emotion Socialization and Child Problem Behavior].


    Fäsche, Anika; Gunzenhauser, Catherine; Friedlmeier, Wolfgang; von Suchodoletz, Antje


    The present study investigated five to six year old children's ability to regulate negative and positive emotions in relation to psychosocial problem behavior (N=53). It was explored, whether mothers' supportive and nonsupportive strategies of emotion socialization influence children's problem behavior by shaping their emotion regulation ability. Mothers reported on children's emotion regulation and internalizing and externalizing problem behavior via questionnaire, and were interviewed about their preferences for socialization strategies in response to children's expression of negative affect. Results showed that children with more adaptive expression of adequate positive emotions had less internalizing behavior problems. When children showed more control of inadequate negative emotions, children were less internalizing as well as externalizing in their behavior. Furthermore, results indicated indirect relations of mothers' socialization strategies with children's problem behavior. Control of inadequate negative emotions mediated the link between non-supportive strategies on externalizing problem behavior. Results suggest that emotion regulatory processes should be part of interventions to reduce the development of problematic behavior in young children. Parents should be trained in dealing with children's emotions in a constructive way.

  8. Maternal Attachment Style and Responses to Adolescents’ Negative Emotions: The Mediating Role of Maternal Emotion Regulation

    PubMed Central

    Jones, Jason D.; Brett, Bonnie E.; Ehrlich, Katherine B.; Lejuez, Carl W.; Cassidy, Jude


    SYNOPSIS Objective Previous research has examined the developmental consequences, particularly in early childhood, of parents’ supportive and unsupportive responses to children’s negative emotions. Much less is known about factors that explain why parents respond in ways that may support or undermine their children’s emotions, and even less is known about how these parenting processes unfold with adolescents. We examined the associations between mothers’ attachment styles and their distress, harsh, and supportive responses to their adolescents’ negative emotions two years later and whether these links were mediated by maternal emotion regulation difficulties. Design Mothers in a longitudinal study (n = 230) reported on their attachment style, difficulties regulating their emotions, and their hypothetical responses to their adolescents’ negative emotions, respectively, at consecutive laboratory visits one year apart. Results Mothers who reported greater attachment-related avoidance and anxiety reported having greater difficulties with emotion regulation one year later. Emotion dysregulation, in turn, predicted more distressed, harsher, and less supportive maternal responses to adolescents’ negative emotions the following year. In addition, greater avoidance directly predicted harsher maternal responses two years later. Conclusions These findings extend previous research by identifying maternal attachment style as a predictor of responses to adolescent distress and by documenting the underlying role of emotion dysregulation in the link between adult attachment style and parenting. PMID:25568638

  9. Corp Regulates P53 in Drosophila melanogaster via a Negative Feedback Loop.


    Chakraborty, Riddhita; Li, Ying; Zhou, Lei; Golic, Kent G


    The tumor suppressor P53 is a critical mediator of the apoptotic response to DNA double-strand breaks through the transcriptional activation of pro-apoptotic genes. This mechanism is evolutionarily conserved from mammals to lower invertebrates, including Drosophila melanogaster. P53 also transcriptionally induces its primary negative regulator, Mdm2, which has not been found in Drosophila. In this study we identified the Drosophila gene companion of reaper (corp) as a gene whose overexpression promotes survival of cells with DNA damage in the soma but reduces their survival in the germline. These disparate effects are shared by p53 mutants, suggesting that Corp may be a negative regulator of P53. Confirming this supposition, we found that corp negatively regulates P53 protein level. It has been previously shown that P53 transcriptionally activates corp; thus, Corp produces a negative feedback loop on P53. We further found that Drosophila Corp shares a protein motif with vertebrate Mdm2 in a region that mediates the Mdm2:P53 physical interaction. In Corp, this motif mediates physical interaction with Drosophila P53. Our findings implicate Corp as a functional analog of vertebrate Mdm2 in flies.

  10. Cut! that’s a wrap: regulating negative emotion by ending emotion-eliciting situations

    PubMed Central

    Vujovic, Lara; Opitz, Philipp C.; Birk, Jeffrey L.; Urry, Heather L.


    Little is known about the potentially powerful set of emotion regulation (ER) processes that target emotion-eliciting situations. We thus studied the decision to end emotion-eliciting situations in the laboratory. We hypothesized that people would try to end negative situations more frequently than neutral situations to regulate distress. In addition, motivated by the selection, optimization, and compensation with ER framework, we hypothesized that failed attempts to end the situation would prompt either (a) greater negative emotion or (b) compensatory use of a different ER process, attentional deployment (AD). Fifty-eight participants (18–26 years old, 67% women) viewed negative and neutral pictures and pressed a key whenever they wished to stop viewing them. After key press, the picture disappeared (“success”) or stayed (“failure”) on screen. To index emotion, we measured corrugator and electrodermal activity, heart rate, and self-reported arousal. To index overt AD, we measured eye gaze. As their reason for ending the situation, participants more frequently reported being upset by high- than low-arousal negative pictures; they more frequently reported being bored by low- than high-arousal neutral pictures. Nevertheless, participants’ negative emotional responding did not increase in the context of ER failure nor did they use overt AD as a compensatory ER strategy. We conclude that situation-targeted ER processes are used to regulate emotional responses to high-arousal negative and low-arousal neutral situations; ER processes other than overt AD may be used to compensate for ER failure in this context. PMID:24592251

  11. Phosphorylation of trihelix transcriptional repressor ASR3 by MAP KINASE4 negatively regulates Arabidopsis immunity.


    Li, Bo; Jiang, Shan; Yu, Xiao; Cheng, Cheng; Chen, Sixue; Cheng, Yanbing; Yuan, Joshua S; Jiang, Daohong; He, Ping; Shan, Libo


    Proper control of immune-related gene expression is crucial for the host to launch an effective defense response. Perception of microbe-associated molecular patterns (MAMPs) induces rapid and profound transcriptional reprogramming via unclear mechanisms. Here, we show that ASR3 (ARABIDOPSIS SH4-RELATED3) functions as a transcriptional repressor and plays a negative role in regulating pattern-triggered immunity (PTI) in Arabidopsis thaliana. ASR3 belongs to a plant-specific trihelix transcription factor family for which functional studies are lacking. MAMP treatments induce rapid phosphorylation of ASR3 at threonine 189 via MPK4, a mitogen-activated protein kinase that negatively regulates PTI responses downstream of multiple MAMP receptors. ASR3 possesses transcriptional repressor activity via its ERF-associated amphiphilic repression motifs and negatively regulates a large subset of flg22-induced genes. Phosphorylation of ASR3 by MPK4 enhances its DNA binding activity to suppress gene expression. Importantly, the asr3 mutant shows enhanced disease resistance to virulent bacterial pathogen infection, whereas transgenic plants overexpressing the wild-type or phospho-mimetic form of ASR3 exhibit compromised PTI responses. Our studies reveal a function of the trihelix transcription factors in plant innate immunity and provide evidence that ASR3 functions as a transcriptional repressor regulated by MAMP-activated MPK4 to fine-tune plant immune gene expression.

  12. USP21 negatively regulates antiviral response by acting as a RIG-I deubiquitinase

    PubMed Central

    Fan, Yihui; Mao, Renfang; Yu, Yang; Liu, Shangfeng; Shi, Zhongcheng; Cheng, Jin; Zhang, Huiyuan; An, Lei; Zhao, Yanling; Xu, Xin; Chen, Zhenghu; Kogiso, Mari; Zhang, Dekai; Zhang, Hong; Zhang, Pumin; Jung, Jae U.; Li, Xiaonan


    Lys63-linked polyubiquitination of RIG-I is essential in antiviral immune defense, yet the molecular mechanism that negatively regulates this critical step is poorly understood. Here, we report that USP21 acts as a novel negative regulator in antiviral responses through its ability to bind to and deubiquitinate RIG-I. Overexpression of USP21 inhibited RNA virus–induced RIG-I polyubiquitination and RIG-I–mediated interferon (IFN) signaling, whereas deletion of USP21 resulted in elevated RIG-I polyubiquitination, IRF3 phosphorylation, IFN-α/β production, and antiviral responses in MEFs in response to RNA virus infection. USP21 also restricted antiviral responses in peritoneal macrophages (PMs) and bone marrow–derived dendritic cells (BMDCs). USP21-deficient mice spontaneously developed splenomegaly and were more resistant to VSV infection with elevated production of IFNs. Chimeric mice with USP21-deficient hematopoietic cells developed virus-induced splenomegaly and were more resistant to VSV infection. Functional comparison of three deubiquitinases (USP21, A20, and CYLD) demonstrated that USP21 acts as a bona fide RIG-I deubiquitinase to down-regulate antiviral response independent of the A20 ubiquitin-editing complex. Our studies identify a previously unrecognized role for USP21 in the negative regulation of antiviral response through deubiquitinating RIG-I. PMID:24493797

  13. Gonadotropin-regulated Testicular RNA Helicase (GRTH/DDX25), a Negative Regulator of Luteinizing/Chorionic Gonadotropin Hormone-induced Steroidogenesis in Leydig Cells

    PubMed Central

    Fukushima, Masato; Villar, Joaquin; Tsai-Morris, Chon-Hwa; Dufau, Maria L.


    Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) is a testis-specific gonadotropin-regulated RNA helicase that is present in Leydig cells (LCs) and germ cells and is essential for spermatid development and completion of spermatogenesis. Normal basal levels of testosterone in serum and LCs were observed in GRTH null (GRTH−/−) mice. However, testosterone production was enhanced in LCs of GRTH−/− mice compared with WT mice by both in vivo and in vitro human chorionic gonadotropin stimulation. LCs of GRTH−/− mice had swollen mitochondria with a significantly increased cholesterol content in the inner mitochondrial membrane. Basal protein levels of SREBP2, HMG-CoA reductase, and steroidogenic acute regulatory protein (StAR; a protein that transports cholesterol to the inner mitochondrial membrane) were markedly increased in LCs of GRTH−/− mice compared with WT mice. Gonadotropin stimulation caused an increase in StAR mRNA levels and protein expression in GRTH−/− mice versus WT mice, with no further increase in SREBP2 and down-regulation of HMG-CoA reductase protein. The half-life of StAR mRNA was significantly increased in GRTH−/− mice. Moreover, association of StAR mRNA with GRTH protein was observed in WT mice. Human chorionic gonadotropin increased GRTH gene expression and its associated StAR protein at cytoplasmic sites. Taken together, these findings indicate that, through its negative role in StAR message stability, GRTH regulates cholesterol availability at the mitochondrial level. The finding of an inhibitory action of GRTH associated with gonadotropin-mediated steroidogenesis has provided insights into a novel negative autocrine molecular control mechanism of this helicase in the regulation of steroid production in the male. PMID:21719703

  14. Fear is only as deep as the mind allows: a coordinate-based meta-analysis of neuroimaging studies on the regulation of negative affect.


    Diekhof, Esther Kristina; Geier, Katharina; Falkai, Peter; Gruber, Oliver


    Humans have the ability to control negative affect and perceived fear. Nevertheless, it is still unclear whether this affect regulation capacity relies on a common neural mechanism in different experimental domains. Here, we sought to identify commonalities in regulatory brain activation in the domains of fear extinction, placebo, and cognitive emotion regulation. Using coordinate-based activation-likelihood estimation meta-analysis we intended to elucidate concordant hyperactivations and the associated deactivations in the three experimental domains, when human subjects successfully diminished negative affect. Our data show that only one region in the ventromedial prefrontal cortex (VMPFC) controlled negative affective responses and reduced the degree of subjectively perceived unpleasantness independent of the experimental domain. This down-regulation of negative affect was further accompanied by a concordant reduction of activation in the left amygdala. Finally, the soothing effect of placebo treatments and cognitive reappraisal strategies, but not extinction retrieval, was specifically accompanied by a coherent hyperactivation in the anterior cingulate and the insular cortex. Collectively, our data strongly imply that the human VMPFC may represent a domain-general controller of perceived fear and aversiveness that modulates negative affective responses in phylogenetically older structures of the emotion processing system. In addition, higher-level regulation strategies may further engage complementary neural resources to effectively deal with the emotion-eliciting events. PMID:21669291

  15. MicroRNA-378 Alleviates Cerebral Ischemic Injury by Negatively Regulating Apoptosis Executioner Caspase-3

    PubMed Central

    Zhang, Nan; Zhong, Jie; Han, Song; Li, Yun; Yin, Yanling; Li, Junfa


    miRNAs have been linked to many human diseases, including ischemic stroke, and are being pursued as clinical diagnostics and therapeutic targets. Among the aberrantly expressed miRNAs in our previous report using large-scale microarray screening, the downregulation of miR-378 in the peri-infarct region of middle cerebral artery occluded (MCAO) mice can be reversed by hypoxic preconditioning (HPC). In this study, the role of miR-378 in the ischemic injury was further explored. We found that miR-378 levels significantly decreased in N2A cells following oxygen-glucose deprivation (OGD) treatment. Overexpression of miR-378 significantly enhanced cell viability, decreased TUNEL-positive cells and the immunoreactivity of cleaved-caspase-3. Conversely, downregulation of miR-378 aggravated OGD-induced apoptosis and ischemic injury. By using bioinformatic algorithms, we discovered that miR-378 may directly bind to the predicted 3′-untranslated region (UTR) of Caspase-3 gene. The protein level of caspase-3 increased significantly upon OGD treatment, and can be downregulated by pri-miR-378 transfection. The luciferase reporter assay confirmed the binding of miR-378 to the 3′-UTR of Caspase-3 mRNA and repressed its translation. In addition, miR-378 agomir decreased cleaved-caspase-3 ratio, reduced infarct volume and neural cell death induced by MCAO. Furthermore, caspase-3 knockdown could reverse anti-miR-378 mediated neuronal injury. Taken together, our data demonstrated that miR-378 attenuated ischemic injury by negatively regulating the apoptosis executioner, caspase-3, providing a potential therapeutic target for ischemic stroke. PMID:27598143

  16. MicroRNA-378 Alleviates Cerebral Ischemic Injury by Negatively Regulating Apoptosis Executioner Caspase-3.


    Zhang, Nan; Zhong, Jie; Han, Song; Li, Yun; Yin, Yanling; Li, Junfa


    miRNAs have been linked to many human diseases, including ischemic stroke, and are being pursued as clinical diagnostics and therapeutic targets. Among the aberrantly expressed miRNAs in our previous report using large-scale microarray screening, the downregulation of miR-378 in the peri-infarct region of middle cerebral artery occluded (MCAO) mice can be reversed by hypoxic preconditioning (HPC). In this study, the role of miR-378 in the ischemic injury was further explored. We found that miR-378 levels significantly decreased in N2A cells following oxygen-glucose deprivation (OGD) treatment. Overexpression of miR-378 significantly enhanced cell viability, decreased TUNEL-positive cells and the immunoreactivity of cleaved-caspase-3. Conversely, downregulation of miR-378 aggravated OGD-induced apoptosis and ischemic injury. By using bioinformatic algorithms, we discovered that miR-378 may directly bind to the predicted 3'-untranslated region (UTR) of Caspase-3 gene. The protein level of caspase-3 increased significantly upon OGD treatment, and can be downregulated by pri-miR-378 transfection. The luciferase reporter assay confirmed the binding of miR-378 to the 3'-UTR of Caspase-3 mRNA and repressed its translation. In addition, miR-378 agomir decreased cleaved-caspase-3 ratio, reduced infarct volume and neural cell death induced by MCAO. Furthermore, caspase-3 knockdown could reverse anti-miR-378 mediated neuronal injury. Taken together, our data demonstrated that miR-378 attenuated ischemic injury by negatively regulating the apoptosis executioner, caspase-3, providing a potential therapeutic target for ischemic stroke. PMID:27598143

  17. Nanoparticles, human health hazard and regulation

    PubMed Central

    Seaton, Anthony; Tran, Lang; Aitken, Robert; Donaldson, Kenneth


    New developments in technology usually entail some hazard as well as advantage to a society. Hazard of a material translates into risk by exposure of humans and/or their environment to the agent in question, and risk is reduced by control of exposure, usually guided by regulation based on understanding of the mechanisms of harm. We illustrate risks relating to the causation of diseases associated with exposure to aerosols of combustion particles and asbestos, leading to paradigms of particle toxicity, and discuss analogies with potential exposure to manufactured nanoparticles (NPs). We review the current understanding of the hazard of NPs derived from the new science of nanotoxicology and the limited research to date into human exposure to these particles. We identify gaps in knowledge relating to the properties of NPs that might determine toxicity and in understanding the most appropriate ways both to measure this in the laboratory and to assess it in the workplace. Nevertheless, we point out that physical principles governing the behaviour of such particles allow determination of practical methods of protecting those potentially exposed. Finally, we discuss the early steps towards regulation and the difficulties facing regulators in controlling potentially harmful exposures in the absence of sufficient scientific evidence. PMID:19726441

  18. TRIM45 negatively regulates NF-{kappa}B-mediated transcription and suppresses cell proliferation

    SciTech Connect

    Shibata, Mio; Sato, Tomonobu; Nukiwa, Ryota; Ariga, Tadashi; Hatakeyama, Shigetsugu


    Highlights: Black-Right-Pointing-Pointer NF-{kappa}B plays an important role in cell survival and carcinogenesis. Black-Right-Pointing-Pointer TRIM45 negatively regulates TNF{alpha}-induced NF-{kappa}B-mediated transcription. Black-Right-Pointing-Pointer TRIM45 overexpression suppresses cell growth. Black-Right-Pointing-Pointer TRIM45 acts as a repressor for the NF-{kappa}B signal and regulates cell growth. -- Abstract: The NF-{kappa}B signaling pathway plays an important role in cell survival, immunity, inflammation, carcinogenesis, and organogenesis. Activation of NF-{kappa}B is regulated by several posttranslational modifications including phosphorylation, neddylation and ubiquitination. The NF-{kappa}B signaling pathway is activated by two distinct signaling mechanisms and is strictly modulated by the ubiquitin-proteasome system. It has been reported that overexpression of TRIM45, one of the TRIM family ubiquitin ligases, suppresses transcriptional activities of Elk-1 and AP-1, which are targets of the MAPK signaling pathway. In this study, we showed that TRIM45 also negatively regulates TNF{alpha}-induced NF-{kappa}B-mediated transcription by a luciferase reporter assay and that TRIM45 lacking a RING domain also has an activity to inhibit the NF-{kappa}B signal. Moreover, we found that TRIM45 overexpression suppresses cell growth. These findings suggest that TRIM45 acts as a repressor for the NF-{kappa}B signal and regulates cell growth.

  19. Identification of Creb3l4 as an essential negative regulator of adipogenesis

    PubMed Central

    Kim, T-H; Jo, S-H; Choi, H; Park, J-M; Kim, M-Y; Nojima, H; Kim, J-W; Ahn, Y-H


    Understanding the molecular networks that regulate adipogenesis is crucial for combating obesity. However, the identity and molecular actions of negative regulators that regulate the early development of adipocytes remain poorly understood. In this study, we investigated the role of CREB3L4, a member of the CREB3-like family, in the regulation of adiposity. Constitutive overexpression of CREB3L4 resulted in the inhibition of adipocyte differentiation, whereas knockdown of Creb3l4 expression caused differentiation of preadipocytes into mature adipocytes, bypassing the mitotic clonal expansion step. In 3T3-L1 preadipocytes, Creb3l4 knockdown resulted in increased expression of peroxisome proliferator-activated receptor γ (PPARγ2) and CCAAT/enhancer binding protein (C/EBPα), either by increasing the protein stability of C/EBPβ or by decreasing the expression of GATA3, a negative regulator of PPARγ2 expression. Consequently, increased PPARγ2 and C/EBPα levels induced adipocyte differentiation, even in the presence of minimal hormonal inducer. Thus, it can be speculated that CREB3L4 has a role as gatekeeper, inhibiting adipogenesis in 3T3-L1 preadipocytes. Moreover, adipocytes of Creb3l4-knockout mice showed hyperplasia caused by increased adipogenesis, and exhibited improved glucose tolerance and insulin sensitivity, as compared with littermate wild-type mice. These results raise the possibility that Creb3l4 could be a useful therapeutic target in the fight against obesity and metabolic syndrome. PMID:25412305

  20. Optomotor-Blind Negatively Regulates Drosophila Eye Development by Blocking Jak/STAT Signaling

    PubMed Central

    Tsai, Yu-Chen; Grimm, Stefan; Chao, Ju-Lan; Wang, Shih-Chin; Hofmeyer, Kerstin; Shen, Jie; Eichinger, Fred; Michalopoulou, Theoni; Yao, Chi-Kuang; Chang, Chih-Hsuan; Lin, Shih-Han; Sun, Y. Henry; Pflugfelder, Gert O.


    Organ formation requires a delicate balance of positive and negative regulators. In Drosophila eye development, wingless (wg) is expressed at the lateral margins of the eye disc and serves to block retinal development. The T-box gene optomotor-blind (omb) is expressed in a similar pattern and is regulated by Wg. Omb mediates part of Wg activity in blocking eye development. Omb exerts its function primarily by blocking cell proliferation. These effects occur predominantly in the ventral margin. Our results suggest that the primary effect of Omb is the blocking of Jak/STAT signaling by repressing transcription of upd which encodes the Jak receptor ligand Unpaired. PMID:25781970

  1. Gene expression in human thyrocytes and autonomous adenomas reveals suppression of negative feedbacks in tumorigenesis

    PubMed Central

    van Staveren, Wilma C. G.; Solís, David Weiss; Delys, Laurent; Venet, David; Cappello, Matteo; Andry, Guy; Dumont, Jacques E.; Libert, Frédérick; Detours, Vincent; Maenhaut, Carine


    The cAMP signaling pathway regulates growth of many cell types, including somatotrophs, thyrocytes, melanocytes, ovarian follicular granulosa cells, adrenocortical cells, and keratinocytes. Mutations of partners from the cAMP signaling cascade are involved in tumor formation. Thyroid-stimulating hormone (TSH) receptor and Gsα activating mutations have been detected in thyroid autonomous adenomas, Gsα mutations in growth hormone-secreting pituitary adenomas, and PKAR1A mutations in Carney complex, a multiple neoplasia syndrome. To gain more insight into the role of cAMP signaling in tumor formation, human primary cultures of thyrocytes were treated for different times (1.5, 3, 16, 24, and 48 h) with TSH to characterize modulations in gene expression using cDNA microarrays. This kinetic study showed a clear difference in expression, early (1.5 and 3 h) and late (16–48 h) after the onset of TSH stimulation. This result suggests a progressive sequential process leading to a change of cell program. The gene expression profile of the long-term stimulated cultures resembled the autonomous adenomas, but not papillary carcinomas. The molecular phenotype of the adenomas thus confirms the role of long-term stimulation of the TSH–cAMP cascade in the pathology. TSH induced a striking up-regulation of different negative feedback modulators of the cAMP cascade, presumably insuring the one-shot effect of the stimulus. Some were down- or nonregulated in adenomas, suggesting a loss of negative feedback control in the tumors. These results suggest that in tumorigenesis, activation of proliferation pathways may be complemented by suppression of multiple corresponding negative feedbacks, i.e., specific tumor suppressors. PMID:16381821

  2. CARD9 negatively regulates NLRP3-induced IL-1β production on Salmonella infection of macrophages

    PubMed Central

    Pereira, Milton; Tourlomousis, Panagiotis; Wright, John; P. Monie, Tom; Bryant, Clare E.


    Interleukin-1β (IL-1β) is a proinflammatory cytokine required for host control of bacterial infections, and its production must be tightly regulated to prevent excessive inflammation. Here we show that caspase recruitment domain-containing protein 9 (CARD9), a protein associated with induction of proinflammatory cytokines by fungi, has a negative role on IL-1β production during bacterial infection. Specifically, in response to activation of the nucleotide oligomerization domain receptor pyrin-domain containing protein 3 (NLRP3) by Salmonella infection, CARD9 negatively regulates IL-1β by fine-tuning pro-IL-1β expression, spleen tyrosine kinase (SYK)-mediated NLRP3 activation and repressing inflammasome-associated caspase-8 activity. CARD9 is suppressed during Salmonella enterica serovar Typhimurium infection, facilitating increased IL-1β production. CARD9 is, therefore, a central signalling hub that coordinates a pathogen-specific host inflammatory response. PMID:27670879

  3. Krüppel-like factor 4 negatively regulates cellular antiviral immune response

    PubMed Central

    Luo, Wei-Wei; Lian, Huan; Zhong, Bo; Shu, Hong-Bing; Li, Shu


    Viral infection triggers activation of the transcription factors NF-κB and IRF3, which collaborate to induce the expression of type I interferons (IFNs) and elicit innate antiviral response. In this report, we identified Krüppel-like factor 4 (KLF4) as a negative regulator of virus-triggered signaling. Overexpression of KLF4 inhibited virus-induced activation of ISRE and IFN-β promoter in various types of cells, while knockdown of KLF4 potentiated viral infection-triggered induction of IFNB1 and downstream genes and attenuated viral replication. In addition, KLF4 was found to be localized in the cytosol and nucleus, and viral infection promoted the translocation of KLF4 from cytosol to nucleus. Upon virus infection, KLF4 was bound to the promoter of IFNB gene and inhibited the recruitment of IRF3 to the IFNB promoter. Our study thus suggests that KLF4 negatively regulates cellular antiviral response. PMID:25531393

  4. Dendritic Cell (DC)-Specific Targeting Reveals Stat3 as a Negative Regulator of DC Function

    PubMed Central

    Melillo, Jessica A.; Song, Li; Bhagat, Govind; Blazquez, Ana Belen; Plumlee, Courtney R.; Lee, Carolyn; Berin, Cecilia; Reizis, Boris; Schindler, Christian


    Dendritic cells (DCs) must achieve a critical balance between activation and tolerance, a process influenced by cytokines and growth factors. IL-10, which transduces signals through Stat3, has emerged as one important negative regulator of DC activation. To directly examine the role Stat3 plays in regulating DC activity, the Stat3 gene was targeted for deletion with a CD11c-cre transgene. Stat3 CKO mice developed cervical lymphadenopathy as well as a mild ileocolitis that persisted throughout life and was associated with impaired weight gain. Consistent with this, Stat3-deficient DCs demonstrated enhanced immune activity, including increased cytokine production, Ag-dependent T-cell activation and resistance to IL-10–mediated suppression. These results reveal a cell-intrinsic negative regulatory role of Stat3 in DCs and link increased DC activation with perturbed immune homeostasis and chronic mucosal inflammation. PMID:20124100

  5. Determinants of body weight regulation in humans.


    Moehlecke, Milene; Canani, Luis Henrique; Silva, Lucas Oliveira Junqueira E; Trindade, Manoel Roberto Maciel; Friedman, Rogerio; Leitão, Cristiane Bauermann


    Body weight is regulated by the ability of hypothalamic neurons to orchestrate behavioral, endocrine and autonomic responses via afferent and efferent pathways to the brainstem and the periphery. Weight maintenance requires a balance between energy intake and energy expenditure. Although several components that participate in energy homeostasis have been identified, there is a need to know in more detail their actions as well as their interactions with environmental and psychosocial factors in the development of human obesity. In this review, we examine the role of systemic mediators such as leptin, ghrelin and insulin, which act in the central nervous system by activating or inhibiting neuropeptide Y, Agouti-related peptide protein, melanocortin, transcript related to cocaine and amphetamine, and others. As a result, modifications in energy homeostasis occur through regulation of appetite and energy expenditure. We also examine compensatory changes in the circulating levels of several peripheral hormones after diet-induced weight loss.

  6. Phytophthora sojae TatD nuclease positively regulates sporulation and negatively regulates pathogenesis.


    Chen, Linlin; Shen, Danyu; Sun, Nannan; Xu, Jing; Wang, Wen; Dou, Daolong


    During pathogenic interactions, both the host and pathogen are exposed to conditions that induce programmed cell death (PCD). Certain aspects of PCD have been recently examined in eukaryotic microbes but not in oomycetes. Here, we identified conserved TatD proteins in Phytophthora sojae; the proteins are key components of DNA degradation in apoptosis. We selected PsTatD4 for further investigation because the enzyme is unique to the oomycete branch of the phylogenetic tree. The purified protein exhibited DNase activity in vitro. Its expression was upregulated in sporangia and later infective stages but downregulated in cysts and during early infection. Functional analysis revealed that the gene was required for sporulation and zoospore production, and the expression levels were associated with the numbers of hydrogen-peroxide-induced terminal dUTP nick end-labeling-positive cells. Furthermore, overexpression of PsTatD4 gene reduced the virulence in a susceptible soybean cultivar. Together, these data suggest that apoptosis may play different roles in the early and late infective stages of P. sojae, and that PsTatD4 is a key regulator of infection. The association of PsTatD4 and apoptosis will lay a foundation to understanding the basic biology of apoptosis and its roles in P. sojae disease cycle.

  7. Mindfulness in schizophrenia: Associations with self-reported motivation, emotion regulation, dysfunctional attitudes, and negative symptoms.


    Tabak, Naomi T; Horan, William P; Green, Michael F


    Mindfulness-based interventions are gaining empirical support as alternative or adjunctive treatments for a variety of mental health conditions, including anxiety, depression, and substance use disorders. Emerging evidence now suggests that mindfulness-based treatments may also improve clinical features of schizophrenia, including negative symptoms. However, no research has examined the construct of mindfulness and its correlates in schizophrenia. In this study, we examined self-reported mindfulness in patients (n=35) and controls (n=25) using the Five-Facet Mindfulness Questionnaire. We examined correlations among mindfulness, negative symptoms, and psychological constructs associated with negative symptoms and adaptive functioning, including motivation, emotion regulation, and dysfunctional attitudes. As hypothesized, patients endorsed lower levels of mindfulness than controls. In patients, mindfulness was unrelated to negative symptoms, but it was associated with more adaptive emotion regulation (greater reappraisal) and beliefs (lower dysfunctional attitudes). Some facets of mindfulness were also associated with self-reported motivation (behavioral activation and inhibition). These patterns of correlations were similar in patients and controls. Findings from this initial study suggest that schizophrenia patients may benefit from mindfulness-based interventions because they (a) have lower self-reported mindfulness than controls and (b) demonstrate strong relationships between mindfulness and psychological constructs related to adaptive functioning. PMID:26232242

  8. Mindfulness in schizophrenia: Associations with self-reported motivation, emotion regulation, dysfunctional attitudes, and negative symptoms

    PubMed Central

    Tabak, Naomi T.; Horan, William P.; Green, Michael F.


    Mindfulness-based interventions are gaining empirical support as alternative or adjunctive treatments for a variety of mental health conditions, including anxiety, depression, and substance use disorders. Emerging evidence now suggests that mindfulness-based treatments may also improve clinical features of schizophrenia, including negative symptoms. However, no research has examined the construct of mindfulness and its correlates in schizophrenia. In this study, we examined self-reported mindfulness in patients (n=35) and controls (n=25) using the Five-Facet Mindfulness Questionnaire. We examined correlations among mindfulness, negative symptoms, and psychological constructs associated with negative symptoms and adaptive functioning, including motivation, emotion regulation, and dysfunctional attitudes. As hypothesized, patients endorsed lower levels of mindfulness than controls. In patients, mindfulness was unrelated to negative symptoms, but it was associated with more adaptive emotion regulation (greater reappraisal) and beliefs (lower dysfunctional attitudes). Some facets of mindfulness were also associated with self-reported motivation (behavioral activation and inhibition). These patterns of correlations were similar in patients and controls. Findings from this initial study suggest that schizophrenia patients may benefit from mindfulness-based interventions because they (a) have lower self-reported mindfulness than controls and (b) demonstrate strong relationships between mindfulness and psychological constructs related to adaptive functioning. PMID:26232242

  9. Mindfulness in schizophrenia: Associations with self-reported motivation, emotion regulation, dysfunctional attitudes, and negative symptoms.


    Tabak, Naomi T; Horan, William P; Green, Michael F


    Mindfulness-based interventions are gaining empirical support as alternative or adjunctive treatments for a variety of mental health conditions, including anxiety, depression, and substance use disorders. Emerging evidence now suggests that mindfulness-based treatments may also improve clinical features of schizophrenia, including negative symptoms. However, no research has examined the construct of mindfulness and its correlates in schizophrenia. In this study, we examined self-reported mindfulness in patients (n=35) and controls (n=25) using the Five-Facet Mindfulness Questionnaire. We examined correlations among mindfulness, negative symptoms, and psychological constructs associated with negative symptoms and adaptive functioning, including motivation, emotion regulation, and dysfunctional attitudes. As hypothesized, patients endorsed lower levels of mindfulness than controls. In patients, mindfulness was unrelated to negative symptoms, but it was associated with more adaptive emotion regulation (greater reappraisal) and beliefs (lower dysfunctional attitudes). Some facets of mindfulness were also associated with self-reported motivation (behavioral activation and inhibition). These patterns of correlations were similar in patients and controls. Findings from this initial study suggest that schizophrenia patients may benefit from mindfulness-based interventions because they (a) have lower self-reported mindfulness than controls and (b) demonstrate strong relationships between mindfulness and psychological constructs related to adaptive functioning.

  10. Type One Protein Phosphatase 1 and Its Regulatory Protein Inhibitor 2 Negatively Regulate ABA Signaling

    PubMed Central

    Zhao, Yang; Xie, Shaojun; Batelli, Giorgia; Wang, Bangshing; Duan, Cheng-Guo; Wang, Xingang; Xing, Lu; Lei, Mingguang; Yan, Jun; Zhu, Xiaohong; Zhu, Jian-Kang


    The phytohormone abscisic acid (ABA) regulates plant growth, development and responses to biotic and abiotic stresses. The core ABA signaling pathway consists of three major components: ABA receptor (PYR1/PYLs), type 2C Protein Phosphatase (PP2C) and SNF1-related protein kinase 2 (SnRK2). Nevertheless, the complexity of ABA signaling remains to be explored. To uncover new components of ABA signal transduction pathways, we performed a yeast two-hybrid screen for SnRK2-interacting proteins. We found that Type One Protein Phosphatase 1 (TOPP1) and its regulatory protein, At Inhibitor-2 (AtI-2), physically interact with SnRK2s and also with PYLs. TOPP1 inhibited the kinase activity of SnRK2.6, and this inhibition could be enhanced by AtI-2. Transactivation assays showed that TOPP1 and AtI-2 negatively regulated the SnRK2.2/3/6-mediated activation of the ABA responsive reporter gene RD29B, supporting a negative role of TOPP1 and AtI-2 in ABA signaling. Consistent with these findings, topp1 and ati-2 mutant plants displayed hypersensitivities to ABA and salt treatments, and transcriptome analysis of TOPP1 and AtI-2 knockout plants revealed an increased expression of multiple ABA-responsive genes in the mutants. Taken together, our results uncover TOPP1 and AtI-2 as negative regulators of ABA signaling. PMID:26943172

  11. Identifying miRNA/mRNA negative regulation pairs in colorectal cancer

    PubMed Central

    Zhou, Xile; Xu, Xiangming; Wang, Jinhai; Lin, Jianjiang; Chen, Wenbin


    Although considerable progress has been made in the molecular biology of Colorectal cancer (CRC), novel approaches are still required to uncover the detailed molecular mechanism of CRC. We aim to explore the potential negatively regulated miRNA-mRNA pairs and investigate their regulatory roles so as to elaborate the potential roles of the critical proteins in the signaling pathways enriched by the differential target genes of negatively regulated miRNA in CRC. Firstly, the differential miRNA-mRNA pairs were selected, followed by pairs of miRNA and their target genes. The obtained relationships were subjected to do functional enrichment analysis and those enriched in CRC pathways were chose to further construct a protein interaction network. Finally, we analyzed the regulatory roles of these relationships and constructed a regulatory network of negatively regulated miRNA and mRNA relationships. A total of 372 pairs of miRNA-mRNA were found and 108 target genes of miRNA were obtained. Three miRNAs including hsa-mir-23b, hsa-mir-365-1 and hsa-mir-365-2 showed significant influence on prognosis of CRC patients. To conclude, the miRNA/mRNA deregulations pairs identified in this study have high potentials to be further applied in diagnosis and treatment of CRC. PMID:26269151

  12. A balance of positive and negative regulators determines the pace of the segmentation clock

    PubMed Central

    Wiedermann, Guy; Bone, Robert Alexander; Silva, Joana Clara; Bjorklund, Mia


    Somitogenesis is regulated by a molecular oscillator that drives dynamic gene expression within the pre-somitic mesoderm. Previous mathematical models of the somitogenesis clock that invoke the mechanism of delayed negative feedback predict that its oscillation period depends on the sum of delays inherent to negative-feedback loops and inhibitor half-lives. We develop a mathematical model that explores the possibility that positive feedback also plays a role in determining the period of clock oscillations. The model predicts that increasing the half-life of the positive regulator, Notch intracellular domain (NICD), can lead to elevated NICD levels and an increase in the oscillation period. To test this hypothesis, we investigate a phenotype induced by various small molecule inhibitors in which the clock is slowed. We observe elevated levels and a prolonged half-life of NICD. Reducing NICD production rescues these effects. These data provide the first indication that tight control of the turnover of positive as well as negative regulators of the clock determines its periodicity. DOI: PMID:26357015

  13. SOCS3 Drives Proteasomal Degradation of TBK1 and Negatively Regulates Antiviral Innate Immunity

    PubMed Central

    Liu, Dong; Sheng, Chunjie; Gao, Shijuan; Yao, Chen; Li, Jiandong; Jiang, Wei; Chen, Huiming; Wu, Jiaoxiang; Pan, Changchuan


    TANK-binding kinase 1 (TBK1)-mediated induction of type I interferon (IFN) plays a critical role in host antiviral responses and immune homeostasis. The negative regulation of TBK1 activity is largely unknown. We report that suppressor of cytokine signaling 3 (SOCS3) inhibits the IFN-β signaling pathway by promoting proteasomal degradation of TBK1. Overexpression and knockdown experiments indicated that SOCS3 is a negative regulator of IFN regulatory factor 3 (IRF3) phosphorylation and IFN-β transcription. Moreover, SOCS3 directly associates with TBK1, and they colocalize in the cytoplasm. SOCS3 catalyzes K48-linked polyubiquitination of TBK1 at Lys341 and Lys344 and promotes subsequent TBK1 degradation. On the contrary, SOCS3 knockdown markedly increases the abundance of TBK1. Interestingly, both the BOX domain of SOCS3 and Ser172 phosphorylation of TBK1 are indispensable for the processes of ubiquitination and degradation. Ectopic expression of SOCS3 significantly inhibits vesicular stomatitis virus (VSV) and influenza A virus strain A/WSN/33 (WSN)-induced IRF3 phosphorylation and facilitates the replication of WSN virus by detecting the transcription of its viral RNA (vRNA). Knockdown of SOCS3 represses WSN replication. Collectively, these results demonstrate that SOCS3 acts as a negative regulator of IFN-β signal by ubiquitinating and degrading TBK1, shed light on the understanding of antiviral innate immunity, and provide a potential target for developing antiviral agents. PMID:25939384

  14. Negative regulation of RIG-I-mediated antiviral signaling by TRK-fused gene (TFG) protein

    SciTech Connect

    Lee, Na-Rae; Shin, Han-Bo; Kim, Hye-In; Choi, Myung-Soo; Inn, Kyung-Soo


    Highlights: •TRK-fused gene product (TFG) interacts with TRIM25 upon viral infection. •TFG negatively regulates RIG-I mediated antiviral signaling. •TFG depletion leads to enhanced viral replication. •TFG act downstream of MAVS. -- Abstract: RIG-I (retinoic acid inducible gene I)-mediated antiviral signaling serves as the first line of defense against viral infection. Upon detection of viral RNA, RIG-I undergoes TRIM25 (tripartite motif protein 25)-mediated K63-linked ubiquitination, leading to type I interferon (IFN) production. In this study, we demonstrate that TRK-fused gene (TFG) protein, previously identified as a TRIM25-interacting protein, binds TRIM25 upon virus infection and negatively regulates RIG-I-mediated type-I IFN signaling. RIG-I-mediated IFN production and nuclear factor (NF)-κB signaling pathways were upregulated by the suppression of TFG expression. Furthermore, vesicular stomatitis virus (VSV) replication was significantly inhibited by small inhibitory hairpin RNA (shRNA)-mediated knockdown of TFG, supporting the suppressive role of TFG in RIG-I-mediated antiviral signaling. Interestingly, suppression of TFG expression increased not only RIG-I-mediated signaling but also MAVS (mitochondrial antiviral signaling protein)-induced signaling, suggesting that TFG plays a pivotal role in negative regulation of RNA-sensing, RIG-I-like receptor (RLR) family signaling pathways.

  15. Down-Regulation of Negative Emotional Processing by Transcranial Direct Current Stimulation: Effects of Personality Characteristics

    PubMed Central

    Peña-Gómez, Cleofé; Vidal-Piñeiro, Dídac; Clemente, Immaculada C.; Pascual-Leone, Álvaro; Bartrés-Faz, David


    Evidence from neuroimaging and electrophysiological studies indicates that the left dorsolateral prefrontal cortex (DLPFC) is a core region in emotional processing, particularly during down-regulation of negative emotional conditions. However, emotional regulation is a process subject to major inter-individual differences, some of which may be explained by personality traits. In the present study we used transcranial direct current stimulation (tDCS) over the left DLPFC to investigate whether transiently increasing the activity of this region resulted in changes in the ratings of positive, neutral and negative emotional pictures. Results revealed that anodal, but not cathodal, tDCS reduced the perceived degree of emotional valence for negative stimuli, possibly due to an enhancement of cognitive control of emotional expression. We also aimed to determine whether personality traits (extraversion and neuroticism) might condition the impact of tDCS. We found that individuals with higher scores on the introversion personality dimension were more permeable than extraverts to the modulatory effects of the stimulation. The present study underlines the role of the left DLPFC in emotional regulation, and stresses the importance of considering individual personality characteristics as a relevant variable, although replication is needed given the limited sample size of our study. PMID:21829522

  16. Burkholderia mallei and Burkholderia pseudomallei Cluster 1 Type VI Secretion System Gene Expression Is Negatively Regulated by Iron and Zinc

    PubMed Central

    Burtnick, Mary N.; Brett, Paul J.


    Burkholderia mallei is a facultative intracellular pathogen that causes glanders in humans and animals. Previous studies have demonstrated that the cluster 1 type VI secretion system (T6SS-1) expressed by this organism is essential for virulence in hamsters and is positively regulated by the VirAG two-component system. Recently, we have shown that T6SS-1 gene expression is up-regulated following internalization of this pathogen into phagocytic cells and that this system promotes multinucleated giant cell formation in infected tissue culture monolayers. In the present study, we further investigated the complex regulation of this important virulence factor. To assess T6SS-1 expression, B. mallei strains were cultured in various media conditions and Hcp1 production was analyzed by Western immunoblotting. Transcript levels of several VirAG-regulated genes (bimA, tssA, hcp1 and tssM) were also determined using quantitative real time PCR. Consistent with previous observations, T6SS-1 was not expressed during growth of B. mallei in rich media. Curiously, growth of the organism in minimal media (M9G) or minimal media plus casamino acids (M9CG) facilitated robust expression of T6SS-1 genes whereas growth in minimal media plus tryptone (M9TG) did not. Investigation of this phenomenon confirmed a regulatory role for VirAG in this process. Additionally, T6SS-1 gene expression was significantly down-regulated by the addition of iron and zinc to M9CG. Other genes under the control of VirAG did not appear to be as tightly regulated by these divalent metals. Similar results were observed for B. pseudomallei, but not for B. thailandensis. Collectively, our findings indicate that in addition to being positively regulated by VirAG, B. mallei and B. pseudomallei T6SS-1 gene expression is negatively regulated by iron and zinc. PMID:24146925

  17. Negative feedback regulation of Homer 1a on norepinephrine-dependent cardiac hypertrophy

    SciTech Connect

    Chiarello, Carmelina; Bortoloso, Elena; Carpi, Andrea; Furlan, Sandra; Volpe, Pompeo


    Homers are scaffolding proteins that modulate diverse cell functions being able to assemble signalling complexes. In this study, the presence, sub-cellular distribution and function of Homer 1 was investigated. Homer 1a and Homer 1b/c are constitutively expressed in cardiac muscle of both mouse and rat and in HL-1 cells, a cardiac cell line. As judged by confocal immunofluorescence microscopy, Homer 1a displays sarcomeric and peri-nuclear localization. In cardiomyocytes and cultured HL-1 cells, the hypertrophic agonist norepinephrine (NE) induces α{sub 1}-adrenergic specific Homer 1a over-expression, with a two-to-three-fold increase within 1 h, and no up-regulation of Homer 1b/c, as judged by Western blot and qPCR. In HL-1 cells, plasmid-driven over-expression of Homer 1a partially antagonizes activation of ERK phosphorylation and ANF up-regulation, two well-established, early markers of hypertrophy. At the morphometric level, NE-induced increase of cell size is likewise and partially counteracted by exogenous Homer 1a. Under the same experimental conditions, Homer 1b/c does not have any effect on ANF up-regulation nor on cell hypertrophy. Thus, Homer 1a up-regulation is associated to early stages of cardiac hypertrophy and appears to play a negative feedback regulation on molecular transducers of hypertrophy. -- Highlights: • Homer 1a is constitutively expressed in cardiac tissue. • In HL-1 cells, norepinephrine activates signaling pathways leading to hypertrophy. • Homer 1a up-regulation is an early event of norepinephrine-induced hypertrophy. • Homer 1a plays a negative feedback regulation modulating pathological hypertrophy. • Over-expression of Homer 1a per se does not induce hypertrophy.

  18. DLK1 Regulates Whole-Body Glucose Metabolism: A Negative Feedback Regulation of the Osteocalcin-Insulin Loop.


    Abdallah, Basem M; Ditzel, Nicholas; Laborda, Jorge; Karsenty, Gerard; Kassem, Moustapha


    The endocrine role of the skeleton in regulating energy metabolism is supported by a feed-forward loop between circulating osteoblast (OB)-derived undercarboxylated osteocalcin (Glu-OCN) and pancreatic β-cell insulin; in turn, insulin favors osteocalcin (OCN) bioactivity. These data suggest the existence of a negative regulation of this cross talk between OCN and insulin. Recently, we identified delta like-1 (DLK1) as an endocrine regulator of bone turnover. Because DLK1 is colocalized with insulin in pancreatic β-cells, we examined the role of DLK1 in insulin signaling in OBs and energy metabolism. We show that Glu-OCN specifically stimulates Dlk1 expression by the pancreas. Conversely, Dlk1-deficient (Dlk1(-/-) ) mice exhibited increased circulating Glu-OCN levels and increased insulin sensitivity, whereas mice overexpressing Dlk1 in OB displayed reduced insulin secretion and sensitivity due to impaired insulin signaling in OB and lowered Glu-OCN serum levels. Furthermore, Dlk1(-/-) mice treated with Glu-OC experienced significantly lower blood glucose levels than Glu-OCN-treated wild-type mice. The data suggest that Glu-OCN-controlled production of DLK1 by pancreatic β-cells acts as a negative feedback mechanism to counteract the stimulatory effects of insulin on OB production of Glu-OCN, a potential mechanism preventing OCN-induced hypoglycemia.

  19. OsGF14b Positively Regulates Panicle Blast Resistance but Negatively Regulates Leaf Blast Resistance in Rice.


    Liu, Qing; Yang, Jianyuan; Zhang, Shaohong; Zhao, Junliang; Feng, Aiqing; Yang, Tifeng; Wang, Xiaofei; Mao, Xinxue; Dong, Jingfang; Zhu, Xiaoyuan; Leung, Hei; Leach, Jan E; Liu, Bin


    Although 14-3-3 proteins have been reported to be involved in responses to biotic stresses in plants, their functions in rice blast, the most destructive disease in rice, are largely unknown. Only GF14e has been confirmed to negatively regulate leaf blast. We report that GF14b is highly expressed in seedlings and panicles during blast infection. Rice plants overexpressing GF14b show enhanced resistance to panicle blast but are susceptible to leaf blast. In contrast, GF14b-silenced plants show increased susceptibility to panicle blast but enhanced resistance to leaf blast. Yeast one-hybrid assays demonstrate that WRKY71 binds to the promoter of GF14b and modulates its expression. Overexpression of GF14b induces expression of jasmonic acid (JA) synthesis-related genes but suppresses expression of salicylic acid (SA) synthesis-related genes. In contrast, suppressed GF14b expression causes decreased expression of JA synthesis-related genes but activation of SA synthesis-related genes. These results suggest that GF14b positively regulates panicle blast resistance but negatively regulates leaf blast resistance, and that GF14b-mediated disease resistance is associated with the JA- and SA-dependent pathway. The different functions for 14-3-3 proteins in leaf and panicle blast provide new evidence that leaf and panicle blast resistance are controlled by different mechanisms. PMID:26467468

  20. Corepressor MMTR/DMAP1 is an intrinsic negative regulator of CAK kinase to regulate cell cycle progression

    SciTech Connect

    Shin, June Ho; Kang, Ho Chul; Park, Yun-Yeon; Ha, Dae Hyun; Choi, Youn Hee; Eum, Hea Young; Kang, Bong Gu; Chae, Ji Hyung; Shin, Incheol; Lee, Jae-Ho; Kim, Chul Geun


    Research highlights: {yields} Co-repressor MMTR/DMAP1 is an intrinsic negative regulator of CAK kinase. {yields} MMTR inhibited cell proliferation due to delays of G1/S and G2/M transitions. {yields} Co-expression of MAT1 and MMTR rescued both cell growth and proliferation rate. {yields} MMTR blocked the CAK kinase-mediated phosphorylation of CDK1. {yields} The expression level of MMTR was modulated during cell cycle progression. -- Abstract: We have previously reported that MMTR (MAT1-mediated transcriptional repressor) is a co-repressor that inhibits TFIIH-mediated transcriptional activity via interaction with MAT1 (Kang et al., 2007). Since MAT1 is a member of the CAK kinase complex that is crucial for cell cycle progression and that regulates CDK phosphorylation as well as the general transcription factor TFIIH, we investigated MMTR function in cell cycle progression. We found that MMTR over-expression delayed G1/S and G2/M transitions, whereas co-expression of MAT1 and MMTR rescued the cell growth and proliferation rate. Moreover, MMTR was required for inhibition of CAK kinase-mediated CDK1 phosphorylation. We also showed that the expression level of MMTR was modulated during cell cycle progression. Our data support the notion that MMTR is an intrinsic negative cell cycle regulator that modulates the CAK kinase activity via interaction with MAT1.

  1. OsGF14b Positively Regulates Panicle Blast Resistance but Negatively Regulates Leaf Blast Resistance in Rice.


    Liu, Qing; Yang, Jianyuan; Zhang, Shaohong; Zhao, Junliang; Feng, Aiqing; Yang, Tifeng; Wang, Xiaofei; Mao, Xinxue; Dong, Jingfang; Zhu, Xiaoyuan; Leung, Hei; Leach, Jan E; Liu, Bin


    Although 14-3-3 proteins have been reported to be involved in responses to biotic stresses in plants, their functions in rice blast, the most destructive disease in rice, are largely unknown. Only GF14e has been confirmed to negatively regulate leaf blast. We report that GF14b is highly expressed in seedlings and panicles during blast infection. Rice plants overexpressing GF14b show enhanced resistance to panicle blast but are susceptible to leaf blast. In contrast, GF14b-silenced plants show increased susceptibility to panicle blast but enhanced resistance to leaf blast. Yeast one-hybrid assays demonstrate that WRKY71 binds to the promoter of GF14b and modulates its expression. Overexpression of GF14b induces expression of jasmonic acid (JA) synthesis-related genes but suppresses expression of salicylic acid (SA) synthesis-related genes. In contrast, suppressed GF14b expression causes decreased expression of JA synthesis-related genes but activation of SA synthesis-related genes. These results suggest that GF14b positively regulates panicle blast resistance but negatively regulates leaf blast resistance, and that GF14b-mediated disease resistance is associated with the JA- and SA-dependent pathway. The different functions for 14-3-3 proteins in leaf and panicle blast provide new evidence that leaf and panicle blast resistance are controlled by different mechanisms.

  2. Resveratrol suppresses NTHi-induced inflammation via up-regulation of the negative regulator MyD88 short

    PubMed Central

    Andrews, Carla S.; Matsuyama, Shingo; Lee, Byung-Cheol; Li, Jian-Dong


    Upper respiratory tract inflammatory diseases such as asthma and chronic obstructive pulmonary diseases (COPD) affect more than one-half billion people globally and are characterized by chronic inflammation that is often exacerbated by respiratory pathogens such as nontypeable Haemophilus influenzae (NTHi). The increasing numbers of antibiotic-resistant bacterial strains and the limited success of currently available pharmaceuticals used to manage the symptoms of these diseases present an urgent need for the development of novel anti-inflammatory therapeutic agents. Resveratrol has long been thought as an interesting therapeutic agent for various diseases including inflammatory diseases. However, the molecular mechanisms underlying its anti-inflammatory properties remain largely unknown. Here we show for the first time that resveratrol decreases expression of pro-inflammatory mediators in airway epithelial cells and in the lung of mice by enhancing NTHi-induced MyD88 short, a negative regulator of inflammation, via inhibition of ERK1/2 activation. Furthermore, resveratrol inhibits NTHi-induced ERK1/2 phosphorylation by increasing MKP-1 expression via a cAMP-PKA-dependent signaling pathway. Finally, we show that resveratrol has anti-inflammatory effects post NTHi infection, thereby demonstrating its therapeutic potential. Together these data reveal a novel mechanism by which resveratrol alleviates NTHi-induced inflammation in airway disease by up-regulating the negative regulator of inflammation MyD88s. PMID:27677845

  3. Stress chaperone mortalin regulates human melanogenesis.


    Wadhwa, Renu; Priyandoko, Didik; Gao, Ran; Widodo, Nashi; Nigam, Nupur; Li, Ling; Ahn, Hyo Min; Yun, Chae-Ok; Ando, Nobuhiro; Mahe, Christian; Kaul, Sunil C


    In order to identify the cellular factors involved in human melanogenesis, we carried out shRNA-mediated loss-of-function screening in conjunction with induction of melanogenesis by 1-oleoyl-2-acetyl-glycerol (OAG) in human melanoma cells using biochemical and visual assays. Gene targets of the shRNAs (that caused loss of OAG-induced melanogenesis) and their pathways, as determined by bioinformatics, revealed involvement of proteins that regulate cell stress response, mitochondrial functions, proliferation, and apoptosis. We demonstrate, for the first time, that the mitochondrial stress chaperone mortalin is crucial for melanogenesis. Upregulation of mortalin was closely associated with melanogenesis in in vitro cell-based assays and clinical samples of keloids with hyperpigmentation. Furthermore, its knockdown resulted in compromised melanogenesis. The data proposed mortalin as an important protein that may be targeted to manipulate pigmentation for cosmetic and related disease therapeutics. PMID:27056733

  4. Btg2 is a Negative Regulator of Cardiomyocyte Hypertrophy through a Decrease in Cytosolic RNA

    PubMed Central

    Masumura, Yuki; Higo, Shuichiro; Asano, Yoshihiro; Kato, Hisakazu; Yan, Yi; Ishino, Saki; Tsukamoto, Osamu; Kioka, Hidetaka; Hayashi, Takaharu; Shintani, Yasunori; Yamazaki, Satoru; Minamino, Tetsuo; Kitakaze, Masafumi; Komuro, Issei; Takashima, Seiji; Sakata, Yasushi


    Under hypertrophic stimulation, cardiomyocytes enter a hypermetabolic state and accelerate biomass accumulation. Although the molecular pathways that regulate protein levels are well-studied, the functional implications of RNA accumulation and its regulatory mechanisms in cardiomyocytes remain elusive. Here, we have elucidated the quantitative kinetics of RNA in cardiomyocytes through single cell imaging and c-Myc (Myc)-mediated hypermetabolic analytical model using cultured cardiomyocytes. Nascent RNA labeling combined with single cell imaging demonstrated that Myc protein significantly increased the amount of global RNA production per cardiomyocyte. Chromatin immunoprecipitation with high-throughput sequencing clarified that overexpressed Myc bound to a specific set of genes and recruits RNA polymerase II. Among these genes, we identified Btg2 as a novel target of Myc. Btg2 overexpression significantly reduced cardiomyocyte surface area. Conversely, shRNA-mediated knockdown of Btg2 accelerated adrenergic stimulus-induced hypertrophy. Using mass spectrometry analysis, we determined that Btg2 binds a series of proteins that comprise mRNA deadenylation complexes. Intriguingly, Btg2 specifically suppresses cytosolic, but not nuclear, RNA levels. Btg2 knockdown further enhances cytosolic RNA accumulation in cardiomyocytes under adrenergic stimulation, suggesting that Btg2 negatively regulates reactive hypertrophy by negatively regulating RNA accumulation. Our findings provide insight into the functional significance of the mechanisms regulating RNA levels in cardiomyocytes. PMID:27346836

  5. Negative feedback regulation of auxin signaling by ATHB8/ACL5-BUD2 transcription module.


    Baima, Simona; Forte, Valentina; Possenti, Marco; Peñalosa, Andrés; Leoni, Guido; Salvi, Sergio; Felici, Barbara; Ruberti, Ida; Morelli, Giorgio


    The role of auxin as main regulator of vascular differentiation is well established, and a direct correlation between the rate of xylem differentiation and the amount of auxin reaching the (pro)cambial cells has been proposed. It has been suggested that thermospermine produced by ACAULIS5 (ACL5) and bushy and dwarf2 (BUD2) is one of the factors downstream to auxin contributing to the regulation of this process in Arabidopsis. Here, we provide an in-depth characterization of the mechanism through which ACL5 modulates xylem differentiation. We show that an increased level of ACL5 slows down xylem differentiation by negatively affecting the expression of homeodomain-leucine zipper (HD-ZIP) III and key auxin signaling genes. This mechanism involves the positive regulation of thermospermine biosynthesis by the HD-ZIP III protein Arabidopsis thaliana homeobox8 tightly controlling the expression of ACL5 and BUD2. In addition, we show that the HD-ZIP III protein REVOLUTA contributes to the increased leaf vascularization and long hypocotyl phenotype of acl5 likely by a direct regulation of auxin signaling genes such as like auxin resistant2 (LAX2) and LAX3. We propose that proper formation and differentiation of xylem depend on a balance between positive and negative feedback loops operating through HD-ZIP III genes.

  6. TORC1 Signaling Is Governed by Two Negative Regulators in Fission Yeast

    PubMed Central

    Ma, Ning; Liu, Qingbin; Zhang, Lili; Henske, Elizabeth P.; Ma, Yan


    The target of rapamycin (TOR) is a highly conserved protein kinase that regulates cell growth and metabolism. Here we performed a genome-wide screen to identify negative regulators of TOR complex 1 (TORC1) in Schizosaccharomyces pombe by isolating mutants that phenocopy Δtsc2, in which TORC1 signaling is known to be up-regulated. We discovered that Δnpr2 displayed similar phenotypes to Δtsc2 in terms of amino acid uptake defects and mislocalization of the Cat1 permease. However, Δnpr2 and Δtsc2 clearly showed different phenotypes in terms of rapamycin supersensitivity and Isp5 transcription upon various treatments. Furthermore, we showed that Tor2 controls amino acid homeostasis at the transcriptional and post-transcriptional levels. Our data reveal that both Npr2 and Tsc2 negatively regulate TORC1 signaling, and Npr2, but not Tsc2, may be involved in the feedback loop of a nutrient-sensing pathway. PMID:23934889

  7. Negative and positive auto-regulation of BMP expression in early eye development.


    Huang, Jie; Liu, Ying; Filas, Benjamen; Gunhaga, Lena; Beebe, David C


    Previous results have shown that Bone Morphogenetic Protein (BMP) signaling is essential for lens specification and differentiation. How BMP signals are regulated in the prospective lens ectoderm is not well defined. To address this issue we have modulated BMP activity in a chicken embryo pre-lens ectoderm explant assay, and also studied transgenic mice, in which the type I BMP receptors, Bmpr1a and Acvr1, are deleted from the prospective lens ectoderm. Our results show that chicken embryo pre-lens ectoderm cells express BMPs and require BMP signaling for lens specification in vitro, and that in vivo inhibition of BMP signals in the mouse prospective lens ectoderm interrupts lens placode formation and prevents lens invagination. Furthermore, our results provide evidence that BMP expression is negatively auto-regulated in the lens-forming ectoderm, decreasing when the tissue is exposed to exogenous BMPs and increasing when BMP signaling is prevented. In addition, eyes lacking BMP receptors in the prospective lens placode develop coloboma in the adjacent wild type optic cup. In these eyes, Bmp7 expression increases in the ventral optic cup and the normal dorsal-ventral gradient of BMP signaling in the optic cup is disrupted. Pax2 becomes undetectable and expression of Sfrp2 increases in the ventral optic cup, suggesting that increased BMP signaling alter their expression, resulting in failure to close the optic fissure. In summary, our results suggest that negative and positive auto-regulation of BMP expression is important to regulate early eye development.

  8. Kin recognition: evidence that humans can perceive both positive and negative relatedness.


    Krupp, D B; DeBruine, L M; Jones, B C; Lalumière, M L


    The evolution of spite entails actors imposing costs on 'negative' relatives: those who are less likely than chance to share the actor's alleles and therefore more likely to bear rival alleles. Yet, despite a considerable body of research confirming that organisms can recognize positive relatives, little research has shown that organisms can recognize negative relatives. Here, we extend previous work on human phenotype matching by introducing a cue to negative relatedness: negative self-resembling faces, which differ from an average face in the opposite direction to the way an individual's own face differs from the average. Participants made trustworthiness and attractiveness judgements of pairs of opposite-sex positive and negative self-resembling faces. Analyses revealed opposing effects of positive and negative self-resembling faces on trustworthiness and attractiveness judgements. This is the first clear evidence that humans are sensitive to negative relatedness cues, and suggests the potential for the adaptive allocation of spiteful behaviour. PMID:22694177

  9. Microbe–Host Interactions are Positively and Negatively Regulated by Galectin–Glycan Interactions

    PubMed Central

    Baum, Linda G.; Garner, Omai B.; Schaefer, Katrin; Lee, Benhur


    Microbe–host interactions are complex processes that are directly and indirectly regulated by a variety of factors, including microbe presentation of specific molecular signatures on the microbial surface, as well as host cell presentation of receptors that recognize these pathogen signatures. Cell surface glycans are one important class of microbial signatures that are recognized by a variety of host cell lectins. Host cell lectins that recognize microbial glycans include members of the galectin family of lectins that recognize specific glycan ligands on viruses, bacteria, fungi, and parasites. In this review, we will discuss the ways that the interactions of microbial glycans with host cell galectins positively and negatively regulate pathogen attachment, invasion, and survival, as well as regulate host responses that mitigate microbial pathogenesis. PMID:24995007

  10. The protein kinase LKB1 negatively regulates bone morphogenetic protein receptor signaling

    PubMed Central

    Raja, Erna; Edlund, Karolina; Kahata, Kaoru; Zieba, Agata; Morén, Anita; Watanabe, Yukihide; Voytyuk, Iryna; Botling, Johan; Söderberg, Ola; Micke, Patrick; Pyrowolakis, George; Heldin, Carl-Henrik; Moustakas, Aristidis


    The protein kinase LKB1 regulates cell metabolism and growth and is implicated in intestinal and lung cancer. Bone morphogenetic protein (BMP) signaling regulates cell differentiation during development and tissue homeostasis. We demonstrate that LKB1 physically interacts with BMP type I receptors and requires Smad7 to promote downregulation of the receptor. Accordingly, LKB1 suppresses BMP-induced osteoblast differentiation and affects BMP signaling in Drosophila wing longitudinal vein morphogenesis. LKB1 protein expression and Smad1 phosphorylation analysis in a cohort of non-small cell lung cancer patients demonstrated a negative correlation predominantly in a subset enriched in adenocarcinomas. Lung cancer patient data analysis indicated strong correlation between LKB1 loss-of-function mutations and high BMP2 expression, and these two events further correlated with expression of a gene subset functionally linked to apoptosis and migration. This new mechanism of BMP receptor regulation by LKB1 has ramifications in physiological organogenesis and disease. PMID:26701726

  11. Invited review: aging and human temperature regulation.


    Kenney, W Larry; Munce, Thayne A


    This mini-review focuses on the effects of aging on human temperature regulation. Although comprehensive reviews have been published on this topic (Kenney WL. Exercise and Sport Sciences Reviews, Baltimore: Williams & Wilkins, 1997, p. 41-76; Pandolf KB. Exp Aging Res 17: 189-204, 1991; Van Someren EJ, Raymann RJ, Scherder EJ, Daanen HA, and Swaab DF. Ageing Res Rev 1: 721-778, 2002; and Young AJ. Exp Aging Res 17: 205-213, 1991), this mini-review concisely summarizes the present state of knowledge about human temperature regulation and aging in thermoneutral conditions, as well as during hypo- and hyperthermic challenges. First, we discuss age-related effects on baseline body core temperature and phasing rhythms of the circadian temperature cycle. We then examine the altered physiological responses to cold stress that result from aging, including attenuated peripheral vasoconstriction and reduced cold-induced metabolic heat production. Finally, we present the age-related changes in sweating and cardiovascular function associated with heat stress. Although epidemiological evidence of increased mortality among older adults from hypo- and hyperthermia exists, this outcome does not reflect an inability to thermoregulate with advanced age. In fact, studies that have attempted to separate the effects of chronological age from concurrent factors, such as fitness level, body composition, and the effects of chronic disease, have shown that thermal tolerance appears to be minimally compromised by age.

  12. Thyroid hormone negatively regulates CDX2 and SOAT2 mRNA expression via induction of miRNA-181d in hepatic cells

    SciTech Connect

    Yap, Chui Sun; Sinha, Rohit Anthony; Ota, Sho; Katsuki, Masahito; Yen, Paul Michael


    Highlights: •Thyroid hormone induces miR-181d expression in human hepatic cells and mouse livers. •Thyroid hormone downregulates CDX2 and SOAT2 (or ACAT2) via miR-181d. •miR-181d reduces cholesterol output from human hepatic cells. -- Abstract: Thyroid hormones (THs) regulate transcription of many metabolic genes in the liver through its nuclear receptors (TRs). Although the molecular mechanisms for positive regulation of hepatic genes by TH are well understood, much less is known about TH-mediated negative regulation. Recently, several nuclear hormone receptors were shown to downregulate gene expression via miRNAs. To further examine the potential role of miRNAs in TH-mediated negative regulation, we used a miRNA microarray to identify miRNAs that were directly regulated by TH in a human hepatic cell line. In our screen, we discovered that miRNA-181d is a novel hepatic miRNA that was regulated by TH in hepatic cell culture and in vivo. Furthermore, we identified and characterized two novel TH-regulated target genes that were downstream of miR-181d signaling: caudal type homeobox 2 (CDX2) and sterol O-acyltransferase 2 (SOAT2 or ACAT2). CDX2, a known positive regulator of hepatocyte differentiation, was regulated by miR-181d and directly activated SOAT2 gene expression. Since SOAT2 is an enzyme that generates cholesteryl esters that are packaged into lipoproteins, our results suggest miR-181d plays a significant role in the negative regulation of key metabolic genes by TH in the liver.

  13. The MprB Extracytoplasmic Domain Negatively Regulates Activation of the Mycobacterium tuberculosis MprAB Two-Component System

    PubMed Central

    Bretl, Daniel J.; Bigley, Tarin M.; Terhune, Scott S.


    Mycobacterium tuberculosis is an acid-fast pathogen of humans and the etiological agent of tuberculosis (TB). It is estimated that one-third of the world's population is latently (persistently) infected with M. tuberculosis. M. tuberculosis persistence is regulated, in part, by the MprAB two-component signal transduction system, which is activated by and mediates resistance to cell envelope stress. Here we identify MprAB as part of an evolutionarily conserved cell envelope stress response network and demonstrate that MprAB-mediated signal transduction is negatively regulated by the MprB extracytoplasmic domain (ECD). In particular, we report that deregulated production of the MprB sensor kinase, or of derivatives of this protein, negatively impacts M. tuberculosis growth. The observed growth attenuation is dependent on MprAB-mediated signal transduction and is exacerbated in strains of M. tuberculosis producing an MprB variant lacking its ECD. Interestingly, full-length MprB, and the ECD of MprB specifically, immunoprecipitates the Hsp70 chaperone DnaK in vivo, while overexpression of dnaK inhibits MprAB-mediated signal transduction in M. tuberculosis grown in the absence or presence of cell envelope stress. We propose that under nonstress conditions, or under conditions in which proteins present in the extracytoplasmic space are properly folded, signaling through the MprAB system is inhibited by the MprB ECD. Following exposure to cell envelope stress, proteins present in the extracytoplasmic space become unfolded or misfolded, leading to removal of the ECD-mediated negative regulation of MprB and subsequent activation of MprAB. PMID:24187094

  14. Dynamic Switch of Negative Feedback Regulation in Drosophila Akt–TOR Signaling

    PubMed Central

    Kockel, Lutz; Kerr, Kimberly S.; Melnick, Michael; Brückner, Katja; Hebrok, Matthias; Perrimon, Norbert


    Akt represents a nodal point between the Insulin receptor and TOR signaling, and its activation by phosphorylation controls cell proliferation, cell size, and metabolism. The activity of Akt must be carefully balanced, as increased Akt signaling is frequently associated with cancer and as insufficient Akt signaling is linked to metabolic disease and diabetes mellitus. Using a genome-wide RNAi screen in Drosophila cells in culture, and in vivo analyses in the third instar wing imaginal disc, we studied the regulatory circuitries that define dAkt activation. We provide evidence that negative feedback regulation of dAkt occurs during normal Drosophila development in vivo. Whereas in cell culture dAkt is regulated by S6 Kinase (S6K)–dependent negative feedback, this feedback inhibition only plays a minor role in vivo. In contrast, dAkt activation under wild-type conditions is defined by feedback inhibition that depends on TOR Complex 1 (TORC1), but is S6K–independent. This feedback inhibition is switched from TORC1 to S6K only in the context of enhanced TORC1 activity, as triggered by mutations in tsc2. These results illustrate how the Akt–TOR pathway dynamically adapts the routing of negative feedback in response to the activity load of its signaling circuit in vivo. PMID:20585550

  15. Drosophila protein kinase N (Pkn) is a negative regulator of actin-myosin activity during oogenesis.


    Ferreira, Tânia; Prudêncio, Pedro; Martinho, Rui Gonçalo


    Nurse cell dumping is an actin-myosin based process, where 15 nurse cells of a given egg chamber contract and transfer their cytoplasmic content through the ring canals into the growing oocyte. We isolated two mutant alleles of protein kinase N (pkn) and showed that Pkn negatively-regulates activation of the actin-myosin cytoskeleton during the onset of dumping. Using live-cell imaging analysis we observed that nurse cell dumping rates sharply increase during the onset of fast dumping. Such rate increase was severely impaired in pkn mutant nurse cells due to excessive nurse cell actin-myosin activity and/or loss of tissue integrity. Our work demonstrates that the transition between slow and fast dumping is a discrete event, with at least a five to six-fold dumping rate increase. We show that Pkn negatively regulates nurse cell actin-myosin activity. This is likely to be important for directional cytoplasmic flow. We propose Pkn provides a negative feedback loop to help avoid excessive contractility after local activation of Rho GTPase.

  16. Drosophila protein kinase N (Pkn) is a negative regulator of actin-myosin activity during oogenesis.


    Ferreira, Tânia; Prudêncio, Pedro; Martinho, Rui Gonçalo


    Nurse cell dumping is an actin-myosin based process, where 15 nurse cells of a given egg chamber contract and transfer their cytoplasmic content through the ring canals into the growing oocyte. We isolated two mutant alleles of protein kinase N (pkn) and showed that Pkn negatively-regulates activation of the actin-myosin cytoskeleton during the onset of dumping. Using live-cell imaging analysis we observed that nurse cell dumping rates sharply increase during the onset of fast dumping. Such rate increase was severely impaired in pkn mutant nurse cells due to excessive nurse cell actin-myosin activity and/or loss of tissue integrity. Our work demonstrates that the transition between slow and fast dumping is a discrete event, with at least a five to six-fold dumping rate increase. We show that Pkn negatively regulates nurse cell actin-myosin activity. This is likely to be important for directional cytoplasmic flow. We propose Pkn provides a negative feedback loop to help avoid excessive contractility after local activation of Rho GTPase. PMID:25131196

  17. Sonic hedgehog acts as a negative regulator of {beta}-catenin signaling in the adult tongue epithelium.


    Schneider, Fabian T; Schänzer, Anne; Czupalla, Cathrin J; Thom, Sonja; Engels, Knut; Schmidt, Mirko H H; Plate, Karl H; Liebner, Stefan


    Wnt/beta-catenin signaling has been implicated in taste papilla development; however, its role in epithelial maintenance and tumor progression in the adult tongue remains elusive. We show Wnt/beta-catenin pathway activation in reporter mice and by nuclear beta-catenin staining in the epithelium and taste papilla of adult mouse and human tongues. beta-Catenin activation in APC(min/+) mice, which carry a mutation in adenomatous poliposis coli (APC), up-regulates Sonic hedgehog (Shh) and Jagged-2 (JAG2) in the tongue epithelium without formation of squamous cell carcinoma (SCC). We demonstrate that Shh suppresses beta-catenin transcriptional activity in a signaling-dependent manner in vitro and in vivo. A similar regulation and function was observed for JAG2, suggesting that both pathways negatively regulate beta-catenin, thereby preventing SCC formation in the tongue. This was supported by reduced nuclear beta-catenin in the tongue epithelium of Patched(+/-) mice, exhibiting dominant active Shh signaling. At the invasive front of human tongue cancer, nuclear beta-catenin and Shh were increased, suggesting their participation in tumor progression. Interestingly, Shh but not JAG2 was able to reduce beta-catenin signaling in SCC cells, arguing for a partial loss of negative feedback on beta-catenin transcription in tongue cancer. We show for the first time that the putative Wnt/beta-catenin targets Shh and JAG2 control beta-catenin signaling in the adult tongue epithelium, a function that is partially lost in lingual SCC. PMID:20508033

  18. Liver X Receptor (LXR) activation negatively regulates visfatin expression in macrophages

    SciTech Connect

    Mayi, Therese Hervee; Rigamonti, Elena; Pattou, Francois; Staels, Bart; Chinetti-Gbaguidi, Giulia


    Research highlights: {yields} Synthetic LXR ligands decreased visfatin expression in human macrophages. {yields} LXR activation leads to a modest and transient decrease of NAD{sup +} concentration. {yields} LXR activation decreased PPAR{gamma}-induced visfatin in human macrophages. -- Abstract: Adipose tissue macrophages (ATM) are the major source of visfatin, a visceral fat adipokine upregulated during obesity. Also known to play a role in B cell differentiation (pre-B cell colony-enhancing factor (PBEF)) and NAD biosynthesis (nicotinamide phosphoribosyl transferase (NAMPT)), visfatin has been suggested to play a role in inflammation. Liver X Receptor (LXR) and Peroxisome Proliferator-Activated Receptor (PPAR){gamma} are nuclear receptors expressed in macrophages controlling the inflammatory response. Recently, we reported visfatin as a PPAR{gamma} target gene in human macrophages. In this study, we examined whether LXR regulates macrophage visfatin expression. Synthetic LXR ligands decreased visfatin gene expression in a LXR-dependent manner in human and murine macrophages. The decrease of visfatin mRNA was paralleled by a decrease of protein secretion. Consequently, a modest and transient decrease of NAD{sup +} concentration was observed. Interestingly, LXR activation decreased the PPAR{gamma}-induced visfatin gene and protein secretion in human macrophages. Our results identify visfatin as a gene oppositely regulated by the LXR and PPAR{gamma} pathways in human macrophages.

  19. Type 2C protein phosphatase ABI1 is a negative regulator of strawberry fruit ripening.


    Jia, Hai-Feng; Lu, Dong; Sun, Jing-Hua; Li, Chun-Li; Xing, Yu; Qin, Ling; Shen, Yuan-Yue


    Although a great deal of progress has been made toward understanding the role of abscisic acid (ABA) in fruit ripening, many components in the ABA signalling pathway remain to be elucidated. Here, a strawberry gene homologous to the Arabidopsis gene ABI1, named FaABI1, was isolated and characterized. The 1641bp cDNA includes an intact open reading frame that encodes a deduced protein of 546 amino acids, in which putative conserved domains were determined by homology analysis. Transcriptional analysis showed that the levels of FaABI1 mRNA expression declined rapidly during strawberry fruit development as evidenced by real-time PCR, semi-quantitative reverse transcription-PCR, and northern blotting analyses, suggesting that the Ser/Thr protein phosphatase PP2C1 encoded by FaABI1 may be involved in fruit ripening as a negative regulator. The results of Tobacco rattle virus-induced gene silencing and PBI121 vector-mediated overexpression suggested that the down- and up-regulation of FaABI1 mRNA expression levels in degreening strawberry fruit could promote and inhibit ripening, respectively. Furthermore, alteration of FaABI1 expression could differentially regulate the transcripts of a set of both ABA-responsive and ripening-related genes, including ABI3, ABI4, ABI5, SnRK2, ABRE1, CHS, PG1, PL, CHI, F3H, DFR, ANS, and UFGT. Taken together, the data provide new evidence for an important role for ABA in regulating strawberry fruit ripening in the processes of which the type 2C protein phosphatase ABI1 serves as a negative regulator. Finally, a possible core mechanism underlying ABA perception and signalling transduction in strawberry fruit ripening is discussed.

  20. Positive and negative regulation of T-cell activation through kinases and phosphatases.

    PubMed Central

    Mustelin, Tomas; Taskén, Kjetil


    The sequence of events in T-cell antigen receptor (TCR) signalling leading to T-cell activation involves regulation of a number of protein tyrosine kinases (PTKs) and the phosphorylation status of many of their substrates. Proximal signalling pathways involve PTKs of the Src, Syk, Csk and Tec families, adapter proteins and effector enzymes in a highly organized tyrosine-phosphorylation cascade. In intact cells, tyrosine phosphorylation is rapidly reversible and generally of a very low stoichiometry even under induced conditions due to the fact that the enzymes removing phosphate from tyrosine-phosphorylated substrates, the protein tyrosine phosphatases (PTPases), have a capacity that is several orders of magnitude higher than that of the PTKs. It follows that a relatively minor change in the PTK/PTPase balance can have a major impact on net tyrosine phosphorylation and thereby on activation and proliferation of T-cells. This review focuses on the involvement of PTKs and PTPases in positive and negative regulation of T-cell activation, the emerging theme of reciprocal regulation of each type of enzyme by the other, as well as regulation of phosphotyrosine turnover by Ser/Thr phosphorylation and regulation of localization of signal components. PMID:12485116

  1. Vector for regulated expression of cloned genes in a wide range of gram-negative bacteria.

    PubMed Central

    Mermod, N; Ramos, J L; Lehrbach, P R; Timmis, K N


    A pKT231-based broad-host-range plasmid vector was constructed which enabled regulation of expression of cloned genes in a wide range of gram-negative bacteria. This vector, pNM185, contained upstream of its EcoRI, SstI, and SstII cloning sites the positively activated pm twin promoters of the TOL plasmid and xylS, the gene of the positive regulator of these promoters. Expression of cloned genes was induced with micromolar quantities of benzoate or m-toluate, the inexpensive coinducers of the pm promoters. Expression of a test gene, xylE, which specifies catechol 2,3-dioxygenase, cloned in this vector was tested in representative strains of a variety of gram-negative bacteria. Regulated expression of xylE was observed in most strains examined, and induced levels of enzyme representing up to 5% of total cellular protein and ratios of induced:noninduced levels of enzyme up to a factor of 600 were observed. The level of xylE gene expression in different bacteria tended to be correlated with their phylogenetic distance from Pseudomonas putida. Images PMID:3525513

  2. Constitutive negative regulation in the processing of the anti-Müllerian hormone receptor II.


    Hirschhorn, Tal; di Clemente, Nathalie; Amsalem, Ayelet R; Pepinsky, R Blake; Picard, Jean-Yves; Smorodinsky, Nechama I; Cate, Richard L; Ehrlich, Marcelo


    The levels and intracellular localization of wild-type transforming growth factor β superfamily (TGFβ-SF) receptors are tightly regulated by endocytic trafficking, shedding and degradation. In contrast, a main regulatory mechanism of mutation-bearing receptors involves their intracellular retention. Anti-Müllerian hormone receptor II (AMHRII, also known as AMHR2) is the type-II receptor for anti-Müllerian hormone (AMH), a TGFβ-SF ligand that mediates Müllerian duct regression in males. Here, we studied AMHRII processing and identified novel mechanisms of its constitutive negative regulation. Immunoblot analysis revealed that a significant portion of AMHRII was missing most of its extracellular domain (ECD) and, although glycosylated, was unfolded and retained in the endoplasmic reticulum. Exogenous expression of AMHRII, but not of type-II TGF-β receptor (TβRII, also known as TGFR2), resulted in its disulfide-bond-mediated homo-oligomerization and intracellular retention, and in a decrease in its AMH-binding capacity. At the plasma membrane, AMHRII differed from TβRII, forming high levels of non-covalent homomeric complexes, which exhibited a clustered distribution and restricted lateral mobility. This study identifies novel mechanisms of negative regulation of a type-II TGFβ-SF receptor through cleavage, intracellular retention and/or promiscuous disulfide-bond mediated homo-oligomerization.

  3. The Arabidopsis Protein Phosphatase PP2C38 Negatively Regulates the Central Immune Kinase BIK1.


    Couto, Daniel; Niebergall, Roda; Liang, Xiangxiu; Bücherl, Christoph A; Sklenar, Jan; Macho, Alberto P; Ntoukakis, Vardis; Derbyshire, Paul; Altenbach, Denise; Maclean, Dan; Robatzek, Silke; Uhrig, Joachim; Menke, Frank; Zhou, Jian-Min; Zipfel, Cyril


    Plants recognize pathogen-associated molecular patterns (PAMPs) via cell surface-localized pattern recognition receptors (PRRs), leading to PRR-triggered immunity (PTI). The Arabidopsis cytoplasmic kinase BIK1 is a downstream substrate of several PRR complexes. How plant PTI is negatively regulated is not fully understood. Here, we identify the protein phosphatase PP2C38 as a negative regulator of BIK1 activity and BIK1-mediated immunity. PP2C38 dynamically associates with BIK1, as well as with the PRRs FLS2 and EFR, but not with the co-receptor BAK1. PP2C38 regulates PAMP-induced BIK1 phosphorylation and impairs the phosphorylation of the NADPH oxidase RBOHD by BIK1, leading to reduced oxidative burst and stomatal immunity. Upon PAMP perception, PP2C38 is phosphorylated on serine 77 and dissociates from the FLS2/EFR-BIK1 complexes, enabling full BIK1 activation. Together with our recent work on the control of BIK1 turnover, this study reveals another important regulatory mechanism of this central immune component. PMID:27494702

  4. Social anxiety and emotion regulation in daily life: spillover effects on positive and negative social events.


    Farmer, Antonina Savostyanova; Kashdan, Todd B


    To minimize the possibility of scrutiny, people with social anxiety difficulties exert great effort to manage their emotions, particularly during social interactions. We examined how the use of two emotion regulation strategies, emotion suppression and cognitive reappraisal, predict the generation of emotions and social events in daily life. Over 14 consecutive days, 89 participants completed daily diary entries on emotions, positive and negative social events, and their regulation of emotions. Using multilevel modeling, we found that when people high in social anxiety relied more on positive emotion suppression, they reported fewer positive social events and less positive emotion on the subsequent day. In contrast, people low in social anxiety reported fewer negative social events on days subsequent to using cognitive reappraisal to reduce distress; the use of cognitive reappraisal did not influence the daily lives of people high in social anxiety. Our findings support theories of emotion regulation difficulties associated with social anxiety. In particular, for people high in social anxiety, maladaptive strategy use contributed to diminished reward responsiveness. PMID:22428662

  5. The Arabidopsis Protein Phosphatase PP2C38 Negatively Regulates the Central Immune Kinase BIK1

    PubMed Central

    Liang, Xiangxiu; Bücherl, Christoph A.; Sklenar, Jan; Macho, Alberto P.; Ntoukakis, Vardis; Derbyshire, Paul; Altenbach, Denise; Robatzek, Silke; Uhrig, Joachim; Menke, Frank; Zhou, Jian-Min


    Plants recognize pathogen-associated molecular patterns (PAMPs) via cell surface-localized pattern recognition receptors (PRRs), leading to PRR-triggered immunity (PTI). The Arabidopsis cytoplasmic kinase BIK1 is a downstream substrate of several PRR complexes. How plant PTI is negatively regulated is not fully understood. Here, we identify the protein phosphatase PP2C38 as a negative regulator of BIK1 activity and BIK1-mediated immunity. PP2C38 dynamically associates with BIK1, as well as with the PRRs FLS2 and EFR, but not with the co-receptor BAK1. PP2C38 regulates PAMP-induced BIK1 phosphorylation and impairs the phosphorylation of the NADPH oxidase RBOHD by BIK1, leading to reduced oxidative burst and stomatal immunity. Upon PAMP perception, PP2C38 is phosphorylated on serine 77 and dissociates from the FLS2/EFR-BIK1 complexes, enabling full BIK1 activation. Together with our recent work on the control of BIK1 turnover, this study reveals another important regulatory mechanism of this central immune component. PMID:27494702

  6. SRFR1 Negatively Regulates Plant NB-LRR Resistance Protein Accumulation to Prevent Autoimmunity

    PubMed Central

    Li, Yingzhong; Li, Shuxin; Bi, Dongling; Cheng, Yu Ti; Li, Xin; Zhang, Yuelin


    Plant defense responses need to be tightly regulated to prevent auto-immunity, which is detrimental to growth and development. To identify negative regulators of Resistance (R) protein-mediated resistance, we screened for mutants with constitutive defense responses in the npr1-1 background. Map-based cloning revealed that one of the mutant genes encodes a conserved TPR domain-containing protein previously known as SRFR1 (SUPPRESSOR OF rps4-RLD). The constitutive defense responses in the srfr1 mutants in Col-0 background are suppressed by mutations in SNC1, which encodes a TIR-NB-LRR (Toll Interleukin1 Receptor-Nucleotide Binding-Leu-Rich Repeat) R protein. Yeast two-hybrid screens identified SGT1a and SGT1b as interacting proteins of SRFR1. The interactions between SGT1 and SRFR1 were further confirmed by co-immunoprecipitation analysis. In srfr1 mutants, levels of multiple NB-LRR R proteins including SNC1, RPS2 and RPS4 are increased. Increased accumulation of SNC1 is also observed in the sgt1b mutant. Our data suggest that SRFR1 functions together with SGT1 to negatively regulate R protein accumulation, which is required for preventing auto-activation of plant immunity. PMID:20862316

  7. Impact of physical maltreatment on the regulation of negative affect and aggression.


    Shackman, Jessica E; Pollak, Seth D


    Physically maltreated children are at risk for developing externalizing behavioral problems characterized by reactive aggression. The current experiment tested the relationships between individual differences in a neural index of social information processing, histories of child maltreatment, child negative affect, and aggressive behavior. Fifty boys (17 maltreated) performed an emotion recognition task while the P3b component of the event-related potential was recorded to index attention allocation to angry faces. Children then participated in a peer-directed aggression task. Negative affect was measured by recording facial electromyography, and aggression was indexed by the feedback that children provided to a putative peer. Physically maltreated children exhibited greater negative affect and more aggressive behavior, compared to nonmaltreated children, and this relationship was mediated by children's allocation of attention to angry faces. These data suggest that physical maltreatment leads to inappropriate regulation of both negative affect and aggression, which likely place maltreated children at increased risk for the development and maintenance of externalizing behavior disorders. PMID:24914736

  8. Impact of physical maltreatment on the regulation of negative affect and aggression.


    Shackman, Jessica E; Pollak, Seth D


    Physically maltreated children are at risk for developing externalizing behavioral problems characterized by reactive aggression. The current experiment tested the relationships between individual differences in a neural index of social information processing, histories of child maltreatment, child negative affect, and aggressive behavior. Fifty boys (17 maltreated) performed an emotion recognition task while the P3b component of the event-related potential was recorded to index attention allocation to angry faces. Children then participated in a peer-directed aggression task. Negative affect was measured by recording facial electromyography, and aggression was indexed by the feedback that children provided to a putative peer. Physically maltreated children exhibited greater negative affect and more aggressive behavior, compared to nonmaltreated children, and this relationship was mediated by children's allocation of attention to angry faces. These data suggest that physical maltreatment leads to inappropriate regulation of both negative affect and aggression, which likely place maltreated children at increased risk for the development and maintenance of externalizing behavior disorders.

  9. Impact of physical maltreatment on the regulation of negative affect and aggression

    PubMed Central



    Physically maltreated children are at risk for developing externalizing behavioral problems characterized by reactive aggression. The current experiment tested the relationships between individual differences in a neural index of social information processing, histories of child maltreatment, child negative affect, and aggressive behavior. Fifty boys (17 maltreated) performed an emotion recognition task while the P3b component of the event-related potential was recorded to index attention allocation to angry faces. Children then participated in a peer-directed aggression task. Negative affect was measured by recording facial electromyography, and aggression was indexed by the feedback that children provided to a putative peer. Physically maltreated children exhibited greater negative affect and more aggressive behavior, compared to nonmaltreated children, and this relationship was mediated by children’s allocation of attention to angry faces. These data suggest that physical maltreatment leads to inappropriate regulation of both negative affect and aggression, which likely place maltreated children at increased risk for the development and maintenance of externalizing behavior disorders. PMID:24914736

  10. Dynamin-2 is a novel NOS1β interacting protein and negative regulator in the collecting duct.


    Hyndman, Kelly A; Arguello, Alexandra M; Morsing, Sofia K H; Pollock, Jennifer S


    Nitric oxide synthase 1 (NOS1)-derived nitric oxide (NO) production in collecting ducts is critical for maintaining fluid-electrolyte balance. Rat collecting ducts express both the full-length NOS1α and its truncated variant NOS1β, while NOS1β predominates in mouse collecting ducts. We reported that dynamin-2 (DNM2), a protein involved in excising vesicles from the plasma membrane, and NOS1α form a protein-protein interaction that promotes NO production in rat collecting ducts. NOS1β was found to be highly expressed in human renal cortical/medullary samples; hence, we tested the hypothesis that DNM2 is a positive regulator of NOS1β-derived NO production. COS7 and mouse inner medullary collecting duct-3 (mIMCD3) cells were transfected with NOS1β and/or DNM2. Coimmunoprecipitation experiments show that NOS1β and DNM2 formed a protein-protein interaction. DNM2 overexpression decreased nitrite production (index of NO) in both COS7 and mIMCD-3 cells by 50-75%. mIMCD-3 cells treated with a panel of dynamin inhibitors or DNM2 siRNA displayed increased nitrite production. To elucidate the physiological significance of IMCD DNM2/NOS1β regulation in vivo, flox control and CDNOS1 knockout mice were placed on a high-salt diet, and freshly isolated IMCDs were treated acutely with a dynamin inhibitor. Dynamin inhibition increased nitrite production by IMCDs from flox mice. This response was blunted (but not abolished) in collecting duct-specific NOS1 knockout mice, suggesting that DNM2 also negatively regulates NOS3 in the mouse IMCD. We conclude that DNM2 is a novel negative regulator of NO production in mouse collecting ducts. We propose that DNM2 acts as a "break" to prevent excess or potentially toxic NO levels under high-salt conditions. PMID:26791826

  11. MiR-21 promoted proliferation and migration in hepatocellular carcinoma through negative regulation of Navigator-3

    SciTech Connect

    Wang, Zhipeng; Yang, Huan; Ren, Lei


    MicroRNA-21 (miR-21) has been well-established and found to be over-expressed in various human cancers and has been associated with hepatocellular carcinoma (HCC) progression. However, the underlying mechanism of miR-21 involvement in the development and progression of HCC remains to be understood. In the present study, we firstly identified that the Navigator-3 (NAV-3) gene as a novel direct target of miR-21. Knock-down of NAV-3 using shRNA can rescue the effects of anti-miR-21 inhibitor in HCC cell lines, whereas re-expression of miR-21 using transfection with miR-21 mimics phenocopied the NAV-3 knock-down model. Additionally, miR-21 levels inversely correlated with NAV-3 both in HCC cells and tissues. Knock-down of NAV-3 promoted both the proliferation and migration in HCC cells. Together, our findings suggest an important role for miR-21 in the progression of HCC, which negatively regulated Navigator-3 in the migration of HCC. - Highlights: • Navigator-3 (NAV-3) suppresses proliferation, migration and tumorigenesis of HCC cells. • NAV-3 was a novel target of miR-21. • MiR-21 negatively regulates NAV-3 in HCC.

  12. Unusual telomeric DNAs in human telomerase-negative immortalized cells.


    Nabetani, Akira; Ishikawa, Fuyuki


    A significant fraction of human cancer cells and immortalized cells maintain telomeres in a telomerase-independent manner called alternative lengthening of telomeres (ALT). It has been suggested that ALT involves homologous recombination that is expected to generate unique intermediate DNAs. However, the precise molecular mechanism of ALT is not known. To gain insight into how telomeric DNAs (T-DNAs) are maintained in ALT, we examined the physical structures of T-DNAs in ALT cells. We found abundant single-stranded regions in both G and C strands of T-DNAs. Moreover, two-dimensional gel electrophoreses and native in-gel hybridization analyses revealed novel ALT-specific single-stranded T-DNAs, in addition to previously reported t-circles. These newly identified ALT-specific T-DNAs include (i) the t-complex, which consists of highly branched T-DNAs with large numbers of internal single-stranded portions; (ii) ss-G, which consists of mostly linear single-G-strand T-DNAs; and (iii) ss-C, which consists of most likely circular single-C-strand T-DNAs. Cellular-DNA fractionation by the Hirt protocol revealed that t-circles and ss-G exist in ALT cells as extrachromosomal and chromatin-associated DNAs. We propose that such ALT-specific T-DNAs are produced by telomere metabolism specific to ALT, namely, homologous recombination and the rolling-circle replication mechanism.

  13. Regulation of gene expression in human tendinopathy

    PubMed Central


    Background Chronic tendon injuries, also known as tendinopathies, are common among professional and recreational athletes. These injuries result in a significant amount of morbidity and health care expenditure, yet little is known about the molecular mechanisms leading to tendinopathy. Methods We have used histological evaluation and molecular profiling to determine gene expression changes in 23 human patients undergoing surgical procedures for the treatment of chronic tendinopathy. Results Diseased tendons exhibit altered extracellular matrix, fiber disorientation, increased cellular content and vasculature, and the absence of inflammatory cells. Global gene expression profiling identified 983 transcripts with significantly different expression patterns in the diseased tendons. Global pathway analysis further suggested altered expression of extracellular matrix proteins and the lack of an appreciable inflammatory response. Conclusions Identification of the pathways and genes that are differentially regulated in tendinopathy samples will contribute to our understanding of the disease and the development of novel therapeutics. PMID:21539748

  14. Human body temperature - Its measurement and regulation

    SciTech Connect

    Houdas, Y.; Ring, E.F.J.


    The terminology used in thermal physiology is examined, and principles of heat transfer are discussed, taking into account heat quantity, heat flux, temperature, pressure, quantities used in physiology, a number of common definitions, the equivalence between different forms of energy, the release of potential energy in living tissues, heat transfer without change of state, and heat transfer with change of state. Temperature and humidity measurement are considered along with man and his environment, the temperature distribution in the systems and tracts of the human body, physiological changes affecting the temperature distribution, problems of temperature regulation, questions of heat loss and conservation, acclimatization to heat and cold, and disorders of thermoregulation. Attention is given to possible thermal imaging applications, causes of temperature irregularities in the head and neck, common causes of increased temperatures of upper limbs, and thermography in disease. 193 references.

  15. Neuronal Nogo-A negatively regulates dendritic morphology and synaptic transmission in the cerebellum

    PubMed Central

    Petrinovic, Marija M.; Hourez, Raphael; Aloy, Elisabeth M.; Dewarrat, Gregoire; Gall, David; Weinmann, Oliver; Gaudias, Julien; Bachmann, Lukas C.; Schiffmann, Serge N.; Vogt, Kaspar E.; Schwab, Martin E.


    Neuronal signal integration as well as synaptic transmission and plasticity highly depend on the morphology of dendrites and their spines. Nogo-A is a membrane protein enriched in the adult central nervous system (CNS) myelin, where it restricts the capacity of axons to grow and regenerate after injury. Nogo-A is also expressed by certain neurons, in particular during development, but its physiological function in this cell type is less well understood. We addressed this question in the cerebellum, where Nogo-A is transitorily highly expressed in the Purkinje cells (PCs) during early postnatal development. We used general genetic ablation (KO) as well as selective overexpression of Nogo-A in PCs to analyze its effect on dendritogenesis and on the formation of their main input synapses from parallel (PFs) and climbing fibers (CFs). PC dendritic trees were larger and more complex in Nogo-A KO mice and smaller than in wild-type in Nogo-A overexpressing PCs. Nogo-A KO resulted in premature soma-to-dendrite translocation of CFs and an enlargement of the CF territory in the molecular layer during development. Although spine density was not influenced by Nogo-A, the size of postsynaptic densities of PF–PC synapses was negatively correlated with the Nogo-A expression level. Electrophysiological studies revealed that Nogo-A negatively regulates the strength of synaptic transmission at the PF–PC synapse. Thus, Nogo-A appears as a negative regulator of PC input synapses, which orchestrates cerebellar connectivity through regulation of synapse morphology and the size of the PC dendritic tree. PMID:23277570

  16. Dietary Methanol Regulates Human Gene Activity

    PubMed Central

    Komarova, Tatiana V.; Sheshukova, Ekaterina V.; Kosorukov, Vyacheslav S.; Kiryanov, Gleb I.; Dorokhov, Yuri L.


    Methanol (MeOH) is considered to be a poison in humans because of the alcohol dehydrogenase (ADH)-mediated conversion of MeOH to formaldehyde (FA), which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC) from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD). There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling. PMID:25033451

  17. Integrative regulation of human brain blood flow

    PubMed Central

    Willie, Christopher K; Tzeng, Yu-Chieh; Fisher, Joseph A; Ainslie, Philip N


    Herein, we review mechanisms regulating cerebral blood flow (CBF), with specific focus on humans. We revisit important concepts from the older literature and describe the interaction of various mechanisms of cerebrovascular control. We amalgamate this broad scope of information into a brief review, rather than detailing any one mechanism or area of research. The relationship between regulatory mechanisms is emphasized, but the following three broad categories of control are explicated: (1) the effect of blood gases and neuronal metabolism on CBF; (2) buffering of CBF with changes in blood pressure, termed cerebral autoregulation; and (3) the role of the autonomic nervous system in CBF regulation. With respect to these control mechanisms, we provide evidence against several canonized paradigms of CBF control. Specifically, we corroborate the following four key theses: (1) that cerebral autoregulation does not maintain constant perfusion through a mean arterial pressure range of 60–150 mmHg; (2) that there is important stimulatory synergism and regulatory interdependence of arterial blood gases and blood pressure on CBF regulation; (3) that cerebral autoregulation and cerebrovascular sensitivity to changes in arterial blood gases are not modulated solely at the pial arterioles; and (4) that neurogenic control of the cerebral vasculature is an important player in autoregulatory function and, crucially, acts to buffer surges in perfusion pressure. Finally, we summarize the state of our knowledge with respect to these areas, outline important gaps in the literature and suggest avenues for future research. PMID:24396059

  18. The Emerging Regulation of VEGFR-2 in Triple-Negative Breast Cancer

    PubMed Central

    Zhu, Xiaoxia; Zhou, Wen


    Vascular endothelial growth factor-A (VEGF) signals vascular development and angiogenesis mainly by binding to VEGF receptor family member 2 (VEGFR-2). Adaptor proteins mediate many VEGFR-2’s functions in the development of blood vessels. Cancer cells secrete VEGF to activate VEGFR-2 pathway in their neighboring endothelial cells in the process of cancer-related angiogenesis. Interestingly, activation of VEGFR-2 signaling is found in breast cancer cells, but its role and regulation are not clear. We highlighted research advances of VEGFR-2, with a focus on VEGFR-2’s regulation by mutant p53 in breast cancer. In addition, we reviewed recent Food and Drug Administration-approved tyrosine kinase inhibitor drugs that can inhibit the function of VEGFR-2. Ongoing preclinical and clinical studies might prove that pharmaceutically targeting VEGFR-2 could be an effective therapeutic strategy in treating triple-negative breast cancer. PMID:26500608

  19. Antennally mediated negative feedback regulation of pheromone production in the pine engraver beetle, Ips pini

    NASA Astrophysics Data System (ADS)

    Ginzel, Matthew D.; Bearfield, Jeremy C.; Keeling, Christopher I.; McCormack, Colin C.; Blomquist, Gary J.; Tittiger, Claus


    Bark beetles use monoterpenoid aggregation pheromones to coordinate host colonization and mating. These chemical signals are produced de novo in midgut cells via the mevalonate pathway, and pheromone production may be regulated by a negative feedback system mediated through the antennae. In this study, we explored the effect of antennectomy on pheromone production and transcript levels of key mevalonate pathway genes in juvenile hormone III-treated male pine engraver beetles, Ips pini (Say). Antennectomized males produced significantly greater amounts of pheromone than podectomized males and those with intact antennae. Likewise, mRNA levels of three mevalonate pathway genes important in pheromone biosynthesis were measured by quantitative real-time PCR and found to be induced to a greater extent with antennectomy, suggesting a transcriptional regulation of pheromone production.

  20. CD45 negatively regulates tumour necrosis factor and interleukin-6 production in dendritic cells.


    Piercy, Jenny; Petrova, Svetla; Tchilian, Elma Z; Beverley, Peter C L


    CD45 is known to regulate signalling through many different surface receptors in diverse haemopoietic cell types. Here we report for the first time that CD45-/- bone marrow dendritic cells (BMDC) are more activated than CD45+/+ cells and that tumour necrosis factor (TNF) and interleukin-6 (IL-6) production by BMDC and splenic dendritic cells (sDC), is increased following stimulation via Toll-like receptor (TLR)3 and TLR9. Nuclear factor-kappaB activation, an important downstream consequence of TLR3 and TLR9 signalling, is also increased in CD45-/- BMDC. BMDC of CD45-/- mice also produce more TNF and IL-6 following stimulation with the cytokines TNF and interferon-alpha. These results show that TLR signalling is increased in CD45-/- dendritic cells and imply that CD45 is a negative regulator of TLR and cytokine receptor signalling in dendritic cells. PMID:16771860

  1. Anaplastic Lymphoma Kinase Acts in the Drosophila Mushroom Body to Negatively Regulate Sleep.


    Bai, Lei; Sehgal, Amita


    Though evidence is mounting that a major function of sleep is to maintain brain plasticity and consolidate memory, little is known about the molecular pathways by which learning and sleep processes intercept. Anaplastic lymphoma kinase (Alk), the gene encoding a tyrosine receptor kinase whose inadvertent activation is the cause of many cancers, is implicated in synapse formation and cognitive functions. In particular, Alk genetically interacts with Neurofibromatosis 1 (Nf1) to regulate growth and associative learning in flies. We show that Alk mutants have increased sleep. Using a targeted RNAi screen we localized the negative effects of Alk on sleep to the mushroom body, a structure important for both sleep and memory. We also report that mutations in Nf1 produce a sexually dimorphic short sleep phenotype, and suppress the long sleep phenotype of Alk. Thus Alk and Nf1 interact in both learning and sleep regulation, highlighting a common pathway in these two processes. PMID:26536237

  2. TRIM13 Is a Negative Regulator of MDA5-Mediated Type I Interferon Production

    PubMed Central

    Narayan, Kavitha; Waggoner, Lisa; Pham, Serena T.; Hendricks, Gabriel L.; Waggoner, Stephen N.; Conlon, Joseph; Wang, Jennifer P.


    ABSTRACT Retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5) are essential intracellular detectors of viral RNA. They contribute to the type I interferon (IFN) response that is crucial for host defense against viral infections. Given the potent antiviral and proinflammatory activities elicited by the type I IFNs, induction of the type I IFN response is tightly regulated. Members of the tripartite motif (TRIM) family of proteins have recently emerged as key regulators of antiviral immunity. We show that TRIM13, an E3 ubiquitin ligase, is expressed in immune cells and is upregulated in bone marrow-derived macrophages upon stimulation with inducers of type I IFN. TRIM13 interacts with MDA5 and negatively regulates MDA5-mediated type I IFN production in vitro, acting upstream of IFN regulatory factor 3. We generated Trim13−/− mice and show that upon lethal challenge with encephalomyocarditis virus (EMCV), which is sensed by MDA5, Trim13−/− mice produce increased amounts of type I IFNs and survive longer than wild-type mice. Trim13−/− murine embryonic fibroblasts (MEFs) challenged with EMCV or poly(I·C) also show a significant increase in beta IFN (IFN-β) levels, but, in contrast, IFN-β responses to the RIG-I-detected Sendai virus were diminished, suggesting that TRIM13 may play a role in positively regulating RIG-I function. Together, these results demonstrate that TRIM13 regulates the type I IFN response through inhibition of MDA5 activity and that it functions nonredundantly to modulate MDA5 during EMCV infection. IMPORTANCE The type I interferon (IFN) response is crucial for host defense against viral infections, and proper regulation of this pathway contributes to maintaining immune homeostasis. Retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5) are intracellular detectors of viral RNA that induce the type I IFN response. In this study, we show that expression of the

  3. Sck1 negatively regulates Gpa2-mediated glucose signaling in Schizosaccharomyces pombe.


    Mudge, Dayna K; Yang, Fan; Currie, Brian M; Kim, James M; Yeda, Kelly; Bashyakarla, Varoon K; Ivey, F Douglas; Hoffman, Charles S


    Schizosaccharomyces pombe detects extracellular glucose via a G protein-mediated cyclic AMP (cAMP)-signaling pathway activating protein kinase A (PKA) and regulating transcription of genes involved in metabolism and sexual development. In this pathway, Gpa2 Gα binds to and activates adenylyl cyclase in response to glucose detection by the Git3 G protein-coupled receptor. Using a two-hybrid screen to identify extrinsic regulators of Gpa2, we isolated a clone that expresses codons 471 to 696 of the Sck1 kinase, which appears to display a higher affinity for Gpa2(K270E)-activated Gα relative to Gpa2(+) Gα. Deletion of sck1(+) or mutational inactivation of the Sck1 kinase produces phenotypes reflecting increased PKA activity in strains expressing Gpa2(+) or Gpa2(K270E), suggesting that Sck1 negatively regulates PKA activation through Gpa2. In contrast to the Gpa2(K270E) GDP-GTP exchange rate mutant, GTPase-defective Gpa2(R176H) weakly binds Sck1 in the two-hybrid screen and a deletion of sck1(+) in a Gpa2(R176H) strain confers phenotypes consistent with a slight reduction in PKA activity. Finally, deleting sck1(+) in a gpa2Δ strain results in phenotypes consistent with a second role for Sck1 acting in parallel with PKA. In addition to this parallel role with PKA, our data suggest that Sck1 negatively regulates Gpa2, possibly targeting the nucleotide-free form of the protein that may expose the one and only AKT/PKB consensus site in Gpa2 for Sck1 to bind. This dual role for Sck1 may allow S. pombe to produce distinct biological responses to glucose and nitrogen starvation signals that both activate the Wis1-Spc1/StyI stress-activated protein kinase (SAPK) pathway.

  4. Penta-EF-Hand Protein Peflin Is a Negative Regulator of ER-To-Golgi Transport

    PubMed Central

    Held, Aaron; Sargeant, John; Thorsen, Kevin; Hay, Jesse C.


    Luminal calcium regulates vesicle transport early in the secretory pathway. In ER-to-Golgi transport, depletion of luminal calcium leads to significantly reduced transport and a buildup of budding and newly budded COPII vesicles and vesicle proteins. Effects of luminal calcium on transport may be mediated by cytoplasmic calcium sensors near ER exits sites (ERES). The penta-EF-hand (PEF) protein apoptosis-linked gene 2 (ALG-2) stabilizes sec31A at ER exit sites (ERES) and promotes the assembly of inner and outer shell COPII components. However, in vitro and intact cell approaches have not determined whether ALG-2 is a negative or positive regulator, or a regulator at all, under basal physiological conditions. ALG-2 interacts with another PEF protein, peflin, to form cytosolic heterodimers that dissociate in response to calcium. However, a biological function for peflin has not been demonstrated and whether peflin and the ALG-2/peflin interaction modulates transport has not been investigated. Using an intact, single cell, morphological assay for ER-to-Golgi transport in normal rat kidney (NRK) cells, we found that depletion of peflin using siRNA resulted in significantly faster transport of the membrane cargo VSV-G. Double depletion of peflin and ALG-2 blocked the increased transport resulting from peflin depletion, demonstrating a role for ALG-2 in the increased transport. Furthermore, peflin depletion caused increased targeting of ALG-2 to ERES and increased ALG-2/sec31A interactions, suggesting that peflin may normally inhibit transport by preventing ALG-2/sec31A interactions. This work identifies for the first time a clear steady state role for a PEF protein in ER-to-Golgi transport—peflin is a negative regulator of transport. PMID:27276012

  5. Importin beta negatively regulates nuclear membrane fusion and nuclear pore complex assembly.


    Harel, Amnon; Chan, Rene C; Lachish-Zalait, Aurelie; Zimmerman, Ella; Elbaum, Michael; Forbes, Douglass J


    Assembly of a eukaryotic nucleus involves three distinct events: membrane recruitment, fusion to form a double nuclear membrane, and nuclear pore complex (NPC) assembly. We report that importin beta negatively regulates two of these events, membrane fusion and NPC assembly. When excess importin beta is added to a full Xenopus nuclear reconstitution reaction, vesicles are recruited to chromatin but their fusion is blocked. The importin beta down-regulation of membrane fusion is Ran-GTP reversible. Indeed, excess RanGTP (RanQ69L) alone stimulates excessive membrane fusion, leading to intranuclear membrane tubules and cytoplasmic annulate lamellae-like structures. We propose that a precise balance of importin beta to Ran is required to create a correct double nuclear membrane and simultaneously to repress undesirable fusion events. Interestingly, truncated importin beta 45-462 allows membrane fusion but produces nuclei lacking any NPCs. This reveals distinct importin beta-regulation of NPC assembly. Excess full-length importin beta and beta 45-462 act similarly when added to prefused nuclear intermediates, i.e., both block NPC assembly. The importin beta NPC block, which maps downstream of GTPgammaS and BAPTA-sensitive steps in NPC assembly, is reversible by cytosol. Remarkably, it is not reversible by 25 microM RanGTP, a concentration that easily reverses fusion inhibition. This report, using a full reconstitution system and natural chromatin substrates, significantly expands the repertoire of importin beta. Its roles now encompass negative regulation of two of the major events of nuclear assembly: membrane fusion and NPC assembly.

  6. Rapid estrogen signaling negatively regulates PTEN activity through phosphorylation in endometrial cancer cells

    PubMed Central

    Scully, Melanie M.; Palacios-Helgeson, Leslie K.; Wah, Lah S.; Jackson, Twila A.


    Hyperestrogenicity is a risk factor for endometrial cancer. 17β-estradiol (E2) is known to stimulate both genomic and nongenomic estrogen receptor-α (ERα) actions in a number of reproductive tissues. However, the contributions of transcription-independent ERα signaling on normal and malignant endometrium are not fully understood. Phosphatase and tensin homolog (PTEN) is a tumor suppressor that decreases cellular mitosis primarily through negative regulation of the phosphoinositide 3-kinase/AKT signaling axis. PTEN levels are elevated during the E2 dominated, mitotically active, proliferative phase of the menstrual cycle, indicating possible hormonal regulation of PTEN in the uterus. In order to determine if rapid E2 signaling regulates PTEN, we used ERα positive, PTEN positive, endometrial cells. We show that cytosolic E2/ERα signaling leads to increased phosphorylation of PTEN at key regulatory residues. Importantly, E2 stimulation decreased PTEN lipid phosphatase activity and caused consequent increases in phospho-AKT. We further demonstrate that cytosolic ERα forms a complex with PTEN in an E2-dependent manner, and that ERα constitutively complexes with protein kinase2-α (CK2α), a kinase previously shown to phosphorylate the C-terminal tail of PTEN. These results provide mechanistic support for an E2-dependent, ERα cytosolic signaling complex that negatively regulates PTEN activity through carboxy terminus phosphorylation. Using an animal model, we show that sustained E2 signaling results in increased phospho-PTEN (S380, T382, T383), total PTEN and phospho-AKT (S473). Taken together, we provide a novel mechanism in which transcription-independent E2/ERα signaling may promote a pro-tumorigenic environment in the endometrium. PMID:24844349

  7. The R3-MYB Gene GhCPC Negatively Regulates Cotton Fiber Elongation

    PubMed Central

    Liu, Bingliang; Zhu, Yichao; Zhang, Tianzhen


    Cotton (Gossypium spp.) fibers are single-cell trichomes that arise from the outer epidermal layer of seed coat. Here, we isolated a R3-MYB gene GhCPC, identified by cDNA microarray analysis. The only conserved R3 motif and different expression between TM-1 and fuzzless-lintless mutants suggested that it might be a negative regulator in fiber development. Transgenic evidence showed that GhCPC overexpression not only delayed fiber initiation but also led to significant decreases in fiber length. Interestingly, Yeast two-hybrid analysis revealed an interaction complex, in which GhCPC and GhTTG1/4 separately interacted with GhMYC1. In transgenic plants, Q-PCR analysis showed that GhHOX3 (GL2) and GhRDL1 were significantly down regulated in −1–5 DPA ovules and fibers. In addition, Yeast one-hybrid analysis demonstrated that GhMYC1 could bind to the E-box cis-elements and the promoter of GhHOX3. These results suggested that GhHOX3 (GL2) might be downstream gene of the regulatory complex. Also, overexpression of GhCPC in tobacco led to differential loss of pigmentation. Taken together, the results suggested that GhCPC might negatively regulate cotton fiber initiation and early elongation by a potential CPC-MYC1-TTG1/4 complex. Although the fibers were shorter in transgenic cotton lines than in the wild type, no significant difference was detected in stem or leaf trichomes, even in cotton mutants (five naked seed or fuzzless), suggesting that fiber and trichome development might be regulated by two sets of genes sharing a similar model. PMID:25646816

  8. Regulating the use of human bodily material.


    Skene, Loane


    The articles in this special issue consider recent developments in the law regulating the use of human bodily material and the wider implications of those developments. For some time, the law has accepted that a person who has undertaken "work and skill" on excised bodily material may obtain at least a possessory right; but the person from whom the material came did not have such a right. Now, however, the law has recognised that people may have some legal rights regarding their own bodily material. What is the nature and source of those rights? Should they be expanded? If so, what legal principles are best to do that? The most frequent suggestion is the law of property but many other areas of law are also relevant: the law of contract; tort (bailment and consent); criminal law (e.g., forensic testing); gifts; custodianship and others. These regulatory options are outlined in this editorial and discussed by lawyers and other contributors in their articles in this special issue. There are also stimulating philosophical reflections on the nature of human bodily material.

  9. Retinoic acid negatively regulates dact3b expression in the hindbrain of zebrafish embryos

    PubMed Central

    Mandal, Amrita; Waxman, Joshua


    Wnt signaling plays important roles in normal development as well as pathophysiological conditions. The Dapper antagonist of β-catenin (Dact) proteins are modulators of both canonical and non-canonical Wnt signaling via direct interactions with Dishevelled (Dvl) and Van Gogh like-2 (Vangl2). Here, we report the dynamic expression patterns of two zebrafish dact3 paralogs during early embryonic development. Our whole mount in situ hybridization (WISH) analysis indicates that specific dact3a expression starts by the tailbud stage in adaxial cells. Later, it is expressed in the anterior lateral plate mesoderm, somites, migrating cranial neural crest, and hindbrain neurons. By comparison, dact3b expression initiates on the dorsal side at the dome stage and soon after is expressed in the dorsal forerunner cells (DFCs) during gastrulation. At later stages, dact3b expression becomes restricted to the branchial neurons of the hindbrain and to the 2nd pharyngeal arch. To investigate how zebrafish dact3 gene expression is regulated, we manipulated retinoic acid (RA) signaling during development and found it negatively regulates dact3b in the hindbrain. Our study is the first to document the expression of the paralogous zebrafish dact3 genes during early development and demonstrate dact3b can be regulated by RA signaling. Therefore, our study opens up new avenues to study Dact3 function in the development of multiple tissues and suggests a previously unappreciated cross regulation of Wnt signaling by RA signaling in the developing vertebrate hindbrain. PMID:25266145

  10. Vitamin D receptor negatively regulates bacterial-stimulated NF-kappaB activity in intestine.


    Wu, Shaoping; Liao, Anne P; Xia, Yinglin; Li, Yan Chun; Li, Jian-Dong; Sartor, R Balfour; Sun, Jun


    Vitamin D receptor (VDR) plays an essential role in gastrointestinal inflammation. Most investigations have focused on the immune response; however, how bacteria regulate VDR and how VDR modulates the nuclear factor (NF)-kappaB pathway in intestinal epithelial cells remain unexplored. This study investigated the effects of VDR ablation on NF-kappaB activation in intestinal epithelia and the role of enteric bacteria on VDR expression. We found that VDR(-/-) mice exhibited a pro-inflammatory bias. After Salmonella infection, VDR(-/-) mice had increased bacterial burden and mortality. Serum interleukin-6 in noninfected VDR(+/+) mice was undetectable, but was easily detectable in VDR(-/-) mice. NF-kappaB p65 formed a complex with VDR in noninfected wild-type mouse intestine. In contrast, deletion of VDR abolished VDR/P65 binding. P65 nuclear translocation occurred in colonic epithelial cells of untreated VDR(-/-) mice. VDR deletion also elevated NF-kappaB activity in intestinal epithelia. VDR was localized to the surface epithelia of germ-free mice, but to crypt epithelial cells in conventionalized mice. VDR expression, distribution, transcriptional activity, and target genes were regulated by Salmonella stimulation, independent of 1,25-dihydroxyvitamin D3. Our study demonstrates that commensal and pathogenic bacteria directly regulate colonic epithelial VDR expression and location in vivo. VDR negatively regulates bacterial-induced intestinal NF-kappaB activation and attenuates response to infection. Therefore, VDR is an important contributor to intestinal homeostasis and host protection from bacterial invasion and infection.

  11. Constitutive Negative Regulation of R Proteins in Arabidopsis also via Autophagy Related Pathway?

    PubMed Central

    Pečenková, Tamara; Sabol, Peter; Kulich, Ivan; Ortmannová, Jitka; Žárský, Viktor


    Even though resistance (R) genes are among the most studied components of the plant immunity, there remain still a lot of aspects to be explained about the regulation of their function. Many gain-of-function mutants of R genes and loss-of-function of their regulators often demonstrate up-regulated defense responses in combination with dwarf stature and/or spontaneous leaf lesions formation. For most of these mutants, phenotypes are a consequence of an ectopic activation of R genes. Based on the compilation and comparison of published results in this field, we have concluded that the constitutively activated defense phenotypes recurrently arise by disruption of tight, constitutive and multilevel negative control of some of R proteins that might involve also their targeting to the autophagy pathway. This mode of R protein regulation is supported also by protein–protein interactions listed in available databases, as well as in silico search for autophagy machinery interacting motifs. The suggested model could resolve some explanatory discrepancies found in the studies of the immunity responses of autophagy mutants. PMID:26973696

  12. MicroRNA-203 negatively regulates c-Abl, ERK1/2 phosphorylation, and proliferation in smooth muscle cells.


    Liao, Guoning; Panettieri, Reynold A; Tang, Dale D


    The nonreceptor tyrosine kinase c-Abl has a role in regulating smooth muscle cell proliferation, which contributes to the development of airway remodeling in chronic asthma. MicroRNAs (miRs) are small noncoding RNA molecules that regulate gene expression by binding to complementary sequences in the 3' untranslated regions (3' UTR) of target mRNAs. Previous analysis suggests that miR-203 is able to bind to the 3' UTR of human c-Abl mRNA. In this report, treatment with miR-203 attenuated the expression of c-Abl mRNA and protein in human airway smooth muscle (HASM) cells. Furthermore, transfection with an miR-203 inhibitor enhanced the expression of c-Abl at mRNA and protein levels in HASM cells. Treatment with platelet-derived growth factor (PDGF) induced the proliferation and ERK1/2 phosphorylation in HASM cells. Exposure to miR-203 attenuated the PDGF-stimulated proliferation and ERK1/2 phosphorylation in HASM cells. The expression of c-Abl at protein and mRNA levels was higher in asthmatic HASM cells, whereas the level of miR-203 was reduced in asthmatic HASM cells as compared to control HASM cells. Taken together, our present results suggest that miR-203 is a negative regulator of c-Abl expression in smooth muscle cells. miR-203 regulates smooth muscle cell proliferation by controlling c-Abl expression, which in turn modulates the activation of ERK1/2.

  13. A Scan for Human-Specific Relaxation of Negative Selection Reveals Unexpected Polymorphism in Proteasome Genes

    PubMed Central

    Somel, Mehmet; Wilson Sayres, Melissa A.; Jordan, Gregory; Huerta-Sanchez, Emilia; Fumagalli, Matteo; Ferrer-Admetlla, Anna; Nielsen, Rasmus


    Environmental or genomic changes during evolution can relax negative selection pressure on specific loci, permitting high frequency polymorphisms at previously conserved sites. Here, we jointly analyze population genomic and comparative genomic data to search for functional processes showing relaxed negative selection specifically in the human lineage, whereas remaining evolutionarily conserved in other mammals. Consistent with previous studies, we find that olfactory receptor genes display such a signature of relaxation in humans. Intriguingly, proteasome genes also show a prominent signal of human-specific relaxation: multiple proteasome subunits, including four members of the catalytic core particle, contain high frequency nonsynonymous polymorphisms at sites conserved across mammals. Chimpanzee proteasome genes do not display a similar trend. Human proteasome genes also bear no evidence of recent positive or balancing selection. These results suggest human-specific relaxation of negative selection in proteasome subunits; the exact biological causes, however, remain unknown. PMID:23699470

  14. BMX Negatively Regulates BAK Function, Thereby Increasing Apoptotic Resistance to Chemotherapeutic Drugs.


    Fox, Joanna L; Storey, Alan


    The ability of chemotherapeutic agents to induce apoptosis, predominantly via the mitochondrial (intrinsic) apoptotic pathway, is thought to be a major determinant of the sensitivity of a given cancer to treatment. Intrinsic apoptosis, regulated by the BCL2 family, integrates diverse apoptotic signals to determine cell death commitment and then activates the nodal effector protein BAK to initiate the apoptotic cascade. In this study, we identified the tyrosine kinase BMX as a direct negative regulator of BAK function. BMX associates with BAK in viable cells and is the first kinase to phosphorylate the key tyrosine residue needed to maintain BAK in an inactive conformation. Importantly, elevated BMX expression prevents BAK activation in tumor cells treated with chemotherapeutic agents and is associated with increased resistance to apoptosis and decreased patient survival. Accordingly, BMX expression was elevated in prostate, breast, and colon cancers compared with normal tissue, including in aggressive triple-negative breast cancers where BMX overexpression may be a novel biomarker. Furthermore, BMX silencing potentiated BAK activation, rendering tumor cells hypersensitive to otherwise sublethal doses of clinically relevant chemotherapeutic agents. Our finding that BMX directly inhibits a core component of the intrinsic apoptosis machinery opens opportunities to improve the efficacy of existing chemotherapy by potentiating BAK-driven cell death in cancer cells. PMID:25649765

  15. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression

    NASA Astrophysics Data System (ADS)

    Makino, Yuichi; Cao, Renhai; Svensson, Kristian; Bertilsson, Göran; Asman, Mikael; Tanaka, Hirotoshi; Cao, Yihai; Berkenstam, Anders; Poellinger, Lorenz


    Alteration of gene expression is a crucial component of adaptive responses to hypoxia. These responses are mediated by hypoxia-inducible transcription factors (HIFs). Here we describe an inhibitory PAS (Per/Arnt/Sim) domain protein, IPAS, which is a basic helix-loop-helix (bHLH)/PAS protein structurally related to HIFs. IPAS contains no endogenous transactivation function but demonstrates dominant negative regulation of HIF-mediated control of gene expression. Ectopic expression of IPAS in hepatoma cells selectively impairs induction of genes involved in adaptation to a hypoxic environment, notably the vascular endothelial growth factor (VEGF) gene, and results in retarded tumour growth and tumour vascular density in vivo. In mice, IPAS was predominantly expressed in Purkinje cells of the cerebellum and in corneal epithelium of the eye. Expression of IPAS in the cornea correlates with low levels of expression of the VEGF gene under hypoxic conditions. Application of an IPAS antisense oligonucleotide to the mouse cornea induced angiogenesis under normal oxygen conditions, and demonstrated hypoxia-dependent induction of VEGF gene expression in hypoxic corneal cells. These results indicate a previously unknown mechanism for negative regulation of angiogenesis and maintenance of an avascular phenotype.

  16. High mobility group protein DSP1 negatively regulates HSP70 transcription in Crassostrea hongkongensis.


    Miao, Zongyu; Xu, Delin; Cui, Miao; Zhang, Qizhong


    HSP70 acts mostly as a molecular chaperone and plays important roles in facilitating the folding of nascent peptides as well as the refolding or degradation of the denatured proteins. Under stressed conditions, the expression level of HSP70 is upregulated significantly and rapidly, as is known to be achieved by various regulatory factors controlling the transcriptional level. In this study, a high mobility group protein DSP1 was identified by DNA-affinity purification from the nuclear extracts of Crassostrea hongkongensis using the ChHSP70 promoter as a bait. The specific interaction between the prokaryotically expressed ChDSP1 and the FITC-labeled ChHSP70 promoter was confirmed by EMSA analysis. ChDSP1 was shown to negatively regulate ChHSP70 promoter expression by Luciferase Reporter Assay in the heterologous HEK293T cells. Both ChHSP70 and ChDSP1 transcriptions were induced by either thermal or CdCl2 stress, while the accumulated expression peaks of ChDSP1 were always slightly delayed when compared with that of ChHSP70. This indicates that ChDSP1 is involved, very likely to exert its suppressive role, in the recovery of the ChHSP70 expression from the induced level to its original state. This study is the first to report negative regulator of HSP70 gene transcription, and provides novel insights into the mechanisms controlling heat shock protein expression. PMID:27154224

  17. The Histidine Kinase BinK Is a Negative Regulator of Biofilm Formation and Squid Colonization

    PubMed Central

    Brooks, John F.


    ABSTRACT Bacterial colonization of animal epithelial tissue is a dynamic process that relies on precise molecular communication. Colonization of Euprymna scolopes bobtail squid by Vibrio fischeri bacteria requires bacterial aggregation in host mucus as the symbiont transitions from a planktonic lifestyle in seawater to a biofilm-associated state in the host. We have identified a gene, binK (biofilm inhibitor kinase; VF_A0360), which encodes an orphan hybrid histidine kinase that negatively regulates the V. fischeri symbiotic biofilm (Syp) in vivo and in vitro. We identified binK mutants as exhibiting a colonization advantage in a global genetic screen, a phenotype that we confirmed in controlled competition experiments. Bacterial biofilm aggregates in the host are larger in strains lacking BinK, whereas overexpression of BinK suppresses biofilm formation and squid colonization. Signaling through BinK is required for temperature modulation of biofilm formation at 28°C. Furthermore, we present evidence that BinK acts upstream of SypG, the σ54-dependent transcriptional regulator of the syp biofilm locus. The BinK effects are dependent on intact signaling in the RscS-Syp biofilm pathway. Therefore, we propose that BinK antagonizes the signal from RscS and serves as an integral component in V. fischeri biofilm regulation. IMPORTANCE Bacterial lifestyle transitions underlie the colonization of animal hosts from environmental reservoirs. Formation of matrix-enclosed, surface-associated aggregates (biofilms) is common in beneficial and pathogenic associations, but investigating the genetic basis of biofilm development in live animal hosts remains a significant challenge. Using the bobtail squid light organ as a model, we analyzed putative colonization factors and identified a histidine kinase that negatively regulates biofilm formation at the host interface. This work reveals a novel in vivo biofilm regulator that influences the transition of bacteria from their

  18. Negative iron regulation of the CP65 cysteine proteinase cytotoxicity in Trichomonas vaginalis.


    Alvarez-Sánchez, María Elizbeth; Solano-González, Eduardo; Yañez-Gómez, Carmina; Arroyo, Rossana


    Several cysteine proteinases (CPs) participate in the virulence of Trichomonas vaginalis. One of them is a 65kDa CP, CP65, involved in cytotoxicity. The aim of this work was to investigate the effect of iron on the trichomonal CP65-dependent cytotoxicity using parasites grown under distinct iron concentrations. Cytotoxicity and cell-binding assays, and zymograms were performed. At the highest iron concentration (250 microM), parasites exhibited the lowest levels of cytotoxicity and less CP65 proteolytic activity. Other cations in the culture medium did not affect the trichomonal CP65-dependent cytotoxicity as iron did. Another four trichomonad fresh isolates presented similar iron negative effect over cytotoxicity. Western blot and RT-PCR experiments also showed reduction in the amount of protein and transcript of CP65 in trichomonads grown under iron-rich conditions, as compared with parasites grown in normal and iron-depleted media. Indirect immunofluorescence using the anti-CP65 antibody showed that parasites grown in iron-rich medium expressed less CP65 than those grown in normal and iron-depleted media. Cytotoxicity inhibition experiments with the anti-CP65 antibody confirmed the iron negative effect over the CP65-dependent cytotoxicity. In conclusion, our data show that iron specifically down-regulates proteolytic activity, expression, and transcription of CP65, negatively affecting trichomonal cytotoxicity in vitro. PMID:18023389

  19. Negative iron regulation of the CP65 cysteine proteinase cytotoxicity in Trichomonas vaginalis.


    Alvarez-Sánchez, María Elizbeth; Solano-González, Eduardo; Yañez-Gómez, Carmina; Arroyo, Rossana


    Several cysteine proteinases (CPs) participate in the virulence of Trichomonas vaginalis. One of them is a 65kDa CP, CP65, involved in cytotoxicity. The aim of this work was to investigate the effect of iron on the trichomonal CP65-dependent cytotoxicity using parasites grown under distinct iron concentrations. Cytotoxicity and cell-binding assays, and zymograms were performed. At the highest iron concentration (250 microM), parasites exhibited the lowest levels of cytotoxicity and less CP65 proteolytic activity. Other cations in the culture medium did not affect the trichomonal CP65-dependent cytotoxicity as iron did. Another four trichomonad fresh isolates presented similar iron negative effect over cytotoxicity. Western blot and RT-PCR experiments also showed reduction in the amount of protein and transcript of CP65 in trichomonads grown under iron-rich conditions, as compared with parasites grown in normal and iron-depleted media. Indirect immunofluorescence using the anti-CP65 antibody showed that parasites grown in iron-rich medium expressed less CP65 than those grown in normal and iron-depleted media. Cytotoxicity inhibition experiments with the anti-CP65 antibody confirmed the iron negative effect over the CP65-dependent cytotoxicity. In conclusion, our data show that iron specifically down-regulates proteolytic activity, expression, and transcription of CP65, negatively affecting trichomonal cytotoxicity in vitro.

  20. Sarco(endo)plasmic reticulum ATPase is a molecular partner of Wolfram syndrome 1 protein, which negatively regulates its expression.


    Zatyka, Malgorzata; Da Silva Xavier, Gabriela; Bellomo, Elisa A; Leadbeater, Wendy; Astuti, Dewi; Smith, Joel; Michelangeli, Frank; Rutter, Guy A; Barrett, Timothy G


    Wolfram syndrome is an autosomal recessive disorder characterized by neurodegeneration and diabetes mellitus. The gene responsible for the syndrome (WFS1) encodes an endoplasmic reticulum (ER)-resident transmembrane protein that is involved in the regulation of the unfolded protein response (UPR), intracellular ion homeostasis, cyclic adenosine monophosphate production and regulation of insulin biosynthesis and secretion. In this study, single cell Ca(2+) imaging with fura-2 and direct measurements of free cytosolic ATP concentration ([ATP]CYT) with adenovirally expressed luciferase confirmed a reduced and delayed rise in cytosolic free Ca(2+) concentration ([Ca(2+)]CYT), and additionally, diminished [ATP]CYT rises in response to elevated glucose concentrations in WFS1-depleted MIN6 cells. We also observed that sarco(endo)plasmic reticulum ATPase (SERCA) expression was elevated in several WFS1-depleted cell models and primary islets. We demonstrated a novel interaction between WFS1 and SERCA by co-immunoprecipitation in Cos7 cells and with endogenous proteins in human neuroblastoma cells. This interaction was reduced when cells were treated with the ER stress inducer dithiothreitol. Treatment of WFS1-depleted neuroblastoma cells with the proteasome inhibitor MG132 resulted in reduced accumulation of SERCA levels compared with wild-type cells. Together these results reveal a role for WFS1 in the negative regulation of SERCA and provide further insights into the function of WFS1 in calcium homeostasis. PMID:25274773

  1. Nitric oxide negatively regulates abscisic acid signaling in guard cells by S-nitrosylation of OST1.


    Wang, Pengcheng; Du, Yanyan; Hou, Yueh-Ju; Zhao, Yang; Hsu, Chuan-Chih; Yuan, Feijuan; Zhu, Xiaohong; Tao, W Andy; Song, Chun-Peng; Zhu, Jian-Kang


    The phytohormone abscisic acid (ABA) plays important roles in plant development and adaptation to environmental stress. ABA induces the production of nitric oxide (NO) in guard cells, but how NO regulates ABA signaling is not understood. Here, we show that NO negatively regulates ABA signaling in guard cells by inhibiting open stomata 1 (OST1)/sucrose nonfermenting 1 (SNF1)-related protein kinase 2.6 (SnRK2.6) through S-nitrosylation. We found that SnRK2.6 is S-nitrosylated at cysteine 137, a residue adjacent to the kinase catalytic site. Dysfunction in the S-nitrosoglutathione (GSNO) reductase (GSNOR) gene in the gsnor1-3 mutant causes NO overaccumulation in guard cells, constitutive S-nitrosylation of SnRK2.6, and impairment of ABA-induced stomatal closure. Introduction of the Cys137 to Ser mutated SnRK2.6 into the gsnor1-3/ost1-3 double-mutant partially suppressed the effect of gsnor1-3 on ABA-induced stomatal closure. A cysteine residue corresponding to Cys137 of SnRK2.6 is present in several yeast and human protein kinases and can be S-nitrosylated, suggesting that the S-nitrosylation may be an evolutionarily conserved mechanism for protein kinase regulation.

  2. Nitric oxide negatively regulates abscisic acid signaling in guard cells by S-nitrosylation of OST1

    PubMed Central

    Wang, Pengcheng; Du, Yanyan; Hou, Yueh-Ju; Zhao, Yang; Hsu, Chuan-Chih; Yuan, Feijuan; Zhu, Xiaohong; Tao, W. Andy; Song, Chun-Peng; Zhu, Jian-Kang


    The phytohormone abscisic acid (ABA) plays important roles in plant development and adaptation to environmental stress. ABA induces the production of nitric oxide (NO) in guard cells, but how NO regulates ABA signaling is not understood. Here, we show that NO negatively regulates ABA signaling in guard cells by inhibiting open stomata 1 (OST1)/sucrose nonfermenting 1 (SNF1)-related protein kinase 2.6 (SnRK2.6) through S-nitrosylation. We found that SnRK2.6 is S-nitrosylated at cysteine 137, a residue adjacent to the kinase catalytic site. Dysfunction in the S-nitrosoglutathione (GSNO) reductase (GSNOR) gene in the gsnor1-3 mutant causes NO overaccumulation in guard cells, constitutive S-nitrosylation of SnRK2.6, and impairment of ABA-induced stomatal closure. Introduction of the Cys137 to Ser mutated SnRK2.6 into the gsnor1-3/ost1-3 double-mutant partially suppressed the effect of gsnor1-3 on ABA-induced stomatal closure. A cysteine residue corresponding to Cys137 of SnRK2.6 is present in several yeast and human protein kinases and can be S-nitrosylated, suggesting that the S-nitrosylation may be an evolutionarily conserved mechanism for protein kinase regulation. PMID:25550508

  3. Coronavirus papain-like proteases negatively regulate antiviral innate immune response through disruption of STING-mediated signaling.


    Sun, Li; Xing, Yaling; Chen, Xiaojuan; Zheng, Yang; Yang, Yudong; Nichols, Daniel B; Clementz, Mark A; Banach, Bridget S; Li, Kui; Baker, Susan C; Chen, Zhongbin


    Viruses have evolved elaborate mechanisms to evade or inactivate the complex system of sensors and signaling molecules that make up the host innate immune response. Here we show that human coronavirus (HCoV) NL63 and severe acute respiratory syndrome (SARS) CoV papain-like proteases (PLP) antagonize innate immune signaling mediated by STING (stimulator of interferon genes, also known as MITA/ERIS/MYPS). STING resides in the endoplasmic reticulum and upon activation, forms dimers which assemble with MAVS, TBK-1 and IKKε, leading to IRF-3 activation and subsequent induction of interferon (IFN). We found that expression of the membrane anchored PLP domain from human HCoV-NL63 (PLP2-TM) or SARS-CoV (PLpro-TM) inhibits STING-mediated activation of IRF-3 nuclear translocation and induction of IRF-3 dependent promoters. Both catalytically active and inactive forms of CoV PLPs co-immunoprecipitated with STING, and viral replicase proteins co-localize with STING in HCoV-NL63-infected cells. Ectopic expression of catalytically active PLP2-TM blocks STING dimer formation and negatively regulates assembly of STING-MAVS-TBK1/IKKε complexes required for activation of IRF-3. STING dimerization was also substantially reduced in cells infected with SARS-CoV. Furthermore, the level of ubiquitinated forms of STING, RIG-I, TBK1 and IRF-3 are reduced in cells expressing wild type or catalytic mutants of PLP2-TM, likely contributing to disruption of signaling required for IFN induction. These results describe a new mechanism used by CoVs in which CoV PLPs negatively regulate antiviral defenses by disrupting the STING-mediated IFN induction.

  4. Procyanidin dimer B2-mediated IRAK-M induction negatively regulates TLR4 signaling in macrophages

    SciTech Connect

    Sung, Nak-Yun; Yang, Mi-So; Song, Du-Sub; Kim, Jae-Kyung; Park, Jong-Heum; Song, Beom-Seok; Park, Sang-Hyun; Lee, Ju-Woon; Park, Hyun-Jin; Kim, Jae-Hun; Byun, Eui-Baek; Byun, Eui-Hong


    Highlights: •Pro B2 elevated the expression of IRAK-M, a negative regulator of TLR signaling. •LPS-induced expression of cell surface molecules was inhibited by Pro B2. •LPS-induced production of pro-inflammatory cytokines was inhibited by Pro B2. •Pro B2 inhibited LPS-induced activation of MAPKs and NF-κB through IRAK-M. •Pro B2 inactivated naïve T cells by inhibiting LPS-induced cytokines via IRAK-M. -- Abstract: Polyphenolic compounds have been found to possess a wide range of physiological activities that may contribute to their beneficial effects against inflammation-related diseases; however, the molecular mechanisms underlying this anti-inflammatory activity are not completely characterized, and many features remain to be elucidated. In this study, we investigated the molecular basis for the down-regulation of toll-like receptor 4 (TLR4) signal transduction by procyanidin dimer B2 (Pro B2) in macrophages. Pro B2 markedly elevated the expression of the interleukin (IL)-1 receptor-associated kinase (IRAK)-M protein, a negative regulator of TLR signaling. Lipopolysaccharide (LPS)-induced expression of cell surface molecules (CD80, CD86, and MHC class I/II) and production of pro-inflammatory cytokines (tumor necrosis factor-α, IL-1β, IL-6, and IL-12p70) were inhibited by Pro B2, and this action was prevented by IRAK-M silencing. In addition, Pro B2-treated macrophages inhibited LPS-induced activation of mitogen-activated protein kinases such as extracellular signal-regulated kinase 1/2, p38, and c-Jun N-terminal kinase and the translocation of nuclear factor κB and p65 through IRAK-M. We also found that Pro B2-treated macrophages inactivated naïve T cells by inhibiting LPS-induced interferon-γ and IL-2 secretion through IRAK-M. These novel findings provide new insights into the understanding of negative regulatory mechanisms of the TLR4 signaling pathway and the immune-pharmacological role of Pro B2 in the immune response against the development

  5. Heregulin negatively regulates transcription of ErbB2/3 receptors via an AKT-mediated pathway

    PubMed Central

    Awasthi, Smita; Hamburger, Anne W.


    Despite the importance of the ErbB2/3 heterodimer in breast cancer progression, the negative regulation of these receptors is still poorly understood. We demonstrate here for the first time that the ErbB3/4 ligand Heregulin (HRG) reduced both ErbB2 and ErbB3 mRNA and protein levels in human breast cancer cell lines. In contrast, EGFR levels were unaffected by HRG treatment. The effect was rapid with a decline in steady state mRNA levels first noted two hours after HRG treatment. HRG reduced the rate of transcription of ErbB2 and ErbB3 mRNA, but did not affect ErbB2 or ErbB3 mRNA stability. To test if ErbB2 kinase activity was required for the HRG-induced downregulation, we treated cells with the ErbB2/EGFR inhibitor lapatinib. Lapatinib diminished the HRG- induced decrease in ErbB2 and ErbB3 mRNA and protein, suggesting that the kinase activity of EGFR/ErbB2 is involved in the HRG-induced receptor down-regulation. Further, HRG-mediated decreases in ErbB2/3 mRNA transcription are reversed by inhibiting the AKT but not MAPK pathway. To examine the functional consequences of HRG-mediated decreases in ErbB receptor levels, we performed cell cycle analysis. HRG blocked cell cycle progression and lapatinib reversed this block. Our findings support a role for HRG in the negative regulation of ErbB expression and suggest that inhibition of ErbB2/3 signaling by ErbB2 directed therapies may interfere with this process. PMID:24692179

  6. Unkempt is negatively regulated by mTOR and uncouples neuronal differentiation from growth control.


    Avet-Rochex, Amélie; Carvajal, Nancy; Christoforou, Christina P; Yeung, Kelvin; Maierbrugger, Katja T; Hobbs, Carl; Lalli, Giovanna; Cagin, Umut; Plachot, Cedric; McNeill, Helen; Bateman, Joseph M


    Neuronal differentiation is exquisitely controlled both spatially and temporally during nervous system development. Defects in the spatiotemporal control of neurogenesis cause incorrect formation of neural networks and lead to neurological disorders such as epilepsy and autism. The mTOR kinase integrates signals from mitogens, nutrients and energy levels to regulate growth, autophagy and metabolism. We previously identified the insulin receptor (InR)/mTOR pathway as a critical regulator of the timing of neuronal differentiation in the Drosophila melanogaster eye. Subsequently, this pathway has been shown to play a conserved role in regulating neurogenesis in vertebrates. However, the factors that mediate the neurogenic role of this pathway are completely unknown. To identify downstream effectors of the InR/mTOR pathway we screened transcriptional targets of mTOR for neuronal differentiation phenotypes in photoreceptor neurons. We identified the conserved gene unkempt (unk), which encodes a zinc finger/RING domain containing protein, as a negative regulator of the timing of photoreceptor differentiation. Loss of unk phenocopies InR/mTOR pathway activation and unk acts downstream of this pathway to regulate neurogenesis. In contrast to InR/mTOR signalling, unk does not regulate growth. unk therefore uncouples the role of the InR/mTOR pathway in neurogenesis from its role in growth control. We also identified the gene headcase (hdc) as a second downstream regulator of the InR/mTOR pathway controlling the timing of neurogenesis. Unk forms a complex with Hdc, and Hdc expression is regulated by unk and InR/mTOR signalling. Co-overexpression of unk and hdc completely suppresses the precocious neuronal differentiation phenotype caused by loss of Tsc1. Thus, Unk and Hdc are the first neurogenic components of the InR/mTOR pathway to be identified. Finally, we show that Unkempt-like is expressed in the developing mouse retina and in neural stem/progenitor cells, suggesting

  7. Selective Androgen Receptor Modulators (SARMs) Negatively Regulate Triple-Negative Breast Cancer Growth and Epithelial:Mesenchymal Stem Cell Signaling

    PubMed Central

    Narayanan, Ramesh; Ahn, Sunjoo; Cheney, Misty D.; Yepuru, Muralimohan; Miller, Duane D.; Steiner, Mitchell S.; Dalton, James T.


    Abstract Introduction The androgen receptor (AR) is the most highly expressed steroid receptor in breast cancer with 75–95% of estrogen receptor (ER)-positive and 40–70% of ER-negative breast cancers expressing AR. Though historically breast cancers were treated with steroidal androgens, their use fell from favor because of their virilizing side effects and the emergence of tamoxifen. Nonsteroidal, tissue selective androgen receptor modulators (SARMs) may provide a novel targeted approach to exploit the therapeutic benefits of androgen therapy in breast cancer. Materials and Methods Since MDA-MB-453 triple-negative breast cancer cells express mutated AR, PTEN, and p53, MDA-MB-231 triple-negative breast cancer cells stably expressing wildtype AR (MDA-MB-231-AR) were used to evaluate the in vitro and in vivo anti-proliferative effects of SARMs. Microarray analysis and epithelial:mesenchymal stem cell (MSC) co-culture signaling studies were performed to understand the mechanisms of action. Results Dihydrotestosterone and SARMs, but not bicalutamide, inhibited the proliferation of MDA-MB-231-AR. The SARMs reduced the MDA-MB-231-AR tumor growth and tumor weight by greater than 90%, compared to vehicle-treated tumors. SARM treatment inhibited the intratumoral expression of genes and pathways that promote breast cancer development through its actions on the AR. SARM treatment also inhibited the metastasis-promoting paracrine factors, IL6 and MMP13, and subsequent migration and invasion of epithelial:MSC co-cultures. Conclusion 1. AR stimulation inhibits paracrine factors that are important for MSC interactions and breast cancer invasion and metastasis. 2. SARMs may provide promise as novel targeted therapies to treat AR-positive triple-negative breast cancer. PMID:25072326

  8. A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus

    USGS Publications Warehouse

    Leisy, D.J.; Rasmussen, C.; Owusu, E.O.; Rohrmann, G.F.


    The Autographa californica multinucleocapsid nuclear polyhedrosis virus (AcMNPV) ie-1 gene product (IE-1) is thought to play a central role in stimulating early viral transcription. IE-1 has been demonstrated to activate several early viral gene promoters and to negatively regulate the promoters of two other AcMNPV regulatory genes, ie-0 and ie-2. Our results indicate that IE-1 negatively regulates the expression of certain genes by binding directly, or as part of a complex, to promoter regions containing a specific IE-1-binding motif (5'-ACBYGTAA-3') near their mRNA start sites. The IE-1 binding motif was also found within the palindromic sequences of AcMNPV homologous repeat (hr) regions that have been shown to bind IE-1. The role of this IE-1 binding motif in the regulation of the ie-2 and pe-38 promoters was examined by introducing mutations in these promoters in which the central 6 bp were replaced with Bg/II sites. GUS reporter constructs containing ie-2 and pe-38 promoter fragments with and without these specific mutations were cotransfected into Sf9 cells with various amounts of an ie-1-containing plasmid (ple-1). Comparisons of GUS expression produced by the mutant and wild-type constructs demonstrated that the IE-1 binding motif mediated a significant decrease in expression from the ie-2 and pe-38 promoters in response to increasing pIe-1 concentrations. Electrophoretic mobility shift assays with pIe-1-transfected cell extracts and supershift assays with IE-1- specific antiserum demonstrated that IE-1 binds to promoter fragments containing the IE-1 binding motif but does not bind to promoter fragments lacking this motif.

  9. Plexin-B2 negatively regulates macrophage motility, Rac, and Cdc42 activation.


    Roney, Kelly E; O'Connor, Brian P; Wen, Haitao; Holl, Eda K; Guthrie, Elizabeth H; Davis, Beckley K; Jones, Stephen W; Jha, Sushmita; Sharek, Lisa; Garcia-Mata, Rafael; Bear, James E; Ting, Jenny P-Y


    Plexins are cell surface receptors widely studied in the nervous system, where they mediate migration and morphogenesis though the Rho family of small GTPases. More recently, plexins have been implicated in immune processes including cell-cell interaction, immune activation, migration, and cytokine production. Plexin-B2 facilitates ligand induced cell guidance and migration in the nervous system, and induces cytoskeletal changes in overexpression assays through RhoGTPase. The function of Plexin-B2 in the immune system is unknown. This report shows that Plexin-B2 is highly expressed on cells of the innate immune system in the mouse, including macrophages, conventional dendritic cells, and plasmacytoid dendritic cells. However, Plexin-B2 does not appear to regulate the production of proinflammatory cytokines, phagocytosis of a variety of targets, or directional migration towards chemoattractants or extracellular matrix in mouse macrophages. Instead, Plxnb2(-/-) macrophages have greater cellular motility than wild type in the unstimulated state that is accompanied by more active, GTP-bound Rac and Cdc42. Additionally, Plxnb2(-/-) macrophages demonstrate faster in vitro wound closure activity. Studies have shown that a closely related family member, Plexin-B1, binds to active Rac and sequesters it from downstream signaling. The interaction of Plexin-B2 with Rac has only been previously confirmed in yeast and bacterial overexpression assays. The data presented here show that Plexin-B2 functions in mouse macrophages as a negative regulator of the GTPases Rac and Cdc42 and as a negative regulator of basal cell motility and wound healing.

  10. Checkpoint Kinase 2 Negatively Regulates Androgen Sensitivity and Prostate Cancer Cell Growth.


    Ta, Huy Q; Ivey, Melissa L; Frierson, Henry F; Conaway, Mark R; Dziegielewski, Jaroslaw; Larner, James M; Gioeli, Daniel


    Prostate cancer is the second leading cause of cancer death in American men, and curing metastatic disease remains a significant challenge. Nearly all patients with disseminated prostate cancer initially respond to androgen deprivation therapy (ADT), but virtually all patients will relapse and develop incurable castration-resistant prostate cancer (CRPC). A high-throughput RNAi screen to identify signaling pathways regulating prostate cancer cell growth led to our discovery that checkpoint kinase 2 (CHK2) knockdown dramatically increased prostate cancer growth and hypersensitized cells to low androgen levels. Mechanistic investigations revealed that the effects of CHK2 were dependent on the downstream signaling proteins CDC25C and CDK1. Moreover, CHK2 depletion increased androgen receptor (AR) transcriptional activity on androgen-regulated genes, substantiating the finding that CHK2 affects prostate cancer proliferation, partly, through the AR. Remarkably, we further show that CHK2 is a novel AR-repressed gene, suggestive of a negative feedback loop between CHK2 and AR. In addition, we provide evidence that CHK2 physically associates with the AR and that cell-cycle inhibition increased this association. Finally, IHC analysis of CHK2 in prostate cancer patient samples demonstrated a decrease in CHK2 expression in high-grade tumors. In conclusion, we propose that CHK2 is a negative regulator of androgen sensitivity and prostate cancer growth, and that CHK2 signaling is lost during prostate cancer progression to castration resistance. Thus, perturbing CHK2 signaling may offer a new therapeutic approach for sensitizing CRPC to ADT and radiation. PMID:26573794

  11. The Human Ventromedial Frontal Lobe Is Critical for Learning from Negative Feedback

    ERIC Educational Resources Information Center

    Wheeler, Elizabeth Z.; Fellows, Lesley K.


    Are positive and negative feedback weighed in a common balance in the brain, or do they influence behaviour through distinct neural mechanisms? Recent neuroeconomic studies in both human and non-human primates indicate that the ventromedial frontal lobe carries information about both losses and gains, suggesting that this region may encode value…

  12. Determining the Presence of Superantigens in Coagulase Negative Staphylococci from Humans

    PubMed Central

    Schlievert, Patrick M.


    Superantigens (SAgs) are important virulence factors in S. aureus. Recent studies identified their presence in animal coagulase-negative staphylococci (CNS). The emergence of human-associated SAg+ CNS would mark a prodigious shift in virulence capabilities. We examined CNS isolates from healthy human nares and diseased individuals, and determined that no known SAgs were present. PMID:26599862

  13. Grouper TRIM13 exerts negative regulation of antiviral immune response against nodavirus.


    Huang, Youhua; Yang, Min; Yu, Yepin; Yang, Ying; Zhou, Linli; Huang, Xiaohong; Qin, Qiwei


    The tripartite motif (TRIM)-containing proteins have attracted particular attention to their multiple functions in different biological processes. TRIM13, a member of the TRIM family, is a RING domain-containing E3 ubiquitin ligase which plays critical roles in diverse cellular processes including cell death, cancer and antiviral immunity. In this study, a TRIM13 homolog from orange spotted grouper, Epinephelus coioides (EcTRIM13) was cloned and characterized. The full-length of EcTRIM13 cDNA encoded a polypeptide of 399 amino acids which shared 81% identity with TRIM13 homolog from large yellow croaker (Larimichthys crocea). Amino acid alignment analysis showed that EcTRIM13 contained conserved RING finger and B-box domain. Expression patterns analysis indicated that EcTRIM13 was abundant in liver, spleen, kidney, intestine and gill. Moreover, the transcript of EcTRIM13 in grouper spleen was differently regulated after injection with Singapore grouper iridovirus (SGIV) or polyinosin-polycytidylic acid (poly I:C). Under fluorescence microscopy, we observed the tubular structure in wild type EcTRIM13 transfected cells, but the RING domain mutant resulted in the fluorescence distribution was changed and the bright punctate fluorescence was evenly situated throughout the cytoplasm, suggesting that the RING domain was essential for its accurate localization. Overexpression of EcTRIM13 in vitro obviously increased the replication of red spotted grouper nervous necrosis virus (RGNNV), and the enhancing effect of EcTRIM13 on virus replication was affected by the RING domain. Furthermore, the ectopic expression of EcTRIM13 not only negatively regulated the interferon promoter activity induced by interferon regulator factor (IRF) 3, IRF7, and melanoma differentiation-associated protein 5 (MDA5), but also decreased the expression of several interferon related factors. In addition, the overexpression of EcTRIM13 also differently regulated the transcription of pro

  14. Grouper TRIM13 exerts negative regulation of antiviral immune response against nodavirus.


    Huang, Youhua; Yang, Min; Yu, Yepin; Yang, Ying; Zhou, Linli; Huang, Xiaohong; Qin, Qiwei


    The tripartite motif (TRIM)-containing proteins have attracted particular attention to their multiple functions in different biological processes. TRIM13, a member of the TRIM family, is a RING domain-containing E3 ubiquitin ligase which plays critical roles in diverse cellular processes including cell death, cancer and antiviral immunity. In this study, a TRIM13 homolog from orange spotted grouper, Epinephelus coioides (EcTRIM13) was cloned and characterized. The full-length of EcTRIM13 cDNA encoded a polypeptide of 399 amino acids which shared 81% identity with TRIM13 homolog from large yellow croaker (Larimichthys crocea). Amino acid alignment analysis showed that EcTRIM13 contained conserved RING finger and B-box domain. Expression patterns analysis indicated that EcTRIM13 was abundant in liver, spleen, kidney, intestine and gill. Moreover, the transcript of EcTRIM13 in grouper spleen was differently regulated after injection with Singapore grouper iridovirus (SGIV) or polyinosin-polycytidylic acid (poly I:C). Under fluorescence microscopy, we observed the tubular structure in wild type EcTRIM13 transfected cells, but the RING domain mutant resulted in the fluorescence distribution was changed and the bright punctate fluorescence was evenly situated throughout the cytoplasm, suggesting that the RING domain was essential for its accurate localization. Overexpression of EcTRIM13 in vitro obviously increased the replication of red spotted grouper nervous necrosis virus (RGNNV), and the enhancing effect of EcTRIM13 on virus replication was affected by the RING domain. Furthermore, the ectopic expression of EcTRIM13 not only negatively regulated the interferon promoter activity induced by interferon regulator factor (IRF) 3, IRF7, and melanoma differentiation-associated protein 5 (MDA5), but also decreased the expression of several interferon related factors. In addition, the overexpression of EcTRIM13 also differently regulated the transcription of pro

  15. SNX3 recruits to phagosomes and negatively regulates phagocytosis in dendritic cells.


    Chua, Rong Yuan Ray; Wong, Siew Heng


    Phagocytes such as dendritic cells (DC) and macrophages employ phagocytosis to take up pathogenic bacteria into phagosomes, digest the bacteria and present the bacteria-derived peptide antigens to the adaptive immunity. Hence, efficient antigen presentation depends greatly on a well-regulated phagocytosis process. Lipids, particularly phosphoinositides, are critical components of the phagosomes. Phosphatidylinositol-3,4,5-triphosphate [PI(3,4,5)P3 ] is formed at the phagocytic cup, and as the phagosome seals off from the plasma membrane, rapid disappearance of PI(3,4,5)P3 is accompanied by high levels of phosphatidylinositol-3-phosphate (PI3P) formation. The sorting nexin (SNX) family consists of a diverse group of Phox-homology (PX) domain-containing cytoplasmic and membrane-associated proteins that are potential effectors of phosphoinositides. We hypothesized that SNX3, a small sorting nexin that contains a single PI3P lipid-binding PX domain as its only protein domain, localizes to phagosomes and regulates phagocytosis in DC. Our results show that SNX3 recruits to nascent phagosomes and silencing of SNX3 enhances phagocytic uptake of bacteria by DC. Furthermore, SNX3 competes with PI3P lipid-binding protein, early endosome antigen-1 (EEA1) recruiting to membranes. Our results indicate that SNX3 negatively regulates phagocytosis in DC possibly by modulating recruitment of essential PI3P lipid-binding proteins of the phagocytic pathways, such as EEA1, to phagosomal membranes.

  16. Integrated expression analysis of muscle hypertrophy identifies Asb2 as a negative regulator of muscle mass

    PubMed Central

    Davey, Jonathan R.; Watt, Kevin I.; Parker, Benjamin L.; Chaudhuri, Rima; Ryall, James G.; Cunningham, Louise; Qian, Hongwei; Sartorelli, Vittorio; Chamberlain, Jeffrey; James, David E.


    The transforming growth factor-β (TGF-β) signaling network is a critical regulator of skeletal muscle mass and function and, thus, is an attractive therapeutic target for combating muscle disease, but the underlying mechanisms of action remain undetermined. We report that follistatin-based interventions (which modulate TGF-β network activity) can promote muscle hypertrophy that ameliorates aging-associated muscle wasting. However, the muscles of old sarcopenic mice demonstrate reduced response to follistatin compared with healthy young-adult musculature. Quantitative proteomic and transcriptomic analyses of young-adult muscles identified a transcription/translation signature elicited by follistatin exposure, which included repression of ankyrin repeat and SOCS box protein 2 (Asb2). Increasing expression of ASB2 reduced muscle mass, thereby demonstrating that Asb2 is a TGF-β network–responsive negative regulator of muscle mass. In contrast to young-adult muscles, sarcopenic muscles do not exhibit reduced ASB2 abundance with follistatin exposure. Moreover, preventing repression of ASB2 in young-adult muscles diminished follistatin-induced muscle hypertrophy. These findings provide insight into the program of transcription and translation events governing follistatin-mediated adaptation of skeletal muscle attributes and identify Asb2 as a regulator of muscle mass implicated in the potential mechanistic dysfunction between follistatin-mediated muscle growth in young and old muscles. PMID:27182554

  17. Induction of Posttranslational Modifications of Mitochondrial Proteins by ATP Contributes to Negative Regulation of Mitochondrial Function.


    Zhang, Yong; Zhao, Zhiyun; Ke, Bilun; Wan, Lin; Wang, Hui; Ye, Jianping


    It is generally accepted that ATP regulates mitochondrial function through the AMPK signaling pathway. However, the AMPK-independent pathway remains largely unknown. In this study, we investigated ATP surplus in the negative regulation of mitochondrial function with a focus on pyruvate dehydrogenase (PDH) phosphorylation and protein acetylation. PDH phosphorylation was induced by a high fat diet in the liver of obese mice, which was associated with ATP elevation. In 1c1c7 hepatoma cells, the phosphorylation was induced by palmitate treatment through induction of ATP production. The phosphorylation was associated with a reduction in mitochondria oxygen consumption after 4 h treatment. The palmitate effect was blocked by etomoxir, which inhibited ATP production through suppression of fatty acid β-oxidation. The PDH phosphorylation was induced by incubation of mitochondrial lysate with ATP in vitro without altering the expression of PDH kinase 2 (PDK2) and 4 (PDK4). In addition, acetylation of multiple mitochondrial proteins was induced by ATP in the same conditions. Acetyl-CoA exhibited a similar activity to ATP in induction of the phosphorylation and acetylation. These data suggest that ATP elevation may inhibit mitochondrial function through induction of the phosphorylation and acetylation of mitochondrial proteins. The results suggest an AMPK-independent mechanism for ATP regulation of mitochondrial function.

  18. DYRK1A Is a Novel Negative Regulator of Cardiomyocyte Hypertrophy*

    PubMed Central

    Kuhn, Christian; Frank, Derk; Will, Rainer; Jaschinski, Christoph; Frauen, Robert; Katus, Hugo A.; Frey, Norbert


    Activation of the phosphatase calcineurin and its downstream targets, transcription factors of the NFAT family, results in cardiomyocyte hypertrophy. Recently, it has been shown that the dual specificity tyrosine (Y) phosphorylation-regulated kinase 1A (DYRK1A) is able to antagonize calcineurin signaling by directly phosphorylating NFATs. We thus hypothesized that DYRK1A might modulate the hypertrophic response of cardiomyocytes. In a model of phenylephrine-induced hypertrophy, adenovirus-mediated overexpression of DYKR1A completely abrogated the hypertrophic response and significantly reduced the expression of the natriuretic peptides ANF and BNP. Furthermore, DYRK1A blunted cardiomyocyte hypertrophy induced by overexpression of constitutively active calcineurin and attenuated the induction of the hypertrophic gene program. Conversely, knockdown of DYRK1A, utilizing adenoviruses encoding for a specific synthetic miRNA, resulted in an increase in cell surface area accompanied by up-regulation of ANF- mRNA. Similarly, treatment of cardiomyocytes with harmine, a specific inhibitor of DYRK1A, revealed cardiomyocyte hypertrophy on morphological and molecular level. Moreover, constitutively active calcineurin led to robust induction of an NFAT-dependent luciferase reporter, whereas DYRK1A attenuated calcineurin-induced reporter activation in cardiomyocytes. Conversely, both knockdown and pharmacological inhibition of DYRK1A significantly augmented the effect of calcineurin in this assay. In summary, we identified DYRK1A as a novel negative regulator of cardiomyocyte hypertrophy. Mechanistically, this effect appears to be mediated via inhibition of NFAT transcription factors. PMID:19372220

  19. Induction of Posttranslational Modifications of Mitochondrial Proteins by ATP Contributes to Negative Regulation of Mitochondrial Function.


    Zhang, Yong; Zhao, Zhiyun; Ke, Bilun; Wan, Lin; Wang, Hui; Ye, Jianping


    It is generally accepted that ATP regulates mitochondrial function through the AMPK signaling pathway. However, the AMPK-independent pathway remains largely unknown. In this study, we investigated ATP surplus in the negative regulation of mitochondrial function with a focus on pyruvate dehydrogenase (PDH) phosphorylation and protein acetylation. PDH phosphorylation was induced by a high fat diet in the liver of obese mice, which was associated with ATP elevation. In 1c1c7 hepatoma cells, the phosphorylation was induced by palmitate treatment through induction of ATP production. The phosphorylation was associated with a reduction in mitochondria oxygen consumption after 4 h treatment. The palmitate effect was blocked by etomoxir, which inhibited ATP production through suppression of fatty acid β-oxidation. The PDH phosphorylation was induced by incubation of mitochondrial lysate with ATP in vitro without altering the expression of PDH kinase 2 (PDK2) and 4 (PDK4). In addition, acetylation of multiple mitochondrial proteins was induced by ATP in the same conditions. Acetyl-CoA exhibited a similar activity to ATP in induction of the phosphorylation and acetylation. These data suggest that ATP elevation may inhibit mitochondrial function through induction of the phosphorylation and acetylation of mitochondrial proteins. The results suggest an AMPK-independent mechanism for ATP regulation of mitochondrial function. PMID:26930489

  20. Evidence for the negative regulation of phytase gene expression in Streptomyces lividans and Streptomyces coelicolor.


    Boukhris, Ines; Dulermo, Thierry; Chouayekh, Hichem; Virolle, Marie-Joëlle


    Sco7697, a gene encoding a phytase, enzyme able to degrade phytate (myo-inositol 1,2,3,4,5,6-hexakis phosphate), the most abundant phosphorus storing compound in plants is present in the genome of S. coelicolor, a soil born bacteria with a saprophytic lifestyle. The expression of this gene was previously shown to be induced in conditions of Pi limitation by the response regulator PhoP binding to an operator sequence, the PHO box, located upstream of the -35 promoter sequence. A close examination of the promoter region of sco7697 revealed the presence of another putative operator site, a Direct Repeat (DR), located downstream of the -10 promoter sequence. In order to determine whether this DR played a role in regulation of sco7697 expression, different variants of the phytase gene promoter region were transcriptionally fused to the ß-glucuronidase reporter gene (GUS). As expected, deletion of the PHO box led to abolition of sco7697 induction in conditions of Pi limitation. Interestingly, alteration of the DR correlated with a dramatic increase of GUS expression but only when PhoP was present. These results demonstrated that this DR is the site of strong negative regulation by an unknown repressor. The latter would impede the necessary activation of phytase expression by PhoP.

  1. Effects of negative air ions on activity of neural substrates involved in autonomic regulation in rats

    NASA Astrophysics Data System (ADS)

    Suzuki, Satoko; Yanagita, Shinya; Amemiya, Seiichiro; Kato, Yumi; Kubota, Natsuko; Ryushi, Tomoo; Kita, Ichiro


    The neural mechanism by which negative air ions (NAI) mediate the regulation of autonomic nervous system activity is still unknown. We examined the effects of NAI on physiological responses, such as blood pressure (BP), heart rate (HR), and heart rate variability (HRV) as well as neuronal activity, in the paraventricular nucleus of the hypothalamus (PVN), locus coeruleus (LC), nucleus ambiguus (NA), and nucleus of the solitary tract (NTS) with c-Fos immunohistochemistry in anesthetized, spontaneously breathing rats. In addition, we performed cervical vagotomy to reveal the afferent pathway involved in mediating the effects of NAI on autonomic regulation. NAI significantly decreased BP and HR, and increased HF power of the HRV spectrum. Significant decreases in c-Fos positive nuclei in the PVN and LC, and enhancement of c-Fos expression in the NA and NTS were induced by NAI. After vagotomy, these physiological and neuronal responses to NAI were not observed. These findings suggest that NAI can modulate autonomic regulation through inhibition of neuronal activity in PVN and LC as well as activation of NA neurons, and that these effects of NAI might be mediated via the vagus nerves.

  2. Phosphorylation acts positively and negatively to regulate MRTF-A subcellular localisation and activity

    PubMed Central

    Panayiotou, Richard; Miralles, Francesc; Pawlowski, Rafal; Diring, Jessica; Flynn, Helen R; Skehel, Mark; Treisman, Richard


    The myocardin-related transcription factors (MRTF-A and MRTF-B) regulate cytoskeletal genes through their partner transcription factor SRF. The MRTFs bind G-actin, and signal-regulated changes in cellular G-actin concentration control their nuclear accumulation. The MRTFs also undergo Rho- and ERK-dependent phosphorylation, but the function of MRTF phosphorylation, and the elements and signals involved in MRTF-A nuclear export are largely unexplored. We show that Rho-dependent MRTF-A phosphorylation reflects relief from an inhibitory function of nuclear actin. We map multiple sites of serum-induced phosphorylation, most of which are S/T-P motifs and show that S/T-P phosphorylation is required for transcriptional activation. ERK-mediated S98 phosphorylation inhibits assembly of G-actin complexes on the MRTF-A regulatory RPEL domain, promoting nuclear import. In contrast, S33 phosphorylation potentiates the activity of an autonomous Crm1-dependent N-terminal NES, which cooperates with five other NES elements to exclude MRTF-A from the nucleus. Phosphorylation thus plays positive and negative roles in the regulation of MRTF-A. DOI: PMID:27304076

  3. WDR82 Negatively Regulates Cellular Antiviral Response by Mediating TRAF3 Polyubiquitination in Multiple Cell Lines

    PubMed Central

    Zhu, Kun; Wang, Xiang; Ju, Lin-Gao; Zhu, Yuan; Yao, Jie; Wang, Yanyi


    Upon virus infection, retinoic acid–inducible gene I–like receptors in host cells recognize viral RNA and activate type I IFN expression. Previously, we identified WD repeat domain (WDR) 5 as one positive regulator for pathway activation. In this study, we report that WDR82, a homolog protein of WDR5, acts opposite to WDR5 and inhibits the activation of the retinoic acid–inducible gene I signaling pathway. WDR82 overexpression inhibits virus-triggered pathway activation, whereas its knockdown enhances induced IFN-β expression. WDR82 is localized on the mitochondria, and its first N-terminal WD40 domain is critical for localization. WDR82 interacts with TNFR-associated factor (TRAF) 3, and its overexpression promotes K48-linked, but not K63-linked, polyubiquitination on TRAF3. Furthermore, WDR82 knockdown inhibits viral replication in the cell, whereas its overexpression has the opposite effect. Interestingly, WDR82 regulates Sendai virus–induced IFNB1 expression in a cell type–specific manner. Taken together, our findings demonstrate that WDR82 is a negative regulator of virus-triggered type I IFNs pathway through mediating TRAF3 polyubiquitination status and stability on mitochondria. PMID:26519536

  4. Induction of Posttranslational Modifications of Mitochondrial Proteins by ATP Contributes to Negative Regulation of Mitochondrial Function

    PubMed Central

    Zhang, Yong; Zhao, Zhiyun; Ke, Bilun; Wan, Lin; Wang, Hui; Ye, Jianping


    It is generally accepted that ATP regulates mitochondrial function through the AMPK signaling pathway. However, the AMPK-independent pathway remains largely unknown. In this study, we investigated ATP surplus in the negative regulation of mitochondrial function with a focus on pyruvate dehydrogenase (PDH) phosphorylation and protein acetylation. PDH phosphorylation was induced by a high fat diet in the liver of obese mice, which was associated with ATP elevation. In 1c1c7 hepatoma cells, the phosphorylation was induced by palmitate treatment through induction of ATP production. The phosphorylation was associated with a reduction in mitochondria oxygen consumption after 4 h treatment. The palmitate effect was blocked by etomoxir, which inhibited ATP production through suppression of fatty acid β-oxidation. The PDH phosphorylation was induced by incubation of mitochondrial lysate with ATP in vitro without altering the expression of PDH kinase 2 (PDK2) and 4 (PDK4). In addition, acetylation of multiple mitochondrial proteins was induced by ATP in the same conditions. Acetyl-CoA exhibited a similar activity to ATP in induction of the phosphorylation and acetylation. These data suggest that ATP elevation may inhibit mitochondrial function through induction of the phosphorylation and acetylation of mitochondrial proteins. The results suggest an AMPK-independent mechanism for ATP regulation of mitochondrial function. PMID:26930489

  5. An Arabidopsis SUMO E3 Ligase, SIZ1, Negatively Regulates Photomorphogenesis by Promoting COP1 Activity

    PubMed Central

    Lin, Xiao-Li; Niu, De; Hu, Zi-Liang; Kim, Dae Heon; Jin, Yin Hua; Cai, Bin; Liu, Peng; Miura, Kenji; Yun, Dae-Jin; Kim, Woe-Yeon; Lin, Rongcheng


    COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1), a ubiquitin E3 ligase, is a central negative regulator of photomorphogenesis. However, how COP1 activity is regulated by post-translational modifications remains largely unknown. Here we show that SUMO (small ubiquitin-like modifier) modification enhances COP1 activity. Loss-of-function siz1 mutant seedlings exhibit a weak constitutive photomorphogenic phenotype. SIZ1 physically interacts with COP1 and mediates the sumoylation of COP1. A K193R substitution in COP1 blocks its SUMO modification and reduces COP1 activity in vitro and in planta. Consistently, COP1 activity is reduced in siz1 and the level of HY5, a COP1 target protein, is increased in siz1. Sumoylated COP1 may exhibits higher transubiquitination activity than does non-sumoylated COP1, but SIZ1-mediated SUMO modification does not affect COP1 dimerization, COP1-HY5 interaction, and nuclear accumulation of COP1. Interestingly, prolonged light exposure reduces the sumoylation level of COP1, and COP1 mediates the ubiquitination and degradation of SIZ1. These regulatory mechanisms may maintain the homeostasis of COP1 activity, ensuing proper photomorphogenic development in changing light environment. Our genetic and biochemical studies identify a function for SIZ1 in photomorphogenesis and reveal a novel SUMO-regulated ubiquitin ligase, COP1, in plants. PMID:27128446

  6. Piwi maintains germline stem cells and oogenesis in Drosophila through negative regulation of Polycomb group proteins.


    Peng, Jamy C; Valouev, Anton; Liu, Na; Lin, Haifan


    The Drosophila melanogaster Piwi protein regulates both niche and intrinsic mechanisms to maintain germline stem cells, but its underlying mechanism remains unclear. Here we report that Piwi interacts with Polycomb group complexes PRC1 and PRC2 in niche and germline cells to regulate ovarian germline stem cells and oogenesis. Piwi physically interacts with the PRC2 subunits Su(z)12 and Esc in the ovary and in vitro. Chromatin coimmunoprecipitation of Piwi, the PRC2 enzymatic subunit E(z), histone H3 trimethylated at lysine 27 (H3K27me3) and RNA polymerase II in wild-type and piwi mutant ovaries demonstrates that Piwi binds a conserved DNA motif at ∼ 72 genomic sites and inhibits PRC2 binding to many non-Piwi-binding genomic targets and H3K27 trimethylation. Moreover, Piwi influences RNA polymerase II activities in Drosophila ovaries, likely via inhibiting PRC2. We hypothesize that Piwi negatively regulates PRC2 binding by sequestering PRC2 in the nucleoplasm, thus reducing PRC2 binding to many targets and influencing transcription during oogenesis. PMID:26780607

  7. Piwi maintains germline stem cells and oogenesis in Drosophila through negative regulation of Polycomb Group proteins

    PubMed Central

    Peng, Jamy C.; Valouev, Anton; Liu, Na; Lin, Haifan


    The Drosophila Piwi protein regulates both niche and intrinsic mechanisms to maintain germline stem cells, but its underlying mechanism remains unclear. Here we report that Piwi cooperates with Polycomb Group complexes PRC1 and PRC2 in niche and germline cells to regulate ovarian germline stem cells and oogenesis. Piwi physically interacts with PRC2 subunits Su(z)12 and Esc in the ovary and in vitro. Chromatin co-immunoprecipitation of Piwi, the PRC2 enzymatic subunit E(z), lysine-27-tri-methylated histone 3 (H3K27m3), and RNA polymerase II in wild-type and piwi mutant ovaries reveals that Piwi binds a conserved DNA motif at ~72 genomic sites, and inhibits PRC2 binding to many non-Piwi-binding genomic targets and H3K27 tri-methylation. Moreover, Piwi influences RNA Polymerase II activities in Drosophila ovaries likely via inhibiting PRC2. We hypothesize that Piwi negatively regulates PRC2 binding by sequestering PRC2 in the nucleoplasm, thus reducing PRC2 binding to many targets and influences transcription during oogenesis. PMID:26780607

  8. Arabidopsis type B cytokinin response regulators ARR1, ARR10, and ARR12 negatively regulate plant responses to drought.


    Nguyen, Kien Huu; Ha, Chien Van; Nishiyama, Rie; Watanabe, Yasuko; Leyva-González, Marco Antonio; Fujita, Yasunari; Tran, Uven Thi; Li, Weiqiang; Tanaka, Maho; Seki, Motoaki; Schaller, G Eric; Herrera-Estrella, Luis; Tran, L S


    In this study, we used a loss-of-function approach to elucidate the functions of three Arabidopsis type B response regulators (ARRs)--namely ARR1, ARR10, and ARR12--in regulating the Arabidopsis plant responses to drought. The arr1,10,12 triple mutant showed a significant increase in drought tolerance versus WT plants, as indicated by its higher relative water content and survival rate on drying soil. This enhanced drought tolerance of arr1,10,12 plants can be attributed to enhanced cell membrane integrity, increased anthocyanin biosynthesis, abscisic acid (ABA) hypersensitivity, and reduced stomatal aperture, but not to altered stomatal density. Further drought-tolerance tests of lower-order double and single mutants indicated that ARR1, ARR10, and ARR12 negatively and redundantly control plant responses to drought, with ARR1 appearing to bear the most critical function among the three proteins. In agreement with these findings, a comparative genome-wide analysis of the leaves of arr1,10,12 and WT plants under both normal and dehydration conditions suggested a cytokinin (CK) signaling-mediated network controlling plant adaptation to drought via many dehydration/drought- and/or ABA-responsive genes that can provide osmotic adjustment and protection to cellular and membrane structures. Expression of all three ARR genes was repressed by dehydration and ABA treatments, inferring that plants down-regulate these genes as an adaptive mechanism to survive drought. Collectively, our results demonstrate that repression of CK response, and thus CK signaling, is one of the strategies plants use to cope with water deficit, providing novel insight for the design of drought-tolerant plants by genetic engineering.

  9. Arabidopsis type B cytokinin response regulators ARR1, ARR10, and ARR12 negatively regulate plant responses to drought.


    Nguyen, Kien Huu; Ha, Chien Van; Nishiyama, Rie; Watanabe, Yasuko; Leyva-González, Marco Antonio; Fujita, Yasunari; Tran, Uven Thi; Li, Weiqiang; Tanaka, Maho; Seki, Motoaki; Schaller, G Eric; Herrera-Estrella, Luis; Tran, L S


    In this study, we used a loss-of-function approach to elucidate the functions of three Arabidopsis type B response regulators (ARRs)--namely ARR1, ARR10, and ARR12--in regulating the Arabidopsis plant responses to drought. The arr1,10,12 triple mutant showed a significant increase in drought tolerance versus WT plants, as indicated by its higher relative water content and survival rate on drying soil. This enhanced drought tolerance of arr1,10,12 plants can be attributed to enhanced cell membrane integrity, increased anthocyanin biosynthesis, abscisic acid (ABA) hypersensitivity, and reduced stomatal aperture, but not to altered stomatal density. Further drought-tolerance tests of lower-order double and single mutants indicated that ARR1, ARR10, and ARR12 negatively and redundantly control plant responses to drought, with ARR1 appearing to bear the most critical function among the three proteins. In agreement with these findings, a comparative genome-wide analysis of the leaves of arr1,10,12 and WT plants under both normal and dehydration conditions suggested a cytokinin (CK) signaling-mediated network controlling plant adaptation to drought via many dehydration/drought- and/or ABA-responsive genes that can provide osmotic adjustment and protection to cellular and membrane structures. Expression of all three ARR genes was repressed by dehydration and ABA treatments, inferring that plants down-regulate these genes as an adaptive mechanism to survive drought. Collectively, our results demonstrate that repression of CK response, and thus CK signaling, is one of the strategies plants use to cope with water deficit, providing novel insight for the design of drought-tolerant plants by genetic engineering. PMID:26884175

  10. [Genetic regulation of human genital papillomaviruses].


    Alvarez-Salas, L M; López-Bayghen, E


    Human papillomavirus (HPV) specifically infect stratified epithelial cells, causing benign and malignant neoplasia. Several elements directing this virus' genetic expression are present in a non-coding region called LCR. HPV infection starts in the basal cells of stratified epithelia, where a particular combination of cellular factors interacting with the LCR starts the transcription of the viral E6 and E7 oncogenes. The E6 and E7 genes alter the cell cycle because they interact and inactivate tumor suppressor proteins: E6 binds and degrades protein p53 and E7 associates with p105RB. E1 and E2 are the next synthesized proteins. E2 blocks the early transcription and permits E1 specific binding to the viral origin of replication located within the LCR, initiating the viral genome replication. Following the course of viral infection, the E2-induced E6 and E7 down-regulation releases p53 and p105RB proteins, and the differentiation process can continue. Then, a putative late promoter can activate the capsid genes L1 and L2. At this step, mature virions can be detected in the upper layers of the epithelium. Disruption in E2 gene transcription is usually associated to genital malignant neoplasia. In the absence of E2, E6 and E7 remain constitutively expressed, sustaining the immortality of the infected cell and blocking the epithelial differentiation program.

  11. Negative regulation of RNA-binding protein HuR by tumor-suppressor ECRG2.


    Lucchesi, C; Sheikh, M S; Huang, Y


    Esophageal cancer-related gene 2 (ECRG2) is a newer tumor suppressor whose function in the regulation of cell growth and apoptosis remains to be elucidated. Here we show that ECRG2 expression was upregulated in response to DNA damage, and increased ECRG2 expression induced growth suppression in cancer cells but not in non-cancerous epithelial cells. ECRG2-mediated growth suppression was associated with activation of caspases and marked reduction in the levels of apoptosis inhibitor, X chromosome-linked inhibitor of apoptosis protein (XIAP). ECRG2, via RNA-binding protein human antigen R (HuR), regulated XIAP mRNA stability and expression. Furthermore, ECRG2 increased HuR ubiquitination and degradation but was unable to modulate the non-ubiquitinable mutant form of HuR. We also identified missense and frame-shift ECRG2 mutations in various human malignancies and noted that, unlike wild-type ECRG2, one cancer-derived ECRG2 mutant harboring glutamic acid instead of valine at position 30 (V30E) failed to induce cell death and activation of caspases. This naturally occurring V30E mutant also did not suppress XIAP and HuR. Importantly, the V30E mutant overexpressing cancer cells acquired resistance against multiple anticancer drugs, thus suggesting that ECRG2 mutations appear to have an important role in the acquisition of anticancer drug resistance in a subset of human malignancies.

  12. A failure of TNFAIP3 negative regulation maintains sustained NF-κB activation in Sjögren's syndrome.


    Sisto, Margherita; Lisi, Sabrina; Lofrumento, Dario Domenico; Ingravallo, Giuseppe; Maiorano, Eugenio; D'Amore, Massimo


    Sjögren's syndrome (SS) is characterized by the features of systemic autoimmunity and exocrine gland dysfunction and inflammation. Deregulated cytokine production is known to contribute to the etiology of SS but the underlying molecular mechanism is still remains to be unclear. TNF-α-induced protein 3 or TNFAIP3 is involved in the negative feedback regulation of nuclear factor-κB (NF-κB) signaling in response to specific pro-inflammatory stimuli in different cell types. To define the contribution of TNFAIP3 to SS, the levels of TNFAIP3 expression in human salivary gland epithelial cells (SGEC) derived from active primary SS patients were analyzed. Histological analysis was performed on paraffin-embedded human Sjögren's samples and healthy tissues. In separate experiments, immunofluorescence staining, western blot analysis and quantitative real-time PCR for TNFAIP3 was conducted in SGEC from SS and healthy subjects. Our findings clearly demonstrate changes in levels of the protein and gene expression between healthy controls and SS patients, depicting a very weak positivity for TNFAIP3 in SS samples. TNFAIP3 was found down-regulated in SGECs derived from SS patients in comparison with controls, and the cells with down-regulated TNFAIP3 expression exhibited enhanced NF-κB activities. In addition, to investigate the role of TNFAIP3 in the activation of NF-κB, we depleted TNFAIP3 expression by siRNA in healthy SGEC after treatment with or without TNF-α. Intriguingly, the silencing of TNFAIP3 by its siRNA in healthy SGEC increased NF-κB activation that could explain the deregulated cytokines production observed in SS.

  13. Seroprevalence of human herpesvirus 8 in human immunodeficiency virus 1-positive and human immunodeficiency virus 1-negative populations in Japan.


    Fujii, T; Taguchi, H; Katano, H; Mori, S; Nakamura, T; Nojiri, N; Nakajima, K; Tadokoro, K; Juji, T; Iwamoto, A


    To determine the seroprevalence of human herpesvirus 8 (HHV8) among human immunodeficiency virus 1 (HIV-1)-positive (HIV-1+) and HIV-1-negative (HIV-1-) populations in Japan, 276 HIV-1+ patients and 1,000 HIV-1- blood donors were enrolled in this study. Antibodies against HHV8 latency-associated nuclear antigen (LANA) were examined through indirect immunofluorescent assay by using a B-cell line that was infected latently with HHV8 (body cavity-based lymphoma 1). An HHV8- and Epstein-Barr virus-negative B-cell line (Ramos) was used as a control. Thirty-two seropositive cases against LANA (anti-LANA+) were identified among the 276 HIV-1+ patients who were studied. Five cases were foreigners living in Japan. The risk factor of all 27 Japanese cases was unprotected sexual intercourse, and the great majority of these cases (23 in 27; 85%) reported homosexual/bisexual behavior. Anti-LANA+ status correlated with the presence of sexually transmitted diseases, such as amoeba and HBV infection, further suggesting male homosexual behavior as the main route of HHV8 transmission in Japan. Only two LANA+ cases were identified among 1,000 HIV- blood donors in Japan; thus, seroprevalence of HHV8 identified by LANA was estimated to be 0.2% among HIV-1- populations in this country. PMID:9892401

  14. Poly r(C) binding protein (PCBP) 1 is a negative regulator of thyroid carcinoma

    PubMed Central

    Zhang, Mingpeng; Wang, Xin; Tan, Jin; Zhao, Minghui; Lian, Linjuan; Zhang, Weisan


    Poly r(C) binding protein (PCBP) 1 or heterogeneous ribonucleoprotein (hnRNP) E1 is a RNA binding protein functional in multiple biological processes. PCBP1 has been shown to function as a tumor suppressor by negatively regulating translation of EMT inducer proteins in different cancers. Loss of PCBP1 expression or its Akt2-mediated phosphorylation at serine residue 43 has both been indicated to de-repress its regulation of EMT inducer proteins. However, its role in thyroid carcinoma has not been elucidated. Here we report that PCBP1 expression is significantly downregulated in thyroid carcinoma patients. In vitro kinase assay revealed that immunoprecipitated PCBP1 from transient or stably transfected thyroid carcinoma cells can be phosphorylated by recombinant Akt2 kinase. In situ analysis revealed that PCBP1 is a putative target of miR-490-3p, which was further confirmed by PCBP1 3’UTR-based reporter assays using the wild-type or a miR-490 seed mutant 3’UTR. The endogenous regulation of the PCBP1 3’UTR reporter by miR-490-3p could be rescued by transfection of miR-490 antagomir in WRO and BCPAP cells. Stably overexpressing PCBP1 BCPAP cells attenuated tumor formation completely as compared to empty vector overexpressing cells in xenograft assay. Cumulatively, our results indicate that PCBP1 functions as a tumor suppressor in thyroid carcinoma and that its expression is down regulated by high expression of the miR-490-3p observed in thyroid carcinoma patients. PMID:27648147

  15. Poly r(C) binding protein (PCBP) 1 is a negative regulator of thyroid carcinoma.


    Zhang, Mingpeng; Wang, Xin; Tan, Jin; Zhao, Minghui; Lian, Linjuan; Zhang, Weisan


    Poly r(C) binding protein (PCBP) 1 or heterogeneous ribonucleoprotein (hnRNP) E1 is a RNA binding protein functional in multiple biological processes. PCBP1 has been shown to function as a tumor suppressor by negatively regulating translation of EMT inducer proteins in different cancers. Loss of PCBP1 expression or its Akt2-mediated phosphorylation at serine residue 43 has both been indicated to de-repress its regulation of EMT inducer proteins. However, its role in thyroid carcinoma has not been elucidated. Here we report that PCBP1 expression is significantly downregulated in thyroid carcinoma patients. In vitro kinase assay revealed that immunoprecipitated PCBP1 from transient or stably transfected thyroid carcinoma cells can be phosphorylated by recombinant Akt2 kinase. In situ analysis revealed that PCBP1 is a putative target of miR-490-3p, which was further confirmed by PCBP1 3'UTR-based reporter assays using the wild-type or a miR-490 seed mutant 3'UTR. The endogenous regulation of the PCBP1 3'UTR reporter by miR-490-3p could be rescued by transfection of miR-490 antagomir in WRO and BCPAP cells. Stably overexpressing PCBP1 BCPAP cells attenuated tumor formation completely as compared to empty vector overexpressing cells in xenograft assay. Cumulatively, our results indicate that PCBP1 functions as a tumor suppressor in thyroid carcinoma and that its expression is down regulated by high expression of the miR-490-3p observed in thyroid carcinoma patients. PMID:27648147

  16. Poly r(C) binding protein (PCBP) 1 is a negative regulator of thyroid carcinoma

    PubMed Central

    Zhang, Mingpeng; Wang, Xin; Tan, Jin; Zhao, Minghui; Lian, Linjuan; Zhang, Weisan


    Poly r(C) binding protein (PCBP) 1 or heterogeneous ribonucleoprotein (hnRNP) E1 is a RNA binding protein functional in multiple biological processes. PCBP1 has been shown to function as a tumor suppressor by negatively regulating translation of EMT inducer proteins in different cancers. Loss of PCBP1 expression or its Akt2-mediated phosphorylation at serine residue 43 has both been indicated to de-repress its regulation of EMT inducer proteins. However, its role in thyroid carcinoma has not been elucidated. Here we report that PCBP1 expression is significantly downregulated in thyroid carcinoma patients. In vitro kinase assay revealed that immunoprecipitated PCBP1 from transient or stably transfected thyroid carcinoma cells can be phosphorylated by recombinant Akt2 kinase. In situ analysis revealed that PCBP1 is a putative target of miR-490-3p, which was further confirmed by PCBP1 3’UTR-based reporter assays using the wild-type or a miR-490 seed mutant 3’UTR. The endogenous regulation of the PCBP1 3’UTR reporter by miR-490-3p could be rescued by transfection of miR-490 antagomir in WRO and BCPAP cells. Stably overexpressing PCBP1 BCPAP cells attenuated tumor formation completely as compared to empty vector overexpressing cells in xenograft assay. Cumulatively, our results indicate that PCBP1 functions as a tumor suppressor in thyroid carcinoma and that its expression is down regulated by high expression of the miR-490-3p observed in thyroid carcinoma patients.

  17. Tamoxifen induces oxidative stress and apoptosis in oestrogen receptor-negative human cancer cell lines

    PubMed Central

    Ferlini, C; Scambia, G; Marone, M; Distefano, M; Gaggini, C; Ferrandina, G; Fattorossi, A; Isola, G; Panici, P Benedetti; Mancuso, S


    Recent data have demonstrated that the anti-oestrogen tamoxifen (TAM) is able to facilitate apoptosis in cancer cells not expressing oestrogen receptor (ER). In an attempt to identify the biochemical pathway for this phenomenon, we investigated the role of TAM as an oxidative stress agent. In two ER-negative human cancer cell lines, namely T-leukaemic Jurkat and ovarian A2780 cancer cells, we have demonstrated that TAM is able to generate oxidative stress, thereby causing thiol depletion and activation of the transcriptional factor NF-κB. As described for other oxidative agents, TAM was able to induce either cell proliferation or apoptosis depending on the dose. When used at the lowest dose tested (0.1 μM), a slight proliferative effect of TAM was noticed in terms of cell counts and DNA synthesis rate, whereas at higher doses (10 μM) a consistent occurrence of apoptosis was detected. Importantly, the induction of apoptosis by TAM is not linked to down-regulation or functional inactivation by phosphorylation of the antiapoptotic bcl-2 protein. © 1999 Cancer Research Campaign PMID:9888466

  18. Toll-Like Receptor 9 Alternatively Spliced Isoform Negatively Regulates TLR9 Signaling in Teleost Fish

    PubMed Central

    Chen, Nai-Yu; Nagarajan, Govindarajulu; Chiou, Pinwen Peter


    Toll-like receptor 9 (TLR9) recognizes and binds unmethylated CpG motifs in DNA, which are found in the genomes of bacteria and DNA viruses. In fish, Tlr9 is highly diverse, with the number of introns ranging from 0 to 4. A fish Tlr9 gene containing two introns has been reported to express two alternatively spliced isoforms, namely gTLR9A (full-length) and gTLR9B (with a truncated Cʹ-terminal signal transducing domain), whose regulation and function remain unclear. Here, we report a unique regulatory mechanism of gTLR9 signaling in orange-spotted grouper (Epinephelus coioides), whose gTlr9 sequence also contains two introns. We demonstrated that the grouper gTlr9 gene indeed has the capacity to produce two gTLR9 isoforms via alternative RNA splicing. We found that gTLR9B could function as a negative regulator to suppress gTLR9 signaling as demonstrated by the suppression of downstream gene expression. Following stimulation with CpG oligodeoxynucleotide (ODN), gTLR9A and gTLR9B were observed to translocate into endosomes and co-localize with ODN and the adaptor protein gMyD88. Both gTLR9A and gTLR9B could interact with gMyD88; however, gTLR9B could not interact with downstream IRAK4 and TRAF6. Further analysis of the expression profile of gTlr9A and gTlr9B upon immune-stimulation revealed that the two isoforms were differentially regulated in a time-dependent manner. Overall, these data suggest that fish TLR9B functions as a negative regulator, and that its temporal expression is mediated by alternative RNA splicing. This has not been observed in mammalian TLR9s and might have been acquired relatively recently in the evolution of fish. PMID:25955250

  19. An aza-anthrapyrazole negatively regulates Th1 activity and suppresses experimental autoimmune encephalomyelitis.


    Clark, Matthew P; Leaman, Douglas W; Hazelhurst, Lori A; Hwang, Eun S; Quinn, Anthony


    Previously we showed that BBR3378, a novel analog of the anticancer drug mitoxantrone, had the ability to ameliorate ascending paralysis in MOG35-55-induced experimental autoimmune encephalomyelitis (EAE), a murine model of human multiple sclerosis, without the drug-induced cardiotoxicity or lymphopenia associated with mitoxantrone therapy. Chemotherapeutic drugs like mitoxantrone, a topoisomerase inhibitor, are thought to provide protection in inflammatory autoimmune diseases like EAE by inducing apoptosis in rapidly proliferating autoreactive lymphocytes. Here, we show that while BR3378 blocked cell division, T cells were still able to respond to antigenic stimulation and upregulate surface molecules indicative of activation. However, in contrast to mitoxantrone, BBR3378 inhibited the production of the proinflammatory cytokine IFN-γ both in recently activated T cell blasts and established Th1 effectors, while sparing the activities of IL-13-producing Th2 cells. IFN-γ is known to be regulated by the transcription factor T-bet. In addition to IFN-γ, in vitro and in vivo exposure to BBR3378 suppressed the expression of other T-bet regulated proteins, including CXCR3 and IL-2Rβ. Microarray analysis revealed BBR3378-induced suppression of additional T-bet regulated genes, suggesting that the drug might disrupt global Th1 programming. Importantly, BBR3378 antagonized ongoing Th1 autoimmune responses in vivo, modulated clinical disease and CNS inflammation in acute and relapsing forms of EAE. Therefore, BBR3378 may be a unique inhibitor of T-bet regulated genes and may have potential as a therapeutic intervention in human autoimmune disease. PMID:26709219

  20. 75 FR 21508 - Health and Human Services Acquisition Regulation; Corrections

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... HUMAN SERVICES 48 CFR Chapter 3 Health and Human Services Acquisition Regulation; Corrections AGENCY: Department of Health and Human Services. ACTION: Correcting amendments. SUMMARY: This action corrects minor errors, inconsistencies and omissions in the final rule, which revised the Health and Human...

  1. The transcription factor GFI1 negatively regulates NLRP3 inflammasome activation in macrophages.


    Zhu, Liuluan; Meng, Qingcai; Liang, Shuntao; Ma, Yaluan; Li, Rui; Li, Guoli; Zeng, Hui


    Interleukin-1β (IL-1β) secretion downstream of Toll-like receptor (TLR) activation is tightly controlled at the transcriptional and post-translational levels. NLRP3 inflammasome is involved in the maturation of pro-IL-1β, with NLRP3 expression identified as the limiting factor for inflammasome activation. Previously, we had demonstrated that the zinc-finger protein GFI1 inhibits pro-IL-1β transcription. Here, we show that GFI1 inhibits NLRP3 inflammasome activation and IL-1β secretion in macrophages. GFI1 suppressed Nlrp3 transcription via two mechanisms: (1) by binding to the Gli-responsive element 1 (GRE1) in the Nlrp3 promoter; and (2) by antagonizing the nuclear factor-κB (NF-κB) transcriptional activity. Thus, GFI1 negatively regulates TLR-mediated IL-1β production at both transcriptional and post-translational levels.

  2. Ephrins as negative regulators of adult neurogenesis in diverse regions of the central nervous system

    PubMed Central

    Jiao, Jian-wei; Feldheim, David A.; Chen, Dong Feng


    In the central nervous system (CNS) of adult mammals, neurogenesis occurs in only two restricted areas, the subgranular zone (SGZ) of the hippocampus and the subventricular zone (SVZ). Isolation of multipotent progenitor cells from other CNS regions suggests that their neurogenic potential is dictated by local environmental cues. Here, we report that astrocytes in areas outside of the SGZ and SVZ of adult mice express high levels of ephrin-A2 and -A3, which present an inhibitory niche, negatively regulating neural progenitor cell growth. Adult mice lacking both ephrin-A2 and -A3 display active ongoing neurogenesis throughout the CNS. These findings suggest that neural cell replacement therapies for neurodegeneration or injury in the adult CNS may be achieved by manipulating ephrin signaling pathways. PMID:18562299

  3. Negative regulation of parathyroid hormone-related protein expression by steroid hormones.


    Kajitani, Takashi; Tamamori-Adachi, Mimi; Okinaga, Hiroko; Chikamori, Minoru; Iizuka, Masayoshi; Okazaki, Tomoki


    Elevated parathyroid hormone-related protein (PTHrP) is responsible for humoral hypercalcemia of malignancy (HHM), which is of clinical significance in treatment of terminal patients with malignancies. Steroid hormones were known to cause suppression of PTHrP expression. However, detailed studies linking multiple steroid hormones to PTHrP expression are lacking. Here we studied PTHrP expression in response to steroid hormones in four cell lines with excessive PTHrP production. Our study established that steroid hormones negatively regulate PTHrP expression. Vitamin D receptor, estrogen receptor α, glucocorticoid receptor, and progesterone receptor, were required for repression of PTHrP expression by the cognate ligands. A notable exception was the androgen receptor, which was dispensable for suppression of PTHrP expression in androgen-treated cells. We propose a pathway(s) involving nuclear receptors to suppress PTHrP expression.

  4. Abscisic acid is a negative regulator of root gravitropism in Arabidopsis thaliana.


    Han, Woong; Rong, Honglin; Zhang, Hanma; Wang, Myeong-Hyeon


    The plant hormone abscisic acid (ABA) plays a role in root gravitropism and has led to an intense debate over whether ABA acts similar to auxin by translating the gravitational signal into directional root growth. While tremendous advances have been made in the past two decades in establishing the role of auxin in root gravitropism, little progress has been made in characterizing the role of ABA in this response. In fact, roots of plants that have undetectable levels of ABA and that display a normal gravitropic response have raised some serious doubts about whether ABA plays any role in root gravitropism. Here, we show strong evidence that ABA plays a role opposite to that of auxin and that it is a negative regulator of the gravitropic response of Arabidopsis roots.

  5. IRTKS negatively regulates antiviral immunity through PCBP2 sumoylation-mediated MAVS degradation

    PubMed Central

    Xia, Pengyan; Wang, Shuo; Xiong, Zhen; Ye, Buqing; Huang, Li-Yu; Han, Ze-Guang; Fan, Zusen


    RNA virus infection is recognized by the RIG-I family of receptors that activate the mitochondrial adaptor MAVS, leading to the clearance of viruses. Antiviral signalling activation requires strict modulation to avoid damage to the host from exacerbated inflammation. Insulin receptor tyrosine kinase substrate (IRTKS) participates in actin bundling and insulin signalling and its deficiency causes insulin resistance. However, whether IRTKS is involved in the regulation of innate immunity remains elusive. Here we show that IRTKS deficiency causes enhanced innate immune responses against RNA viruses. IRTKS-mediated suppression of antiviral responses depends on the RIG-I-MAVS signalling pathway. IRTKS recruits the E2 ligase Ubc9 to sumoylate PCBP2 in the nucleus, which causes its cytoplasmic translocation during viral infection. The sumoylated PCBP2 associates with MAVS to initiate its degradation, leading to downregulation of antiviral responses. Thus, IRTKS functions as a negative modulator of excessive inflammation. PMID:26348439

  6. The phosphatase Dullard negatively regulates BMP signalling and is essential for nephron maintenance after birth.


    Sakaguchi, Masaji; Sharmin, Sazia; Taguchi, Atsuhiro; Ohmori, Tomoko; Fujimura, Sayoko; Abe, Takaya; Kiyonari, Hiroshi; Komatsu, Yoshihiro; Mishina, Yuji; Asashima, Makoto; Araki, Eiichi; Nishinakamura, Ryuichi


    Most kidney nephron components, including glomeruli and renal tubules, derive from the metanephric mesenchyme. The overall differentiation into each component finishes at birth, but the molecular events linking the perinatal and adult kidneys remain elusive. Dullard was cloned from Xenopus kidneys, and encodes a phosphatase that negatively regulates BMP signalling. Here we report that Dullard deletion in the murine metanephric mesenchyme leads to failure of nephron maintenance after birth, resulting in lethality before adulthood. The nephron components are lost by massive apoptosis within 3 weeks after birth, leading to formation of a large hollow with a thin-layered cortex and medulla. Phosphorylated Smad1/5/8 is upregulated in the mutant nephrons, probably through cell-autonomous inhibitory effects of Dullard on BMP signalling. Importantly, administration of the BMP receptor kinase inhibitor LDN-193189 partially rescued the defects caused by Dullard deletion. Thus, Dullard keeps BMP signalling at an appropriate level, which is required for nephron maintenance in the postnatal period.

  7. Models of aire-dependent gene regulation for thymic negative selection.


    Danso-Abeam, Dina; Humblet-Baron, Stephanie; Dooley, James; Liston, Adrian


    Mutations in the autoimmune regulator (AIRE) gene lead to autoimmune polyendocrinopathy syndrome type 1 (APS1), characterized by the development of multi-organ autoimmune damage. The mechanism by which defects in AIRE result in autoimmunity has been the subject of intense scrutiny. At the cellular level, the working model explains most of the clinical and immunological characteristics of APS1, with AIRE driving the expression of tissue-restricted antigens (TRAs) in the epithelial cells of the thymic medulla. This TRA expression results in effective negative selection of TRA-reactive thymocytes, preventing autoimmune disease. At the molecular level, the mechanism by which AIRE initiates TRA expression in the thymic medulla remains unclear. Multiple different models for the molecular mechanism have been proposed, ranging from classical transcriptional activity, to random induction of gene expression, to epigenetic tag recognition effect, to altered cell biology. In this review, we evaluate each of these models and discuss their relative strengths and weaknesses.

  8. A Putative PP2C-Encoding Gene Negatively Regulates ABA Signaling in Populus euphratica

    PubMed Central

    Chen, Jinhuan; Zhang, Dongzhi; Zhang, Chong; Xia, Xinli; Yin, Weilun; Tian, Qianqian


    A PP2C homolog gene was cloned from the drought-treated cDNA library of Populus euphratica. Multiple sequence alignment analysis suggested that the gene is a potential ortholog of HAB1. The expression of this HAB1 ortholog (PeHAB1) was markedly induced by drought and moderately induced by ABA. To characterize its function in ABA signaling, we generated transgenic Arabidopsis thaliana plants overexpressing this gene. Transgenic lines exhibited reduced responses to exogenous ABA and reduced tolerance to drought compared to wide-type lines. Yeast two-hybrid analyses indicated that PeHAB1 could interact with the ABA receptor PYL4 in an ABA-independent manner. Taken together; these results indicated that PeHAB1 is a new negative regulator of ABA responses in poplar. PMID:26431530

  9. Expression of microRNAs in HPV negative tonsil cancers and their regulation of PDCD4.


    Khoury, Samantha; Ahadi, Alireza; Zhang, Xiaoying; Tran, Nham


    Global rates of tonsil cancer have been increasing since the turn of the millennia, however we still have a limited understanding of the genes and pathways which control this disease. This array dataset which is linked to our publication (Zhang et al., 2015) describes the profiling of human miRNAs in tonsil and normal adjacent tissues. With this dataset, we identified a list of microRNA (miRNA) which were highly over represented in tonsil cancers and showed that several miRNAs were able to regulate the tumour suppressor PDCD4 in a temporal manner. The dataset has been deposited into Gene Expression Omnibus (GSE75630). PMID:27222808

  10. Smart conjugated polymer nanocarrier for healthy weight loss by negative feedback regulation of lipase activity

    NASA Astrophysics Data System (ADS)

    Chen, Yu-Lei; Zhu, Sha; Zhang, Lei; Feng, Pei-Jian; Yao, Xi-Kuang; Qian, Cheng-Gen; Zhang, Can; Jiang, Xi-Qun; Shen, Qun-Dong


    Healthy weight loss represents a real challenge when obesity is increasing in prevalence. Herein, we report a conjugated polymer nanocarrier for smart deactivation of lipase and thus balancing calorie intake. After oral administration, the nanocarrier is sensitive to lipase in the digestive tract and releases orlistat, which deactivates the enzyme and inhibits fat digestion. It also creates negative feedback to control the release of itself. The nanocarrier smartly regulates activity of the lipase cyclically varied between high and low levels. In spite of high fat diet intervention, obese mice receiving a single dose of the nanocarrier lose weight over eight days, whereas a control group continues the tendency to gain weight. Daily intragastric administration of the nanocarrier leads to lower weight of livers or fat pads, smaller adipocyte size, and lower total cholesterol level than that of the control group. Near-infrared fluorescence of the nanocarrier reveals its biodistribution.Healthy weight loss represents a real challenge when obesity is increasing in prevalence. Herein, we report a conjugated polymer nanocarrier for smart deactivation of lipase and thus balancing calorie intake. After oral administration, the nanocarrier is sensitive to lipase in the digestive tract and releases orlistat, which deactivates the enzyme and inhibits fat digestion. It also creates negative feedback to control the release of itself. The nanocarrier smartly regulates activity of the lipase cyclically varied between high and low levels. In spite of high fat diet intervention, obese mice receiving a single dose of the nanocarrier lose weight over eight days, whereas a control group continues the tendency to gain weight. Daily intragastric administration of the nanocarrier leads to lower weight of livers or fat pads, smaller adipocyte size, and lower total cholesterol level than that of the control group. Near-infrared fluorescence of the nanocarrier reveals its biodistribution

  11. PECAM-1 negatively regulates GPIb/V/IX signaling in murine platelets.


    Rathore, Vipul; Stapleton, Michelle A; Hillery, Cheryl A; Montgomery, Robert R; Nichols, Timothy C; Merricks, Elizabeth P; Newman, Debra K; Newman, Peter J


    Platelet adhesion at sites of vascular injury is mediated, in part, by interaction of the platelet plasma membrane glycoprotein (GP) Ib/V/IX complex with von Willebrand Factor (VWF) presented on collagen-exposed surfaces. Recent studies indicate that GPIb/V/IX may be functionally coupled with the Fc receptor gamma (FcR gamma)-chain, which, by virtue of its cytoplasmic immunoreceptor tyrosine-based activation motif, sends activation signals into the cell. Platelet endothelial cell adhesion molecule-1 (PECAM-1) is an inhibitory receptor that has previously been shown to negatively regulate platelet responses to collagen, which transduces activation signals via the GPVI/FcR gamma-chain complex. To determine whether PECAM-1 might similarly regulate signals emanating from GPIb/FcR gamma, we compared activation and aggregation responses to VWF of PECAM-1-positive and PECAM-1-deficient murine platelets. PECAM-1 and the FcR gamma-chain became rapidly tyrosine phosphorylated in platelets following botrocetin-induced VWF binding, but FcR gamma-chain tyrosine phosphorylation was delayed in PECAM-1-positive, versus PECAM-1-deficient, platelets. PECAM-1-deficient platelets were hyperaggregable to VWF, exhibited enhanced spreading and, under conditions of arterial flow, formed markedly larger thrombi on immobilized VWF than did wild-type platelets. Taken together, these data support the notion that engagement of the GPIb complex, in addition to sending activation signals, also initiates a negative feedback loop involving PECAM-1 that controls the rate and extent of platelet activation. PMID:12893757

  12. The Lipid-Modifying Enzyme SMPDL3B Negatively Regulates Innate Immunity

    PubMed Central

    Heinz, Leonhard X.; Baumann, Christoph L.; Köberlin, Marielle S.; Snijder, Berend; Gawish, Riem; Shui, Guanghou; Sharif, Omar; Aspalter, Irene M.; Müller, André C.; Kandasamy, Richard K.; Breitwieser, Florian P.; Pichlmair, Andreas; Bruckner, Manuela; Rebsamen, Manuele; Blüml, Stephan; Karonitsch, Thomas; Fauster, Astrid; Colinge, Jacques; Bennett, Keiryn L.; Knapp, Sylvia; Wenk, Markus R.; Superti-Furga, Giulio


    Summary Lipid metabolism and receptor-mediated signaling are highly intertwined processes that cooperate to fulfill cellular functions and safeguard cellular homeostasis. Activation of Toll-like receptors (TLRs) leads to a complex cellular response, orchestrating a diverse range of inflammatory events that need to be tightly controlled. Here, we identified the GPI-anchored Sphingomyelin Phosphodiesterase, Acid-Like 3B (SMPDL3B) in a mass spectrometry screening campaign for membrane proteins co-purifying with TLRs. Deficiency of Smpdl3b in macrophages enhanced responsiveness to TLR stimulation and profoundly changed the cellular lipid composition and membrane fluidity. Increased cellular responses could be reverted by re-introducing affected ceramides, functionally linking membrane lipid composition and innate immune signaling. Finally, Smpdl3b-deficient mice displayed an intensified inflammatory response in TLR-dependent peritonitis models, establishing its negative regulatory role in vivo. Taken together, our results identify the membrane-modulating enzyme SMPDL3B as a negative regulator of TLR signaling that functions at the interface of membrane biology and innate immunity. PMID:26095358

  13. Negative feedback regulation of UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.


    Gruber, Henriette; Heijde, Marc; Heller, Werner; Albert, Andreas; Seidlitz, Harald K; Ulm, Roman


    Plants respond to low levels of UV-B radiation with a coordinated photomorphogenic response that allows acclimation to this environmental stress factor. The key players in this UV-B response are COP1 (an E3 ubiquitin ligase), UVR8 (a β-propeller protein), and HY5 (a bZIP transcription factor). We have shown previously that an elevated UV-B-specific response is associated with dwarf growth, indicating the importance of balancing UV-B-specific signaling. Negative regulators of this pathway are not known, however. Here, we describe two highly related WD40-repeat proteins, REPRESSOR OF UV-B PHOTOMORPHOGENESIS 1 (RUP1) and RUP2, that interact directly with UVR8 as potent repressors of UV-B signaling. Both genes were transcriptionally activated by UV-B in a COP1-, UVR8-, and HY5-dependent manner. rup1 rup2 double mutants showed an enhanced response to UV-B and elevated UV-B tolerance after acclimation. Overexpression of RUP2 resulted in reduced UV-B-induced photomorphogenesis and impaired acclimation, leading to hypersensitivity to UV-B stress. These results are consistent with an important regulatory role for RUP1 and RUP2, which act downstream of UVR8-COP1 in a negative feedback loop impinging on UVR8 function, balancing UV-B defense measures and plant growth.

  14. DCIR negatively regulates CpG-ODN-induced IL-1β and IL-6 production.


    Zhao, Xibao; Shen, Yaping; Hu, Weiwei; Chen, Junru; Wu, Tian; Sun, Xiaoqiang; Yu, Juan; Wu, Tingting; Chen, Weilin


    C-type lectin receptors (CLR) are a diverse family of proteins mainly expressed on antigen-presenting cells (APC). As antigen-uptake and signaling receptors, CLR modulate immune responses of APC. The dendritic cell immunoreceptor (DCIR) is a member of CLR and has an immunoreceptor tyrosine based inhibitory motif (ITIM) in cytoplasmic tail, which is believed to play a negative role in cellular responses after antigen exposure. In addition to pathogen recognition, DCIR has been shown to be pivotal in preventing autoimmune disease by controlling dendritic cell proliferation. However, much less is known about the role of DCIR in innate immunity and its crosstalk with the Toll like receptors (TLR) pathway. In this study, we demonstrate that CpG-ODN stimulation can promote DCIR expression in macrophages and DCIR triggering inhibits the production of CpG-ODN-induced proinflammatory cytokines. We further confirm that siRNA-mediated knockdown of DCIR expression enhances CpG-ODN-induced phosphorylation of Erk1/2, JNK1/2 and p38 in macrophages. Collectively, these results indicate that DCIR is a negatively regulator in TLR9-mediated innate immune response. PMID:26514427

  15. A Longitudinal Study of Emotion Regulation, Emotion Lability-Negativity, and Internalizing Symptomatology in Maltreated and Nonmaltreated Children

    ERIC Educational Resources Information Center

    Kim-Spoon, Jungmeen; Cicchetti, Dante; Rogosch, Fred A.


    The longitudinal contributions of emotion regulation and emotion lability-negativity to internalizing symptomatology were examined in a low-income sample (171 maltreated and 151 nonmaltreated children, from age 7 to 10 years). Latent difference score models indicated that for both maltreated and nonmaltreated children, emotion regulation was a…

  16. Neuronal leucine-rich repeat 1 negatively regulates anaplastic lymphoma kinase in neuroblastoma.


    Satoh, Shunpei; Takatori, Atsushi; Ogura, Atsushi; Kohashi, Kenichi; Souzaki, Ryota; Kinoshita, Yoshiaki; Taguchi, Tomoaki; Hossain, Md Shamim; Ohira, Miki; Nakamura, Yohko; Nakagawara, Akira


    In neuroblastoma (NB), one of the most common paediatric solid tumours, activation of anaplastic lymphoma kinase (ALK) is often associated with poor outcomes. Although genetic studies have identified copy number alteration and nonsynonymous mutations of ALK, the regulatory mechanism of ALK signalling at protein levels is largely elusive. Neuronal leucine-rich repeat 1 (NLRR1) is a type 1 transmembrane protein that is highly expressed in unfavourable NB and potentially influences receptor tyrosine kinase signalling. Here, we showed that NLRR1 and ALK exhibited a mutually exclusive expression pattern in primary NB tissues by immunohistochemistry. Moreover, dorsal root ganglia of Nlrr1+/+ and Nlrr1-/- mice displayed the opposite expression patterns of Nlrr1 and Alk. Of interest, NLRR1 physically interacted with ALK in vitro through its extracellular region. Notably, the NLRR1 ectodomain impaired ALK phosphorylation and proliferation of ALK-mutated NB cells. A newly identified cleavage of the NLRR1 ectodomain also supported NLRR1-mediated ALK signal regulation in trans. Thus, we conclude that NLRR1 appears to be an extracellular negative regulator of ALK signalling in NB and neuronal development. Our findings may be beneficial to comprehend NB heterogeneity and to develop a novel therapy against unfavourable NB.

  17. MDM1 is a microtubule-binding protein that negatively regulates centriole duplication

    PubMed Central

    Van de Mark, Daniel; Kong, Dong; Loncarek, Jadranka; Stearns, Tim


    Mouse double-minute 1 (Mdm1) was originally identified as a gene amplified in transformed mouse cells and more recently as being highly up-regulated during differentiation of multiciliated epithelial cells, a specialized cell type having hundreds of centrioles and motile cilia. Here we show that the MDM1 protein localizes to centrioles of dividing cells and differentiating multiciliated cells. 3D-SIM microscopy showed that MDM1 is closely associated with the centriole barrel, likely residing in the centriole lumen. Overexpression of MDM1 suppressed centriole duplication, whereas depletion of MDM1 resulted in an increase in granular material that likely represents early intermediates in centriole formation. We show that MDM1 binds microtubules in vivo and in vitro. We identified a repeat motif in MDM1 that is required for efficient microtubule binding and found that these repeats are also present in CCSAP, another microtubule-binding protein. We propose that MDM1 is a negative regulator of centriole duplication and that its function is mediated through microtubule binding. PMID:26337392

  18. BLOS2 negatively regulates Notch signaling during neural and hematopoietic stem and progenitor cell development

    PubMed Central

    Zhou, Wenwen; He, Qiuping; Zhang, Chunxia; He, Xin; Cui, Zongbin; Liu, Feng; Li, Wei


    Notch signaling plays a crucial role in controling the proliferation and differentiation of stem and progenitor cells during embryogenesis or organogenesis, but its regulation is incompletely understood. BLOS2, encoded by the Bloc1s2 gene, is a shared subunit of two lysosomal trafficking complexes, biogenesis of lysosome-related organelles complex-1 (BLOC-1) and BLOC-1-related complex (BORC). Bloc1s2−/− mice were embryonic lethal and exhibited defects in cortical development and hematopoiesis. Loss of BLOS2 resulted in elevated Notch signaling, which consequently increased the proliferation of neural progenitor cells and inhibited neuronal differentiation in cortices. Likewise, ablation of bloc1s2 in zebrafish or mice led to increased hematopoietic stem and progenitor cell production in the aorta-gonad-mesonephros region. BLOS2 physically interacted with Notch1 in endo-lysosomal trafficking of Notch1. Our findings suggest that BLOS2 is a novel negative player in regulating Notch signaling through lysosomal trafficking to control multiple stem and progenitor cell homeostasis in vertebrates. DOI: PMID:27719760

  19. Purification and Crystallization of Murine Myostatin: A Negative Regulator of Muscle Mass

    NASA Technical Reports Server (NTRS)

    Hong, Young S.; Adamek, Daniel; Bridge, Kristi; Malone, Christine C.; Young, Ronald B.; Miller, Teresa; Karr, Laurel


    Myostatin (MSTN) has been crystallized and its preliminary X-ray diffraction data were collected. MSTN is a negative regulator of muscle growt/differentiation and suppressor of fat accumulation. It is a member of TGF-b family of proteins. Like other members of this family, the regulation of MSTN is critically tied to its process of maturation. This process involves the formation of a homodimer followed by two proteolytic steps. The first proteolytic cleavage produces a species where the n-terminal portion of the dimer is covalently separated from, but remains non-covalently bound to, the c-terminal, functional, portion of the protein. The protein is activated upon removal of the n-terminal "pro-segment" by a second n-terminal proteolytic cut by BMP-1 in vivo, or by acid treatment in vitro. Understanding the structural nature and physical interactions involved in these regulatory processes is the objective of our studies. Murine MSTN was purified from culture media of genetically engineered Chinese Hamster Ovary cells by multicolumn purification process and crystallized using the vapor diffusion method.

  20. Akt2 negatively regulates assembly of the POSH-MLK-JNK signaling complex.


    Figueroa, Claudia; Tarras, Samantha; Taylor, Jennifer; Vojtek, Anne B


    We demonstrate that POSH, a scaffold for the JNK signaling pathway, binds to Akt2. A POSH mutant that is unable to bind Akt2 (POSH W489A) exhibits enhanced-binding to MLK3, and this increase in binding is accompanied by increased activation of the JNK signaling pathway. In addition, we show that the association of MLK3 with POSH is increased upon inhibition of the endogenous phosphatidylinositol 3-kinase/Akt signaling pathway. Thus, the assembly of an active JNK signaling complex by POSH is negatively regulated by Akt2. Further, the level of Akt-phosphorylated MLK3 is reduced in cells expressing the Akt2 binding domain of POSH, which acts as a dominant interfering protein. Taken together, our results support a model in which Akt2 binds to a POSH-MLK-MKK-JNK complex and phosphorylates MLK3; phosphorylation of MLK3 by Akt2 results in the disassembly of the JNK complex bound to POSH and down-regulation of the JNK signaling pathway.

  1. The PhoP transcription factor negatively regulates avermectin biosynthesis in Streptomyces avermitilis.


    Yang, Renjun; Liu, Xingchao; Wen, Ying; Song, Yuan; Chen, Zhi; Li, Jilun


    Bacteria sense and respond to the stress of phosphate limitation, anticipating Pi deletion/starvation via the two-component PhoR-PhoP system. The role of the response regulator PhoP in primary metabolism and avermectin biosynthesis in Streptomyces avermitilis was investigated. In response to phosphate starvation, S. avermitilis PhoP, like Streptomyces coelicolor and Streptomyces lividans PhoP, activates the expression of phoRP, phoU, and pstS by binding to the PHO boxes in their promoter regions. Avermectin biosynthesis was significantly increased in ΔphoP deletion mutants. Electrophoretic mobility gel shift assay (EMSA) and DNase I footprinting assays showed that PhoP can bind to a PHO box formed by two direct repeat units of 11 nucleotides located downstream of the transcriptional start site of aveR. By negatively regulating the transcription of aveR, PhoP directly affects avermectin biosynthesis in S. avermitilis. PhoP indirectly affects melanogenesis on Casaminoacids Minimal Medium (MMC) lacking supplemental phosphate. Nitrogen metabolism and some key genes involved in morphological differentiation and antibiotic production in S. avermitilis are also under the control of PhoP.

  2. The Arabidopsis thaliana NGATHA transcription factors negatively regulate cell proliferation of lateral organs.


    Lee, Byung Ha; Kwon, So Hyun; Lee, Sang-Joo; Park, Soon Ki; Song, Jong Tae; Lee, Sangman; Lee, Myeong Min; Hwang, Yong-sic; Kim, Jeong Hoe


    The cell proliferation process of aerial lateral organs, such as leaves and flowers, is coordinated by complex genetic networks that, in general, converge on the cell cycle. The Arabidopsis thaliana NGATHA (AtNGA) family comprises four members that belong to the B3-type transcription factor superfamily, and has been suggested to be involved in growth and development of aerial lateral organs, although its role in the cell proliferation and expansion processes remains to be resolved in more detail. In order to clarify the role of AtNGAs in lateral organ growth, we took a systematic approach using both the loss- and gain-of-functional mutants of all four members. Our results showed that overexpressors of AtNGA1 to AtNGA4 developed small, narrow lateral organs, whereas the nga1 nga2 nga3 nga4 quadruple mutant produced large, wide lateral organs. We found that cell numbers of the lateral organs were significantly affected: a decrease in overexpressors and, inversely, an increase in the quadruple mutant. Kinematic analyses on leaf growth revealed that, compared with the wild type, the overexpressors displayed a lower activity of cell proliferation and yet the mutant a higher activity. Changes in expression of cell cycle-regulating genes were well in accordance with the cell proliferation activities, establishing that the AtNGA transcription factors act as bona fide negative regulators of the cell proliferation of aerial lateral organs.

  3. Glycogen Synthase Kinase-3β Is a Negative Regulator of Cardiomyocyte Hypertrophy

    PubMed Central

    Haq, Syed; Choukroun, Gabriel; Kang, Zhao Bin; Ranu, Hardeep; Matsui, Takashi; Rosenzweig, Anthony; Molkentin, Jeffrey D.; Alessandrini, Alessandro; Woodgett, James; Hajjar, Roger; Michael, Ashour; Force, Thomas


    Hypertrophy is a basic cellular response to a variety of stressors and growth factors, and has been best characterized in myocytes. Pathologic hypertrophy of cardiac myocytes leads to heart failure, a major cause of death and disability in the developed world. Several cytosolic signaling pathways have been identified that transduce prohypertrophic signals, but to date, little work has focused on signaling pathways that might negatively regulate hypertrophy. Herein, we report that glycogen synthase kinase-3β (GSK-3β), a protein kinase previously implicated in processes as diverse as development and tumorigenesis, is inactivated by hypertrophic stimuli via a phosphoinositide 3-kinase–dependent protein kinase that phosphorylates GSK-3β on ser 9. Using adenovirus-mediated gene transfer of GSK-3β containing a ser 9 to alanine mutation, which prevents inactivation by hypertrophic stimuli, we demonstrate that inactivation of GSK-3β is required for cardiomyocytes to undergo hypertrophy. Furthermore, our data suggest that GSK-3β regulates the hypertrophic response, at least in part, by modulating the nuclear/cytoplasmic partitioning of a member of the nuclear factor of activated T cells family of transcription factors. The identification of GSK-3β as a transducer of antihypertrophic signals suggests that novel therapeutic strategies to treat hypertrophic diseases of the heart could be designed that target components of the GSK-3 pathway. PMID:11018058

  4. Lrig2 Negatively Regulates Ectodomain Shedding of Axon Guidance Receptors by ADAM Proteases.


    van Erp, Susan; van den Heuvel, Dianne M A; Fujita, Yuki; Robinson, Ross A; Hellemons, Anita J C G M; Adolfs, Youri; Van Battum, Eljo Y; Blokhuis, Anna M; Kuijpers, Marijn; Demmers, Jeroen A A; Hedman, Håkan; Hoogenraad, Casper C; Siebold, Christian; Yamashita, Toshihide; Pasterkamp, R Jeroen


    Many guidance receptors are proteolytically cleaved by membrane-associated metalloproteases of the ADAM family, leading to the shedding of their ectodomains. Ectodomain shedding is crucial for receptor signaling and function, but how this process is controlled in neurons remains poorly understood. Here, we show that the transmembrane protein Lrig2 negatively regulates ADAM-mediated guidance receptor proteolysis in neurons. Lrig2 binds Neogenin, a receptor for repulsive guidance molecules (RGMs), and prevents premature Neogenin shedding by ADAM17 (TACE). RGMa reduces Lrig2-Neogenin interactions, providing ADAM17 access to Neogenin and allowing this protease to induce ectodomain shedding. Regulation of ADAM17-mediated Neogenin cleavage by Lrig2 is required for neurite growth inhibition by RGMa in vitro and for cortical neuron migration in vivo. Furthermore, knockdown of Lrig2 significantly improves CNS axon regeneration. Together, our data identify a unique ligand-gated mechanism to control receptor shedding by ADAMs and reveal functions for Lrigs in neuron migration and regenerative failure. PMID:26651291

  5. Negative regulation of pathogenesis in Pseudomonas syringae pv. tabaci 11528 by ATP-dependent Lon protease.


    Yang, Hyun Ju; Lee, Jun Seung; Cha, Ji Young; Baik, Hyung Suk


    Pseudomonas syringae pv. tabaci causes wildfire disease in tobacco plants. The hrp pathogenicity island (hrp PAI) of P. syringae pv. tabaci encodes a type III secretion system (TTSS) and its regulatory system, which are required for pathogenesis in plants. Three important regulatory proteins-HrpR, HrpS, and HrpL-have been identified to activate hrp PAI gene expression. The bacterial Lon protease regulates the expression of various genes. To investigate the regulatory mechanism of the Lon protease in P. syringae pv. tabaci 11528, we cloned the lon gene, and then a Δlon mutant was generated by allelic exchange. lon mutants showed increased UV sensitivity, which is a typical feature of such mutants. The Δlon mutant produced higher levels of tabtoxin than the wild-type. The lacZ gene was fused with hrpA promoter and activity of β-galactosidase was measured in hrp-repressing and hrp-inducing media. The Lon protease functioned as a negative regulator of hrp PAI under hrp-repressing conditions. We found that strains with lon disruption elicited the host defense system more rapidly and strongly than the wild-type strain, suggesting that the Lon protease is essential for systemic pathogenesis.

  6. AMPK is a negative regulator of the Warburg Effect and suppresses tumor growth in vivo

    PubMed Central

    Faubert, Brandon; Boily, Gino; Izreig, Said; Griss, Takla; Samborska, Bozena; Dong, Zhifeng; Dupuy, Fanny; Chambers, Christopher; Fuerth, Benjamin J.; Viollet, Benoit; Mamer, Orval A.; Avizonis, Daina; DeBerardinis, Ralph J.; Siegel, Peter M.; Jones, Russell G.


    Summary AMPK is a metabolic sensor that helps maintain cellular energy homeostasis. Despite evidence linking AMPK with tumor suppressor functions, the role of AMPK in tumorigenesis and tumor metabolism is unknown. Here we show that AMPK negatively regulates aerobic glycolysis (the Warburg effect) in cancer cells, and suppresses tumor growth in vivo. Genetic ablation of the α1 catalytic subunit of AMPK accelerates Myc-induced lymphomagenesis. Inactivation of AMPKα in both transformed and non-transformed cells promotes a metabolic shift to aerobic glycolysis, increased allocation of glucose carbon into lipids, and biomass accumulation. These metabolic effects require normoxic stabilization of the hypoxia-inducible factor-1α (HIF-1α), as silencing HIF-1α reverses the shift to aerobic glycolysis and the biosynthetic and proliferative advantages conferred by reduced AMPKα signaling. Together our findings suggest that AMPK activity opposes tumor development, and its loss fosters tumor progression in part by regulating cellular metabolic pathways that support cell growth and proliferation. PMID:23274086

  7. The new RGA locus encodes a negative regulator of gibberellin response in Arabidopsis thaliana.


    Silverstone, A L; Mak, P Y; Martínez, E C; Sun, T P


    We have identified a new locus involved in gibberellin (GA) signal transduction by screening for suppressors of the Arabidopsis thaliana GA biosynthetic mutant gal-3. The locus is named RGA for repressor of gal-3. Based on the recessive phenotype of the digenic rga/gal-3 mutant, the wild-type gene product of RGA is probably a negative regulator of GA responses. Our screen for suppressors of gal-3 identified 17 mutant alleles of RGA as well as 10 new mutant alleles at the previously identified SPY locus. The digenic (double homozygous) rga/gal-3 mutants are able to partially repress several defects of gal-3 including stem growth, leaf abaxial trichome initiation, flowering time, and apical dominance. The phenotype of the trigenic mutant (triple homozygous) rga/spy/gal-3 shows that rga and spy have additive effects regulating flowering time, abaxial leaf trichome initiation and apical dominance. This trigenic mutant is similar to wild type with respect to each of these developmental events. Because rga/spy/gal-3 is almost insensitive to GA for hypocotyl growth and its bolting stem is taller than the wild-type plant, the combined effects of the rga and spy mutations appear to allow GA-independent stem growth. Our studies indicate that RGA lies on a separate branch of the GA signal transduction pathway from SPY, which leads us to propose a modified model of the GA response pathway.

  8. The PhoP transcription factor negatively regulates avermectin biosynthesis in Streptomyces avermitilis.


    Yang, Renjun; Liu, Xingchao; Wen, Ying; Song, Yuan; Chen, Zhi; Li, Jilun


    Bacteria sense and respond to the stress of phosphate limitation, anticipating Pi deletion/starvation via the two-component PhoR-PhoP system. The role of the response regulator PhoP in primary metabolism and avermectin biosynthesis in Streptomyces avermitilis was investigated. In response to phosphate starvation, S. avermitilis PhoP, like Streptomyces coelicolor and Streptomyces lividans PhoP, activates the expression of phoRP, phoU, and pstS by binding to the PHO boxes in their promoter regions. Avermectin biosynthesis was significantly increased in ΔphoP deletion mutants. Electrophoretic mobility gel shift assay (EMSA) and DNase I footprinting assays showed that PhoP can bind to a PHO box formed by two direct repeat units of 11 nucleotides located downstream of the transcriptional start site of aveR. By negatively regulating the transcription of aveR, PhoP directly affects avermectin biosynthesis in S. avermitilis. PhoP indirectly affects melanogenesis on Casaminoacids Minimal Medium (MMC) lacking supplemental phosphate. Nitrogen metabolism and some key genes involved in morphological differentiation and antibiotic production in S. avermitilis are also under the control of PhoP. PMID:26298701

  9. Regulated Breathing Effect of Silicon Negative Electrode for Dramatically Enhanced Performance of Li-Ion Battery

    SciTech Connect

    Xiao, Xingcheng; Zhou, Weidong; Kim, Youngnam; Ryu, Ill; Gu, Meng; Wang, Chong M.; Liu, Gao; Liu, Zhongyi; Gao, Huajian


    Si is an attractive negative electrode material for lithium ion batteries due to its high specifi c capacity (≈3600 mAh g –1 ). However, the huge volume swelling and shrinking during cycling, which mimics a breathing effect at the material/electrode/cell level, leads to several coupled issues including fracture of Si particles, unstable solid electrolyte interphase, and low Coulombic effi ciency. In this work, the regulation of the breathing effect is reported by using Si–C yolk–shell nanocomposite which has been well-developed by other researchers. The focus is on understanding how the nanoscaled materials design impacts the mechanical and electrochemical response at electrode level. For the fi rst time, it is possible to observe one order of magnitude of reduction on breathing effect at the electrode level during cycling: the electrode thickness variation reduced down to 10%, comparing with 100% in the electrode with Si nanoparticles as active materials. The Si–C yolk–shell nanocomposite electrode exhibits excellent capacity retention and high cycle effi ciency. In situ transmission electron microscopy and fi nite element simulations consistently reveals that the dramatically enhanced performance is associated with the regulated breathing of the Si in the new composite, therefore the suppression of the overall electrode expansion.

  10. Optineurin Negatively Regulates the Induction of IFNβ in Response to RNA Virus Infection

    PubMed Central

    Mankouri, Jamel; Fragkoudis, Rennos; Richards, Kathryn H.; Wetherill, Laura F.; Harris, Mark; Kohl, Alain; Elliott, Richard M.; Macdonald, Andrew


    The innate immune response provides a critical defense against microbial infections, including viruses. These are recognised by pattern recognition receptors including Toll-like receptors (TLRs) and RIG-I like helicases (RLHs). Detection of virus triggers signalling cascades that induce transcription of type I interferons including IFNβ, which are pivotal for the initiation of an anti-viral state. Despite the essential role of IFNβ in the anti-viral response, there is an incomplete understanding of the negative regulation of IFNβ induction. Here we provide evidence that expression of the Nemo-related protein, optineurin (NRP/FIP2), has a role in the inhibition of virus-triggered IFNβ induction. Over-expression of optineurin inhibited Sendai-virus (SeV) and dsRNA triggered induction of IFNβ, whereas depletion of optineurin with siRNA promoted virus-induced IFNβ production and decreased RNA virus replication. Immunoprecipitation and immunofluorescence studies identified optineurin in a protein complex containing the antiviral protein kinase TBK1 and the ubiquitin ligase TRAF3. Furthermore, mutagenesis studies determined that binding of ubiquitin was essential for both the correct sub-cellular localisation and the inhibitory function of optineurin. This work identifies optineurin as a critical regulator of antiviral signalling and potential target for future antiviral therapy. PMID:20174559

  11. Neuronal leucine-rich repeat 1 negatively regulates anaplastic lymphoma kinase in neuroblastoma

    PubMed Central

    Satoh, Shunpei; Takatori, Atsushi; Ogura, Atsushi; Kohashi, Kenichi; Souzaki, Ryota; Kinoshita, Yoshiaki; Taguchi, Tomoaki; Hossain, Md. Shamim; Ohira, Miki; Nakamura, Yohko; Nakagawara, Akira


    In neuroblastoma (NB), one of the most common paediatric solid tumours, activation of anaplastic lymphoma kinase (ALK) is often associated with poor outcomes. Although genetic studies have identified copy number alteration and nonsynonymous mutations of ALK, the regulatory mechanism of ALK signalling at protein levels is largely elusive. Neuronal leucine-rich repeat 1 (NLRR1) is a type 1 transmembrane protein that is highly expressed in unfavourable NB and potentially influences receptor tyrosine kinase signalling. Here, we showed that NLRR1 and ALK exhibited a mutually exclusive expression pattern in primary NB tissues by immunohistochemistry. Moreover, dorsal root ganglia of Nlrr1+/+ and Nlrr1−/− mice displayed the opposite expression patterns of Nlrr1 and Alk. Of interest, NLRR1 physically interacted with ALK in vitro through its extracellular region. Notably, the NLRR1 ectodomain impaired ALK phosphorylation and proliferation of ALK-mutated NB cells. A newly identified cleavage of the NLRR1 ectodomain also supported NLRR1-mediated ALK signal regulation in trans. Thus, we conclude that NLRR1 appears to be an extracellular negative regulator of ALK signalling in NB and neuronal development. Our findings may be beneficial to comprehend NB heterogeneity and to develop a novel therapy against unfavourable NB. PMID:27604320

  12. Hormonal regulation of the gravity s negative control of morphogenesis in cucumber seedlings

    NASA Astrophysics Data System (ADS)

    Takahashi, H.; Kamada, M.; Saito, Y.; Fujii, N.

    Just after germination, seedlings of most cucurbitaceous plants develop a peg to pull the cotyledons and plumule out from the seed coat. The peg usually develops on the concave side of the gravitropically bending transition zone between the hypocotyl and the root. Because cucumber seedlings grown in microgravity developed a peg on each side of the transition zone, it was suggested that peg formation was negatively regulated by gravity on Earth. It has also been suggested that auxin is an essential factor responsible for peg formation. To verify this hypothesis and to understand the molecular mechanism of the gravity-regulated peg formation, we measured the distribution of endogenous auxin in the transition zone, examined the expression patterns of an auxininducible genes (CS-IAAs), auxin response factor and auxin carrier genes (CS-ARFs, CS-AUX1, CS-PIN1). Because ethylene modifies peg development, we examined the expression of ACC synthase genes (CS-ACSs) and its relation to the auxin-mediated development of peg. Furthermore, we examined some other factors that might interact with auxin for peg formation. Based on the results of these studies, we propose a model for the mechanism of peg formation in cucumber seedlings.

  13. Splicing factor SRSF1 negatively regulates alternative splicing of MDM2 under damage

    PubMed Central

    Comiskey, Daniel F.; Jacob, Aishwarya G.; Singh, Ravi K.; Tapia-Santos, Aixa S.; Chandler, Dawn S.


    Genotoxic stress induces alternative splicing of the oncogene MDM2 generating MDM2-ALT1, an isoform attributed with tumorigenic properties. However, the mechanisms underlying this event remain unclear. Here we explore MDM2 splicing regulation by utilizing a novel minigene that mimics endogenous MDM2 splicing in response to UV and cisplatinum-induced DNA damage. We report that exon 11 is necessary and sufficient for the damage-specific alternative splicing of the MDM2 minigene and that the splicing factor SRSF1 binds exon 11 at evolutionarily conserved sites. Interestingly, mutations disrupting this interaction proved sufficient to abolish the stress-induced alternative splicing of the MDM2 minigene. Furthermore, SRSF1 overexpression promoted exclusion of exon 11, while its siRNA-mediated knockdown prevented the stress-induced alternative splicing of endogenous MDM2. Additionally, we observed elevated SRSF1 levels under stress and in tumors correlating with the expression of MDM2-ALT1. Notably, we demonstrate that MDM2-ALT1 splicing can be blocked by targeting SRSF1 sites on exon 11 using antisense oligonucleotides. These results present conclusive evidence supporting a negative role for SRSF1 in MDM2 alternative splicing. Importantly, we define for the first time, a clear-cut mechanism for the regulation of damage-induced MDM2 splicing and present potential strategies for manipulating MDM2 expression via splicing modulation. PMID:25845590

  14. Neuronal leucine-rich repeat 1 negatively regulates anaplastic lymphoma kinase in neuroblastoma.


    Satoh, Shunpei; Takatori, Atsushi; Ogura, Atsushi; Kohashi, Kenichi; Souzaki, Ryota; Kinoshita, Yoshiaki; Taguchi, Tomoaki; Hossain, Md Shamim; Ohira, Miki; Nakamura, Yohko; Nakagawara, Akira


    In neuroblastoma (NB), one of the most common paediatric solid tumours, activation of anaplastic lymphoma kinase (ALK) is often associated with poor outcomes. Although genetic studies have identified copy number alteration and nonsynonymous mutations of ALK, the regulatory mechanism of ALK signalling at protein levels is largely elusive. Neuronal leucine-rich repeat 1 (NLRR1) is a type 1 transmembrane protein that is highly expressed in unfavourable NB and potentially influences receptor tyrosine kinase signalling. Here, we showed that NLRR1 and ALK exhibited a mutually exclusive expression pattern in primary NB tissues by immunohistochemistry. Moreover, dorsal root ganglia of Nlrr1+/+ and Nlrr1-/- mice displayed the opposite expression patterns of Nlrr1 and Alk. Of interest, NLRR1 physically interacted with ALK in vitro through its extracellular region. Notably, the NLRR1 ectodomain impaired ALK phosphorylation and proliferation of ALK-mutated NB cells. A newly identified cleavage of the NLRR1 ectodomain also supported NLRR1-mediated ALK signal regulation in trans. Thus, we conclude that NLRR1 appears to be an extracellular negative regulator of ALK signalling in NB and neuronal development. Our findings may be beneficial to comprehend NB heterogeneity and to develop a novel therapy against unfavourable NB. PMID:27604320

  15. LMO4 functions as a negative regulator of sensory organ formation in the mammalian cochlea.


    Deng, Min; Luo, Xiong-jian; Pan, Ling; Yang, Hua; Xie, Xiaoling; Liang, Guoqing; Huang, Liang; Hu, Fang; Kiernan, Amy E; Gan, Lin


    In mammals, formation of the auditory sensory organ (the organ of Corti) is restricted to a specialized area of the cochlea. However, the molecular mechanisms limiting sensory formation to this discrete region in the ventral cochlear duct are not well understood, nor is it known whether other regions of the cochlea have the competence to form the organ of Corti. Here we identify LMO4, a LIM-domain-only nuclear protein, as a negative regulator of sensory organ formation in the cochlea. Inactivation of Lmo4 in mice leads to an ectopic organ of Corti (eOC) located in the lateral cochlea. The eOC retains the features of the native organ, including inner and outer hair cells, supporting cells, and other nonsensory specialized cell types. However, the eOC shows an orientation opposite to the native organ, such that the eOC appears as a mirror-image duplication to the native organ of Corti. These data demonstrate a novel sensory competent region in the lateral cochlear duct that is regulated by LMO4 and may be amenable to therapeutic manipulation.

  16. Hsc70 negatively regulates epithelial sodium channel trafficking at multiple sites in epithelial cells.


    Chanoux, Rebecca A; Shubin, Calla B; Robay, Amal; Suaud, Laurence; Rubenstein, Ronald C


    The epithelial sodium channel (ENaC) plays an important role in homeostasis of blood pressure and of the airway surface liquid, and excess function of ENaC results in refractory hypertension (in Liddle's syndrome) and impaired mucociliary clearance (in cystic fibrosis). The regulation of ENaC by molecular chaperones, such as the 70-kDa heat shock protein Hsc70, is not completely understood. Our previously published data suggest that Hsc70 negatively affects ENaC activity and surface expression in Xenopus oocytes; here we investigate the mechanism by which Hsc70 acts on ENaC in epithelial cells. In Madin-Darby canine kidney cells stably expressing epitope-tagged αβγ-ENaC and with tetracycline-inducible overexpression of Hsc70, treatment with 5 μg/ml doxycycline increased total Hsc70 expression 20%. This increase in Hsc70 expression led to a decrease in ENaC activity and surface expression that corresponded to an increased rate of functional ENaC retrieval from the cell surface. In addition, Hsc70 overexpression decreased the association of newly synthesized ENaC subunits. These data support the hypothesis that Hsc70 inhibits ENaC functional expression at the apical surface of epithelia by regulating ENaC biogenesis and ENaC trafficking at the cell surface. PMID:23885065

  17. MDM1 is a microtubule-binding protein that negatively regulates centriole duplication.


    Van de Mark, Daniel; Kong, Dong; Loncarek, Jadranka; Stearns, Tim


    Mouse double-minute 1 (Mdm1) was originally identified as a gene amplified in transformed mouse cells and more recently as being highly up-regulated during differentiation of multiciliated epithelial cells, a specialized cell type having hundreds of centrioles and motile cilia. Here we show that the MDM1 protein localizes to centrioles of dividing cells and differentiating multiciliated cells. 3D-SIM microscopy showed that MDM1 is closely associated with the centriole barrel, likely residing in the centriole lumen. Overexpression of MDM1 suppressed centriole duplication, whereas depletion of MDM1 resulted in an increase in granular material that likely represents early intermediates in centriole formation. We show that MDM1 binds microtubules in vivo and in vitro. We identified a repeat motif in MDM1 that is required for efficient microtubule binding and found that these repeats are also present in CCSAP, another microtubule-binding protein. We propose that MDM1 is a negative regulator of centriole duplication and that its function is mediated through microtubule binding.

  18. ProBDNF negatively regulates neuronal remodeling, synaptic transmission and synaptic plasticity in hippocampus

    PubMed Central

    Yang, Jianmin; Harte-Hargrove, Lauren C.; Siao, Chia-Jen; Marinic, Tina; Clarke, Roshelle; Ma, Qian; Jing, Deqiang; LaFrancois, John J.; Bath, Kevin G.; Mark, Willie; Ballon, Douglas; Lee, Francis S.; Scharfman, Helen E.; Hempstead, Barbara L.


    Summary Experience-dependent plasticity shapes postnatal development of neural circuits, but the mechanisms that refine dendritic arbors, remodel spines, and impair synaptic activity are poorly understood. Mature brain-derived neurotrophic factor (BDNF) modulates neuronal morphology and synaptic plasticity, including long-term potentiation (LTP) via TrkB activation. BDNF is initially translated as proBDNF which binds p75NTR. In vitro, recombinant proBDNF modulates neuronal structure and alters hippocampal long-term plasticity, but the actions of endogenously expressed proBDNF are unclear. Therefore, we generated a cleavage-resistant probdnf knock-in mouse. Our results demonstrate that proBDNF negatively regulates hippocampal dendritic complexity and spine density through p75NTR. Hippocampal slices from probdnf mice exhibit depressed synaptic transmission, impaired LTP and enhanced long-term depression (LTD) in area CA1. These results suggest that proBDNF acts in vivo as a biologically active factor that regulates hippocampal structure, synaptic transmission and plasticity, effects that are distinct from mature BDNF. PMID:24746813

  19. RUNX3 is a novel negative regulator of oncogenic TEAD-YAP complex in gastric cancer.


    Qiao, Y; Lin, S J; Chen, Y; Voon, D C-C; Zhu, F; Chuang, L S H; Wang, T; Tan, P; Lee, S C; Yeoh, K G; Sudol, M; Ito, Y


    Runt-related transcription factor 3 (RUNX3) is a well-documented tumour suppressor that is frequently inactivated in gastric cancer. Here, we define a novel mechanism by which RUNX3 exerts its tumour suppressor activity involving the TEAD-YAP complex, a potent positive regulator of proliferative genes. We report that the TEAD-YAP complex is not only frequently hyperactivated in liver and breast cancer, but also confers a strong oncogenic activity in gastric epithelial cells. The increased expression of TEAD-YAP in tumour tissues significantly correlates with poorer overall survival of gastric cancer patients. Strikingly, RUNX3 physically interacts with the N-terminal region of TEAD through its Runt domain. This interaction markedly reduces the DNA-binding ability of TEAD that attenuates the downstream signalling of TEAD-YAP complex. Mutation of RUNX3 at Arginine 122 to Cysteine, which was previously identified in gastric cancer, impairs the interaction between RUNX3 and TEAD. Our data reveal that RUNX3 acts as a tumour suppressor by negatively regulating the TEAD-YAP oncogenic complex in gastric carcinogenesis. PMID:26364597

  20. PGC-1-related coactivator (PRC) negatively regulates endothelial adhesion of monocytes via inhibition of NF κB activity

    SciTech Connect

    Chengye, Zhan; Daixing, Zhou Qiang, Zhong; Shusheng, Li


    Highlights: •First time to display that LPS downregulate the expression of PRC. •First time to show that PRC inhibits the induction of VCAM-1 and E-selectin. •First time to show that PRC inhibit monocytes attachment to endothelial cells. •First time to display that PRC inhibits transcriptional activity of NF-κB. •PRC protects the respiration rate and suppresses the glycolysis rate against LPS. -- Abstract: PGC-1-related coactivator (PRC) is a growth-regulated transcriptional cofactor known to activate many of the nuclear genes specifying mitochondrial respiratory function. Endothelial dysfunction is a prominent feature found in many inflammatory diseases. Adhesion molecules, such as VCAM-1, mediate the attachment of monocytes to endothelial cells, thereby playing an important role in endothelial inflammation. The effects of PRC in regards to endothelial inflammation remain unknown. In this study, our findings show that PRC can be inhibited by the inflammatory cytokine LPS in cultured human umbilical vein endothelial cells (HUVECs). In the presence of LPS, the expression of endothelial cell adhesion molecular, such as VCAM1 and E-selectin, is found to be increased. These effects can be negated by overexpression of PRC. Importantly, monocyte adhesion to endothelial cells caused by LPS is significantly attenuated by PRC. In addition, overexpression of PRC protects mitochondrial metabolic function and suppresses the rate of glycolysis against LPS. It is also found that overexpression of PRC decreases the transcriptional activity of NF-κB. These findings suggest that PRC is a negative regulator of endothelial inflammation.

  1. Working memory capacity and spontaneous emotion regulation: high capacity predicts self-enhancement in response to negative feedback.


    Schmeichel, Brandon J; Demaree, Heath A


    Although previous evidence suggests that working memory capacity (WMC) is important for success at emotion regulation, that evidence may reveal simply that people with higher WMC follow instructions better than those with lower WMC. The present study tested the hypothesis that people with higher WMC more effectively engage in spontaneous emotion regulation following negative feedback, relative to those with lower WMC. Participants were randomly assigned to receive either no feedback or negative feedback about their emotional intelligence. They then completed a disguised measure of self-enhancement and a self-report measure of affect. Experimental condition and WMC interacted such that higher WMC predicted more self-enhancement and less negative affect following negative feedback. This research provides novel insight into the consequences of individual differences in WMC and illustrates that cognitive capacity may facilitate the spontaneous self-regulation of emotion. PMID:21038959

  2. DEC2 is a negative regulator for the proliferation and differentiation of chondrocyte lineage-committed mesenchymal stem cells.


    Sasamoto, Tomoko; Fujimoto, Katsumi; Kanawa, Masami; Kimura, Junko; Takeuchi, Junpei; Harada, Naoko; Goto, Noriko; Kawamoto, Takeshi; Noshiro, Mitsuhide; Suardita, Ketut; Tanne, Kazuo; Kato, Yukio


    Differentiated embryo chondrocyte 2 (DEC2) is a basic helix-loop-helix-Orange transcription factor that regulates cell differentiation in various mammalian tissues. DEC2 has been shown to suppress the differentiation of mesenchymal stem cells (MSCs) into myocytes and adipocytes. In the present study, we examined the role of DEC2 in the chondrogenic differentiation of human MSCs. The overexpression of DEC2 exerted minimal effects on the proliferation of MSCs in monolayer cultures with the growth medium under undifferentiating conditions, whereas it suppressed increases in DNA content, glycosaminoglycan content, and the expression of several chondrocyte-related genes, including aggrecan and type X collagen alpha 1, in MSC pellets in centrifuge tubes under chondrogenic conditions. In the pellets exposed to chondrogenesis induction medium, DEC2 overexpression downregulated the mRNA expression of fibroblast growth factor 18, which is involved in the proliferation and differentiation of chondrocytes, and upregulated the expression of p16INK4, which is a cell cycle inhibitor. These findings suggest that DEC2 is a negative regulator of the proliferation and differentiation of chondrocyte lineage-committed mesenchymal cells. PMID:27430159

  3. Human amygdala response to dynamic facial expressions of positive and negative surprise.


    Vrticka, Pascal; Lordier, Lara; Bediou, Benoît; Sander, David


    Although brain imaging evidence accumulates to suggest that the amygdala plays a key role in the processing of novel stimuli, only little is known about its role in processing expressed novelty conveyed by surprised faces, and even less about possible interactive encoding of novelty and valence. Those investigations that have already probed human amygdala involvement in the processing of surprised facial expressions either used static pictures displaying negative surprise (as contained in fear) or "neutral" surprise, and manipulated valence by contextually priming or subjectively associating static surprise with either negative or positive information. Therefore, it still remains unresolved how the human amygdala differentially processes dynamic surprised facial expressions displaying either positive or negative surprise. Here, we created new artificial dynamic 3-dimensional facial expressions conveying surprise with an intrinsic positive (wonderment) or negative (fear) connotation, but also intrinsic positive (joy) or negative (anxiety) emotions not containing any surprise, in addition to neutral facial displays either containing ("typical surprise" expression) or not containing ("neutral") surprise. Results showed heightened amygdala activity to faces containing positive (vs. negative) surprise, which may either correspond to a specific wonderment effect as such, or to the computation of a negative expected value prediction error. Findings are discussed in the light of data obtained from a closely matched nonsocial lottery task, which revealed overlapping activity within the left amygdala to unexpected positive outcomes. PMID:24219397

  4. Tmem178 acts in a novel negative feedback loop targeting NFATc1 to regulate bone mass

    PubMed Central

    Decker, Corinne E.; Yang, Zhengfeng; Rimer, Ryan; Park-Min, Kyung-Hyun; Macaubas, Claudia; Mellins, Elizabeth D.; Novack, Deborah V.; Faccio, Roberta


    Phospholipase C gamma-2 (PLCγ2)-dependent calcium (Ca2+) oscillations are indispensable for nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1) activation and downstream gene transcription driving osteoclastogenesis during skeletal remodeling and pathological bone loss. Here we describe, to our knowledge, the first known function of transmembrane protein 178 (Tmem178), a PLCγ2 downstream target gene, as a critical modulator of the NFATc1 axis. In surprising contrast to the osteopetrotic phenotype of PLCγ2−/− mice, Tmem178−/− mice are osteopenic in basal conditions and are more susceptible to inflammatory bone loss, owing to enhanced osteoclast formation. Mechanistically, Tmem178 localizes to the ER membrane and regulates RANKL-induced Ca2+ fluxes, thus controlling NFATc1 induction. Importantly, down-regulation of Tmem178 is observed in human CD14+ monocytes exposed to plasma from systemic juvenile idiopathic arthritis patients. Similar to the mouse model, reduced Tmem178 expression in human cells correlates with excessive osteoclastogenesis. In sum, these findings identify an essential role for Tmem178 to maintain skeletal mass and limit pathological bone loss. PMID:26644563

  5. Tumor angiogenesis mediated by myeloid cells is negatively regulated by CEACAM1.


    Lu, Rongze; Kujawski, Maciej; Pan, Hao; Shively, John E


    Bv8 (prokineticin 2) expressed by Gr1(+)CD11b(+) myeloid cells is critical for VEGF-independent tumor angiogenesis. Although granulocyte colony-stimulating factor (G-CSF) has been shown to be a key inducer of Bv8 expression, the basis for Bv8 production in driving tumor angiogenesis is undefined. Because the cell adhesion molecule CEACAM1, which is highly expressed on Gr1(+)CD11b(+) myeloid cells, is known to regulate G-CSF receptor (G-CSFR) signaling, we hypothesized that CEACAM1 would regulate Bv8 production in these cells. In support of this hypothesis, we found that Bv8 expression was elevated in Gr1(+)CD11b(+) cells from Ceacam1-deficient mice implanted with B16 melanoma, increasing the infiltration of Gr1(+)CD11b(+) myeloid cells in melanoma tumors and enhancing their growth and angiogenesis. Furthermore, treatment with anti-Gr1 or anti-Bv8 or anti-G-CSF monoclonal antibody reduced myeloid cell infiltration, tumor growth, and angiogenesis to levels observed in tumor-bearing wild-type (WT) mice. Reconstitution of CEACAM1-deficient mice with WT bone marrow cells restored tumor infiltration of Gr1(+)CD11b(+) cells along with tumor growth and angiogenesis to WT levels. Treatment of tumor-bearing WT mice with anti-CEACAM1 antibody limited tumor outgrowth and angiogenesis, albeit to a lesser extent. Tumor growth in Ceacam1-deficient mice was not affected significantly in Rag(-/-) background, indicating that CEACAM1 expression in T and B lymphocytes had a negligible role in this pathway. Together, our findings show that CEACAM1 negatively regulates Gr1(+)CD11b(+) myeloid cell-dependent tumor angiogenesis by inhibiting the G-CSF-Bv8 signaling pathway.

  6. ABSCISIC ACID-INSENSITIVE 4 negatively regulates flowering through directly promoting Arabidopsis FLOWERING LOCUS C transcription

    PubMed Central

    Shu, Kai; Chen, Qian; Wu, Yaorong; Liu, Ruijun; Zhang, Huawei; Wang, Shengfu; Tang, Sanyuan; Yang, Wenyu; Xie, Qi


    During the life cycle of a plant, one of the major biological processes is the transition from the vegetative to the reproductive stage. In Arabidopsis, flowering time is precisely controlled by extensive environmental and internal cues. Gibberellins (GAs) promote flowering, while abscisic acid (ABA) is considered as a flowering suppressor. However, the detailed mechanism through which ABA inhibits the floral transition is poorly understood. Here, we report that ABSCISIC ACID-INSENSITIVE 4 (ABI4), a key component in the ABA signalling pathway, negatively regulates floral transition by directly promoting FLOWERING LOCUS C (FLC) transcription. The abi4 mutant showed the early flowering phenotype whereas ABI4-overexpressing (OE-ABI4) plants had delayed floral transition. Consistently, quantitative reverse transcription–PCR (qRT–PCR) assay revealed that the FLC transcription level was down-regulated in abi4, but up-regulated in OE-ABI4. The change in FT level was consistent with the pattern of FLC expression. Chromatin immunoprecipitation-qPCR (ChIP-qPCR), electrophoretic mobility shift assay (EMSA), and tobacco transient expression analysis showed that ABI4 promotes FLC expression by directly binding to its promoter. Genetic analysis demonstrated that OE-ABI4::flc-3 could not alter the flc-3 phenotype. OE-FLC::abi4 showed a markedly delayed flowering phenotype, which mimicked OE-FLC::WT, and suggested that ABI4 acts upstream of FLC in the same genetic pathway. Taken together, these findings suggest that ABA inhibits the floral transition by activating FLC transcription through ABI4. PMID:26507894

  7. KLF17 is a negative regulator of epithelial-mesenchymal transition and metastasis in breast cancer

    PubMed Central

    Gumireddy, Kiranmai; Li, Anping; Gimotty, Phyllis A.; Klein-Szanto, Andres J.; Showe, Louise C.; Katsaros, Dionyssios; Coukos, George; Zhang, Lin; Huang, Qihong


    Metastasis is a complex multi-step process requiring the concerted action of many genes and is the primary cause of cancer deaths. Pathways that regulate metastasis enhancement and suppression both contribute to tumor dissemination process. In order to identify novel metastasis suppressors, we set up a forward genetic screen in a mouse model. We transduced a genome-wide RNAi library into the non-metastatic 168FARN breast cancer cell line, orthotopically transplanted the cells into mouse mammary fat pads, and then selected for cells that could metastasize to the lung and identified an RNAi for the KLF17 gene. Conversely, we demonstrate that ectopic expression of KLF17 in highly metastatic 4T1 breast cancer cell line inhibited their ability to metastasize from the mammary fat pad to the lung. We also show that suppression of KLF17 expression promotes breast cancer cell invasion and epithelial-mesenchymal transition (EMT) and that KLF17 functions by directly binding to the promoter of Id-1, a key metastasis regulator in breast cancer, to inhibit its transcription. Finally, we demonstrate that KLF17 expression is significantly down-regulated in primary human breast cancer samples and that the combined expression patterns of KLF17 and Id-1 can serve as a potential biomarker for lymph node metastasis in breast cancer. PMID:19801974

  8. Prolyl isomerase Pin1 negatively regulates the stability of SUV39H1 to promote tumorigenesis in breast cancer.


    Khanal, Prem; Kim, Garam; Lim, Sung-Chul; Yun, Hyo-Jeong; Lee, Kwang Youl; Choi, Hoo-Kyun; Choi, Hong Seok


    Pin1, a conserved eukaryotic peptidyl-prolyl cis/trans isomerase, has profound effects on numerous key-signaling molecules, and its deregulation contributes to disease, particularly cancer. Although Pin1-mediated prolyl isomerization of protein servers as a regulatory switch in signaling pathways, the significance of proline isomerase activity in chromatin modifying complex remains unclear. Here, we identify Pin1 as a key negative regulator for suppressor of variegation 3-9 homologue 1 (SUV39H1) stability, a major methyltransferase responsible for histone H3 trimethylation on Lys9 (H3K9me3). Pin1 interacts with SUV39H1 in a phosphorylation-dependent manner and promotes ubiquitination-mediated degradation of SUV39H1. Consequently, Pin1 reduces SUV39H1 abundance and suppresses SUV39H1 ability to induce H3K9me3. In contrast, depletion of Pin1 in cancer cells leads to elevated SUV39H1 expression, which subsequently increases H3K9me3, inhibiting tumorigenecity of cancer cells. In a xenograft model with 4T1 metastatic mouse breast carcinoma cells, Pin1 overexpression increases tumor growth, whereas SUV39H1 overexpression abrogates it. In human breast cancer patients, immunohistochemical staining shows that Pin1 levels are negatively correlated with SUV39H1 as well as H3K9me3 levels. Thus, Pin1-mediated reduction of SUV39H1 stability contributes to convey oncogenic signals for aggressiveness of human breast cancer, suggesting that Pin1 may be a promising drug target for anticancer therapy. PMID:23934277

  9. Distinct brain activity in processing negative pictures of animals and objects - the role of human contexts.


    Cao, Zhijun; Zhao, Yanbing; Tan, Tengteng; Chen, Gang; Ning, Xueling; Zhan, Lexia; Yang, Jiongjiong


    Previous studies have shown that the amygdala is important in processing not only animate entities but also social information. It remains to be determined to what extent the factors of category and social context interact to modulate the activities of the amygdala and cortical regions. In this study, pictures depicting animals and inanimate objects in negative and neutral levels were presented. The contexts of the pictures differed in whether they included human/human parts. The factors of valence, arousal, familiarity and complexity of pictures were controlled across categories. The results showed that the amygdala activity was modulated by category and contextual information. Under the nonhuman context condition, the amygdala responded more to animals than objects for both negative and neutral pictures. In contrast, under the human context condition, the amygdala showed stronger activity for negative objects than animals. In addition to cortical regions related to object action, functional and effective connectivity analyses showed that the anterior prefrontal cortex interacted more with the amygdala for negative objects (vs. animals) in the human context condition, by a top-down modulation of the anterior prefrontal cortex to the amygdala. These results highlighted the effects of category and human contexts on modulating brain activity in emotional processing.

  10. Perfectionism, Emotion Regulation and Their Relationship to Negative Affect in Patients with Social Phobia

    PubMed Central

    Rukmini, Systla; Sudhir, Paulomi M.; Math, Suresh Bada


    Context: Research on the perfectionism and emotion regulation strategies in anxiety disorders has gained increased attention. These have an important implication for formulation of therapies. Aims: We examined perfectionism, emotion regulation were examined in 30 patients with social phobia (SP) and 30 community participants. Settings and Design: A cross-sectional design using a clinical and a community control sample was adopted in this exploratory study. Materials and Methods: Participants were assessed on The Mini-International Neuropsychiatric Interview, Frost's-Multidimensional Perfectionism Scale, Ruminative Response Scale of the response style questionnaire, cognitive emotion regulation questionnaire, Social Interaction Anxiety Scale and the Beck's Depression Inventory. Statistical Analysis: Data was analyzed using independents samples t-test and Pearson's Product moment correlations and step-wise linear regression. Results: Individuals with SP had higher perfectionism (mean = 100.30, SD = ±17.73, t = 7.29, P < 0.001), rumination (mean = 61.47, SD = ±11.96, t = 6.71, P < 0.001) and lower levels of positive reappraisal (mean = 11.53, SD = ±3.85, t = 4.90, P < 0.001). Perfectionism was correlated with social anxiety (r = 0.44, P < 0.05) and rumination (r = 0.43, P < 0.05), but not with depression. Rumination was positively correlated with both social anxiety (r = 0.513, P < 0.01) and depression (r = 0.485, P < 0.01). Positive reappraisal was negatively correlated with depression (r = -0.396, P < 0.05) and anxiety (r = -0.335, P < 0.05). Acceptance was found to be significantly correlated only to the reflective pondering subscale of rumination. Parental criticism was a significant predictor of social anxiety (F = 11.11, P < 0.01) and brooding predicted depression (F = 10.49, P < 0.01). Conclusions: This study highlights the role of perfectionism as a maintaining factor in SP and the importance of adaptive forms of emotion regulation that need to be addressed

  11. Transcriptional control of human p53-regulated genes.


    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold


    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  12. A human cytomegalovirus early promoter with upstream negative and positive cis-acting elements: IE2 negates the effect of the negative element, and NF-Y binds to the positive element.

    PubMed Central

    Huang, L; Malone, C L; Stinski, M F


    The human cytomegalovirus early promoter for the UL4 gene, which codes for an early viral envelope glycoprotein designated gpUL4, requires immediate-early viral protein two (IE2) synthesis to be activated (C.-P. Chang, C. L. Malone, and M. F. Stinski, J. Virol. 63:281, 1989). We investigated the cis-acting and trans-acting factors that regulate transcription from this UL4 promoter. In transient transfection assays, the viral IE2 protein negated the effect of an upstream cis-acting negative element and enhanced downstream gene expression. A cis-acting positive element contributed to the activity of the viral promoter when an upstream cis-acting negative element was deleted or when the viral IE2 protein was present. The cellular protein(s) that binds to the cis-acting negative element requires further investigation. The cellular protein that binds to the cis-acting positive element was characterized. Two DNA sequence-specific protein complexes were detected with DNA probes spanning the region containing the cis-acting positive element and human cytomegalovirus-infected human fibroblast cell nuclear extracts. The more slowly migrating complex was labeled complex A, and the faster was labeled complex B. Only complex B was detected with mock-infected cell nuclear extracts. Competition experiments confirmed the specificity of the A and B complexes. The protein bound to the DNA in both the complexes contacts a CCAAT box imperfect dyad symmetry (5'CCAATCACTGG3'). Either CCAAT box within the dyad symmetry could compete for binding the nuclear factor. Mutation of the CCAAT box dyad symmetry resulted in a decrease of the transcriptional activity from the UL4 promoter. A cellular transcription factor, antigenically related to nuclear factor-Y (NF-Y), was found in both complexes A and B. Events associated with viral infection caused phosphorylation of protein complex A. Dephosphorylation of the DNA-binding protein converts complex A to complex B. The effect of phosphorylation

  13. Lysophosphatidic acid receptor-5 negatively regulates cellular responses in mouse fibroblast 3T3 cells

    SciTech Connect

    Dong, Yan; Hirane, Miku; Araki, Mutsumi; Fukushima, Nobuyuki; Tsujiuchi, Toshifumi


    Highlights: • LPA{sub 5} inhibits the cell growth and motile activities of 3T3 cells. • LPA{sub 5} suppresses the cell motile activities stimulated by hydrogen peroxide in 3T3 cells. • Enhancement of LPA{sub 5} on the cell motile activities inhibited by LPA{sub 1} in 3T3 cells. • The expression and activation of Mmp-9 were inhibited by LPA{sub 5} in 3T3 cells. • LPA signaling via LPA{sub 5} acts as a negative regulator of cellular responses in 3T3 cells. - Abstract: Lysophosphatidic acid (LPA) signaling via G protein-coupled LPA receptors (LPA{sub 1}–LPA{sub 6}) mediates a variety of biological functions, including cell migration. Recently, we have reported that LPA{sub 1} inhibited the cell motile activities of mouse fibroblast 3T3 cells. In the present study, to evaluate a role of LPA{sub 5} in cellular responses, Lpar5 knockdown (3T3-L5) cells were generated from 3T3 cells. In cell proliferation assays, LPA markedly stimulated the cell proliferation activities of 3T3-L5 cells, compared with control cells. In cell motility assays with Cell Culture Inserts, the cell motile activities of 3T3-L5 cells were significantly higher than those of control cells. The activity levels of matrix metalloproteinases (MMPs) were measured by gelatin zymography. 3T3-L5 cells stimulated the activation of Mmp-2, correlating with the expression levels of Mmp-2 gene. Moreover, to assess the co-effects of LPA{sub 1} and LPA{sub 5} on cell motile activities, Lpar5 knockdown (3T3a1-L5) cells were also established from Lpar1 over-expressing (3T3a1) cells. 3T3a1-L5 cells increased the cell motile activities of 3T3a1 cells, while the cell motile activities of 3T3a1 cells were significantly lower than those of control cells. These results suggest that LPA{sub 5} may act as a negative regulator of cellular responses in mouse fibroblast 3T3 cells, similar to the case for LPA{sub 1}.

  14. The habenula encodes negative motivational value associated with primary punishment in humans.


    Lawson, Rebecca P; Seymour, Ben; Loh, Eleanor; Lutti, Antoine; Dolan, Raymond J; Dayan, Peter; Weiskopf, Nikolaus; Roiser, Jonathan P


    Learning what to approach, and what to avoid, involves assigning value to environmental cues that predict positive and negative events. Studies in animals indicate that the lateral habenula encodes the previously learned negative motivational value of stimuli. However, involvement of the habenula in dynamic trial-by-trial aversive learning has not been assessed, and the functional role of this structure in humans remains poorly characterized, in part, due to its small size. Using high-resolution functional neuroimaging and computational modeling of reinforcement learning, we demonstrate positive habenula responses to the dynamically changing values of cues signaling painful electric shocks, which predict behavioral suppression of responses to those cues across individuals. By contrast, negative habenula responses to monetary reward cue values predict behavioral invigoration. Our findings show that the habenula plays a key role in an online aversive learning system and in generating associated motivated behavior in humans.

  15. The habenula encodes negative motivational value associated with primary punishment in humans.


    Lawson, Rebecca P; Seymour, Ben; Loh, Eleanor; Lutti, Antoine; Dolan, Raymond J; Dayan, Peter; Weiskopf, Nikolaus; Roiser, Jonathan P


    Learning what to approach, and what to avoid, involves assigning value to environmental cues that predict positive and negative events. Studies in animals indicate that the lateral habenula encodes the previously learned negative motivational value of stimuli. However, involvement of the habenula in dynamic trial-by-trial aversive learning has not been assessed, and the functional role of this structure in humans remains poorly characterized, in part, due to its small size. Using high-resolution functional neuroimaging and computational modeling of reinforcement learning, we demonstrate positive habenula responses to the dynamically changing values of cues signaling painful electric shocks, which predict behavioral suppression of responses to those cues across individuals. By contrast, negative habenula responses to monetary reward cue values predict behavioral invigoration. Our findings show that the habenula plays a key role in an online aversive learning system and in generating associated motivated behavior in humans. PMID:25071182

  16. Simultaneous and Sequential Feature Negative Discriminations: Elemental Learning and Occasion Setting in Human Pavlovian Conditioning

    ERIC Educational Resources Information Center

    Baeyens, Frank; Vervliet, Bram; Vansteenwegen, Debora; Beckers, Tom; Hermans, Dirk; Eelen, Paul


    Using a conditioned suppression task, we investigated simultaneous (XA-/A+) vs. sequential (X [right arrow] A-/A+) Feature Negative (FN) discrimination learning in humans. We expected the simultaneous discrimination to result in X (or alternatively the XA configuration) becoming an inhibitor acting directly on the US, and the sequential…

  17. TRIM11 negatively regulates IFNβ production and antiviral activity by targeting TBK1.


    Lee, Younglang; Song, Byeongwoon; Park, Chankyu; Kwon, Ki-Sun


    The innate immune response is a host defense mechanism against infection by viruses and bacteria. Type I interferons (IFNα/β) play a crucial role in innate immunity. If not tightly regulated under normal conditions and during immune responses, IFN production can become aberrant, leading to inflammatory and autoimmune diseases. In this study, we identified TRIM11 (tripartite motif containing 11) as a novel negative regulator of IFNβ production. Ectopic expression of TRIM11 decreased IFNβ promoter activity induced by poly (I:C) stimulation or overexpression of RIG-I (retinoic acid-inducible gene-I) signaling cascade components RIG-IN (constitutively active form of RIG-I), MAVS (mitochondrial antiviral signaling protein), or TBK1 (TANK-binding kinase-1). Conversely, TRIM11 knockdown enhanced IFNβ promoter activity induced by these stimuli. Moreover, TRIM11 overexpression inhibited the phosphorylation and dimerization of IRF3 and expression of IFNβ mRNA. By contrast, TRIM11 knockdown increased the IRF3 phosphorylation and IFNβ mRNA expression. We also found that TRIM11 and TBK1, a key kinase that phosphorylates IRF3 in the RIG-I pathway, interacted with each other through CC and CC2 domain, respectively. This interaction was enhanced in the presence of the TBK1 adaptor proteins, NAP1 (NF-κB activating kinase-associated protein-1), SINTBAD (similar to NAP1 TBK1 adaptor) or TANK (TRAF family member-associated NF-κB activator). Consistent with its inhibitory role in RIG-I-mediated IFNβ signaling, TRIM11 overexpression enhanced viral infectivity, whereas TRIM11 knockdown produced the opposite effect. Collectively, our results suggest that TRIM11 inhibits RIG-I-mediated IFNβ production by targeting the TBK1 signaling complex. PMID:23675467

  18. SUMOylation of phytochrome-B negatively regulates light-induced signaling in Arabidopsis thaliana

    PubMed Central

    Sadanandom, Ari; Ádám, Éva; Orosa, Beatriz; Viczián, András; Klose, Cornelia; Zhang, Cunjin; Josse, Eve-Marie; Kozma-Bognár, László; Nagy, Ferenc


    The red/far red light absorbing photoreceptor phytochrome-B (phyB) cycles between the biologically inactive (Pr, λmax, 660 nm) and active (Pfr; λmax, 730 nm) forms and functions as a light quality and quantity controlled switch to regulate photomorphogenesis in Arabidopsis. At the molecular level, phyB interacts in a conformation-dependent fashion with a battery of downstream regulatory proteins, including PHYTOCHROME INTERACTING FACTOR transcription factors, and by modulating their activity/abundance, it alters expression patterns of genes underlying photomorphogenesis. Here we report that the small ubiquitin-like modifier (SUMO) is conjugated (SUMOylation) to the C terminus of phyB; the accumulation of SUMOylated phyB is enhanced by red light and displays a diurnal pattern in plants grown under light/dark cycles. Our data demonstrate that (i) transgenic plants expressing the mutant phyBLys996Arg-YFP photoreceptor are hypersensitive to red light, (ii) light-induced SUMOylation of the mutant phyB is drastically decreased compared with phyB-YFP, and (iii) SUMOylation of phyB inhibits binding of PHYTOCHROME INTERACTING FACTOR 5 to phyB Pfr. In addition, we show that OVERLY TOLERANT TO SALT 1 (OTS1) de-SUMOylates phyB in vitro, it interacts with phyB in vivo, and the ots1/ots2 mutant is hyposensitive to red light. Taken together, we conclude that SUMOylation of phyB negatively regulates light signaling and it is mediated, at least partly, by the action of OTS SUMO proteases. PMID:26283376

  19. SUMOylation of phytochrome-B negatively regulates light-induced signaling in Arabidopsis thaliana.


    Sadanandom, Ari; Ádám, Éva; Orosa, Beatriz; Viczián, András; Klose, Cornelia; Zhang, Cunjin; Josse, Eve-Marie; Kozma-Bognár, László; Nagy, Ferenc


    The red/far red light absorbing photoreceptor phytochrome-B (phyB) cycles between the biologically inactive (Pr, λmax, 660 nm) and active (Pfr; λmax, 730 nm) forms and functions as a light quality and quantity controlled switch to regulate photomorphogenesis in Arabidopsis. At the molecular level, phyB interacts in a conformation-dependent fashion with a battery of downstream regulatory proteins, including PHYTOCHROME INTERACTING FACTOR transcription factors, and by modulating their activity/abundance, it alters expression patterns of genes underlying photomorphogenesis. Here we report that the small ubiquitin-like modifier (SUMO) is conjugated (SUMOylation) to the C terminus of phyB; the accumulation of SUMOylated phyB is enhanced by red light and displays a diurnal pattern in plants grown under light/dark cycles. Our data demonstrate that (i) transgenic plants expressing the mutant phyB(Lys996Arg)-YFP photoreceptor are hypersensitive to red light, (ii) light-induced SUMOylation of the mutant phyB is drastically decreased compared with phyB-YFP, and (iii) SUMOylation of phyB inhibits binding of PHYTOCHROME INTERACTING FACTOR 5 to phyB Pfr. In addition, we show that OVERLY TOLERANT TO SALT 1 (OTS1) de-SUMOylates phyB in vitro, it interacts with phyB in vivo, and the ots1/ots2 mutant is hyposensitive to red light. Taken together, we conclude that SUMOylation of phyB negatively regulates light signaling and it is mediated, at least partly, by the action of OTS SUMO proteases.

  20. Cereblon negatively regulates TLR4 signaling through the attenuation of ubiquitination of TRAF6

    PubMed Central

    Min, Yoon; Wi, Sae Mi; Kang, Jung-Ah; Yang, Taewoo; Park, Chul-Seung; Park, Sung-Gyoo; Chung, Sungkwon; Shim, Jae-Hyuck; Chun, Eunyoung; Lee, Ki-Young


    Cereblon (CRBN) is a substrate receptor protein for the CRL4A E3 ubiquitin ligase complex. In this study, we report on a new regulatory role of CRBN in TLR4 signaling. CRBN overexpression leads to suppression of NF-κB activation and production of pro-inflammatory cytokines including IL-6 and IL-1β in response to TLR4 stimulation. Biochemical studies revealed interactions between CRBN and TAK1, and TRAF6 proteins. The interaction between CRBN and TAK1 did not affect the association of the TAB1 and TAB2 proteins, which have pivotal roles in the activation of TAK1, whereas the CRBN-TRAF6 interaction critically affected ubiquitination of TRAF6 and TAB2. Binding mapping results revealed that CRBN interacts with the Zinc finger domain of TRAF6, which contains the ubiquitination site of TRAF6, leading to attenuation of ubiquitination of TRAF6 and TAB2. Functional studies revealed that CRBN-knockdown THP-1 cells show enhanced NF-κB activation and p65- or p50-DNA binding activities, leading to up-regulation of NF-κB-dependent gene expression and increased pro-inflammatory cytokine levels in response to TLR4 stimulation. Furthermore, Crbn−/− mice exhibit decreased survival in response to LPS challenge, accompanied with marked enhancement of pro-inflammatory cytokines, such as TNF-α and IL-6. Taken together, our data demonstrate that CRBN negatively regulates TLR4 signaling via attenuation of TRAF6 and TAB2 ubiquitination. PMID:27468689

  1. The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity.


    Chan, Pamela Y; Carrera Silva, Eugenio A; De Kouchkovsky, Dimitri; Joannas, Leonel D; Hao, Liming; Hu, Donglei; Huntsman, Scott; Eng, Celeste; Licona-Limón, Paula; Weinstein, Jason S; Herbert, De'Broski R; Craft, Joseph E; Flavell, Richard A; Repetto, Silvia; Correale, Jorge; Burchard, Esteban G; Torgerson, Dara G; Ghosh, Sourav; Rothlin, Carla V


    Host responses against metazoan parasites or an array of environmental substances elicit type 2 immunity. Despite its protective function, type 2 immunity also drives allergic diseases. The mechanisms that regulate the magnitude of the type 2 response remain largely unknown. Here, we show that genetic ablation of a receptor tyrosine kinase encoded byTyro3in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. Furthermore, the TYRO3 agonist PROS1 was induced in T cells by the quintessential type 2 cytokine, interleukin-4. T cell-specificPros1knockouts phenocopied the loss ofTyro3 Thus, a PROS1-mediated feedback from adaptive immunity engages a rheostat, TYRO3, on innate immune cells to limit the intensity of type 2 responses.

  2. The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity

    PubMed Central

    Chan, Pamela Y.; Carrera Silva, Eugenio A.; De Kouchkovsky, Dimitri; Joannas, Leonel D.; Hao, Liming; Hu, Donglei; Huntsman, Scott; Eng, Celeste; Licona-Limón, Paula; Weinstein, Jason S.; Herbert, De’Broski R.; Craft, Joseph E.; Flavell, Richard A.; Repetto, Silvia; Correale, Jorge; Burchard, Esteban G.; Torgerson, Dara G.; Ghosh, Sourav; Rothlin, Carla V.


    Host responses against metazoan parasites or an array of environmental substances elicit type 2 immunity. Despite its protective function, type 2 immunity also drives allergic diseases. The mechanisms that regulate the magnitude of the type 2 response remain largely unknown. Here, we show that genetic ablation of a receptor tyrosine kinase encoded by Tyro3 in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. Furthermore, the TYRO3 agonist PROS1 was induced in T cells by the quintessential type 2 cytokine, interleukin-4. T cell–specific Pros1 knockouts phenocopied the loss of Tyro3. Thus, a PROS1-mediated feedback from adaptive immunity engages a rheostat, TYRO3, on innate immune cells to limit the intensity of type 2 responses. PMID:27034374

  3. The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity.


    Chan, Pamela Y; Carrera Silva, Eugenio A; De Kouchkovsky, Dimitri; Joannas, Leonel D; Hao, Liming; Hu, Donglei; Huntsman, Scott; Eng, Celeste; Licona-Limón, Paula; Weinstein, Jason S; Herbert, De'Broski R; Craft, Joseph E; Flavell, Richard A; Repetto, Silvia; Correale, Jorge; Burchard, Esteban G; Torgerson, Dara G; Ghosh, Sourav; Rothlin, Carla V


    Host responses against metazoan parasites or an array of environmental substances elicit type 2 immunity. Despite its protective function, type 2 immunity also drives allergic diseases. The mechanisms that regulate the magnitude of the type 2 response remain largely unknown. Here, we show that genetic ablation of a receptor tyrosine kinase encoded byTyro3in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. Furthermore, the TYRO3 agonist PROS1 was induced in T cells by the quintessential type 2 cytokine, interleukin-4. T cell-specificPros1knockouts phenocopied the loss ofTyro3 Thus, a PROS1-mediated feedback from adaptive immunity engages a rheostat, TYRO3, on innate immune cells to limit the intensity of type 2 responses. PMID:27034374

  4. Infant negative reactivity defines the effects of parent-child synchrony on physiological and behavioral regulation of social stress.


    Pratt, Maayan; Singer, Magi; Kanat-Maymon, Yaniv; Feldman, Ruth


    How infants shape their own development has puzzled developmentalists for decades. Recent models suggest that infant dispositions, particularly negative reactivity and regulation, affect outcome by determining the extent of parental effects. Here, we used a microanalytic experimental approach and proposed that infants with varying levels of negative reactivity will be differentially impacted by parent-infant synchrony in predicting physiological and behavioral regulation of increasing social stress during an experimental paradigm. One hundred and twenty-two mother-infant dyads (4-6 months) were observed in the face-to-face still face (SF) paradigm and randomly assigned to three experimental conditions: SF with touch, standard SF, and SF with arms' restraint. Mother-infant synchrony and infant negative reactivity were observed at baseline, and three mechanisms of behavior regulation were microcoded; distress, disengagement, and social regulation. Respiratory sinus arrhythmia baseline, reactivity, and recovery were quantified. Structural equation modeling provided support for our hypothesis. For physiological regulation, infants high in negative reactivity receiving high mother-infant synchrony showed greater vagal withdrawal, which in turn predicted comparable levels of vagal recovery to that of nonreactive infants. In behavioral regulation, only infants low in negative reactivity who received high synchrony were able to regulate stress by employing social engagement cues during the SF phase. Distress was reduced only among calm infants to highly synchronous mothers, and disengagement was lowest among highly reactive infants experiencing high mother-infant synchrony. Findings chart two pathways by which synchrony may bolster regulation in infants of high and low reactivity. Among low reactive infants, synchrony builds a social repertoire for handling interpersonal stress, whereas in highly reactive infants, it constructs a platform for repeated reparation of

  5. SHP1 tyrosine phosphatase negatively regulates NPM-ALK tyrosine kinase signaling.


    Honorat, Jean-François; Ragab, Ashraf; Lamant, Laurence; Delsol, Georges; Ragab-Thomas, Jeannie


    Anaplastic large-cell lymphoma (ALCL) is frequently associated with the 2;5 translocation and expresses the NPM-ALK fusion protein, which possesses a constitutive tyrosine kinase activity. We analyzed SHP1 tyrosine phosphatase expression and activity in 3 ALK-positive ALCL cell lines (Karpas 299, Cost, and SU-DHL1) and in lymph node biopsies (n = 40). We found an inverse correlation between the level of NPM-ALK phosphorylation and SHP1 phosphatase activity. Pull-down and coimmunoprecipitation experiments demonstrated a SHP1/NPM-ALK association. Furthermore, confocal microscopy performed on ALCL cell lines and biopsy specimens showed the colocalization of the 2 proteins in cytoplasmic bodies containing Y664-phosphorylated NPM-ALK. Dephosphorylation of NPM-ALK by SHP1 demonstrated that NPM-ALK was a SHP1 substrate. Downregulation of SHP1 expression by RNAi in Karpas cells led to hyperphosphorylation of NPM-ALK, STAT3 activation, and increase in cell proliferation. Furthermore, SHP1 overexpression in 3T3 fibroblasts stably expressing NPM-ALK led to the decrease of NPM-ALK phosphorylation, lower cell proliferation, and tumor progression in nude mice. These findings show that SHP1 is a negative regulator of NPM-ALK signaling. The use of tissue microarrays revealed that 50% of ALK-positive ALCLs were positive for SHP1. Our results suggest that SHP1 could be a critical enzyme in ALCL biology and a potential therapeutic target.

  6. Third target of rapamycin complex negatively regulates development of quiescence in Trypanosoma brucei

    PubMed Central

    Barquilla, Antonio; Saldivia, Manuel; Diaz, Rosario; Bart, Jean-Mathieu; Vidal, Isabel; Calvo, Enrique; Hall, Michael N.; Navarro, Miguel


    African trypanosomes are protozoan parasites transmitted by a tsetse fly vector to a mammalian host. The life cycle includes highly proliferative forms and quiescent forms, the latter being adapted to host transmission. The signaling pathways controlling the developmental switch between the two forms remain unknown. Trypanosoma brucei contains two target of rapamycin (TOR) kinases, TbTOR1 and TbTOR2, and two TOR complexes, TbTORC1 and TbTORC2. Surprisingly, two additional TOR kinases are encoded in the T. brucei genome. We report that TbTOR4 associates with an Armadillo domain-containing protein (TbArmtor), a major vault protein, and LST8 to form a unique TOR complex, TbTORC4. Depletion of TbTOR4 caused irreversible differentiation of the parasite into the quiescent form. AMP and hydrolysable analogs of cAMP inhibited TbTOR4 expression and induced the stumpy quiescent form. Our results reveal unexpected complexity in TOR signaling and show that TbTORC4 negatively regulates differentiation of the proliferative form into the quiescent form. PMID:22908264

  7. ADS1 encodes a MATE-transporter that negatively regulates plant disease resistance.


    Sun, Xinli; Gilroy, Eleanor M; Chini, Andrea; Nurmberg, Pedro L; Hein, Ingo; Lacomme, Christophe; Birch, Paul R J; Hussain, Adil; Yun, Byung-Wook; Loake, Gary J


    Multidrug and toxic compound extrusion (MATE) proteins comprise the most recently identified family of multidrug transporters. In plants, the numbers of MATE proteins has undergone a remarkable expansion, underscoring the importance of these transporters within this kingdom. Here, we describe the identification and characterization of Activated Disease Susceptibility 1 (ADS1) which encodes a putative MATE transport protein. An activation tagging screen uncovered the ads1-Dominant (ads1-D) mutant, which was subsequently characterized by molecular, genetic and biochemical approaches. The ads1-D mutant was compromised in both basal and nonhost resistance against microbial pathogens. Further, plant defence responses conferred by RPS4 were also disabled in ads1-D plants. By contrast, depletion of ADS1 transcripts by RNA-interference (RNAi) promoted basal disease resistance. Unexpectedly, ads1-D plants were found to constitutively accumulate reactive oxygen intermediates (ROIs). However, analysis of ads1-D Arabidopsis thaliana respiratory burst oxidase (atrboh) double and triple mutants indicated that an increase in ROIs did not impact ads1-D-mediated disease susceptibility. Our findings imply that ADS1 negatively regulates the accumulation of the plant immune activator salicylic acid (SA) and cognate Pathogenesis-Related 1 (PR1) gene expression. Collectively, these data highlight an important role for MATE proteins in the establishment of plant disease resistance. PMID:21762165

  8. The Mycobacterium tuberculosis transcriptional repressor EthR is negatively regulated by Serine/Threonine phosphorylation.


    Leiba, Jade; Carrère-Kremer, Séverine; Blondiaux, Nicolas; Dimala, Martin Moune; Wohlkönig, Alexandre; Baulard, Alain; Kremer, Laurent; Molle, Virginie


    Recent efforts have underlined the role of Serine/Threonine Protein Kinases (STPKs) in growth, pathogenesis and cell wall metabolism in mycobacteria. Herein, we demonstrated that the Mycobacterium tuberculosis EthR, a transcriptional repressor that regulates the activation process of the antitubercular drug ethionamide (ETH) is a specific substrate of the mycobacterial kinase PknF. ETH is a prodrug that must undergo bioactivation by the monooxygenease EthA to exert its antimycobacterial activity and previous studies reported that EthR represses transcription of ethA by binding to the ethA-ethR intergenic region. Mass spectrometry analyses and site-directed mutagenesis identified a set of four phosphoacceptors, namely Thr2, Thr3, Ser4 and Ser7. This was further supported by the complete loss of PknF-dependent phosphorylation of a phosphoablative EthR mutant protein. Importantly, a phosphomimetic version of EthR, in which all phosphosites were replaced by Asp residues, exhibited markedly decreased DNA-binding activity compared with the wild-type protein. Together, these findings are the first demonstration of EthR phosphorylation and indicate that phosphorylation negatively affects its DNA-binding activity, which may impact ETH resistance levels in M. tb.

  9. GILZ mediates the antiproliferative activity of glucocorticoids by negative regulation of Ras signaling

    PubMed Central

    Ayroldi, Emira; Zollo, Ornella; Bastianelli, Alessandra; Marchetti, Cristina; Agostini, Massimiliano; Di Virgilio, Rosa; Riccardi, Carlo


    Tsc22d3 coding for glucocorticoid-induced leucine zipper (GILZ) was initially identified as a dexamethasone-responsive gene involved in the control of T lymphocyte activation and apoptosis. However, the physiological role of this molecule and its function in the biological activity of glucocorticoids (GCs) has not been clarified. Here, we demonstrate that GILZ interacts directly with Ras in vitro and in vivo as shown by GILZ and Ras coimmunoprecipitation and colocalization upon PMA activation in primary mouse spleen T lymphocytes and thymus cells. The analysis of GILZ mutants showed that they bound Ras through the tuberous sclerosis complex box (TSC) and, depending on the Ras activation level, formed a trimeric complex with Ras and Raf, which we previously identified as a GILZ binder. As a consequence of these interactions, GILZ diminished the activation of Ras and Raf downstream targets including ERK1/2, AKT/PKB serine/threonine kinase, and retinoblastoma (Rb) phosphorylation and cyclin D1 expression, leading to inhibition of Ras- and Raf-dependent cell proliferation and Ras-induced NIH-3T3 transformation. GILZ silencing resulted in an increase in concanavalin A–induced T cell proliferation and, most notably, inhibition of dexamethasone antiproliferative effects. Together, these findings indicate that GILZ serves as a negative regulator of Ras- and Raf-induced proliferation and is an important mediator of the antiproliferative effect of GCs. PMID:17492054

  10. Negative density dependence regulates two tree species at later life stage in a temperate forest.


    Piao, Tiefeng; Chun, Jung Hwa; Yang, Hee Moon; Cheon, Kwangil


    Numerous studies have demonstrated that tree survival is influenced by negative density dependence (NDD) and differences among species in shade tolerance could enhance coexistence via resource partitioning, but it is still unclear how NDD affects tree species with different shade-tolerance guilds at later life stages. In this study, we analyzed the spatial patterns for trees with dbh (diameter at breast height) ≥2 cm using the pair-correlation g(r) function to test for NDD in a temperate forest in South Korea after removing the effects of habitat heterogeneity. The analyses were implemented for the most abundant shade-tolerant (Chamaecyparis obtusa) and shade-intolerant (Quercus serrata) species. We found NDD existed for both species at later life stages. We also found Quercus serrata experienced greater NDD compared with Chamaecyparis obtusa. This study indicates that NDD regulates the two abundant tree species at later life stages and it is important to consider variation in species' shade tolerance in NDD study. PMID:25058660

  11. Role and regulation of heme iron acquisition in gram-negative pathogens

    PubMed Central

    Runyen-Janecky, Laura J.


    Bacteria that reside in animal tissues and/or cells must acquire iron from their host. However, almost all of the host iron is sequestered in iron-containing compounds and proteins, the majority of which is found within heme molecules. Thus, likely iron sources for bacterial pathogens (and non-pathogenic symbionts) are free heme and heme-containing proteins. Furthermore, the cellular location of the bacterial within the host (intra or extracellular) influences the amount and nature of the iron containing compounds available for transport. The low level of free iron in the host, coupled with the presence of numerous different heme sources, has resulted in a wide range of high-affinity iron acquisition strategies within bacteria. However, since excess iron and heme are toxic to bacteria, expression of these acquisition systems is highly regulated. Precise expression in the correct host environment at the appropriate times enables heme iron acquisitions systems to contribute to the growth of bacterial pathogens within the host. This mini-review will highlight some of the recent findings in these areas for gram-negative pathogens. PMID:24116354

  12. Cyclic nucleotide gated channel 10 negatively regulates salt tolerance by mediating Na+ transport in Arabidopsis.


    Jin, Yakang; Jing, Wen; Zhang, Qun; Zhang, Wenhua


    A number of cyclic nucleotide gated channel (CNGC) genes have been identified in plant genomes, but their functions are mainly undefined. In this study, we identified the role of CNGC10 in the response of Arabidopsis thaliana to salt stress. The cngc10 T-DNA insertion mutant showed greater tolerance to salt than wild-type A. thaliana during seed germination and seedling growth. The cngc10 mutant accumulated less Na(+) and K(+), but not less Ca(2+), in shoots in response to salt stress. By contrast, overexpression of CNGC10 resulted in greater sensitivity to salt stress, and complementation of this gene recovered salt sensitivity. In response to salt stress, heterologous expression of CNGC10 in the Na(+) sensitive yeast mutant strain B31 inhibited growth due to accumulation of Na(+) at a rate greater than that of yeast transformed with an empty vector. Quantitative RT-PCR analysis demonstrated that CNGC10 was expressed mainly in roots and flowers. GUS analysis of a root cross section indicated that CNGC10 was expressed mainly in the endodermis and epidermis. Furthermore, the expression of CNGC10 in roots was dramatically inhibited by exposure to 200 mM NaCl for 6 h. These data suggest that CNGC10 negatively regulates salt tolerance in A. thaliana and may be involved in mediating Na(+) transport. PMID:25416933

  13. Slamf8 is a negative regulator of Nox2 activity in macrophages

    PubMed Central

    Wang, Guoxing; Abadía-Molina, Ana C; Berger, Scott B; Romero, Xavier; O'Keeffe, Michael; Rojas-Barros, Domingo I.; Aleman, Marta; Liao, Gongxian; Maganto-García, Elena; Fresno, Manuel; Wang, Ninghai; Detre, Cynthia; Terhorst, Cox


    Slamf8 (CD353) is a cell surface receptor that is expressed upon activation of macrophages by interferon-gamma or bacteria. Here we report that a very high Nox2 activity enzyme was found in Slamf8−/− macrophages in response to E.coli or S.aureus, but also to phorbol myristate acetate. The elevated Nox2 activity in Slamf8−/− macrophages was also demonstrated in E.coli or S.aureus phagosomes by using a pH indicator system, and was further confirmed by a reduction of the enzyme activity after transfection of the receptor into Slamf8-deficient primary macrophages or RAW 264.7 cells. Upon exposure to bacteria and/or phorbol myristate acetate, PKC activity in Slamf8−/− macrophages is increased. This results in an enhanced phosphorylation of p40phox, one key component of the Nox2 enzyme complex, which in turn leads to greater Nox2 activity. Taken together, the data show that upon response to inflammation-associated stimuli the inducible receptor Slamf8 negatively regulates inflammatory responses. PMID:22593622

  14. Negative regulation of parathyroid hormone-related protein expression by steroid hormones

    SciTech Connect

    Kajitani, Takashi; Tamamori-Adachi, Mimi; Okinaga, Hiroko; Chikamori, Minoru; Iizuka, Masayoshi; Okazaki, Tomoki


    Highlights: {yields} Steroid hormones repress expression of PTHrP in the cell lines where the corresponding nuclear receptors are expressed. {yields} Nuclear receptors are required for suppression of PTHrP expression by steroid hormones, except for androgen receptor. {yields} Androgen-induced suppression of PTHrP expression appears to be mediated by estrogen receptor. -- Abstract: Elevated parathyroid hormone-related protein (PTHrP) is responsible for humoral hypercalcemia of malignancy (HHM), which is of clinical significance in treatment of terminal patients with malignancies. Steroid hormones were known to cause suppression of PTHrP expression. However, detailed studies linking multiple steroid hormones to PTHrP expression are lacking. Here we studied PTHrP expression in response to steroid hormones in four cell lines with excessive PTHrP production. Our study established that steroid hormones negatively regulate PTHrP expression. Vitamin D receptor, estrogen receptor {alpha}, glucocorticoid receptor, and progesterone receptor, were required for repression of PTHrP expression by the cognate ligands. A notable exception was the androgen receptor, which was dispensable for suppression of PTHrP expression in androgen-treated cells. We propose a pathway(s) involving nuclear receptors to suppress PTHrP expression.

  15. Cyclic nucleotide gated channel 10 negatively regulates salt tolerance by mediating Na+ transport in Arabidopsis.


    Jin, Yakang; Jing, Wen; Zhang, Qun; Zhang, Wenhua


    A number of cyclic nucleotide gated channel (CNGC) genes have been identified in plant genomes, but their functions are mainly undefined. In this study, we identified the role of CNGC10 in the response of Arabidopsis thaliana to salt stress. The cngc10 T-DNA insertion mutant showed greater tolerance to salt than wild-type A. thaliana during seed germination and seedling growth. The cngc10 mutant accumulated less Na(+) and K(+), but not less Ca(2+), in shoots in response to salt stress. By contrast, overexpression of CNGC10 resulted in greater sensitivity to salt stress, and complementation of this gene recovered salt sensitivity. In response to salt stress, heterologous expression of CNGC10 in the Na(+) sensitive yeast mutant strain B31 inhibited growth due to accumulation of Na(+) at a rate greater than that of yeast transformed with an empty vector. Quantitative RT-PCR analysis demonstrated that CNGC10 was expressed mainly in roots and flowers. GUS analysis of a root cross section indicated that CNGC10 was expressed mainly in the endodermis and epidermis. Furthermore, the expression of CNGC10 in roots was dramatically inhibited by exposure to 200 mM NaCl for 6 h. These data suggest that CNGC10 negatively regulates salt tolerance in A. thaliana and may be involved in mediating Na(+) transport.

  16. Syndecan-4 negatively regulates antiviral signalling by mediating RIG-I deubiquitination via CYLD

    PubMed Central

    Lin, Wei; Zhang, Jing; Lin, Haiyan; Li, Zexing; Sun, Xiaofeng; Xin, Di; Yang, Meng; Sun, Liwei; Li, Lin; Wang, Hongmei; Chen, Dahua; Sun, Qinmiao


    Retinoic acid-inducible gene I (RIG-I) plays important roles in pathogen recognition and antiviral signalling transduction. Here we show that syndecan-4 (SDC4) is a RIG-I-interacting partner identified in a yeast two-hybrid screen. We find that SDC4 negatively regulates the RIG-I-mediated antiviral signalling in a feedback-loop control manner. The genetic evidence obtained by using knockout mice further emphasizes this biological role of SDC4 in antiviral signalling. Mechanistically, we show that SDC4 interacts with both RIG-I and deubiquitinase CYLD via its carboxyl-terminal intracellular region. SDC4 likely promotes redistribution of RIG-I and CYLD in a perinuclear pattern post viral infection, and thus enhances the RIG-I–CYLD interaction and potentiates the K63-linked deubiquitination of RIG-I. Collectively, our findings uncover a mechanism by which SDC4 antagonizes the activation of RIG-I in a CYLD-mediated deubiquitination-dependent process, thereby balancing antiviral signalling to avoid deleterious effects on host cells. PMID:27279133

  17. Src-like Adaptor Protein (Slap) Is a Negative Regulator of T Cell Receptor Signaling

    PubMed Central

    Sosinowski, Tomasz; Pandey, Akhilesh; Dixit, Vishva M.; Weiss, Arthur


    Initiation of T cell antigen receptor (TCR) signaling is dependent on Lck, a Src family kinase. The Src-like adaptor protein (SLAP) contains Src homology (SH)3 and SH2 domains, which are highly homologous to those of Lck and other Src family members. Because of the structural similarity between Lck and SLAP, we studied its potential role in TCR signaling. Here, we show that SLAP is expressed in T cells, and that when expressed in Jurkat T cells it can specifically inhibit TCR signaling leading to nuclear factor of activated T cells (NFAT)-, activator protein 1 (AP-1)–, and interleukin 2–dependent transcription. The SH3 and SH2 domains of SLAP are required for maximal attenuation of TCR signaling. This inhibitory activity can be bypassed by the combination of phorbol myristate acetate (PMA) and ionomycin, suggesting that SLAP acts proximally in the TCR signaling pathway. SLAP colocalizes with endosomes in Jurkat and in HeLa cells, and is insoluble in mild detergents. In stimulated Jurkat cells, SLAP associates with a molecular signaling complex containing CD3ζ, ZAP-70, SH2 domain–containing leukocyte protein of 76 kD (SLP-76), Vav, and possibly linker for activation of T cells (LAT). These results suggest that SLAP is a negative regulator of TCR signaling. PMID:10662792

  18. Src-like adaptor protein (SLAP) is a negative regulator of T cell receptor signaling.


    Sosinowski, T; Pandey, A; Dixit, V M; Weiss, A


    Initiation of T cell antigen receptor (TCR) signaling is dependent on Lck, a Src family kinase. The Src-like adaptor protein (SLAP) contains Src homology (SH)3 and SH2 domains, which are highly homologous to those of Lck and other Src family members. Because of the structural similarity between Lck and SLAP, we studied its potential role in TCR signaling. Here, we show that SLAP is expressed in T cells, and that when expressed in Jurkat T cells it can specifically inhibit TCR signaling leading to nuclear factor of activated T cells (NFAT)-, activator protein 1 (AP-1)-, and interleukin 2-dependent transcription. The SH3 and SH2 domains of SLAP are required for maximal attenuation of TCR signaling. This inhibitory activity can be bypassed by the combination of phorbol myristate acetate (PMA) and ionomycin, suggesting that SLAP acts proximally in the TCR signaling pathway. SLAP colocalizes with endosomes in Jurkat and in HeLa cells, and is insoluble in mild detergents. In stimulated Jurkat cells, SLAP associates with a molecular signaling complex containing CD3zeta, ZAP-70, SH2 domain-containing leukocyte protein of 76 kD (SLP-76), Vav, and possibly linker for activation of T cells (LAT). These results suggest that SLAP is a negative regulator of TCR signaling.

  19. MEK-dependent IL-8 induction regulates the invasiveness of triple-negative breast cancer cells.


    Kim, Sangmin; Lee, Jeongmin; Jeon, Myeongjin; Lee, Jeong Eon; Nam, Seok Jin


    Interleukin-8 (IL-8) serves as a prognostic marker for breast cancer, and its expression level correlates with metastatic breast cancer and poor prognosis. Here, we investigated the levels of IL-8 expression in a variety of breast cancer cells and the regulatory mechanism of IL-8 in triple-negative breast cancer (TNBC) cells. Our results showed that IL-8 expression correlated positively with overall survival in basal-type breast cancer patients. The levels of IL-8 mRNA expression and protein secretion were significantly increased in TNBC cells compared with non-TNBC cells. In addition, the invasiveness of the TNBC cells was dramatically increased by IL-8 treatment and then augmented invasion-related proteins such as matrix metalloproteinase (MMP)-2 or MMP-9. We observed that elevated IL-8 mRNA expression and protein secretion were suppressed by a specific MEK1/2 inhibitor, UO126. In contrast, the overexpression of constitutively active MEK significantly increased the level of IL-8 mRNA expression in BT474 non-TNBC cells. Finally, we investigated the effect of UO126 on the tumorigenecity of TNBC cells. Our results showed that anchorage-independent growth, cell invasion, and cell migration were also decreased by UO126 in TNBC cells. As such, we demonstrated that IL-8 expression is regulated through MEK/ERK-dependent pathways in TNBC cells. A diversity of MEK blockers, including UO126, may be promising for treating TNBC patients.

  20. Zebrafish Tshz3b negatively regulates Hox function in the developing hindbrain.


    Erickson, Timothy; Pillay, Laura M; Waskiewicz, Andrew J


    In flies, the zinc-finger protein Teashirt promotes trunk segmental identities, in part, by repressing the expression and function of anterior hox paralog group (PG) 1-4 genes that specify head fates. Anterior-posterior patterning of the vertebrate hindbrain also requires Hox PG 1-4 function, but the role of vertebrate teashirt-related genes in this process has not been investigated. In this work, we use overexpression and structure-function analyses to show that zebrafish tshz3b antagonizes Hox-dependent hindbrain segmentation. Ectopic Tshz3b perturbs the specification of rhombomere identities and leads to the caudal expansion of r1, the only rhombomere whose identity is specified independently of Hox function. This overexpression phenotype does not require the homeodomain and C-terminal zinc fingers that are unique to vertebrate Teashirt-related proteins, but does require that Tshz3b function as a repressor. Together, these results argue that the negative regulation of Hox PG 1-4 function is a conserved characteristic of Teashirt-related proteins.

  1. VISTA is a novel broad-spectrum negative checkpoint regulator for cancer immunotherapy.


    Lines, J Louise; Sempere, Lorenzo F; Broughton, Thomas; Wang, Li; Noelle, Randolph


    In the past few years, the field of cancer immunotherapy has made great progress and is finally starting to change the way cancer is treated. We are now learning that multiple negative checkpoint regulators (NCR) restrict the ability of T-cell responses to effectively attack tumors. Releasing these brakes through antibody blockade, first with anti-CTLA4 and now followed by anti-PD1 and anti-PDL1, has emerged as an exciting strategy for cancer treatment. More recently, a new NCR has surfaced called V-domain immunoglobulin (Ig)-containing suppressor of T-cell activation (VISTA). This NCR is predominantly expressed on hematopoietic cells, and in multiple murine cancer models is found at particularly high levels on myeloid cells that infiltrated the tumors. Preclinical studies with VISTA blockade have shown promising improvement in antitumor T-cell responses, leading to impeded tumor growth and improved survival. Clinical trials support combined anti-PD1 and anti-CTLA4 as safe and effective against late-stage melanoma. In the future, treatment may involve combination therapy to target the multiple cell types and stages at which NCRs, including VISTA, act during adaptive immune responses.

  2. Negative regulation of bacterial killing and inflammation by two novel CD16 ligands.


    Beppler, Jaqueline; Mkaddem, Sanae Ben; Michaloski, Jussara; Honorato, Rodrigo Vargas; Velasco, Irineu Tadeu; de Oliveira, Paulo Sérgio Lopes; Giordano, Ricardo José; Monteiro, Renato C; Pinheiro da Silva, Fabiano


    Sepsis, a leading cause of death worldwide, involves exacerbated proinflammatory responses and inefficient bacterial clearance. Phagocytic cells play a crucial part in the prevention of sepsis by clearing bacteria through host innate receptors. Here, we used a phage display library to identify two peptides in Escherichia coli that interact with host innate receptors. One of these peptides, encoded by the wzxE gene of E. coli K-12, was involved in the transbilayer movement of a trisaccharide-lipid intermediate in the assembly of enterobacterial common antigen. Peptide-receptor interactions induced CD16-mediated inhibitory immunoreceptor tyrosine-based activating motif signaling, blocking the production of ROS and bacterial killing. This CD16-mediated inhibitory signaling was abrogated in a WzxE(-/-) mutant of E. coli K-12, restoring the production of ROS and bacterial killing. Taken together, the two novel CD16 ligands identified negatively regulate bacterial killing and inflammation. Our findings may contribute toward the development of new immunotherapies for E. coli-mediated infectious diseases and inflammation. PMID:27226142

  3. The lin-15 locus encodes two negative regulators of Caenorhabditis elegans vulval development.

    PubMed Central

    Huang, L S; Tzou, P; Sternberg, P W


    During Caenorhabditis elegans vulval development, an inductive signal from the anchor cell stimulates three of the six vulval precursor cells (VPCs) to adopt vulval rather than nonvulval epidermal fates. Genes necessary for this induction include the lin-3 growth factor, the let-23 receptor tyrosine kinase, and let-60 ras. lin-15 is a negative regulator of this inductive pathway. In lin-15 mutant animals, all six VPCs adopt vulval fates, even in the absence of inductive signal. Previous genetic studies suggested that lin-15 is a complex locus with two independently mutable activities, A and B. We have cloned the lin-15 locus by germline transformation and find that it encodes two nonoverlapping transcripts that are transcribed in the same direction. The downstream transcript encodes the lin-15A function; the upstream transcript encodes the lin-15B function. The predicted lin-15A and lin-15B proteins are novel and hydrophilic. We have identified a molecular null allele of lin-15 and have used it to analyze the role of lin-15 in the signaling pathway. We find that lin-15 acts upstream of let-23 and in parallel to the inductive signal. Images PMID:8054684

  4. Tomosyn Negatively Regulates Arginine Vasopressin Secretion in Embryonic Stem Cell-Derived Neurons

    PubMed Central

    Takeuchi, Seiji; Iwama, Shintaro; Takagi, Hiroshi; Kiyota, Atsushi; Nakashima, Kohtaro; Izumida, Hisakazu; Fujisawa, Haruki; Iwata, Naoko; Suga, Hidetaka; Watanabe, Takashi; Kaibuchi, Kozo; Oiso, Yutaka; Arima, Hiroshi; Sugimura, Yoshihisa


    Arginine vasopressin (AVP) is secreted via exocytosis; however, the precise molecular mechanism underlying the exocytosis of AVP remains to be elucidated. To better understand the mechanisms of AVP secretion, in our study we have identified proteins that bind with a 25 kDa synaptosomal-associated protein (SNAP25). SNAP25 plays a crucial role in exocytosis, in the posterior pituitary. Embryonic stem (ES) cell-derived AVP neurons were established to investigate the functions of the identified proteins. Using glutathione S-transferase (GST)-pulldown assays and proteomic analyses, we identified tomosyn-1 (syntaxin-binding protein 5) as a SNAP25-binding protein in the posterior pituitary. Coimmunoprecipitation assays indicated that tomosyn formed N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) complexes with SNAP25 and syntaxin1. Immunohistochemistry showed that tomosyn localized to the posterior pituitary. Mouse ES cells self-differentiated into AVP neurons (mES-AVP) that expressed tomosyn and two transmembrane SNARE proteins, including SNAP25 and syntaxin1. KCl increased AVP secretion in mES-AVP, and overexpression of tomosyn-1 reduced KCl-stimulated AVP secretion. Downregulation of tomosyn-1 with siRNA increased KCl-stimulated AVP secretion. These results suggested that tomosyn-1 negatively regulated AVP secretion in mES-AVP and further suggest the possibility of using mES-AVP culture systems to evaluate the role of synaptic proteins from AVP neurons. PMID:27732637

  5. Leishmania mexicana metacaspase is a negative regulator of amastigote proliferation in mammalian cells

    PubMed Central

    Castanys-Muñoz, E; Brown, E; Coombs, G H; Mottram, J C


    Metacaspases (MCAs) are caspase family cysteine peptidases that have been implicated in cell death processes in plants, fungi and protozoa. MCAs have also been suggested to be involved in cell cycle control, differentiation and clearance of aggregates; they are virulence factors. Dissecting the function of MCAs has been complicated by the presence in many organisms of multiple MCA genes or limitations on genetic manipulation. We describe here the creation of a MCA gene-deletion mutant (Δmca) in the protozoan parasite Leishmania mexicana, which has allowed us to dissect the role of the parasite's single MCA gene in cell growth and cell death. Δmca parasites are viable as promastigotes, and differentiate normally to the amastigote form both in in vitro macrophages infection and in mice. Δmca promastigotes respond to cell death inducers such as the drug miltefosine and H2O2 similarly to wild-type (WT) promastigotes, suggesting that MCAs do not have a caspase-like role in execution of L. mexicana cell death. Δmca amastigotes replicated significantly faster than WT amastigotes in macrophages and in mice, but not as axenic culture in vitro. We propose that the Leishmania MCA acts as a negative regulator of amastigote proliferation, thereby acting to balance cell growth and cell death. PMID:22951982

  6. Neutrophils negatively regulate induction of mucosal IgA responses after sublingual immunization

    PubMed Central

    Jee, Junbae; Bonnegarde-Bernard, Astrid; Duverger, Alexandra; Iwakura, Yoichiro; Cormet-Boyaka, Estelle; Martin, Tara L.; Steiner, Haley E.; Bachman, Ryan C.; Boyaka, Prosper N.


    Induction of mucosal IgA capable of providing a first line of defense against bacterial and viral pathogens remains a major goal of needle-free vaccines given via mucosal routes. Innate immune cells are known to play a central role in induction of IgA responses by mucosal vaccines, but the relative contribution of myeloid cell subsets to these responses has not firmly been established. Using an in vivo model of sublingual vaccination with Bacillus anthracis edema toxin (EdTx) as adjuvant, we examined the role of myeloid cell subsets for mucosal secretory IgA responses. Sublingual immunization of wild-type mice resulted in a transient increase of neutrophils in sublingual tissues and cervical lymph nodes. These mice later developed Ag-specific serum IgG responses, but not serum or mucosal IgA. Interestingly, EdTx failed to increase neutrophils in sublingual tissues of IKKβΔMye mice, and these mice developed IgA responses. Partial depletion of neutrophils before immunization of wild-type mice allowed the development of both mucosal and serum IgA responses. Finally, co-culture of B cells with neutrophils from either wild-type or IKKβΔMye mice suppressed production of IgA, but not IgM or IgG. These results identify a new role for neutrophils as negative regulators of IgA responses. PMID:25563500

  7. Syndecan-4 negatively regulates antiviral signalling by mediating RIG-I deubiquitination via CYLD.


    Lin, Wei; Zhang, Jing; Lin, Haiyan; Li, Zexing; Sun, Xiaofeng; Xin, Di; Yang, Meng; Sun, Liwei; Li, Lin; Wang, Hongmei; Chen, Dahua; Sun, Qinmiao


    Retinoic acid-inducible gene I (RIG-I) plays important roles in pathogen recognition and antiviral signalling transduction. Here we show that syndecan-4 (SDC4) is a RIG-I-interacting partner identified in a yeast two-hybrid screen. We find that SDC4 negatively regulates the RIG-I-mediated antiviral signalling in a feedback-loop control manner. The genetic evidence obtained by using knockout mice further emphasizes this biological role of SDC4 in antiviral signalling. Mechanistically, we show that SDC4 interacts with both RIG-I and deubiquitinase CYLD via its carboxyl-terminal intracellular region. SDC4 likely promotes redistribution of RIG-I and CYLD in a perinuclear pattern post viral infection, and thus enhances the RIG-I-CYLD interaction and potentiates the K63-linked deubiquitination of RIG-I. Collectively, our findings uncover a mechanism by which SDC4 antagonizes the activation of RIG-I in a CYLD-mediated deubiquitination-dependent process, thereby balancing antiviral signalling to avoid deleterious effects on host cells. PMID:27279133

  8. miR-194 is a negative regulator of GEF-H1 pathway in melanoma.


    Guo, Bingyu; Hui, Qiang; Zhang, Yu; Chang, Peng; Tao, Kai


    The incidence and associated mortality of melanoma continues to increase worldwide. At present, there is no curative therapy for advanced stage of melanoma. It is necessary to find new indicators of prognosis and therapeutic targets. Increasing evidence shows that miRNA can provide potential candidate biomarkers for melanoma and therapeutic targets. GEF-H1, a regulator of RhoA, as oncogenic driver in melanoma, promotes the growth and invasion of melanoma. miR-194 is a tumor-suppressor gene in multiple tumors, such as bladder and non-small cell lung cancer, and clear cell renal cell carcinoma. In the present study, we demonstrated that GEF-H1 serves as target of miR-194. Overexpression of miR-194 downregulates the GEF-H1/RhoA pathway, inhibits melanoma cancer cell proliferation and metastasis. Furthermore, miR-194 expression is negatively associated with tumor-node-metastasis (TNM) stages. Briefly, our findings provided new theoretical basis for melanoma treatment. PMID:27573550

  9. NRROS Negatively Regulates Osteoclast Differentiation by Inhibiting RANKL-Mediated NF-N:B and Reactive Oxygen Species Pathways.


    Kim, Jung Ha; Kim, Kabsun; Kim, Inyoung; Seong, Semun; Kim, Nacksung


    Negative regulator of reactive oxygen species (NRROS) is known to repress ROS generation in phagocytes. In this study, we examined the roles of NRROS in both osteoclasts and osteoblasts. Our results demonstrate that NRROS negatively regulates the differentiation of osteoclasts, but not osteoblasts. Further, overexpression of NRROS in osteoclast precursor cells attenuates RANKL-induced osteoclast differentiation. Conversely, osteoclast differentiation is enhanced upon siRNA-mediated knockdown of NRROS. Additionally, NRROS attenuates RANKL-induced NF-N:B activation, as well as degradation of the NOX1 and NOX2 proteins, which are required for ROS generation. Based on our observations, we present NRROS as a novel negative regulator of RANKL-induced osteoclastogenesis.

  10. NRROS Negatively Regulates Osteoclast Differentiation by Inhibiting RANKL-Mediated NF-κB and Reactive Oxygen Species Pathways

    PubMed Central

    Kim, Jung Ha; Kim, Kabsun; Kim, Inyoung; Seong, Semun; Kim, Nacksung


    Negative regulator of reactive oxygen species (NRROS) is known to repress ROS generation in phagocytes. In this study, we examined the roles of NRROS in both osteoclasts and osteoblasts. Our results demonstrate that NRROS negatively regulates the differentiation of osteoclasts, but not osteoblasts. Further, overexpression of NRROS in osteoclast precursor cells attenuates RANKL-induced osteoclast differentiation. Conversely, osteoclast differentiation is enhanced upon siRNA-mediated knockdown of NRROS. Additionally, NRROS attenuates RANKL-induced NF-κB activation, as well as degradation of the NOX1 and NOX2 proteins, which are required for ROS generation. Based on our observations, we present NRROS as a novel negative regulator of RANKL-induced osteoclastogenesis. PMID:26442864

  11. Identification of miRNA/mRNA-Negative Regulation Pairs in Nasopharyngeal Carcinoma

    PubMed Central

    Liu, Minglei; Zhu, Kangru; Qian, Xinmei; Li, Wei


    Background Nasopharyngeal carcinoma (NPC) is a common malignancy in South-East Asia. NPC is characterized by distant metastasis and poor prognosis. The pathophysiological mechanism of nasopharyngeal carcinoma is unknown. This study aimed to identify the crucial miRNAs in nasopharyngeal carcinoma and their target genes, and to discover the potential mechanism of nasopharyngeal carcinoma development. Material/Methods Microarray expression profiling of miRNA and mRNA from the Gene Expression Omnibus database was downloaded, and we performed a significance analysis of differential expression. An interaction network of miRNAs and target genes was constructed. The underlying function of differentially expressed genes was predicted through Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses. To validate the microarray analysis data, significantly different expression levels of miRNAs and target genes were validated by quantitative real-time polymerase chain reaction. Results We identified 27 differentially expressed miRNAs and 982 differentially expressed mRNAs between NPC and normal control tissues. 12 miRNAs and 547 mRNAs were up-regulated and 15 miRNAs and 435 mRNAs were down-regulated in NPC samples. We found a total of 1185 negative correlation pairs between miRNA and mRNA. Differentially expressed target genes were significantly enriched in pathways in cancer, cell cycle, and cytokine-cytokine receptor interaction signaling pathways. Significantly differentially expressed miRNAs and genes, such as hsa-miR-205, hsa-miR-18b, hsa-miR-632, hsa-miR-130a, hsa-miR-34b, PIGR, SMPD3, CD22, DTX4, and CDC6, may play essential roles in the development of nasopharyngeal carcinoma. Conclusions hsa-miR-205, hsa-miR-18b, hsa-miR-632, hsa-miR-130a, and hsa-miR-34b may be related to the development of nasopharyngeal carcinoma by regulating the genes involved in pathways in cancer and cell cycle signaling pathways. PMID:27350400

  12. DEK Depletion Negatively Regulates Rho/ROCK/MLC Pathway in Non–Small Cell Lung Cancer

    PubMed Central

    Wang, Junying; Sun, Limei; Yang, Mingyue; Luo, Wenting; Gao, Ying; Liu, Zihui; Wang, Enhua


    The human DEK proto-oncogene is a nuclear protein with suspected roles in human carcinogenesis. DEK appears to function in several nuclear processes, including transcriptional regulation and modulation of chromatin structure. To investigate the clinicopathological significance of DEK in patients with non–small cell lung cancer (NSCLC), we analyzed DEK immunohistochemistry in 112 NSCLC cases. The results showed that DEK was overexpressed mainly in the nuclear compartment of tumor cells. In squamous cell carcinoma, DEK-positive expression occurred in 47.9% (23/48) of cases, and in lung adenocarcinoma, DEK-positive expression occurred in 67.2% (43/64) of cases and correlated with differentiation, p-TNM stage, and nodal status. Moreover, in lung adenocarcinoma, DEK expression was significantly higher compared with DEK expression in squamous cell carcinoma. Kaplan-Meier analysis showed that patients with low DEK expression had higher overall survival compared with patients with high DEK expression. Depleting DEK expression inhibited cellular proliferation and migration. Furthermore, in DEK-depleted NSCLC cells, we found that RhoA expression was markedly reduced; in conjunction, active RhoA-GTP levels and the downstream effector phosphorylated MLC2 were also reduced. Taken together, DEK depletion inhibited cellular migration in lung cancer cell lines possibly through inactivation of the RhoA/ROCK/MLC signal transduction pathway. PMID:23571382

  13. Event-Related Potentials Reveal Preserved Attention Allocation but Impaired Emotion Regulation in Patients with Epilepsy and Comorbid Negative Affect

    PubMed Central

    De Taeye, Leen; Pourtois, Gilles; Meurs, Alfred; Boon, Paul; Vonck, Kristl; Carrette, Evelien; Raedt, Robrecht


    Patients with epilepsy have a high prevalence of comorbid mood disorders. This study aims to evaluate whether negative affect in epilepsy is associated with dysfunction of emotion regulation. Event-related potentials (ERPs) are used in order to unravel the exact electrophysiological time course and investigate whether a possible dysfunction arises during early (attention) and/or late (regulation) stages of emotion control. Fifty epileptic patients with (n = 25) versus without (n = 25) comorbid negative affect plus twenty-five matched controls were recruited. ERPs were recorded while subjects performed a face- or house-matching task in which fearful, sad or neutral faces were presented either at attended or unattended spatial locations. Two ERP components were analyzed: the early vertex positive potential (VPP) which is normally enhanced for faces, and the late positive potential (LPP) that is typically larger for emotional stimuli. All participants had larger amplitude of the early face-sensitive VPP for attended faces compared to houses, regardless of their emotional content. By contrast, in patients with negative affect only, the amplitude of the LPP was significantly increased for unattended negative emotional expressions. These VPP results indicate that epilepsy with or without negative affect does not interfere with the early structural encoding and attention selection of faces. However, the LPP results suggest abnormal regulation processes during the processing of unattended emotional faces in patients with epilepsy and comorbid negative affect. In conclusion, this ERP study reveals that early object-based attention processes are not compromised by epilepsy, but instead, when combined with negative affect, this neurological disease is associated with dysfunction during the later stages of emotion regulation. As such, these new neurophysiological findings shed light on the complex interplay of epilepsy with negative affect during the processing of emotional

  14. How Is Emotional Awareness Related to Emotion Regulation Strategies and Self-Reported Negative Affect in the General Population?

    PubMed Central

    Subic-Wrana, Claudia; Beutel, Manfred E.; Brähler, Elmar; Stöbel-Richter, Yve; Knebel, Achim; Lane, Richard D.; Wiltink, Jörg


    Objective The Levels of Emotional Awareness Scale (LEAS) as a performance task discriminates between implicit or subconscious and explicit or conscious levels of emotional awareness. An impaired awareness of one's feeling states may influence emotion regulation strategies and self-reports of negative emotions. To determine this influence, we applied the LEAS and self-report measures for emotion regulation strategies and negative affect in a representative sample of the German general population. Sample and Methods A short version of the LEAS, the Hospital Anxiety and Depression Scale (HADS) and the Emotion Regulation Questionnaire (ERQ), assessing reappraisal and suppression as emotion regulation strategies, were presented to N = 2524 participants of a representative German community study. The questionnaire data were analyzed with regard to the level of emotional awareness. Results LEAS scores were independent from depression, but related to self-reported anxiety. Although of small or medium effect size, different correlational patters between emotion regulation strategies and negative affectivity were related to implict and explict levels of emotional awareness. In participants with implicit emotional awareness, suppression was related to higher anxiety and depression, whereas in participants with explicit emotional awareness, in addition to a positive relationship of suppression and depression, we found a negative relationship of reappraisal to depression. These findings were independent of age. In women high use of suppression and little use of reappraisal were more strongly related to negative affect than in men. Discussion Our first findings suggest that conscious awareness of emotions may be a precondition for the use of reappraisal as an adaptive emotion regulation strategy. They encourage further research in the relation between subconsious and conscious emotional awareness and the prefarance of adaptive or maladaptive emotion regulation strategies The

  15. Negative regulation of Gq-mediated pathways in platelets by G(12/13) pathways through Fyn kinase.


    Kim, Soochong; Kunapuli, Satya P


    Platelets contain high levels of Src family kinases (SFKs), but their functional role downstream of G protein pathways has not been completely understood. We found that platelet shape change induced by selective G(12/13) stimulation was potentiated by SFK inhibitors, which was abolished by intracellular calcium chelation. Platelet aggregation, secretion, and intracellular Ca(2+) mobilization mediated by low concentrations of SFLLRN or YFLLRNP were potentiated by SFK inhibitors. However, 2-methylthio-ADP-induced intracellular Ca(2+) mobilization and platelet aggregation were not affected by PP2, suggesting the contribution of SFKs downstream of G(12/13), but not G(q)/G(i), as a negative regulator to platelet activation. Moreover, PP2 potentiated YFLLRNP- and AYPGKF-induced PKC activation, indicating that SFKs downstream of G(12/13) regulate platelet responses through the negative regulation of PKC activation as well as calcium response. SFK inhibitors failed to potentiate platelet responses in the presence of G(q)-selective inhibitor YM254890 or in G(q)-deficient platelets, indicating that SFKs negatively regulate platelet responses through modulation of G(q) pathways. Importantly, AYPGKF-induced platelet aggregation and PKC activation were potentiated in Fyn-deficient but not in Lyn-deficient mice compared with wild-type littermates. We conclude that SFKs, especially Fyn, activated downstream of G(12/13) negatively regulate platelet responses by inhibiting intracellular calcium mobilization and PKC activation through G(q) pathways. PMID:21592972

  16. PKC{delta}-mediated IRS-1 Ser24 phosphorylation negatively regulates IRS-1 function

    SciTech Connect

    Greene, Michael W. . E-mail:; Ruhoff, Mary S.; Roth, Richard A.; Kim, Jeong-a; Quon, Michael J.; Krause, Jean A.


    The IRS-1 PH and PTB domains are essential for insulin-stimulated IRS-1 Tyr phosphorylation and insulin signaling, while Ser/Thr phosphorylation of IRS-1 disrupts these signaling events. To investigate consensus PKC phosphorylation sites in the PH-PTB domains of human IRS-1, we changed Ser24, Ser58, and Thr191 to Ala (3A) or Glu (3E), to block or mimic phosphorylation, respectively. The 3A mutant abrogated the inhibitory effect of PKC{delta} on insulin-stimulated IRS-1 Tyr phosphorylation, while reductions in insulin-stimulated IRS-1 Tyr phosphorylation, cellular proliferation, and Akt activation were observed with the 3E mutant. When single Glu mutants were tested, the Ser24 to Glu mutant had the greatest inhibitory effect on insulin-stimulated IRS-1 Tyr phosphorylation. PKC{delta}-mediated IRS-1 Ser24 phosphorylation was confirmed in cells with PKC{delta} catalytic domain mutants and by an RNAi method. Mechanistic studies revealed that IRS-1 with Ala and Glu point mutations at Ser24 impaired phosphatidylinositol-4,5-bisphosphate binding. In summary, our data are consistent with the hypothesis that Ser24 is a negative regulatory phosphorylation site in IRS-1.

  17. Amygdalin Regulates Apoptosis and Adhesion in Hs578T Triple-Negative Breast Cancer Cells

    PubMed Central

    Lee, Hye Min; Moon, Aree


    Amygdalin, D-mandelonitrile-β-D-glucoside-6-β-glucoside, belongs to aromatic cyanogenic glycoside group derived from rosaceous plant seed. Mounting evidence has supported the anti-cancer effects of amygdalin. However, whether amygdalin indeed acts as an anti-tumor agent against breast cancer cells is not clear. The present study aimed to investigate the effect of amygdalin on the proliferation of human breast cancer cells. Here, we show that amygdalin exerted cytotoxic activities on estrogen receptors (ER)-positive MCF7 cells, and MDA-MB-231 and Hs578T triple-negative breast cancer (TNBC) cells. Amygdalin induced apoptosis of Hs578T TNBC cells. Amygdalin downregulated B-cell lymphoma 2 (Bcl-2), upregulated Bcl-2-associated X protein (Bax), activated of caspase-3 and cleaved poly ADP-ribose polymerase (PARP). Amygdalin activated a pro-apoptotic signaling molecule p38 mitogen-activated protein kinases (p38 MAPK) in Hs578T cells. Treatment of amygdalin significantly inhibited the adhesion of Hs578T cells, in which integrin α5 may be involved. Taken together, this study demonstrates that amygdalin induces apoptosis and inhibits adhesion of breast cancer cells. The results suggest a potential application of amygdalin as a chemopreventive agent to prevent or alleviate progression of breast cancer, especially TNBC. PMID:26759703

  18. Positive and negative regulation of adenovirus infection by CAR-like soluble protein, CLSP.


    Kawabata, K; Tashiro, K; Sakurai, F; Osada, N; Kusuda, J; Hayakawa, T; Yamanishi, K; Mizuguchi, H


    Coxsackievirus and adenovirus receptor (CAR) is a member of the immunoglobulin (Ig) superfamily and a component of epithelial tight junction. CAR also functions as a primary receptor for coxsackievirus B and adenovirus (Ad) infection. In this study, we report the identification of a novel protein, CAR-like soluble protein (CLSP), which is closely related to CAR. Mouse CLSP (mCLSP) was composed of 390 amino acids, including three Ig domains, and showed strong homology to the IgV domain of CAR. Interestingly, mCLSP lacks a transmembrane domain, indicating that this is a soluble protein. mCLSP mRNA was detected primarily in the brain and ovary. When mCLSP cDNA was introduced into SK HEP-1 cells, which were known to be CAR positive and easily infected with Ad vector, the infection with Ad vector was severely inhibited. On the other hand, mCLSP promoted the infection with Ad vector in CAR-negative NIH3T3 cells. Furthermore, recombinant CLSP directly bound to Ad and inhibited the Ad vector-mediated transduction in SK HEP-1 cells. Computational analysis for a genome database showed that the CLSP gene is rodent-specific, and that human and bovine lack this gene. These results suggest that CLSP may play a role in the antiviral defense of the host in rodent animals.

  19. Reassurance Against Future Risk of Precancer and Cancer Conferred by a Negative Human Papillomavirus Test

    PubMed Central

    Schiffman, Mark; Katki, Hormuzd A.; Castle, Philip E.; Fetterman, Barbara; Wentzensen, Nicolas; Poitras, Nancy E.; Lorey, Thomas; Cheung, Li C.; Kinney, Walter K.


    Primary human papillomavirus (HPV) testing (without concurrent Pap tests) every 3 years is under consideration in the United States as an alternative to the two recommended cervical cancer screening strategies: primary Pap testing every 3 years, or concurrent Pap and HPV testing (“cotesting”) every 5 years. Using logistic regression and Weibull survival models, we estimated and compared risks of cancer and cervical intraepithelial neoplasia grade 3 or worse (CIN3+) for the three strategies among 1011092 women aged 30 to 64 years testing HPV-negative and/or Pap-negative in routine screening at Kaiser Permanente Northern California since 2003. All statistical tests were two sided. Three-year risks following an HPV-negative result were lower than 3-year risks following a Pap-negative result (CIN3+ = 0.069% vs 0.19%, P < .0001; Cancer = 0.011% vs 0.020%, P < .0001) and 5-year risks following an HPV-negative/Pap-negative cotest (CIN3+ = 0.069% vs 0.11%, P < .0001; Cancer = 0.011% vs 0.014%, P = .21). These findings suggest that primary HPV testing merits consideration as another alternative for cervical screening. PMID:25038467

  20. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans

    PubMed Central

    Dlugos, Andrea M.; Palmer, Abraham A.


    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression. PMID:19657584

  1. Negative emotionality: monoamine oxidase B gene variants modulate personality traits in healthy humans.


    Dlugos, Andrea M; Palmer, Abraham A; de Wit, Harriet


    Monoamine oxidase A and B (MAOA and MAOB) appear to be involved in the pathogenesis of Major Depression, and vulnerability of Major Depression is associated with personality traits relating to positive and negative affect. This study aimed to investigate associations between MAOA and MAOB polymorphisms and personality traits of positive and negative emotionality in healthy volunteers, to elucidate mechanisms underlying personality and the risk for depression. Healthy Caucasian volunteers (N = 150) completed the Multiphasic Personality Questionnaire (MPQ), which includes independent superfactors of Positive Emotionality and Negative Emotionality. Participants were genotyped for 8 MAOA and 12 MAOB single nucleotide polymorphisms (SNPs). Association analyses for both SNPs and haplotypes were performed using the permutation approach implemented in PLINK. Negative Emotionality was significantly associated with the two highly linked MAOB polymorphisms rs10521432 and rs6651806 (p < 0.002). Findings were extended in haplotype analyses. For MAOB the 4-SNP haplotype GACG formed from rs1799836, rs10521432, rs6651806 and rs590551 was significantly related to lower Negative Emotionality scores (p < 0.002). MAOA was not related to personality in this study. Our finding provides the first evidence that MAOB polymorphisms influence levels of negative emotionality in healthy human volunteers. If confirmed, these results could lead to a better understanding of personality traits and inter-individual susceptibility developing psychiatric disorders such as major depression.

  2. Role of the guanine nucleotide exchange factor Ost in negative regulation of receptor endocytosis by the small GTPase Rac1.


    Ieguchi, Katsuaki; Ueda, Shuji; Kataoka, Tohru; Satoh, Takaya


    The Rho family of GTPases has been implicated in the regulation of intracellular vesicle trafficking. Here, we investigated the mechanism underlying the negative regulation of clathrin-mediated endocytosis of cell surface receptors mediated by the Rho family protein Rac1. Contrary to previous reports, only the activated mutant of Rac1, but not other Rho family members including RhoA and Cdc42, suppressed internalization of the transferrin receptor. On the other hand, down-regulation of Rac1 expression by RNA interference resulted in enhanced receptor internalization, suggesting that endogenous Rac1 in fact functions as a negative regulator. We identified a guanine nucleotide exchange factor splice variant designated Ost-III, which contains a unique C-terminal region including an Src homology 3 domain, as a regulator of Rac1 involved in the inhibition of receptor endocytosis. In contrast, other splice variants Ost-I and Ost-II exerted virtually no effect on receptor endocytosis. We also examined subcellular localization of synaptojanin 2, a putative Rac1 effector implicated in negative regulation of receptor endocytosis. Each Ost splice variant induced distinct subcellular localization of synaptojanin 2, depending on Rac1 activation. Furthermore, we isolated gamma-aminobutyric acid type A receptor-associated protein (GABARAP) as a protein that binds to the C-terminal region of Ost-III. When ectopically expressed, GABARAP was co-localized with Ost-III and potently suppressed the Ost-III-dependent Rac1 activation and the inhibition of receptor endocytosis. Lipid modification of GABARAP was necessary for the suppression of Ost-III. These results are discussed in terms of subcellular region-specific regulation of the Rac1-dependent signaling pathway that negatively regulates clathrin-mediated endocytosis.

  3. MiR-146b negatively regulates migration and delays progression of T-cell acute lymphoblastic leukemia

    PubMed Central

    Correia, Nádia C.; Fragoso, Rita; Carvalho, Tânia; Enguita, Francisco J.; Barata, João T.


    Previous results indicated that miR-146b-5p is downregulated by TAL1, a transcription factor critical for early hematopoiesis that is frequently overexpressed in T-cell acute lymphoblastic leukemia (T-ALL) where it has an oncogenic role. Here, we confirmed that miR-146b-5p expression is lower in TAL1-positive patient samples than in other T-ALL cases. Furthermore, leukemia T-cells display decreased levels of miR-146b-5p as compared to normal T-cells, thymocytes and other hematopoietic progenitors. MiR-146b-5p silencing enhances the in vitro migration and invasion of T-ALL cells, associated with increased levels of filamentous actin and chemokinesis. In vivo, miR-146b overexpression in a TAL1-positive cell line extends mouse survival in a xenotransplant model of human T-ALL. In contrast, knockdown of miR-146b-5p results in leukemia acceleration and decreased mouse overall survival, paralleled by faster tumor infiltration of the central nervous system. Our results suggest that miR-146b-5p is a functionally relevant microRNA gene in the context of T-ALL, whose negative regulation by TAL1 and possibly other oncogenes contributes to disease progression by modulating leukemia cell motility and disease aggressiveness. PMID:27550837

  4. RIN3 is a negative regulator of mast cell responses to SCF.


    Janson, Christine; Kasahara, Noriyuki; Prendergast, George C; Colicelli, John


    Stimulation of the receptor tyrosine kinase KIT by Stem Cell Factor (SCF) triggers activation of RAS and its downstream effectors. Proper KIT activation is essential for the maturation, survival and proliferation of mast cells. In addition, SCF activation of KIT is critical for recruiting mast cells to sites of infection or injury, where they release a mix of pro-inflammatory substances. RIN3, a RAS effector and RAB5-directed guanine nucleotide exchange factor (GEF), is highly expressed and enriched in human mast cells. SCF treatment of mast cells increased the amount of GTP-bound RAB5, and the degree of RAB5 activation correlated with the expression level of RIN3. At the same time, SCF caused the dissociation of a pre-formed complex of RIN3 with BIN2, a membrane bending protein implicated in endocytosis. Silencing of RIN3 increased the rate of SCF-induced KIT internalization, while persistent RIN3 over-expression led to KIT down regulation. These observations strongly support a role for RIN3 in coordinating the early steps of KIT endocytosis. Importantly, RIN3 also functioned as an inhibitor of mast cell migration toward SCF. Finally, we demonstrate that elevated RIN3 levels sensitize mastocytosis cells to treatment with a KIT tyrosine kinase inhibitor, suggesting the value of a two-pronged inhibitor approach for this difficult to treat malignancy. These findings directly connect KIT activation with a mast cell-specific RAS effector that regulates the cellular response to SCF and provide new insight for the development of more effective mastocytosis treatments. PMID:23185384

  5. PBL13 Is a Serine/Threonine Protein Kinase That Negatively Regulates Arabidopsis Immune Responses.


    Lin, Zuh-Jyh Daniel; Liebrand, Thomas W H; Yadeta, Koste A; Coaker, Gitta


    Receptor-like cytoplasmic kinases (RLCKs) are a subset of plant receptor-like kinases lacking both extracellular and transmembrane domains. Some of the 46 members in the Arabidopsis (Arabidopsis thaliana) RLCK subfamily VII have been linked to plant innate immunity; however, most remain uncharacterized. Thus, multiple subfamily VII members are expected to be involved in plant immune signaling. Here, we investigate the role of AvrPphB SUSCEPTIBLE1-LIKE13 (PBL13), a subfamily VII RLCK with unique domain architecture. Unlike other characterized RLCKs, PBL13 transfer DNA insertion lines exhibit enhanced disease resistance after inoculation with virulent Pseudomonas syringae. The pbl13-2 knockout also exhibits elevated basal-level expression of the PATHOGENESIS-RELATED GENE1 defense marker gene, enhanced reactive oxygen species (ROS) burst in response to perception of bacterial microbial patterns, and accelerated flagellin-induced activation of mitogen-activated protein kinases. Recombinant PBL13 is an active kinase, and its primary autophosphorylated sites map to a 15-amino acid repeat motif unique to PBL13. Complementation of pbl13-2 with PBL13-3xFLAG converts the enhanced resistance and elevated ROS phenotypes back to wild-type levels. In contrast, kinase-dead PBL13(K111A)-3xFLAG was unable to rescue pbl13-2 disease phenotypes. Consistent with the enhanced ROS burst in the pbl13-2 knockout, PBL13 is able to associate with the nicotinamide adenine dinucleotide phosphate, reduced oxidase RESPIRATORY BURST OXIDASE HOMOLOG PROTEIN D (RBOHD) by split-luciferase complementation assay, and this association is disrupted by flagellin treatment. We conclude that the PBL13 kinase negatively regulates plant innate immunity to pathogenic bacteria and can associate with RBOHD before pathogen perception. These data are consistent with the hypothesis that PBL13 acts to prevent inappropriate activation of defense responses in the absence of pathogen challenge.

  6. A mutation of the fission yeast EB1 overcomes negative regulation by phosphorylation and stabilizes microtubules

    SciTech Connect

    Iimori, Makoto; Ozaki, Kanako; Chikashige, Yuji; Habu, Toshiyuki; Hiraoka, Yasushi; Maki, Takahisa; Hayashi, Ikuko; Obuse, Chikashi; Matsumoto, Tomohiro


    Mal3 is a fission yeast homolog of EB1, a plus-end tracking protein (+ TIP). We have generated a mutation (89R) replacing glutamine with arginine in the calponin homology (CH) domain of Mal3. Analysis of the 89R mutant in vitro has revealed that the mutation confers a higher affinity to microtubules and enhances the intrinsic activity to promote the microtubule-assembly. The mutant Mal3 is no longer a + TIP, but binds strongly the microtubule lattice. Live cell imaging has revealed that while the wild type Mal3 proteins dissociate from the tip of the growing microtubules before the onset of shrinkage, the mutant Mal3 proteins persist on microtubules and reduces a rate of shrinkage after a longer pausing period. Consequently, the mutant Mal3 proteins cause abnormal elongation of microtubules composing the spindle and aster. Mal3 is phosphorylated at a cluster of serine/threonine residues in the linker connecting the CH and EB1-like C-terminal motif domains. The phosphorylation occurs in a microtubule-dependent manner and reduces the affinity of Mal3 to microtubules. We propose that because the 89R mutation is resistant to the effect of phosphorylation, it can associate persistently with microtubules and confers a stronger stability of microtubules likely by reinforcing the cylindrical structure. -- Highlights: Black-Right-Pointing-Pointer We characterize a mutation (mal3-89R) in fission yeast homolog of EB1. Black-Right-Pointing-Pointer The mutation enhances the activity to assemble microtubules. Black-Right-Pointing-Pointer Mal3 is phosphorylated in a microtubule-dependent manner. Black-Right-Pointing-Pointer The phosphorylation negatively regulates the Mal3 activity.

  7. BP1, an Isoform of DLX4 Homeoprotein, Negatively Regulates BRCA1 in Sporadic Breast Cancer

    PubMed Central

    Kluk, Brian J.; Fu, Yebo; Formolo, Trina A.; Zhang, Lei; Hindle, Anne K.; Man, Yan-gao; Siegel, Robert S.; Berg, Patricia E.; Deng, Chuxia; McCaffrey, Timothy A.; Fu, Sidney W.


    Introduction: Several lines of evidence point to an important role for BP1, an isoform of DLX4 homeobox gene, in breast carcinogenesis and progression. BRCA1 is a well-known player in the etiology of breast cancer. While familial breast cancer is often marked by BRCA1 mutation and subsequent loss of heterozygosity, sporadic breast cancers exhibit reduced expression of wild type BRCA1, and loss of BRCA1 expression may result in tumor development and progression. Methods: The Cister algorithm and Genomatix program were used to identify potential BP1 binding sites in BRCA1 gene. Real-time PCR, Western blot and immunohistochemistry analysis were performed to verify the expression of BRCA1 and BP1 in cell lines and breast cancer tissues. Double-stranded siRNA transfection was carried out for silencing BP1 expression. ChIP and EMSA were used to confirm that BP1 specifically binds to BRCA1. Results: A putative BP1 binding site was identified in the first intron of BRCA1, which was confirmed by chromatin immunoprecipiation and electrophoresis mobility shift assay. BP1 and BRCA1 expression were inversely correlated in breast cancer cell lines and tissues, suggesting that BP1 may suppress BRCA1 transcription through consensus sequence binding. Conclusions: BP1 homeoprotein represses BRCA1 expression through direct binding to its first intron, which is consistent with a previous study which identified a novel transcriptional repressor element located more than 500 base pairs into the first intron of BRCA1, suggesting that the first intron plays an important role in the negative regulation of BRCA1. Although further functional studies are necessary to confirm its repressor activity towards BRCA1, the elucidation of the role of BP1 in breast tumorigenesis holds great promise in establishing BP1 as a novel target for drug therapy. PMID:20877436

  8. Rac1 inhibition negatively regulates transcriptional activity of the amyloid precursor protein gene.


    Wang, Pi-Lin; Niidome, Tetsuhiro; Akaike, Akinori; Kihara, Takeshi; Sugimoto, Hachiro


    Rac1, a member of the Rho family GTPases, participates in a variety of cellular functions including lamellipodia formation, actin cytoskeleton organization, cell growth, apoptosis, and neuronal development. Recent studies have implicated Rac1 in cytoskeletal abnormalities, production of reactive oxygen species, and generation of the amyloid beta-peptide (Abeta) observed in Alzheimer's disease. In this study, we examined the relationship between Rac1 and amyloid precursor protein (APP), because the abnormal proteolytic processing of APP is a pathologic feature of Alzheimer's disease. In primary hippocampal neurons, the Rac1-specific inhibitor NSC23766 decreased both Rac1 activity and APP protein levels in a concentration-dependent manner. To elucidate how NSC23766 decreases APP protein levels, we examined the effects of NSC23766 on APP processing, degradation, and biosynthesis. NSC23766 did not increase the levels of the proteolytic products of APP, sAPPalpha, Abeta40, and Abeta42. The proteasome inhibitor lactacystin did not reverse the NSC23766-induced decrease in APP protein levels. NSC23766 did, however, decrease the levels of both APP mRNA and APP protein. Decreased levels of APP mRNA and protein were also observed when HEK293 cells were transfected with an expression vector containing a dominant-negative Rac1 mutant or with siRNA targeting Rac1. By overexpressing progressively deleted fragments of the APP promoter in HEK293 cells, we identified a Rac1 response site at positions -233 to -41 bp in the APP promoter. Taken together, our results suggest that Rac1 regulates transcription of the APP gene in primary hippocampal neurons.

  9. Regulation of toll-like receptors-mediated inflammation by immunobiotics in bovine intestinal epitheliocytes: role of signaling pathways and negative regulators.


    Villena, Julio; Aso, Hisashi; Kitazawa, Haruki


    Intestinal epithelial cells (IECs) detect bacterial and viral associated molecular patterns via germline-encoded pattern-recognition receptors (PRRs) and are responsible for maintaining immune tolerance to the communities of resident commensal bacteria while being also capable to mount immune responses against pathogens. Toll-like receptors (TLRs) are a major class of PRRs expressed on IECs and immune cells, which are involved in the induction of both tolerance and inflammation. In the last decade, experimental and clinical evidence was generated to support the application of probiotics with immunoregulatory capacities (immunobiotics) for the prevention and treatment of several gastrointestinal inflammatory disorders in which TLRs exert a significant role. The majority of these studies were performed in mouse and human cell lines, and despite the growing interest in the bovine immune system due to the economic importance of cattle as livestock, only few studies have been conducted on cattle. In this regard, our group has established a bovine intestinal epithelial (BIE) cell line originally derived from fetal bovine intestinal epitheliocytes and used this cell line to evaluate the impact of immunobiotics in TLR-mediated inflammation. This review aims to summarize the current knowledge of the beneficial effects of immunobiotics in the regulation of intestinal inflammation/infection in cattle. Especially, we discuss the role of TLRs and their negative regulators in both the inflammatory response and the beneficial effects of immunobiotics in bovine IECs. This review article emphasizes the cellular and molecular interactions of immunobiotics with BIE cells through TLRs and gives the scientific basis for the development of immunomodulatory feed for bovine healthy development. PMID:25228903

  10. Regulation of Toll-Like Receptors-Mediated Inflammation by Immunobiotics in Bovine Intestinal Epitheliocytes: Role of Signaling Pathways and Negative Regulators

    PubMed Central

    Villena, Julio; Aso, Hisashi; Kitazawa, Haruki


    Intestinal epithelial cells (IECs) detect bacterial and viral associated molecular patterns via germline-encoded pattern-recognition receptors (PRRs) and are responsible for maintaining immune tolerance to the communities of resident commensal bacteria while being also capable to mount immune responses against pathogens. Toll-like receptors (TLRs) are a major class of PRRs expressed on IECs and immune cells, which are involved in the induction of both tolerance and inflammation. In the last decade, experimental and clinical evidence was generated to support the application of probiotics with immunoregulatory capacities (immunobiotics) for the prevention and treatment of several gastrointestinal inflammatory disorders in which TLRs exert a significant role. The majority of these studies were performed in mouse and human cell lines, and despite the growing interest in the bovine immune system due to the economic importance of cattle as livestock, only few studies have been conducted on cattle. In this regard, our group has established a bovine intestinal epithelial (BIE) cell line originally derived from fetal bovine intestinal epitheliocytes and used this cell line to evaluate the impact of immunobiotics in TLR-mediated inflammation. This review aims to summarize the current knowledge of the beneficial effects of immunobiotics in the regulation of intestinal inflammation/infection in cattle. Especially, we discuss the role of TLRs and their negative regulators in both the inflammatory response and the beneficial effects of immunobiotics in bovine IECs. This review article emphasizes the cellular and molecular interactions of immunobiotics with BIE cells through TLRs and gives the scientific basis for the development of immunomodulatory feed for bovine healthy development. PMID:25228903

  11. Interactions of cellular proteins involved in the transcriptional regulation of the human immunodeficiency virus.

    PubMed Central

    Garcia, J A; Wu, F K; Mitsuyasu, R; Gaynor, R B


    The human immunodeficiency virus (HIV) is a human retrovirus which is the etiologic agent of the acquired immunodeficiency syndrome. To study the cellular factors involved in the transcriptional regulation of this virus, we performed DNase I footprinting of the viral LTR using partially purified HeLa cell extracts. Five regions of the viral LTR appear critical for DNA binding of cellular proteins. These include the negative regulatory, enhancer, SP1, TATA and untranslated regions. Deletion mutagenesis of these binding domains has significant effects on the basal level of transcription and the ability to be induced by the viral tat protein. Mutations of either the negative regulatory or untranslated regions affect factor binding to the enhancer region. In addition, oligonucleotides complementary to several of the binding domains specifically compete for factor binding. These results suggest that interactions between several distinct cellular proteins are required for HIV transcriptional regulation. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 6. PMID:3428273

  12. Interactions of cellular proteins involved in the transcriptional regulation of the human immunodeficiency virus.


    Garcia, J A; Wu, F K; Mitsuyasu, R; Gaynor, R B


    The human immunodeficiency virus (HIV) is a human retrovirus which is the etiologic agent of the acquired immunodeficiency syndrome. To study the cellular factors involved in the transcriptional regulation of this virus, we performed DNase I footprinting of the viral LTR using partially purified HeLa cell extracts. Five regions of the viral LTR appear critical for DNA binding of cellular proteins. These include the negative regulatory, enhancer, SP1, TATA and untranslated regions. Deletion mutagenesis of these binding domains has significant effects on the basal level of transcription and the ability to be induced by the viral tat protein. Mutations of either the negative regulatory or untranslated regions affect factor binding to the enhancer region. In addition, oligonucleotides complementary to several of the binding domains specifically compete for factor binding. These results suggest that interactions between several distinct cellular proteins are required for HIV transcriptional regulation.

  13. Cumulative Risk, Negative Emotionality, and Emotion Regulation as Predictors of Social Competence in Transition to School: A Mediated Moderation Model

    ERIC Educational Resources Information Center

    Chang, Hyein; Shelleby, Elizabeth C.; Cheong, JeeWon; Shaw, Daniel S.


    The goals of this study were to examine the additive and interactive effects of cumulative risk and child negative emotionality on children's social competence in the transition from preschool to school and to test whether these associations were mediated by child emotion regulation within a sample of 310 low-income, ethnically diverse boys.…

  14. Maternal Positive and Negative Interaction Behaviors and Early Adolescents' Depressive Symptoms: Adolescent Emotion Regulation as a Mediator

    ERIC Educational Resources Information Center

    Yap, Marie B. H.; Schwartz, Orli S.; Byrne, Michelle L.; Simmons, Julian G.; Allen, Nicholas B.


    This study examined the relation between mothers' positive and negative interaction behaviors during mother-child interactions and the emotion regulation (ER) and depressive symptoms of their adolescent offspring. Event-planning (EPI) and problem-solving interactions (PSI) were observed in 163 mother-adolescent dyads, and adolescents also provided…

  15. E3 Ubiquitin Ligase RLIM Negatively Regulates c-Myc Transcriptional Activity and Restrains Cell Proliferation

    PubMed Central

    Wang, Lan; Cai, Hao; Zhu, Jingjing; Yu, Long


    RNF12/RLIM is a RING domain-containing E3 ubiquitin ligase whose function has only begun to be elucidated recently. Although RLIM was reported to play important roles in some biological processes such as imprinted X-chromosome inactivation and regulation of TGF-β pathway etc., other functions of RLIM are largely unknown. Here, we identified RLIM as a novel E3 ubiquitin ligase for c-Myc, one of the most frequently deregulated oncoproteins in human cancers. RLIM associates with c-Myc in vivo and in vitro independently of the E3 ligase activity of RLIM. Moreover, RLIM promotes the polyubiquitination of c-Myc protein independently of Ser62 and Thr58 phosphorylation of c-Myc. However, RLIM-mediated ubiquitination does not affect c-Myc stability. Instead, RLIM inhibits the transcriptional activity of c-Myc through which RLIM restrains cell proliferation. Our results suggest that RLIM may function as a tumor suppressor by controlling the activity of c-Myc oncoprotein. PMID:27684546

  16. Regulators of G-protein-signaling proteins: negative modulators of G-protein-coupled receptor signaling.


    Woodard, Geoffrey E; Jardín, Isaac; Berna-Erro, A; Salido, Gines M; Rosado, Juan A


    Regulators of G-protein-signaling (RGS) proteins are a category of intracellular proteins that have an inhibitory effect on the intracellular signaling produced by G-protein-coupled receptors (GPCRs). RGS along with RGS-like proteins switch on through direct contact G-alpha subunits providing a variety of intracellular functions through intracellular signaling. RGS proteins have a common RGS domain that binds to G alpha. RGS proteins accelerate GTPase and thus enhance guanosine triphosphate hydrolysis through the alpha subunit of heterotrimeric G proteins. As a result, they inactivate the G protein and quickly turn off GPCR signaling thus terminating the resulting downstream signals. Activity and subcellular localization of RGS proteins can be changed through covalent molecular changes to the enzyme, differential gene splicing, and processing of the protein. Other roles of RGS proteins have shown them to not be solely committed to being inhibitors but behave more as modulators and integrators of signaling. RGS proteins modulate the duration and kinetics of slow calcium oscillations and rapid phototransduction and ion signaling events. In other cases, RGS proteins integrate G proteins with signaling pathways linked to such diverse cellular responses as cell growth and differentiation, cell motility, and intracellular trafficking. Human and animal studies have revealed that RGS proteins play a vital role in physiology and can be ideal targets for diseases such as those related to addiction where receptor signaling seems continuously switched on.

  17. Polio vaccines, SV40 and human tumours, an update on false positive and false negative results.


    Elmishad, A G; Bocchetta, M; Pass, H I; Carbone, M


    Simian virus 40 (SV40) has been detected in different human tumours in numerous laboratories. The detection of SV40 in human tumours has been linked to the administration of SV40-contaminated polio vaccines from 1954 until 1963. Many of these reports linked SV40 to human mesothelioma. Some studies have failed to detect SV40 in human tumours and this has caused a controversy. Here we review the current literature. Moreover, we present evidence showing how differences in the sensitivities of methodologies can lead to a very different interpretation of the same study. The same 20 mesothelioma specimens all tested negative, 2/20 tested positive or 7/20 tested positive for SV40 Tag by simply changing the detection method on the same immuno-precipitation/western blot membranes. These results provide a simple explanation for some of the apparent discordant results reported in the literature.

  18. CLAVATA1 dominant-negative alleles reveal functional overlap between multiple receptor kinases that regulate meristem and organ development.


    Diévart, Anne; Dalal, Monica; Tax, Frans E; Lacey, Alexzandria D; Huttly, Alison; Li, Jianming; Clark, Steven E


    The CLAVATA1 (CLV1) receptor kinase controls stem cell number and differentiation at the Arabidopsis shoot and flower meristems. Other components of the CLV1 signaling pathway include the secreted putative ligand CLV3 and the receptor-like protein CLV2. We report evidence indicating that all intermediate and strong clv1 alleles are dominant negative and likely interfere with the activity of unknown receptor kinase(s) that have functional overlap with CLV1. clv1 dominant-negative alleles show major differences from dominant-negative alleles characterized to date in animal receptor kinase signaling systems, including the lack of a dominant-negative effect of kinase domain truncation and the ability of missense mutations in the extracellular domain to act in a dominant-negative manner. We analyzed chimeric receptor kinases by fusing CLV1 and BRASSINOSTEROID INSENSITIVE1 (BRI1) coding sequences and expressing these in clv1 null backgrounds. Constructs containing the CLV1 extracellular domain and the BRI1 kinase domain were strongly dominant negative in the regulation of meristem development. Furthermore, we show that CLV1 expressed within the pedicel can partially replace the function of the ERECTA receptor kinase. We propose the presence of multiple receptors that regulate meristem development in a functionally related manner whose interactions are driven by the extracellular domains and whose activation requires the kinase domain.

  19. CLAVATA1 Dominant-Negative Alleles Reveal Functional Overlap between Multiple Receptor Kinases That Regulate Meristem and Organ Development

    PubMed Central

    Diévart, Anne; Dalal, Monica; Tax, Frans E.; Lacey, Alexzandria D.; Huttly, Alison; Li, Jianming; Clark, Steven E.


    The CLAVATA1 (CLV1) receptor kinase controls stem cell number and differentiation at the Arabidopsis shoot and flower meristems. Other components of the CLV1 signaling pathway include the secreted putative ligand CLV3 and the receptor-like protein CLV2. We report evidence indicating that all intermediate and strong clv1 alleles are dominant negative and likely interfere with the activity of unknown receptor kinase(s) that have functional overlap with CLV1. clv1 dominant-negative alleles show major differences from dominant-negative alleles characterized to date in animal receptor kinase signaling systems, including the lack of a dominant-negative effect of kinase domain truncation and the ability of missense mutations in the extracellular domain to act in a dominant-negative manner. We analyzed chimeric receptor kinases by fusing CLV1 and BRASSINOSTEROID INSENSITIVE1 (BRI1) coding sequences and expressing these in clv1 null backgrounds. Constructs containing the CLV1 extracellular domain and the BRI1 kinase domain were strongly dominant negative in the regulation of meristem development. Furthermore, we show that CLV1 expressed within the pedicel can partially replace the function of the ERECTA receptor kinase. We propose the presence of multiple receptors that regulate meristem development in a functionally related manner whose interactions are driven by the extracellular domains and whose activation requires the kinase domain. PMID:12724544

  20. MAGI3 negatively regulates Wnt/β-catenin signaling and suppresses malignant phenotypes of glioma cells

    PubMed Central

    Zheng, Shuai; Meng, Ran; Fa, Pengyan; Zhao, Chunjuan; Liu, Hua; Song, Ran; Tao, Tao; Yang, Longyan; Dai, Jie; Wang, Songlin; Jiang, Wen G.; He, Junqi


    Gliomas are the most common primary brain malignancies and are associated with a poor prognosis. Here, we showed that the PDZ domain-containing protein membrane-associated guanylate kinase inverted 3 (MAGI3) was downregulated at the both mRNA and protein levels in human glioma samples. MAGI3 inhibited proliferation, migration, and cell cycle progression of glioma cells in its overexpression and knockdown studies. By using GST pull-down and co-immunoprecipitation assays, we found that MAGI3 bound to β-catenin through its PDZ domains and the PDZ-binding motif of β-catenin. MAGI3 overexpression inhibited β-catenin transcriptional activity via its interaction with β-catenin. Consistently, MAGI3 overexpression in glioma cells C6 suppressed expression of β-catenin target genes including Cyclin D1 and Axin2, whereas MAGI3 knockdown in glioma cells U373 and LN229 enhanced their expression. MAGI3 overexpression decreased growth of C6 subcutaneous tumors in mice, and inhibited expression of β-catenin target genes in xenograft tumors. Furthermore, analysis based on the Gene Expression Omnibus (GEO) glioma dataset showed association of MAGI3 expression with overall survival and tumor grade. Finally, we demonstrated negative correlation between MAGI3 expression and activity of Wnt/β-catenin signaling through GSEA of three public glioma datasets and immunohistochemical staining of clinical glioma samples. Taken together, these results identify MAGI3 as a novel tumor suppressor and provide insight into the pathogenesis of glioma. PMID:26452219

  1. Human Misato regulates mitochondrial distribution and morphology

    SciTech Connect

    Kimura, Masashi . E-mail:; Okano, Yukio


    Misato of Drosophila melanogaster and Saccharomyces cerevisiae DML1 are conserved proteins having a homologous region with a part of the GTPase family that includes eukaryotic tubulin and prokaryotic FtsZ. We characterized human Misato sharing homology with Misato of D. melanogaster and S. cerevisiae DML1. Tissue distribution of Misato exhibited ubiquitous distribution. Subcellular localization of the protein studied using anti-Misato antibody suggested that it is localized to the mitochondria. Further experiments of fractionating mitochondria revealed that Misato was localized to the outer membrane. The transfection of Misato siRNA led to growth deficiencies compared with control siRNA transfected HeLa cells, and the Misato-depleted HeLa cells showed apoptotic nuclear fragmentation resulting in cell death. After silencing of Misato, the filamentous mitochondrial network disappeared and fragmented mitochondria were observed, indicating human Misato has a role in mitochondrial fusion. To examine the effects of overexpression, COS-7 cells were transfected with cDNA encoding EGFP-Misato. Its overexpression resulted in the formation of perinuclear aggregations of mitochondria in these cells. The Misato-overexpressing cells showed low viability and had no nuclei or a small and structurally unusual ones. These results indicated that human Misato has a role(s) in mitochondrial distribution and morphology and that its unregulated expression leads to cell death.

  2. Limitation of immune tolerance-inducing thymic epithelial cell development by Spi-B-mediated negative feedback regulation.


    Akiyama, Nobuko; Shinzawa, Miho; Miyauchi, Maki; Yanai, Hiromi; Tateishi, Ryosuke; Shimo, Yusuke; Ohshima, Daisuke; Matsuo, Koichi; Sasaki, Izumi; Hoshino, Katsuaki; Wu, Guoying; Yagi, Shintaro; Inoue, Jun-ichiro; Kaisho, Tsuneyasu; Akiyama, Taishin


    Medullary thymic epithelial cells (mTECs) expressing the autoimmune regulator AIRE and various tissue-specific antigens (TSAs) are critical for preventing the onset of autoimmunity and may attenuate tumor immunity. However, molecular mechanisms controlling mTEC development remain elusive. Here, we describe the roles of the transcription factor Spi-B in mTEC development. Spi-B is rapidly up-regulated by receptor activator of NF-κB ligand (RANKL) cytokine signaling, which triggers mTEC differentiation, and in turn up-regulates CD80, CD86, some TSAs, and the natural inhibitor of RANKL signaling, osteoprotegerin (OPG). Spi-B-mediated OPG expression limits mTEC development in neonates but not in embryos, suggesting developmental stage-specific negative feedback regulation. OPG-mediated negative regulation attenuates cellularity of thymic regulatory T cells and tumor development in vivo. Hence, these data suggest that this negative RANKL-Spi-B-OPG feedback mechanism finely tunes mTEC development and function and may optimize the trade-off between prevention of autoimmunity and induction of antitumor immunity.

  3. Limitation of immune tolerance–inducing thymic epithelial cell development by Spi-B–mediated negative feedback regulation

    PubMed Central

    Akiyama, Nobuko; Shinzawa, Miho; Miyauchi, Maki; Yanai, Hiromi; Tateishi, Ryosuke; Shimo, Yusuke; Ohshima, Daisuke; Matsuo, Koichi; Sasaki, Izumi; Hoshino, Katsuaki; Wu, Guoying; Yagi, Shintaro; Inoue, Jun-ichiro


    Medullary thymic epithelial cells (mTECs) expressing the autoimmune regulator AIRE and various tissue-specific antigens (TSAs) are critical for preventing the onset of autoimmunity and may attenuate tumor immunity. However, molecular mechanisms controlling mTEC development remain elusive. Here, we describe the roles of the transcription factor Spi-B in mTEC development. Spi-B is rapidly up-regulated by receptor activator of NF-κB ligand (RANKL) cytokine signaling, which triggers mTEC differentiation, and in turn up-regulates CD80, CD86, some TSAs, and the natural inhibitor of RANKL signaling, osteoprotegerin (OPG). Spi-B–mediated OPG expression limits mTEC development in neonates but not in embryos, suggesting developmental stage–specific negative feedback regulation. OPG-mediated negative regulation attenuates cellularity of thymic regulatory T cells and tumor development in vivo. Hence, these data suggest that this negative RANKL–Spi-B–OPG feedback mechanism finely tunes mTEC development and function and may optimize the trade-off between prevention of autoimmunity and induction of antitumor immunity. PMID:25385757

  4. Linking Emotion Regulation Strategies to Affective Events and Negative Emotions at Work

    ERIC Educational Resources Information Center

    Diefendorff, James M.; Richard, Erin M.; Yang, Jixia


    This study examined the use of specific forms of emotion regulation at work, utilizing Gross's [Gross, J. J. (1998). "The emerging field of emotion regulation: An integrative review." "Review of General Psychology" 2, 271-299] process-based framework of emotion regulation as a guiding structure. In addition to examining employee self-reported…

  5. Liver X Receptor (LXR) Regulates Human Adipocyte Lipolysis*

    PubMed Central

    Stenson, Britta M.; Rydén, Mikael; Venteclef, Nicolas; Dahlman, Ingrid; Pettersson, Annie M. L.; Mairal, Aline; Åström, Gaby; Blomqvist, Lennart; Wang, Victoria; Jocken, Johan W. E.; Clément, Karine; Langin, Dominique; Arner, Peter; Laurencikiene, Jurga


    The Liver X receptor (LXR) is an important regulator of carbohydrate and lipid metabolism in humans and mice. We have recently shown that activation of LXR regulates cellular fuel utilization in adipocytes. In contrast, the role of LXR in human adipocyte lipolysis, the major function of human white fat cells, is not clear. In the present study, we stimulated in vitro differentiated human and murine adipocytes with the LXR agonist GW3965 and observed an increase in basal lipolysis. Microarray analysis of human adipocyte mRNA following LXR activation revealed an altered gene expression of several lipolysis-regulating proteins, which was also confirmed by quantitative real-time PCR. We show that expression and intracellular localization of perilipin1 (PLIN1) and hormone-sensitive lipase (HSL) are affected by GW3965. Although LXR activation does not influence phosphorylation status of HSL, HSL activity is required for the lipolytic effect of GW3965. This effect is abolished by PLIN1 knockdown. In addition, we demonstrate that upon activation, LXR binds to the proximal regions of the PLIN1 and HSL promoters. By selective knock-down of either LXR isoform, we show that LXRα is the major isoform mediating the lipolysis-related effects of LXR. In conclusion, the present study demonstrates that activation of LXRα up-regulates basal human adipocyte lipolysis. This is at least partially mediated through LXR binding to the PLIN1 promoter and down-regulation of PLIN1 expression. PMID:21030586

  6. Liver X receptor (LXR) regulates human adipocyte lipolysis.


    Stenson, Britta M; Rydén, Mikael; Venteclef, Nicolas; Dahlman, Ingrid; Pettersson, Annie M L; Mairal, Aline; Aström, Gaby; Blomqvist, Lennart; Wang, Victoria; Jocken, Johan W E; Clément, Karine; Langin, Dominique; Arner, Peter; Laurencikiene, Jurga


    The Liver X receptor (LXR) is an important regulator of carbohydrate and lipid metabolism in humans and mice. We have recently shown that activation of LXR regulates cellular fuel utilization in adipocytes. In contrast, the role of LXR in human adipocyte lipolysis, the major function of human white fat cells, is not clear. In the present study, we stimulated in vitro differentiated human and murine adipocytes with the LXR agonist GW3965 and observed an increase in basal lipolysis. Microarray analysis of human adipocyte mRNA following LXR activation revealed an altered gene expression of several lipolysis-regulating proteins, which was also confirmed by quantitative real-time PCR. We show that expression and intracellular localization of perilipin1 (PLIN1) and hormone-sensitive lipase (HSL) are affected by GW3965. Although LXR activation does not influence phosphorylation status of HSL, HSL activity is required for the lipolytic effect of GW3965. This effect is abolished by PLIN1 knockdown. In addition, we demonstrate that upon activation, LXR binds to the proximal regions of the PLIN1 and HSL promoters. By selective knock-down of either LXR isoform, we show that LXRα is the major isoform mediating the lipolysis-related effects of LXR. In conclusion, the present study demonstrates that activation of LXRα up-regulates basal human adipocyte lipolysis. This is at least partially mediated through LXR binding to the PLIN1 promoter and down-regulation of PLIN1 expression. PMID:21030586

  7. Episodic memory and appetite regulation in humans.


    Brunstrom, Jeffrey M; Burn, Jeremy F; Sell, Nicola R; Collingwood, Jane M; Rogers, Peter J; Wilkinson, Laura L; Hinton, Elanor C; Maynard, Olivia M; Ferriday, Danielle


    Psychological and neurobiological evidence implicates hippocampal-dependent memory processes in the control of hunger and food intake. In humans, these have been revealed in the hyperphagia that is associated with amnesia. However, it remains unclear whether 'memory for recent eating' plays a significant role in neurologically intact humans. In this study we isolated the extent to which memory for a recently consumed meal influences hunger and fullness over a three-hour period. Before lunch, half of our volunteers were shown 300 ml of soup and half were shown 500 ml. Orthogonal to this, half consumed 300 ml and half consumed 500 ml. This process yielded four separate groups (25 volunteers in each). Independent manipulation of the 'actual' and 'perceived' soup portion was achieved using a computer-controlled peristaltic pump. This was designed to either refill or draw soup from a soup bowl in a covert manner. Immediately after lunch, self-reported hunger was influenced by the actual and not the perceived amount of soup consumed. However, two and three hours after meal termination this pattern was reversed - hunger was predicted by the perceived amount and not the actual amount. Participants who thought they had consumed the larger 500-ml portion reported significantly less hunger. This was also associated with an increase in the 'expected satiation' of the soup 24-hours later. For the first time, this manipulation exposes the independent and important contribution of memory processes to satiety. Opportunities exist to capitalise on this finding to reduce energy intake in humans. PMID:23227200

  8. Circadian regulation of human cortical excitability

    PubMed Central

    Ly, Julien Q. M.; Gaggioni, Giulia; Chellappa, Sarah L.; Papachilleos, Soterios; Brzozowski, Alexandre; Borsu, Chloé; Rosanova, Mario; Sarasso, Simone; Middleton, Benita; Luxen, André; Archer, Simon N.; Phillips, Christophe; Dijk, Derk-Jan; Maquet, Pierre; Massimini, Marcello; Vandewalle, Gilles


    Prolonged wakefulness alters cortical excitability, which is essential for proper brain function and cognition. However, besides prior wakefulness, brain function and cognition are also affected by circadian rhythmicity. Whether the regulation of cognition involves a circadian impact on cortical excitability is unknown. Here, we assessed cortical excitability from scalp electroencephalography (EEG) responses to transcranial magnetic stimulation in 22 participants during 29 h of wakefulness under constant conditions. Data reveal robust circadian dynamics of cortical excitability that are strongest in those individuals with highest endocrine markers of circadian amplitude. In addition, the time course of cortical excitability correlates with changes in EEG synchronization and cognitive performance. These results demonstrate that the crucial factor for cortical excitability, and basic brain function in general, is the balance between circadian rhythmicity and sleep need, rather than sleep homoeostasis alone. These findings have implications for clinical applications such as non-invasive brain stimulation in neurorehabilitation. PMID:27339884

  9. Circadian regulation of human cortical excitability.


    Ly, Julien Q M; Gaggioni, Giulia; Chellappa, Sarah L; Papachilleos, Soterios; Brzozowski, Alexandre; Borsu, Chloé; Rosanova, Mario; Sarasso, Simone; Middleton, Benita; Luxen, André; Archer, Simon N; Phillips, Christophe; Dijk, Derk-Jan; Maquet, Pierre; Massimini, Marcello; Vandewalle, Gilles


    Prolonged wakefulness alters cortical excitability, which is essential for proper brain function and cognition. However, besides prior wakefulness, brain function and cognition are also affected by circadian rhythmicity. Whether the regulation of cognition involves a circadian impact on cortical excitability is unknown. Here, we assessed cortical excitability from scalp electroencephalography (EEG) responses to transcranial magnetic stimulation in 22 participants during 29 h of wakefulness under constant conditions. Data reveal robust circadian dynamics of cortical excitability that are strongest in those individuals with highest endocrine markers of circadian amplitude. In addition, the time course of cortical excitability correlates with changes in EEG synchronization and cognitive performance. These results demonstrate that the crucial factor for cortical excitability, and basic brain function in general, is the balance between circadian rhythmicity and sleep need, rather than sleep homoeostasis alone. These findings have implications for clinical applications such as non-invasive brain stimulation in neurorehabilitation.

  10. Hippo Component TAZ Functions as a Co-repressor and Negatively Regulates ΔNp63 Transcription through TEA Domain (TEAD) Transcription Factor.


    Valencia-Sama, Ivette; Zhao, Yulei; Lai, Dulcie; Janse van Rensburg, Helena J; Hao, Yawei; Yang, Xiaolong


    Transcriptional co-activator with a PDZ binding domain (TAZ) is a WW domain-containing transcriptional co-activator and a core component of an emerging Hippo signaling pathway that regulates organ size, tumorigenesis, metastasis, and drug resistance. TAZ regulates these biological functions by up-regulating downstream cellular genes through transactivation of transcription factors such as TEAD and TTF1. To understand the molecular mechanisms underlying TAZ-induced tumorigenesis, we have recently performed a gene expression profile analysis by overexpressing TAZ in mammary cells. In addition to the TAZ-up-regulated genes that were confirmed in our previous studies, we identified a large number of cellular genes that were down-regulated by TAZ. In this study, we have confirmed these down-regulated genes (including cytokines, chemokines, and p53 gene family members) as bona fide downstream transcriptional targets of TAZ. By using human breast and lung epithelial cells, we have further characterized ΔNp63, a p53 gene family member, and shown that TAZ suppresses ΔNp63 mRNA, protein expression, and promoter activity through interaction with the transcription factor TEAD. We also show that TEAD can inhibit ΔNp63 promoter activity and that TAZ can directly interact with ΔNp63 promoter-containing TEAD binding sites. Finally, we provide functional evidence that down-regulation of ΔNp63 by TAZ may play a role in regulating cell migration. Altogether, this study provides novel evidence that the Hippo component TAZ can function as a co-repressor and regulate biological functions by negatively regulating downstream cellular genes.

  11. Fas-Associated Factor 1 Negatively Regulates the Antiviral Immune Response by Inhibiting Translocation of Interferon Regulatory Factor 3 to the Nucleus

    PubMed Central

    Song, Soonhwa; Lee, Jae-Jin; Kim, Hee-Jung; Lee, Jeong Yoon; Chang, Jun


    This study is designed to examine the cellular functions of human Fas-associated factor 1 (FAF1) containing multiple ubiquitin-related domains. Microarray analyses revealed that interferon-stimulated genes related to the antiviral response are significantly increased in FAF1-knockdown HeLa cells. Silencing FAF1 enhanced the poly(I·C)- and respiratory syncytial virus (RSV)-induced production of type I interferons (IFNs), the target genes of interferon regulator factor 3 (IRF3). IRF3 is a key transcription factor in IFN-β signaling responsible for the host innate immune response. This study also found that FAF1 and IRF3 physically associate with IPO5/importin-β3 and that overexpression of FAF1 reduces the interaction between IRF3 and IPO5/importin-β3. These findings suggest that FAF1 negatively regulates IRF3-mediated IFN-β production and the antiviral innate immune response by regulating nuclear translocation of IRF3. We conclude that FAF1 plays a novel role in negatively regulating virus-induced IFN-β production and the antiviral response by inhibiting the translocation of active, phosphorylated IRF3 from the cytosol to the nucleus. PMID:26811330

  12. CaMKII Negatively Regulates Calcineurin-NFAT Signaling in Cardiac Myocytes

    PubMed Central

    MacDonnell, Scott M.; Weisser-Thomas, Jutta; Kubo, Hajime; Hanscome, Marie; Liu, Qinghang; Jaleel, Naser; Berretta, Remus; Chen, Xiongwen; Brown, Joan H.; Sabri, Abdel-Karim; Molkentin, Jeffery D.; Houser, Steven R.


    Rationale Pathologic cardiac myocyte hypertrophy is thought to be induced by the persistent increases in intracellular Ca2+ needed to maintain cardiac function when systolic wall stress is increased. Hypertrophic Ca2+ binds to calmodulin (CaM) and activates the phosphatase calcineurin (Cn) and CaM kinase (CaMKII). Cn dephosphorylates cytoplasmic nuclear factor of activated T-cells (NFAT), inducing its translocation to the nucleus where it activates anti-apoptotic and hypertrophic target genes. Cytoplasmic CaMKII regulates Ca2+ handling proteins but whether or not it is directly involved in hypertrophic and survival signaling is not known. Objective This study explored the hypothesis that cytoplasmic CaMKII reduces NFAT nuclear translocation by inhibiting the phosphatase activity of Cn. Methods and Results GFP-tagged NFATc3 was used to determine the cellular location of NFAT in cultured neonatal rat ventricular myocytes (NRVM) and adult feline ventricular myocytes. Constitutively active (CaMKII-CA) or dominant negative (CaMKII-DN) mutants of cytoplasmic targeted CaMKIIδc were used to activate and inhibit cytoplasmic CaMKII activity. In NRVM CaMKII-DN (48.5±3%, P<0.01 vs control) increased while CaMKII-CA decreased (5.9±1%, P<0.01 vs control) NFAT nuclear translocation (Control: 12.3±1%). Cn inhibitors were used to show that these effects were caused by modulation of Cn activity. Increasing Ca2+ increased Cn-dependent NFAT translocation (to 71.7±7%, p<0.01) and CaMKII-CA reduced this effect (to 17.6±4%). CaMKII-CA increased TUNEL and caspase-3 activity (P<0.05). CaMKII directly phosphorylated Cn at Ser197 in CaMKII-CA infected NRVM and in hypertrophied feline hearts. Conclusion These data show that activation of cytoplasmic CaMKII inhibits NFAT nuclear translocation by phosphorylation and subsequent inhibition of Cn. PMID:19608982

  13. Negative regulation of the antiviral response by grouper LGP2 against fish viruses.


    Yu, Yepin; Huang, Youhua; Yang, Ying; Wang, Shaowen; Yang, Min; Huang, Xiaohong; Qin, Qiwei


    Laboratory of genetics and physiology 2 (LGP2), a member of RIG-I like receptor (RLR) family, plays crucial roles in modulating cellular antiviral response during viral infection. However, the detailed roles of LGP2 in different virus infection were controversial up to now. Here, we cloned a LGP2 gene from orange-spotted grouper (EcLGP2) and investigated its roles in response to grouper virus infection. EcLGP2 encoded a 678-aa protein which shared 83% identity to sea perch (Lateolabrax japonicas). Amino acid alignment showed that EcLGP2 contained three conserved domains, including a DEAD/DEAH box helicase domain, a helicase superfamily C-terminal domain and a C-terminal domain of RIG-I. In healthy grouper, the transcript of EcLGP2 could be predominantly detected in kidney, gill, fin, spleen and skin. Subcellular localization analysis showed that EcLGP2 distributed throughout the cytoplasm in grouper cells. Notably, the intracellular distribution of EcLGP2 was altered at the late stage of Singapore grouper iridovirus (SGIV) infection, but remained unchanged during red-spotted grouper nervous necrosis virus (RGNNV) infection. Moreover, overexpression of EcLGP2 in vitro significantly enhanced the viral replication of SGIV and RGNNV, evidenced by the acceleration of CPE occurrence and the up-regulation of the viral gene transcription or protein synthesis. Further studies indicated that overexpression of EcLGP2 decreased the expression level of interferon related molecules or effectors, including IRF3, IRF7, ISG15, IFP35, MXI, MXII, and MDA5, suggesting that the negative feedback of interferon immune response by EcLGP2 might contribute to the enhancement of RGNNV infection. Moreover, the expression levels of pro-inflammation cytokines, including IL-8 and TNFα were significantly decreased, but that of IL-6 was increased by the ectopic expression of EcLGP2. Thus, our results will contribute greatly to understanding the roles of fish LGP2 in innate immune response during

  14. Negative regulation of the antiviral response by grouper LGP2 against fish viruses.


    Yu, Yepin; Huang, Youhua; Yang, Ying; Wang, Shaowen; Yang, Min; Huang, Xiaohong; Qin, Qiwei


    Laboratory of genetics and physiology 2 (LGP2), a member of RIG-I like receptor (RLR) family, plays crucial roles in modulating cellular antiviral response during viral infection. However, the detailed roles of LGP2 in different virus infection were controversial up to now. Here, we cloned a LGP2 gene from orange-spotted grouper (EcLGP2) and investigated its roles in response to grouper virus infection. EcLGP2 encoded a 678-aa protein which shared 83% identity to sea perch (Lateolabrax japonicas). Amino acid alignment showed that EcLGP2 contained three conserved domains, including a DEAD/DEAH box helicase domain, a helicase superfamily C-terminal domain and a C-terminal domain of RIG-I. In healthy grouper, the transcript of EcLGP2 could be predominantly detected in kidney, gill, fin, spleen and skin. Subcellular localization analysis showed that EcLGP2 distributed throughout the cytoplasm in grouper cells. Notably, the intracellular distribution of EcLGP2 was altered at the late stage of Singapore grouper iridovirus (SGIV) infection, but remained unchanged during red-spotted grouper nervous necrosis virus (RGNNV) infection. Moreover, overexpression of EcLGP2 in vitro significantly enhanced the viral replication of SGIV and RGNNV, evidenced by the acceleration of CPE occurrence and the up-regulation of the viral gene transcription or protein synthesis. Further studies indicated that overexpression of EcLGP2 decreased the expression level of interferon related molecules or effectors, including IRF3, IRF7, ISG15, IFP35, MXI, MXII, and MDA5, suggesting that the negative feedback of interferon immune response by EcLGP2 might contribute to the enhancement of RGNNV infection. Moreover, the expression levels of pro-inflammation cytokines, including IL-8 and TNFα were significantly decreased, but that of IL-6 was increased by the ectopic expression of EcLGP2. Thus, our results will contribute greatly to understanding the roles of fish LGP2 in innate immune response during

  15. Both positive and negative selection pressures contribute to the polymorphism pattern of the duplicated human CYP21A2 gene.


    Szabó, Julianna Anna; Szilágyi, Ágnes; Doleschall, Zoltán; Patócs, Attila; Farkas, Henriette; Prohászka, Zoltán; Rácz, Kárioly; Füst, George; Doleschall, Márton


    The human steroid 21-hydroxylase gene (CYP21A2) participates in cortisol and aldosterone biosynthesis, and resides together with its paralogous (duplicated) pseudogene in a multiallelic copy number variation (CNV), called RCCX CNV. Concerted evolution caused by non-allelic gene conversion has been described in great ape CYP21 genes, and the same conversion activity is responsible for a serious genetic disorder of CYP21A2, congenital adrenal hyperplasia (CAH). In the current study, 33 CYP21A2 haplotype variants encoding 6 protein variants were determined from a European population. CYP21A2 was shown to be one of the most diverse human genes (HHe=0.949), but the diversity of intron 2 was greater still. Contrary to previous findings, the evolution of intron 2 did not follow concerted evolution, although the remaining part of the gene did. Fixed sites (different fixed alleles of sites in human CYP21 paralogues) significantly accumulated in intron 2, indicating that the excess of fixed sites was connected to the lack of effective non-allelic conversion and concerted evolution. Furthermore, positive selection was presumably focused on intron 2, and possibly associated with the previous genetic features. However, the positive selection detected by several neutrality tests was discerned along the whole gene. In addition, the clear signature of negative selection was observed in the coding sequence. The maintenance of the CYP21 enzyme function is critical, and could lead to negative selection, whereas the presumed gene regulation altering steroid hormone levels via intron 2 might help fast adaptation, which broadly characterizes the genes of human CNVs responding to the environment.

  16. Orphan Nuclear Receptor ERRα Controls Macrophage Metabolic Signaling and A20 Expression to Negatively Regulate TLR-Induced Inflammation.


    Yuk, Jae-Min; Kim, Tae Sung; Kim, Soo Yeon; Lee, Hye-Mi; Han, Jeongsu; Dufour, Catherine Rosa; Kim, Jin Kyung; Jin, Hyo Sun; Yang, Chul-Su; Park, Ki-Sun; Lee, Chul-Ho; Kim, Jin-Man; Kweon, Gi Ryang; Choi, Hueng-Sik; Vanacker, Jean-Marc; Moore, David D; Giguère, Vincent; Jo, Eun-Kyeong


    The orphan nuclear receptor estrogen-related receptor α (ERRα; NR3B1) is a key metabolic regulator, but its function in regulating inflammation remains largely unknown. Here, we demonstrate that ERRα negatively regulates Toll-like receptor (TLR)-induced inflammation by promoting Tnfaip3 transcription and fine-tuning of metabolic reprogramming in macrophages. ERRα-deficient (Esrra(-/-)) mice showed increased susceptibility to endotoxin-induced septic shock, leading to more severe pro-inflammatory responses than control mice. ERRα regulated macrophage inflammatory responses by directly binding the promoter region of Tnfaip3, a deubiquitinating enzyme in TLR signaling. In addition, Esrra(-/-) macrophages showed an increased glycolysis, but impaired mitochondrial respiratory function and biogenesis. Further, ERRα was required for the regulation of NF-κB signaling by controlling p65 acetylation via maintenance of NAD(+) levels and sirtuin 1 activation. These findings unravel a previously unappreciated role for ERRα as a negative regulator of TLR-induced inflammatory responses through inducing Tnfaip3 transcription and controlling the metabolic reprogramming.

  17. SALT-RESPONSIVE ERF1 is a negative regulator of grain filling and gibberellin-mediated seedling establishment in rice.


    Schmidt, Romy; Schippers, Jos H M; Mieulet, Delphine; Watanabe, Mutsumi; Hoefgen, Rainer; Guiderdoni, Emmanuel; Mueller-Roeber, Bernd


    Grain quality is an important agricultural trait that is mainly determined by grain size and composition. Here, we characterize the role of the rice transcription factor (TF) SALT-RESPONSIVE ERF1 (SERF1) during grain development. Through genome-wide expression profiling and chromatin immunoprecipitation, we found that SERF1 directly regulates RICE PROLAMIN-BOX BINDING FACTOR (RPBF), a TF that functions as a positive regulator of grain filling. Loss of SERF1 enhances RPBF expression resulting in larger grains with increased starch content, while SERF1 overexpression represses RPBF resulting in smaller grains. Consistently, during grain filling, starch biosynthesis genes such as GRANULE-BOUND STARCH SYNTHASEI (GBSSI), STARCH SYNTHASEI (SSI), SSIIIa, and ADP-GLUCOSE PYROPHOSPHORYLASE LARGE SUBUNIT2 (AGPL2) are up-regulated in SERF1 knockout grains. Moreover, SERF1 is a direct upstream regulator of GBSSI. In addition, SERF1 negatively regulates germination by controlling RPBF expression, which mediates the gibberellic acid (GA)-induced expression of RICE AMYLASE1A (RAmy1A). Loss of SERF1 results in more rapid seedling establishment, while SERF1 overexpression has the opposite effect. Our study reveals that SERF1 represents a negative regulator of grain filling and seedling establishment by timing the expression of RPBF. PMID:24046061

  18. β-Arrestins Negatively Regulate the Toll Pathway in Shrimp by Preventing Dorsal Translocation and Inhibiting Dorsal Transcriptional Activity.


    Sun, Jie-Jie; Lan, Jiang-Feng; Shi, Xiu-Zhen; Yang, Ming-Chong; Niu, Guo-Juan; Ding, Ding; Zhao, Xiao-Fan; Yu, Xiao-Qiang; Wang, Jin-Xing


    The Toll signaling pathway plays an important role in the innate immunity ofDrosophila melanogasterand mammals. The activation and termination of Toll signaling are finely regulated in these animals. Although the primary components of the Toll pathway were identified in shrimp, the functions and regulation of the pathway are seldom studied. We first demonstrated that the Toll signaling pathway plays a central role in host defense againstStaphylococcus aureusby regulating expression of antimicrobial peptides in shrimp. We then found that β-arrestins negatively regulate Toll signaling in two different ways. β-Arrestins interact with the C-terminal PEST domain of Cactus through the arrestin-N domain, and Cactus interacts with the RHD domain of Dorsal via the ankyrin repeats domain, forming a heterotrimeric complex of β-arrestin·Cactus·Dorsal, with Cactus as the bridge. This complex prevents Cactus phosphorylation and degradation, as well as Dorsal translocation into the nucleus, thus inhibiting activation of the Toll signaling pathway. β-Arrestins also interact with non-phosphorylated ERK (extracellular signal-regulated protein kinase) through the arrestin-C domain to inhibit ERK phosphorylation, which affects Dorsal translocation into the nucleus and phosphorylation of Dorsal at Ser(276)that impairs Dorsal transcriptional activity. Our study suggests that β-arrestins negatively regulate the Toll signaling pathway by preventing Dorsal translocation and inhibiting Dorsal phosphorylation and transcriptional activity. PMID:26846853

  19. Affect regulation training (ART) for alcohol use disorders: development of a novel intervention for negative affect drinkers.


    Stasiewicz, Paul R; Bradizza, Clara M; Schlauch, Robert C; Coffey, Scott F; Gulliver, Suzy B; Gudleski, Gregory D; Bole, Christopher W


    Although negative affect is a common precipitant of alcohol relapse, there are few interventions for alcohol dependence that specifically target negative affect. In this stage 1a/1b treatment development study, several affect regulation strategies (e.g., mindfulness, prolonged exposure, distress tolerance) were combined to create a new treatment supplement called affect regulation training (ART), which could be added to enhance cognitive-behavioral therapy (CBT) for alcohol dependence. A draft therapy manual was given to therapists and treatment experts before being administered to several patients who also provided input. After two rounds of manual development (stage 1a), a pilot randomized clinical trial (N=77) of alcohol-dependent outpatients who reported drinking often in negative affect situations was conducted (stage 1b). Participants received 12-weekly, 90-minute sessions of either CBT for alcohol dependence plus ART (CBT+ART) or CBT plus a healthy lifestyles control condition (CBT+HLS). Baseline, end-of-treatment, and 3- and 6-month posttreatment interviews were conducted. For both treatment conditions, participant ratings of treatment satisfaction were high, with CBT+ART rated significantly higher. Drinking outcome results indicated greater reductions in alcohol use for CBT+ART when compared to CBT+HLS, with moderate effect sizes for percent days abstinent, drinks per day, drinks per drinking day, and percent heavy drinking days. Overall, findings support further research on affect regulation interventions for negative affect drinkers.

  20. Affect Regulation Training (ART) for Alcohol Use Disorders: Development of a Novel Intervention for Negative Affect Drinkers

    PubMed Central

    Stasiewicz, Paul R.; Bradizza, Clara M.; Schlauch, Robert C.; Coffey, Scott F.; Gulliver, Suzy B.; Gudleski, Gregory; Bole, Christopher W.


    Although negative affect is a common precipitant of alcohol relapse, there are few interventions for alcohol dependence that specifically target negative affect. In this Stage 1a/1b treatment development study, several affect regulation strategies (e.g., mindfulness, prolonged exposure, distress tolerance) were combined to create a new treatment supplement called Affect Regulation Training (ART), which could be added to enhance Cognitive-Behavioral Therapy (CBT) for alcohol dependence. A draft therapy manual was given to therapists and treatment experts before being administered to several patients who also provided input. After two rounds of manual development (Stage 1a), a pilot randomized clinical trial (N = 77) of alcohol-dependent outpatients who reported drinking often in negative affect situations was conducted (Stage 1b). Participants received 12-weekly, 90-minute sessions of either CBT for alcohol dependence plus ART (CBT + ART) or CBT plus a healthy lifestyles control condition (CBT + HLS). Baseline, end-of-treatment, and 3- and 6-month posttreatment interviews were conducted. For both treatment conditions, participant ratings of treatment satisfaction were high, with CBT + ART rated significantly higher. Drinking outcome results indicated greater reductions in alcohol use for CBT + ART when compared to CBT + HLS, with moderate effect sizes for percent days abstinent, drinks per day, drinks per drinking day, and percent heavy drinking days. Overall, findings support further research on affect regulation interventions for negative affect drinkers. PMID:23876455

  1. Serotonin regulation of the human stress response.


    Hood, Sean D; Hince, Dana A; Robinson, Hayley; Cirillo, Melita; Christmas, David; Kaye, Joey M


    Acute tryptophan depletion (ATD) is a technique that has been used to evaluate the effects on humans of acutely reducing serotonin neurotransmission. We have developed a model using a single breath of 35% CO(2) that activates the hormonal axis and produces autonomic and behavioural arousal, thus modelling a stress response. This study combines ATD and single breath 35% CO(2) inhalation to study stress responses in volunteers. A randomised, double-blinded, placebo-controlled, cross-over trial involving 14 healthy adult volunteers aged between 18 and 65 years was undertaken. Subjects underwent double-blind tryptophan depletion over 2 days and were then crossed over 1 week later. During each study day, at the time of peak depletion, participants were single blinded to receive a single breath of 35% CO(2) or air. This was followed 40 min later by the other gas. Psychological outcomes were assessed with the Spielberger State Anxiety Inventory (SSAI), Visual Analogue Scales (VAS), Panic Inventory (PI), Panic and Agoraphobia Scale (PSI) and Beck Depression Inventory (BDI). Physiological outcome was measured by serial plasma cortisol, prolactin and tryptophan levels, pulse and blood pressure. Tryptophan depletion did not exacerbate 35% CO(2) inhalation effects on anxiety symptoms. Single breath CO(2) robustly increased plasma cortisol levels in comparison to an air inhalation; this was less certain for prolactin levels. ATD influenced the HPA axis (associated with higher cortisol levels), apparently independent of CO(2) or air inhalation stressors. ATD and 35% CO(2) inhalation both induced a pressor response and bradycardia in these normal volunteers. Thirty-five percent CO(2) inhalation and ATD independently activate the human stress response, but do not appear to produce synergistic effects when combined, at least for the conditions produced in this study.

  2. Estradiol regulates MICA expression in human endometrial cells

    PubMed Central

    Basu, Satarupa; Pioli, Patricia A.; Conejo-Garcia, Jose; Wira, Charles R.; Sentman, Charles L.


    The human endometrium undergoes cyclical changes regulated by sex hormones. Evidence suggests sex hormones regulate NK cell recruitment into the uterus in large numbers. NKG2D is an activating receptor expressed on human NK cells, γδ and CD8 T cells. NKG2D ligands are known to be sensors of cellular “stress”. In this study, we investigated whether sex hormones directly regulate expression of NKG2D ligands in the human uterus. Estradiol increased MICA expression on uterine epithelial cells; regulation was estrogen receptor-dependent. Real-time PCR analysis showed that NKG2D ligands MICA and MICB were expressed in the human endometrium. MICA protein was detected primarily on epithelial cells, and greater expression was observed in immunohistochemical analysis of tissues from patients in the secretory phase of the menstrual cycle. Thus, estrogens regulate expression of MICA. These data suggest hormonal regulation of innate immunity and NKG2D-mediated recognition in other tissues and diseases where estrogen may be involved. PMID:18728002

  3. AMAP1 as a negative-feedback regulator of nuclear factor-κB under inflammatory conditions.


    Tien, Dat Nguyen; Kishihata, Masako; Yoshikawa, Ayumu; Hashimoto, Ari; Sabe, Hisataka; Nishi, Eiichiro; Kamei, Kaeko; Arai, Hidenori; Kita, Toru; Kimura, Takeshi; Yokode, Masayuki; Ashida, Noboru


    NF-κB is a major transcriptional factor regulating many cellular functions including inflammation; therefore, its appropriate control is of high importance. The detailed mechanism of its activation has been well characterized, but that of negative regulation is poorly understood. In this study, we showed AMAP1, an Arf-GTPase activating protein, as a negative feedback regulator for NF-κB by binding with IKKβ, an essential kinase in NF-κB signaling. Proteomics analysis identified AMAP1 as a binding protein with IKKβ. Overexpression of AMAP1 suppressed NF-κB activity by interfering the binding of IKKβ and NEMO, and deletion of AMAP1 augmented NF-κB activity. The activation of NF-κB induced translocation of AMAP1 to cytoplasm from cell membrane and nucleus, which resulted in augmented interaction of AMAP1 and IKKβ. These results demonstrated a novel role of AMAP1 as a negative feedback regulator of NF-κB, and presented it as a possible target for anti-inflammatory treatments.

  4. A large family of antivirulence regulators modulates the effects of transcriptional activators in Gram-negative pathogenic bacteria.


    Santiago, Araceli E; Ruiz-Perez, Fernando; Jo, Noah Y; Vijayakumar, Vidhya; Gong, Mei Q; Nataro, James P


    We have reported that transcription of a hypothetical small open reading frame (orf60) in enteroaggregative E. coli (EAEC) strain 042 is impaired after mutation of aggR, which encodes a global virulence activator. We have also reported that the cryptic orf60 locus was linked to protection against EAEC diarrhea in two epidemiologic studies. Here, we report that the orf60 product acts as a negative regulator of aggR itself. The orf60 protein product lacks homology to known repressors, but displays 44-100% similarity to at least fifty previously undescribed small (<10 kDa) hypothetical proteins found in many gram negative pathogen genomes. Expression of orf60 homologs from enterotoxigenic E. coli (ETEC) repressed the expression of the AraC-transcriptional ETEC regulator CfaD/Rns and its regulon in ETEC strain H10407. Complementation in trans of EAEC 042orf60 by orf60 homologs from ETEC and the mouse pathogen Citrobacter rodentium resulted in dramatic suppression of aggR. A C. rodentium orf60 homolog mutant showed increased levels of activator RegA and increased colonization of the adult mouse. We propose the name Aar (AggR-activated regulator) for the clinically and epidemiologically important orf60 product in EAEC, and postulate the existence of a large family of homologs among pathogenic Enterobacteriaceae and Pasteurellaceae. We propose the name ANR (AraC Negative Regulators) for this family. PMID:24875828

  5. A Large Family of Antivirulence Regulators Modulates the Effects of Transcriptional Activators in Gram-negative Pathogenic Bacteria

    PubMed Central

    Santiago, Araceli E.; Ruiz-Perez, Fernando; Jo, Noah Y.; Vijayakumar, Vidhya; Gong, Mei Q.; Nataro, James P.


    We have reported that transcription of a hypothetical small open reading frame (orf60) in enteroaggregative E. coli (EAEC) strain 042 is impaired after mutation of aggR, which encodes a global virulence activator. We have also reported that the cryptic orf60 locus was linked to protection against EAEC diarrhea in two epidemiologic studies. Here, we report that the orf60 product acts as a negative regulator of aggR itself. The orf60 protein product lacks homology to known repressors, but displays 44–100% similarity to at least fifty previously undescribed small (<10 kDa) hypothetical proteins found in many gram negative pathogen genomes. Expression of orf60 homologs from enterotoxigenic E. coli (ETEC) repressed the expression of the AraC-transcriptional ETEC regulator CfaD/Rns and its regulon in ETEC strain H10407. Complementation in trans of EAEC 042orf60 by orf60 homologs from ETEC and the mouse pathogen Citrobacter rodentium resulted in dramatic suppression of aggR. A C. rodentium orf60 homolog mutant showed increased levels of activator RegA and increased colonization of the adult mouse. We propose the name Aar (AggR-activated regulator) for the clinically and epidemiologically important orf60 product in EAEC, and postulate the existence of a large family of homologs among pathogenic Enterobacteriaceae and Pasteurellaceae. We propose the name ANR (AraC Negative Regulators) for this family. PMID:24875828

  6. Marital conflict and parental responses to infant negative emotions: Relations with toddler emotional regulation.


    Frankel, Leslie A; Umemura, Tomo; Jacobvitz, Deborah; Hazen, Nancy


    According to family systems theory, children's emotional development is likely to be influenced by family interactions at multiple levels, including marital, mother-child, and father-child interactions, as well as by interrelations between these levels. The purpose of the present study was to examine parents' marital conflict and mothers' and fathers' distressed responses to their infant's negative emotions, assessed when their child was 8 and 24 months old, in addition to interactions between parents' marital conflict and their distressed responses, as predictors of their toddler's negative and flat/withdrawn affect at 24 months. Higher marital conflict during infancy and toddlerhood predicted both increased negative and increased flat/withdrawn affect during toddlerhood. In addition, toddlers' negative (but not flat) affect was related to mothers' distressed responses, but was only related to father's distressed responses when martial conflict was high. Implications of this study for parent education and family intervention were discussed. PMID:26047678

  7. Marital conflict and parental responses to infant negative emotions: Relations with toddler emotional regulation.


    Frankel, Leslie A; Umemura, Tomo; Jacobvitz, Deborah; Hazen, Nancy


    According to family systems theory, children's emotional development is likely to be influenced by family interactions at multiple levels, including marital, mother-child, and father-child interactions, as well as by interrelations between these levels. The purpose of the present study was to examine parents' marital conflict and mothers' and fathers' distressed responses to their infant's negative emotions, assessed when their child was 8 and 24 months old, in addition to interactions between parents' marital conflict and their distressed responses, as predictors of their toddler's negative and flat/withdrawn affect at 24 months. Higher marital conflict during infancy and toddlerhood predicted both increased negative and increased flat/withdrawn affect during toddlerhood. In addition, toddlers' negative (but not flat) affect was related to mothers' distressed responses, but was only related to father's distressed responses when martial conflict was high. Implications of this study for parent education and family intervention were discussed.

  8. Are we ignoring neutral and negative human-animal relationships in zoos?


    Hosey, Geoff; Melfi, Vicky


    Human-animal interactions (HAI), which may lead to human-animal relationships (HAR), may be positive, neutral, or negative in nature. Zoo studies show that visitors may be stressful, may have no effect, or may be enriching. There is also evidence that good HARs set up between animals and their keepers can have positive effects on animal welfare. However, we need to know more about negative HARs, and as a first step we attempt to do this here by considering cases where animals attack people in the zoo. Due to the sensitivity and rarity of these events data appear sparse and unsystematically collected. Here, information available in the public domain about the circumstances of these attacks has been collated to test hypotheses about negative HAIs derived from a model of zoo HARs. The limited data presented here broadly support the zoo HAR model, and suggest that attacks usually happen in unusual circumstances, where there may be a failure by the animal to recognise the HAR, or where the relationship, if there is one, does not hold; and give some support to the prediction that exposure to many keepers may impair the development of a positive HAR. This study may provide useful information for the zoo community to proactively collect systematic standardised records, which will enable a fuller understanding of zoo HARs, upon which appropriate measures might be adopted to build better zoo HARs, which are likely to positively impact zoo animal welfare, and reduce these rare incidences further.

  9. Are we ignoring neutral and negative human-animal relationships in zoos?


    Hosey, Geoff; Melfi, Vicky


    Human-animal interactions (HAI), which may lead to human-animal relationships (HAR), may be positive, neutral, or negative in nature. Zoo studies show that visitors may be stressful, may have no effect, or may be enriching. There is also evidence that good HARs set up between animals and their keepers can have positive effects on animal welfare. However, we need to know more about negative HARs, and as a first step we attempt to do this here by considering cases where animals attack people in the zoo. Due to the sensitivity and rarity of these events data appear sparse and unsystematically collected. Here, information available in the public domain about the circumstances of these attacks has been collated to test hypotheses about negative HAIs derived from a model of zoo HARs. The limited data presented here broadly support the zoo HAR model, and suggest that attacks usually happen in unusual circumstances, where there may be a failure by the animal to recognise the HAR, or where the relationship, if there is one, does not hold; and give some support to the prediction that exposure to many keepers may impair the development of a positive HAR. This study may provide useful information for the zoo community to proactively collect systematic standardised records, which will enable a fuller understanding of zoo HARs, upon which appropriate measures might be adopted to build better zoo HARs, which are likely to positively impact zoo animal welfare, and reduce these rare incidences further. PMID:25328013

  10. Investigation of negative BOLD responses in human brain through NIRS technique. A visual stimulation study.


    Maggioni, Eleonora; Molteni, Erika; Zucca, Claudio; Reni, Gianluigi; Cerutti, Sergio; Triulzi, Fabio M; Arrigoni, Filippo; Bianchi, Anna M


    Despite negative blood oxygenation level dependent (BOLD) responses to visual stimuli h