Science.gov

Sample records for nested primers specific

  1. Development of Specific Nested Oligonucleotide PCR Primers for the Streptococcus iniae 16S-23S Ribosomal DNA Intergenic Spacer

    PubMed Central

    Berridge, Brian R.; Fuller, Jeffrey D.; de Azavedo, Joyce; Low, Donald E.; Bercovier, Herve; Frelier, Paul F.

    1998-01-01

    Streptococcus iniae is a cause of septicemia, meningoencephalitis, and death in farmed fish and of cellulitis in human beings. A set of nested oligonucleotide PCR primers that specifically amplified a 373-bp subunit from a variety of clinical isolates from farmed fish and human patients were constructed from a 524-bp consensus sequence of the S. iniae 16S-23S ribosomal DNA intergenic spacer. PMID:9705438

  2. [Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus].

    PubMed

    Fernandes, Paula Rogério; Da Silva, Andréa Caetano; Gambarini, Maria Lúcia; Linhares, Guido Fontgalland C

    2008-01-01

    Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the rDNA (ITS1 and ITS2). A pair of primers was constructed for the genus-specific amplification of a 648 bp fragment and two others to amplify T. foetus species-specific fragments of 343 and 429 bp. No cross amplification was observed against Bos taurus genomic DNA neither against the DNA of usual bovine genital pathogens. Both, single and nested-PCR assays, presented analytical sensitivity to detect at least two T. foetus organisms.

  3. Species-specific ITS primers for the identification of Picoa juniperi and Picoa lefebvrei and using nested-PCR for detection of P. juniperi in planta.

    PubMed

    Jamali, Samad; Banihashemi, Zia

    2013-10-01

    Desert truffles, hypogeous Pezizales (Ascomycota), are difficult to identify due to evolutionary convergence of morphological characters among taxa that share a similar habitat and mode of spore dispersal. Also, during their symbiotic phase, these are barely distinguishable morphologically, and molecular probes are needed for their identification. We have developed a PCR-based method for the identification of Picoa juniperi and Picoa lefebvrei based on internal transcribed spacers of rDNA. Two PCR primers specific for P. lefebvrei (FLE/RLE) and two specific for P. juniperi (FJU/RJU) were designed. A collection of samples from different geographical areas representing diversity of these species were examined for unique regions of internal transcribed spacers 1, 2 and 5.8S gene of rDNA (ITS) compared to other closely related species. Annealing temperatures and extension times were optimized for each set of primers for maximum specificity and efficiency. They proved to be efficient to specifically detect the presence of P. juniperi and P. lefebvrei by PCR and neither set amplified purified DNA from other truffle species as well as some ascomycetous fungi. The partial small subunit of ribosomal DNA genes of P. juniperi were amplified with the genomic DNA extracted from Helianthemum ledifolium var. ledifolium roots by nested polymerase chain reaction (PCR) using the universal fungal primer pair ITS1/ITS4 and specific primer pair FTC/RTC, which was designed based on internal transcribed spacer 1, 2 and 5.8S gene of rDNA sequences of P juniperi. The nested-PCR was sensitive enough to re-amplify the direct-PCR product, resulting in a DNA fragment of 426 bp. The efficacy of nested-PCR showed that it could re-amplify the direct-PCR product and detect 200 fg genomic DNA.

  4. Simple, sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers.

    PubMed Central

    Albert, J; Fenyö, E M

    1990-01-01

    A simple, sensitive, and specific polymerase chain reaction (PCR) protocol for the detection of human immunodeficiency virus type 1 (HIV-1) is described. We have improved all three PCR steps: sample preparation, DNA amplification, and detection of the amplified product. Some of the improvements have been described previously, but they have never been combined into a complete PCR protocol. Peripheral blood mononuclear cells were lysed directly in a buffer containing sodium dodecyl sulfate, Triton X-100, and proteinase K. This crude cell lysate was amplified in a two-step PCR, first with outer primers and then with inner primers nested within the first primers. The PCR product was visualized by agarose gel electrophoresis and ethidium bromide staining. Thus, we avoided conventional DNA extraction as well as hybridization for the detection of the PCR product. The samples were analyzed with four sets of nested primers (JA4 through JA7, JA9 through JA12, JA13 through JA16, and JA17 through JA20) designed to amplify HIV-1 gag, env gp120, env gp41, and pol sequences, respectively. We were able to amplify HIV-1 sequences in all samples from 90 HIV-1-seropositive individuals with mostly mild symptoms. Of these individuals, 24 were negative in HIV-1 isolation and 9 were selected because they were infected by African and Haitian HIV-1 strains. Eighty-five (94%) individuals were positive with at least three of four primer sets. Samples from 26 healthy blood donors, as well as cells infected in vitro with human immunodeficiency virus type 2 and human T-cell leukemia virus type I, were negative in PCR, thus demonstrating the specificity of the amplification. Images PMID:2380380

  5. Design and application of specific 16S rDNA-targeted primers for assessing endophytic diversity in Dendrobium officinale using nested PCR-DGGE.

    PubMed

    Yu, Jie; Zhou, Xiao-Feng; Yang, Sui-Juan; Liu, Wen-Hong; Hu, Xiu-Fang

    2013-11-01

    Novel specific 16S rDNA-targeted primers were successfully designed and applied to the characterization of endophytic diversity in Dendrobium officinale. Using the popular universal bacterial primers 27f/1492r, the fragments of chloroplast and mitochondrion 16S/18S rDNA were amplified from D. officinale. They shared high nucleotide identity with the chloroplast 16S rDNAs (99-100 %) and with the mitochondrion 18S rDNAs (93-100 %) from various plants, respectively, and both shared 73-86 % identities with the bacterial 16S rDNA sequences in GenBank. The current bacterial universal primers, including 27f/1492r, match well with the chloroplast and mitochondrion 16S/18S rDNAs, which accordingly renders these primers not useful for endophytic diversity analysis. Novel 16S rDNA-targeted primers fM1 (5'-CCGCGTGNRBGAHGAAGGYYYT-3') and rC5 (5'-TAATCCTGTTTGCTCC CCAC-3') were designed, which show good specificity compared to the 16S/18S rDNAs of D. officinale, and perfect universality within bacteria except for Cyanobacteria. The primers fM1/rC5, together with 515f-GC/rC5, which overlaps the whole V4 region of 16S rDNA, were subjected to nested polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) to analyze the diversity of endophytic bacteria in D. officinale from three different sources in China. The results showed diversities in roots and stems of the plants from all three locations. Altogether, 29 bands were identified as bacteria, with the dominant group being Proteobacteria and the dominant genus being Burkholderia, some of which commonly has the function of nitrogen fixation and thus may play potentially important roles in D. officinale. Therefore, the nested PCR-DGGE method based on the novel primers provides a good alternative for investigating the communities and roles of endophytes in D. officinale.

  6. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  7. URPD: a specific product primer design tool.

    PubMed

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  8. Direct detection of Listeria monocytogenes in 25 milliliters of raw milk by a two-step PCR with nested primers.

    PubMed

    Herman, L M; De Block, J H; Moermans, R J

    1995-02-01

    A method for direct detection of Listeria monocytogenes in 25 ml of raw milk is presented. The detection limit can be situated between 10 and 5 CFU. The detection method is based on chemical extraction of the milk components and PCR amplification with two nested pairs of primers specific for Listeria monocytogenes.

  9. Development of Specific Primer for Tricholoma matsutake

    PubMed Central

    Kim, Jang-Han

    2009-01-01

    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used in this study. PMID:23983557

  10. Cancer Chemotherapy Specific to Acidic Nests.

    PubMed

    Kobayashi, Hiroshi

    2017-04-20

    The realization of cancer therapeutics specific to cancer cells with less of an effect on normal tissues is our goal. Many trials have been carried out for this purpose, but this goal is still far from being realized. It was found more than 80 years ago that solid cancer nests are acidified, but in vitro studies under acidic conditions have not been extensively studied. Recently, in vitro experiments under acidic conditions were started and anti-cancer drugs specific to acidic areas have been identified. Many genes have been reported to be expressed at a high level under acidic conditions, and such genes may be potent targets for anti-cancer drugs specific to acidic nests. In this review article, recent in vitro, in vivo, and clinical achievements in anti-cancer drugs with marked efficacy under acidic conditions are summarized, and the clinical use of anti-cancer drugs specific to acidic nests is discussed.

  11. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction.

    PubMed

    Ye, Jian; Coulouris, George; Zaretskaya, Irena; Cutcutache, Ioana; Rozen, Steve; Madden, Thomas L

    2012-06-18

    Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR

  12. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

    PubMed Central

    2012-01-01

    Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool

  13. Specific primer design for the polymerase chain reaction.

    PubMed

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2013-10-01

    The design of primers has a major impact on the success of PCR in relation to the specificity and yield of the amplified product. Here, we introduce the applications of PCR as well as the definition and characteristics for PCR primer design. Recent primer design tools based on Primer3, along with several computational intelligence-based primer design methods which have been applied in primer design, are also reviewed. In addition, characteristics of population-based methods used in primer design are discussed in detail.

  14. Specific PCR product primer design using memetic algorithm.

    PubMed

    Yang, Cheng-Hong; Cheng, Yu-Huei; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2009-01-01

    To provide feasible primer sets for performing a polymerase chain reaction (PCR) experiment, many primer design methods have been proposed. However, the majority of these methods require a relatively long time to obtain an optimal solution since large quantities of template DNA need to be analyzed. Furthermore, the designed primer sets usually do not provide a specific PCR product size. In recent years, evolutionary computation has been applied to PCR primer design and yielded promising results. In this article, a memetic algorithm (MA) is proposed to solve primer design problems associated with providing a specific product size for PCR experiments. The MA is compared with a genetic algorithm (GA) using an accuracy formula to estimate the quality of the primer design and test the running time. Overall, 50 accession nucleotide sequences were sampled for the comparison of the accuracy of the GA and MA for primer design. Five hundred runs of the GA and MA primer design were performed with PCR product lengths of 150-300 bps and 500-800 bps, and two different methods of calculating T(m) for each accession nucleotide sequence were tested. A comparison of the accuracy results for the GA and MA primer design showed that the MA primer design yielded better results than the GA primer design. The results further indicate that the proposed method finds optimal or near-optimal primer sets and effective PCR products in a dry dock experiment. Related materials are available online at http://bio.kuas.edu.tw/ma-pd/.

  15. Homolog-specific PCR primer design for profiling splice variants.

    PubMed

    Srivastava, Gyan Prakash; Hanumappa, Mamatha; Kushwaha, Garima; Nguyen, Henry T; Xu, Dong

    2011-05-01

    To study functional diversity of proteins encoded from a single gene, it is important to distinguish the expression levels among the alternatively spliced variants. A variant-specific primer pair is required to amplify each alternatively spliced variant individually. For this purpose, we developed a new feature, homolog-specific primer design (HSPD), in our high-throughput primer and probe design software tool, PRIMEGENS-v2. The algorithm uses a de novo approach to design primers without any prior information of splice variants or close homologs for an input query sequence. It not only designs primer pairs but also finds potential isoforms and homologs of the input sequence. Efficiency of this algorithm was tested for several gene families in soybean. A total of 187 primer pairs were tested under five different abiotic stress conditions with three replications at three time points. Results indicate a high success rate of primer design. Some primer pairs designed were able to amplify all splice variants of a gene. Furthermore, by utilizing combinations within the same multiplex pool, we were able to uniquely amplify a specific variant or duplicate gene. Our method can also be used to design PCR primers to specifically amplify homologs in the same gene family. PRIMEGENS-v2 is available at: http://primegens.org.

  16. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts

    PubMed Central

    Martin, Kendall J; Rygiewicz, Paul T

    2005-01-01

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmental samples provide varying degrees of success at discriminating against plant DNA while maintaining a broad range of compatibility. Typically, it has been necessary to use multiple primer sets to accommodate the range of fungi under study, potentially creating artificial distinctions for fungal sequences that amplify with more than one primer set. Results Numerous sequences for PCR primers were tested to develop PCR assays with a wide range of fungal compatibility and high discrimination from plant DNA. A nested set of 4 primers was developed that reflected these criteria and performed well amplifying ITS regions of fungal rDNA. Primers in the 5.8S sequence were also developed that would permit separate amplifications of ITS1 and ITS2. A range of basidiomycete fruiting bodies and ascomycete cultures were analyzed with the nested set of primers and Restriction Fragment Length Polymorphism (RFLP) fingerprinting to demonstrate the specificity of the assay. Single ectomycorrhizal root tips were similarly analyzed. These primers have also been successfully applied to Quantitative PCR (QPCR), Length Heterogeneity PCR (LH-PCR) and Terminal Restriction Fragment Length Polymorphism (T-RFLP) analyses of fungi. A set of wide-range plant-specific primers were developed at positions corresponding to one pair of the fungal primers. These were used to verify that the host plant DNA was not being amplified with the fungal primers. Conclusion These plant primers have been successfully applied to PCR-RFLP analyses of forest plant tissues from above- and below-ground samples and work well at distinguishing a selection of plants to the species level. The complete set of primers was developed with an emphasis on

  17. Estimating stage-specific daily survival probabilities of nests when nest age is unknown

    USGS Publications Warehouse

    Stanley, T.R.

    2004-01-01

    Estimation of daily survival probabilities of nests is common in studies of avian populations. Since the introduction of Mayfield's (1961, 1975) estimator, numerous models have been developed to relax Mayfield's assumptions and account for biologically important sources of variation. Stanley (2000) presented a model for estimating stage-specific (e.g. incubation stage, nestling stage) daily survival probabilities of nests that conditions on “nest type” and requires that nests be aged when they are found. Because aging nests typically requires handling the eggs, there may be situations where nests can not or should not be aged and the Stanley (2000) model will be inapplicable. Here, I present a model for estimating stage-specific daily survival probabilities that conditions on nest stage for active nests, thereby obviating the need to age nests when they are found. Specifically, I derive the maximum likelihood function for the model, evaluate the model's performance using Monte Carlo simulations, and provide software for estimating parameters (along with an example). For sample sizes as low as 50 nests, bias was small and confidence interval coverage was close to the nominal rate, especially when a reduced-parameter model was used for estimation.

  18. Detection of summer truffle (Tuber aestivum Vittad.) in ectomycorrhizae and in soil using specific primers.

    PubMed

    Gryndler, Milan; Hršelová, Hana; Soukupová, Lucie; Streiblová, Eva; Valda, Slavomír; Borovička, Jan; Gryndlerová, Hana; Gažo, Ján; Miko, Marián

    2011-05-01

    Tuber aestivum is becoming an important commodity of great economical value in some European countries. At the same time, it is a highly protected organism in other countries, where it needs careful treatment. A reliable method of detection in roots and soil is thus needed for assessment of geographic distribution, ecological studies and inoculation efficiency testing in man-made experiments. A PCR-based method of detection of T. aestivum using specific primers was therefore developed. A pair of PCR primers Tu1sekvF/Tu2sekvR selective for T. aestivum and some genotypes of Tuber mesentericum was designed on the basis of the known internal transcribed spacer T. aestivum sequences. TaiI restriction cleavage was then used to distinguish the two species. The selectivity of the designed primer pair was evaluated using DNA extracted from specimens of a further 13 Tuber spp. Subsequently, the selectivity and robustness to false-positive results with nontarget DNA of the designed primers was compared with two other primer pairs (UncI/UncII and BTAE-F/BTAEMB-R). The occurrence of T. aestivum in soil and ectomycorrhizae collected in its native habitat has been successfully detected using the designed primers and nested PCR. The method is reliable and thus suitable for detection of T. aestivum in the field.

  19. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  20. Genus-Specific Primers for Study of Fusarium Communities in Field Samples.

    PubMed

    Karlsson, Ida; Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-10-30

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

  1. Detection of bacterial DNA from cholesterol gallstones by nested primers polymerase chain reaction

    PubMed Central

    Wu, Xiao-Ting; Xiao, Lu-Jia; Li, Xing-Quan; Li, Jie-Shou

    1998-01-01

    AIM: To search for bacterial DNA sequences in cholesterol gallstones with negative bacterial culture. METHODS: DNA was extracted from cholesterol gallstones in gallbladders and nested primers polymerase chain reaction (NP-PCR) was used to amplify bacterial gene fragments for identifying the existence of bacteria. The samples of bacterial DNA extracted from potentially causative or unrelated living bacteria were amplified in vitro as the standard markers and comparative 16S ribosomal RNA sequence analysis was made for bacterial identification. RESULTS: The gallbladder gallstones of 30 patients were analyzed and bacterial DNA was found in 26 patients. Among them, gallstones with cholesterol content between 30%-69% were seen in 5 (5/5) patients, 70%-90% in 11 (11/14) patients, and more than 90% in 10 (10/11) patients. There was no difference either in cholesterol and water content of gallstones or in harboring bacterial DNA of gallstones. E. coli-related DNA fragments appeared in the stones of 8 (26.67%) patients; propionibacteria type DNA in 7 (23.33%); and harbored bacterial gene fragments in 2 patients, similar to Streptococcus pyogenes. A more heterogenous sequence collection was found in 7 (23.33%) patients, which could belong to multiple bacterial infections. Two (6.67%) patients had bacterial DNA with low molecular weight which might be related to some unidentified bacteria. CONCLUSION: Most cholesterol gallstones harbor bacterial DNA. It is important to determine whether these microorganisms are innocent bystanders or active participants in cholesterol gallstone formation. PMID:11819284

  2. Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR

    PubMed Central

    Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru

    2005-01-01

    Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082

  3. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    PubMed Central

    2011-01-01

    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  4. Taxon-specific oligonucleotide primers for detection of two ancient endomycorrhizal fungi, Glomus occultum and Glomus brasilianum.

    PubMed

    Millner, P D; Mulbry, W W; Reynolds, S L

    2001-03-15

    A unique oligonucleotide pair, GOCC56:GOCC427, was designed that correctly primed specific amplification of a approximately 370-bp sequence spanning the ITS and 5.8S rDNA regions of Glomus occultum and Glomus brasilianum. In addition, this primer pair successfully detected G. occultum and G. brasilianum DNA in nested PCR using a primary PCR product amplified from highly diluted extracts of colonized corn (Zea mays) roots using modified ITS1:ITS4 primers. A second primer pair, GBRAS86:GBRAS388, primed specific amplification of a approximately 200-bp sequence spanning the ITS and 5.8S rDNA regions present only in G. brasilianum and Glomus strain GR582. Combined use of both primer pairs provides the means to detect and differentiate two ancient endomycorrhizal species, G. occultum and G. brasilianum, undetectable by standard root staining procedures. Sequence analysis showed that the purported G. occultum strain GR582 is likely a strain of G. brasilianum.

  5. A Primer for Analyzing Nested Data: Multilevel Modeling in SPSS Using an Example from a REL Study. REL 2015-046

    ERIC Educational Resources Information Center

    O'Dwyer, Laura M.; Parker, Caroline E.

    2014-01-01

    Analyzing data that possess some form of nesting is often challenging for applied researchers or district staff who are involved in or in charge of conducting data analyses. This report provides a description of the challenges for analyzing nested data and provides a primer of how multilevel regression modeling may be used to resolve these…

  6. PCR primers specific for the genus Tuber reveal the presence of several truffle species in a truffle-ground.

    PubMed

    Zampieri, Elisa; Mello, Antonietta; Bonfante, Paola; Murat, Claude

    2009-08-01

    Truffles are hypogeous Ascomycete fungi belonging to the genus Tuber and forming fruiting bodies highly prized for their taste and aroma. The identification of the genus Tuber and its species is important to investigate their ecology and avoid fraud in the food market. As genus-specific primers are not available, the aims of this work were (1) to assess the usefulness of the beta-tubulin gene as a DNA barcoding region for designing Tuber genus-specific primers, (2) to test the primers on a range of fruiting bodies, representing a large part of truffle biodiversity and (3) to check their ecological usefulness, applying them to truffle-ground soil. The new primers designed on the beta-tubulin gene were specific to the Tuber genus in nested PCR. When applied to DNA from soils, they gave a positive signal for 23 of 32 soils. Phylogenetic analysis confirmed that the bands corresponded to Tuber and that at least five Tuber species were present in the truffle-ground. beta-tubulin was found to be a good barcoding region for designing Tuber genus-specific primers, detecting a high Tuber diversity in a natural environment. These primers will be useful for understanding truffle ecology and for practical needs in plantation management.

  7. Rapid identification of Zygosaccharomyces with genus-specific primers.

    PubMed

    Hulin, Michelle; Wheals, Alan

    2014-03-03

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design.

  8. Sex determination of early medieval individuals through nested PCR using a new primer set in the SRY gene.

    PubMed

    Luptáková, Lenka; Bábelová, Andrea; Omelka, Radoslav; Kolena, Branislav; Vondráková, Mária; Bauerová, Mária

    2011-04-15

    One of the first questions asked about excavated human skeletal remains is the sex. As the morphological sex determination is complicated in cases involving fragmentary bones and in skeletons from infants and children, the development of DNA-based techniques has led to improvements in sex determination. This study is focused on sex determination from ancient DNA obtained from 25 skeletons found in Middle Aged burials in western Slovakia. We performed separate amplifications of DXZ4 repetitive satellite sequences on the X chromosome, and SRY gene - testis determined factor on the Y chromosome, using nested PCR. Our results showed that DXZ4 was amplified in the case of 23 individuals. With newly designed internal and external primer sets for SRY detection with internal PCR products in lengths of 102 bp and 85 bp we succeeded in detecting the SRY locus in 9 samples. Finally, the gender was determined in 23 individuals (14 females and 9 males). In 20 samples, the gender was determined by morphological and molecular methods. Sex determination of 17 samples using nested PCR matched the morphological one, providing evidence of the authenticity and ancient origin of the PCR amplifications. The DXZ4/SRY nested PCR method represents a useful technique in sex determination of medieval human remains and it is a critical addition to anthropological studies.

  9. Nested PCR for specific diagnosis of Taenia solium taeniasis.

    PubMed

    Mayta, Holger; Gilman, Robert H; Prendergast, Emily; Castillo, Janeth P; Tinoco, Yeny O; Garcia, Hector H; Gonzalez, Armando E; Sterling, Charles R

    2008-01-01

    Taeniasis due to Taenia solium is a disease with important public health consequences, since the larval stage is not exclusive to the animal intermediate, the pig, but also infects humans, causing neurocysticercosis. Early diagnosis and treatment of T. solium tapeworm carriers is important to prevent human cysticercosis. Current diagnosis based on microscopic observation of eggs lacks both sensitivity and specificity. In the present study, a nested-PCR assay targeting the Tso31 gene was developed for the specific diagnosis of taeniasis due to T. solium. Initial specificity and sensitivity testing was performed using stored known T. solium-positive and -negative samples. The assay was further analyzed under field conditions by conducting a case-control study of pretreatment stool samples collected from a population in an area of endemicity. Using the archived samples, the assay showed 97% (31/32) sensitivity and 100% (123/123) specificity. Under field conditions, the assay had 100% sensitivity and specificity using microscopy/enzyme-linked immunosorbent assay coproantigen testing as the gold standards. The Tso31 nested PCR described here might be a useful tool for the early diagnosis and prevention of taeniasis/cysticercosis.

  10. Nested PCR for Specific Diagnosis of Taenia solium Taeniasis▿

    PubMed Central

    Mayta, Holger; Gilman, Robert H.; Prendergast, Emily; Castillo, Janeth P.; Tinoco, Yeny O.; Garcia, Hector H.; Gonzalez, Armando E.; Sterling, Charles R.

    2008-01-01

    Taeniasis due to Taenia solium is a disease with important public health consequences, since the larval stage is not exclusive to the animal intermediate, the pig, but also infects humans, causing neurocysticercosis. Early diagnosis and treatment of T. solium tapeworm carriers is important to prevent human cysticercosis. Current diagnosis based on microscopic observation of eggs lacks both sensitivity and specificity. In the present study, a nested-PCR assay targeting the Tso31 gene was developed for the specific diagnosis of taeniasis due to T. solium. Initial specificity and sensitivity testing was performed using stored known T. solium-positive and -negative samples. The assay was further analyzed under field conditions by conducting a case-control study of pretreatment stool samples collected from a population in an area of endemicity. Using the archived samples, the assay showed 97% (31/32) sensitivity and 100% (123/123) specificity. Under field conditions, the assay had 100% sensitivity and specificity using microscopy/enzyme-linked immunosorbent assay coproantigen testing as the gold standards. The Tso31 nested PCR described here might be a useful tool for the early diagnosis and prevention of taeniasis/cysticercosis. PMID:17989190

  11. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    PubMed Central

    Yao, Jiqiang; Lin, Hong; Van Deynze, Allen; Doddapaneni, Harshavardhan; Francis, Martha; Lemos, Eliana Gertrudes Macedo; Civerolo, Edwin L

    2008-01-01

    Background The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the identification of the few loci in the genome that can serve as unique markers for strain differentiation. PrimerSNP attempts to identify reliable strain-specific markers, on which specific primers are designed for pathogen detection purpose. Results PrimerSNP is an online tool to design primers based on strain specific SNPs for multiple strains/species of microorganisms at the whole genome level. The allele-specific primers could distinguish query sequences of one strain from other homologous sequences by standard PCR reaction. Additionally, PrimerSNP provides a feature for designing common primers that can amplify all the homologous sequences of multiple strains/species of microorganisms. PrimerSNP is freely available at . Conclusion PrimerSNP is a high-throughput specific primer generation tool for the differentiation of phylogenetically-related strains/species. Experimental validation showed that this software had a successful prediction rate of 80.4 – 100% for strain specific primer design. PMID:18937861

  12. Specificity and transmission mosaic of ant nest-wall fungi

    PubMed Central

    Schlick-Steiner, Birgit C.; Steiner, Florian M.; Konrad, Heino; Seifert, Bernhard; Christian, Erhard; Moder, Karl; Stauffer, Christian; Crozier, Ross H.

    2008-01-01

    Mutualism, whereby species interact to their mutual benefit, is extraordinary in a competitive world. To recognize general patterns of origin and maintenance from the plethora of mutualistic associations proves a persisting challenge. The simplest situation is believed to be that of a single mutualist specific to a single host, vertically transmitted from one host generation to the next. We characterized ascomycete fungal associates cultured for nest architecture by the ant subgenera Dendrolasius and Chthonolasius. The ants probably manage their fungal mutualists by protecting them against fungal competitors. The ant subgenera display different ant-to-fungus specificity patterns, one-to-two and many-to-one, and we infer vertical transmission, in the latter case overlaid by horizontal transmission. Possible evolutionary trajectories include a reversal from fungiculture by other Lasius subgenera and inheritance of fungi through life cycle interactions of the ant subgenera. The mosaic indicates how specificity patterns can be shaped by an interplay between host life-cycles and transmission adaptations. PMID:18195358

  13. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene

    PubMed Central

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-01-01

    Background The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. Objectives This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. Patients and Methods In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher’s exact test, and SPSS17 software. Results The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. Conclusions These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1. PMID:27679699

  14. GSP: A web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  15. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  16. Specific detection of Pacific oyster (Crassostrea gigas) larvae in plankton samples using nested polymerase chain reaction.

    PubMed

    Patil, Jawahar G; Gunasekera, Rasanthi M; Deagle, Bruce E; Bax, Nicholas J

    2005-01-01

    Management of sustainable Pacific oyster fisheries would be assisted by an early, rapid, and accurate means of detecting their planktonic larvae. Reported here is an approach, based on polymerase chain reaction (PCR), for the detection of Pacific oyster larvae in plankton samples. Species-specific primers were designed by comparing partial mitochondrial cytochrome oxidase subunit I (COI) sequences from Crassostrea gigas, with other members of the family Ostreidae including those of Crassostrea angulata. Assay specificity was empirically validated through screening DNA samples obtained from several species of oysters. The assay was specific as only C. gigas samples returned PCR-positive results. A nested PCR approach could consistently detect 5 or more D-hinge-stage larvae spiked into a background of about 146 mg of plankton. The assay does not require prior sorting of larvae. We conclude that the assay could be used to screen environmental and ballast water samples, although further specificity testing against local bivalve species is recommended in new locations.

  17. MFEprimer-2.0: a fast thermodynamics-based program for checking PCR primer specificity.

    PubMed

    Qu, Wubin; Zhou, Yang; Zhang, Yanchun; Lu, Yiming; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2012-07-01

    Evaluating the specificity of polymerase chain reaction (PCR) primers is an essential step in PCR primer design. The MFEprimer-2.0 server allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. MFEprimer-2.0 uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported on the results page. Based on these characteristics and the user-friendly output, users can readily draw conclusions about the specificity of PCR primers. Analyses for degenerate primers and multiple PCR primers are also supported in MFEprimer-2.0. In addition, the databases supported by MFEprimer-2.0 are comprehensive, and custom databases can also be supported on request. The MFEprimer-2.0 server does not require a login and is freely available at http://biocompute.bmi.ac.cn/CZlab/MFEprimer-2.0. More over, the MFEprimer-2.0 command-line version and local server version are open source and can be downloaded at https://github.com/quwubin/MFEprimer/wiki/Manual/.

  18. A tool for design of primers for microRNA-specific quantitative RT-qPCR

    PubMed Central

    2014-01-01

    Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. Conclusions The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language. PMID:24472427

  19. A tool for design of primers for microRNA-specific quantitative RT-qPCR.

    PubMed

    Busk, Peter K

    2014-01-28

    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  20. Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

    PubMed

    Campos, Maria Jorge; Quesada, Alberto

    2017-01-01

    PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

  1. A novel technique for detecting single nucleotide polymorphisms by analyzing consumed allele-specific primers.

    PubMed

    Watanabe, G; Umetsu, K; Yuasa, I; Sato, M; Sakabe, M; Naito, E; Yamanouchi, H; Suzuki, T

    2001-02-01

    We present a simple and rapid polymerase chain reaction (PCR)-based technique, termed consumed allele-specific primer analysis (CASPA), as a new strategy for single nucleotide polymorphism (SNP) analysis. The method involves the use of labeled allele-specific primers, differing in length, with several noncomplementary nucleotides added in the 5'-terminal region. After PCR amplification, the amounts of the remaining primers not incorporated into the PCR products are determined. Thus, nucleotide substitutions are identified by measuring the consumption of primers. In this study, the CASPA method was successfully applied to ABO genotyping. In the present method, the allele-specific primer only anneals with the target polymorphic site on the DNA, so it is not necessary to analyze the PCR products. Therefore, this method is only little affected by modification of the PCR products. The CASPA method is expected to be a useful tool for typing of SNPs.

  2. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

    PubMed Central

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

  3. Identification of putative sequence specific PCR primers for detection of the toxigenic fungal species Stachybotrys chartarum.

    PubMed

    Haugland, R A; Heckman, J L

    1998-12-01

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relationships of these organisms and to search for sequence specific polymerase chain reaction (PCR) primers for S. chartarum in the internal transcribed spacer (ITS) regions. Searches for candidate primers were performed both by computer using the commercially available Oligo(R) v5.0 primer analysis software package and by manual inspection of the aligned sequences. Primers identified in both types of searches were evaluated for their specificities using a priming efficiency analysis algorithm available in the Oligo(R) 5.0 software. The automated computer searches were unsuccessful in finding S. chartarum-specific primers but did identify a group-specific reverse primer (designated as StacR4) for a phylogenetically related cluster of species that included S. chartarum. Manual searches led to the identification of a reverse primer (designated as StacR3) that was predicted to be specific for only S. chartarum and one other species of Stachybotrys. Experimental PCR analyses using these primers in conjunction with a universal forward primer indicated that the computer-generated amplification efficiency predictions were correct in most instances. A notable exception was the finding that StacR3 was specific only for S. chartarum. The relative merits of different PCR strategies for the detection of S. chartarum employing either one or both of the primers identified in this study are discussed.

  4. Microarrays for high-throughput genotyping of MICA alleles using allele-specific primer extension.

    PubMed

    Baek, I C; Jang, J-P; Choi, H-B; Choi, E-J; Ko, W-Y; Kim, T-G

    2013-10-01

    The role of major histocompatibility complex (MHC) class I chain-related gene A (MICA), a ligand of NKG2D, has been defined in human diseases by its allele associations with various autoimmune diseases, hematopoietic stem cell transplantation (HSCT) and cancer. This study describes a practical system to develop MICA genotyping by allele-specific primer extension (ASPE) on microarrays. From the results of 20 control primers, strict and reliable cut-off values of more than 30,000 mean fluorescence intensity (MFI) as positive and less than 3000 MFI as negative, were applied to select high-quality specific extension primers. Among 55 allele-specific primers, 44 primers could be initially selected as optimal primer. Through adjusting the length, six primers were improved. The other failed five primers were corrected by refractory modification. MICA genotypes by ASPE on microarrays showed the same results as those by nucleotide sequencing. On the basis of these results, ASPE on microarrays may provide high-throughput genotyping for MICA alleles for population studies, disease-gene associations and HSCT.

  5. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    PubMed Central

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti

    2015-01-01

    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  6. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    PubMed Central

    2011-01-01

    Background MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological settings. Results We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision in microRNA quantification. Conclusions MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification. PMID:21702990

  7. Design of primer pairs for species-specific diagnosis of Leishmania (Leishmania) infantum chagasi using PCR.

    PubMed

    da Silveira Neto, Osvaldo José; Duarte, Sabrina Castilho; da Costa, Hérika Xavier; Linhares, Guido Fontgalland Coelho

    2012-01-01

    The objective of this study was to design and evaluate new primers for species-specific detection of L. infantum chagasi using PCR. Two combinations of primer pairs were established with the aim of obtaining specific amplification products from the L. infantum chagasi 18S rRNA gene. The combinations of the primer pairs and the respective sizes of the PCR products, based on the U422465 GenBank reference sequence of L. infantum chagasi, were: LCS1/LCS3 (259 bp) and LCS2/LCS3 (820 bp). It was concluded that the new PCR assays optimized using the primer pairs LCS1/LCS3 and LCS2/LCS3 were effective for specific detection of L. infantum chagasi, with analytical sensitivity to detect 1 pg/µL of DNA.

  8. primers4clades: a web server that uses phylogenetic trees to design lineage-specific PCR primers for metagenomic and diversity studies.

    PubMed

    Contreras-Moreira, Bruno; Sachman-Ruiz, Bernardo; Figueroa-Palacios, Iraís; Vinuesa, Pablo

    2009-07-01

    Primers4clades is an easy-to-use web server that implements a fully automatic PCR primer design pipeline for cross-species amplification of novel sequences from metagenomic DNA, or from uncharacterized organisms, belonging to user-specified phylogenetic clades or taxa. The server takes a set of non-aligned protein coding genes, with or without introns, aligns them and computes a neighbor-joining tree, which is displayed on screen for easy selection of species or sequence clusters to design lineage-specific PCR primers. Primers4clades implements an extended CODEHOP primer design strategy based on both DNA and protein multiple sequence alignments. It evaluates several thermodynamic properties of the oligonucleotide pairs, and computes the phylogenetic information content of the predicted amplicon sets from Shimodaira-Hasegawa-like branch support values of maximum likelihood phylogenies. A non-redundant set of primer formulations is returned, ranked according to their thermodynamic properties. An amplicon distribution map provides a convenient overview of the coverage of the target locus. Altogether these features greatly help the user in making an informed choice between alternative primer pair formulations. Primers4clades is available at two mirror sites: http://maya.ccg.unam.mx/primers4clades/and http://floresta.eead.csic.es/primers4clades/. Three demo data sets and a comprehensive documentation/tutorial page are provided for easy testing of the server's capabilities and interface.

  9. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies.

    PubMed

    O'Donnell, James L; Kelly, Ryan P; Lowell, Natalie C; Port, Jesse A

    2016-01-01

    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary.

  10. 5'-degenerate 3'-dideoxy-terminated competitors of PCR primers increase specificity of amplification.

    PubMed

    Atamas, S P; Luzina, I G; Handwerger, B S; White, B

    1998-03-01

    Amplification of a product in PCR with specific primers may be viewed as an artificial Darwinian-type "selection of the fittest". In other selective systems, such as general evolution, immune system and probably brain cortex, the stringency of selection is not absolute but rather degenerate, with selection of many highly fit units, not limited, however, to only the fittest. In PCR also, annealing of the primers is not absolutely specific. The subsequent amplification frequently leads to amplification of not only the desired product but also to less-specific sequences. Using theoretical analysis of the degenerate mode of selection, we predict theoretically and prove experimentally that 5'-degenerate, 3'-dideoxy-terminated competitors of PCR primers can be used to dramatically improve the specificity of PCR amplification without affecting the quantitation of the final specific product.

  11. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    PubMed

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes.

  12. Detection of fiber-digesting bacteria in the ceca of ostrich using specific primer sets.

    PubMed

    Matsui, Hiroki; Ban-Tokuda, Tomomi; Wakita, Masaaki

    2010-02-01

    The purpose of this study was to detect three fibrolytic bacteria, Fibrobacter succinogenes, Ruminococcus flavefaciens, and Ruminococcus albus, in the cecal digesta of the ostrich (Struthio camelus) by PCR using a species-specific primer set for each 16S ribosomal RNA gene (16S rDNA). Although amplified DNA fragments obtained from each primer set had the expected size, the clone library derived from the amplimer contained non-specific sequences. The F. succinogenes-specific primer set recovered a partial 16S rDNA sequence of an uncultivated Fibrobacter with low similarity (<95%) and distantly related phylogenetic positioning to Fibrobacter sequences deposited in the databases, indicating a novel species of Fibrobacter. The sequence was considered to be identical to a clone detected in our previous experiment. Thus, we confirm that the gastrointestinal tract of the ostrich is one of the habitats of Fibrobacter species. The clone library derived from the R. flavefaciens-specific primer set contained a 16S rDNA sequence with 97% similarity to R. flavefaciens, indicating it could be one of a major fibrolytic bacterium in the ostrich ceca. No R. albus 16S rDNA sequence was found in the clone library of the R. albus-specific primer set.

  13. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  14. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  15. Nesting behaviour influences species-specific gas exchange across avian eggshells

    PubMed Central

    Portugal, Steven J.; Maurer, Golo; Thomas, Gavin H.; Hauber, Mark E.; Grim, Tomáš; Cassey, Phillip

    2014-01-01

    Carefully controlled gas exchange across the eggshell is essential for the development of the avian embryo. Water vapour conductance (GH2O) across the shell, typically measured as mass loss during incubation, has been demonstrated to optimally ensure the healthy development of the embryo while avoiding desiccation. Accordingly, eggs exposed to sub-optimal gas exchange have reduced hatching success. We tested the association between eggshell GH2O and putative life-history correlates of adult birds, ecological nest parameters and physical characteristics of the egg itself to investigate how variation in GH2O has evolved to maintain optimal water loss across a diverse set of nest environments. We measured gas exchange through eggshell fragments in 151 British breeding bird species and fitted phylogenetically controlled, general linear models to test the relationship between GH2O and potential predictor parameters of each species. Of our 17 life-history traits, only two were retained in the final model: wet-incubating parent and nest type. Eggs of species where the parent habitually returned to the nest with wet plumage had significantly higher GH2O than those of parents that returned to the nest with dry plumage. Eggs of species nesting in ground burrows, cliffs and arboreal cups had significantly higher GH2O than those of species nesting on the ground in open nests or cups, in tree cavities and in shallow arboreal nests. Phylogenetic signal (measured as Pagel's λ) was intermediate in magnitude, suggesting that differences observed in the GH2O are dependent upon a combination of shared ancestry and species-specific life history and ecological traits. Although these data are correlational by nature, they are consistent with the hypothesis that parents constrained to return to the nest with wet plumage will increase the humidity of the nest environment, and the eggs of these species have evolved a higher GH2O to overcome this constraint and still achieve optimal water

  16. Nesting behaviour influences species-specific gas exchange across avian eggshells.

    PubMed

    Portugal, Steven J; Maurer, Golo; Thomas, Gavin H; Hauber, Mark E; Grim, Tomáš; Cassey, Phillip

    2014-09-15

    Carefully controlled gas exchange across the eggshell is essential for the development of the avian embryo. Water vapour conductance (G(H2O)) across the shell, typically measured as mass loss during incubation, has been demonstrated to optimally ensure the healthy development of the embryo while avoiding desiccation. Accordingly, eggs exposed to sub-optimal gas exchange have reduced hatching success. We tested the association between eggshell G(H2O) and putative life-history correlates of adult birds, ecological nest parameters and physical characteristics of the egg itself to investigate how variation in G(H2O) has evolved to maintain optimal water loss across a diverse set of nest environments. We measured gas exchange through eggshell fragments in 151 British breeding bird species and fitted phylogenetically controlled, general linear models to test the relationship between G(H2O) and potential predictor parameters of each species. Of our 17 life-history traits, only two were retained in the final model: wet-incubating parent and nest type. Eggs of species where the parent habitually returned to the nest with wet plumage had significantly higher G(H2O) than those of parents that returned to the nest with dry plumage. Eggs of species nesting in ground burrows, cliffs and arboreal cups had significantly higher G(H2O) than those of species nesting on the ground in open nests or cups, in tree cavities and in shallow arboreal nests. Phylogenetic signal (measured as Pagel's λ) was intermediate in magnitude, suggesting that differences observed in the G(H2O) are dependent upon a combination of shared ancestry and species-specific life history and ecological traits. Although these data are correlational by nature, they are consistent with the hypothesis that parents constrained to return to the nest with wet plumage will increase the humidity of the nest environment, and the eggs of these species have evolved a higher G(H2O) to overcome this constraint and still

  17. Living archaeology: artefacts of specific nest site fidelity in wild chimpanzees.

    PubMed

    Stewart, F A; Piel, A K; McGrew, W C

    2011-10-01

    Savanna chimpanzees are known to re-use areas of the landscape for sleep, and patterns of chimpanzee sleeping site re-use are proposed as a referential model for early hominin archaeological site formation. We recorded the prevalence of deformed but healed branches and remnants of dead branches found around fresh nests at the savanna site of Issa in Ugalla, Tanzania. These old nest scars were found in 79% of 112 beds. We also randomly selected potential nesting locations for a subset of 32 beds within the same trees, and found nest scars in only 19% of these "control" locations. We then monitored 275 nests for up to 19 months for decay, regeneration of new branches, and re-use. Of these 275 nest locations, 24% were re-used within the first nine months of monitoring, and most re-use occurred when the nest had already decayed and was not easily visible from the ground. After 18 months, the proportion of specific nest positions re-used increased to 48%. This fidelity is likely a result of the creation of ideally-shaped support structures and supple new growth for mattress material with successive use of nest locations. We propose that specific nest site re-use may not be a direct product of environmental determination, but a result of "niche construction" through formation of good building sites within trees. Environmental modification through construction behaviour may have influenced both chimpanzee and early hominin ranging, and thus leaves behind recognisable patterns of artefact deposition across the landscape. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. [Sensitivity and specificity of nested PCR pyrosequencing in hepatitis B virus drug resistance gene testing].

    PubMed

    Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian

    2012-05-01

    To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, P<0.05). Nested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, P<0.01). The detection sensitivity of Sanger sequencing varied with the viral loads, especially in samples with low viral copies (HBV DNA ≤3log10 copies/ml), where the sensitivity was 78%, significantly lower than that of pyrosequencing (100%, P<0.01). Neither of the two methods yielded positive results for the negative control samples, suggesting their good specificity. Compared with nested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.

  19. A simple ABO genotyping by PCR using sequence-specific primers with mismatched nucleotides.

    PubMed

    Taki, Takashi; Kibayashi, Kazuhiko

    2014-05-01

    In forensics, the specific ABO blood group is often determined by analyzing the ABO gene. Among various methods used, PCR employing sequence-specific primers (PCR-SSP) is simpler than other methods for ABO typing. When performing the PCR-SSP, the pseudo-positive signals often lead to errors in ABO typing. We introduced mismatched nucleotides at the second and the third positions from the 3'-end of the primers for the PCR-SSP method and examined whether reliable typing could be achieved by suppressing pseudo-positive signals. Genomic DNA was extracted from nail clippings of 27 volunteers, and the ABO gene was examined with PCR-SSP employing primers with and without mismatched nucleotides. The ABO blood group of the nail clippings was also analyzed serologically, and these results were compared with those obtained using PCR-SSP. When mismatched primers were employed for amplification, the results of the ABO typing matched with those obtained by the serological method. When primers without mismatched nucleotides were used for PCR-SSP, pseudo-positive signals were observed. Thus our method may be used for achieving more reliable ABO typing.

  20. A specific oligonucleotide primer for the rapid detection of Lactobacillus lindneri by polymerase chain reaction.

    PubMed

    Yasui, T; Okamoto, T; Taguchi, H

    1997-02-01

    A polymerase chain reaction (PCR) method was developed for the rapid detection of the beer-spoilage heterofermentative lactic acid bacterium Lactobacillus lindneri. Three strains, the Chinese brewery isolate DA1, the Japanese commercial beer isolate BG2, and the Japanese brewery isolate SE3, which were serologically classified as belonging to L. lindneri, were used in this study. After sequencing the 16S rDNA of the isolates DA1 and BG2 and the typical beer-spoilage heterofermentative Lactobacillus brevis L63, these sequences were compared with published data. A L. lindneri specific PCR primer, DA-40, was then constructed based on the V1 variable region of 16S rDNA. The specificity of PCR using the L. lindneri specific primer DA-40 and the universal primer 907r was examined using five L. lidneri strains: the three isolates described above and two strains from culture collection, DSM 20690 and DSM 20692. A variety of beer-spoilage lactic acid bacteria, including 71 Lactobacillus strains and 13 Pediococcus strains, were also included in this examination. No PCR product was obtained from any DNA with the exception of the five L. lindneri strains, indicating that the L. lindneri specific primer DA-40 was highly specific. The detection limit for L. lindneri in beer was 63 CFU/100 mL of beer.

  1. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

    USDA-ARS?s Scientific Manuscript database

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

  2. Multiply-primed rolling circle amplification of human papillomavirus using sequence-specific primers.

    PubMed

    Marincevic-Zuniga, Yanara; Gustavsson, Inger; Gyllensten, Ulf

    2012-10-10

    Multiply-primed rolling circle amplification (RCA) is a suitable technique for amplification of circular templates and has been used to identify novel human papillomaviruses (HPV). In this study we develop an efficient RCA for whole genome amplification of HPV using HPV-specific primers in clinical samples and establish a protocol for whole genome sequencing using the Sanger method. Amplification of cloned HPV-genomes by RCA was compared using specific primers against random hexamers. Using HPV-specific primers increased the effectiveness on average 15.2 times and the enrichment of HPV relative to human gDNA on average 62.2 times, as compared to using random hexamer. RCA products were sequenced without need for cloning, even when using low-input amounts. The technique was successfully used on 4 patient samples from FTA cards, to generate whole HPV-genome sequences. Degenerated HPV-specific primers for RCA produce DNA of sufficient quality and quantity suitable for sequencing and other potential downstream analyses.

  3. TM7 detection in human microbiome: are PCR primers and FISH probes specific enough?

    PubMed Central

    Sizova, Maria V.; Doerfert, Sebastian N.; Gavrish, Ekaterina; Epstein, Slava S.

    2015-01-01

    TM7 appears important and omnipresent because it is repeatedly detected by molecular techniques in diverse environments. Here we report that most of primers and FISH probes thought to be TM7-specific do hybridize with multiple species from oral and vaginal cavity. This calls for re-examination of TM7 distribution and abundance. PMID:25957511

  4. MICB Allele Genotyping on Microarrays by Improving the Specificity of Extension Primers

    PubMed Central

    Baek, In-Cheol; Jang, Jung-Pil; Choi, Eun-Jeong; Kim, Tai-Gyu

    2015-01-01

    Major histocompatibility complex (MHC) class I chain-related gene B (MICB) encodes a ligand for activating NKG2D that expressed in natural killer cells, γδ T cells, and αβ CD8+ T cells, which is associated with autoimmune diseases, cancer, and infectious diseases. Here, we have established a system for genotyping MICB alleles using allele-specific primer extension (ASPE) on microarrays. Thirty-six high quality, allele-specific extension primers were evaluated using strict and reliable cut-off values using mean fluorescence intensity (MFI), whereby an MFI >30,000 represented a positive signal and an MFI <10,000 represented a negative signal. Eight allele-specific extension primers were found to be false positives, five of which were improved by adjusting their length, and three of which were optimized by refractory modification. The MICB alleles (*002:01, *003, *005:02/*010, *005:03, *008, *009N, *018, and *024) present in the quality control panel could be exactly defined by 22 allele-specific extension primers. MICB genotypes that were identified by ASPE on microarrays were in full concordance with those identified by PCR-sequence-based typing. In conclusion, we have developed a method for genotyping MICB alleles using ASPE on microarrays; which can be applicable for large-scale single nucleotide polymorphism typing studies of population and disease associations. PMID:26569110

  5. GSP: a web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

  6. ITS fungal barcoding primers vs 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

    PubMed

    Berruti, A; Desirò, A; Visentin, S; Zecca, O; Bonfante, P

    2017-08-11

    ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil), and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) since it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. This article is protected by copyright. All rights reserved. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  7. Short communication: HIV type 1 tropism determination in a novel dried blood spot membrane and the use of a mixture of outer nested polymerase chain reaction primers.

    PubMed

    Lavigne, Shirlene; Santos, Carlos; Arif, Muhammad Shoaib; Reis, Alexanda; Samer, Sadia; Dos Santos, Cintia Vilhena; Diaz, Ricardo Sobhie

    2014-02-01

    Genotropism was determined in 608 Brazilian samples collected in dried blood spots using Polyethersulfone collection cards. Patients were infected by subtype B (88.8%), F (5.6%), C (3.3%), A (1.8%), and G (0.5%). All patients were exposed to three classes of antiretrovirals, and 59.8% of the samples harbored R5 viruses, 35% non-R5-tropic viruses, and 5.1% harbored mixtures of R5 and non-R5-tropic viruses, with non-R5 more prevalent among clade B-infected patients as compared to non-B (42.8% versus 19.1%; p<0.0003). A strategy using a mixture of outer nested polymerase chain reaction (PCR) primers reduced the number of negative PCR results from 39% to 19%.

  8. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    PubMed

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens.

  9. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    PubMed

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  10. Modeling and estimation of stage-specific daily survival probabilities of nests

    USGS Publications Warehouse

    Stanley, T.R.

    2000-01-01

    In studies of avian nesting success, it is often of interest to estimate stage-specific daily survival probabilities of nests. When data can be partitioned by nesting stage (e.g., incubation stage, nestling stage), piecewise application of the Mayfield method or Johnsona??s method is appropriate. However, when the data contain nests where the transition from one stage to the next occurred during the interval between visits, piecewise approaches are inappropriate. In this paper, I present a model that allows joint estimation of stage-specific daily survival probabilities even when the time of transition between stages is unknown. The model allows interval lengths between visits to nests to vary, and the exact time of failure of nests does not need to be known. The performance of the model at various sample sizes and interval lengths between visits was investigated using Monte Carlo simulations, and it was found that the model performed quite well: bias was small and confidence-interval coverage was at the nominal 95% rate. A SAS program for obtaining maximum likelihood estimates of parameters, and their standard errors, is provided in the Appendix.

  11. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  12. Nest Success and Cause-Specific Nest Failure of Grassland Passerines Breeding in Prairie Grazed by Livestock

    EPA Science Inventory

    This manuscript describes two years of field research on ground-nesting songbird species at Zumwalt Prairie Reserve, northeastern Oregon, USA. Cattle-grazing has long been suspected in declines of ground-nesting songbirds in grazed grassland, primarily due to increased trampling...

  13. Nest Success and Cause-Specific Nest Failure of Grassland Passerines Breeding in Prairie Grazed by Livestock

    EPA Science Inventory

    This manuscript describes two years of field research on ground-nesting songbird species at Zumwalt Prairie Reserve, northeastern Oregon, USA. Cattle-grazing has long been suspected in declines of ground-nesting songbirds in grazed grassland, primarily due to increased trampling...

  14. Development of species-specific primers for rapid identification of Debaryomyces hansenii.

    PubMed

    Wrent, Petra; Rivas, Eva-María; Gil de Prado, Elena; Peinado, José M; de Silóniz, María-Isabel

    2015-01-16

    In this work, we developed a specific PCR assay for Debaryomyces hansenii strains that uses a putative homologous PAD1 region (729 bp) present in this yeast species as a target. The amplification of this sequence with the D. hansenii specific primer pair (DhPADF/DhPADR) was found to be a rapid, specific and an affordable method enabling identification of D. hansenii from other yeast strains. Primers were tested in almost 100 strains, 49 strains from Type Culture Collection belonging to the genus Debaryomyces and to other yeast species commonly found in foods or related genera. These primers were able to discriminate between closely related species of Debaryomyces, such as Debaryomyces fabryi and Debaryomyces subglobosus, with a 100% detection rate for D. hansenii. Also, the method was tested in 45 strains from different foods. Results confirmed the specificity of the PCR method and detected two earlier misidentifications of D. hansenii strains obtained by RFLP analysis of the 5.8S ITS rDNA region. Subsequently we confirmed by sequencing the D1/D2 domain of 26S rDNA that these strains belonged to D. fabryi. We call attention in this work to the fact that the RFLPs of the 5.8S ITS rDNA profiles of D. hansenii, D. fabryi and D. subglobosus are the same and this technique will thus lead to incorrect identifications. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Development of genus-specific primers for better understanding the diversity and population structure of Sphingomonas in soils.

    PubMed

    Zhou, Lisha; Li, Hui; Zhang, Ying; Han, Siqin; Xu, Hui

    2014-08-01

    Genus Sphingomonas has received increasing attentions due to its somewhat unique metabolic versatilities in the contaminated environment. However, due to the lack of genus-specific primers, the ecological significance of Sphingomonas in polluted soils has been rarely documented by 16S rDNA finger-printing methods. In this study, three genus-specific primer sets targeted at the 16S rRNA gene of Sphingomonas were developed and their specificities were tested with four contaminated soils from Shenfu petroleum-wastewater irrigation zone by constructing clone libraries, amplified ribosomal DNA restriction analysis (ARDRA) and sequencing the represented ARDRA patterns. Meanwhile, the newly designed primer sets and a previously reported primer set were compared, and the results showed that the newly developed primer set SA/429f-933r could detect a larger spectrum (90%) of Sphingomonas strains with higher specificity. Despite the superiority of primer set SA/429f-933r in specifically detecting Sphingomonas from contaminated soils, we cannot blink the fact that different primer sets preferentially amplified different dominant species. Therefore, two or more primer sets are recommended for evaluating the diversity and population structure of genus Sphingomonas. Additionally, a proportion (9.7%) of the cloned sequences discovered in this study were different from known Sphingomonas sequences, suggesting that new Sphingomonas sequences might present in soils from Shenfu irrigation zone.

  16. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    USDA-ARS?s Scientific Manuscript database

    The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the id...

  17. Design of allele-specific primers and detection of the human ABO genotyping to avoid the pseudopositive problem.

    PubMed

    Yaku, Hidenobu; Yukimasa, Tetsuo; Nakano, Shu-ichi; Sugimoto, Naoki; Oka, Hiroaki

    2008-11-01

    PCR experiments using DNA primers forming mismatch pairing with template lambda DNA at the 3' end were carried out in order to develop allele-specific primers capable of detecting SNP in genomes without generating pseudopositive amplification products, and thus avoiding the so-called pseudopositive problem. Detectable amounts of PCR products were obtained when primers forming a single or two mismatch pairings at the 3' end were used. In particular, 3' terminal A/C or T/C (primer/template) mismatches tended to allow PCR amplification to proceed, resulting in pseudopositive results in many cases. While less PCR product was observed for primers forming three terminal mismatch pairings, target DNA sequences were efficiently amplified by primers forming two mismatch pairings next to the terminal G/C base pairing. These results indicate that selecting a primer having a 3' terminal nucleotide that recognizes the SNP nucleotide and the next two nucleotides that form mismatch pairings with the template sequence can be used as an allele-specific primer that eliminates the pseudopositive problem. Trials with the human ABO genes demonstrated that this primer design is also useful for detecting a single base pair difference in gene sequences with a signal-to-noise ratio of at least 45.

  18. Species-specific variation in nesting and postfledging resource selection for two forest breeding migrant songbirds.

    PubMed

    Jenkins, Julianna M A; Thompson, Frank R; Faaborg, John

    2017-01-01

    Habitat selection is a fundamental component of community ecology, population ecology, and evolutionary biology and can be especially important to species with complex annual habitat requirements, such as migratory birds. Resource preferences on the breeding grounds may change during the postfledging period for migrant songbirds, however, the degree to which selection changes, timing of change, and whether all or only a few species alter their resource use is unclear. We compared resource selection for nest sites and resource selection by postfledging juvenile ovenbirds (Seiurus aurocapilla) and Acadian flycatchers (Empidonax virescens) followed with radio telemetry in Missouri mature forest fragments from 2012-2015. We used Bayesian discrete choice modeling to evaluate support for local vegetation characteristics on the probability of selection for nest sites and locations utilized by different ages of postfledging juveniles. Patterns of resource selection variation were species-specific. Resource selection models indicated that Acadian flycatcher habitat selection criteria were similar for nesting and dependent postfledging juveniles and selection criteria diverged when juveniles became independent from adults. After independence, flycatcher resource selection was more associated with understory foliage density. Ovenbirds differed in selection criteria between the nesting and postfledging periods. Fledgling ovenbirds selected areas with higher densities of understory structure compared to nest sites, and the effect of foliage density on selection increased as juveniles aged and gained independence. The differences observed between two sympatric forest nesting species, in both the timing and degree of change in resource selection criteria over the course of the breeding season, illustrates the importance of considering species-specific traits and postfledging requirements when developing conservation efforts, especially when foraging guilds or prey bases differ

  19. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    PubMed

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  20. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers.

    PubMed

    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan; Ro, Hyeon-Su

    2013-12-01

    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens.

  1. Group-specific primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents.

    PubMed

    Kuusk, A K; Agustí, N

    2008-05-01

    Group-specific, degenerate polymerase chain reaction primers for DNA-based detection of springtails (Hexapoda: Collembola) within predator gut contents have been developed for the first time. Primers were designed from 18S rDNA and amplified fragments of 272 bp and 177 bp from 17 springtail species collected in agricultural habitats. Specificity tests against 41 nontarget species revealed no cross-reactivity. Group-specific polymerase chain reaction is advantageous when working in species-rich habitats and these primers could facilitate studies of trophic links between springtails and generalist arthropod predators worldwide.

  2. Development of a Semi-nested PCR-Based Method for Specific and Rapid Detection of Alternaria solani Causing Potato Early Blight in Soil.

    PubMed

    Gu, Qing; Yang, Zhi-Hui; Zhao, Dong-Mei; Zhang, Dai; Wang, Qian; Ma, Li-Song; Zhu, Jie-Hua

    2017-09-01

    Early blight, caused by Alternaria solani, is one of the most devastating diseases of potato that causes severe yield loss worldwide. The infected potato debris existed in the soil serve as the initial infection sources for the next growing potato. Current identification of A. solani in soil relies primarily on cultural and morphological characteristics, which are time-consuming and inaccurate. In this study, a semi-nested PCR method was developed using primers based on internal transcribed spacer region that is specific to A. solani. 20 isolates including 6 Alternaria species and 10 other species of common potato pathogens were used to examine the specificity of the primers. The primer set ptAsQ-F/ptAs-R was highly specific to A. solani, as a product of 251 bp was amplified only from A. solani isolates and no amplification signal was observed from other tested species. The sensitivity of this method determined using A. solani genomic DNA was 10 fg. This PCR assay was also successfully employed to detect A. solani in soil with the detection sensitivity of one conidia spore in 0.5 g of soil. To the best of our knowledge, this is the first report of molecular detection of A. solani in soil, which provides a useful tool for early and rapid detection of early blight in soil before next growing season.

  3. Degenerate PCR primer design for the specific identification of rhinovirus C.

    PubMed

    Nam, Young Ran; Lee, Uk; Choi, Han Seok; Lee, Kyoung Jin; Kim, Nari; Jang, Yong Ju; Joo, Chul Hyun

    2015-03-01

    Human rhinovirus (HRV)-A and -B is a common cause of upper respiratory tract infections. Recently, a third species, HRV-C, was categorized based on molecular typing studies. The results showed that the HRV-C genome had diverged from that of HRV-A and -B. Despite its late identification, increasing evidence suggests that HRV-C causes more severe pathogenic infections than HRV-A or -B; however, a large amount of epidemiological data is required to confirm this association in different clinical settings. Consequently, a simple and rapid method for identifying HRV-C is required to expedite such epidemiological studies. Here, two degenerate primer sets (HEV and HRVC) were designed based on bioinformatic analyses. The HEV set targeting the fifth IRES domain sequence within the 5'-UTR, which is highly conserved among enteroviruses, was designed to detect all enteroviruses, whereas the HRVC set, which targeted the VP2 coding region, was designed to detect HRV-C alone. Both primer sets were tested against a panel of standard enteroviruses and clinical lavage samples. HEV detected all enteroviruses tested whereas HRVC was specific for HRV-C. Although the primer design strategy was confirmed with a limited number of samples, extensive tests are required to be applied in clinical settings.

  4. Approach to Analyze the Diversity of Myxobacteria in Soil by Semi-Nested PCR-Denaturing Gradient Gel Electrophoresis (DGGE) Based on Taxon-Specific Gene

    PubMed Central

    Li, Baiyuan; Yao, Qing; Zhu, Honghui

    2014-01-01

    The genotypic diversity of insoluble macromolecules degraded myxobacteria, provided an opportunity to discover new bacterial resources and find new ecological functions. In this study, we developed a semi-nested-PCR-denaturing gradient gel electrophoresis (DGGE) strategy to determine the presence and genotypic diversity of myxobacteria in soil. After two rounds of PCR with myxobacteria-specific primers, an 194 bp fragment of mglA, a key gene involved in gliding motility, suitable for DGGE was obtained. A large number of bands were observed in DGGE patterns, indicating diverse myxobacteria inhabiting in soils. Furthermore, sequencing and BLAST revealed that most of the bands belonged to the myxobacteria-group, and only three of the twenty-eight bands belonged to other group, i.e., Deinococcus maricopensis. The results verified that myxobacterial strains with discrepant sequence compositions of gene mglA could be discriminated by DGGE with myxobacteria-specific primers. Collectively, the developed semi-nested-PCR-DGGE strategy is a useful tool for studying the diversity of myxobacteria. PMID:25280065

  5. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    PubMed

    O'Halloran, Damien M

    2016-02-08

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction.

  6. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  7. RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers

    PubMed Central

    2011-01-01

    Background The polymerase chain reaction (PCR) is commonly used to detect the presence of nucleic acid sequences both in research and diagnostic settings. While high specificity is often achieved, biological requirements sometimes necessitate that primers are placed in suboptimal locations which lead to problems with the formation of primer dimers and/or misamplification of homologous sequences. Results Pyrococcus abyssi (P.a.) RNase H2 was used to enable PCR to be performed using blocked primers containing a single ribonucleotide residue which are activated via cleavage by the enzyme (rhPCR). Cleavage occurs 5'-to the RNA base following primer hybridization to the target DNA. The requirement of the primer to first hybridize with the target sequence to gain activity eliminates the formation of primer-dimers and greatly reduces misamplification of closely related sequences. Mismatches near the scissile linkage decrease the efficiency of cleavage by RNase H2, further increasing the specificity of the assay. When applied to the detection of single nucleotide polymorphisms (SNPs), rhPCR was found to be far more sensitive than standard allele-specific PCR. In general, the best discrimination occurs when the mismatch is placed at the RNA:DNA base pair. Conclusion rhPCR eliminates the formation of primer dimers and markedly improves the specificity of PCR with respect to off-target amplification. These advantages of the assay should find utility in challenging qPCR applications such as genotyping, high level multiplex assays and rare allele detection. PMID:21831278

  8. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    PubMed

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding.

  9. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    PubMed Central

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  10. [Molecular identification of Mentha haplocalyx and Mentha spicata with specific primers multi-PCR system].

    PubMed

    Cao, Liang; Qin, Shuang-shuang; Yuan, Yuan; Zhu, Xiao-qi

    2014-01-01

    To screen specific SNPs loci of Mentha haplocalyx and Mentha spicata,and then specific primers were designed to identify the two species and their mixture rapidly. PsbA-trnH sequences of Mentha haplocalyx and Mentha spicata were obtained by PCR product sequencing and downloading from GenBank. SNPs in the psbA-trnH sequences of Mentha haplocalyx and Mentha spicata were found by ClustulW program and Bioedit software. Primers for authentication of the two species were designed according to the SNP loci, and PCR reaction system was optimized to identify the original plants. Multi-PCR reaction system was constructed. The 181 bp identification band for Mentha haplocalyx or(and) 288 bp identification band for Mentha spicata could be produced by a single PCR reaction,which showed good identification ability to the two species. The multi-PCR reaction system can be applied to identify Mentha haplocalyx and Mentha spicata as well as their mixture.

  11. Comparative Evaluation of Four Bacteria-Specific Primer Pairs for 16S rRNA Gene Surveys

    PubMed Central

    Thijs, Sofie; Op De Beeck, Michiel; Beckers, Bram; Truyens, Sascha; Stevens, Vincent; Van Hamme, Jonathan D.; Weyens, Nele; Vangronsveld, Jaco

    2017-01-01

    Bacterial taxonomic community analyses using PCR-amplification of the 16S rRNA gene and high-throughput sequencing has become a cornerstone in microbiology research. To reliably detect the members, or operational taxonomic units (OTUs), that make up bacterial communities, taxonomic surveys rely on the use of the most informative PCR primers to amplify the broad range of phylotypes present in up-to-date reference databases. However, primers specific for the domain Bacteria were often developed some time ago against database versions that are now out of date. Here we evaluated the performance of four bacterial primers for characterizing complex microbial communities in explosives contaminated and non-contaminated forest soil and by in silico evaluation against the current SILVA123 database. Primer pair 341f/785r produced the highest number of bacterial OTUs, phylogenetic richness, Shannon diversity, low non-specificity and most reproducible results, followed by 967f/1391r and 799f/1193r. Primer pair 68f/518r showed overall low coverage and a bias toward Alphaproteobacteria. In silico, primer pair 341f/785r showed the highest coverage of the domain Bacteria (96.1%) with no obvious bias toward the majority of bacterial species. This suggests the high utility of primer pair 341f/785r for soil and plant-associated bacterial microbiome studies. PMID:28400755

  12. Generation of polymerase chain reaction-specific probes for library screening using single degenerate primers.

    PubMed

    Hommes, N G; Arp, D J; Sayavedra-Soto, L A

    1995-03-01

    Degenerate oligonucleotide primers were made to peptide sequences from hydroxylamine oxidoreductase (HAO) from Nitrosomonas europaea. The primers were used singly in PCR reactions to amplify portions of the gene for HAO from genomic DNA. Southern hybridizations using fragments amplified with each primer showed that they labeled the same genomic DNA fragments. The PCR-amplified fragments were successfully used to screen a gene library for clones containing the HAO gene. The method of isolating genes by PCR with single primers has general utility.

  13. Mining of novel species-specific primers for PCR detection of Listeria monocytogenes based on genomic approach.

    PubMed

    Tao, Tingting; Chen, Qiming; Bie, Xiaomei; Lu, Fengxia; Lu, Zhaoxin

    2015-12-01

    Listeria monocytogenes in contaminated food is considered as a serious health threat for consumers due to its high mortality rate. The objective of this study was to obtain novel species-specific target-genes and primers for the molecular detection of L. monocytogenes using a comparative genomic approach. By comparative analysis of L. monocytogenes and non-L. monocytogenes genome sequences in the GenBank database with BLAST program, 26 specific target sequences were used as candidates and the primers were designed for L. monocytogenes species-specificity verification by using PCR assay. Finally, the three genes LMOf2365_0970, LMOf2365_2721 and mpl were identified to have L. monocytogenes species-specificity and be unique as detection targets for diagnostic application. The species-specific primer Lm8 of gene LMOf2365_0970, Lm13 of gene LMOf2365_2721 and Lm20 of gene mpl showed better specificity and sensitivity than the primers described previously. The PCR detection limits of the three specific primer sets were 430, 43, 4.3 fg/μL for genomic DNA, and 5 × 10(3), 50, 5 cfu/mL for pure culture of L. monocytogenes. There was no interference in specificity of detecting L. monocytogenes by co-culture with other foodborne pathogens in high concentration. Moreover, after 6-8 h of enrichment, L. monocytogenes in the artificially contaminated milk samples at an inoculum dose of 38 cfu/10 mL milk could be detected successfully with the studied three primers. Therefore, the three specific genes and primers can be applied to establish a novel rapid and accurate method for detecting L. monocytogenes in food materials.

  14. Nest success, cause-specific nest failure, and hatchability of aquatic birds at selenium-contaminated Kesterson Reservoir and a reference site

    USGS Publications Warehouse

    Ohlendorf, Harry M.; Hothem, Roger L.; Welsh, Daniel

    1989-01-01

    During 1983-1985, we studied the reproductive success of several species of aquatic birds (coots, ducks, shorebirds, and grebes) nesting at two sites in Merced County, California: a selenium-contaminated site (Kesterson Reservoir) and a nearby reference site (Volta Wildlife Area). We used a computer program (MICROMORT) developed for the analysis of radiotelemetry data (Heisey and Fuller 1985) to estimate nest success and cause-specific failure rates, and then compared these parameters and hatchability between sites and among years. Nest success and causes of failure varied by species, site, and year. The most important causes of nest failure were usually predation, desertion, and water-level changes. However, embryotoxicosis (mortality, deformity, and lack of embryonic development) was the most important cause of nest failure in Eared Grebes (Podiceps nigricollis) at Kesterson Reservoir. Embryotoxicosis also reduced the hatchability of eggs of all other species at Kesterson in one or more years; embryonic mortality occurred rarely at Volta, and abnormalities were not observed.

  15. [A method using long primers for cloning the upstream sequence of delta-6 fatty acid desaturases gene of Thamnidium elegans by nested inverse PCR].

    PubMed

    Wang, De-Pei; Sun, Wei; Li, Ming-Chun; Wei, Dong-Sheng; Zhang, Ying-Hui; Xing, Lai-Jun

    2006-07-01

    Thamnidium elegans is a kind of phycomycete that produces essential unsaturated fatty acids, particularly y-linolenic acid. In this process, delta6-Fatty acid desaturase (D6D) plays a key role due to its enzymatic properties that catalyze the delta6 site dehydrogenation of precursor linoleic acid (18:2delta(9, 12) n-6) and a-linolenic acid (18:3delta(9, 12, 15) n-3). This reaction is the first and rate-limiting step of highly unsaturated fatty acids (HUFA) synthesis pathways. After we have isolated and cloned the gene coding delta6-fatty acid desaturase from Thamnidium elegans As3.2806 (GenBank accession number DQ099380), our interest focuses on the promotion and regulation of the gene transcription. To achieve this aim, we designed long primers and used nested inverse PCR to amplify DNA flanking sequences. First, genome of Thamnidium elegans was extracted and digested with restriction enzymes EcoR I and Kpn I , respectively. Then we ligated the digested DNA with T4 ligase at low concentration which is propitious for linear DNA to joint intromolecule. According to the sequence of delta6-fatty acid desaturase gene of Thamnidium elegans, we designed a couple of 35nt long inverse primers and two couples of shorter inverse primers for inverse PCR. Three rounds of PCR reactions were performed. In the primary reaction, the ligated DNA was used as a template, and the product was used as the template of the secondary reaction, the tertiary reaction was achieved in the same way. After all the three rounds of reactions, we got a nice product about 4 kb from the EcoR I digested sample, in which a 1.3kb 5' upstream sequence (GenBank accession number DQ309425) of delta6-fatty acid desaturase gene containing several putative regulatory elements including TATA. box, FSE-2, AP-1 sites, CCAAT cis-element site and STRE-binding site was derived after sequencing. All of these implied intensely that this 1.3kb fragment is a condition-regulated promoter. It is the first report about

  16. Environmental distribution of two widespread uncultured freshwater Euryarchaeota clades unveiled by specific primers and quantitative PCR.

    PubMed

    Restrepo-Ortiz, Claudia X; Casamayor, Emilio O

    2013-12-01

    Quantitative environmental distribution of two widely distributed uncultured freshwater Euryarchaeota with unknown functional role was explored by newly designed quantitative PCR primers targeting the 16S rRNA gene of clades Miscellaneous Euryarchaeota Group (MEG, containing the groups pMC2A384 and VALII/Eury4) and Deep-Sea Euryarchaeotal Groups (DSEG, targeting the cluster named VALIII containing the DHVE-3/DSEG, BC07-2A-27/DSEG-3 and DSEG-2 groups), respectively. The summer surface plankton of 28 lakes was analysed, and one additional dimictic deep alpine lake, Lake Redon, was temporally and vertically surveyed covering seasonal limnological variability. A trophic range between 0.2 and 5.2 μg l(-1) Chl a, and pH span from 3.8 to 9.5 was explored at altitudes between 632 and 2590 m above sea level. The primers showed to be highly selective with c. 85% coverage and 100% specificity. Only pH significantly explained the changes observed in gene abundances and environment. In Lake Redon, DSEG bloomed in deep stratified waters both in summer and early spring, and MEG at intermediate depths during the ice-cover period. Overall, MEG and DSEG showed a differential ecological distribution although correlational analyses indicated lack of coupling of both Euryarchaeota with phytoplankton (chlorophyll a). However, an intriguing positive and significant relationship was found between DSEG and putative ammonia oxidizing thaumarchaeota.

  17. Time-specific patterns of nest survival for ducks and passerines breeding in North Dakota

    USGS Publications Warehouse

    Shaffer, Terry L.; Grant, Todd A.

    2012-01-01

    In many bird species, survival can vary with the age of the nest, with the date a nest was initiated, or among years within the same nesting area. A literature review showed that patterns of survival vary in relation to nest age and date and are often contradictory. Inconsistencies could be a result of temporal variation in the environment or life-history differences among species. We examined patterns of nest survival in relation to nest age, date, and year for several duck and passerine species nesting at a single location in North Dakota during 1998–2003. We predicted that if environment shaped nest survival patterns, then temporal patterns in survival might be similar among three species of upland nesting ducks, and also among three species of grassland passerines nesting at the same site. We expected that survival patterns would differ between ducks and passerines because of relatively disparate life histories and differences in predators that prey on their nests. Nest survival was rarely constant among years, seasonally, or with age of the nest for species that we studied. As predicted, the pattern of survival was similar among duck species, driven mainly by differences in nest survival associated with nest initiation date. The pattern of survival also was similar among passerine species, but nest survival was more influenced by nest age than by date. Our findings suggest that some but not all variation in temporal patterns of nest survival in grassland birds reported in the literature can be explained on the basis of temporal environmental variation. Because patterns of survival were dissimilar among ducks and passerines, it is likely that mechanisms such as predation or brood parasitism have variable influences on productivity of ducks and passerines nesting in the same area. Our results indicate that biologists and managers should not assume that temporal environmental variations, especially factors that affect nest survival, act similarly on all

  18. Determination of ABO genotypes by real-time PCR using allele-specific primers.

    PubMed

    Muro, Tomonori; Fujihara, Junko; Imamura, Shinji; Nakamura, Hiroaki; Kimura-Kataoka, Kaori; Toga, Tomoko; Iida, Reiko; Yasuda, Toshihiro; Takeshita, Haruo

    2012-01-01

    ABO grouping of biological specimens is informative for identifying victims and narrowing down suspects. In Japan and elsewhere, ABO grouping as well as DNA profiling plays an essential role in crime investigations. In the present study, we developed a new method for ABO genotyping using allele-specific primers and real-time PCR. The method allows for the detection of three single nucleotide polymorphisms (SNPs) at nucleotide positions 261, 796, and 803 in the ABO gene and the determination of six major ABO genotypes. This method required less than 2 h for accurate ABO genotyping using 2.0 ng of DNA. This method could be applicable for rapid and simple screening of forensic samples.

  19. Identification of Mycobacterium bovis in bovine clinical samples by PCR species-specific primers.

    PubMed Central

    Romero, R E; Garzón, D L; Mejía, G A; Monroy, W; Patarroyo, M E; Murillo, L A

    1999-01-01

    Tuberculosis, caused by Mycobacterium bovis is emerging as the most important disease affecting cattle. Furthermore, it results in a major public health problem when transmitted to humans. Due to its difficult and non-specific diagnosis, M. bovis has been declared to be one of the etiologic agents causing significant economic loss in the cattle industry. Our group evaluated a more rapid and specific method, based on a new polymerase chain reaction species-specific primers, which amplifies a 470-base pair fragment of the M. bovis genome. A total of 275 milk-producing cows were studied by intradermal tuberculin test (ITT) which gave 184 positive and 91 negative cases. From them, 50 animals were taken from a cattle ranch free of tuberculosis. Three different samples were collected from each animal (blood, nasal mucus, and milk). Positive results were obtained from 26 animals by PCR (11.4%), 1 by bacteriological culturing (0.4%) and 1 by bacilloscopy (0.4%). This finding suggests, as in previous reports, that ITT, normally used for bovine tuberculosis detection, has the inconvenience of having a broad range of specificity and sensitivity, and the PCR technique is a more specific and sensitive test to detect infection associated with M. bovis. Therefore, we propose this PCR assay as a useful tool in the epidemiological characterization of infected animals in areas considered to be at high risk of transmission. Images Figure 1. PMID:10369566

  20. Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

    PubMed

    Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

    2014-01-01

    Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

  1. Exploiting extension bias in polymerase chain reaction to improve primer specificity in ensembles of nearly identical DNA templates.

    PubMed

    Wright, Erik S; Yilmaz, L Safak; Ram, Sri; Gasser, Jeremy M; Harrington, Gregory W; Noguera, Daniel R

    2014-05-01

    We describe a semi-empirical framework that combines thermodynamic models of primer hybridization with experimentally determined elongation biases introduced by 3'-end mismatches for improving polymerase chain reaction (PCR)-based sequence discrimination. The framework enables rational and automatic design of primers for optimal targeting of one or more sequences in ensembles of nearly identical DNA templates. In situations where optimal targeting is not feasible, the framework accurately predicts non-target sequences that are difficult to distinguish with PCR alone. Based on the synergistic effects of disparate sources of PCR bias, we used our framework to robustly distinguish between two alleles that differ by a single base pair. To demonstrate the applicability to environmental microbiology, we designed primers specific to all recognized archaeal and bacterial genera in the Ribosomal Database Project, and have made these primers available online. We applied these primers experimentally to obtain genus-specific amplification of 16S rRNA genes representing minor constituents of an environmental DNA sample. Our results demonstrate that inherent PCR biases can be reliably employed in an automatic fashion to maximize sequence discrimination and accurately identify potential cross-amplifications. We have made our framework accessible online as a programme for designing primers targeting one group of sequences in a set with many other sequences (http://DECIPHER.cee.wisc.edu). © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

    PubMed

    Gonzales, J L; Loza, A; Chacon, E

    2006-03-15

    There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

  3. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms

    PubMed Central

    David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart

    2017-01-01

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161

  4. GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.

    PubMed

    David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart

    2017-01-04

    GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Human Blastocystis subtyping with subtype-specific primers developed from unique sequences of the SSU rRNA gene.

    PubMed

    Yoshikawa, Hisao; Iwamasa, Ayana

    2016-12-01

    The genus Blastocystis is one of the most genetically diverse parasites. Blastocystis isolates from humans and animals have been classified into subtypes (STs) based on the phylogeny of the small subunit rRNA gene (SSU rDNA). Although human Blastocystis isolates are limited to STs 1-9, the identification of all 9 STs remains challenging due to the lack of specific primers for several STs. The sequencing of partial SSU rDNA is therefore essential for the identification of several STs. In this study, we developed 9 sets of PCR primers to detect each of the 9 kinds of ST in humans. When these ST-specific primer pairs were examined reference Blastocystis for the 9 STs, all 9 amplified only the target ST even in a DNA mixture of all 9 STs. The specificities of the 9 primer sets were tested against several intestinal parasites and fungi found in human stool samples. No amplification with these common human intestinal eukaryotes was observed using the primer pairs for 8 STs, while the ST5 primer set gave only faint bands with some parasites. Since genomic DNA levels of these parasites extracted from Blastocystis-positive cultures are expected to be markedly lower than the pure or highly concentrated DNA samples tested, the cross-amplifications with these organisms are unlikely to be detected when DNA samples are extracted from Blastocystis-positive cultures. The PCR conditions for all 9 primer sets were the same, hence a one-step analysis by PCR amplification, followed by electrophoresis has potential as a simple tool for the subtyping of human Blastocystis isolates.

  6. Rapid Plant Identification Using Species- and Group-Specific Primers Targeting Chloroplast DNA

    PubMed Central

    Staudacher, Karin; Schallhart, Nikolaus; Mitterrutzner, Evi; Steiner, Eva-Maria; Thalinger, Bettina; Traugott, Michael

    2012-01-01

    Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae), the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory. PMID:22253728

  7. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    PubMed

    Wallinger, Corinna; Juen, Anita; Staudacher, Karin; Schallhart, Nikolaus; Mitterrutzner, Evi; Steiner, Eva-Maria; Thalinger, Bettina; Traugott, Michael

    2012-01-01

    Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae), the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  8. Controlled hot start and improved specificity in carrying out PCR utilizing touch-up and loop incorporated primers (TULIPS).

    PubMed

    Ailenberg, M; Silverman, M

    2000-11-01

    The PCR technique often yields nonspecific products. To overcome this problem, a simple, specific and efficient method was designed: touch-up and loop incorporated primers (TULIPS)-PCR. This approach utilizes loop primers (i.e., additional nontemplate 5' sequence that self-anneals to the 3' region and inhibits initiation of polymerization). Upon heating of the reaction, the primers melt, initiating hot start. The reaction also uses touch-up pre-cycling with gradual elevation in annealing temperatures to ensure correct pairing. The method has been validated with glyceraldehyde-3-phosphate dehydrogenase (GAPD) primers, and its general applicability is demonstrated by specific amplification of the human gelatinase A transgene from genomic DNA extracted from transgenic mice tails. The TULIPS-PCR protocol is a novel method. The self-annealing primers utilized in this method offer improved specificity and more robust synthesis compared with touch-down and manual hot start PCR. It is performed without the need to open, pause or add to the reaction mixture any nonrectant components, such as wax, antibody or nonspecific dsDNA.

  9. Selection of a set of specific primers for the identification of Tuber rufum: a truffle species with high genetic variability.

    PubMed

    Iotti, Mirco; Amicucci, Antonella; Bonito, Gregory; Bonuso, Enrico; Stocchi, Vilberto; Zambonelli, Alessandra

    2007-12-01

    Tuber rufum is a truffle widely distributed throughout Europe, which forms mycorrhizal associations with numerous species of broadleaf and coniferous trees. The possibility of T. rufum contamination in commercial truffle-infected plants makes its detection important. To facilitate the identification of T. rufum from mycorrhiza and fruitbodies, species-specific primers were designed and tested. To overcome the high intraspecific genetic variability within the internal transcribed spacer (ITS) regions of T. rufum, as demonstrated by phylogenetic analysis, two forward primers, Ru1f and Ru2f, located on the ITS1 region were designed to be used in concert with the reverse primer ITS4. Only T. rufum was amplified with this primer combination, while DNA of Tuber magnatum, Tuber brumale, Tuber maculatum, Tuber borchii, Tuber excavatum and Tuber melanosporum was not. These primers give a specific amplicon ranging between 566 and 572 bp and are able to discriminate between T. rufum, T. borchii and T. magnatum in multiplex PCR. In addition, T. rufum-specific amplicons were obtained from both spore suspensions and mycorrhiza by direct PCR. Tuber rufum mycorrhiza obtained in the greenhouse using mycelial inoculation techniques had morphological features similar to those of other species of Tuber, stressing the importance of molecular tools for their identification.

  10. Detection of Clostridium tetani in human clinical samples using tetX specific primers targeting the neurotoxin.

    PubMed

    Ganesh, Madhu; Sheikh, Nasira K; Shah, Pooja; Mehetre, Gajanan; Dharne, Mahesh S; Nagoba, Basavraj S

    2016-01-01

    Tetanus resulting from ear injury remains an important health problem, particularly in the developing world. We report the successful detection of Clostridium tetani using tetX specific primers targeting the Cl. tetani neurotoxin. The sample was obtained from an ear discharge of a case of otogenic tetanus in a 2-year-old male child. Based on the culture results of the ear discharge, Gram staining and virulence testing by genotyping, a diagnosis of tetanus was confirmed. This is the first report from India on the successful detection of Cl. tetani in a human clinical sample using tetX specific primers targeting the Cl. tetani neurotoxin.

  11. Hypervariable spacer regions are good sites for developing specific PCR-RFLP markers and PCR primers for screening actinorhizal symbionts.

    PubMed

    Varehese, Rajani; Chauhan, Vineeta S; Misra, Arvind K

    2003-06-01

    While the ribosomal RNA like highly conserved genes are good molecular chronometers for establishing phylogenetic relationships, they can also be useful in securing the amplification of adjoining hyper-variable regions. These regions can then be used for developing specific PCR primers or PCR-RFL profiles to be used as molecular markers. We report here the use of ITS region of rrn operon of Frankia for developing PCR-RFL profiles capable of discriminating between closely related frankiae. We have also made use of the ITS1 region of the nuclear rrn operon of Alnus nepalensis (D Don) for designing a PCR primer for specific amplification of nuclear DNA of this tree.

  12. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  13. Characterization of the 18S rRNA gene for designing universal eukaryote specific primers.

    PubMed

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M; Troedsson, Christofer

    2014-01-01

    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies.

  14. Robust Detection of Rare Species Using Environmental DNA: The Importance of Primer Specificity

    PubMed Central

    Wilcox, Taylor M.; McKelvey, Kevin S.; Young, Michael K.; Jane, Stephen F.; Lowe, Winsor H.; Whiteley, Andrew R.; Schwartz, Michael K.

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method’s sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design. PMID:23555689

  15. Robust detection of rare species using environmental DNA: the importance of primer specificity.

    PubMed

    Wilcox, Taylor M; McKelvey, Kevin S; Young, Michael K; Jane, Stephen F; Lowe, Winsor H; Whiteley, Andrew R; Schwartz, Michael K

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probe-based chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence of closely related, sympatric taxa. If related species cause any cross-amplification or interference, false positives and negatives may be generated. These errors can be disastrous if false positives lead to overestimate the abundance of an endangered species or if false negatives prevent detection of an invasive species. In this study we test factors that influence the specificity and sensitivity of TaqMan MGB assays using co-occurring, closely related brook trout (Salvelinus fontinalis) and bull trout (S. confluentus) as a case study. We found qPCR to be substantially more sensitive than traditional PCR, with a high probability of detection at concentrations as low as 0.5 target copies/µl. We also found that number and placement of base pair mismatches between the Taqman MGB assay and non-target templates was important to target specificity, and that specificity was most influenced by base pair mismatches in the primers, rather than in the probe. We found that insufficient specificity can result in both false positive and false negative results, particularly in the presence of abundant related species. Our results highlight the utility of qPCR as a highly sensitive eDNA tool, and underscore the importance of careful assay design.

  16. Detection of Proteobacteria from the rumen by PCR using methanotroph-specific primers.

    PubMed

    Mitsumori, M; Ajisaka, N; Tajima, K; Kajikawa, H; Kurihara, M

    2002-01-01

    To detect Proteobacteria, including methanotrophs, from the rumen fluid and the bacteria inhabiting the rumen epithelium. Proteobacteria inhabiting the rumen were detected by PCR using methanotroph-specific primers. The detected Proteobacteria were divided into clusters A, B, and C in addition to one clone, which was distinct from the clusters and closely related to Nitrosomonas sp. The clusters A, B, and C were close to Succinivibrio dextrinosolvens, Enterobacter cloacae, and Actinobacillus minor, respectively. The clones obtained from the rumen fluid each belonged to cluster A or B. The clones obtained from the rumen epithelium belonged to cluster B or C or to Nitrosomonas sp. It has been assumed that the rumen fluid and the rumen epithelium host different populations of Proteobacteria. Moreover, detection of Nitrosomonas from the rumen epithelium would indicate the possibility that the bacterium oxidizes ammonia and methane on the rumen surface. These findings suggest that the rumen fluid and the epithelium support different microbial populations, which would play specific roles in rumen function. Future study should focus on the relationship between these communities and physiological functions in the rumen.

  17. AmoA-Targeted Polymerase Chain Reaction Primers for the Specific Detection and Quantification of Comammox Nitrospira in the Environment

    PubMed Central

    Pjevac, Petra; Schauberger, Clemens; Poghosyan, Lianna; Herbold, Craig W.; van Kessel, Maartje A. H. J.; Daebeler, Anne; Steinberger, Michaela; Jetten, Mike S. M.; Lücker, Sebastian; Wagner, Michael; Daims, Holger

    2017-01-01

    Nitrification, the oxidation of ammonia via nitrite to nitrate, has always been considered to be catalyzed by the concerted activity of ammonia- and nitrite-oxidizing microorganisms. Only recently, complete ammonia oxidizers (“comammox”), which oxidize ammonia to nitrate on their own, were identified in the bacterial genus Nitrospira, previously assumed to contain only canonical nitrite oxidizers. Nitrospira are widespread in nature, but for assessments of the distribution and functional importance of comammox Nitrospira in ecosystems, cultivation-independent tools to distinguish comammox from strictly nitrite-oxidizing Nitrospira are required. Here we developed new PCR primer sets that specifically target the amoA genes coding for subunit A of the distinct ammonia monooxygenase of comammox Nitrospira. While existing primers capture only a fraction of the known comammox amoA diversity, the new primer sets cover as much as 95% of the comammox amoA clade A and 92% of the clade B sequences in a reference database containing 326 comammox amoA genes with sequence information at the primer binding sites. Application of the primers to 13 samples from engineered systems (a groundwater well, drinking water treatment and wastewater treatment plants) and other habitats (rice paddy and forest soils, rice rhizosphere, brackish lake sediment and freshwater biofilm) detected comammox Nitrospira in all samples and revealed a considerable diversity of comammox in most habitats. Excellent primer specificity for comammox amoA was achieved by avoiding the use of highly degenerate primer preparations and by using equimolar mixtures of oligonucleotides that match existing comammox amoA genes. Quantitative PCR with these equimolar primer mixtures was highly sensitive and specific, and enabled the efficient quantification of clade A and clade B comammox amoA gene copy numbers in environmental samples. The measured relative abundances of comammox Nitrospira, compared to canonical

  18. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    PubMed

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases.

  19. Single nucleotide polymorphism genotyping by mini-primer allele-specific amplification with universal reporter primers for identification of degraded DNA.

    PubMed

    Asari, Masaru; Watanabe, Satoshi; Matsubara, Kazuo; Shiono, Hiroshi; Shimizu, Keiko

    2009-03-01

    Single nucleotide polymorphism (SNP) is informative for human identification, and much shorter regions are targeted in analysis of biallelic SNP compared with highly polymorphic short tandem repeat (STR). Therefore, SNP genotyping is expected to be more sensitive than STR genotyping of degraded human DNA. To achieve simple, economical, and sensitive SNP genotyping for identification of degraded human DNA, we developed 18 loci for a SNP genotyping technique based on the mini-primer allele-specific amplification (ASA) combined with universal reporter primers (URP). The URP/ASA-based genotyping consisted of two amplifications followed by detection using capillary electrophoresis. The sizes of the target genome fragments ranged from 40 to 67bp in length. In the Japanese population, the frequencies of minor alleles of 18 SNPs ranged from 0.36 to 0.50, and these SNPs are informative for identification. The success rate of SNP genotyping was much higher than that of STR genotyping of artificially degraded DNA. Moreover, we applied this genotyping method to case samples and showed successful SNP genotyping of severely degraded DNA from a 4-year buffered formalin-fixed tissue sample for human identification.

  20. Group-specific PCR primers for the phylum Acidobacteria designed based on the comparative analysis of 16S rRNA gene sequences.

    PubMed

    Lee, Sang-Hoon; Cho, Jae-Chang

    2011-08-01

    We performed a comprehensive phylogenetic analysis of the phylum Acidobacteria and developed novel, group-specific PCR primers for Acidobacteria and its class-level subgroups. Acidobacterial 16S rRNA gene sequences deposited in the RDP database were used to construct a local database then subsequently analyzed. A total of 556 phylotypes were observed and the majority of the phylotypes belonged to five major subgroups (subgroups 1, 2, 3, 4, and 6), which comprised >80% of the acidobacterial sequences in the RDP database. Phylum-specific and subgroup-specific primers were designed from the consensus sequences of the phylotype sequences, and the specificities of the designed primers were evaluated both in silico and empirically for coverage and tolerance. The phylum-specific primer ACIDO, which was designed in this study, showed increased coverage for Acidobacteria, as compared to the previous phylum-specific primer 31F. However, the tolerance of the primer ACIDO for non-target sequences was slightly higher than that of the primer 31F. We also developed subgroup-specific PCR primers for the major subgroups of Acidobacteria, except for subgroup 4. Subgroup-specific primers S1, S2, and S3, which targeted subgroups 1, 2, and 3, respectively, showed high coverage for their target subgroups and low tolerance for non-target sequences. However, the primer S6 targeting subgroup 6 showed a lower specificity in its empirical evaluation than expected from the in silico results. The subgroup-specific primers, as well as the phylum-specific primer designed in this study, will be valuable tools in understanding the phylogenetic diversity and ecological niche of the phylum Acidobacteria and its subgroups.

  1. A novel PCR technique using Alu-specific primers to identify unknown flanking sequences from the human genome

    SciTech Connect

    Minami, M.; Poussin, K.; Brechot, C.; Paterlini, P.

    1995-09-20

    The rapid and reproducible identification of new cellular DNA sequences is difficult to achieve with the currently available procedures. Here we describe a novel approach based on the polymerase chain reaction (PCR) using a primer specific to the known sequence and another directed to a human Alu repeat. To avoid undesirable amplifications between Alu sequences, primers are constructed with dUTPs and destroyed by uracil DNA glycosylase treatment after 10 initial cycles of amplification. Only desirable fragments are then further amplified with specific primers to the known region and to a tag sequence introduced in the Alu-specific primer. Using this protocol, we have successfully indentified cellular sequences flanking integrated hepatitis B virus DNA from the human genome of three hepatoma tissues. The method enables a direct specific amplification without any ligation or nonspecific annealing steps as required by previous PCR-based protocols. This rapid and straightforward approach will be a powerful tool for the study of viral integration sites, but is also widely applicable to other studies of the human genome. 39 refs., 4 figs.

  2. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  3. FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS

    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  4. Specific detection of chikungunya virus using a RT-PCR/nested PCR combination.

    PubMed

    Pfeffer, M; Linssen, B; Parke, M D; Kinney, R M

    2002-02-01

    Chikungunya (CHIK) virus is enzootic in many countries in Asia and throughout tropical Africa. In Asia the virus is transmitted from primates to humans almost exclusively by Aedes aegypti, while various aedine mosquito species are responsible for human infections in Africa. The clinical picture is characterized by a sudden onset of fever, rash and severe pain in the joints which may persist in a small proportion of cases. Although not listed as a haemorrhagic fever virus, illness caused by CHIK virus can be confused with diseases such as dengue or yellow fever, based on the similarity of the symptoms. Thus, laboratory confirmation of suspected cases is required to launch control measures during an epidemic. CHIK virus diagnosis based on virus isolation is very sensitive, yet requires at least a week in conjunction with virus identification using monovalent sera. We developed a reverse transcription-polymerase chain reaction (RT-PCR) assay which amplifies a 427-bp fragment of the E2 gene. Specificity was confirmed by testing representative strains of all known alphavirus species. To verify further the viral origin of the amplicon and to enhance sensitivity, a nested PCR was performed subsequently. This RT-PCR/nested PCR combination was able to amplify a CHIK virus-specific 172-bp amplicon from a sample containing as few as 10 genome equivalents. This assay was successfully applied to four CHIK virus isolates from Asia and Africa as well as to a vaccine strain developed by USAMRIID. Our method can be completed in less than two working days and may serve as a sensitive alternative in CHIK virus diagnosis.

  5. Preliminary level 2 specification for the nested, fixed-depth sampling system

    SciTech Connect

    BOGER, R.M.

    1999-02-08

    This preliminary Level 2 Component Specification establishes the performance, design, development, and test requirements for the in-tank sampling system which will support the BNFL contract in the final disposal of Hanford's High Level Wastes (HLW) and Low Activity Wastes (LAW). The PHMC will provide Low Activity Wastes (LAW) tank wastes for final treatment by BNFL from double-shell feed tanks. Concerns about the inability of the baseline ''grab'' sampling to provide large volume samples within time constraints has led to the development of a nested, fixed-depth sampling system. This sampling system will provide large volume? representative samples without the environmental, radiation exposure, and sample volume Impacts of the current base-line ''grab'' sampling method. This preliminary Level 2 Component Specification is not a general specification for tank sampling, but is based on a ''record of decision'', AGA (HNF-SD-TWR-AGA-001 ), the System Specification for the Double Shell Tank System (HNF-SD-WM-TRD-O07), and the BNFL privatization contract.

  6. Age-specific productivity and nest site characteristics of Cooper's hawks (Accipiter cooperii)

    USGS Publications Warehouse

    Moore, K.R.; Henny, C.J.

    1984-01-01

    Nesting Cooper's Hawks (Accipiter cooperii) were studied in northeastern Oregon. Second-year (SY) males did not breed, but 22 percent of the breeding females were SY's. Mean clutch size (P = 0.012) and mean number of young fledged per pair that laid eggs (P < 0.10) were lower for SY females than for adult (after second year [ASY}) females; however, an equal percentage of the eggs (excluding a collected sample egg) yielded fledged young for each age class. Stepwise discriminant analysis suggested differences in structural characteristics of the nest site habitat for ASY and SY females, i.e., SY female nest sites were associated with younger successional stages than ASY female nest sites. Nests of both age groups were built in trees with high crown volume, but ASY females utilized mistletoe (Arceuthobium sp.) for nest structures more frequently (P < 0.01) than SY females.

  7. Specific immunoassays for endocrine disruptor monitoring using recombinant antigens cloned by degenerated primer PCR.

    PubMed

    Ferraz, Natalia; Carnevia, Daniel; Nande, Gonzalo; Rossotti, Martin; Miguez, María N; Last, Jerold A; Gonzalez-Sapienza, Gualberto

    2007-12-01

    Vitellogenin (VTG) and choriogenin (CHO) are valuable biomarkers of endocrine-disrupting compound (EDC) exposure in fish. Existing immunoassays are limited to a few species, which restricts their use for the analysis of local wildlife sentinels. Using C. facetum as a relevant South American model fish, this work presents a new strategy for the preparation of antibodies to VTG and CHO, with zero cross-reactivity with fish serum components. Recombinant fragments of Cichlasoma facetum VTG (280-mer) and CHO (223-mer) were prepared by degenerate primer RT-PCR and expression in E. coli. Polyclonal and monoclonal antibodies prepared with these antigens were used to develop rapid dotblot assays for VTG and CHO. Both the polyclonal and monoclonal antibodies prepared with the recombinant antigens reacted against the native proteins adsorbed on to nitrocellulose allowing the set up of sensitive dotblot assays. The VTG assay was further validated with spiked samples and purified native VTG. Exposure experiments with several estrogenic compounds revealed the potential of C. facetum as a sensitive biomonitor that produced measurable responses at concentrations of 100 ng L(-1) of 17-beta-estradiol, 100 ng L(-1) of ethynylestradiol, and 6.6 microg L(-1) of nonylphenol. The approach described here may be applied to other native species to produce highly specific and sensitive rapid tests. It may be particularly advantageous for species that cannot be kept in captivity or when homogeneous purification of the immunizing proteins is particularly challenging. In conclusion, we present a novel approach to develop a strategy for the generation of immunoassay reagents for vitellogenin (VTG) and choriogenin (CHO), which will facilitate regional studies on the impact of endocrine-disrupting chemicals on local wildlife.

  8. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    PubMed

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  9. Diversity of Methane-Cycling Archaea in Hydrothermal Sediment Investigated by General and Group-Specific PCR Primers

    PubMed Central

    Teske, Andreas P.

    2014-01-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primer pairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group-specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs in detection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group-specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm (∼2 to 40°C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40°C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (≥60°C). While mcrA-based and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature. PMID:25527539

  10. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.

    PubMed

    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin

    2016-07-01

    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.

  11. cry1 genes from Bacillus thuringiensis: specificity determination and implications for primer design.

    PubMed

    Davolos, Camila C; Guidelli-Thuler, Ana M; de Abreu, Irlan L; Sena, Janete A D; Lemos, Manoel V F

    2009-12-01

    Some pest management programs employ PCR to identify cry1 genes from Bacillus thuringiensis to predict bacterial toxicity towards different insect pests. However, due to changes on the mode of action of the Cry proteins, new primers had to be designed to detect the new genes. Therefore, an 'in-silico' study of genetic sequences from five cry1 subclasses was carried out and characterized by molecular tools. The design of new primers allows for more precise selection of B. thuringiensis isolates, helping to better direct the programs employing biological control.

  12. RAPD method useful for distinguishing Leishmania species: design of specific primers for L. braziliensis.

    PubMed

    Martinez, E; Alonso, V; Quispe, A; Thomas, M C; Alonso, R; Piñero, J E; González, A C; Ortega, A; Valladares, B

    2003-12-01

    The technique of Random Amplification Polymorphic DNA allows fragments of the genome to be amplified by means of polymerase chain reaction (PCR) without previous knowledge of their sequences. The protozoa of the genus Leishmania present great genetic variability, making it difficult to characterize the different species. A method is developed with a single 10-mers long primer, which allows the species L. braziliensis, L. mexicana, L. infantum, L. tropica, L. chagasi, L. amazonensis and L. major to be differentiated. These products amplified by RAPD have also facilitated the design of some primers that amplify L. braziliensis DNA exclusively.

  13. Synteny analysis provides a route to design genus-specific PCR primers for rapid identification of all Saccharomyces species.

    PubMed

    Sharpe, Ben; Hulin, Michelle; Thorne-Wallis, James; Wheals, Alan

    2014-05-01

    The genus Saccharomyces comprises seven single-genome species (S. arboricola, S. cerevisiae, S. eubayanus, S. kudriavzevii, S. mikatae, S. paradoxus and S. uvarum) and two hybrid species - S. pastorianus (S. cerevisiae plus S. eubayanus) and S. bayanus (mostly S. uvarum plus S. eubayanus). Species-specific primers have already been developed for the identification of each of the single-genome species, and these primers can usually detect both genomes in hybrids. It would be advantageous if a single reaction could detect any member of the clade. We have investigated three potentially generic approaches to design genus-specific primers. Two methods that both use sequence alignment differences for primer design were only partly successful. A third method used synteny data to identify 136 target genes that are potentially present only in all species of the Saccharomyces clade. HSP30 (YCR021C) was fully successful; different primer pairs were developed with high G+C content for use at 63 °C. In < 3 h, using a robust colony-PCR followed by gel electrophoresis, the method can reliably detect any member of the genus. This novel approach still uses conventional sequence alignment mismatches but relies principally on the presence of the target gene only within the genus Saccharomyces. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  14. A blocking primer increases specificity in environmental DNA detection of bull trout (Salvelinus confluentus)

    Treesearch

    Taylor M. Wilcox; Michael K. Schwartz; Kevin S. McKelvey; Michael K. Young; Winsor H. Lowe

    2014-01-01

    Environmental DNA (eDNA) is increasingly applied as a highly sensitive way to detect aquatic animals non-invasively. However, distinguishing closely related taxa can be particularly challenging. Previous studies of ancient DNA and genetic diet analysis have used blocking primers to enrich target template in the presence of abundant, non-target DNA. Here we apply a...

  15. Specific primers for the detection of the black-yeast fungus associated with lethargic crab disease (LCD).

    PubMed

    Pie, Marcio R; Boeger, Walter A; Patella, Luciana; Vicente, Vânia A; Ribeiro, Raphael O; Ostrensky, Antonio

    2011-03-16

    Lethargic crab disease (LCD) is an emerging infirmity that has been causing extensive mortalities in populations of the mangrove land crab Ucides cordatus (Ocypodidae) along the Atlantic coast of Brazil. Previous studies have indicated that LCD is associated with a dematiaceous fungus, Exophiala cancerae de Hoog et al. In the present study, we sequenced the internal transcribed spacer (ITS) of the rDNA region of this black yeast species and developed species-specific PCR primers. Sensitivity tests indicated that the developed protocol is capable of detecting very small amounts of target DNA. Also, the application of the protocol to a variety of other dematiaceous fungi did not generate any false positives. The specific primers provided in the present study represent an important tool for rapidly surveying a large number of crab individuals, as well as environmental samples. Such knowledge will be instrumental in understanding the epidemiological dynamics of LCD.

  16. Fast DNA-based identification of the black truffle Tuber melanosporum with direct PCR and species-specific primers.

    PubMed

    Bonito, Gregory

    2009-12-01

    Abstract A quick and sensitive DNA-based assay for identifying the black truffle species Tuber melanosporum is presented. Both direct PCR and species-specific primers are used to amplify a phylogenetically informative region of T. melanosporum rDNA. This method was successfully used to screen fresh and frozen T. melanosporum fruitbodies, and could be modified for the molecular detection of other truffle and mushroom species.

  17. Diversity of methane-cycling archaea in hydrothermal sediment investigated by general and group-specific PCR primers.

    PubMed

    Lever, Mark A; Teske, Andreas P

    2015-02-01

    The zonation of anaerobic methane-cycling Archaea in hydrothermal sediment of Guaymas Basin was studied by general primerpairs (mcrI, ME1/ME2, mcrIRD) targeting the alpha subunit of methyl coenzyme M reductase gene (mcrA) and by new group specific mcrA and 16S rRNA gene primer pairs. The mcrIRD primer pair outperformed the other general mcrA primer pairs indetection sensitivity and phylogenetic coverage. Methanotrophic ANME-1 Archaea were the only group detected with group specific primers only. The detection of 14 mcrA lineages surpasses the diversity previously found in this location. Most phylotypes have high sequence similarities to hydrogenotrophs, methylotrophs, and anaerobic methanotrophs previously detected at Guaymas Basin or at hydrothermal vents, cold seeps, and oil reservoirs worldwide. Additionally, five mcrA phylotypes belonging to newly defined lineages are detected. Two of these belong to deeply branching new orders, while the others are new species or genera of Methanopyraceae and Methermicoccaceae. Downcore diversity decreases from all groups detected in the upper 6 cm(2 to 40 °C, sulfate measurable to 4 cm) to only two groups below 6 cm (>40 °C). Despite the presence of hyperthermophilic genera (Methanopyrus, Methanocaldococcus) in cooler surface strata, no genes were detected below 10 cm (>60 °C). While mcrAbased and 16S rRNA gene-based community compositions are generally congruent, the deeply branching mcrA cannot be assigned to specific 16S rRNA gene lineages. Our study indicates that even among well-studied metabolic groups and in previously characterized model environments, major evolutionary branches are overlooked. Detecting these groups by improved molecular biological methods is a crucial first step toward understanding their roles in nature.

  18. The use of real-time PCR and species-specific primers for the identification and monitoring of Paecilomyces lilacinus.

    PubMed

    Atkins, Simon D; Clark, Ian M; Pande, Sonal; Hirsch, Penny R; Kerry, Brian R

    2005-01-01

    The Paecilomyces lilacinus is the most widely tested fungus for the control of root-knot and cyst nematodes. The fungus has also been implicated in a number of human and animal infections, difficulties in diagnosis often result in misdiagnosis or delays in identification leading to a delay in treatment. Here, we report the development of species-specific primers for the identification of P. lilacinus based on sequence information from the ITS gene, and their use in identifying P. lilacinus isolates, including clinical isolates of the fungus. The primer set generated a single PCR fragment of 130 bp in length that was specific to P. lilacinus and was also used to detect the presence of P. lilacinus from soil, roots and nematode eggs. Real-time PCR primers and a TaqMan probe were also developed and provided quantitative data on the population size of the fungus in two field sites. PCR, bait and culture methods were combined to investigate the presence and abundance of the fungus from two field sites in the United Kingdom where potato cyst nematode populations were naturally declining, and results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.

  19. Novel intein-containing DNA specific primers for rapid identification of Candida glabrata using Real-Time PCR assays.

    PubMed

    Kumar, R Satish; Ramesh, S

    2014-12-01

    Candida glabrata is an opportunistic human pathogen known to cause systemic and vaginal candidiasis. Rapid detection of Candida glabrata is indispensable for appropriate selection of antifungal drugs for chemotherapy. The study describes a unique intein-containing DNA fragment for specific detection of C. glabrata. The designed oligonucleotides detected C. glabrata (Ct mean: 24.75 ± 1.1 and Tm: 70.08 ± 0.23°C) in Real-Time PCR assays. The fluorescent signals were negative when the primers were tested for cross-species and cross-genera amplifications. In conclusion, our study recommends a novel primer set for developing a quick identification system which does not require laborious and time-consuming experimentations.

  20. Opisthorchis viverrini and Haplorchis taichui: development of a multiplex PCR assay for their detection and differentiation using specific primers derived from HAT-RAPD.

    PubMed

    Wongsawad, Chalobol; Wongsawad, Pheravut

    2012-10-01

    Specific primers for the detection of Opisthorchis viverrini and Haplorchis taichui were investigated by using the HAT-RAPD PCR method. Fourteen arbitrary primers (Operon Technologies) were performed for the generation of polymorphic DNA profiles. The results showed that a 319 bp fragment generated from the OPA-04 primer was expected to be O. viverrini-specific while a 256 bp fragment generated from the OPP-11 primer was considered to be H. taichui-specific. Based on each sequence data, two pairs of specific primers were designed and sequences of each primer were as follows; H. taichui; Hapt_F5'-GGCCAACGCAATCGTCATCC-3'and Hapt_R1 5'-CTCTCGACCTCCTCTAGAAT-3' which yielded a 170 bp PCR product. For O. viverrini, OpV-1F: 5'-AATCGGGCTGCATATTGACCGAT-3' and OpV-1R: 5'-CGGTGTTGCTTATTTTGCAGACAA-3' which generated a 319 bp PCR product. These specific primers were tested for efficacy and specific detection for all parasites DNA samples. The results showed that 170 and 319 bp specific PCR products were generated as equivalent to positive result in H. taichui and O. viverrini, respectively by having no cross-reaction with any parasites tested. PCR conditions are recommended at 68°C annealing temperature and with 0.5 mM magnesium chloride (Mg Cl(2)). Additionally, specific primers developed in this study were effective to determine the presence of both parasites in fish and snail intermediate hosts, which the DNA of O. viverrini was artificially spiked since it is rarely found in northern Thailand. The H. taichui and O. viverrini-specific primers successfully developed in this study can be use for epidemiological monitoring, preventing management and control programs.

  1. A specific primer pair for the diagnosis and identification of Acanthamoeba astronyxis by random amplified polymorphic DNA-polymerase chain reaction.

    PubMed

    Ortega-Rivas, A; Lorenzo-Morales, J; Martínez, E; Villa, M; Clavel, A; Valladares, B; del Castillo, A

    2005-02-01

    Random amplified polymorphic DNA (RAPD) is a useful tool for species identification. The obtained band patterns can be used for specific primer pair design that is useful for species identification. In this study, a distinctive 485-bp band in Acanthamoeba astronyxis band patterns was found, using the OPC20 primer (ACTTCGCCAC). The band specificity was confirmed by hybridization, using it as a probe, against all OPC20 amplifications from different Acanthamoeba species. Once the fragment was sequenced, we used it to design a specific primer pair that was useful for the identification of different isolates as A. astronyxis species.

  2. Development of Catechol 2,3-Dioxygenase-Specific Primers for Monitoring Bioremediation by Competitive Quantitative PCR

    PubMed Central

    Mesarch, Matthew B.; Nakatsu, Cindy H.; Nies, Loring

    2000-01-01

    Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primers that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 102 to 103 gene copies, which was lowered to 100 to 101 gene copies by hybridization. Using the dioxygenase-specific primers, an increase in catechol 2,3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR with a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2,3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation. PMID:10653735

  3. Retrospective study of central nervous system lesions and association with Parelaphostrongylus species by histology and specific nested polymerase chain reaction in domestic camelids and wild ungulates.

    PubMed

    Dobey, Carrie L; Grunenwald, Caroline; Newman, Shelley J; Muller, Lisa; Gerhold, Richard W

    2014-11-01

    Formalin-fixed, paraffin-embedded tissues from elk (Cervus elaphus), goats, and camelids with case histories and lesions suggestive of Parelaphostrongylus tenuis were examined by histology to characterize lesions that could aid in definitively diagnosing P. tenuis infection. Additionally, sections of paraffin-embedded tissue were used in a nested polymerase chain reaction (nPCR) using Parelaphostrongylus-specific primers to determine how PCR results corresponded with histological findings. Histological changes in brain and spinal cord consisted of linear tracks of hemorrhage; tracks or perivascular accumulations of hemosiderin-laden macrophages; acute foci of axonal degeneration and/or linear glial scars; and perivascular, parenchymal, or meningeal accumulations of eosinophils and/or lymphocytes and plasma cells. Of the 43 samples with histologic lesions consistent with neural larval migrans, 19 were PCR positive; however, only 8 were confirmed Parelaphostrongylus by DNA sequencing. Additionally, 1 goat was identified with a protostrongylid that had a 97% identity to both Parelaphostrongylus odocoilei and a protostrongylid nematode from pampas deer (Ozotoceros bezoarticus celer) from Argentina. None of the histologic lesions individually or in combination correlated statistically to positive molecular tests for the nematode. The results indicate that it is possible to extract Parelaphostrongylus DNA from formalin-fixed, paraffin-embedded tissue, but extended fixation presumably can cause DNA crosslinking. Nested PCR provides another diagnostic tool to identify the cause of neurologic disease in camelids and elk with histologic lesions consistent with neural larval migrans. Furthermore, potential novel protostrongylid DNA was detected from a goat with lesions consistent with P. tenuis infection, suggesting that other neurotropic Parelaphostrongylus species may occur locally.

  4. Development of amplified fragment length polymorphism (AFLP)-derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot.

    PubMed

    Casasnovas, F; Fantini, E N; Palazzini, J M; Giaj-Merlera, G; Chulze, S N; Reynoso, M M; Torres, A M

    2013-06-01

    The objective of this work was to design an amplified fragment length polymorphism (AFLP)-derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot (PBRR) in plant material and soil. Specific primers for the detection of the pathogen were designed based on an amplified region using AFLPs. The banding patterns by AFLPs showed that isolates from diseased roots were clearly distinguishable from others members of the F. solani species complex. Many bands were specific to F. solani PBRR, one of these fragments was selected and sequenced. Sequence obtained was used to develop specific PCR primers for the identification of pathogen in pure culture and in plant material and soil. Primer pair FS1/FS2 amplified a single DNA product of 175 bp. Other fungal isolates occurring in soil, included F. solani non-PBRR, were not detected by these specific primers. The assay was effective for the detection of pathogen from diseased root and infected soils. The designed primers for F. solani causing PBRR can be used in a PCR diagnostic protocol to rapidly and reliably detect and identify this pathogen. These diagnostic PCR primers will aid the detection of F. solani causing PBRR in diseased root and natural infected soils. The method developed could be a helpful tool for epidemiological studies and to avoid the spread of this serious disease in new areas. © 2013 The Society for Applied Microbiology.

  5. PrimerView: high-throughput primer design and visualization.

    PubMed

    O'Halloran, Damien M

    2015-01-01

    High-throughput primer design is routinely performed in a wide number of molecular applications including genotyping specimens using traditional PCR techniques as well as assembly PCR, nested PCR, and primer walking experiments. Batch primer design is also required in validation experiments from RNA-seq transcriptome sequencing projects, as well as in generating probes for microarray experiments. The growing popularity of next generation sequencing and microarray technology has created a greater need for more primer design tools to validate large numbers of candidate genes and markers. To meet these demands I here present a tool called PrimerView that designs forward and reverse primers from multi-sequence datasets, and generates graphical outputs that map the position and distribution of primers to the target sequence. This module operates from the command-line and can collect user-defined input for the design phase of each primer. PrimerView is a straightforward to use module that implements a primer design algorithm to return forward and reverse primers from any number of FASTA formatted sequences to generate text based output of the features for each primer, and also graphical outputs that map the designed primers to the target sequence. PrimerView is freely available without restrictions.

  6. Linear-After-The-Exponential (LATE)-PCR: Primer design criteria for high yields of specific single-stranded DNA and improved real-time detection

    PubMed Central

    Pierce, Kenneth E.; Sanchez, J. Aquiles; Rice, John E.; Wangh, Lawrence J.

    2005-01-01

    Traditional asymmetric PCR uses conventional PCR primers at unequal concentrations to generate single-stranded DNA. This method, however, is difficult to optimize, often inefficient, and tends to promote nonspecific amplification. An alternative approach, Linear-After-The-Exponential (LATE)-PCR, solves these problems by using primer pairs deliberately designed for use at unequal concentrations. The present report systematically examines the primer design parameters that affect the exponential and linear phases of LATE-PCR amplification. In particular, we investigated how altering the concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX ≥ 5°C. We also investigated how altering TmX relative to the higher Tm of the double-stranded amplicon (TmA) affects the rate and extent of linear amplification. Excess primers with TmX closer to TmA yielded higher rates of linear amplification and stronger signals from a hybridization probe. These design criteria maximize the yield of specific single-stranded DNA products and make LATE-PCR more robust and easier to implement. The conclusions were validated by using primer pairs that amplify sequences within the cystic fibrosis transmembrane regulator (CFTR) gene, mutations of which are responsible for cystic fibrosis. PMID:15937116

  7. Prey choice by carabid beetles feeding on an earthworm community analysed using species- and lineage-specific PCR primers.

    PubMed

    King, R Andrew; Vaughan, Ian P; Bell, James R; Bohan, David A; Symondson, William O C

    2010-04-01

    The carabid beetle Pterostichus melanarius is a major natural enemy of pests, such as aphids and slugs in agricultural systems. Earthworms are a dominant non-pest component of the diet of P. melanarius which help sustain the beetles during periods when the pest population is low or absent. In this study we wanted to test whether this predator exercises prey choice among different earthworm species or ecological groups. High levels of genetic diversity within morphological species of earthworm necessitated the development of primers that were specific not just to species but lineages and sub-lineages within species as well. Gut samples from beetles were analysed using multiplex-PCR and fluorescent-labelled primers. Calibratory feeding trials were undertaken to calculate median detection times for prey DNA following ingestion. Extensive testing demonstrated that the primers were species-specific, that detection periods were negatively related to amplicon size and that meal size had a highly significant effect on detection periods. Monte Carlo simulations showed that, in general, worms were being predated in proportion to their densities in the field with little evidence of prey choice, other than probable avoidance of the larger, deep-living species. There was no evidence that epigeic species were being taken preferentially in comparison with endogeic species. There was also no evidence that defensive secretions by Allolobophora chlorotica reduced predation pressure on this species by P. melanarius. We concluded that any management system that increases earthworm densities generally, regardless of component species, is likely to be optimal for increasing numbers of this beneficial beetle predator.

  8. Detection of Erysiphe necator in Air Samples Using the Polymerase Chain Reaction and Species-Specific Primers.

    PubMed

    Falacy, Jennifer S; Grove, Gary G; Mahaffee, Walter F; Galloway, Heather; Glawe, Dean A; Larsen, Richard C; Vandemark, George J

    2007-10-01

    ABSTRACT A polymerase chain reaction (PCR) assay employing species-specific primers was developed to differentiate Erysiphe necator from other powdery mildews common in the northwest United States. DNA was extracted from mycelia, conidia, and/or chasmothecia that were collected from grape leaves with a Burkard cyclonic surface sampler. To differentiate E. necator from other erysiphaeceous fungi, primer pairs Uncin144 and Uncin511 were developed to select unique sequences of the internal transcribed spacer regions of E. necator. Using these primers in PCR amplifications, a 367-bp amplicon specific to E. necator was generated, but no amplicons were generated from other erysiphaceous species collected from 48 disparate hosts representing 26 vascular plant families. The PCR limit of detection was one to five conidia of E. necator placed directly into reaction mixtures or 100 to 250 conidia placed on glass rods coated with silicon grease. During field studies, this PCR assay facilitated the detection of E. necator inoculum in air samples within hours of sample rod collection and prior to disease onset. Amplification of E. necator DNA did not occur when the PCR assay was conducted on vineyard air samples collected while grapes were dormant or during periods when vine growth occurred but E. necator remained dormant. The initial PCR detection of E. necator of the season occurred during seasonal ascospore releases caused by precipitation events between bud burst and the prebloom period during the 3 years of the study. Detection ceased for 7 to 11 days following ascospore release and then resumed several days prior to the observance of microscopic symptoms and signs of powdery mildew in the field. Results of this study represent the initial step toward the goal of incorporating an inoculum availability component into current and future grapevine powdery mildew risk assessment models.

  9. Revealing the Diversity and Quantity of Peritrich Ciliates in Environmental Samples Using Specific Primer-based PCR and Quantitative PCR

    PubMed Central

    Liu, Xihan; Gong, Jun

    2012-01-01

    Peritrichs are a diverse, ecologically important ciliate group usually with a complex life cycle. To date, the community of the peritrichs has been investigated by using morphology-based methods such as living observation and silver staining. Here we show a molecular approach for characterizing the diversity and quantity of free-living peritrichs in environmental samples. We newly designed four peritrich-specific primers targeting 18S rRNA genes that allow clone library construction, screening and analysis. A quantitative real-time PCR (qPCR) assay was developed to quantify peritrichs in environmental samples by using rDNA copy number as an indicator. DNA extracted from four water samples of contrasting environmental gradients was analysed. The results showed that the peritrich community was differentiated among these samples, and that the diversity decreased with the increase of water salinity. The qPCR results are consistent with the library sequence analysis in terms of quantity variations from sample to sample. The development of peritrich-specific primers, for the first time, for conventional PCR and qPCR assays, provides useful molecular tools for revealing the diversity and quantity of peritrich ciliates in environmental samples. Also, our study illustrates the potential of these molecular tools to ecological studies of other ciliate groups in diverse environments. PMID:23100023

  10. Evaluation of strain-specific primer sequences from an abortifacient strain of ovine Chlamydophila abortus (Chalmydia psittaci) for the detection of EAE by PCR.

    PubMed

    Creelan, J L; McCullough, S J

    2000-09-01

    Strain-specific primer sequences derived from the helicase gene of an ovine abortifacient strain (S26/3) of Chlamydophila abortus (Chlamydia psittaci) were evaluated for the diagnosis of enzootic abortion in ewes (EAE) by polymerase chain reaction (PCR). C abortus DNA was amplified from tissues submitted from ovine abortion cases using genus-specific and strain-specific primers in a standard thermal cycler. Amplification was followed by Southern blotting and hybridisation with a strain-specific probe. Real-time PCR was also evaluated using strain-specific primers in a microvolume fluorimeter-based thermal cycler (LightCycler). Detection using both PCR methods was compared with other diagnostic methods against the standard of McCoy cell culture isolation. In this paper we report the application of strain-specific PCR as a fast, sensitive, specific method for the detection of EAE.

  11. A set of plastid DNA-specific universal primers for flowering plants.

    PubMed

    Haider, N; Wilkinson, M J

    2011-09-01

    MatKand rbcL are recommended as the official barcode loci for higher plants but there remains a need for additional universal markers. We generated a series of 84 new universal primers targeting 42 plastid loci that all yielded single amplicons when applied to DNA templates from 19 diverse higher plant families. Marker utility ultimately depends on sequence variability, with rapidly evolving loci being useful for barcoding or biogeographic applications and more conserved loci being better suited to deep phylogeny reconstruction. Whereas excessive size variation is undesirable for many applications, modest size variability caused by indels and the sequence variation frequently associated with indels are highly desirable. We therefore performed a quick screen of the markers for size and sequence variation using pooled DNA templates from 96 taxonomically diverse species. All markers produced little or no size variation (consistent with the presence of minor indels). The seven regions exhibiting most size variation in pooled (rpl23&rpl2.1, 16S, 23S, 4.5S&5S, petB&D, and rpl2, rpoCl and trnK introns) were then amplified for all species individually, confirming the pooled template results. When the most variable loci (introns of trnK and rpoC1) were sequenced for all 96 species, a high level of sequence variation (nucleotide substitutions and indels) was observed among congeneric species groups for both loci. Both markers therefore have potential as supplementary barcode markers.

  12. TESTING THE SPECIFICITY OF PRIMERS TO ENVIRONMENTAL AMMONIA MONOOXYGENASE (AMOA) GENES IN GROUNDWATER TREATED WITH UREA TO PROMOTE CALCITE PRECIPITATION

    SciTech Connect

    Stephanie Freeman; David Reed; Yoshiko Fujita

    2006-12-01

    The diversity of bacterial ammonia monooxygenase (amoA) genes in DNA isolated from microorganisms in groundwater was characterized by amplification of amoA DNA using polymerase chain reaction (PCR), Restriction Fragment Length Polymorphism (RFLP) analysis, and sequencing. The amoA gene is characteristic of ammonia oxidizing bacteria (AOB). The DNA extracts were acquired from an experiment where dilute molasses and urea were sequentially introduced into a well in the Eastern Snake River Plain Aquifer (ESRPA) in Idaho to examine whether such amendments could stimulate enhanced ureolytic activity. The hydrolysis of urea into ammonium and carbonate serves as the basis for a potential remediation technique for trace metals and radionuclide contaminants that co-precipitate in calcite. The ammonium ion resulting from ureolysis can promote the growth of AOB. The goal of this work was to investigate the effectiveness of primers designed for quantitative PCR of environmental amoA genes and to evaluate the effect of the molasses and urea amendments upon the population diversity of groundwater AOB. PCR primers designed to target a portion of the amoA gene were used to amplify amoA gene sequences in the groundwater DNA extracts. Following PCR, amplified gene products were cloned and the clones were characterized by RFLP, a DNA restriction technique that can distinguish different DNA sequences, to gauge the initial diversity. Clones exhibiting unique RFLP patterns were subjected to DNA sequencing. Initial sequencing results suggest that the primers were successful at specific detection of amoA sequences and the RFLP analyses indicated that the diversity of detected amoA sequences in the ESRPA decreased with the additions of molasses and urea.

  13. Empirical testing of 16S rRNA gene PCR primer pairs reveals variance in target specificity and efficacy not suggested by in silico analysis.

    PubMed

    Morales, Sergio E; Holben, William E

    2009-05-01

    Phylogenetic and "fingerprinting" analyses of the 16S rRNA genes of prokaryotes have been a mainstay of microbial ecology during the last two decades. However, many methods and results from studies that rely on the 16S rRNA gene for detection and quantification of specific microbial taxa have seemingly received only cursory or even no validation. To directly examine the efficacy and specificity of 16S rRNA gene-based primers for phylum-, class-, and operational taxonomic unit-specific target amplification in quantitative PCR, we created a collection of primers based solely on an extensive soil bacterial 16S rRNA gene clone library containing approximately 5,000 sequences from a single soil sample (i.e., a closed site-specific library was used to create PCR primers for use at this site). These primers were initially tested in silico prior to empirical testing by PCR amplification of known target sequences and of controls based on disparate phylogenetic groups. Although all primers were highly specific according to the in silico analysis, the empirical analyses clearly exhibited a high degree of nonspecificity for many of the phyla or classes, while other primers proved to be highly specific. These findings suggest that significant care must be taken when interpreting studies whose results were obtained with target specific primers that were not adequately validated, especially where population densities or dynamics have been inferred from the data. Further, we suggest that the reliability of quantification of specific target abundance using 16S rRNA-based quantitative PCR is case specific and must be determined through rigorous empirical testing rather than solely in silico.

  14. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces.

    PubMed

    Yang, Yun-Wen; Chen, Mang-Kun; Yang, Bing-Ya; Huang, Xian-Jie; Zhang, Xue-Rui; He, Liang-Qiang; Zhang, Jing; Hua, Zi-Chun

    2015-10-01

    Mouse models are widely used for studying gastrointestinal (GI) tract-related diseases. It is necessary and important to develop a new set of primers to monitor the mouse gut microbiota. In this study, 16S rRNA gene-targeted group-specific primers for Firmicutes, Actinobacteria, Bacteroidetes, Deferribacteres, "Candidatus Saccharibacteria," Verrucomicrobia, Tenericutes, and Proteobacteria were designed and validated for quantification of the predominant bacterial species in mouse feces by real-time PCR. After confirmation of their accuracy and specificity by high-throughput sequencing technologies, these primers were applied to quantify the changes in the fecal samples from a trinitrobenzene sulfonic acid-induced colitis mouse model. Our results showed that this approach efficiently predicted the occurrence of colitis, such as spontaneous chronic inflammatory bowel disease in transgenic mice. The set of primers developed in this study provides a simple and affordable method to monitor changes in the intestinal microbiota at the phylum level.

  15. HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization

    PubMed Central

    Meisal, Roger; Rounge, Trine Ballestad; Christiansen, Irene Kraus; Eieland, Alexander Kirkeby; Worren, Merete Molton; Molden, Tor Faksvaag; Kommedal, Øyvind; Hovig, Eivind; Leegaard, Truls Michael

    2017-01-01

    Sensitive and specific genotyping of human papillomaviruses (HPVs) is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS) to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP)-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution. PMID:28045981

  16. Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

    PubMed

    Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

    2016-02-01

    Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients.

  17. Species and temporal factors affect predator-specific rates of nest predation for forest songbirds in the midwest

    Treesearch

    W. Andrew Cox; Frank R. III Thompson; John. Faaborg

    2012-01-01

    Knowledge of the relative contributions of predator species to overall rates of nest predation can improve our understanding of why predation risk varies, but the identity of predators is seldom known. We used video technology to identify nest predators of the tree-nesting Acadian Flycatcher (Empidonax virescens) and the shrub-nesting Indigo Bunting...

  18. Development of catechol 2,3-dioxygenase-specific primers for monitoring bioremediation by competitive quantitative PCR

    SciTech Connect

    Mesarch, M.B.; Nakatsu, C.H.; Nies, L.

    2000-02-01

    Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primes that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 10{sup 2} to 10{sup 3} gene copies, which was lowered to 10{sup 0} to 10{sup 1} gene copies of hybridization. Using the dioxygenase-specific primers, an increase in catechol 2,3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR and a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2,3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation.

  19. Sensitive and specific detection of Xanthomonas campestris pv campestris by PCR using species-specific primers based on hrpF gene sequences.

    PubMed

    Park, Young Jin; Lee, Byoung Moo; Ho-Hahn, Jang; Lee, Gil Bok; Park, Dong Suk

    2004-01-01

    A sensitive and specific assay was developed to detect bacterial black rot of crucifers caused by Xanthomonas campestris pv. campestris (X. c. pv. campestris), in cabbage seed and plant. Primers XCF and XCR from hrpF homologous to nolX, host recognition protein, were used to amplify a 525 bp DNA fragment. PCR technique was applied to detect the pathogen in naturally infected seed and plant of cabbage. The PCR product was only produced from X. c. pv. campestris among 40 isolates of Xanthomonas strains, Escherichia coli (O157:H7), Pectobacterium carotovorum subsp. carotovorum, and other reference bacteria.

  20. Sensitive and specific detection of Xanthomonas axonopodis pv. citri by PCR using pathovar specific primers based on hrpW gene sequences.

    PubMed

    Park, Dong Suk; Hyun, Jae Wook; Park, Young Jin; Kim, Jung Sun; Kang, Hee Wan; Hahn, Jang Ho; Go, Seung Joo

    2006-01-01

    A sensitive and specific assay was developed to detect citrus bacterial canker caused by Xanthomonas axonopodis pv. citri, in leaves and fruits of citrus. Primers XACF and XACR from hrpW homologous to pectate lyase, modifying the structure of pectin in plants, were used to amplify a 561 bp DNA fragment. PCR technique was applied to detect the pathogen in naturally or artificially infected leaves of citrus. The PCR product was only produced from X. axonopodis pv. citri among 26 isolates of Xanthomonas strains, Escherichia coli (O157:H7), Pectobacterium carotovorum subsp. carotovorum, and other reference microbes.

  1. Spurious Amplification of a Plasmodium vivax Small-Subunit RNA Gene by Use of Primers Currently Used To Detect P. knowlesi▿

    PubMed Central

    Imwong, Mallika; Tanomsing, Naowarat; Pukrittayakamee, Sasithon; Day, Nicholas P. J.; White, Nicholas J.; Snounou, Georges

    2009-01-01

    The PCR primers commonly used to detect Plasmodium knowlesi infections in humans were found to cross-react stochastically with P. vivax genomic DNA. A nested primer set that targets one of the P. knowlesi small-subunit rRNA genes was validated for specificity and for sensitivity of detection of <10 parasite genomes. PMID:19812279

  2. Detection and Identification of Gastrointestinal Lactobacillus Species by Using Denaturing Gradient Gel Electrophoresis and Species-Specific PCR Primers

    PubMed Central

    Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.

    2000-01-01

    Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239

  3. Assessment of primers designed for the subspecies-specific discrimination among Babesia canis canis, Babesia canis vogeli and Babesia canis rossi by PCR assay.

    PubMed

    Duarte, Sabrina Castilho; Linhares, Guido Fontgalland Coelho; Romanowsky, Tatiana Nunes; da Silveira Neto, Osvaldo José; Borges, Ligia Miranda Ferreira

    2008-03-25

    Canine babesiosis is an infectious disease caused by either Babesia gibsoni or Babesia canis protozoans. The latter is also classified under three different phylogenetic groups, referred to as subspecies B. canis canis, B. canis vogeli and B. canis rossi. The objective of the present study was to validate and standardize a PCR assay to discriminate the organisms at the subspecies level. First, the reference sequences of the 18S rRNA, 5.8S rRNA and 28S rRNA genes, including the internal transcribed spacer 1 (ITS1) and 2 (ITS2) of the most common species and subspecies of the genus Babesia were retrieved from the GenBank database. Subspecies-specific primers (BAB3, BAB4 and BAB5) and one genus-specific primer were designed from the alignment of the sequences. The PCR assays were evaluated in three different combinations of primer pairs in order to assure complete specificity for each reaction. The results of the tests had demonstrated effectiveness of the novel primer pairs BAB1/BAB3, BAB1/BAB4 and BAB1/BAB5 for the amplification of the subspecies-specific target fragments of 746 bp (B. c. canis), 546 bp (B. c. vogeli) and 342 bp (B. c. rossi) by PCR. The original enzymatic amplification assays with novel primers reported in this paper were confirmed to be a reliable tool for the specific discrimination among B. canis subspecies by single-step PCR assays.

  4. Rapid detection and identification of the free-living nitrogen fixing genus Azospirillum by 16S rRNA-gene-targeted genus-specific primers.

    PubMed

    Lin, Shih-Yao; Shen, Fo-Ting; Young, Chiu-Chung

    2011-05-01

    The modern agricultural practice utilizing plant growth promoting rhizobacteria (PGPR) has brought great benefits in the promotion of crop growth. Among PGPR, Azospirillum is considered as an important genus which is not only closely-associated with plants but also shows potential in the degradation of organic contaminants. However, lack of media for selective isolation or techniques for specific detection or identification limit the exploration of these rhizobacteria. This motivated us to design a genus-specific oligonucleotide primer pair which could assist in rapid detection of species of the genus Azospirillum by means of PCR-specific amplification. The sensitivity and specificity of the newly designed primer pair Azo494-F/Azo756-R were tested against 12 Azospirillum type strains and other closely-related genera. The Azospirillum-specific 16S rRNA gene fragment (263 bp) was successfully amplified for all the reference Azospirillum species with the designed primer pair. No amplification was noted for closely-related species from other genera. The genus specificity was validated with 18 strains including environmental isolates. Interestingly, two strains assigned earlier as Azospirillum amazonense (DSM 2787(T)) and Azospirillum irakense (DSM 11586(T)) failed to produce an Azospirillum-specific fragment with this primer pair. Further phylogenetic analysis of these two isolates based on 16S rRNA gene sequences shows that these two strains might belong to other genera rather than Azospirillum. Preliminary screening of isolates and soil samples with the Azospirillum-specific primers was successful in terms of the rapid detection of Azospirillum isolates. By using real-time PCR analysis the minimum limit of Azospirillum detection was 10(2) CFU g(-1) in the seeded soil sample. The newly designed primers can be used to study the diversity of Azospirillum in ecosystems and aid in the exploration of novel species.

  5. Robust detection of rare species using environmental DNA: The importance of primer specificity

    Treesearch

    Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Stephen F. Jane; Winsor H. Lowe; Andrew R. Whiteley; Michael K. Schwartz

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probebased chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence...

  6. Agronomically important thrips: development of species-specific primers in multiplex PCR and microarray assay using internal transcribed spacer 1 (ITS1) sequences for identification.

    PubMed

    Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

    2015-02-01

    Thrips, the sole vector of plant Tospovirus, are major pests of many agricultural crops throughout the world. Molecular approaches have been applied in recent decades to identify these minute and morphologically difficult to distinguish insects. In this study, sequences of internal transcribed spacer 1 (ITS1) region of 15 agronomically important thrips, including several virus transmission species, have been analyzed in order to design species-specific primers for multiplex PCR and probes for microarray assay. That the ITS1 sequence distances within species were smaller than those among species suggests that the ITS1 fragment can be used for thrips species identification. The specificity and stability of these primers, combined with universal paired primers, were tested and verified in multiplex PCR. Using these specific primers as probes, microarray assay showed that PCR products of all thrips species hybridized consistently to their corresponding probes, though some signals were weak. We have demonstrated that multiplex PCR using specific primers based on ITS1 sequences is a simple, reliable, and cost-effective diagnostic tool for thrips species identification. Moreover, the DNA microarray assay is expected to extend into a reliable high-throughput screening tool for the vast numbers of thrips.

  7. COMPARISON OF A GENUS-SPECIFIC CONVENTIONAL PCR AND A SPECIES-SPECIFIC NESTED-PCR FOR MALARIA DIAGNOSIS USING FTA COLLECTED SAMPLES FROM KINGDOM OF SAUDI ARABIA.

    PubMed

    Al-Harthi, Saeed A

    2015-12-01

    Molecular tools are increasingly accepted as the most sensitive and reliable techniques for malaria diagnosis and epidemiological surveys. Also, collection of finger prick blood spots onto filter papers is the most simple and affordable method for samples preservation and posterior molecular analysis, especially in rural endemic regions where malaria remains a major health problem. Two malaria molecular diagnostic tests, a Plasmodium genus-specific conventional PCR and a Plasmodium species-specific Nested PCR, were evaluated using DNA templates prepared from Whatman-FTA cards' dry blood spots using both, Methanol-fixation/Heat-extraction and FTA commercial purification kit. A total of 121 blood samples were collected from six Saudi south-western endemic districts both, as thick and thin films for routine microscopic screening and onto FTA cards for molecular studies. Out of the 121 samples, 75 were P. falciparum positive by at least one technique. No other species of Plasmodium were detected. P. falciparum parasites were identified in 69/75 (92%) samples by microscopic screening in health care centers. P. genus-specific PCR was able to amplify P. falciparum DNA in 41/75 (55%) and 59/75 (79%) samples using Methanol-fixation/Heat-extraction and FTA purification kit, respectively. P. species-specific Nested PCR revealed 68/75 (91%) and 75/75 (100%) positive samples using DNA templates were isolated by Methanol-fixation/Heat- extraction and FTA purification methods, respectively. The species-specific Nested PCR applied to Whatman-FTA preserved and processed blood samples represents the best alternative to classical microscopy for malaria diagnosis, particularly in epidemiological screening.

  8. Sensitivity, Specificity, and Receiver Operating Characteristics: A Primer for Neuroscience Nurses.

    PubMed

    McNett, Molly; Amato, Shelly; Olson, DaiWai M

    2017-04-01

    It is important for neuroscience nurses to have a solid understanding of the instruments they use in clinical practice. Specifically, when reviewing reports of research instruments, nurses should be knowledgeable of analytical terms when determining the applicability of instruments for use in clinical practice. The purpose of this article is to review 3 such analytical terms: sensitivity, specificity, and receiver operating characteristic curves. Examples of how these terms are used in the neuroscience literature highlight the relevance of these terms to neuroscience nursing practice. As the role of the nurse continues to expand, it is important not to simply accept all instruments as valid but to be able to critically evaluate their properties for applicability to nursing practice and evidence-based care of our patients.

  9. Use of specific primers based on the 16S-23S internal transcribed spacer (ITS) region for the screening Bifidobacterium adolescentis in yogurt products and human stool samples.

    PubMed

    Tsai, Cheng-Chih; Lai, Chieh-Hsien; Yu, Bi; Tsen, Hau-Yang

    2008-10-01

    Effective methods for the identification and enumeration of lactic acid producing bacteria (LAB) cells are important for the quality control and assurance of probiotic products. In this study, we designed a polymerase chain reaction (PCR) primer set from the sequence in 16S-23S internal transcribed spacer (ITS) region and used it for the specific detection of Bifidobacterium adolescentis, one of the Bifidobacterium species used in probiotics. Specificity of the PCR primers, i.e., bits-1/bits-2, was assured by assay strains of B. adolescentis, other Bifidobacterium species, and strains of non-Bifidobacterium spp. Coupled with the use of a known primer set specific for Bifidobacterium species, Bifidobacterium strains and B. adolescentis could be identified from LAB strains in fermented dairy products and human fecal samples.

  10. Helicobacter pylori specific nested PCR assay for the detection of 23S rRNA mutation associated with clarithromycin resistance

    PubMed Central

    Maeda, S; Yoshida, H; Ogura, K; Kanai, F; Shiratori, Y; Omata, M

    1998-01-01

    Background—Clarithromycin is one of the most important antibiotics for Helicobacter pylori eradication. However, 5-10% of strains are reported to be resistant. It has been shown that one point mutation in the 23S rRNA gene is associated with resistance to clarithromycin. 
Aims—To establish a polymerase chain reaction (PCR) system which amplifies a segment of the 23S rRNA gene containing the mutation points with primers specific for H pylori, so that H pylori infection and the mutation associated with clarithromycin resistance can be examined simultaneously. 
Methods—To detect H pylori infection and the mutation simultaneously, primers specific for the H pylori 23S rRNA gene were designed based on sequence conservation among H pylori strains and sequence specificity as compared with other bacteria. DNA from 57 cultured strains and from 39 gastric juice samples was amplified in the seminested 23S rRNA PCR. Clinical applicability was evaluated in 85patients. 
Results—DNA samples from 57 cultured strains were all amplified. The novel assay and the urease A PCR agreed in 37/39 gastric juice samples with no false positives. The assay did not amplify the DNA of bacteria other than H pylori. Eight of 85 samples had the mutation before treatment. In clarithromycin based treatment, eradication was achieved in 2/5 (40%) with the mutation and 29/34 (85%) without the mutation. 
Conclusion—The assay using gastric juice is quick (within 12 hours) and non-invasive (endoscopy not required), enabling rapid initiation of appropriate antibiotic treatment. 

 Keywords: Helicobacter pylori; eradication; clarithromycin; resistance; point mutation PMID:9863474

  11. New Design Strategy for Development of Specific Primer Sets for PCR-Based Detection of Chlorophyceae and Bacillariophyceae in Environmental Samples▿ †

    PubMed Central

    Valiente Moro, Claire; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-01-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments. PMID:19592531

  12. New design strategy for development of specific primer sets for PCR-based detection of Chlorophyceae and Bacillariophyceae in environmental samples.

    PubMed

    Moro, Claire Valiente; Crouzet, Olivier; Rasconi, Séréna; Thouvenot, Antoine; Coffe, Gérard; Batisson, Isabelle; Bohatier, Jacques

    2009-09-01

    Studying aquatic microalgae is essential for monitoring biodiversity and water quality. We designed new sets of 18S rRNA PCR primers for Chlorophyceae and Bacillariophyceae by using the ARB software and implementing a virtual PCR program. The results of specificity analysis showed that most of the targeted algal families were identified and nontargeted organisms, such as fungi or ciliates, were excluded. These newly developed PCR primer sets were also able to amplify microalgal rRNA genes from environmental samples with accurate specificity. These tools could be of great interest for studying freshwater microalgal ecology and for developing bioindicators of the health status of aquatic environments.

  13. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    PubMed

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

  14. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    PubMed

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-08-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle.

  15. Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

    PubMed

    Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

    2014-07-01

    In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Primer evaluation and adaption for cost-efficient SYBR Green-based qPCR and its applicability for specific quantification of methanogens.

    PubMed

    Reitschuler, Christoph; Lins, Philipp; Illmer, Paul

    2014-01-01

    In the present study nine promising primer sets, targeting Archaea and methanogenic Archaea in particular, were evaluated in silico, in vitro and in situ concerning specificity, accuracy and applicability in end-point (ep-) and especially quantitative (q-)PCR research. The main goal was to adapt and evaluate already adapted primer sets, which were partially designed in combination with TaqMan probes, in substantially cheaper SYBR Green-based qPCR applications. An initial 16S rRNA gene bank-based in silico evaluation revealed high coverage potentials for all primers within targeted groups, ranging from 71 to 90%, except the Methanosaeta specific set showing a low potential of 37%. Mentionable cross-reacting potentials could be detected for the Methanothermobacter, Methanomicrobiales and Methanoculleus sets. The in vitro evaluation with selected reference organisms revealed a specific behavior for most primer sets, while the Methanosarcina and Methanothermobacter sets showed most problematic cross-reactions in epPCR application. We were able to show that primers for detecting the total archaeal community, methanogenic orders Methanosarcinales, Methanobacteriales, Methanococcales and the genus Methanoculleus performed in a highly specific way and allowed an accurate quantification of targeted organisms without the use of expensive TaqMan probes. However, primer pairs designed for detecting Methanomicrobiales, Methanothermobacter, Methanosarcina and Methanosaeta are not suitable for SYBR Green applications. The reliability of in situ quantifications was assessed for a typical methanogenic community, derived from a thermophilic fermenter, and confirmed via denaturing gradient gel band quantification and sequencing. Thereby, we revealed high abundances of methanogenic Archaea, mainly comprising Methanoculleus and Methanosarcinales, while Methanobacteriales only formed a minor fraction.

  17. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    PubMed

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed.

  18. BatchPrimer3: a high throughput web application for PCR and sequencing primer design.

    PubMed

    You, Frank M; Huo, Naxin; Gu, Yong Qiang; Luo, Ming-Cheng; Ma, Yaqin; Hane, Dave; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2008-05-29

    Microsatellite (simple sequence repeat - SSR) and single nucleotide polymorphism (SNP) markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR), as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated in several laboratories. BatchPrimer3 is a

  19. High-specificity single-tube multiplex genotyping using Ribo-PAP PCR, tag primers, alkali cleavage of RNA/DNA chimeras and MALDI-TOF MS.

    PubMed

    Mauger, Florence; Gelfand, David H; Gupta, Amar; Bodepudi, Veeraiah; Will, Stephen G; Bauer, Keith; Myers, Thomas W; Gut, Ivo G

    2013-01-01

    Here, we describe a high-throughput, single-tube, allele-specific ribonucleotide analog pyrophosphorolysis-activated polymerization (ribo-PAP) PCR multiplex genotyping and resequencing method. An RNA/DNA chimeric PCR product is generated using genomic DNA as starting template, a panel of allele-selective 5'-tagged primers, a reverse primer, one nucleotide in the ribo-form (90-100%), the other nucleotides in the deoxy-form, a DNA polymerase capable of incorporating ribonucleotides, a suitable buffer and thermal cycling. The RNA/DNA chimeric PCR products are fragmented by treatment with alkali and analyzed by mass spectrometry. All allele-selective primers have a 5' repetitive motif where each repeat unit has a unique, distinct mass upon reverse copying and alkali fragmentation. The mass of the complement repeat fragment or flag identifies the primer or primers that were recruited in the ribo-PAP PCR. The method readily identifies homozygous and heterozygous positions in simplex or duplex ribo-PAP PCR. Many different tags can be analyzed simultaneously. The assay can genotype several SNPs in a single tube. It thus constitutes the simplest genotyping protocol with multiplex analysis. This novel genotyping and resequencing protocol was applied to different genomic loci: NOS1 and H19 in 30 individuals in simplex ribo-PAP PCR and at two SLCO1B1 loci in 95 individuals in duplex ribo-PAP PCR.

  20. Group-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residue at positions of codon degeneracy.

    PubMed Central

    Kilpatrick, D R; Nottay, B; Yang, C F; Yang, S J; Mulders, M N; Holloway, B P; Pallansch, M A; Kew, O M

    1996-01-01

    We have developed a method for differentiating polioviruses from nonpolio enteroviruses using PCR. A pair of panpoliovirus PCR primers were designed to match intervals encoding amino acid sequences within VP1 that are strongly conserved among polioviruses. The initiating primer hybridizes with codons of a 7-amino-acid sequence that has been found only in polioviruses; the second primer matches codons of a domain thought to interact with the cell receptor. The panpoliovirus PCR primers contain mixed-base and deoxyinosine residues to compensate for the high degeneracy of the targeted codons. All RNAs from 48 vaccine-related and 110 wild poliovirus isolates of all three serotypes served as efficient templates for amplification of 79-bp product. None of the genomic sequences of 49 nonpolio enterovirus reference strains were amplified under equivalent reaction conditions. Sensitivities of poliovirus detection were as low as 100 fg (equivalent to approximately 25,000 genomic copies or 25 to 250 PFU) when the amplified products were visualized by ethidium bromide fluorescence. These degenerate PCR primers should aid in the detection of all polioviruses, including those wild poliovirus isolates for which genotype-specific reagents are unavailable. PMID:8940436

  1. Genus-specific primers targeting the 16S rRNA gene for PCR detection of members of the genus Verrucosispora.

    PubMed

    Xie, Qingyi; Hong, Kui; Goodfellow, Michael

    2011-06-01

    Little is known about the genus Verrucosispora though it does contain organisms which produce novel antibiotics. A set of genus-specific oligonucleotide primers was generated to gain an insight into the presence, distribution and taxonomic diversity of members of this genus in diverse samples taken from marine habitats. In silico and pure culture studies showed that the primers matched perfectly with target sequences of the 16S rRNA genes of representatives of the genus Verrucosispora. The primers, designated S-G-Verr-0195-a-S-20 and S-G-Verr-1152-a-A-18, amplified an ≈960 bp stretch of the 16S rRNA genes of Verrucosispora strains but not those of representatives of other genera classified in the family Micromonosporaceae. Genus-specific amplicons were detected from 17 out of 20 community DNA samples prepared from diverse marine sediments and coastal soils. Phylogenetic analysis of over 40% of clones derived from five of the samples indicated they belonged to novel Verrucosispora species. The primers were also used to confirm the identity of Verrucosispora-like strains isolated from two of the environmental samples. The primers can be used to facilitate the isolation of novel Verrucosispora strains by allowing prescreening of environmental samples and the subsequent identification of verrucosisporae on selective isolation plates. For this purpose, a novel medium facilitating the recovery of Verrucosispora strains was formulated and used to recover novel isolates validated using the novel PCR primers. This medium may be useful as the basis for development of a selective medium.

  2. Sensitive and specific detection of miRNA using an isothermal exponential amplification method using fluorescence-labeled LNA/DNA chimera primers.

    PubMed

    Huang, Jun-Fu; Zhao, Na; Xu, Han-Qing; Xia, Han; Wei, Kun; Fu, Wei-Ling; Huang, Qing

    2016-10-01

    MicroRNAs (miRNAs) are currently considered as potential biomarkers for various human diseases. In the present study, miRNA-triggered real-time fluorescent isothermal reaction with exponential amplification (ReFIRE) with or without Thermus aquaticus MutS (Taq MutS) was developed to analyze miRNAs using DNA polymerase, a nicking endonuclease, and fluorescently labeled primers. In the absence of Taq MutS, the ReFIRE system permitted the detection of 100 ymol of targeted miRNA in 80 min. However, this system enabled limited differentiation between homologous miRNA family members. Upon addition of Taq MutS to the ReFIRE system, non-specific amplification generated from the mishybridization between primers and primer dimers or primers and the template duplex was eliminated. The addition of Taq MutS enabled the ultrasensitive detection of as little as 10 ymol of targeted miRNAs in 50 min, which corresponds to less than 10 copies of miRNAs in a total volume of 20 μl. Additionally, the assay exhibited a dynamic range of up to 12 orders of magnitude. The ReFIRE system also showed high specificity, enabling differentiation between homologous miRNA family members exhibiting only single-base differences. The sensitivity, specificity, and dynamic range associated with this system were greater than most currently available miRNA isothermal amplification assays. Moreover, when target-specific primers were labeled with different fluorescent reporters, multiplex analysis was easily performed in a single tube, permitting accurate normalization of miRNA expression. This simple, fast, ultrasensitive, highly specific, and easy-to-multiplex method could significantly contribute to research investigations pertaining to the biological roles of miRNA, as well as clinical diagnosis of various diseases that involve miRNA disruptions. Graphical Abstract The principle of ReFIRE system.

  3. The nucleocapsid protein specifically anneals tRNALys-3 onto a noncomplementary primer binding site within the HIV-1 RNA genome in vitro

    PubMed Central

    Chan, Barden; Musier-Forsyth, Karin

    1997-01-01

    HIV type 1 (HIV-1) specifically uses host cell tRNALys-3 as a primer for reverse transcription. The 3′ 18 nucleotides of this tRNA are complementary to a region on the HIV RNA genome known as the primer binding site (PBS). HIV-1 has a strong preference for maintaining a lysine-specific PBS in vivo, and viral genomes with mutated PBS sequences quickly revert to be complementary to tRNALys-3. To investigate the mechanism for the observed PBS reversion events in vitro, we examined the capability of the nucleocapsid protein (NC) to anneal various tRNA primer sequences onto either complementary or noncomplementary PBSs. We show that NC can anneal different full-length tRNAs onto viral RNA transcripts derived from the HIV-1 MAL or HXB2 isolates, provided that the PBS is complementary to the tRNA used. In contrast, NC promotes specific annealing of only tRNALys-3 onto an RNA template (HXB2) whose PBS sequence has been mutated to be complementary to the 3′ 18 nt of human tRNAPro. Moreover, HIV-1 reverse transcriptase extends this binary complex from the proline-specific PBS. The formation of the noncomplementary binary complex does not occur when a chimeric tRNALys/Pro containing proline-specific D and anticodon domains is used as the primer. Thus, elements outside the acceptor-TΨC domains of tRNALys-3 play an important role in preferential primer use in vitro. Our results support the hypothesis that mutant PBS reversion is a result of tRNALys-3 annealing onto and extension from a PBS that specifies an alternate host cell tRNA. PMID:9391060

  4. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

    PubMed Central

    2014-01-01

    Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

  5. Preliminary level 2 specification for the nested, fixed-depth sampling system

    SciTech Connect

    BOGER, R.M.

    1999-05-26

    This revision 1 Level 2 Specification establishes the performance, design, development, and test requirements for a sampling system and for an at-tank analysis system that will support the BNFL, Inc. privatization contract in the final disposal of Hanford's high level waste (HLW) and low activity waste (LAW). The sampling system will quickly provide large volume, representative waste samples for validating the chemical, radiological, and physical properties of the tank waste without the exposure and time concerns of the baseline grab sampling method. The on-line sensors of the at-tank analysis system will provide data from which the mixing or settling status of the waste can be assessed. This revision 1 document includes functions, requirement, and specifications for the at-tank analysis system, the results of the preliminary outline design, and the FY 1998 validation testing. The sample container filling system will comply with RCRA criteria for samples with volatile organic constituents, include empty container and swipe input ports, use Hanford's Steel Pig radioactive sample package, comply with Hanford's flammable gas criteria, and have the means to recover from broken sample containers.

  6. Mitochondrial D-loop {open_quotes}signatures{close_quotes} produced by low-stringency single specific primer PCR constitute a simple comparative human identity test

    SciTech Connect

    Barreto, G.; Vago, A.R.; Pena, S.D.J.

    1996-03-01

    We have developed a technique called {open_quotes}LSSP-PCR{close_quotes} (low-stringency single specific primer PCR) that detects single or multiple mutations in DNA. A purified DNA fragment is submitted to PCR by using a single primer specific for one of the extremities of the fragment, under conditions of very low stringency. The primer hybridizes specifically to its complementary extremity and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner. A complex set of reaction products is thus created that, when separated by electrophoresis, constitutes a unique {open_quotes}gene signature.{close_quotes} We here report the application of LSSP-PCR to the detection of sequence variation in the control (D-loop) region of human mtDNA, which is known to differ significantly between unrelated individuals. We prepared human DNA samples from blood and amplified a 1,024-bp portion of the mtDNA control region, using primers L15996 and H408. The amplified mtDNA fragments were then reamplified under LSSP-PCR conditions by using L15996 or H408 as drivers to produce complex signatures that always differed between unrelated individuals and yet were highly reproducible. In contrast, all mother-child pairs tested were identical, as expected from the matrilineal inheritance of mtDNA. Thus, the use of LSSP-PCR to produce D-loop signatures constitutes a powerful new technique for mtDNA-based comparative identity testing. 18 refs., 7 figs.

  7. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    NASA Astrophysics Data System (ADS)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  8. Visual System Homeobox 1 (VSX1) Gene Analysis in Keratoconus: Design of Specific Primers and DNA Amplification Protocols for Accurate Molecular Characterization.

    PubMed

    Ng, Jun B; Poh, Rozaida Y Y; Lee, Kenneth R; Subrayan, Visvaraja; Deva, Jenny P; Lau, Amy Y L; Tan, Jin A M A

    2016-09-01

    Keratoconus is an ocular degeneration characterized by the thinning of corneal stroma that may lead to varying degrees of myopia and visual impairment. Genetic factors have been reported in the pathology of keratoconus where Asians have a higher incidence, earlier onset, and undergo earlier corneal grafts compared to Caucasians. The visual system homeobox 1 (VSX1) gene forms part of a paired-like homeodomain transcription factor which is responsible for ocular development. The gene was marked as a candidate in genetic studies of keratoconus in various populations. Single nucleotide polymorphisms (SNPs) in the VSX1 gene have been reported to be associated with keratoconus. The detection of the SNPs involves DNA amplification of the VSX1 gene followed by genomic sequencing. Thus, the objective of this study aims to establish sensitive and accurate screening protocols for the molecular characterization of VSX1 polymorphisms. Keratoconic (n = 74) and control subjects (n = 96) were recruited based on clinical diagnostic tests and selection criteria. DNA extracted from the blood samples was used to genotype VSX1 polymorphisms. In-house designed primers and optimization of PCR conditions were carried out to amplify exons 1 and 3 of the VSX1 gene. PCR conditions including percentage GC content, melting temperatures, and differences in melting temperatures of primers were evaluated to produce sensitive and specific DNA amplifications. Genotyping was successfully carried out in 4 exons of the VSX1 gene. Primer annealing temperatures were observed to be crucial in enhancing PCR sensitivity and specificity. Annealing temperatures were carefully evaluated to produce increased specificity, yet not allowing sensitivity to be compromised. In addition, exon 1 of the VSX1 gene was amplified using 2 different sets of primers to produce 2 smaller amplified products with absence of non-specific bands. DNA amplification of exons 1 and 3 consistently showed single band products which

  9. Population-Specific Covariation between Immune Function and Color of Nesting Male Threespine Stickleback

    PubMed Central

    Bolnick, Daniel I.; Shim, Kum Chuan; Schmerer, Matthew; Brock, Chad D.

    2015-01-01

    Multiple biological processes can generate sexual selection on male visual signals such as color. For example, females may prefer colorful males because those males are more readily detected (perceptual bias), or because male color conveys information about male quality and associated direct or indirect benefits to females. For example, male threespine stickleback often exhibit red throat coloration, which females prefer both because red is more visible in certain environments, and red color is correlated with male immune function and parasite load. However, not all light environments favor red nuptial coloration: more tannin-stained water tends to favor the evolution of a melanic male phenotype. Do such population differences in stickleback male color, driven by divergent light environments, lead to changes in the relationship between color and immunity? Here, we show that, within stickleback populations, multiple components of male color (brightness and hue of four body parts) are correlated with multiple immune variables (ROS production, phagocytosis rates, and lymphocyte:leukocyte ratios). Some of these color-immune associations persist across stickleback populations with very different male color patterns, whereas other color-immune associations are population-specific. Overall, lakes with red males exhibit stronger color-immune covariance while melanic male populations exhibit weak if any color-immune associations. Our finding that color-immunity relationships are labile implies that any evolution of male color traits (e.g., due to female perceptual bias in a given light environment), can alter the utility of color as an indicator of male quality. PMID:26039044

  10. HLA-DRB and -DBQ typing by PCR amplification using sequence-specific primers (PCR-SSP): assessment after 1 year of routine use by three laboratories.

    PubMed

    Mercier, B; al Daccak, R; Samaan, A; David, F; Carta, A; Cracco, P; Raguenes, O; Dufosse, F; Ferec, C; Charron, D

    1994-04-01

    Using sequence-specific amplifications, a practical and fast technique for DRB and DQB typing has been developed. The primers are chosen in order to amplify groups of alleles corresponding to the same serological specificity. In a second step, precise allelic determination is obtained by studying the restriction fragment length polymorphism of the PCR products. The experience of three laboratories using this technique in the context of organ or bone marrow transplantation is reported.

  11. Nesting Instincts.

    ERIC Educational Resources Information Center

    Greenman, Geri

    2003-01-01

    Describes an art project where beginning drawing students used values and chiaroscuro techniques to draw bird nests. Explains how the students observed the nest that was displayed in the art classroom. Discusses the steps involved in creating the artworks. (CMK)

  12. Nesting Instincts.

    ERIC Educational Resources Information Center

    Greenman, Geri

    2003-01-01

    Describes an art project where beginning drawing students used values and chiaroscuro techniques to draw bird nests. Explains how the students observed the nest that was displayed in the art classroom. Discusses the steps involved in creating the artworks. (CMK)

  13. Conditions during adulthood affect cohort-specific reproductive success in an Arctic-nesting goose population.

    PubMed

    Weegman, Mitch D; Bearhop, Stuart; Hilton, Geoff M; Walsh, Alyn; Fox, Anthony David

    2016-01-01

    Variation in fitness between individuals in populations may be attributed to differing environmental conditions experienced among birth (or hatch) years (i.e., between cohorts). In this study, we tested whether cohort fitness could also be explained by environmental conditions experienced in years post-hatch, using 736 lifelong resighting histories of Greenland white-fronted geese (Anser albifrons flavirostris) marked in their first winter. Specifically, we tested whether variation in age at first successful reproduction, the size of the first successful brood and the proportion of successful breeders by cohort was explained by environmental conditions experienced on breeding areas in west Greenland during hatch year, those in adulthood prior to successful reproduction and those in the year of successful reproduction, using North Atlantic Oscillation indices as proxies for environmental conditions during these periods. Fifty-nine (8%) of all marked birds reproduced successfully (i.e., were observed on wintering areas with young) only once in their lifetime and 15 (2%) reproduced successfully twice or thrice. Variation in age at first successful reproduction was explained by the environmental conditions experienced during adulthood in the years prior to successful reproduction. Birds bred earliest (mean age 4) when environmental conditions were 'good' prior to the year of successful reproduction. Conversely, birds successfully reproduced at older ages (mean age 7) if they experienced adverse conditions prior to the year of successful reproduction. Hatch year conditions and an interaction between those experienced prior to and during the year of successful reproduction explained less (marginally significant) variation in age at first successful reproduction. Environmental conditions did not explain variation in the size of the first successful brood or the proportion of successful breeders. These findings show that conditions during adulthood prior to the year of

  14. Conditions during adulthood affect cohort-specific reproductive success in an Arctic-nesting goose population

    PubMed Central

    Bearhop, Stuart; Hilton, Geoff M.; Walsh, Alyn; Fox, Anthony David

    2016-01-01

    Variation in fitness between individuals in populations may be attributed to differing environmental conditions experienced among birth (or hatch) years (i.e., between cohorts). In this study, we tested whether cohort fitness could also be explained by environmental conditions experienced in years post-hatch, using 736 lifelong resighting histories of Greenland white-fronted geese (Anser albifrons flavirostris) marked in their first winter. Specifically, we tested whether variation in age at first successful reproduction, the size of the first successful brood and the proportion of successful breeders by cohort was explained by environmental conditions experienced on breeding areas in west Greenland during hatch year, those in adulthood prior to successful reproduction and those in the year of successful reproduction, using North Atlantic Oscillation indices as proxies for environmental conditions during these periods. Fifty-nine (8%) of all marked birds reproduced successfully (i.e., were observed on wintering areas with young) only once in their lifetime and 15 (2%) reproduced successfully twice or thrice. Variation in age at first successful reproduction was explained by the environmental conditions experienced during adulthood in the years prior to successful reproduction. Birds bred earliest (mean age 4) when environmental conditions were ‘good’ prior to the year of successful reproduction. Conversely, birds successfully reproduced at older ages (mean age 7) if they experienced adverse conditions prior to the year of successful reproduction. Hatch year conditions and an interaction between those experienced prior to and during the year of successful reproduction explained less (marginally significant) variation in age at first successful reproduction. Environmental conditions did not explain variation in the size of the first successful brood or the proportion of successful breeders. These findings show that conditions during adulthood prior to the year of

  15. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces

    PubMed Central

    Yang, Yun-Wen; Chen, Mang-Kun; Yang, Bing-Ya; Huang, Xian-Jie; Zhang, Xue-Rui; He, Liang-Qiang

    2015-01-01

    Mouse models are widely used for studying gastrointestinal (GI) tract-related diseases. It is necessary and important to develop a new set of primers to monitor the mouse gut microbiota. In this study, 16S rRNA gene-targeted group-specific primers for Firmicutes, Actinobacteria, Bacteroidetes, Deferribacteres, “Candidatus Saccharibacteria,” Verrucomicrobia, Tenericutes, and Proteobacteria were designed and validated for quantification of the predominant bacterial species in mouse feces by real-time PCR. After confirmation of their accuracy and specificity by high-throughput sequencing technologies, these primers were applied to quantify the changes in the fecal samples from a trinitrobenzene sulfonic acid-induced colitis mouse model. Our results showed that this approach efficiently predicted the occurrence of colitis, such as spontaneous chronic inflammatory bowel disease in transgenic mice. The set of primers developed in this study provides a simple and affordable method to monitor changes in the intestinal microbiota at the phylum level. PMID:26187967

  16. Evaluation of combined general primer-mediated PCR sequencing and type-specific PCR strategies for determination of human papillomavirus genotypes in cervical cell specimens.

    PubMed

    Fontaine, Véronique; Mascaux, Corinne; Weyn, Christine; Bernis, Aurore; Celio, Nathalie; Lefèvre, Philippe; Kaufman, Leonard; Garbar, Christian

    2007-03-01

    A strategy combining human papillomavirus general primer (mainly the PGMY primers)-directed PCR sequencing and type-specific PCR is presented. DNA samples were first tested in general primer-mediated PCR. The amplified fragments of positive samples after ethidium bromide-stained DNA gel analysis were further sequenced, and corresponding DNA samples were further analyzed by PCR using type-specific primers for human papillomavirus (HPV) types 16, 18, 31, and 52. The comparison of the results of 157 samples analyzed by this strategy in parallel with the Hybrid Capture 2 tests and with the HPV INNO-LiPA (Innogenetics line probe assay) shows that this method is suitable for HPV detection and genotyping in cervical cell samples. Although the PCR sequencing method is as sensitive as the HPV INNO-LiPA for HPV detection, our method allows the identification of a broader range of HPV types. In contrast, the HPV INNO-LiPA was less time-consuming and better identified coinfections.

  17. Evaluation of Combined General Primer-Mediated PCR Sequencing and Type-Specific PCR Strategies for Determination of Human Papillomavirus Genotypes in Cervical Cell Specimens▿

    PubMed Central

    Fontaine, Véronique; Mascaux, Corinne; Weyn, Christine; Bernis, Aurore; Celio, Nathalie; Lefèvre, Philippe; Kaufman, Leonard; Garbar, Christian

    2007-01-01

    A strategy combining human papillomavirus general primer (mainly the PGMY primers)-directed PCR sequencing and type-specific PCR is presented. DNA samples were first tested in general primer-mediated PCR. The amplified fragments of positive samples after ethidium bromide-stained DNA gel analysis were further sequenced, and corresponding DNA samples were further analyzed by PCR using type-specific primers for human papillomavirus (HPV) types 16, 18, 31, and 52. The comparison of the results of 157 samples analyzed by this strategy in parallel with the Hybrid Capture 2 tests and with the HPV INNO-LiPA (Innogenetics line probe assay) shows that this method is suitable for HPV detection and genotyping in cervical cell samples. Although the PCR sequencing method is as sensitive as the HPV INNO-LiPA for HPV detection, our method allows the identification of a broader range of HPV types. In contrast, the HPV INNO-LiPA was less time-consuming and better identified coinfections. PMID:17229855

  18. Further analysis of Del (D-elute) using polymerase chain reaction (PCR) with RHD gene-specific primers.

    PubMed

    Fukumori, Y; Hori, Y; Ohnoki, S; Nagao, N; Shibata, H; Okubo, Y; Yamaguchi, H

    1997-09-01

    Del (D-elute) in the Rh blood group system is a variant with very weak D antigen and no agglutination is found by the indirect antiglobulin test. This variant is characterized by the presence of anti-D eluate obtained after an adsorption-elution test using anti-D antibodies. We studied here the molecular genetic status of Del by using polymerase chain reaction with sequence-specific primers (PCR-SSP). We screened 306 serologically apparent D-negative Japanese donors comprising 102 Del types for exons 7, 4 and 10 of the RHD gene. No PCR product was found in all 204 non-Del samples from the D-seronegative donors. However, PCR products were found in all 102 Del samples and all 70 D-seropositive samples tested by the three PCR methods for exons 7, 4 and 10 analysis. Del was found with CCee, CcEe and Ccee, but not with CCEe, CcEE, ccEE, ccEe or ccee phenotype. The incidences of Del in the samples with the serological phenotypes CCee, CcEe and Ccee were 80.0% (4/5), 68.2% (45/66) and 61.6% (53/86), respectively. The results provide evidence that Del samples have exons 4, 7 and 10 of an RHD gene present in some form. This is consistent with the evidence that D antigen is present on the cells although only detected by antibody adsorption and elution. The PCR-SSP method in the present study is useful to confirm Del among serologically apparent D-negative samples.

  19. Superior Multiplexing Capacity of PlexPrimers Enables Sensitive and Specific Detection of SNPs and Clustered Mutations in qPCR

    PubMed Central

    Tan, Lit Yeen; Walker, Samantha Michelle; Lonergan, Tina; Lima, Nicole Elizabeth; Todd, Alison Velyian

    2017-01-01

    Background Whilst qPCR provides an extremely powerful tool for genetic analysis, some applications such as multiplexing variant alleles (eg SNPs, point mutations or deletions), remain challenging using current primer/probe systems. The novel design features of PlexPrimers allow sensitive, multiplexed analysis of variant alleles even when these are tightly clustered. Method PlexPrimers were combined with PlexZymes in qPCR assays for the detection of SNPs in human absorption, distribution, metabolism, and excretion (ADME) genes; clustered mutations in the 23S rRNA gene which confer antibiotic resistance to Mycoplasma genitalium; and deletions within the human epidermal growth factor receptor (EGFR) gene. Results The combination of PlexPrimers and PlexZymes allowed robust multiplexing of targets which resulted in 100% concordance with results obtained using hydrolysis probe kits for 14 SNPs in the ADME genes. A 7-plex qPCR assay targeting M. genitalium, 5 clustered mutations associated with macrolide resistance and an internal control, allowed efficient amplification of all targets, with all 5 mutations detected in a single channel. Finally, the strategy was employed to analyse common EGFR mutants with high sensitivity, detecting deletions present at only 0.01%. Conclusion PlexPrime is a novel technology for the detection of genetic variants. Unlike previous strategies, the combination of PlexPrimers with PlexZymes enables both allele-specific detection and allele-specific amplification in qPCR. The study demonstrated highly sensitive and specific detection of mutations and SNPs, and superior multiplexing capacity. The ability to multiplex clustered genetic variants reduces the time to result providing more actionable information. PMID:28114309

  20. Resource quantity and quality determine the inter-specific associations between ecosystem engineers and resource users in a cavity-nest web.

    PubMed

    Robles, Hugo; Martin, Kathy

    2013-01-01

    While ecosystem engineering is a widespread structural force of ecological communities, the mechanisms underlying the inter-specific associations between ecosystem engineers and resource users are poorly understood. A proper knowledge of these mechanisms is, however, essential to understand how communities are structured. Previous studies suggest that increasing the quantity of resources provided by ecosystem engineers enhances populations of resource users. In a long-term study (1995-2011), we show that the quality of the resources (i.e. tree cavities) provided by ecosystem engineers is also a key feature that explains the inter-specific associations in a tree cavity-nest web. Red-naped sapsuckers (Sphyrapicusnuchalis) provided the most abundant cavities (52% of cavities, 0.49 cavities/ha). These cavities were less likely to be used than other cavity types by mountain bluebirds (Sialiacurrucoides), but provided numerous nest-sites (41% of nesting cavities) to tree swallows (Tachycinetabicolour). Swallows experienced low reproductive outputs in northern flicker (Colaptesauratus) cavities compared to those in sapsucker cavities (1.1 vs. 2.1 fledglings/nest), but the highly abundant flickers (33% of cavities, 0.25 cavities/ha) provided numerous suitable nest-sites for bluebirds (58%). The relative shortage of cavities supplied by hairy woodpeckers (Picoidesvillosus) and fungal/insect decay (<10% of cavities each, <0.09 cavities/ha) provided fewer breeding opportunities (<15% of nests), but represented high quality nest-sites for both bluebirds and swallows. Because both the quantity and quality of resources supplied by different ecosystem engineers may explain the amount of resources used by each resource user, conservation strategies may require different management actions to be implemented for the key ecosystem engineer of each resource user. We, therefore, urge the incorporation of both resource quantity and quality into models that assess community dynamics to

  1. Resource Quantity and Quality Determine the Inter-Specific Associations between Ecosystem Engineers and Resource Users in a Cavity-Nest Web

    PubMed Central

    Robles, Hugo; Martin, Kathy

    2013-01-01

    While ecosystem engineering is a widespread structural force of ecological communities, the mechanisms underlying the inter-specific associations between ecosystem engineers and resource users are poorly understood. A proper knowledge of these mechanisms is, however, essential to understand how communities are structured. Previous studies suggest that increasing the quantity of resources provided by ecosystem engineers enhances populations of resource users. In a long-term study (1995-2011), we show that the quality of the resources (i.e. tree cavities) provided by ecosystem engineers is also a key feature that explains the inter-specific associations in a tree cavity-nest web. Red-naped sapsuckers (Sphyrapicusnuchalis) provided the most abundant cavities (52% of cavities, 0.49 cavities/ha). These cavities were less likely to be used than other cavity types by mountain bluebirds (Sialiacurrucoides), but provided numerous nest-sites (41% of nesting cavities) to tree swallows (Tachycinetabicolour). Swallows experienced low reproductive outputs in northern flicker (Colaptesauratus) cavities compared to those in sapsucker cavities (1.1 vs. 2.1 fledglings/nest), but the highly abundant flickers (33% of cavities, 0.25 cavities/ha) provided numerous suitable nest-sites for bluebirds (58%). The relative shortage of cavities supplied by hairy woodpeckers (Picoidesvillosus) and fungal/insect decay (<10% of cavities each, <0.09 cavities/ha) provided fewer breeding opportunities (<15% of nests), but represented high quality nest-sites for both bluebirds and swallows. Because both the quantity and quality of resources supplied by different ecosystem engineers may explain the amount of resources used by each resource user, conservation strategies may require different management actions to be implemented for the key ecosystem engineer of each resource user. We, therefore, urge the incorporation of both resource quantity and quality into models that assess community dynamics to

  2. Development of PCR primers for specific amplification of two distinct regions of the genomes of San Miguel sea-lion and vesicular exanthema of swine viruses.

    PubMed

    Neill, J D; Seal, B S

    1995-02-01

    The San Miguel sea-lion viruses (SMSV) and vesicular exanthema of swine viruses (VESV) are members of the calicivirus family and aetiologic agents of vesicular disease in susceptible hosts. These two virus groups have been shown by several serological methods to be closely related antigenically. To further examine their relatedness, two sets of non-degenerate oligonucleotide primers were designed for the specific amplification of two distinct regions of the SMSV and VESV genomes using a reverse transcriptase-polymerase chain reaction (RT-PCR) protocol. The sequence of the primers were based on the nucleotide sequence of SMSV serotypes 1 and 4. The RNAs from a number of SMSV serotypes and a single VESV isolate were used as template in this study. These included SMSV serotypes 1, 2, 4, 5, 6, 7, 13 and 14 and VESV serotype A48. Also included in this study were Tillamook calicivirus (Bos-1 calicivirus, BCV) and a recently isolated skunk calicivirus (SCV). The first primer set amplified a 357-bp fragment from the 2C-like or RNA-helicase-encoding region (11 of 11 viruses) and the second set amplified a fragment from the RNA-dependent RNA polymerase region (520 bp, 9 of 11 viruses). These primer sets did not amplify product from either feline calicivirus or mink calicivirus. The results of this study demonstrate the genetic relatedness of SMSV and VESV and the potential usefulness of RT-PCR to detect and identify these viruses in diagnostic and routine screening applications.

  3. Sensitivity and specificity of a nested polymerase chain reaction for detection of lentivirus infection in lions (Panthera leo).

    PubMed

    Adams, Hayley; van Vuuren, Moritz; Kania, Stephen; Bosman, Anna-Mari; Keet, Dewald; New, John; Kennedy, Melissa

    2010-12-01

    Feline immunodeficiency virus (FIV) is a lentivirus in the Retroviridae family that causes lifelong infection in domestic cats. The lentivirus of African lions (Panthera leo), referred to as FIVple, is endemic in certain lion populations in eastern and southern Africa. Lentivirus infection leads to immunologic dysfunction and immunosuppressive disease in domestic cats; however, little is known about the pathogenic effects of infection in lions, nor about the epidemiologic impact on free-ranging and captive populations. Whole blood and serum samples were collected opportunistically from free-ranging lions in Kruger National Park, Republic of South Africa (RSA). Whole blood and serum samples were also collected from captive wild lions in the RSA. A nested polymerase chain reaction (PCR) assay for detection of FIV was performed on all whole blood samples. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and puma lentivirus synthetic envelope peptide antigen. The PCR assay successfully amplified the lion lentivirus from African lions. The relative sensitivity and relative specificity were 79% and 100%, respectively, and the positive and negative predictive values were 100% and 67%, respectively. This research represents the first study to compare genetic material with antibody-based methods of lentivirus detection on lions in RSA. Using PCR as an additional diagnostic test for FIV in lions will increase screening sensitivity and will allow viral characterization among circulating isolates and monitoring of changes in the viral epidemiology within geographic regions and populations over time.

  4. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

    PubMed Central

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

    2016-01-01

    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  5. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA.

    PubMed

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

    2016-02-16

    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA.

  6. Rapid detection and identification of Candida albicans and Torulopsis (Candida) glabrata in clinical specimens by species-specific nested PCR amplification of a cytochrome P-450 lanosterol-alpha-demethylase (L1A1) gene fragment.

    PubMed Central

    Burgener-Kairuz, P; Zuber, J P; Jaunin, P; Buchman, T G; Bille, J; Rossier, M

    1994-01-01

    PCR of a Candida albicans cytochrome P-450 lanosterol-alpha-demethylase (P450-L1A1) gene segment is a rapid and sensitive method of detection in clinical specimens. This enzyme is a target for azole antifungal action. In order to directly detect and identify the clinically most important species of Candida, we cloned and sequenced 1.3-kbp fragments of the cytochrome P450-L1A1 genes from Torulopsis (Candida) glabrata and from Candida krusei. These segments were compared with the published sequences from C. albicans and Candida tropicalis. Amplimers for gene sequences highly conserved throughout the fungal kingdom were first used; positive PCR results were obtained for C. albicans, T. glabrata, C. krusei, Candida parapsilosis, C. tropicalis, Cryptococcus neoformans, and Trichosporon beigelii DNA extracts. Primers were then selected for a highly variable region of the gene, allowing the species-specific detection from purified DNA of C. albicans, T. glabrata, C. krusei, and C. tropicalis. The assay sensitivity as tested for C. albicans in seeded clinical specimens such as blood, peritoneal fluid, or urine was 10 to 20 cells per 0.1 ml. Compared with results obtained by culture, the sensitivity, specificity, and efficiency of the species-specific nested PCR tested with 80 clinical specimens were 71, 95, and 83% for C. albicans and 100, 97, and 98% for T. glabrata, respectively. Images PMID:7989540

  7. Development of SYBR green-based real-time PCR and duplex nested PCR assays for quantitation and differential detection of species- or type-specific porcine Torque teno viruses.

    PubMed

    Huang, Y W; Dryman, B A; Harrall, K K; Vaughn, E M; Roof, M B; Meng, X J

    2010-12-01

    Porcine Torque teno virus (TTV), a single-stranded circular DNA virus, has been incriminated in swine diseases recently. Multiple infection with porcine TTV species 1 (PTTV1) and species 2 (PTTV2), each consisting of two types (PTTV1a and 1b) or subtypes (PTTV2b and 2c), in a single pig had been reported by our group previously. The present study described three novel assays for quantitation and differential detection of porcine TTV. First, we developed two SYBR green-based real-time PCR assays to quantify viral loads of two porcine TTV species, respectively. The PTTV1- and PTTV2-specific real-time PCR primer sequences were selected to target conserved regions identified by multiple alignments of ten available porcine TTV full-length genomes. Furthermore, by coupling the two singleplex PCR assays, a duplex real-time PCR assay followed by melting curve analysis was established for simultaneous detection and differentiation of PTTV1 and PTTV2. In addition, a type-specific duplex nested PCR was also developed to simultaneously detect and distinguish between the two types, PTTV1a and 1b, in PTTV1 species. These assays provide rapid and practical tools for molecular diagnosis of species- or type-specific porcine TTV.

  8. Microeukaryotic diversity in the extreme environments of the Iberian Pyrite Belt: a comparison between universal and fungi-specific primer sets, temperature gradient gel electrophoresis and cloning.

    PubMed

    Gadanho, Mário; Sampaio, José Paulo

    2006-07-01

    The Iberian Pyrite Belt extends from Portugal to Spain and is one of the most important pyrite regions in the world. Its aquatic reservoirs display extreme conditions characterized by low pH and high concentrations of heavy metals. In this study, the diversity of microeukaryotes was analysed at the abandoned mines of São Domingos (Portugal) and at Rio Tinto (Spain). DNA was extracted from water samples and a set of eukaryotic universal primers directed to the small subunit rRNA genes (rDNA) was used. The amplicons were analysed by molecular cloning and temperature gradient gel electrophoresis (TGGE). In addition, a fungi-specific primer set was also used in TGGE experiments. The fungi-specific primers contributed to a substantial increase in the number of fungal taxa found due, probably, to the relative low density of fungal structures. Several microorganisms, belonging (or closely related) to the ascomycetous yeast Pichia acaciae, the basidiomycetous yeasts Cryptococcus humicola and Cystofilobasidium bisporidii, the green algae Chlamydomonas noctigama and Chlorella protothecoides var. acidicola and some uncultured microeukaryotes were present at both localities, which suggests that specific microorganisms are adapted to the peculiar conditions of the Iberian Pyrite Belt extreme environments. However, in spite of the similarities, a higher algal richness was observed at S. Domingos, whereas for R. Tinto the richness of fungi was more prominent.

  9. Design of Vibrio 16S rRNA gene specific primers and their application in the analysis of seawater Vibrio community

    NASA Astrophysics Data System (ADS)

    Liu, Yong; Yang, Guanpin; Wang, Hualei; Chen, Jixiang; Shi, Xianming; Zou, Guiwei; Wei, Qiwei; Sun, Xiuqin

    2006-04-01

    The pathogenic species of genus Vibrio cause vibriosis, one of the most prevalent diseases of maricultured animals and seafood consumers. Monitoring their kinetics in the chain of seafood production, processing and consumption is of great importance for food and mariculture safety. In order to enrich Vibrio-representing 16S ribosomal RNA gene (rDNA) fragments and identify these bacteria further real-timely and synchronously among bacterial flora in the chain, a pair of primers that selectively amplify Vibrio 16S rDNA fragments were designed with their specificities and coverage testified in the analysis of seawater Vibrio community. The specificities and coverage of two primers, VF169 and VR744, were determined theoretically among bacterial 16S rDNAs available in GenBank by using BLAST program and practically by amplifying, Vibrio 16S rDNA fragments from seawater DNA. More than 88.3% of sequences in GenBank, which showed identical matches with VR744, belong to Vibrio genus. A total of 33 clones were randomly selected and sequenced. All of the sequences showed their highest similarities to and clustered around those of diverse known Vibrio species. The primers designed are capable of retrieving a wide range of Vibrio 16S rDNA fragments specifically among bacterial flora in seawater, the most important natural environment of seafood cultivation.

  10. Accurate Estimation of Fungal Diversity and Abundance through Improved Lineage-Specific Primers Optimized for Illumina Amplicon Sequencing

    PubMed Central

    Walters, William A.; Lennon, Niall J.; Bochicchio, James; Krohn, Andrew; Pennanen, Taina

    2016-01-01

    ABSTRACT While high-throughput sequencing methods are revolutionizing fungal ecology, recovering accurate estimates of species richness and abundance has proven elusive. We sought to design internal transcribed spacer (ITS) primers and an Illumina protocol that would maximize coverage of the kingdom Fungi while minimizing nontarget eukaryotes. We inspected alignments of the 5.8S and large subunit (LSU) ribosomal genes and evaluated potential primers using PrimerProspector. We tested the resulting primers using tiered-abundance mock communities and five previously characterized soil samples. We recovered operational taxonomic units (OTUs) belonging to all 8 members in both mock communities, despite DNA abundances spanning 3 orders of magnitude. The expected and observed read counts were strongly correlated (r = 0.94 to 0.97). However, several taxa were consistently over- or underrepresented, likely due to variation in rRNA gene copy numbers. The Illumina data resulted in clustering of soil samples identical to that obtained with Sanger sequence clone library data using different primers. Furthermore, the two methods produced distance matrices with a Mantel correlation of 0.92. Nonfungal sequences comprised less than 0.5% of the soil data set, with most attributable to vascular plants. Our results suggest that high-throughput methods can produce fairly accurate estimates of fungal abundances in complex communities. Further improvements might be achieved through corrections for rRNA copy number and utilization of standardized mock communities. IMPORTANCE Fungi play numerous important roles in the environment. Improvements in sequencing methods are providing revolutionary insights into fungal biodiversity, yet accurate estimates of the number of fungal species (i.e., richness) and their relative abundances in an environmental sample (e.g., soil, roots, water, etc.) remain difficult to obtain. We present improved methods for high-throughput Illumina sequencing of the

  11. A multiplex nested PCR assay for simultaneous detection of Corchorus golden mosaic virus and a phytoplasma in white jute (Corchorus capsularis L.).

    PubMed

    Biswas, C; Dey, P; Satpathy, S

    2013-05-01

    A multiplex nested PCR assay was developed by optimizing reaction components and reaction cycling parameters for simultaneous detection of Corchorus golden mosaic virus (CoGMV) and a phytoplasma (Group 16Sr V-C) causing little leaf and bunchy top in white jute (Corchorus capsularis). Three sets of specific primers viz. a CoGMV specific (DNA-A region) primer, a 16S rDNA universal primer pair P1/P7 and nested primer pair R16F2n/R2 for phytoplasmas were used. The concentrations of the PCR components such as primers, MgCl2 , Taq DNA polymerase, dNTPs and PCR conditions including annealing temperature and amplification cycles were examined and optimized. Expected fragments of 1 kb (CoGMV), 674 bp (phytoplasma) and 370 bp (nested R16F2n/R2) were successfully amplified by this multiplex nested PCR system ensuring simultaneous, sensitive and specific detection of the phytoplasma and the virus. The multiplex nested PCR provides a sensitive, rapid and low-cost method for simultaneous detection of jute little leaf phytoplasma and CoGMV. Based on BLASTn analyses, the phytoplasma was found to belong to the Group 16Sr V-C.

  12. PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers

    Treesearch

    M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga

    2004-01-01

    The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...

  13. Avian growth and development rates and age-specific mortality: the roles of nest predation and adult mortality.

    PubMed

    Remes, V

    2007-01-01

    Previous studies have shown that avian growth and development covary with juvenile mortality. Juveniles of birds under strong nest predation pressure grow rapidly, have short incubation and nestling periods, and leave the nest at low body mass. Life-history theory predicts that parental investment increases with adult mortality rate. Thus, developmental traits that depend on the parental effort exerted (pre- and postnatal growth rate) should scale positively with adult mortality, in contrast to those that do not have a direct relationship with parental investment (timing of developmental events, e.g. nest leaving). I tested this prediction on a sample of 84 North American songbirds. Nestling growth rate scaled positively and incubation period duration negatively with annual adult mortality rates even when controlled for nest predation and other covariates, including phylogeny. On the contrary, neither the duration of the nestling period nor body mass at fledging showed any relationship. Proximate mechanisms generating the relationship of pre- and postnatal growth rates to adult mortality may include increased feeding, nest attentiveness during incubation and/or allocation of hormones, and deserve further attention.

  14. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    PubMed

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera.

  15. Degenerate and Nested PCR: a Highly Sensitive and Specific Method for Detection of Human Papillomavirus Infection in Cutaneous Warts

    PubMed Central

    Harwood, Catherine A.; Spink, Patricia J.; Surentheran, T.; Leigh, Irene M.; de Villiers, Ethel-Michele; McGregor, Jane M.; Proby, Charlotte M.; Breuer, Judith

    1999-01-01

    The role of human papillomavirus (HPV) in anogenital carcinogenesis is firmly established, but evidence that supports a similar role in skin remains speculative. Immunosuppressed renal transplant recipients have an increased incidence of viral warts and nonmelanoma skin cancer, and the presence of HPV DNA in these lesions, especially types associated with the condition epidermodysplasia verruciformis (EV), has led to suggestions that HPV may play a pathogenic role. However, differences in the specificities and sensitivities of techniques used to detect HPV in skin have led to wide discrepancies in the spectrum of HPV types reported. We describe a degenerate nested PCR technique with the capacity to detect a broad spectrum of cutaneous, mucosal, and EV HPV types. In a series of 51 warts from 23 renal transplant recipients, this method detected HPV DNA in all lesions, representing a significant improvement over many previously published studies. Cutaneous types were found in 84.3% of warts and EV types were found in 80.4% of warts, whereas mucosal types were detected in 27.4% of warts. In addition, the method allowed codetection of two or more distinct HPV types in 94.1% of lesions. In contrast, single HPV types were detected in all but 1 of 20 warts from 15 immunocompetent individuals. In summary, we have established a highly sensitive and comprehensive degenerate PCR methodology for detection and genotyping of HPV from the skin and have demonstrated a diverse spectrum of multiple HPV types in cutaneous warts from transplant recipients. Studies designed to assess the significance of these findings to cutaneous carcinogenesis are under way. PMID:10523550

  16. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    PubMed Central

    Wang, Deguo; Liu, Yanhong

    2015-01-01

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies. PMID:26016433

  17. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    PubMed

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  18. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  19. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  20. Triangular Nests!

    ERIC Educational Resources Information Center

    Powell, R. I.

    2002-01-01

    Shows how integer-sided triangles can be nested, each nest having a single enclosing isosceles triangle. Brings to light what can be seen as a relatively simple generalization of Pythagoras' theorem, a result that should be readily accessible to many secondary school pupils. (Author/KHR)

  1. Triangular Nests!

    ERIC Educational Resources Information Center

    Powell, R. I.

    2002-01-01

    Shows how integer-sided triangles can be nested, each nest having a single enclosing isosceles triangle. Brings to light what can be seen as a relatively simple generalization of Pythagoras' theorem, a result that should be readily accessible to many secondary school pupils. (Author/KHR)

  2. Detection of first-line anti-tuberculosis drug resistance mutations by allele-specific primer extension on a microsphere-based platform.

    PubMed

    Lee, Seung Heon; Choi, Hee Baeg; Yu, Sung Yul; Chang, Uck Jin; Kim, Chang Ki; Kim, Hee Jin

    2015-09-01

    Resistance of Mycobacterium tuberculosis to anti-tuberculosis (TB) drugs is almost exclusively due to spontaneous chromosomal mutations in target genes. Rapid detection of drug resistance to both first- and second-line anti-TB drugs has become a key component of TB control programs. Technologies that allow rapid, cost-effective, and high-throughput detection of specific nucleic acid sequences are needed. This study was to develop a high-throughput assay based on allele-specific primer extension (ASPE) and MagPlex-TAG microspheres to detect anti-TB drug resistance mutations. DNA samples from 357 M. tuberculosis clinical isolates and H37Rv were amplified by multiplex PCR using four primer sets, followed by multiplex ASPE using 23 TAG-ASPE primers. The products were sorted on the TAG-ASPE array and detected by using the Luminex xMAP system. Genotypes were also determined by sequencing. Genetic drug susceptibility typing by the TAG-ASPE method was 100% concordant with those obtained by sequencing. Compared with phenotypic drug susceptibility testing (DST) as a reference method, the sensitivity and specificity of the TAG-ASPE method were 83% (95% confidence interval [CI], 79-88%) and 97% (95% CI, 90-100%) for isoniazid. For rifampin testing, the sensitivity and specificity were 90% (95% CI, 86-93%) and 100% (95% CI, 99-100%). Also, the sensitivity and specificity were 58% (95% CI, 51-65%) and 86% (95% CI, 79-93%) for ethambutol. This study demonstrated the TAG-ASPE method is suitable for highly reproducible, cost-effective, and high-throughput clinical genotyping applications.

  3. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  4. Novel polymerase chain reaction primers for the specific detection of bacterial copper P-type ATPases gene sequences in environmental isolates and metagenomic DNA.

    PubMed

    De la Iglesia, R; Valenzuela-Heredia, D; Pavissich, J P; Freyhoffer, S; Andrade, S; Correa, J A; González, B

    2010-06-01

    In the last decades, the worldwide increase in copper wastes release by industrial activities like mining has driven environmental metal contents to toxic levels. For this reason, the study of the biological copper-resistance mechanisms in natural environments is important. Therefore, an appropriate molecular tool for the detection and tracking of copper-resistance genes was developed. In this work, we designed a PCR primer pair to specifically detect copper P-type ATPases gene sequences. These PCR primers were tested in bacterial isolates and metagenomic DNA from intertidal marine environments impacted by copper pollution. As well, T-RFLP fingerprinting of these gene sequences was used to compare the genetic composition of such genes in microbial communities, in normal and copper-polluted coastal environments. New copper P-type ATPases gene sequences were found, and a high degree of change in the genetic composition because of copper exposure was also determined. This PCR based method is useful to track bacterial copper-resistance gene sequences in the environment. This study is the first to report the design and use of a PCR primer pair as a molecular marker to track bacterial copper-resistance determinants, providing an excellent tool for long-term analysis of environmental communities exposed to metal pollution.

  5. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities

    PubMed Central

    2016-01-01

    ABSTRACT The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3′ end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. IMPORTANCE The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential

  6. The cavity-nest ant Temnothorax crassispinus prefers larger nests.

    PubMed

    Mitrus, S

    Colonies of the ant Temnothorax crassispinus inhabit mostly cavities in wood and hollow acorns. Typically in the field, nest sites that can be used by the ant are a limited resource. In a field experiment, it was investigated whether the ants prefer a specific size of nest, when different ones are available. In July 2011, a total of 160 artificial nests were placed in a beech-pine forest. Four artificial nests (pieces of wood with volume cavities, ca 415, 605, 730, and 980 mm(3), respectively) were located on each square meter of the experimental plot. One year later, shortly before the emergence of new sexuals, the nests were collected. In July 2012, colonies inhabited more frequently bigger nests. Among queenright colonies, the ones which inhabited bigger nests had more workers. However, there was no relationship between volume of nest and number of workers for queenless colonies. Queenright colonies from bigger nests produced more sexual individuals, but there was no correlation between number of workers and sex allocation ratio, or between volume of nest and sex allocation ratio. In a laboratory experiment where ant colonies were kept in 470 and 860 mm(3) nests, larger colonies allocated more energy to produce sexual individuals. The results of this study show the selectivity of T. crassispinus ants regarding the size of nest cavity, and that the nest volume has an impact on life history parameters.

  7. Development of species-specific diagnostic primers for Zoophthora radicans and Pandora blunckii; two co-occurring fungal pathogens of the diamondback moth, Plutella xylostella.

    PubMed

    Guzmán-Franco, Ariel W; Atkins, Simon D; Alderson, Peter G; Pell, Judith K

    2008-10-01

    Species-specific primers for Zoophthora radicans and Pandora bluckii were developed. To achieve this, partial sequences of DNA that encode for rRNA, more specifically, the ITS region (rDNA-ITS) were obtained from different isolates and analysed. Seven Z. radicans isolates (four from P. xylostella, and three from other lepidopteran hosts) and one P. blunckii isolate (from P. xylostella) were used. These isolates were selected based on PCR-RFLP patterns obtained from 22 isolates of P. blunckii and 39 isolates of Z. radicans. All P. blunckii isolates were from the same host (P. xylostella); 20 isolates were from Mexico, one from the Philippines, and one from Germany. The Z. radicans isolates were more diverse in geographical origin (Mexico, Kenya, Japan, New Zealand, Australia, Taiwan, Philippines, Malaysia, Uruguay, France, USA, Poland, Indonesia, Switzerland, Israel, China, and Denmark) and host origin (Lepidoptera, Hemiptera, Hymentoptera, and Diptera). Using conventional PCR, each pair of species-specific primers successfully detected each species of fungus from DNA extracted from infected host larvae either single- or dual-inoculated with both fungal species. The PCR-RFLP analysis also showed that Z. radicans was genetically more diverse than P. blunckii, although only a limited number of P. blunckii isolates from one country were considered. There was no direct relationship between genetic diversity and host or geographical origin. The relationship between genetic variation within both fungal species and host specificity or ecological adaptation is discussed.

  8. Nested PCR for ultrasensitive detection of the potato ring rot bacterium, Clavibacter michiganensis subsp. sepedonicus.

    PubMed Central

    Lee, I M; Bartoszyk, I M; Gundersen, D E; Mogen, B; Davis, R E

    1997-01-01

    Oligonucleotide primers derived from sequences of the 16S rRNA gene (CMR16F1, CMR16R1, CMR16F2, and CMR16R2) and insertion element IS1121 of Clavibacter michiganensis subsp. sepedonicus (CMSIF1, CMSIR1, CMSIF2, and CMISR2) were used in nested PCR to detect the potato ring rot bacterium C. michiganensis subsp. sepedonicus. Nested PCR with primer pair CMSIF1-CMSIR1 followed by primer pair CMSIF2-CMSIR2 specifically detected C. michiganensis subsp. sepedonicus, while nested PCR with CMR16F1-CMR16R1 followed by CMR16F2-CMR16R2 detected C. michiganensis subsp. sepedonicus and the other C. michiganensis subspecies. In the latter case, C. michiganensis subsp. sepedonicus can be differentiated from the other subspecies by restriction fragment length polymorphism (RFLP) analyses of the nested PCR products (16S rDNA sequences). The nested PCR assays developed in this work allow ultrasensitive detection of very low titers of C. michiganensis subsp. sepedonicus which may be present in symptomiess potato plants or tubers and which cannot be readily detected by direct PCR (single PCR amplification). RFLP analysis of PCR products provides for an unambiguous confirmation of the identify of C. michiganensis subsp. sepedonicus. PMID:9212412

  9. Nested PCR for ultrasensitive detection of the potato ring rot bacterium, Clavibacter michiganensis subsp. sepedonicus.

    PubMed

    Lee, I M; Bartoszyk, I M; Gundersen, D E; Mogen, B; Davis, R E

    1997-07-01

    Oligonucleotide primers derived from sequences of the 16S rRNA gene (CMR16F1, CMR16R1, CMR16F2, and CMR16R2) and insertion element IS1121 of Clavibacter michiganensis subsp. sepedonicus (CMSIF1, CMSIR1, CMSIF2, and CMISR2) were used in nested PCR to detect the potato ring rot bacterium C. michiganensis subsp. sepedonicus. Nested PCR with primer pair CMSIF1-CMSIR1 followed by primer pair CMSIF2-CMSIR2 specifically detected C. michiganensis subsp. sepedonicus, while nested PCR with CMR16F1-CMR16R1 followed by CMR16F2-CMR16R2 detected C. michiganensis subsp. sepedonicus and the other C. michiganensis subspecies. In the latter case, C. michiganensis subsp. sepedonicus can be differentiated from the other subspecies by restriction fragment length polymorphism (RFLP) analyses of the nested PCR products (16S rDNA sequences). The nested PCR assays developed in this work allow ultrasensitive detection of very low titers of C. michiganensis subsp. sepedonicus which may be present in symptomiess potato plants or tubers and which cannot be readily detected by direct PCR (single PCR amplification). RFLP analysis of PCR products provides for an unambiguous confirmation of the identify of C. michiganensis subsp. sepedonicus.

  10. Improving PCR detection of prey in molecular diet studies: importance of group-specific primer set selection and extraction protocol performances.

    PubMed

    Zarzoso-Lacoste, Diane; Corse, Emmanuel; Vidal, Eric

    2013-01-01

    While the morphological identification of prey remains in predators' faeces is the most commonly used method to study trophic interactions, many studies indicate that this method does not detect all consumed prey. Polymerase chain reaction-based methods are increasingly used to detect prey DNA in the predator food bolus and have proven efficient, delivering highly accurate results. When studying complex diet samples, the extraction of total DNA is a critical step, as polymerase chain reaction (PCR) inhibitors may be co-extracted. Another critical step involves a careful selection of suitable group-specific primer sets that should only amplify DNA from the targeted prey taxon. In this study, the food boluses of five Rattus rattus and seven Rattus exulans were analysed using both morphological and molecular methods. We tested a panel of 31 PCR primer pairs targeting bird, invertebrate and plant sequences; four of them were selected to be used as group-specific primer pairs in PCR protocols. The performances of four DNA extraction protocols (QIAamp(®) DNA stool mini kit, DNeasy(®) mericon food kit and two of cetyltrimethylammonium bromide-based methods) were compared using four variables: DNA concentration, A(260) /A(280) absorbance ratio, food compartment analysed (stomach or faecal contents) and total number of prey-specific PCR amplification per sample. Our results clearly indicate that the A(260) /A(280) absorbance ratio, which varies between extraction protocols, is positively correlated to the number of PCR amplifications of each prey taxon. We recommend using the DNeasy(®) mericon food kit (QIAGEN), which yielded results very similar to those achieved with the morphological approach. © 2012 Blackwell Publishing Ltd.

  11. Nested Cohort

    Cancer.gov

    NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.

  12. Development of allele-specific primer PCR for a swine TLR2 SNP and comparison of the frequency among several pig breeds of Japan and the Czech Republic.

    PubMed

    Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor

    2012-05-01

    In the present study, we have developed an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 2 (TLR2) (C406G), which is related to the prevalence of pneumonia caused by Mycoplasma hyopneumoniae. We also compared the allele frequency among several pig breeds of Japan and the Czech Republic. Allele-specific primers were constructed by introducing 1-base mismatch sequence before the SNP site. The swine TLR2 C406G mutation was successfully determined by the ASP-PCR using genomic DNA samples in Japan as previously genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from pig blood obtained from 110 pigs from 7 different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR were completely matched with the results from the sequencing method. The allele frequency of the swine TLR2 C406G mutation was 27.5% in the Czech Republic and 3.6% in Japan. The C406G mutation was only found in the Landrace breed in Japan, and was almost exclusively found in the Landrace breed in the Czech Republic as well. These results indicated the usefulness of ASP-PCR for detecting a specific SNP for swine TLR2.

  13. Use of cadA-Specific Primers and DNA Probes as Tools to Select Cadmium Biosorbents with Potential in Remediation Strategies.

    PubMed

    Icgen, Bulent; Yilmaz, Fadime

    2016-05-01

    Biosorption, using cadmium-resistant bacterial isolates, is often regarded as a relatively inexpensive and efficient way of cleaning up wastes, sediments, or soils polluted with cadmium. Therefore, many efforts have been devoted to the isolation of cadmium-resistant isolates for the efficient management of cadmium remediation processes. However, isolation, identification and in situ screening of efficient cadmium-resistant isolates are primary challenges. To overcome these challanges, in this study, cadA, cadmium resistance coding gene, specific primers and DNA probes were used to identify and screen cadmium-resistant bacteria in the cadmium-polluted river waters through polymerase chain reaction (PCR) and fluorescein in situ hybridization (FISH). PCR amplification of the cadA amplicon coupled with 16S rRNA sequencing revealed various gram-positive and -negative bacterial isolates harboring cadA. Accordingly, a cadA-mediated DNA probe was prepared and used for in situ screening of cadmium-resistant isolates from water samples collected from cadmium-polluted river waters. The FISH analyses of cadA probe showed highly specific and efficient hybridization with cadA harboring isolates. The use of primers and DNA probes specific for cadA gene seems to be very helpful tools for the selection and screening of cadmium biosorbents with potential to be used in the remediation of cadmium-polluted sites.

  14. Specific detection and identification of [Actinobacillus] muris by PCR using primers targeting the 16S-23S rRNA internal transcribed spacer regions.

    PubMed

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin

    2013-08-01

    [Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Quantitative polymerase chain reaction analysis with allele-specific oligonucleotide primers for individual IgH VDJ regions to evaluate tumor burden in myeloma patients.

    PubMed

    Sata, Hiroshi; Shibayama, Hirohiko; Maeda, Ikuhiro; Habuchi, Yoko; Nakatani, Eiji; Fukushima, Kentaro; Fujita, Jiro; Ezoe, Sachiko; Tadokoro, Seiji; Maeda, Tetsuo; Mizuki, Masao; Kosugi, Satoru; Nakagawa, Masashi; Ueda, Shuji; Iida, Masato; Tokumine, Yukihiro; Azenishi, Yasuhiko; Mitsui, Hideki; Oritani, Kenji; Kanakura, Yuzuru

    2015-05-01

    Quantitative polymerase chain reaction (PCR) with patient-specific, allele-specific oligonucleotide (ASO) primers for individual immunoglobulin H VDJ region (ASO-PCR) amplification was performed using several sources of clinical material, including mRNA from peripheral blood cells (PBMNCs), whole bone marrow cells (BMMNCs), and the CD20+ CD38- B-cell population in bone marrow, as well as cell-free DNA from the sera of patients with multiple myeloma (MM). We designed the ASO primers and produced sufficient PCR fragments to evaluate tumor burden in 20 of 30 bone marrow samples at diagnosis. Polymerase chain reaction amplification efficiency depended on primer sequences because the production of ASO-PCR fragments did not correlate with serum M-protein levels. However, the ASO-PCR levels in BMMNCs showed statistically significant correlations with those in PBMNCs and CD20+ CD38- B-cells. The good association between the BMMNC and PBMNC data indicated that PBMNCs could be a suitable source for monitoring minimal residual disease (MRD). In the case of cell-free DNA, ASO-PCR levels showed a unique pattern and remained high even after treatment. Because the sequence information for each ASO-PCR product was identical to the original, the cell-free DNA might also be useful for evaluating MRD. Moreover, the ASO-PCR products were clearly detected in 17 of 22 mRNA samples from CD20+ CD38- populations, suggesting that MM clones might exist in relatively earlier stages of B cells than in plasma cells. Thus, ASO-PCR analysis using various clinical materials is useful for detecting MRD in MM patients as well as for clarifying MM pathogenesis. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  16. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    PubMed

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  17. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    USGS Publications Warehouse

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  18. Explanatory chapter: PCR primer design.

    PubMed

    Álvarez-Fernández, Rubén

    2013-01-01

    This chapter is intended as a guide on polymerase chain reaction (PCR) primer design (for information on PCR, see General PCR and Explanatory Chapter: Troubleshooting PCR). In the next section, general guidelines will be provided, followed by a discussion on primer design for specific applications. A list of recommended software tools is shown at the end. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. The allele-specific probe and primer amplification assay, a new real-time PCR method for fine quantification of single-nucleotide polymorphisms in pooled DNA.

    PubMed

    Billard, A; Laval, V; Fillinger, S; Leroux, P; Lachaise, H; Beffa, R; Debieu, D

    2012-02-01

    The evolution of fungicide resistance within populations of plant pathogens must be monitored to develop management strategies. Such monitoring often is based on microbiological tests, such as microtiter plate assays. Molecular monitoring methods can be considered if the mutations responsible for resistance have been identified. Allele-specific real-time PCR approaches, such as amplification refractory mutation system (ARMS) PCR and mismatch amplification mutation assay (MAMA) PCR, are, despite their moderate efficacy, among the most precise methods for refining SNP quantification. We describe here a new real-time PCR method, the allele-specific probe and primer amplification assay (ASPPAA PCR). This method makes use of mixtures of allele-specific minor groove binder (MGB) TaqMan probes and allele-specific primers for the fine quantification of SNPs from a pool of DNA extracted from a mixture of conidia. It was developed for a single-nucleotide polymorphism (SNP) that is responsible for resistance to the sterol biosynthesis inhibitor fungicide fenhexamid, resulting in the replacement of the phenylalanine residue (encoded by the TTC codon) in position 412 of the enzymatic target (3-ketoreductase) by a serine (TCC), valine (GTC), or isoleucine (ATC) residue. The levels of nonspecific amplification with the ASPPAA PCR were reduced at least four times below the level of currently available allele-specific real-time PCR approaches due to strong allele specificity in amplification cycles, including two allele selectors. This new method can be used to quantify a complex quadriallelic SNP in a DNA pool with a false discovery rate of less than 1%.

  20. Identification of lipase encoding genes from Antarctic seawater bacteria using degenerate primers: expression of a cold-active lipase with high specific activity.

    PubMed

    Parra, Loreto P; Espina, Giannina; Devia, Javier; Salazar, Oriana; Andrews, Barbara; Asenjo, Juan A

    2015-01-01

    Cold-active enzymes are valuable catalysts showing high activity at low and moderate temperatures and low thermostability. Among cold-active enzymes, lipases offer a great potential in detergent, cosmetic, biofuel and food or feed industries. In this paper we describe the identification of novel lipase coding genes and the expression of a lipase with high activity at low temperatures. The genomic DNA from Antarctic seawater bacteria showing lipolytic activity at 4°C was used to amplify five DNA fragments that partially encode novel lipases using specifically designed COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOP). All the fragments were found to have a high identity with an α/β-hydrolase domain-containing protein identified by the sequencing of the complete genome of Shewanella frigidimarina NCIMB 400. The complete sequence of one of the lipase-coding gene fragments, lipE13, was obtained by genome walking. Considering that the other fragments had a high identity to the putative lipase from S. frigidimarina NCIMB 400, the complete lipase genes were amplified using oligonucleotide primers designed based on the 5' and 3' regions of the coding sequence of the related protein. This strategy allowed the amplification of 3 lipase-encoding genes of which one was expressed in the periplasm using the Escherichia coli BL21(DE3)/pET-22b(+) expression system. The recombinant protein was obtained with activity toward p-nitrophenyl caproate showing a high specific activity between 15 and 25°C.

  1. Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

    PubMed Central

    Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

  2. Neuraminidase subtyping of avian influenza viruses with PrimerHunter-designed primers and quadruplicate primer pools.

    PubMed

    Huang, Yanyan; Khan, Mazhar I; Khan, Mazhar; Măndoiu, Ion; Măndoiu, Ion I

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers.

  3. Testing the Specificity of Primers to Environmental Ammonia Monooxygenase (amoA) Genes in Groundwater Treated with Urea to Promote Calcite Precipitation

    SciTech Connect

    Freeman, S.; Reed, D.W.; Fujita, Y.

    2006-01-01

    Bacterial ammonia monooxygenase (amoA) genes in DNA isolated from microorganisms in groundwater were characterized by amplification of amoA DNA using polymerase chain reaction (PCR), Restriction Fragment Length Polymorphism (RFLP) analysis, and sequencing. The amoA gene is characteristic of ammonia oxidizing bacteria (AOB). The DNA extracts were acquired from an experiment where dilute molasses and urea were sequentially introduced into a well in the Eastern Snake River Plain Aquifer (ESRPA) in Idaho to examine whether such amendments could stimulate enhanced ureolytic activity. The hydrolysis of urea into ammonium and carbonate serves as the basis for a potential remediation technique for trace metals and radionuclide contaminants that can co-precipitate in calcite. The ammonium ion resulting from ureolysis can promote the growth of AOB. The goal of this work was to investigate the effectiveness of primers designed for quantitative PCR of environmental amoA genes and to evaluate the effect of the molasses and urea amendments upon the population diversity of groundwater AOB. PCR primers designed to target a portion of the amoA gene were used to amplify amoA gene sequences in the groundwater DNA extracts. Following PCR, amplified gene products were cloned and the clones were characterized by RFLP, a DNA restriction technique that can distinguish different DNA sequences, to gauge the initial diversity. Clones exhibiting unique RFLP patterns were subjected to DNA sequencing. Initial sequencing results suggest that the primers were successful at specific detection of amoA sequences and the RFLP analyses indicated that the diversity of detected amoA sequences in the ESRPA decreased with the additions of molasses and urea.

  4. Identification of new primer binding site mutations at TH01 and D13S317 loci and determination of their corresponding STR alleles by allele-specific PCR.

    PubMed

    Li, Fengrui; Xuan, Jinfeng; Xing, Jiaxin; Ding, Mei; Wang, Baojie; Pang, Hao

    2014-01-01

    Several commercial multiplex PCR kits for the amplification of short tandem repeat (STR) loci have been extensively applied in forensic genetics. Consequently, large numbers of samples have been genotyped, and the number of discordant genotypes observed has also increased. We observed allele dropout with two novel alleles at the STR loci TH01 and D13S317 during paternity testing using the AmpFℓSTR Identifiler PCR Amplification Kit. The lost alleles reappeared when alternative PCR primer pairs were used. A sequence analysis revealed a G-to-A substitution 82 bases downstream of the last TCAT motif of the repeat region at the TH01 locus (GenBank accession: D00269) and a G-to-T substitution 90 bases upstream of the first TATC motif of the repeat region at the D13S317 locus (GenBank accession: G09017). The frequencies of these two point mutations were subsequently investigated in the Chinese population using sequence-specific primer PCR (SSP-PCR), but neither of these mutations was detected in any of the samples tested. In addition, the DNA samples in which the mutations were identified were amplified to type the point mutations by SSP-PCR to determine the corresponding STR alleles at the two loci. Subsequently, the amplified PCR products with different point mutations and STR repeat numbers were directly sequenced because this strategy overcomes the appearance overlapping peaks generated by different STR alleles and accurately characterizes genotypes. Thus, our findings not only provide useful information for DNA databases and forensic identification but also establish an effective strategy for typing STR alleles with primer binding site mutations.

  5. PCR-based molecular discrimination of Pandora neoaphidis isolates from related entomopathogenic fungi and development of species-specific diagnostic primers.

    PubMed

    Tymon, Anna M; Shah, Paresh A; Pell, Judith K

    2004-04-01

    Studies were performed to assess the genetic variation amongst isolates of the aphid-pathogenic fungus Pandora neoaphidis (syn. Erynia neoaphidis). 37 isolates were examined, from a range of pest and non-pest aphid species, as well as 21 from eight other entomophthoralean species. Universal primers were used to amplify the ITS rDNA regions and all of the species tested produced discrete ITS groups, with the exception of Conidiobolus spp. Neighbour-joining analysis of the ITS2 regions from P. neoaphidis, P. kondoiensis and Zoophthora radicans demonstrated that these three species formed distinct groups with sequence identities of 58-82% between the groups. An ITS size of ca 1,100 bp was diagnostic for P. neoaphidis, while ca 1,450 bp was characteristic of P. kondoiensis. ITS-RFLP analysis failed to yield intraspecific polymorphisms in any of the P. neoaphidis isolates screened, although it was useful in distinguishing between different entomophthoralean species. Some intraspecific variation in the ITS region was detected in a number of isolates of Z. radicans and Conidiobolus spp. We propose that two isolates previously identified as P. neoaphidis based on conidia morphology, are actually P. kondoiensis based on molecular studies. Sequencing analysis of the complete ITS region from P. neoaphidis and P. kondoiensis allowed species-specific primers to be developed for P. neoaphidis and P. kondoiensis. These were used to screen aphids infected in laboratory bioassays and from field-collected samples, without prior isolation of the fungus. The primers are useful tools for quantifying the epizootiology of P. neoaphidis in aphid populations, as well as assessing competitive interactions between these two species.

  6. Sensitive and robust detection of citrus greening (huanglongbing) bacterium "Candidatus Liberibacter asiaticus" by DNA amplification with new 16S rDNA-specific primers.

    PubMed

    Fujikawa, Takashi; Iwanami, Toru

    2012-10-01

    Citrus greening disease is caused by "Candidatus Liberibacter spp.," including "Candidatus Liberibacter asiaticus (Las)." For detecting this disease, we designed new primers from the Las 16S rDNA and used a very small DNA template for PCR. More Las-infected tissues were detected with our primers than with the common primers. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus.

    PubMed

    Si, Wei; Zhou, Shun; Wang, Zhao; Cui, Shang-jin

    2010-05-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

  8. Molecular survey of Bartonella henselae and Bartonella clarridgeiae in pet cats across Japan by species-specific nested-PCR.

    PubMed

    Sato, S; Kabeya, H; Negishi, A; Tsujimoto, H; Nishigaki, K; Endo, Y; Maruyama, S

    2017-10-01

    Cats are known to be the main reservoir for Bartonella henselae and Bartonella clarridgeiae, which are the agents of 'cat-scratch disease' in humans. In the present study, we investigated the prevalence of the two Bartonella species on 1754 cat bloods collected from all prefectures in Japan during 2007-2008 by a nested-polymerase chain reaction (PCR) targeting the 16S-23S rRNA internal transcribed spacer region. Overall, Bartonella DNA was detected in 4·6% (80/1754) of the cats examined. The nested-PCR showed that 48·8% (39/80) of the positive cats were infected with B. henselae mono-infection, 33·8% (27/80) with B. clarridgeiae mono-infection and 17·5% (14/80) were infected with both species. The prevalence (5·9%; 65/1103) of Bartonella infection in the western part of Japan was significantly higher than that (2·3%; 15/651) of eastern Japan (P < 0·001). Statistical analysis of the cats examined suggested a significant association between Bartonella infection and FeLV infection (OR = 1·9; 95% CI = 1·1-3·4), but not with FIV infection (OR = 1·6; 95% CI = 1·0-2·6).

  9. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  10. Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

    PubMed

    Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

    2014-11-01

    To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  11. Retrospective monitoring of minimal residual disease using hairpin-shaped clone specific primers in B-cell lymphoma affected dogs.

    PubMed

    Gentilini, Fabio; Turba, Maria E; Forni, Monica

    2013-06-15

    Lymphoma is one of the most common forms of cancer in dogs as it is in humans but, unlike humans, the cure rates in canines are still very low. Despite the fact that high grade B-cell lymphomas are considered to be chemotherapy responsive, almost all treated dogs ultimately relapse and die due to the residual malignant lymphocytes, namely minimal residual disease (MRD). It would be extremely valuable for clinicians to detect, monitor and quantify MRD for risk group stratification, effective treatment intervention and outcome prediction. The PCRs targeting the Ig gene rearrangements constitute one of the most reliable tools to this end. We have recently validated a method which exploits hairpin-shaped primers for quantifying MRD. In the present study, that method is conveniently used for retrospectively monitoring MRD in the peripheral blood of 8 dogs diagnosed with B-cell lymphoma who underwent chemotherapy. All dogs attained complete remission. The median disease-free interval was 254.5 days (range 63-774) while the median survival time was 313.5 days (range 143-817 days). At admission, all dogs, except one which had already been treated with prednisone, had circulating neoplastic cells. All dogs attained complete remission (CR) which was almost always matched with a complete MRD response. The persistence of MRD despite apparent CR indicated a worse prognosis and a short duration of CR. Finally, the relapse is consistently anticipated by the reappearance of MRD in the peripheral blood. The study confirmed the suitability of an MRD monitoring assay as a clinical decision-making tool.

  12. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori

    PubMed Central

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-01-01

    AIM: To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). METHODS: The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. RESULTS: The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. CONCLUSION: The nested-ASP-PCR assay showed higher

  13. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

    PubMed

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-07-07

    To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and

  14. Identification and quantification of Lactobacillus casei strain Shirota in human feces with strain-specific primers derived from randomly amplified polymorphic DNA.

    PubMed

    Fujimoto, Junji; Matsuki, Takahiro; Sasamoto, Masae; Tomii, Yasuaki; Watanabe, Koichi

    2008-08-15

    Lactobacillus casei strain Shirota (LcS) has been used in the production of fermented milk products for many years and is one of the most intensively studied probiotics. To evaluate the ability of LcS to proliferate in human intestines after it has been ingested, we developed a PCR-based method to identify and quantify LcS using an LcS-specific primer set (pLcS) derived from a randomly amplified polymorphic DNA (RAPD) analysis. We confirmed the high specificity of the pLcS primer set in 167 bacterial strains (57 strains of L. casei and 110 other strains of bacteria commonly isolated from human feces). The method's ability to identify LcS matched that of an ELISA using a monoclonal antibody and a RAPD analysis in a representative sample of colonies cultured from human feces. The detection limit of quantitative PCR (qPCR) using pLcS was 10(4.6) per gram of feces. The number of LcS in feces detected with qPCR was highly and significantly correlated with the number of LcS added to fecal samples within the range of 10(4.6) to 10(9.6) per gram feces (r(2)=0.999, P<0.001). After 14 healthy subjects ingested 10(11.0) CFU of LcS daily for 7 days, 10(9.1+/-0.5) LcS g(-1) (mean+/-S.D.) was detected in the fecal samples of all subjects by qPCR, and 10(8.0+/-0.9) CFU g(-1) was detected by culture; these values were significantly different (P<0.001, paired t-test). After the subjects stopped ingesting LcS, fecal LcS counts obtained with both methods decreased daily. The values produced by the 2 methods might have differed because of an overestimation in the PCR analysis due to the presence of dead LcS cells or an underestimation in the culture system due to the use of selective culture media; however, dead LcS cells can also be beneficial as immunomodulators. We confirmed that qPCR with an LcS-specific primer set was a rapid and accurate method for determining the total amount of LcS in feces including dead or less active cells which could not be detected by culture method.

  15. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    PubMed

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

  16. Rapid Method for Species-Specific Identification of Vibrio cholerae Using Primers Targeted to the Gene of Outer Membrane Protein OmpW

    PubMed Central

    Nandi, Bisweswar; Nandy, Ranjan K.; Mukhopadhyay, Sarmishtha; Nair, G. Balakrish; Shimada, Toshio; Ghose, Asoke C.

    2000-01-01

    The distribution of genes for an outer membrane protein (OmpW) and a regulatory protein (ToxR) in Vibrio cholerae and other organisms was studied using respective primers and probes. PCR amplification results showed that all (100%) of the 254 V. cholerae strains tested were positive for ompW and 229 (∼98%) of 233 were positive for toxR. None of the 40 strains belonging to other Vibrio species produced amplicons with either ompW- or toxR-specific primers, while 80 bacterial strains from other genera tested were also found to be negative by the assay. These studies were extended with representative number of strains using ompW- and toxR-specific probes in DNA dot blot assay. While the V. cholerae strains reacted with ompW probe, only one (V. mimicus) out of 60 other bacterial strains tested showed weak recognition. In contrast, several strains belonging to other Vibrio species (e.g., V. mimicus, V. splendidus, V. alginolyticus, V. fluvialis, V. proteolyticus, V. aestuarianus, V. salmonicida, V. furnissii, and V. parahaemolyticus) showed weak to strong reactivity to the toxR probe. Restriction fragment length polymorphism analysis and nucleotide sequence data revealed that the ompW sequence is highly conserved among V. cholerae strains belonging to different biotypes and/or serogroups. All of these results suggest that the ompW gene can be targeted for the species-specific identification of V. cholerae strains. The scope of this study was further extended through the development of a one-step multiplex PCR assay for the simultaneous amplification of ompW and ctxA genes which should be of considerable value in the screening of both toxigenic and nontoxigenic V. cholerae strains of clinical as well as environmental origin. PMID:11060082

  17. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    PubMed

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  18. Can selection on nest size from nest predation explain the latitudinal gradient in clutch size?

    USGS Publications Warehouse

    Biancucci, L.; Martin, T.E.

    2010-01-01

    1. Latitudinal variation in clutch sizes of birds is a well described, but poorly understood pattern. Many hypotheses have been proposed, but few have been experimentally tested, and none have been universally accepted by researchers. 2. The nest size hypothesis posits that higher nest predation in the tropics favours selection for smaller nests and thereby constrains clutch size by shrinking available space for eggs and/or nestlings in the nest. We tested this hypothesis with an experiment in a tropical forest and a comparative study between temperate and tropical field sites. 3. Specifically, we tested if: (i) predation increased with nest size; (ii) tropical birds had smaller nests controlled for body size; and (iii) clutch size was explained by nest size controlled for body size. 4. Experimental swapping of nests of different sizes showed that nest predation increased with nest size in the tropical site. Moreover, nest predation rates were higher in species with larger nests in both sites. However, nest size, corrected for body mass and phylogeny, did not differ between sites and was not related to clutch size between sites. 5. Hence, nest predation can exert selection on nest size as predicted by the hypothesis. Nest size increased with adult body mass, such that adult size might indirectly influence reproductive success through effects on nest size and nest predation risk. Ultimately, however, selection from nest predation on nest size does not explain the smaller clutch sizes typical of the tropics.

  19. Identification of Penicillium marneffei in Paraffin-Embedded Tissue Using Nested PCR.

    PubMed

    Zeng, Hanxiang; Li, Xiqing; Chen, Xiejie; Zhang, Junmin; Sun, Jiufeng; Xie, Zhi; Xi, Liyan

    2009-07-01

    Penicillium marneffei is one of the unique thermally dimorphic fungi in Penicillium species that causes a disseminated, progressive and life threatening infection in immunocompromised patients. The diagnosis of Penicilliosis marneffei depends on culture that may delay the treatment due to the time-consuming process. In the present study, we evaluated the specificity and sensitivity of nested PCR to identify Penicillium marneffei from paraffin-embedded tissue. Two sets of oligonucleotide primers were derived from the sequence of 18S rRNA of Penicillium marneffei. The outer primers (RRF1 and RRH1) were specific to fungi. The inner primers (Pm1 and Pm2) were specific to Penicillium marneffei. The specific fragment of approximately 400 bp was amplified from all paraffin-embedded tissues from 14 patients with Penicilliosis marneffei and 10 bamboo rats. The detectable DNA concentration of single PCR and nested PCR were 14 pg/microl and 14 fg/microl, respectively. Further studies are required in order to use nested PCR for early diagnosis of the disease.

  20. Differentiation of Plum pox virus isolates by single-strand conformation polymorphism and low-stringency single specific primer PCR analysis of HC-Pro genome region.

    PubMed

    Gadiou, S; Safárová, D; Navrátil, M

    2009-01-01

    Single-strand conformation polymorphism (SSCP) and low-stringency single specific primer (LSSP)-PCR were assessed for suitability and reliability in genotyping of Plum pox virus (PPV) isolates. Examined PPV isolates included 16 PPV-D, 12 PPV-M, and 14 PPV-Rec isolates collected in Czech Republic. The analysis was performed on the helper component protease (HC-Pro) region of the PPV genome. SSCP and LSSP-PCR allowed the differentiation of PPV strain, but SSCP was not able to distinguish isolates within the same strain. The individual genotyping of each PPV isolate was obtained by LSSP-PCR. Nevertheless, both SSCP and LSSP-PCR techniques are suitable for preliminary screening of genetic variability of plant RNA viruses.

  1. Identification of human herpesvirus 6 variants A and B by primer-specific real-time PCR may help to revisit their respective role in pathology.

    PubMed

    Boutolleau, David; Duros, Caroline; Bonnafous, Pascale; Caïola, Delphine; Karras, Alexandre; Castro, Nathalie De; Ouachée, Marie; Narcy, Philippe; Gueudin, Marie; Agut, Henri; Gautheret-Dejean, Agnès

    2006-03-01

    Human herpesvirus 6 (HHV-6) isolates are classified into two variants, termed HHV-6A and HHV-6B, on the basis of distinct genetic, antigenic and biological characteristics, but the specific pathogenicity of each variant remains poorly understood. To design a rapid, sensitive and specific real-time variant-specific PCR (VS-PCR) method to differentiate both variants in biological specimens. The VS-PCR was adapted from a real-time PCR assay, based on TaqMan technology, previously developed for the genome quantitation of both HHV-6 variants [Gautheret-Dejean A, Manichanh C, Thien-Ah-Koon F, Fillet AM, Mangeney N, Vidaud M, et al. Development of a real-time polymerase chain reaction assay for the diagnosis of human herpesvirus-6 infection and application to bone marrow transplant patients. J Virol Meth 2002;100:27-35], a consensual reverse primer (Taq2) being changed into two variant-specific primers named H6A and H6B. This method was applied to a large set of biological specimens obtained in different pathological contexts. The sensitivity threshold was about 10 copies/well for HHV-6A-specific PCR (PCR-A) and 1 copy/well for HHV-6B-specific PCR (PCR-B). Both assays showed a linear dynamic range from 10 to 100,000 copies of HHV-6 DNA. Regarding the specificity and the capacity of discrimination of each assay, one variant could be detected and identified in the presence of more than 1000 times higher concentrations of the other variant in virus mixtures. The comparison of the results obtained with this VS-PCR with those previously obtained with a classic PCR method allowed us to validate our new technique on a wide panel of biological samples, including numerous patients with severe HHV-6-related symptoms. The high prevalence of HHV-6B was confirmed in healthy individuals and immunocompromised patients. HHV-6A was identified in distinct samples from several patients exhibiting neurological disorders. We developed a new VS-PCR assay, able to differentiate HHV-6A and HHV-6

  2. Detection of a Bacteriophage Gene Encoding a Mu-like Portal Protein in Haemophilus parasuis Reference Strains and Field Isolates by Nested Polymerase Chain Reaction

    USDA-ARS?s Scientific Manuscript database

    A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...

  3. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  4. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance.

    PubMed

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence.

  5. Lead Free Electric Primer

    DTIC Science & Technology

    2011-10-06

    Resonance NSWC-IH Naval Surface Warfare Center, Indian Head NTI Nano Technology, Inc . PAD Propellant Actuated Devices PEG Polyethylene Glycol... supplied hardware components and WC 868 propellant. Each round was assembled according to the drawing specification modifying only the primer...Nanotechnologies, Inc . (now NovaCentrix since July 2006), and it was characterized by the China Lake Chemistry Division prior to being used in formulation

  6. A sensitive and reliable RT-nested PCR assay for detection of Citrus tristeza virus from naturally infected citrus plants.

    PubMed

    Adkar-Purushothama, Charith Raj; Maheshwar, P K; Sano, Teruo; Janardhana, G R

    2011-05-01

    A specific and sensitive reverse transcriptase-nested polymerase chain reaction assay (RT-nPCR) was developed for the detection of Citrus tristeza virus (CTV) from naturally infected citrus samples. Two sets of primer pairs were designed by alignment of nucleotide sequences available in GenBank database for different genotypes of CTV. RT-nPCR reaction components and thermal cycling parameters were optimized and reaction conditions were standardized. Sequencing of the PCR products from direct and nested-PCR reactions confirmed the specificity of both primer pairs. Presence of CTV specific amplicons in asymptomatic samples which were collected from diseased orchards indicated the sensitivity of the test. As RT-nPCR technique, developed in the present study, is specific and efficient in detecting CTV, this could be envisioned for diagnostic applications and surveillance.

  7. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    PubMed

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments.

  8. Multi-primer qPCR assay capable of highly efficient and specific detection of the vast majority of all known Mycoplasma.

    PubMed

    Salling, H K; Bang-Christensen, S R

    2016-05-01

    Mycoplasma bacteria are able to pass through sterilizing grade filters due to their small size and lack of a cell wall, making them a common contaminant of biopharmaceutical productions. The classical method for detecting Mycoplasma is described in the European Pharmacopeia (Ph.Eur) 2.6.7. The method takes 28 days to perform, due to the slow growing nature of some Mycoplasma species. The Ph.Eur has described Nucleic Acid Testing (NAT) as a rapid alternative to the classical method. Here we present the development of a quantitative polymerase chain reaction (qPCR) assay capable of unambiguous detection of Mycoplasma with high sensitivity and specificity. The broadness of detection and the specificity towards Mycoplasma has been investigated by in silico analysis of the primer sequences followed by testing on purified Mycoplasma DNA as well as DNA from closely related genera. The assay will in all probability detect at least 356 species and strains of Mycoplasma, Spiroplasma and Acholeplasma with high sensitivity. To our knowledge this assay has the most uniform amplification efficiency over the broadest range of species and it is extremely specific towards Mycoplasma. With appropriate validation, the assay can be applied as a powerful tool for rapid Mycoplasma detection in the biopharmaceutical industry.

  9. Development of species-specific primers with potential for amplifying eDNA from imperilled freshwater unionid mussels.

    PubMed

    Cho, Anna; Morris, Todd; Wilson, Chris; Freeland, Joanna

    2016-12-01

    Environmental DNA (eDNA) is emerging as a potentially powerful tool for inferring species' presence, and hence occupancy, from DNA that is shed into environmental samples such as water. Although eDNA screening has been used to detect DNA from a variety of taxonomic groups, it has not yet been used to identify DNA from species with numerous potentially sympatric confamilial species, a situation that may preclude the development of species-specific markers. There are 41 native freshwater mussel species (Unionidae) in Ontario, Canada. Many of these are potentially sympatric, and 14 species have been formally assessed as endangered, threatened, or special concern. We investigated whether there was sufficient variation within the cytochrome oxidase region (COI) to develop species-specific eDNA markers for at-risk unionids. We developed 32 COI markers for eight unionid species, and tested each of these on the target species plus 29 potentially sympatric unionid taxa. Six of these markers amplified DNA only from the intended target species. We then extracted and amplified mussel eDNA from rearing-tank water samples. We conclude that despite high species diversity, it should be possible to develop eDNA COI markers and screen water samples for habitat occupancy by unionid mussels.

  10. Differences in predators of artificial and real songbirds nests: Evidence of bias in artificial nest studies

    Treesearch

    Frank R. Thompson; Dirk E. Burhans

    2004-01-01

    In the past two decades, many researchers have used artificial nest to measure relative rates of nest predation. Recent comparisons show that real and artificial nests may not be depredated at the same rate, but no one has examined the mechanisms underlying these patterns. We determined differences in predator-specific predation rates of real and artificial nests. we...

  11. Diagnosis of Oropouche virus infection by RT-nested-PCR.

    PubMed

    Moreli, Marcos Lázaro; Aquino, Victor Hugo; Cruz, Ana Cecília R; Figueiredo, Luiz Tadeu M

    2002-01-01

    Using the RT-PCR with primers that anneal to the 5' and the 3' extremities of the genome segments of bunyaviruses and internal primers that anneal to the S segment of Simbu serogroup viruses in a nested PCR it was possible to amplify the Oropouche virus (ORO) genome from the sera of three patients. These results show that this RT-nested-PCR is a useful tool for rapid diagnosis of Oropouche fever infections. Copyright 2002 Wiley-Liss, Inc.

  12. Clinical and epidemiological use of nested PCR targeting the repetitive element IS1111 associated with the transposase gene from Coxiella burnetii.

    PubMed

    Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S

    2017-08-24

    Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.

  13. COI barcode based species-specific primers for identification of five species of stored-product pests from genus Cryptolestes (Coleoptera: Laemophloeidae).

    PubMed

    Varadínová, Z; Wang, Y J; Kučerová, Z; Stejskal, V; Opit, G; Cao, Y; Li, F J; Li, Z H

    2015-04-01

    Flat grain beetles of the genus Cryptolestes (Coleoptera: Laemophloeidae) are one of the economically most important stored-product pests which feed on many kinds of agricultural products, especially grains. Nine of more than 40 described Cryptolestes species are recognized as stored-product pests and two of the pest species have a cosmopolitan distribution. Given the rapid growth in global trade of food products, ecological barriers to the spread of pests are easily overcome. Therefore, development of reliable systems for routine quarantine inspection and early infestation detection is vital. In the present study, we established a new rapid and accurate cytochrome c oxidase subunit I-based system for molecular identification of five common stored-product Cryptolestes species, namely, Cryptolestes capensis, Cryptolestes ferrugineus, Cryptolestes pusilloides, Cryptolestes pusillus and Cryptolestes turcicus. Five species-specific primer pairs for traditional uniplex polymerase chain reaction assay are described and their specificity and sensitivity for the identification process is evaluated using larval samples of 12 different populations from three continents (Asia, Europe and North America).

  14. Primer3--new capabilities and interfaces.

    PubMed

    Untergasser, Andreas; Cutcutache, Ioana; Koressaar, Triinu; Ye, Jian; Faircloth, Brant C; Remm, Maido; Rozen, Steven G

    2012-08-01

    Polymerase chain reaction (PCR) is a basic molecular biology technique with a multiplicity of uses, including deoxyribonucleic acid cloning and sequencing, functional analysis of genes, diagnosis of diseases, genotyping and discovery of genetic variants. Reliable primer design is crucial for successful PCR, and for over a decade, the open-source Primer3 software has been widely used for primer design, often in high-throughput genomics applications. It has also been incorporated into numerous publicly available software packages and web services. During this period, we have greatly expanded Primer3's functionality. In this article, we describe Primer3's current capabilities, emphasizing recent improvements. The most notable enhancements incorporate more accurate thermodynamic models in the primer design process, both to improve melting temperature prediction and to reduce the likelihood that primers will form hairpins or dimers. Additional enhancements include more precise control of primer placement-a change motivated partly by opportunities to use whole-genome sequences to improve primer specificity. We also added features to increase ease of use, including the ability to save and re-use parameter settings and the ability to require that individual primers not be used in more than one primer pair. We have made the core code more modular and provided cleaner programming interfaces to further ease integration with other software. These improvements position Primer3 for continued use with genome-scale data in the decade ahead.

  15. Identification of root rot fungi in nursery seedlings by nested multiplex PCR.

    PubMed Central

    Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M

    1996-01-01

    The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993

  16. From neurons to nests: nest-building behaviour as a model in behavioural and comparative neuroscience.

    PubMed

    Hall, Zachary J; Meddle, Simone L; Healy, Susan D

    Despite centuries of observing the nest building of most extant bird species, we know surprisingly little about how birds build nests and, specifically, how the avian brain controls nest building. Here, we argue that nest building in birds may be a useful model behaviour in which to study how the brain controls behaviour. Specifically, we argue that nest building as a behavioural model provides a unique opportunity to study not only the mechanisms through which the brain controls behaviour within individuals of a single species but also how evolution may have shaped the brain to produce interspecific variation in nest-building behaviour. In this review, we outline the questions in both behavioural and comparative neuroscience that nest building could be used to address, summarize recent findings regarding the neurobiology of nest building in lab-reared zebra finches and across species building different nest structures, and suggest some future directions for the neurobiology of nest building.

  17. [Detection of wheat as an allergenic substance in food by a nested PCR method].

    PubMed

    Hashimoto, Hiroyuki; Makabe, Yuhki; Hasegawa, Yasuyuki; Sajiki, Junko; Miyamoto, Fumio

    2008-02-01

    A nested PCR method was developed for the detection of DNAs extracted from allergenic substances (here, wheat) in food. Because of DNA fragmentation, detection of wheat-specific DNA extracted from food, such as retort pouch food, is very difficult. Therefore, to improve the sensitivity of detection, a nested PCR primer pair (Wtr01NE2-5' and Wtr10NE5-3': amplicon size 97 bp) was newly designed within the region of the PCR products amplified by the official Japanese primer pair (Wtr01-5' and Wtr10-3'; amplicon size 141 bp) for wheat. Genomic DNAs of seven kinds of commercial processed foods containing wheat, wheat flour and three kinds of wheat flours pressure-heated at 100, 121 and 131 degrees C were extracted with a commercial ion-exchange type kit by modifying the Japanese official method. The nested PCR method involved two PCR procedures. First, PCR was performed by varying both the PCR reagents and cycling conditions of the Japanese official method. Second, PCR was performed using the first PCR products diluted 200-fold with TE buffer. The Japanese official method enabled detection of only four of the seven kinds of foods and three of the four kinds of flours (one sample was just a trace), while the nested PCR method detected all seven foods and all four flours. Investigation of the detectability of the four kinds of wheat flours depending on the size of the amplified fragment using five primer pairs showed that its size must be kept to less than approximately 100 bp. The nested PCR method significantly improved the sensitivity of detection of wheat-specific DNA.

  18. Molecular RH blood group typing of serologically D-/CE+ donors: the use of a polymerase chain reaction-sequence-specific primer test kit with pooled samples.

    PubMed

    Londero, Donatella; Fiorino, Mauro; Miotti, Valeria; de Angelis, Vincenzo

    2011-01-01

    The known presence of RHD blood group alleles in apparently D– individuals who are positive for C or E antigens leads to an appropriate investigation for the RHD gene on the red blood cells (RBCs) of D– blood donors, thus preventing their RBCs from immunizing D– recipients. Ready-to-use polymerase chain reaction–sequence-specific primer (PCR-SSP) typing kits are available and allow single-sample results. The need to perform this testing on a large number of donors affiliated with the Transfusion Department of Udine (Northern Italy) led to the use of molecular genetic RH blood group typing with PCR-SSP test kits and DNA samples mixed in pools. From a population of 35,000 blood donors screened for D antigen by serologic typing, a total of 235 samples, distributed in pools of 5 DNA samples, were investigated. Positive results were reevaluated by opening the pools and retesting single samples. Validation of DNA-pool typing with commercial kits was done. Among 235 genotyped samples, 12 were found to be PCR positive (5.1%), exhibiting DEL genotype and RHD-CE-D hybrid alleles. Our data demonstrate that the use of a PCR-SSP commercial test kit with pooled samples is a helpful and valid method to correctly detect RHD alleles. As a consequence, we reclassified our donors as carriers of potentially immunogenic alleles.

  19. Modification of universal 12S rDNA primers for specific amplification of contaminated Taenia spp. (Cestoda) gDNA enabling phylogenetic studies.

    PubMed

    von Nickisch-Rosenegk, M; Silva-Gonzalez, R; Lucius, R

    1999-10-01

    The construction of new specific tapeworm primers allowed synthesis of a 311-bp fragment of the mitochondrial 12S rDNA of 11 Taenia species and two Echinococcus species by PCR. After direct sequencing and construction of an alignment, the DNA sequences were calculated by three different phylogenetic algorithms. The phylogenetic trees were tested by 1000 bootstrap replications. Reliability of the nodes was tested by splits testing. All three algorithms revealed a clear monophyletic phylum Taenia, suggesting it may be paraphyletic with respect to the genus Echinococcus. Within the genus Taenia, the first secure group was composed by Taenia saginata, T. solium, T. serialis, T. ovis and T. hydatigena. A delimited second group was formed by T. martis, T. taeniaeformis, T. mustelae and T. parva. All of them were opposed to the genus Echinococcus using other cyclophyllideans as an outgroup. In this study Echinococcus was used as an outgroup, being the closest species against which the ingroup could be routed. The findings of this publication reflect Verster's basic morphologically based grouping of the Taeniidae.

  20. Detection of Lactobacillus, Pediococcus, Leuconostoc, and Weissella species in human feces by using group-specific PCR primers and denaturing gradient gel electrophoresis.

    PubMed

    Walter, J; Hertel, C; Tannock, G W; Lis, C M; Munro, K; Hammes, W P

    2001-06-01

    Denaturing gradient gel electrophoresis (DGGE) of DNA fragments generated by PCR with 16S ribosomal DNA-targeted group-specific primers was used to detect lactic acid bacteria (LAB) of the genera Lactobacillus, Pediococcus, Leuconostoc, and Weissella in human feces. Analysis of fecal samples of four subjects revealed individual profiles of DNA fragments originating not only from species that have been described as intestinal inhabitants but also from characteristically food-associated bacteria such as Lactobacillus sakei, Lactobacillus curvatus, Leuconostoc mesenteroides, and Pediococcus pentosaceus. Comparison of PCR-DGGE results with those of bacteriological culture showed that the food-associated species could not be cultured from the fecal samples by plating on Rogosa agar. On the other hand, all of the LAB species cultured from feces were detected in the DGGE profile. We also detected changes in the types of LAB present in human feces during consumption of a milk product containing the probiotic strain Lactobacillus rhamnosus DR20. The analysis of fecal samples from two subjects taken before, during, and after administration of the probiotic revealed that L. rhamnosus was detectable by PCR-DGGE during the test period in the feces of both subjects, whereas it was detectable by culture in only one of the subjects.

  1. A specific test for transthyretin 122 (Val yields Ile), based on PCR-primer-introduced restriction analysis (PCR-PIRA): Confirmation of the gene frequency in blacks

    SciTech Connect

    Jacobson, D.R. )

    1992-01-01

    The variant transthyretin (TTR) allele, TTR (122 Val {yields} Ile), associated with cardiac amyloidosis in blacks, is caused by a G {yields} A transition which destroys a MaeIII site. This variant has previously been detected by PCR around codon 122, followed by MaeIII digestion, but this test is not specific: any of 12 mutations in the MaeIII recognition site, each of which yields a different amino acid change, would also destroy this site. A modification of PCR, termed PCR-primer-introduced restriction analysis, was used to introduce a new FokI site into the PCR products derived from the variant (122 Ile) but not wild-type (122 Val) allele. This test demonstrated that each of six previously identified MaeIII ({minus}) alleles had lost its MaeIII site because of a G {yields} A transition encoding TTR (122 Val {yields} Ile), confirming that the same TTR variant was present both in 4/177 healthy black individuals and as a homozygous variant in an individual with cardiac amyloidosis.

  2. Polymerase chain reaction primers and probes derived from flagellin gene sequences for specific detection of the agents of Lyme disease and North American relapsing fever.

    PubMed Central

    Picken, R N

    1992-01-01

    By cloning and sequencing the flagellin gene of Borrelia hermsii and comparing this sequence with that of the corresponding gene from B. burgdorferi, I identified a central region within the two genes which showed a reduced level of sequence similarity. Oligonucleotide sequences selected from this region produced species-specific amplimers when used in polymerase chain reaction experiments. Thus, primers derived from the B. burgdorferi sequence amplified a 276-bp fragment from 22 strains of B. burgdorferi of diverse geographic origin but not from 5 strains of B. hermsii, 5 other Borrelia species, 16 Treponema, Leptospira, and Spirochaeta species, or representatives of 10 other bacterial genera. However, when the amplified fragments were tested for hybridization with an oligonucleotide probe derived from the nonhomologous region, seven strains from either Germany or Switzerland did not hybridize. Cloning and sequencing of the amplified fragments from these strains revealed that the 22 strains of B. burgdorferi tested could be divided into three groups based on the nucleic acid sequence of the central region of the flagellin gene. With this information, oligonucleotide probes that hybridized to the amplified fragments and were able to differentiate the three groups of B. burgdorferi were designed. The corresponding primers, derived from the B. hermsii gene sequence, were tested for their ability to amplify DNA from this collection of strains. Although no amplification was obtained with representatives of the three groups of B. burgdorferi or various Treponema, Leptospira, and Spirochaeta species, amplification was obtained with the five other Borrelia species (B. parkeri, B. turicatae, B. crocidurae, B. anserina, and B. coriaceae) in addition to the five strains of B. hermsii. Sequencing of the amplified fragments from one strain of B. hermsii as well as B. parkeri and B. turicatae allowed the design of oligonucleotide probes that were able to differentiate the three

  3. Diskette Primer.

    ERIC Educational Resources Information Center

    Chien, Philip

    1986-01-01

    This detailed look into proper diskette maintenance presents general precautions on temperature, humidity, lifespan, labeling, storage, and disk drive maintenance. The Apple UniDisk 3.5 disk drive is described, tips on purchasing diskettes are presented, and information on specific data retrieval and backup software and diskettes is included. (MBR)

  4. Diskette Primer.

    ERIC Educational Resources Information Center

    Chien, Philip

    1986-01-01

    This detailed look into proper diskette maintenance presents general precautions on temperature, humidity, lifespan, labeling, storage, and disk drive maintenance. The Apple UniDisk 3.5 disk drive is described, tips on purchasing diskettes are presented, and information on specific data retrieval and backup software and diskettes is included. (MBR)

  5. Swine Leukocyte Antigen (SLA) class I allele typing of Danish swine herds and identification of commonly occurring haplotypes using sequence specific low and high resolution primers.

    PubMed

    Pedersen, Lasse Eggers; Jungersen, Gregers; Sorensen, Maria Rathmann; Ho, Chak-Sum; Vadekær, Dorte Fink

    2014-12-15

    The swine major histocompatibility complex (MHC) genomic region (SLA) is extremely polymorphic comprising high numbers of different alleles, many encoding a distinct MHC class I molecule, which binds and presents endogenous peptides to circulating T cells of the immune system. Upon recognition of such peptide-MHC complexes (pMHC) naïve T cells can become activated and respond to a given pathogen leading to its elimination and the generation of memory cells. Hence SLA plays a crucial role in maintaining overall adaptive immunologic resistance to pathogens. Knowing which SLA alleles that are commonly occurring can be of great importance in regard to future vaccine development and the establishment of immune protection in swine through broad coverage, highly specific, subunit based vaccination against viruses such as swine influenza, porcine reproductive and respiratory syndrome virus, vesicular stomatitis virus, foot-and-mouth-disease virus and others. Here we present the use of low- and high-resolution PCR-based typing methods to identify individual and commonly occurring SLA class I alleles in Danish swine. A total of 101 animals from seven different herds were tested, and by low resolution typing the top four most frequent SLA class I alleles were those of the allele groups SLA-3*04XX, SLA-1*08XX, SLA-2*02XX, and SLA-1*07XX, respectively. Customised high resolution primers were used to identify specific alleles within the above mentioned allele groups as well as within the SLA-2*05XX allele group. Our studies also suggest the most common haplotype in Danish pigs to be Lr-4.0 expressing the SLA-1*04XX, SLA-2*04XX, and SLA-3*04XX allele combination. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Leishmania species: Detection and identification by nested PCR assay from skin samples of rodent reservoirs

    PubMed Central

    Akhavan, Amir Ahmad; Mirhendi, Hossein; Khamesipour, Ali; Alimohammadian, Mohammad Hossein; Rassi, Yavar; Bates, Paul; Kamhawi, Shaden; Valenzuela, Jesus G.; Arandian, Mohammad Hossein; Abdoli, Hamid; Jalali-zand, Niloufar; Jafari, Reza; Shareghi, Niloufar; Ghanei, Maryam; Yaghoobi-Ershadi, Mohammad Reza

    2010-01-01

    Many rodent species act as reservoir hosts of zoonotic cutaneous leishmaniasis in endemic areas. In the present study a simple and reliable assay based on nested PCR was developed for the detection and identification of Leishmania parasites from rodent skin samples. We designed Leishmania-specific primers that successfully amplified ITS regions of Leishmania major, Leishmania gerbilli and Leishmania turanica using nested PCR. Out of 95 field collected Rhombomys opimus, 21 were positive by microscopic examination and 48 by nested PCR. The percentage of gerbils infected with L. major, L. gerbilli and L. turanica was 3.2%, 1.1% and 27.4%, respectively. In 15.8% of the rodents, we found mixed natural infections by L. major and L. turanica, 1.1% by L. major and L. gerbilli, and 2.1% by the three species. We concluded that this method is simple and reliable for detecting and identifying Leishmania species circulating in rodent populations. PMID:20566364

  7. Detection of pathogenic leptospires in urine from naturally infected cattle by nested PCR.

    PubMed

    Bomfim, Maria Rosa Quaresma; Barbosa-Stancioli, Edel Figueiredo; Koury, Matilde Cota

    2008-11-01

    A nested polymerase chain reaction (PCR) using primers from the LipL32 sequence of Leptospira spp. was used to detect shedding of pathogenic leptospires in urine from naturally infected cattle. Amplicons (497bp) were obtained from 21 pathogenic reference serovars belonging to four species (L. interrogans, L. borgpetersenii, L. santarosai, L. kirschneri). DNA was amplified from 26/30 urine samples taken from cattle with suspected leptospirosis and from leptospires cultivated from 10 of these samples. The limit of detection of DNA in the clinical samples was 200pg and the nested PCR detected all pathogenic reference serovars of Leptospira spp. tested. No PCR products were amplified using DNA from other common bacterial species from the bovine urogenital tract or urine, or from the non-pathogenic L. biflexa Andamana serovar. The nested PCR exhibited high specificity and sensitivity for detection of pathogenic serovars in urine from cattle.

  8. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.

    1985-01-01

    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  9. CODEHOP PCR and CODEHOP PCR primer design.

    PubMed

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  10. Recognition of social parasites as nest-mates: adoption of colony-specific host cuticular odours by the paper wasp parasite Polistes sulcifer.

    PubMed Central

    Sledge, M. F.; Dani, F. R.; Cervo, R.; Dapporto, L.; Turillazzi, S.

    2001-01-01

    Colonies of the polistine wasp Polistes dominulus are parasitized by the permanent worker-less social parasite Polistes sulcifer. After usurpation of the host colony, parasite females are characterized by a change in the relative proportions of their cuticular hydrocarbons to match those of the host species. In this paper we present evidence from field data and laboratory experiments that P. sulcifer females adopt a colony-specific host odour that facilitates their acceptance by host females of the usurped colony. Presentation experiments demonstrate that parasite females are recognized as foreign individuals by workers of other parasitized nests. We show that the modification of parasite cuticular compounds is sufficient for this recognition. This provides evidence that, after invasion, P. sulcifer queens do not require appeasement or propaganda substances for their acceptance by host colonies. Furthermore, multivariate discriminant analysis of the cuticular hydrocarbon proportions of the parasites after usurpation assigns the parasites together with P. dominulus females of their own host colony. To the authors' knowledge, this is the first confirmation that social parasites adopt colony-specific host odours. PMID:11674873

  11. Quantitative Detection of Viable Bifidobacterium bifidum BF-1 Cells in Human Feces by Using Propidium Monoazide and Strain-Specific Primers

    PubMed Central

    Fujimoto, Junji

    2013-01-01

    We developed a PCR-based method to detect and quantify viable Bifidobacterium bifidum BF-1 cells in human feces. This method (PMA-qPCR) uses propidium monoazide (PMA) to distinguish viable from dead cells and quantitative PCR using a BF-1-specific primer set designed from the results of randomly amplified polymorphic DNA analysis. During long-term culture (10 days), the number of viable BF-1 cells detected by counting the number of CFU on modified MRS agar, by measuring the ATP contents converted to CFU, and by using PMA-qPCR decreased from about 1010 to 106 cells/ml; in contrast, the total number of (viable and dead) BF-1 cells detected by counting 4′,6-diamidino-2-phenylindolee (DAPI)-stained cells and by using qPCR without PMA and reverse transcription-qPCR remained constant. The number of viable BF-1 cells in fecal samples detected by using PMA-qPCR was highly and significantly correlated with the number of viable BF-1 cells added to the fecal samples, within the range of 105.3 to 1010.3 cells/g feces (wet weight) (r > 0.99, P < 0.001). After 12 healthy subjects ingested 1010.3 to 1011.0 CFU of BF-1 in a fermented milk product daily for 28 days, 104.5 ± 1.5 (mean ± standard deviation [SD]) BF-1 CFU/g was detected in fecal samples by using strain-specific selective agar; in contrast, 106.2 ± 0.4 viable BF-1 cells/g were detected by using PMA-qPCR, and a total of 107.6 ± 0.7 BF-1 cells/g were detected by using qPCR without PMA. Thus, the number of viable BF-1 cells detected by PMA-qPCR was about 50 times higher (P < 0.01) than that detected by the culture-dependent method. We conclude that strain-specific PMA-qPCR can be used to quickly and accurately evaluate viable BF-1 in feces. PMID:23354719

  12. Myelin basic protein-specific T lymphocyte repertoire in multiple sclerosis. Complexity of the response and dominance of nested epitopes due to recruitment of multiple T cell clones.

    PubMed Central

    Meinl, E; Weber, F; Drexler, K; Morelle, C; Ott, M; Saruhan-Direskeneli, G; Goebels, N; Ertl, B; Jechart, G; Giegerich, G

    1993-01-01

    The human T cell response to the myelin basic protein (MBP) has been studied with respect to T cell receptor (TCR) usage, HLA class II restriction elements, and epitope specificity using a total of 215 long-term MBP-specific T cell lines (TCL) isolated from the peripheral blood of 13 patients with multiple sclerosis (MS) and 10 healthy donors. In most donors, the anti-MBP response was exceedingly heterogeneous. Using a panel of overlapping synthetic peptides spanning the entire length of human MBP, at least 26 epitopes recognized by human TCL could be distinguished. The MBP domain most commonly recognized was sequence 80-105 (31% of MS TCL, and 24% of control TCL). Sequence 29-48 was recognized more frequently by control-derived TCL (24%) than by TCL from MS patients (5%). The MBP epitopes were recognized in the context of DRB1 *0101, DRB5*0101, DRB1*1501, DRB1*0301, DRB1*0401, DRB1*1402, and DRB3*0102, as demonstrated using a panel of DR gene-transfected L cells. The TCR gene usage was also heterogeneous. V beta 5.2, a peptide of which is currently being used in a clinical trial for treatment of MS patients, was expressed by only one of our TCL. However, within this complex pattern of MBP-specific T cell responses, a minority of MS patients were found to exhibit a more restricted response with respect to their TCL epitope specificity. In these patients 75-87% of the TCL responded to a single, patient-specific cluster of immunodominant T cell epitopes located within a small (20-amino acid) domain of MBP. These nested clusters of immunodominant epitopes were noted within the amino acids 80-105, 108-131, and 131-153. The T cell response to the immunodominant epitopes was not monoclonal, but heterogeneous, with respect to fine specificity, TCR usage, and even HLA restriction. In one patient (H.K.), this restricted epitope profile remained stable for > 2 yr. The TCR beta chain sequences of TCL specific for the immunodominant region of HK are consistent with an

  13. Identification of Pythium insidiosum by nested PCR in cutaneous lesions of Brazilian horses and rabbits.

    PubMed

    Botton, Sonia A; Pereira, Daniela I B; Costa, Mateus M; Azevedo, Maria Isabel; Argenta, Juliana S; Jesus, Francielli P K; Alves, Sydney Hartz; Santurio, Janio Morais

    2011-04-01

    Pythium insidiosum is a fungus-like organism present in subtropical and tropical areas, such as Brazil, known to infect humans and various animal species. P. insidiosum is the etiological agent of pythiosis, an emerging and granulomatous disease characterized mainly by cutaneous and subcutaneous lesions in horses, the principal species affected. Accurate diagnosis of pythiosis and identification of its causal agent by microbiological and serological tests can be often difficult and inconclusive principally for horses and humans. The aim of this study was to evaluate the application of the previously described P. insidiosum-specific nested polymerase chain reaction (PCR) assay to directly detect P. insidiosum DNA in clinical and experimental lesions. Universal fungal primers (ITS1 and ITS4) were used during the first-round of PCR to amplify ITS1, 5.8s, and ITS2. A second-round of PCR was conducted with P. insidiosum-specific primers (PI1 and PI2) to amplify a variable region within this ITS1. In this study, a total of 21 equine clinical samples (kunkers) and 28 specimens from experimentally infected rabbits were analyzed by nested PCR. The first-round of PCR generated 800-base pair products, and the second-round produced 105-base pair amplicons for each P. insidiosum-specific sample; no amplicons were generated in negative control samples. Our results suggest that nested PCR is an important and efficient tool for diagnosis of both endemic (horse samples) and experimental (rabbit samples) pythiosis.

  14. An alternative nested-PCR assay for the detection of Toxoplasma gondii strains based on GRA7 gene sequences.

    PubMed

    Costa, Maria Eduarda S M; Oliveira, Claudio Bruno S; Andrade, Joelma Maria de A; Medeiros, Thatiany A; Neto, Valter F Andrade; Lanza, Daniel C F

    2016-07-01

    Toxoplasma gondii is a widespread parasite able to infect virtually any nucleated cells of warm-blooded hosts. In some cases, T. gondii detection using already developed PCR primers can be inefficient in routine laboratory tests, especially to detect atypical strains. Here we report a new nested-PCR protocol able to detect virtually all T. gondii isolates. Analyzing 685 sequences available in GenBank, we determine that GRA7 is one of the most conserved genes of T. gondii genome. Based on an alignment of 85 GRA7 sequences new primer sets that anneal in the highly conserved regions of this gene were designed. The new GRA7 nested-PCR assay providing sensitivity and specificity equal to or greater than the gold standard PCR assays for T. gondii detection, that amplify the B1 sequence or the repetitive 529bp element.

  15. Primary brain tumours and specific serum immunoglobulin E: a case-control study nested in the European Prospective Investigation into Cancer and Nutrition cohort.

    PubMed

    Schlehofer, B; Siegmund, B; Linseisen, J; Schüz, J; Rohrmann, S; Becker, S; Michaud, D; Melin, B; Bas Bueno-de-Mesquita, H; Peeters, P H M; Vineis, P; Tjonneland, A; Olsen, A; Overvad, K; Romieu, I; Boeing, H; Aleksandrova, K; Trichopoulou, A; Bamia, C; Lagiou, P; Sacerdote, C; Palli, D; Panico, S; Sieri, S; Tumino, R; Sanchez, M-J; Rodriguez, L; Dorronsoro, M; Duell, E J; Chirlaque, M-D; Barricarte, A; Borgquist, S; Manjer, J; Gallo, V; Allen, N E; Key, T J; Riboli, E; Kaaks, R; Wahrendorf, J

    2011-11-01

    Case-control studies suggest that patients with allergic diseases have a lower risk of developing glioma but not meningioma or schwannoma. However, those data can be differentially biased. Prospective studies with objective measurements of immunologic biomarkers, like immunoglobulin E (IgE), in blood obtained before cancer diagnosis could help to clarify whether an aetiological association exists. The present case-control study nested within the European Prospective Investigation into Cancer and Nutrition (EPIC) measured specific serum IgE as a biomarker for the most common inhalant allergens in 275 glioma, 175 meningioma and 49 schwannoma cases and 963 matched controls using the ImmunoCAP specific IgE test. Subjects with an IgE level ≥0.35 kUA/l (kilo antibody units per litre) were classified as sensitized by allergens. Odds ratios (OR) and 95% confidence intervals (CI) were estimated by adjusted conditional logistic regression models for each tumour subtype. The effect of dose-response relationship was assessed in five increasing IgE level categories to estimate P-values for trend. The risk of glioma was inversely related to allergic sensitization (OR = 0.73; 95% CI 0.51-1.06), especially pronounced in women (OR = 0.53; 95% CI 0.30-0.95). In dose-response analyses, for high-grade glioma, the lowest OR was observed in sera with the highest IgE levels (P for trend = 0.04). No association was seen for meningioma and schwannoma. The results, based on serum samples prospectively collected in a cohort study, provide some support for the hypothesis that individuals with allergic sensitization are at reduced risk of glioma and confirm results from previous case-control studies. © 2011 John Wiley & Sons A/S.

  16. Straight Talk: A Communication Primer.

    ERIC Educational Resources Information Center

    Maidment, Robert

    Using typical statements made by teachers and school administrators as examples, this self-help primer offers tips for developing conversational patterns that promote interpersonal understanding. The tips are designed to help readers learn about 40 effective conversational habits, including being specific, talking sparingly, admitting mistakes,…

  17. Detection of blood chimerism after lung and heart-lung transplantation. The superiority of nested as compared with standard polymerase chain reaction amplification.

    PubMed

    Knoop, C; Andrien, M; Defleur, V; Antonine, M; de Francquen, P; Goldman, M; Estenne, M

    1994-12-27

    Migration of donor cells from the graft to various tissues of the recipient has been demonstrated after different types of solid organ transplants. Currently, the detection of donor cells in the recipient's tissues is most simply performed by polymerase chain reaction (PCR) amplification of a donor-specific gene. In the present study, we first determined in vitro the sensitivity of standard and nested PCR amplification with sequence-specific primers (PCR-SSP) of a donor-specific allele of the HLA-DRB1 gene and then used this technique to assess prospectively blood chimerism in two single-lung (SLT) and one heart-lung (HLT) transplant recipients. Standard PCR-SSP consisted in a single amplification round with sequence-specific primers for the donor-specific DRB1 allele. Nested PCR-SSP consisted in a first round of generic amplification of exon 2 of the DRB1 gene, followed by a second amplification round with primers specific for the donor allele. In vitro, nested PCR-SSP of the donor-specific allele was 1000-fold more sensitive than standard PCR-SSP and allowed the detection of 1 donor cell in 10(5) recipient cells. In vivo, standard PCR-SSP detected donor cells among the recipients' peripheral blood mononuclear cells (PBMCs) only during the first postoperative days, whereas nested PCR-SSP demonstrated their presence until the end of the first postoperative month in patients 1 and 2 and until 3 months after transplantation in patient 3. We conclude that donor cells can be detected in the peripheral blood of SLT and HLT recipients during the first postoperative months and that nested PCR-SSP amplification of a donor-specific HLA-DRB1 allele is much more sensitive than standard PCR-SSP to demonstrate such chimerism.

  18. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    PubMed

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  19. Improving qPCR methodology for detection of foaming bacteria by analysis of broad-spectrum primers and a highly specific probe for quantification of Nocardia spp. in activated sludge.

    PubMed

    Asvapathanagul, P; Olson, B H

    2017-01-01

    To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10(2) to 5 × 10(6) copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10(6) copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10(6) copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10(6) M. bovis: 10(2) N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.

  20. Detection of HLA-DRB1 microchimerism using nested polymerase chain reaction and single-strand conformation polymorphism analysis.

    PubMed

    Song, Eun Young; Chung, Hye Yoon; Joo, Shin Young; Roh, Eun Youn; Seong, Moon-Woo; Shin, Yunsu; Park, Myoung Hee

    2012-03-01

    For the detection of microchimerism, molecular methods detecting donor-specific HLA-DRB1 alleles in the recipient are most commonly used. Nested polymerase chain reaction sequence specific primer (nested PCR-SSP) methods widely used to increase the sensitivity of detection have been reported to give frequent false-positive reactions. We have developed a new method combining nested PCR with single-strand conformation polymorphism analysis (nested PCR-SSCP) and tested the 1 to 0.00001% level of microchimerism for 27 different HLA-DRB1 alleles. For most (26/27) of the HLA-DRB1 alleles tested, this method could detect 0.01 to 0.001% of microchimerism and its sensitivity was equal to or better than that of nested PCR-SSP tested in parallel. Its specificity was verified by visualizing particular DRB1-specific SSCP bands under test. Nested PCR-SSP indicated frequent false-positive reactions, mainly caused by nonspecific amplification of DRB3/B4/B5 alleles present in the major (recipient) DNAs. We have compared a real-time quantitative PCR for non-human leukocyte antigen (HLA) target (insertion/deletion marker) using a commercial kit (AlleleSEQR Chimerism assay), and its microchimerism detection sensitivity (around 0.1%) was 1 step (10 times) lower than that of nested PCR-SSP or -SSCP methods for HLA-DRB1 alleles. We validated that the newly designed nested PCR-SSCP affords good sensitivity and specificity and may be useful for studying microchimerism in clinical settings.

  1. Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments

    PubMed Central

    Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

    2017-01-01

    In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249

  2. Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments.

    PubMed

    Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

    2017-01-01

    In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis.

  3. rDNA-targeted PCR primers and FISH probe in the detection of Ophiocordyceps sinensis hyphae and conidia.

    PubMed

    Zhong, Xin; Peng, Qingyun; Qi, Lili; Lei, Wei; Liu, Xin

    2010-11-01

    Ophiocordyceps sinensis (Berk.) Sung, Sung, Hywel-Jones & Spatafora (syn. Cordyceps sinensis) one of the entomopathogenic fungi, is a rare Traditional Chinese Medicine (TCM) found in the Qinghai-Tibetan Plateau. Polymerase Chain Reaction (PCR) and Fluorescence in situ hybridization (FISH) methods are necessary to identify the mycelia or spores of O. sinensis from its habitat and to monitor its dispersal, colonization and infectivity. To develop both primers and probe specific to O. sinensis, ribosomal DNA (rDNA) amplified with universal primers from O. sinensis genomic DNA and seven closely related fungi were sequenced. According to these sequences, the upper and lower primers (OsT-F and OsT-R) were designed within internal transcribed spacer region 1 (ITS1) and ITS2 and flanked by universal primers ITS5 and ITS4, respectively. The designed primers were used for general PCR, touchdown PCR, or both together with the universal primers for nested-touchdown PCR. The results showed that only the extracted DNA of O. sinensis was specifically amplified. The sensitivity of nested-touchdown PCR with extracted DNA of O. sinensis is as low as 10(-14)g (10 fg) and at least 1000 times higher than the other PCR methods. In addition, Cy5-labeled probe (OsLSU) for cytoplasmic LSU rRNA was hybridized with the ascospores of O. sinensis. It showed a strong red fluorescence throughout the whole cell but did not cross-react with other entomopathogenic fungi. Taken together, these methods were useful for studying the biology and ecology of O. sinensis.

  4. A mixture detection method based on separate amplification using primer specific alleles of INDELs-a study based on two person's DNA mixture.

    PubMed

    Liu, Jinding; Wang, Jiaqi; Zhang, Xiaojia; Li, Zeqin; Yun, Keming; Liu, Zhizhen; Zhang, Gengqian

    2017-02-01

    Samples containing unbalanced DNA mixtures from individuals often occur in forensic DNA examination and clinical detection. Because of the PCR amplification bias, the minor contributor DNA is often masked by the major contributor DNA when using traditional STR or SNP typing techniques. Here we propose a method based in allele-specific Insertion/Deletion (INDEL) genotyping to detect DNA mixtures in forensic samples. Fourteen INDELs were surveyed in the Chinese Han population of Shanxi Province. The INDELs were amplified using two separate primer-specific reactions by real-time PCR. The difference Ct value of the 2 reactions (D-value) were used for determination of the single source DNA. INDELs types and further confirmed by electrophoresis separation. The minor allele frequency (MAF) was above 0.2 in 10 INDELs. The detection limit was 0.3125 ng-1.25 ng template DNA for real-time PCR in all 14 INDEL markers. For single source 10 ng DNA, the average D-value was 0.31 ± 0.14 for LS type, 6.96 ± 1.05 for LL type and 7.20 ± 1.09 for SS type. For the series of simulated DNA mixture, the Ct value varied between the ranges of single source DNA, depending on their INDEL typing and mixture ratios. This method can detect the specific allele of the minor DNA contributor as little as 1:50 in rs397782455 and rs397696936; 1:100 in rs397832665, rs397822382 and rs397897230; the detection limit of the minor DNA contributor was as little as 1:500-1:1000 in the rest INDEL markers, a much higher sensitivity compared with traditional STR typing. The D-value variation depended on the alternation of dilution ratio and INDEL types. When the dilution was 1:1000, the maximum and minimum D-values were 8.84 ± 0.11 in rs397897230 and 4.27 ± 0.19 in rs397897239 for LL and SS type mixture, the maximum and minimum D-values were 9.32 ± 0.54 in rs397897230 and 4.38 ± 0.26 in rs 397897239 for LL(SS) and LS type mixture, separately. Any D-value between 0.86 and 5.11 in the 14

  5. The feather-degrading bacterial community in two soils as revealed by a specific primer targeting serine-type keratinolytic proteases.

    PubMed

    Gu, Zhenhong; Zhu, Honghui; Xie, Xiaolin; Wang, Yonghong; Liu, Xiaodi; Yao, Qing

    2016-10-01

    Feather waste represents a huge resource of protein, but is underutilized due to its recalcitrant nature. Feather-degrading bacteria can biologically degrade feathers and have great potential for industries. In this study, we first designed a primer set (BC) suitable for exploring the diversity of the keratinolytic bacterial community with denatured gradient gel electrophoresis (DGGE). With the BC primer set, the difference in the keratinolytic bacterial community between a feather-dumping (FD) soil and a non feather-dumping (NFD) soil and the influence of feather addition (enrichment culture) on the keratinolytic bacterial community were investigated. DGGE and sequencing showed that keratinolytic bacteria in these soils belong to 2 phyla (Actinobacteria and Proteobacteria) and 9 genera (Micromonospora, Verrucosispora, Actinopolymorpha, Knoellia, Hyalangium, Stigmatella, Archangium, Cystobacter, and Luteimonas). Feather addition decreased the species richness of the keratinolytic bacteria in FD soil, but greatly increased the diversity, species richness and abundance in NFD soil. Moreover, feather addition to NFD soil induced some keratinolytic bacteria that were absent in all of the other soils. Collectively, these data indicate that keratinolytic bacteria are diverse in both FD and NFD soil, and some novel keratinolytic bacteria taxa might be revealed by using the BC primer set.

  6. In silico PCR primer designing and validation.

    PubMed

    Kumar, Anil; Chordia, Nikita

    2015-01-01

    Polymerase chain reaction (PCR) is an enzymatic reaction whose efficiency and sensitivity largely depend on the efficiency of the primers that are used for the amplification of a concerned gene/DNA fragment. Selective amplification of nucleic acid molecules initially present in minute quantities provides a powerful tool for analyzing nucleic acids. In silico method helps in designing primers. There are various programs available for PCR primer design. Here we described designing of primers using web-based tools like "Primer3" and "Web Primer". For designing the primer, DNA template sequence is required that can be taken from any of the available sequence databases, e.g., RefSeq database. The in silico validation can be carried out using BLAST tool and Gene Runner software, which check their efficiency and specificity. Thereafter, the primers designed in silico can be validated in the wet lab. After that, these validated primers can be synthesized for use in the amplification of concerned gene/DNA fragment.

  7. Eggs in the Freezer: Energetic Consequences of Nest Site and Nest Design in Arctic Breeding Shorebirds

    PubMed Central

    Tulp, Ingrid; Schekkerman, Hans; de Leeuw, Joep

    2012-01-01

    Birds construct nests for several reasons. For species that breed in the Arctic, the insulative properties of nests are very important. Incubation is costly there and due to an increasing surface to volume ratio, more so in smaller species. Small species are therefore more likely to place their nests in thermally favourable microhabitats and/or to invest more in nest insulation than large species. To test this hypothesis, we examined characteristics of nests of six Arctic breeding shorebird species. All species chose thermally favourable nesting sites in a higher proportion than expected on the basis of habitat availability. Site choice did not differ between species. Depth to frozen ground, measured near the nests, decreased in the course of the season at similar non-species-specific speeds, but this depth increased with species size. Nest cup depth and nest scrape depth (nest cup without the lining) were unrelated to body mass (we applied an exponent of 0.73, to account for metabolic activity of the differently sized species). Cup depth divided by diameter2 was used as a measure of nest cup shape. Small species had narrow and deep nests, while large species had wide shallow nests. The thickness of nest lining varied between 0.1 cm and 7.6 cm, and decreased significantly with body mass. We reconstruct the combined effect of different nest properties on the egg cooling coefficient using previously published quantitative relationships. The predicted effect of nest cup depth and lining depth on heat loss to the frozen ground did not correlate with body mass, but the sheltering effect of nest cup diameter against wind and the effects of lining material on the cooling coefficient increased with body mass. Our results suggest that small arctic shorebirds invest more in the insulation of their nests than large species. PMID:22701596

  8. Testing ecological and behavioral correlates of nest predation

    USGS Publications Warehouse

    Fontaine, J.J.; Martel, M.; Markland, H.M.; Niklison, Alina M.; Decker, Karie L.; Martin, T.E.

    2007-01-01

    Variation in nest predation rates among bird species are assumed to reflect differences in risk that are specific to particular nest sites. Theoretical and empirical studies suggest that parental care behaviors can evolve in response to nest predation risk and thereby differ among ecological conditions that vary in inherent risk. However, parental care also can influence predation risk. Separating the effects of nest predation risk inherent to a nest site from the risk imposed by parental strategies is needed to understand the evolution of parental care. Here we identify correlations between risks inherent to nest sites, and risk associated with parental care behaviors, and use an artificial nest experiment to assess site-specific differences in nest predation risk across nesting guilds and between habitats that differed in nest predator abundance. We found a strong correlation between parental care behaviors and inherent differences in nest predation risk, but despite the absence of parental care at artificial nests, patterns of nest predation risk were similar for real and artificial nests both across nesting guilds and between predator treatments. Thus, we show for the first time that inherent risk of nest predation varies with nesting guild and predator abundance independent of parental care. ?? Oikos.

  9. Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material

    PubMed Central

    Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.

    2000-01-01

    A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384

  10. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    PubMed Central

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  11. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  12. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  13. Transmission Investment: A Primer

    SciTech Connect

    McGarvey, Joe

    2006-10-15

    This primer highlights recent trends in transmission investment, summarizes the division of jurisdictional authority over transmission, and presents four alternative models for transmission ownership. (author)

  14. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    PubMed

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  15. Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India.

    PubMed

    Mandal, Partha Sarathi; Mukhopadhayay, Sunit Kumar; Pradhan, Saktipada; Mondal, Samiran; Jana, Chandrakanta; Patra, Nimai Chandra; Hansda, Rabindra Nath

    2017-03-01

    The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP) infected eggs, and histopathological changes of chorioallantoic membrane (CAM) in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR). After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell) embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076) showed homology with the sequences data available in GenBank. The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.

  16. Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India

    PubMed Central

    Mandal, Partha Sarathi; Mukhopadhayay, Sunit Kumar; Pradhan, Saktipada; Mondal, Samiran; Jana, Chandrakanta; Patra, Nimai Chandra; Hansda, Rabindra Nath

    2017-01-01

    Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP) infected eggs, and histopathological changes of chorioallantoic membrane (CAM) in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR). Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell) embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076) showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP. PMID:28435197

  17. Waterbird nest-site selection is influenced by neighboring nests and island topography

    USGS Publications Warehouse

    Hartman, Christopher; Ackerman, Josh; Takekawa, John Y.; Herzog, Mark

    2016-01-01

    Avian nest-site selection is influenced by factors operating across multiple spatial scales. Identifying preferred physical characteristics (e.g., topography, vegetation structure) can inform managers to improve nesting habitat suitability. However, social factors (e.g., attraction, territoriality, competition) can complicate understanding physical characteristics preferred by nesting birds. We simultaneously evaluated the physical characteristics and social factors influencing selection of island nest sites by colonial-nesting American avocets (Recurvirostra americana) and Forster's terns (Sterna forsteri) at 2 spatial scales in San Francisco Bay, 2011–2012. At the larger island plot (1 m2) scale, we used real-time kinematics to produce detailed topographies of nesting islands and map the distribution of nests. Nesting probability was greatest in island plots between 0.5 m and 1.5 m above the water surface, at distances <10 m from the water's edge, and of moderately steep (avocets) or flat (terns) slopes. Further, avocet and tern nesting probability increased as the number of nests initiated in adjacent plots increased up to a peak of 11–12 tern nests, and then decreased thereafter. Yet, avocets were less likely to nest in plots adjacent to plots with nesting avocets, suggesting an influence of intra-specific territoriality. At the smaller microhabitat scale, or the area immediately surrounding the nest, we compared topography, vegetation, and distance to nearest nest between nest sites and paired random sites. Topography had little influence on selection of the nest microhabitat. Instead, nest sites were more likely to have vegetation present, and greater cover, than random sites. Finally, avocet, and to a lesser extent tern, nest sites were closer to other active conspecific or heterospecific nests than random sites, indicating that social attraction played a role in selection of nest microhabitat. Our results demonstrate key differences in nest

  18. Detection and strain identification of Actinobacillus actinomycetemcomitans by nested PCR.

    PubMed Central

    Leys, E J; Griffen, A L; Strong, S J; Fuerst, P A

    1994-01-01

    By using PCR, Actinobacillus actinomycetemcomitans strains were identified directly from plaque samples without the need to isolate or culture bacteria. DNA fragments were generated by a nested, two-step PCR amplification of the ribosomal spacer region between the 16S and 23S rRNA genes. For the first amplification, primers homologous to sequences common to all bacterial species were used. This was followed by a second amplification with primers specific to A. actinomycetemcomitans. The ribosomal DNA spacer region was amplified from as few as 10 bacterial cells within a total population of 10(8) cells (0.00001%), and cross-reactivity between species was not observed. DNA fragments specific for Porphyromonas gingivalis were generated from the same samples by using a P. gingivalis-specific primer, and equivalent sensitivity and specificity were observed. A. actinomycetemcomitans was detected in 60% and P. gingivalis was detected in 79% of 52 subjects tested. Sequence analysis of the spacer region DNA fragment for A. actinomycetemcomitans gave precise strain identification, producing unique sequences for seven reference strains and identification of nine plaque-derived isolates. A phylogenetic tree based on quantitative sequence relationships was constructed. Two-step PCR amplification directly from plaque samples combined with sequence analysis of the ribosomal DNA spacer region provides a sensitive assay for detection and strain identification of multiple species directly from a single plaque sample. This simplified approach provides a practical method for large-scale studies on the transmission and pathogenicity of periodontitis-associated bacteria. Images PMID:8051258

  19. Analysis of yeast-like symbiote diversity in the brown planthopper (BPH), Nilaparvata lugens Stål, using a novel nested PCR-DGGE protocol.

    PubMed

    Hou, Yun; Ma, Zheng; Dong, Shengzhang; Chen, Yolanda H; Yu, Xiaoping

    2013-09-01

    Yeast-like symbiotes (YLS) are endosymbionts that are intimately associated with the growth, development, reproduction of their host, the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae). However, it is unclear how many species of YLS are found within N. lugens, and how they are related to each other. Traditional methods or simple amplification based on 18S rDNA sequence does not reliably identify new species quickly and efficiently. Therefore, a novel nested PCR-denaturing gradient gel electrophoresis (DGGE) strategy was developed in this article to analyze the YLS of brown planthopper using a nested PCR protocol that involved the 18S rDNA gene and the 5.8S-ITS gene using fungal universal primers. The nested PCR protocol was developed as follows: firstly, the 18S rDNA gene, and 5.8S-ITS gene were amplified using fungal universal primers. Subsequently, these products were used as a template in a second PCR with primers ITS1GC-ITS2, ITS1FGC-ITS2, and NFGC-NR, which was suitable for DGGE. Using this highly specific molecular approach, we found several previously detected fungi: Noda, Pichia guilliermondii, Candida sp., and some previously undetected fungi, such as Saccharomycetales sp., Debaryomyces hansenii, and some uncultured fungi. In conclusion, the nested PCR system developed in this study, coupled with DGGE fingerprinting, offers a new tool for uncovering fungal endosymbiont diversity within planthoppers.

  20. Specific detection of the toxigenic species Fusarium proliferatum and F. oxysporum from asparagus plants using primers based on calmodulin gene sequences.

    PubMed

    Mulè, Giuseppina; Susca, Antonia; Stea, Gaetano; Moretti, Antonio

    2004-01-30

    Fusarium proliferatum and Fusarium oxysporum are the causal agents of a destructive disease of asparagus called Fusarium crown and root rot. F. proliferatum from asparagus produces fumonisin B1 and B2, which have been detected as natural contaminants in infected asparagus plants. Polymerase chain reaction (PCR) assays were developed for the rapid identification of F. proliferatum and F. oxysporum in asparagus plants. The primer pairs are based on calmodulin gene sequences. The PCR products from F. proliferatum and F. oxysporum were 526 and 534 bp long, respectively. The assays were successfully applied to identify both species from the vegetative part of the plants.

  1. Primer design versus PCR bias in methylation independent PCR amplifications.

    PubMed

    Wojdacz, Tomasz K; Borgbo, Tanni; Hansen, Lise Lotte

    2009-05-16

    Many protocols in methylation studies utilize one primer set to generate a PCR product from bisulfite modified template regardless of its methylation status (methylation independent amplification MIP). However, proportional amplification of methylated and unmethylated alleles is hard to achieve due to PCR bias favoring amplification of unmethylated relatively GC poor sequence. Two primer design systems have been proposed to overcome PCR bias in methylation independent amplifications. The first advises against including any CpG dinucleoteides into the primer sequence (CpG-free primers) and the second, recently published by us, is based on inclusion of a limited number of CpG sites into the primer sequence. Here we used the Methylation Sensitive High Resolution Melting (MS-HRM) technology to investigate the ability of primers designed according to both of the above mentioned primer design systems to proportionally amplify methylated and unmethylated templates. Ten "CpG-free" primer pairs and twenty primers containing limited number of CpGs were tested. In reconstruction experiments the "CpG-free" primers showed primer specific sensitivity and allowed us to detect methylation levels in the range from 5 to 50%. Whereas while using primers containing limited number of CpG sites we were able to consistently detect 1-0.1% methylation levels and effectively control PCR amplification bias. In conclusion, the primers with limited number of CpG sites are able to effectively reverse PCR bias and therefore detect methylated templates with significantly higher sensitivity than CpG free primers.

  2. PRISE (PRImer SElector): software for designing sequence-selective PCR primers.

    PubMed

    Fu, Qi; Ruegger, Paul; Bent, Elizabeth; Chrobak, Marek; Borneman, James

    2008-03-01

    This report presents PRImer Selector (PRISE), a new software package that implements several features that improve and streamline the design of sequence-selective PCR primers. The PRISE design process involves two main steps. In the first step, target and non-target DNA sequences are identified. In the second step, primers are designed to amplify target (but not non-target) sequences. One important feature of PRISE is that it automates the task of placing primer-template mismatches at the 3' end of the primers - a property that is crucial for sequence selectivity. Once a list of candidate primers has been produced, sorting tools in PRISE speed up the selection process by allowing a user to sort the primers by properties such as amplicon length, GC content and sequence selectivity. PRISE can be used to design primers with a range of specificities, targeting individual sequences as well as diverse assemblages of genes. PRISE also allows user-defined primers to be analyzed, enabling their properties to be examined in relation to target and non-target sequences. The utility of PRISE was demonstrated by using it to design sequence-selective PCR primers for an rRNA gene from the fungus Pochonia chlamydosporia.

  3. Stomach-specific Biomarkers (GastroPanel) Can Predict the Development of Gastric Cancer in a Caucasian Population: A Longitudinal Nested Case-Control Study in Siberia.

    PubMed

    Kurilovich, Svetlana; Belkovets, Anna; Reshetnikov, Oleg; Openko, Tatyana; Malyutina, Sofja; Ragino, Ylija; Scherbakova, Lilija; Leja, Marcis; Paloheimo, Lea; Syrjänen, Kari; Voevoda, Mikhail

    2016-01-01

    Atrophic gastritis (AG) is the most important risk condition for gastric cancer (GC). A panel of stomach-specific serum biomarkers: pepsinogen (PG) I, pepsinogen (PG) II, gastrin-17 (G-17), and IgG antibodies to H. pylori (HP-Ab) detects the extent and grade of AG. The aim of the present study was to assess the predictive value of this 4-biomarker panel (GastroPanel, Biohit Oyj, Helsinki, Finland) in a case-control setting nested within a cohort of Caucasian population in Western Siberia. Both the cases and controls for the study derived from a population-based cohort of 45-69-year-old subjects (n=9,360) in the HAPIEE (Health, Alcohol and Psychosocial Factors In Eastern Europe) study, enrolled in Novosibirsk, Siberia during 2003-2005. Cases represent all GCs reported to the Cancer Registry until 2012, being matched (1:2) with healthy controls (COs). Altogether 156 (52 GCs and 104 COs) serum samples collected at study entry were available for GastroPanel analysis. Conditional logistic regression models (uni- and multivariate) were used to analyze this matched case-control setting. The biomarker levels below cut-off at baseline predicted the development of GC as follows: PGI (OR=2.9; 95%CI=1.3-6.4), PGII (OR=9.0; 95%CI=1.8-44.3), PGI/PGII (OR=3.3; 95%CI=1.5-7.3); G-17 (OR=1.8; 95%CI=0.7-4.8), and HP-Ab (OR=0.4; 95%CI=0.1-1.3). In the multivariate model adjusted for sex, age, and all GastroPanel markers, PGI/PGII ratio was the most powerful independent predictor of GC (OR=2.9; 95% CI=1.01-8.0). For the first time in a Caucasian population, we demonstrated that PGI, PGII and PGI/PGII ratio are reliable longitudinal predictors of incidence of GC. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  4. Cavity Nesting Birds

    Treesearch

    Virgil E. Scott; Keith E. Evans; David R. Patton; Charles P. Stone

    1977-01-01

    Many species of cavity-nesting birds have declined because of habitat reduction. In the eastern United States, where primeval forests are gone, purple martins depend almost entirely on man-made nesting structures (Allen and Nice 1952). The hole-nesting population of peregrine falcons disappeared with the felling of the giant trees upon which they depended (Hickey and...

  5. An experimentally validated panel of subfamily-specific oligonucleotide primers (V alpha 1-w29/V beta 1-w24) for the study of human T cell receptor variable V gene segment usage by polymerase chain reaction.

    PubMed

    Genevée, C; Diu, A; Nierat, J; Caignard, A; Dietrich, P Y; Ferradini, L; Roman-Roman, S; Triebel, F; Hercend, T

    1992-05-01

    We report here the characterization of a series of T cell receptor (TcR) V alpha or V beta subfamily-specific oligonucleotide primers. Criteria that have guided the design of each oligonucleotide include appropriate thermodynamic parameters as well as differential base-pairing scores with related and unrelated target sequences. The specificity of the oligonucleotides for each V alpha or V beta subfamily was tested by polymerase chain reaction (PCR) on both a series of TcR encoding plasmid DNA and clonal T cell populations. Unexpected cross-reactivities were observed with plasmid cDNA sequences corresponding to unrelated subfamily gene segments. This led to the synthesis of additional series of oligonucleotides to obtain a relevant panel. A series of V alpha 1-w29/V beta 1-w24 TcR subfamily-specific oligonucleotides was eventually selected which generates little, if any, cross-reactivity. The use of C alpha or C beta primers for the amplification of internal positive control templates (i.e. C beta for the V alpha series and C alpha for the V beta series) has been tested in PCR performed with cDNA derived from peripheral blood lymphocytes; it was shown not to alter the amplification of the V subfamily-specific DNA fragments. This panel of oligonucleotides will be helpful in the study of TcRV gene segment usage and, thus, may lead to a better characterization of T cell responses in physiological and pathological situations.

  6. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.

    PubMed

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus

    2011-07-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at http://www.cbs.dtu.dk/services/phuser/.

  7. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection.

    PubMed

    Mastan, Shaik G; Sudheer, Pamidimarri D V N; Rahman, Hifzur; Reddy, Muppala P; Chikara, Jitendra

    2012-01-01

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies.

  8. Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

    PubMed

    Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

    2014-12-01

    Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation.

  9. HIV lipodystrophy syndrome: a primer.

    PubMed

    Robinson, F Patrick

    2004-01-01

    Treatment with highly active antiretroviral therapy (HAART) has been implicated in the development of anthropomorphic and metabolic abnormalities termed HIV lipodystrophy syndrome (or LDS). This primer offers a comprehensive overview of LDS including epidemiology, hypothesized etiologies, and clinical consequences. The evidence-based literature is reviewed for current treatment strategies including discontinuation of specific antiretrovirals, pharmacological management of dyslipidemia and insulin resistance, exercise training, facial augmentation, liposuction, and hormonal therapy. Patient education, counseling, and adherence are discussed.

  10. Detection of Mycoplasma hyopneumoniae by Air Sampling with a Nested PCR Assay

    PubMed Central

    Stärk, Katharina D. C.; Nicolet, Jacques; Frey, Joachim

    1998-01-01

    This article describes the first successful detection of airborne Mycoplasma hyopneumoniae under experimental and field conditions with a new nested PCR assay. Air was sampled with polyethersulfone membranes (pore size, 0.2 μm) mounted in filter holders. Filters were processed by dissolution and direct extraction of DNA for PCR analysis. For the PCR, two nested pairs of oligonucleotide primers were designed by using an M. hyopneumoniae-specific DNA sequence of a repeated gene segment. A nested PCR assay was developed and used to analyze samples collected in eight pig houses where respiratory problems had been common. Air was also sampled from a mycoplasma-free herd. The nested PCR was highly specific and 104 times as sensitive as a one-step PCR. Under field conditions, the sampling system was able to detect airborne M. hyopneumoniae on 80% of farms where acute respiratory disease was present. No airborne M. hyopneumoniae was detected on infected farms without acute cases. The chance of successful detection was increased if air was sampled at several locations within a room and at a lower air humidity. PMID:9464391

  11. Detection of horses infected naturally with equine infectious anemia virus by nested polymerase chain reaction.

    PubMed

    Nagarajan, M M; Simard, C

    2001-05-01

    A nested polymerase chain reaction (PCR) amplifying a region of the gag gene of equine infectious anemia virus (EIAV) was developed for the rapid and direct detection of proviral DNA from the peripheral blood of naturally infected horses and was compared with the Coggins test. DNA prepared from white blood cells of 122 field horses from 15 stables with reported cases of EIAV and one seronegative stable were analysed. Amplifications of expected size fragments were obtained by nested PCR for 88 horses using two different sets of primers targeting the gag region. The specificity of the amplified products was confirmed by hybridization using a digoxigenin-labeled probe. Gag-nested PCR-restriction fragment length polymorphism analysis distinguished two different subtypes of gag gene, A and B. Subtype A was found to be the most prevalent among the infected horses that were tested. The PCR-gag amplified sequence of subtype A shared 84.6% nucleotide and 93% deduced amino acid sequence identities with the prototype Wyoming strain whereas subtype B sequence was almost 100% identical to the prototype. Sequence analysis of gag subtype A suggests the presence of a novel EIAV variant among infected horses in Canada. The nested PCR assay developed in the present study detected more EIAV positive animals and was found as specific as the agar gel immunodiffusion (Coggins) assay and offers great potential a diagnostic test for the detection of EIAV infections in field horses.

  12. PyMultiNest: Python interface for MultiNest

    NASA Astrophysics Data System (ADS)

    Buchner, Johannes

    2016-06-01

    PyMultiNest provides programmatic access to MultiNest (ascl:1109.006) and PyCuba, integration existing Python code (numpy, scipy), and enables writing Prior & LogLikelihood functions in Python. PyMultiNest can plot and visualize MultiNest's progress and allows easy plotting, visualization and summarization of MultiNest results. The plotting can be run on existing MultiNest output, and when not using PyMultiNest for running MultiNest.

  13. Ability to assess nest predation risk in secondary hole-nesting birds: an experimental study.

    PubMed

    Pöysä, Hannu; Ruusila, Vesa; Milonoff, Markku; Virtanen, Juha

    2001-01-01

    Because nest predation is the major source of nesting mortality in birds, site-specific predation risk may play an important role in determining birds' ability to select nest sites that reduce predation risk. This possibility has not been adequately tested. Here we report on 5-year experiments by which we studied, independently from birds' earlier experience with specific nest boxes, both the selection and predation risk of nest sites in the common goldeneye (Bucephala clangula). New, previously unoccupied nest boxes were erected in two habitat types on three study areas. Experimentally measured predation risk in the nest boxes varied between 0 and 1.0, i.e. goldeneye females could select a nest site along a wide gradient of possible predation-risk values. We did not find a difference in predation risk between occupied and unoccupied nest boxes, nor was the order of nest box occupation associated with predation risk. A power analysis revealed that our test had reasonably high power to reject a false null hypothesis. Our results suggest that common goldeneye females likely have not evolved an ability to assess predation risk of new, previously unoccupied nest sites.

  14. A thermodynamic approach to PCR primer design.

    PubMed

    Mann, Tobias; Humbert, Richard; Dorschner, Michael; Stamatoyannopoulos, John; Noble, William Stafford

    2009-07-01

    We developed a primer design method, Pythia, in which state of the art DNA binding affinity computations are directly integrated into the primer design process. We use chemical reaction equilibrium analysis to integrate multiple binding energy calculations into a conservative measure of polymerase chain reaction (PCR) efficiency, and a precomputed index on genomic sequences to evaluate primer specificity. We show that Pythia can design primers with success rates comparable with those of current methods, but yields much higher coverage in difficult genomic regions. For example, in RepeatMasked sequences in the human genome, Pythia achieved a median coverage of 89% as compared with a median coverage of 51% for Primer3. For parameter settings yielding sensitivities of 81%, our method has a recall of 97%, compared with the Primer3 recall of 48%. Because our primer design approach is based on the chemistry of DNA interactions, it has fewer and more physically meaningful parameters than current methods, and is therefore easier to adjust to specific experimental requirements. Our software is freely available at http://pythia.sourceforge.net.

  15. Specific primer amplification of the VP1 region directed by 5' UTR sequence analysis: enterovirus testing and identification in clinical samples from hand-foot-and-mouth disease patients.

    PubMed

    Ge, Shengxiang; Yan, Qiang; He, Shuizhen; Zhuang, Sijie; Niu, Jianjun; Xia, Ningshao

    2013-11-01

    Many genotypes of the enterovirus (EV) pathogens can cause clinical hand-foot-and-mouth disease (HFMD). Therefore, rapid identification and monitoring of HFMD pathogens can be difficult, especially from the original clinical specimens. In this study, both universal pan-enterovirus and EV71/CA16 VP1-specific primer sets were designed and used to examine clinical specimens from HFMD patients. Based on the initial sequence analysis of the 5'-untanslated region (5'-UTR) and VP1 amplification products, additional primers for the VP1 region were redesigned for further genotyping of the remaining small portion non-EV71/non-CA16 specimens. With a known panel, it was possible to identify 15 out of 16 members using 5'-UTR sequence typing and VP1 typing, suggesting good detectability and genotyping of this method. One strain that was not typed by 5'-UTR was shown to be a recombinant virus. When this method was applied to examine clinical specimens from 44 suspected HFMD patients, 41 were detected as EV positive. In only one case, the VP1 sequence could not be identified. Four types of EVs, including CA16 (26/41, 63.4%), EV71-C4 (6/41, 14.6%), CA6 (5/41, 12.2%) and CA10 (3/41, 7.3%), were detected. In conclusion, 5' UTR amplification sequencing and subsequent VP1 specific primer amplification ensures a high detection rate and good genotyping accuracy in the examination of clinical samples. This detection strategy can be used for routine evaluation and monitoring of HFMD to follow local trends of EV infection.

  16. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    PubMed

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  17. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR

    PubMed Central

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-lin; Korbie, Darren; Trau, Matt

    2017-01-01

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com). PMID:28117430

  18. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur

    2014-03-12

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  19. Next-generation freshwater bioassessment: eDNA metabarcoding with a conserved metazoan primer reveals species-rich and reservoir-specific communities

    PubMed Central

    Tay, Ywee Chieh; Srivathsan, Amrita; Tan, Jonathan W. T.; Kwik, Jeffrey T. B.; Baloğlu, Bilgenur; Yeo, Darren C. J.

    2016-01-01

    Freshwater habitats are of high conservation value and provide a wide range of ecosystem services. Effective management requires regular monitoring. However, conventional methods based on direct observation or specimen collection are so invasive, expensive and labour-intensive that frequent monitoring is uncommon. Here, we test whether the evaluation of environmental DNA (eDNA) from water based on a simple protocol can be used for assessing biodiversity. We use universal metazoan primers for characterizing water eDNA across horizontal and vertical spatial dimensions in two reservoirs with known species diversity for two key taxa. eDNA obtained directly from 42 samples × 15 ml water (total = 630 ml) per reservoir yielded DNA signatures for more than 500 metazoan species, of which 105 could be identified to species/genus based on DNA barcodes. We show that eDNA can be used to assign each water sample to its reservoir of origin, and that eDNA outperforms conventional survey methods in single-sample richness comparisons, while revealing evidence for hundreds of unknown species that are undetected by conventional bioassessment methods. eDNA also confirms the presence of a recently discovered invasive snail species and provides evidence for the continued survival of a rare native species of goby not sighted in that habitat since 2007. eDNA thus promises to be a useful addition to the bioassessment toolbox for freshwater systems. PMID:28018653

  20. Geographical clustering of Trypanosoma cruzi I groups from Colombia revealed by low-stringency single specific primer-PCR of the intergenic regions of spliced-leader genes.

    PubMed

    Mejía-Jaramillo, Ana María; Arboleda-Sánchez, Sair; Rodríguez, Ingrid Bibiana; Cura, Carolina; Salazar, Alexander; Del Mazo, Jesús; Triana-Chávez, Omar; Schijman, Alejandro Gabriel

    2009-01-01

    A low-stringency single-primer polymerase chain reaction (LSSP-PCR) typing procedure targeted to the intergenic regions of spliced-leader genes (SL) was designed to profile Trypanosoma cruzi I stocks from endemic regions of Colombia. Comparison between SL-LSSP-PCR profiles of parasite DNA from vector faeces and cultures isolated from those faeces showed more conservative signatures than profiles using LSSP-PCR targeted to the minicircle variable regions (kDNA). This was also observed by analysing 15 parasite clones from one stock as well as serial samples of a same stock after in vitro culturing or inoculation into mice. Thus, SL-LSSP-PCR appears more appropriate than kDNA-LSSP-PCR for reliable typing of major T. cruzi I groups from in vitro cultured stocks and triatomine faeces. SL-LSSP-PCR grouped 46 of 47 T. cruzi I Colombian stocks according to their geographical procedences in four clusters: Cluster Cas from Casanare Department, Cluster Mg from Northern Magdalena department, Cluster Mom from Momposina Depression in Southern Magdalena and finally Cluster NW from northwestern Colombia, including Sucre, Chocó, Córdoba and Antioquia departments. Sequence analysis identified punctual mutations among amplicons from each cluster. Within Cluster Mg, sequence polymorphism allowed association with different sylvatic vector species. Novel SL sequences and LSSP-PCR profiles are reported from T. cruzi I infecting Eratyrus cuspidatus, Panstrongylus geniculatus and Rhodnius pallescens vectors.

  1. Morphology of nested fullerenes

    SciTech Connect

    Srolovitz, D.J.; Safran, S.A.; Homyonfer, M.; Tenne, R. )

    1995-03-06

    We introduce a continuum model which shows that dislocations and/or grain boundaries are intrinsic features of nested fullerenes whose thickness exceeds a critical value to relieve the large inherent strains in these structures. The ratio of the thickness to the radius of the nested fullerenes is determined by the ratio of the surface to curvature and dislocation (or grain boundary) energies. Confirming experimental evidence is presented for nested fullerenes with small thicknesses and with spherosymmetric shapes.

  2. Primer3—new capabilities and interfaces

    PubMed Central

    Untergasser, Andreas; Cutcutache, Ioana; Koressaar, Triinu; Ye, Jian; Faircloth, Brant C.; Remm, Maido; Rozen, Steven G.

    2012-01-01

    Polymerase chain reaction (PCR) is a basic molecular biology technique with a multiplicity of uses, including deoxyribonucleic acid cloning and sequencing, functional analysis of genes, diagnosis of diseases, genotyping and discovery of genetic variants. Reliable primer design is crucial for successful PCR, and for over a decade, the open-source Primer3 software has been widely used for primer design, often in high-throughput genomics applications. It has also been incorporated into numerous publicly available software packages and web services. During this period, we have greatly expanded Primer3’s functionality. In this article, we describe Primer3’s current capabilities, emphasizing recent improvements. The most notable enhancements incorporate more accurate thermodynamic models in the primer design process, both to improve melting temperature prediction and to reduce the likelihood that primers will form hairpins or dimers. Additional enhancements include more precise control of primer placement—a change motivated partly by opportunities to use whole-genome sequences to improve primer specificity. We also added features to increase ease of use, including the ability to save and re-use parameter settings and the ability to require that individual primers not be used in more than one primer pair. We have made the core code more modular and provided cleaner programming interfaces to further ease integration with other software. These improvements position Primer3 for continued use with genome-scale data in the decade ahead. PMID:22730293

  3. Identification of Leishmania Species Isolated from Human Cutaneous Leishmaniasis in Mehran, Western Iran Using Nested PCR

    PubMed Central

    FEIZ HADDAD, Mohammad Hossein; GHASEMI, Ezatollah; MARAGHI, Sharif; TAVALA, Mehdi

    2016-01-01

    Background: The incidence of cutaneous leishmaniasis in the city of Mehran has risen sharply in recent years because the city borders Iraq, which has allowed entrance of different Leishmania strains. These strains have different shapes, periods of disease, and healing of lesions. The present study identified and determined cutaneous leishmaniasis species in this region. Methods: This cross-sectional study was carried out by preparing slides from 92 patients with suspected cutaneous leishmaniasis lesions from Mehran during 2012–2013. Parasite genomic DNA was extracted and CSB2XF and CSB1XR primers were used to amplify the Leishmania minicircle kDNA regions. The parasite species were detected by specific 13Z and LIR primers by applying nested PCR technique. Results: All banding patterns were diagnosed as L. major parasite by comparison of standard models with amplified fragments 560 bp in length from bands. The patients were 56.5% male and 43.5% female. The most frequently-infected age group was the 21–30 years group at a rate of 27.2%. About 56.3% of patients had a single lesion and a significant correlation was observed between age and number of lesions (P > 0.05). Conclusion: The nested PCR technique was shown to be an effective method with high sensitivity and specificity for identification of human Leishmania parasites. Molecular analysis revealed that parasites isolated from Mehran were identified as L. major and the disease was rural in form. PMID:27095970

  4. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array.

  5. Detection of circulating tumor cells in breast cancer patients using multiplex reverse transcription-polymerase chain reaction and specific primers for MGB, PTHRP and KRT19 correlation with clinicopathological features.

    PubMed

    Skondra, Maria; Gkioka, Eliona; Kostakis, Ioannis D; Pissimissis, Nikolaos; Lembessis, Panagiotis; Pectasides, Dimitrios; Koutsilieris, Michael

    2014-11-01

    The aim of this study was to correlate the clinicopathological features of breast cancer patients with the positive detection of parathyroid hormone-related protein (PTHRP), cytokeratin protein 19 (KRT19) and mammaglobin (MGB) using a multiplex reverse transcription polymerase chain reaction (RT-PCR) assay developed to detect circulating tumor cells (CTCs) in peripheral blood of patients with breast cancer. Peripheral blood samples were collected from 54 breast cancer patients and 20 healthy blood donors. Subsequently, the samples were processed for RNA extraction and analyzed for the expression of PTHRP, KRT19 and MGB using specific primers and multiplex RT-PCR. The positive detection rates in breast cancer patients for PTHRP, KRT19 and MGB were 68.5%, 63% and 22.2% and for healthy donors 10%, 0% and 10%, respectively. The statistical analysis revealed that PTHRP- and KRT19-positive detections correlated with the diagnosis of breast cancer while the combined positive detections of PTHRP-plus-KRT19 correlated with the presence of distant metastasis, especially with bone metastasis. Moreover, positive detections of KRT19 correlated with high proliferation rate of breast cancer tumors. MGB-positive detections did not add any diagnostic advantage in such analysis. Multiplex-PCR based detection of CTCs using PTHRP and KRT19 primers can provide useful information for the disease. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  6. A unified approach to analyzing nest success

    USGS Publications Warehouse

    Shaffer, T.L.

    2004-01-01

    Logistic regression has become increasingly popular for modeling nest success in terms of nest-specific explanatory variables. However, logistic regression models for nest fate are inappropriate when applied to data from nests found at various ages, for the same reason that the apparent estimator of nest success is biased (i.e. older clutches are more likely to be successful than younger clutches). A generalized linear model is presented and illustrated that gives ornithologists access to a flexible, suitable alternative to logistic regression that is appropriate when exposure periods vary, as they usually do. Unlike the Mayfield method and the logistic regression method of Aebischer (1999), the logistic-exposure model requires no assumptions about when nest losses occur. Nest survival models involving continuous and categorical explanatory variables, multi-way classifications, and time-specific (e.g. nest age) and random effects are easily implemented with the logistic-exposure model. Application of the model to a sample of Yellow-breasted Chat (Icteria virens) nests shows that logistic-exposure estimates for individual levels of categorical explanatory variables agree closely with estimates obtained with Johnson's (1979) constant-survival estimator. Use of the logistic-exposure method to model time-specific effects of nest age and date on survival of Blue-winged Teal (Anas discors) and Mallard (A. platyrhynchos) nests gives results comparable to those reported by Klett and Johnson (1982). However, the logistic-exposure approach is less subjective and much easier to implement than Klett and Johnson's method. In addition, logistic-exposure survival rate estimates are constrained to the (0,1) interval, whereas Klett and Johnson estimates are not. When applied to a sample of Mountain Plover (Charadrius montanus) nests, the logistic-exposure method gives results either identical to, or similar to, those obtained with the nest survival model in program MARK. I

  7. Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil.

    PubMed

    Osaki, Silvia Cristina; Soccol, Vanete Thomaz; Costa, Adriana Oliveira; Oliveira-Silva, Márcia Benedita; Pereira, Juliana Tracz; Procópio, Antônio Eduardo

    2013-01-01

    Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR) and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP) in Curitiba, Paraná, Brazil. First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

  8. Marsh nesting by mallards

    USGS Publications Warehouse

    Krapu, G.L.; Talent, L.G.; Dwyer, T.J.

    1979-01-01

    Nest-site selection by mallard (Anas platyrhynchos) hens was studied on a 52-km2, privately owned area in the Missouri Coteau of south-central North Dakota during 1974-77. Sixty-six percent of 53 nests initiated by radio-marked and unmarked hens were in wetlands in dense stands of emergent vegetation and usually within 50 m of the wetland edge. These findings and other sources of information suggest that significant numbers of mallards breeding in the Prairie Pothole Region nest in marsh habitat. Potential factors contributing to mallard use of marsh habitat for nesting purposes are discussed. Management considerations associated with marsh nesting by mallards are described and research needs are identified.

  9. Spatial dynamics of nesting behavior: lizards shift microhabitats to construct nests with beneficial thermal properties.

    PubMed

    Angilletta, Michael J; Sears, Michael W; Pringle, Robert M

    2009-10-01

    Because temperature affects the growth, development, and survival of embryos, oviparous mothers should discriminate carefully among available nesting sites. We combined a radiotelemetric study of animal movements with a spatial mapping of environmental temperatures to test predictions about the nesting behavior of the eastern fence lizard (Sceloporus undulatus). Females made large excursions from their typical home ranges to construct nests in exposed substrates. These excursions appeared to be related solely to nesting because all females returned to forested habitat immediately afterward. On average, <1% (range = 0-8%, n = 19) of the area used by a female during nesting was contained within the area used before and after nesting. The selection of nesting sites matched predictions based on laboratory studies of embryonic performance; specifically, females nested in extremely open habitat at a mean of 6 cm depth. Spatial mapping of soil temperatures revealed that temperatures of nesting areas exceeded those of areas typically used by females, indicating that females preferred to construct warm nests that speed embryonic growth and development. However, this behavior could reduce the survivorship of females because of the need to rapidly navigate unfamiliar and exposed terrain.

  10. China Energy Primer

    SciTech Connect

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  11. Population diversity of ammonium oxidizers investigated by specific PCR amplification

    USGS Publications Warehouse

    Ward, B.B.; Voytek, M.A.; Witzel, K.-P.

    1997-01-01

    The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.

  12. MPprimer: a program for reliable multiplex PCR primer design.

    PubMed

    Shen, Zhiyong; Qu, Wubin; Wang, Wen; Lu, Yiming; Wu, Yonghong; Li, Zhifeng; Hang, Xingyi; Wang, Xiaolei; Zhao, Dongsheng; Zhang, Chenggang

    2010-03-18

    Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs) for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2x to 5x plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy), which has 79 exons, for 20x, 20x, 20x, 14x, and 5x plex PCR reactions in five tubes to detect underlying exon deletions. MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  13. Analysis of microbial communities in doenjang, a Korean fermented soybean paste, using nested PCR-denaturing gradient gel electrophoresis.

    PubMed

    Kim, Tae-Woon; Lee, Jun-Hwa; Kim, Sung-Eon; Park, Min-Hee; Chang, Hae Choon; Kim, Hae-Yeong

    2009-05-31

    Doenjang is a traditional Korean fermented soybean paste that provides a major source of protein. The microbial diversity of 10 samples of doenjang (5 commercially manufactured products and 5 homemade products) was investigated using nested PCR-denaturing gradient gel electrophoresis (DGGE). In the first step, the nearly complete 16S rRNA and 18S rRNA genes were amplified using universal primers. Subsequently, these products were used as a template in a nested PCR to obtain fragments suitable for DGGE. The bacterial DGGE profile targeting the V3 region of the 16S rRNA gene indicated that lactic acid bacteria such as Leuconostoc mesenteroide, Tetragenococcus halophilus, and Enterococcus faecium were the predominant species. However, bands corresponding to Bacillus species, known to be the main organisms in doenjang, were not detected under the conditions described above. When selective PCR was conducted using a primer specific for Bacillus species, Bacillus subtilis and B. licheniformis were detected in several doenjang samples. In analysis of fungi, Mucor plumbeus, Aspergillus oryzae, and Debaryomyces hansenii were the most common species in the doenjang samples. On the basis of DGGE, a few differences in community structure were found for different samples. Also, cluster analysis of the DGGE profile revealed that the microbial diversity did not differ clearly between commercially manufactured and homemade products. The nested PCR-DGGE technique was used for the first time in this study to asses a microbial community in doenjang and proved to be effective in profiling microbial diversity.

  14. Development of primer sets for loop-mediated isothermal amplification that enables rapid and specific detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    USDA-ARS?s Scientific Manuscript database

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three ...

  15. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    USDA-ARS?s Scientific Manuscript database

    A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricte...

  16. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  17. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  18. Systems Engineering Measurement Primer

    DTIC Science & Technology

    1998-03-01

    Systems Engineering Measurement Primer A Basic Introduction to Systems Engineering Measurement Concepts and Use Version 1.0 March 1998 This document...Federal Systems Garry Roedler Lockheed Martin Management & Data Systems Cathy Tilton The National Registry, Inc. E. Richard Widmann Raytheon Systems...IV 1. INTRODUCTION

  19. Nulcear materials production: Primer

    SciTech Connect

    Not Available

    1988-09-01

    The US Department of Energy's (DOE's) Office of Nuclear Materials Production (NMP) is responsible for managing the production and recovery of nuclear materials for national defense. NMP oversees the production of radioactive materials for government, commercial, industrial, and medical applications. This Primer is a general introduction to NMP's major activities.

  20. Nested neural networks

    NASA Technical Reports Server (NTRS)

    Baram, Yoram

    1988-01-01

    Nested neural networks, consisting of small interconnected subnetworks, allow for the storage and retrieval of neural state patterns of different sizes. The subnetworks are naturally categorized by layers of corresponding to spatial frequencies in the pattern field. The storage capacity and the error correction capability of the subnetworks generally increase with the degree of connectivity between layers (the nesting degree). Storage of only few subpatterns in each subnetworks results in a vast storage capacity of patterns and subpatterns in the nested network, maintaining high stability and error correction capability.

  1. A New Diagnostic system for Ultra Sensitive and Specific Detection and Quantitation of “Candidatus Liberibacter asiaticus”, the Bacterium Associated with Citrus Huanglongbing

    USDA-ARS?s Scientific Manuscript database

    In this study, an ultra sensitive and quantitative diagnostic system for “Candidatus Liberibacter asiaticus” was developed. This system adapts a nested PCR and Taq-Man PCR in a single closed tube. The procedure involves two steps of PCR using the species specific outer and inner primer pairs. Differ...

  2. Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

    PubMed

    Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

    2014-09-01

    PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists.

  3. [Rapid detection of influenza virus A (AH1, AH3) and B by nested-polymerase chain reaction].

    PubMed

    Shimizu, H; Watanabe, S; Imai, M

    1997-06-01

    We applied the Nested-polymerase chain reaction (PCR) for laboratory diagnosis of influenza virus infection. We used three primer sets for detection of influenza virus A (AH1, AH3) and B. The primer sets for each type (AH1, AH3, B) was able to detect specifically each type of influenza. We measured the sensitivity for detection of vaccine strains. The PCR method was able to detect 0.9 PFU/assey of AH1 type, 1.0 PFU/assey of AH3 type and 1.8 PFU/assey of B type. Out of 46 isolation negative but antibody positive cases, 38 cases were positive for PCR (82.6%). This method is sensitive and useful for rapid diagnosis of influenza virus infection.

  4. Nested-multiplex PCR detection of Orthopoxvirus and Parapoxvirus directly from exanthematic clinical samples

    PubMed Central

    Abrahão, Jônatas S; Lima, Larissa S; Assis, Felipe L; Alves, Pedro A; Silva-Fernandes, André T; Cota, Marcela MG; Ferreira, Vanessa M; Campos, Rafael K; Mazur, Carlos; Lobato, Zélia IP; Trindade, Giliane S; Kroon, Erna G

    2009-01-01

    Background Orthopoxvirus (OPV) and Parapoxvirus (PPV) have been associated with worldwide exanthematic outbreaks. Some species of these genera are able to infect humans and domestic animals, causing serious economic losses and public health impact. Rapid, useful and highly specific methods are required to detect and epidemiologically monitor such poxviruses. In the present paper, we describe the development of a nested-multiplex PCR method for the simultaneous detection of OPV and PPV species directly from exanthematic lesions, with no previous viral isolation or DNA extraction. Methods and Results The OPV/PPV nested-multiplex PCR was developed based on the evaluation and combination of published primer sets, and was applied to the detection of the target pathogens. The method showed high sensitivity, and the specificity was confirmed by amplicon sequencing. Exanthematic lesion samples collected during bovine vaccinia or contagious ecthyma outbreaks were submitted to OPV/PPV nested-multiplex PCR and confirmed its applicability. Conclusion These results suggest that the presented multiplex PCR provides a highly robust and sensitive method to detect OPV and PPV directly from clinical samples. The method can be used for viral identification and monitoring, especially in areas where OPV and PPV co-circulate. PMID:19747382

  5. Primer design using Primer Express® for SYBR Green-based quantitative PCR.

    PubMed

    Singh, Amarjeet; Pandey, Girdhar K

    2015-01-01

    To quantitate the gene expression, real-time RT-PCR or quantitative PCR (qPCR) is one of the most sensitive, reliable, and commonly used methods in molecular biology. The reliability and success of a real-time PCR assay depend on the optimal experiment design. Primers are the most important constituents of real-time PCR experiments such as in SYBR Green-based detection assays. Designing of an appropriate and specific primer pair is extremely crucial for correct estimation of transcript abundance of any gene in a given sample. Here, we are presenting a quick, easy, and reliable method for designing target-specific primers using Primer Express(®) software for real-time PCR (qPCR) experiments.

  6. Creating State-Specific Resources: A Technical Assistance Model That Works. Primers on Implementing Special Education in Charter Schools. Special Report

    ERIC Educational Resources Information Center

    Lange, Cheryl M.

    2008-01-01

    A model developed by the Technical Assistance Customizer (TAC) Project offers state education agencies and other organizations an approach to assist them with converting national findings and resources to state-specific materials in a timely and cost-effective manner. Moreover, the approach recognizes the importance of collaboration with and the…

  7. Creating State-Specific Resources: A Technical Assistance Model That Works. Primers on Implementing Special Education in Charter Schools. Special Report

    ERIC Educational Resources Information Center

    Lange, Cheryl M.

    2008-01-01

    A model developed by the Technical Assistance Customizer (TAC) Project offers state education agencies and other organizations an approach to assist them with converting national findings and resources to state-specific materials in a timely and cost-effective manner. Moreover, the approach recognizes the importance of collaboration with and the…

  8. EasyExonPrimer: automated primer design for exon sequences.

    PubMed

    Wu, Xiaolin; Munroe, David J

    2006-01-01

    EasyExonPrimer is a web-based software that automates the design of PCR primers to amplify exon sequences from genomic DNA. EasyExonPrimer is written in Perl and uses Primer3 to design PCR primers based on the genome builds and annotation databases available at the University of California, Santa Cruz (UCSC) Genome Browser database (http://genome.ucsc.edu/). It masks repeats and known single nucleotide polymorphism (SNP) sites in the genome and designs standardised primers using optimised conditions. Users can input genes by RefSeq mRNA ID, gene name or keyword. The primer design is optimised for large-scale resequencing of exons. For exons larger than 1 kb, the user has the option of breaking the exon sequence down into overlapping smaller fragments. All primer pairs are then verified using the In-Silico PCR software to test for uniqueness in the genome. We have designed >1000 pairs of primers for 90 genes; 95% of the primer pairs successfully amplified exon sequences under standard PCR conditions without requiring further optimisation. EasyExonPrimer is available from http://129.43.22.27/~primer/. The source code is also available upon request. Xiaolin Wu (forestwu@mail.nih.gov).

  9. The use of singleplex and nested PCR to detect Batrachochytrium dendrobatidis in free-living frogs

    PubMed Central

    Coutinho, Selene Dall'Acqua; Burke, Julieta Catarina; de Paula, Catia Dejuste; Rodrigues, Miguel Trefaut; Catão-Dias, José Luiz

    2015-01-01

    Many microorganisms are able to cause diseases in amphibians, and in the past few years one of the most reported has been Batrachochytrium dendrobatidis. This fungus was first reported in Brazil in 2005; following this, other reports were made in specimens deposited in museum collections, captive and free-living frogs. The aim of this study was to compare singleplex and nested-PCR techniques to detect B. dendrobatidis in free-living and apparently healthy adult frogs from the Brazilian Atlantic Forest. The sample collection area was a protected government park, with no general entrance permitted and no management of the animals there. Swabs were taken from the skin of 107 animals without macroscopic lesions and they were maintained in ethanol p.a. Fungal DNA was extracted and identification of B. dendrobatidis was performed using singleplex and nested-PCR techniques, employing specific primers sequences. B. dendrobatidis was detected in 61/107 (57%) and 18/107 (17%) animals, respectively by nested and singleplex-PCR. Nested-PCR was statistically more sensible than the conventional for the detection of B. dendrobatidis (Chi-square = 37.1; α = 1%) and the agreement between both techniques was considered just fair (Kappa = 0.27). The high prevalence obtained confirms that these fungi occur in free-living frogs from the Brazilian Atlantic Forest with no macroscopic lesions, characterizing the state of asymptomatic carrier. We concluded that the nested-PCR technique, due to its ease of execution and reproducibility, can be recommended as one of the alternatives in epidemiological surveys to detect B. dendrobatidis in healthy free-living frog populations. PMID:26273273

  10. The use of singleplex and nested PCR to detect Batrachochytrium dendrobatidis in free-living frogs.

    PubMed

    Coutinho, Selene Dall'Acqua; Burke, Julieta Catarina; de Paula, Catia Dejuste; Rodrigues, Miguel Trefaut; Catão-Dias, José Luiz

    2015-06-01

    Many microorganisms are able to cause diseases in amphibians, and in the past few years one of the most reported has been Batrachochytrium dendrobatidis. This fungus was first reported in Brazil in 2005; following this, other reports were made in specimens deposited in museum collections, captive and free-living frogs. The aim of this study was to compare singleplex and nested-PCR techniques to detect B. dendrobatidis in free-living and apparently healthy adult frogs from the Brazilian Atlantic Forest. The sample collection area was a protected government park, with no general entrance permitted and no management of the animals there. Swabs were taken from the skin of 107 animals without macroscopic lesions and they were maintained in ethanol p.a. Fungal DNA was extracted and identification of B. dendrobatidis was performed using singleplex and nested-PCR techniques, employing specific primers sequences. B. dendrobatidis was detected in 61/107 (57%) and 18/107 (17%) animals, respectively by nested and singleplex-PCR. Nested-PCR was statistically more sensible than the conventional for the detection of B. dendrobatidis (Chi-square = 37.1; α = 1%) and the agreement between both techniques was considered just fair (Kappa = 0.27). The high prevalence obtained confirms that these fungi occur in free-living frogs from the Brazilian Atlantic Forest with no macroscopic lesions, characterizing the state of asymptomatic carrier. We concluded that the nested-PCR technique, due to its ease of execution and reproducibility, can be recommended as one of the alternatives in epidemiological surveys to detect B. dendrobatidis in healthy free-living frog populations.

  11. Nest Site Characteristics of Cavity Nesting Birds in Central Missouri

    Treesearch

    Jeffery D. Brawn; Bernice Tannenbaum; Keith E. Evans

    1984-01-01

    Two study sites in central Missouri oak-hickory forests were searched for nest sites of cavity nesting birds. Researchers located and measured 133 nests of 11 species. Cavity nesting bird habitat selection is affected by both snag characteristics and vegetation structure.

  12. Nested polymerase chain reaction for early diagnosis of typhoid fever.

    PubMed

    Sultana, S; Hossain, M A; Alam, M A; Paul, S K; Mahmud, C; Kabir, M R; Haque, N; Yesmin, T; Kayes, M T; Maruf, A A; Kobayashi, N

    2012-01-01

    Typhoid fever, caused by Salmonella typhi, is an important cause of morbidity and mortality in many developing countries. A rapid and sensitive method for the detection of S. typhi is essential for early diagnosis. This was a study to prospectively evaluate the sensitivity and specificity of nested polymerase chain reaction (PCR) to identify the S. typhi using flagellin gene related primers. The study was carried out in the department of Microbiology, Mymensingh Medical College, Mymensingh between July, 2010 and June, 2011, including 82 individuals of different age and sex. Of them, 62 were clinically suspected cases of typhoid fever and remaining 20 were apparently healthy controls. Cultures as well as PCR of blood specimens were performed for each of the cases. Among the 62 suspected typhoid fever cases, 8(12.9%) were blood culture positive and 55(88.7%) were PCR positive for S. typhi. All culture positive cases were positive by PCR and among 54 culture negative cases, 47(87%) were positive by PCR. Neither of the healthy controls was positive by PCR or blood culture. The sensitivity, specificity, positive predictive value and negative predictive value of PCR using blood culture as gold standard were 88.7%, 100%, 100% and 74% respectively for typhoid fever. In this study, the PCR appears highly specific, very sensitive and superior to blood culture for the early diagnosis of typhoid fever.

  13. Nested PCR detection of Centipeda periodontii in primary endodontic infections.

    PubMed

    Siqueira, José F; Rôças, Isabela N

    2004-03-01

    In recent years, molecular genetic methodologies have provided significant additional knowledge about components of the microbiota associated with infections of endodontic origin. Following this research line, the purpose of the present study was to investigate the prevalence of Centipeda periodontii in primary endodontic infections using a species-specific nested PCR assay. Samples were collected from fifty teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was initially amplified using universal 16S rDNA primers, and a second round of amplification used the first PCR products to detect a specific fragment of C. periodontii 16S rDNA. This species was detected in 3 (13%) of 23 asymptomatic cases, in 1 (14%) of 7 cases diagnosed as acute apical periodontitis, and in 3 (15%) of 20 pus samples aspirated from acute periradicular abscesses. There was no significant association between C. periodontii and the presence of clinical symptoms. Overall, C. periodontii was detected in 14% of the cases of endodontic infections. This is probably the hitherto first study to detect C. periodontii in primary endodontic infections. The specific role played by this bacterial species in infections of endodontic origin awaits further clarification.

  14. Primer on Beam Optics

    DTIC Science & Technology

    1993-09-27

    emphasis on neutral particle beam (NPB) optical devices. It explains how the motion of charged particles in magnetic and electric fields is...Inc. San Diego, California Table of Contents Page 1. Introduction 1 1.1 Organization of Primer 1 1.2 Introduction to Neutral Particle Beam...102 Figures Figure Pag© 1. Generic Neutral Particle Beam Device 4 2. An orthogonal three dimensional coordinate system 11 3. Trajectory of a

  15. Primer on molecular genetics

    SciTech Connect

    Not Available

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  16. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  17. Crystalline Silica Primer

    USGS Publications Warehouse

    ,

    1992-01-01

    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  18. Evaluation of the Bacterial Diversity in the Human Tongue Coating Based on Genus-Specific Primers for 16S rRNA Sequencing

    PubMed Central

    Zhou, Dongrui

    2017-01-01

    The characteristics of tongue coating are very important symbols for disease diagnosis in traditional Chinese medicine (TCM) theory. As a habitat of oral microbiota, bacteria on the tongue dorsum have been proved to be the cause of many oral diseases. The high-throughput next-generation sequencing (NGS) platforms have been widely applied in the analysis of bacterial 16S rRNA gene. We developed a methodology based on genus-specific multiprimer amplification and ligation-based sequencing for microbiota analysis. In order to validate the efficiency of the approach, we thoroughly analyzed six tongue coating samples from lung cancer patients with different TCM types, and more than 600 genera of bacteria were detected by this platform. The results showed that ligation-based parallel sequencing combined with enzyme digestion and multiamplification could expand the effective length of sequencing reads and could be applied in the microbiota analysis. PMID:28904972

  19. eDNA and specific primers for early detection of invasive species--A case study on the bivalve Rangia cuneata, currently spreading in Europe.

    PubMed

    Ardura, Alba; Zaiko, Anastasija; Martinez, Jose L; Samulioviene, Aurelija; Semenova, Anna; Garcia-Vazquez, Eva

    2015-12-01

    Intense human activities facilitate the successful spread and establishment of non-indigenous aquatic organisms in marine and freshwater ecosystems. In some cases such intrusions result in noticeable and adverse changes in the recipient environments. In the Baltic Sea, the discovery and rapid initial spread of the North American wedge clam Rangia cuneata represents a new wave of invasion which may trigger unpredictable changes of the local benthic communities. In this study we present a species-specific DNA-based marker developed in silico and experimentally tested on environmental samples. Marker specificity and sensitivity were assessed in vitro from water samples containing different mixtures of the target species and other five bivalves currently present in the region: the native Cerastoderma glaucum, Macoma balthica and Mytilus trossulus, the invasive Dreissena polymorpha and the cryptogenic Mya arenaria. Cross-species amplification was not found in any case. The method allows to detecting at least 0.4 ng of R. cuneata DNA per μl, and 0.1 g of tissue per liter of water. Finally, the marker performance was assessed in water samples from the Baltic Sea and Vistula Lagoon. The coincidence between independent visual observations of R. cuneata and positive PCR amplification of the marker from the water samples confirmed the efficiency of this highly reproducible, fast, and technically easy method. R. cuneata traces can be detected from environmental DNA even when the population is sparse and small, enabling rapid management responses and allowing to track the invasion dynamics. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Size matters: nest colonization patterns for twig-nesting ants

    PubMed Central

    Jiménez-Soto, Estelí; Philpott, Stacy M

    2015-01-01

    Understanding the drivers of ant diversity and co-occurrence in agroecosystems is fundamental because ants participate in interactions that influence agroecosystem processes. Multiple local and regional factors influence ant community assembly. We examined local factors that influence the structure of a twig-nesting ant community in a coffee system in Mexico using an experimental approach. We investigated whether twig characteristics (nest entrance size and diversity of nest entrance sizes) and nest strata (canopy shade tree or coffee shrub) affected occupation, species richness, and community composition of twig-nesting ants and whether frequency of occupation of ant species varied with particular nest entrance sizes or strata. We conducted our study in a shaded coffee farm in Chiapas, Mexico, between March and June 2012. We studied ant nest colonization by placing artificial nests (bamboo twigs) on coffee shrubs and shade trees either in diverse or uniform treatments. We also examined whether differences in vegetation (no. of trees, canopy cover and coffee density) influenced nest colonization. We found 33 ant species occupying 73% of nests placed. Nest colonization did not differ with nest strata or size. Mean species richness of colonizing ants was significantly higher in the diverse nest size entrance treatment, but did not differ with nest strata. Community composition differed between strata and also between the diverse and uniform size treatments on coffee shrubs, but not on shade trees. Some individual ant species were more frequently found in certain nest strata and in nests with certain entrance sizes. Our results indicate that twig-nesting ants are nest-site limited, quickly occupy artificial nests of many sizes, and that trees or shrubs with twigs of a diversity of entrance sizes likely support higher ant species richness. Further, individual ant species more frequently occupy nests with different sized entrances promoting ant richness on individual

  1. Nest and home.

    PubMed

    Hediger, H

    1977-01-01

    A nest as a rather loose construction of plant material, as it is used by most birds and some of the lowest primates, never serves as a goal of flight, very rarely as a sleeping place but mainly as a support for the offspring. A home, however, as used by many nonprimate mammals and other vertebrates, is a solid construction or an excavation in a solid material (tree hole, burrow, etc.) which serves principally as a goal of flight in case of danger, also as a sleeping place and temporarily as a nest, that is a fix-point for raising the young. In the phylogeny of primates the nest has been given up very early. The sleeping nest of pongids has nothing to do with it. Whereas the most primitive primates using nests transport their young with the mouth, in all other primates the young has to grasp actively the mother's (parent's) hair to be tranported. When the hair disappeared phylogenetically, technical devices came into use.

  2. Strategies for nest-site selection by king eiders

    USGS Publications Warehouse

    Bentzen, R.L.; Powell, A.N.; Suydam, R.S.

    2009-01-01

    Nest site selection is a critical component of reproduction and has presumably evolved in relation to predation, local resources, and microclimate. We investigated nest-site choice by king eiders (Somateria spectabilis) on the coastal plain of northern Alaska, USA, 2003-2005. We hypothesized that nest-site selection is driven by predator avoidance and that a variety of strategies including concealment, seclusion, and conspecific or inter-specific nest defense might lead to improved nesting success. We systematically searched wetland basins for king eider nests and measured habitat and social variables at nests (n = 212) and random locations (n = 493). King eiders made use of both secluded and concealed breeding strategies; logistic regression models revealed that females selected nests close to water, on islands, and in areas with high willow (Salix spp.) cover but did not select sites near conspecific or glaucous gull (Larus hyperboreus) nests. The most effective nest-placement strategy may vary depending on density and types of nest predators; seclusion is likely a mammalian-predator avoidance tactic whereas concealment may provide protection from avian predators. We recommend that managers in northern Alaska attempt to maintain wetland basins with islands and complex shorelines to provide potential nest sites in the vicinity of water. ?? The Wildlife Society.

  3. Do ducks and songbirds initiate more nests when the probability of survival is greater?

    USGS Publications Warehouse

    Grant, Todd A.; Shaffer, Terry L.

    2015-01-01

    Nesting chronology in grassland birds can vary by species, locality, and year. The date a nest is initiated can influence the subsequent probability of its survival in some grassland bird species. Because predation is the most significant cause of nest loss in grassland birds, we examined the relation between timing of nesting and nest survival. Periods of high nest survival that correspond with the peak of nesting activity might reflect long-term adaptations to specific predation pressures commonly recurring during certain periods of the nesting cycle. We evaluated this theory by comparing timing of nesting with date-specific nest survival rates for several duck and passerine species breeding in north-central North Dakota during 1998–2003. Nest survival decreased seasonally with date for five of the seven species we studied. We found little evidence to support consistent relations between timing of nesting, the number of nest initiations, and nest survival for any species we studied, suggesting that factors other than nest predation may better explain nesting chronology for these species. The apparent mismatch between date-specific patterns of nest survival and nest initiation underscores uncertainty about the process of avian nest site selection driven mainly by predation. Although timing of nesting differed among species, the general nesting period was fairly predictable across all years of study, suggesting the potential for research activities or management actions to be timed to take advantage of known periods when nests are active (or inactive). However, our results do not support the notion that biologists can take advantage of periods when many nests are active and survival is also high.

  4. Imported malaria in United Arab Emirates: evaluation of a new DNA extraction technique using nested PCR.

    PubMed

    Sultan, Doaa M; Khalil, Marwa M; Abdouh, Ahmed S; Doleh, Wafaa F; Al Muthanna, Abdul Aziz M

    2009-09-01

    Local malaria transmission in the United Arab Emirates (UAE) came to an end in 1997. Nevertheless, UAE has been subjected to substantial importation of malaria cases from abroad, concerning both UAE nationals and immigrants from malarious countries with a total number of 2,119 cases in 2007. To evaluate a new DNA extraction technique using nested PCR, blood samples were collected from 132 individuals who presented to Infectious Diseases Department in Rashid Hospital, Dubai, and Central Department of Malaria Control with fever and persistent headache. Giemsa-stained blood films and ELISA test for malaria antibodies were carried out for detection of Plasmodium infection. Plasmodium infections were identified with the genus-specific primer set and species differentiation using nested PCR. A rapid procedure for diagnosis of malaria infections directly from dried blood spots using for the first time DNA extract from FTA Elute cards was evaluated in contrast to extraction techniques using FTA classic cards and rapid boiling technique. Our new simple technique for DNA extraction using FTA Elute cards was very sensitive giving a sensitivity of 100% compared to 94% using FTA classic cards and 62% in the rapid boiling technique. No complex preparation of blood samples was required prior to the amplification. The production cost of DNA isolation in our PCR assay was much less in comparable to that of other DNA extraction protocols. The nested PCR detected plasmodial infection and could differentiate P. falciparum from P. vivax, and also detected the mixed infection.

  5. Primers for Clinical Detection of Paracoccidioides brasiliensis

    PubMed Central

    San-Blas, Gioconda; Niño-Vega, Gustavo; Barreto, Laura; Hebeler-Barbosa, Flavia; Bagagli, Eduardo; Olivero de Briceño, Rosa; Mendes, Rinaldo Poncio

    2005-01-01

    From a 0.72-kb fragment universally generated in Paracoccidioides brasiliensis strains, primers were designed and tested on genomic DNA of this and other pathogenic fungi. They were specific and highly sensitive for P. brasiliensis DNA. Positive results were obtained when these were tested in clinical samples. PMID:16081993

  6. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  7. Serenbe Nest Cottages

    SciTech Connect

    Butler, T.; Curtis, O.; Kim, E.; Roberts, S.; Stephenson, R.

    2012-12-01

    As part of the NAHB Research Center Industry Partnership, Southface partnered with Martin Dodson Builders and the Serenbe community on the construction of a new test home in the suburbs of Atlanta, GA in the mixed humid climate zone. The most recent subdivision within the Serenbe community, the Nest, will contain 15 small footprint cottage style homes, and Southface has selected Lot Nine, as the test home for this study. This Nest subdivision serves as a project showcase for both the builder partner and the Serenbe community as a whole. The planning and design incorporated into the Nest cottages will be implemented in each home within the subdivision. These homes addresses Building America Savings targets and serve as a basis of design for other homes Martin Dodson plans to build within the Serenbe community.

  8. Serenbe Nest Cottages

    SciTech Connect

    Butler, T.; Curtis, O.; Kim, E.; Roberts, S.; Stephenson, R.

    2012-12-01

    As part of the NAHB Research Center Industry Partnership, Southface partnered with Martin Dodson Builders and the Serenbe community on the construction of a new test home in the suburbs of Atlanta, GA, in the mixed humid climate zone. The most recent subdivision within the Serenbe community, the Nest, will contain 15 small footprint cottage-style homes, and Southface has selected Lot Nine, as the test home for this study. This Nest subdivision serves as a project showcase for both the builder partner and the Serenbe community as a whole. The planning and design incorporated into the Nest cottages will be implemented in each home within the subdivision. These homes addresses Building America savings targets and serve as a basis of design for other homes Martin Dodson plans to build within the Serenbe community.

  9. Sharp-Tailed Grouse Nest Survival and Nest Predator Habitat Use in North Dakota's Bakken Oil Field.

    PubMed

    Burr, Paul C; Robinson, Aaron C; Larsen, Randy T; Newman, Robert A; Ellis-Felege, Susan N

    2017-01-01

    Recent advancements in extraction technologies have resulted in rapid increases of gas and oil development across the United States and specifically in western North Dakota. This expansion of energy development has unknown influences on local wildlife populations and the ecological interactions within and among species. Our objectives for this study were to evaluate nest success and nest predator dynamics of sharp-tailed grouse (Tympanuchus phasianellus) in two study sites that represented areas of high and low energy development intensities in North Dakota. During the summers of 2012 and 2013, we monitored 163 grouse nests using radio telemetry. Of these, 90 nests also were monitored using miniature cameras to accurately determine nest fates and identify nest predators. We simultaneously conducted predator surveys using camera scent stations and occupancy modeling to estimate nest predator occurrence at each site. American badgers (Taxidea taxus) and striped skunks (Mephitis mephitis) were the primary nest predators, accounting for 56.7% of all video recorded nest depredations. Nests in our high intensity gas and oil area were 1.95 times more likely to succeed compared to our minimal intensity area. Camera monitored nests were 2.03 times more likely to succeed than non-camera monitored nests. Occupancy of mammalian nest predators was 6.9 times more likely in our study area of minimal gas and oil intensity compared to the high intensity area. Although only a correlative study, our results suggest energy development may alter the predator community, thereby increasing nest success for sharp-tailed grouse in areas of intense development, while adjacent areas may have increased predator occurrence and reduced nest success. Our study illustrates the potential influences of energy development on the nest predator-prey dynamics of sharp-tailed grouse in western North Dakota and the complexity of evaluating such impacts on wildlife.

  10. Sharp-Tailed Grouse Nest Survival and Nest Predator Habitat Use in North Dakota’s Bakken Oil Field

    PubMed Central

    2017-01-01

    Recent advancements in extraction technologies have resulted in rapid increases of gas and oil development across the United States and specifically in western North Dakota. This expansion of energy development has unknown influences on local wildlife populations and the ecological interactions within and among species. Our objectives for this study were to evaluate nest success and nest predator dynamics of sharp-tailed grouse (Tympanuchus phasianellus) in two study sites that represented areas of high and low energy development intensities in North Dakota. During the summers of 2012 and 2013, we monitored 163 grouse nests using radio telemetry. Of these, 90 nests also were monitored using miniature cameras to accurately determine nest fates and identify nest predators. We simultaneously conducted predator surveys using camera scent stations and occupancy modeling to estimate nest predator occurrence at each site. American badgers (Taxidea taxus) and striped skunks (Mephitis mephitis) were the primary nest predators, accounting for 56.7% of all video recorded nest depredations. Nests in our high intensity gas and oil area were 1.95 times more likely to succeed compared to our minimal intensity area. Camera monitored nests were 2.03 times more likely to succeed than non-camera monitored nests. Occupancy of mammalian nest predators was 6.9 times more likely in our study area of minimal gas and oil intensity compared to the high intensity area. Although only a correlative study, our results suggest energy development may alter the predator community, thereby increasing nest success for sharp-tailed grouse in areas of intense development, while adjacent areas may have increased predator occurrence and reduced nest success. Our study illustrates the potential influences of energy development on the nest predator—prey dynamics of sharp-tailed grouse in western North Dakota and the complexity of evaluating such impacts on wildlife. PMID:28081245

  11. Nest site characteristics, nesting movements, and lack of long-term nest site fidelity in Agassiz's desert tortoises at a wind energy facility in southern California

    USGS Publications Warehouse

    Lovich, Jeffrey E.; Agha, Mickey; Yackulic, Charles B.; Meyer-Wilkins, Kathie; Bjurlin, Curtis; Ennen, Joshua R.; Arundel, Terry R.; Austin, Meaghan

    2014-01-01

    Nest site selection has important consequences for maternal and offspring survival and fitness. Females of some species return to the same nesting areas year after year. We studied nest site characteristics, fidelity, and daily pre-nesting movements in a population of Agassiz’s desert tortoises (Gopherus agassizii) at a wind energy facility in southern California during two field seasons separated by over a decade. No females returned to the same exact nest site within or between years but several nested in the same general area. However, distances between first and second clutches within a year (2000) were not significantly different from distances between nests among years (2000 and 2011) for a small sample of females, suggesting some degree of fidelity within their normal activity areas. Environmental attributes of nest sites did not differ significantly among females but did among years due largely to changes in perennial plant structure as a result of multiple fires. Daily pre-nesting distances moved by females decreased consistently from the time shelled eggs were first visible in X-radiographs until oviposition, again suggesting some degree of nest site selection. Tortoises appear to select nest sites that are within their long-term activity areas, inside the climate-moderated confines of one of their self-constructed burrows, and specifically, at a depth in the burrow that minimizes exposure of eggs and embryos to lethal incubation temperatures. Nesting in “climate-controlled” burrows and nest guarding by females relaxes some of the constraints that drive nest site selection in other oviparous species.

  12. Sensitive detection of SARS coronavirus RNA by a novel asymmetric multiplex nested RT-PCR amplification coupled with oligonucleotide microarray hybridization.

    PubMed

    Zhang, Zhi-wei; Zhou, Yi-ming; Zhang, Yan; Guo, Yong; Tao, Sheng-ce; Li, Ze; Zhang, Qiong; Cheng, Jing

    2005-01-01

    We have developed a sensitive method for the detection of specific genes simultaneously. First, DNA was amplified by a novel asymmetric multiplex PCR with universal primer(s). Second, the 6-carboxytetramethylrhodamine (TAMRA)-labeled PCR products were hybridized specifically with oligonucleotide microarrays. Finally, matched duplexes were detected by using a laser-induced fluorescence scanner. The usefulness of this method was illustrated by analyzing severe acute respiratory syndrome (SARS) coronavirus RNA. The detection limit was 10(0) copies/microL. The results of the asymmetric multiplex nested reverse transcription-PCR were in agreement with the results of the microarray hybridization; no hybridization signal was lost as happened with applicons from symmetric amplifications. This reliable method can be used to the identification of other microorganisms, screening of genetic diseases, and other applications.

  13. Density-dependent nest predation in waterfowl: the relative importance of nest density versus nest dispersion

    USGS Publications Warehouse

    Ackerman, Joshua T.; Ringelman, KM; Eadie, J.M.

    2012-01-01

    When nest predation levels are very high or very low, the absolute range of observable nest success is constrained (a floor/ceiling effect), and it may be more difficult to detect density-dependent nest predation. Density-dependent nest predation may be more detectable in years with moderate predation rates, simply because there can be a greater absolute difference in nest success between sites. To test this, we replicated a predation experiment 10 years after the original study, using both natural and artificial nests, comparing a year when overall rates of nest predation were high (2000) to a year with moderate nest predation (2010). We found no evidence for density-dependent predation on artificial nests in either year, indicating that nest predation is not density-dependent at the spatial scale of our experimental replicates (1-ha patches). Using nearest-neighbor distances as a measure of nest dispersion, we also found little evidence for “dispersion-dependent” predation on artificial nests. However, when we tested for dispersion-dependent predation using natural nests, we found that nest survival increased with shorter nearest-neighbor distances, and that neighboring nests were more likely to share the same nest fate than non-adjacent nests. Thus, at small spatial scales, density-dependence appears to operate in the opposite direction as predicted: closer nearest neighbors are more likely to be successful. We suggest that local nest dispersion, rather than larger-scale measures of nest density per se, may play a more important role in density-dependent nest predation.

  14. Use of p16-INK4A overexpression to increase the specificity of human papillomavirus testing: a nested substudy of the NTCC randomised controlled trial.

    PubMed

    Carozzi, Francesca; Confortini, Massimo; Dalla Palma, Paolo; Del Mistro, Annarosa; Gillio-Tos, Anna; De Marco, Laura; Giorgi-Rossi, Paolo; Pontenani, Giovanni; Rosso, Stefano; Sani, Cristina; Sintoni, Catia; Segnan, Nereo; Zorzi, Manuel; Cuzick, Jack; Rizzolo, Raffaella; Ronco, Guglielmo

    2008-10-01

    Human-papillomavirus (HPV) testing is more sensitive, but less specific, than conventional cytology for detecting high-grade cervical intraepithelial neoplasia (CIN). We assessed whether HPV testing with triage by p16-INK4A overexpression can increase specificity while maintaining sensitivity. HPV-positive women were enrolled between June 10, 2003, and Dec 31, 2004 in a multicentre randomised controlled trial, which compared stand-alone HPV testing by Hybrid Capture 2 (experimental group) with conventional cytology, were referred for colposcopy. In seven of nine centres, cytospin preparations from these women were tested for p16-INK4A overexpression by immunostaining. The sensitivity and specificity for CIN grade 2 or more, determined at blind review of histology, were calculated for these women. We also estimated the relative sensitivity and relative referral to colposcopy that would have been obtained by HPV testing with p16-INK4A triage compared with conventional cytology. This trial is registered as a Standard Randomised Controlled Trial, number ISRCTN81678807. 24 661 women were randomly assigned to the experimental group. 1137 women (74% of those undergoing colposcopy in relevant centres), including 50 with CIN2 and 42 with CIN3 or cancer, had valid p16-INK4A immunostaining. For the endpoint of CIN2+, sensitivity and specificity of p16-INK4A (deemed positive with any number of stained cells-except endocervical, metaplastic, and atrophic cells if morphologically normal) in HPV-positive women of any age were 88% (81 of 92; 95% CI 80-94) and 61% (633 of 1045; 57-64), respectively. In the 35-60-year age group, the relative sensitivity of HPV testing and p16-INK4A triage versus conventional cytology for CIN2+ was 1.53 (95% CI 1.15-2.02) and relative referral was 1.08 (0.96-1.21). In the 25-34-year age group, relative sensitivity was 3.01 (1.82-5.17) and relative referral was 1.15 (0.96-1.37). In the latter age group, when 5% or more stained cells were deemed

  15. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic.

    PubMed

    Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor

    2012-06-01

    In the present study, an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 5 (TLR5) (C1205T; P402L) that is related to the impaired recognition of Salmonella enterica serovar Choleraesuis (SC) was developed. The allele frequencies in several pig breeds in Japan and the Czech Republic were also compared. The swine TLR5 C1205T mutation was successfully determined by ASP-PCR using genomic DNA samples in Japan that had previously been genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from blood obtained from 110 pigs from seven different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR completely matched the results from the sequencing method. The allele frequency of the swine TLR5 C1205T mutation was 27.5% in the Landrace breed of the Czech Republic compared with 50.0% in Japanese Landrace. In Japan, the C1205T mutation was found only in the Landrace breed, whereas in the Czech Republic it was found in both the Landrace and Piétrain breeds. These results indicate the usefulness of ASP-PCR for detecting a specific SNP for swine TLR5 affecting ligand recognition. They also suggest the possibility of genetically improving pigs to enhance their resistance against SC infection by eliminating or selecting this specific SNP of swine TLR5. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  16. Feathering Your Nest

    ERIC Educational Resources Information Center

    Nabors, Martha L.; Edwards, Linda Carol; Decker, Suzanne

    2010-01-01

    The first-grade classroom was like a natural history museum. Bird nests of every shape and size lay on top of bookshelves that lined two walls. Methods students, who were visiting the classroom in preparation for the science lessons they would teach there, were immediately inspired by the collection. They used the collection as a springboard for…

  17. Feathering Your Nest

    ERIC Educational Resources Information Center

    Nabors, Martha L.; Edwards, Linda Carol; Decker, Suzanne

    2010-01-01

    The first-grade classroom was like a natural history museum. Bird nests of every shape and size lay on top of bookshelves that lined two walls. Methods students, who were visiting the classroom in preparation for the science lessons they would teach there, were immediately inspired by the collection. They used the collection as a springboard for…

  18. Absolute quantification of the alleles in somatic point mutations by bioluminometric methods based on competitive polymerase chain reaction in the presence of a locked nucleic acid blocker or an allele-specific primer.

    PubMed

    Iliadi, Alexandra; Petropoulou, Margarita; Ioannou, Penelope C; Christopoulos, Theodore K; Anagnostopoulos, Nikolaos I; Kanavakis, Emmanuel; Traeger-Synodinos, Jan

    2011-09-01

    In somatic (acquired) point mutations, the challenge is to quantify minute amounts of the mutant allele in the presence of a large excess of the normal allele that differs only in a single base pair. We report two bioluminometric methods that enable absolute quantification of the alleles. The first method exploits the ability of a locked nucleic acid (LNA) oligonucleotide to bind to and inhibit effectively the polymerase chain reaction (PCR) amplification of the normal allele while the amplification of the mutant allele remains unaffected. The second method employs allele-specific PCR primers, thereby allowing the amplification of the corresponding allele only. DNA internal standards (competitors) are added to the PCR mixture to compensate for any sample-to-sample variation in the amplification efficiency. The amplification products from the two alleles and the internal standards are quantified by a microtiter well-based bioluminometric hybridization assay using the photoprotein aequorin as a reporter. The methods allow absolute quantification of less than 300 copies of the mutant allele even in samples containing less than 1% of the mutant allele.

  19. Variability in nest survival rates and implications to nesting studies

    USGS Publications Warehouse

    Klett, A.T.; Johnson, D.H.

    1982-01-01

    We used four reasonably large samples (83-213) of Mallard (Anas platyrhynchos) and Blue-winged Teal (A. discors) nests on an interstate highway right-of-way in southcentral North Dakota to evaluate potential biases in hatch-rate estimates. Twelve consecutive, weekly searches for nests were conducted with a cable-chain drag in 1976 and 1977. Nests were revisited at weekly intervals. Four methods were used to estimate hatch rates for the four data sets: the Traditional Method, the Mayfield Method, and two modifications of the Mayfield Method that are sometimes appropriate when daily mortality rates of nests are not constant. Hatch rates and the average age of nests at discovery declined as the interval between searches decreased, suggesting that mortality rates were not constant in our samples. An analysis of variance indicated that daily mortality rates varied with the age of nests in all four samples. Mortality was generally highest during the early laying period, moderately high during the late laying period, and lowest during incubation. We speculate that this relationship of mortality to nest age might be due to the presence of hens at nests or to differences in the vulnerability of nest sites to predation. A modification of the Mayfield Method that accounts for age-related variation in nest mortality was most appropriate for our samples. We suggest methods for conducting nesting studies and estimating nest success for species possessing similar nesting habits.

  20. Fiber Tracking Cylinder Nesting

    SciTech Connect

    Stredde, H.; /Fermilab

    1999-03-30

    The fiber tracker consists of 8 concentric carbon fiber cylinders of varying diameters, from 399mm to 1032.2mm and two different lengths. 1.66 and 2.52 meters. Each completed cylinder is covered over the entire o.d. with scintillating fiber ribbons with a connector on each ribbon. These ribbons are axial (parallel to the beam line) at one end and stereo (at 3 deg. to the beam line) at the other. The ribbon connectors have dowel pins which are used to match with the connectors on the wave guide ribbons. These dowel pins are also used during the nesting operation, locating and positioning measurements. The nesting operation is the insertion of one cylinder into another, aligning them with one another and fastening them together into a homogeneous assembly. For ease of assembly. the nesting operation is accomplished working from largest diameter to smallest. Although the completed assembly of all 8 cylinders glued and bolted together is very stiff. individual cylinders are relatively flexible. Therefore. during this operation, No.8 must be supported in a manner which maintains its integrity and yet allows the insertion of No.7. This is accomplished by essentially building a set of dummy end plates which replicate a No.9 cylinder. These end plates are mounted on a wheeled cart that becomes the nesting cart. Provisions for a protective cover fastened to these rings has been made and will be incorporated in finished product. These covers can be easily removed for access to No.8 and/or the connection of No.8 to No.9. Another wheeled cart, transfer cart, is used to push a completed cylinder into the cylinder(s) already mounted in the nesting cart.

  1. Impact of cervical screening on cervical cancer mortality: estimation using stage-specific results from a nested case–control study

    PubMed Central

    Landy, Rebecca; Pesola, Francesca; Castañón, Alejandra; Sasieni, Peter

    2016-01-01

    Background: It is well established that screening can prevent cervical cancer, but the magnitude of the impact of regular screening on cervical cancer mortality is unknown. Methods: Population-based case–control study using prospectively recorded cervical screening data, England 1988–2013. Case women had cervical cancer diagnosed during April 2007–March 2013 aged 25–79 years (N=11 619). Two cancer-free controls were individually age matched to each case. We used conditional logistic regression to estimate the odds ratio (OR) of developing stage-specific cancer for women regularly screened or irregularly screened compared with women not screened in the preceding 15 years. Mortality was estimated from excess deaths within 5 years of diagnosis using stage-specific 5-year relative survival from England with adjustment for age within stage based on SEER (Surveillance, Epidemiology and End Results, USA) data. Results: In women aged 35–64 years, regular screening is associated with a 67% (95% confidence interval (CI): 62–73%) reduction in stage 1A cancer and a 95% (95% CI: 94–97%) reduction in stage 3 or worse cervical cancer: the estimated OR comparing regular (⩽5.5yearly) screening to no (or minimal) screening are 0.18 (95% CI: 0.16–0.19) for cancer incidence and 0.08 (95% CI: 0.07–0.09) for mortality. It is estimated that in England screening currently prevents 70% (95% CI: 66–73%) of cervical cancer deaths (all ages); however, if everyone attended screening regularly, 83% (95% CI: 82–84%) could be prevented. Conclusions: The association between cervical cancer screening and incidence is stronger in more advanced stage cancers, and screening is more effective at preventing death from cancer than preventing cancer itself. PMID:27632376

  2. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  3. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  4. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  5. Multiplexed Primer Prediction for PCR

    SciTech Connect

    2007-07-23

    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequences used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.

  6. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  7. A primer on water

    USGS Publications Warehouse

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  8. A Brief Taxometrics Primer

    PubMed Central

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  9. Metabolomics: A Primer.

    PubMed

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future.

  10. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  11. CO2 efflux from subterranean nests of ant communities in a seasonal tropical forest, Thailand

    PubMed Central

    Hasin, Sasitorn; Ohashi, Mizue; Yamada, Akinori; Hashimoto, Yoshiaki; Tasen, Wattanachai; Kume, Tomonori; Yamane, Seiki

    2014-01-01

    Many ant species construct subterranean nests. The presence of their nests may explain soil respiration “hot spots”, an important factor in the high CO2 efflux from tropical forests. However, no studies have directly measured CO2 efflux from ant nests. We established 61 experimental plots containing 13 subterranean ant species to evaluate the CO2 efflux from subterranean ant nests in a tropical seasonal forest, Thailand. We examined differences in nest CO2 efflux among ant species. We determined the effects of environmental factors on nest CO2 efflux and calculated an index of nest structure. The mean CO2 efflux from nests was significantly higher than those from the surrounding soil in the wet and dry seasons. The CO2 efflux was species-specific, showing significant differences among the 13 ant species. The soil moisture content significantly affected nest CO2 efflux, but there was no clear relationship between nest CO2 efflux and nest soil temperature. The diameter of the nest entrance hole affected CO2 efflux. However, there was no significant difference in CO2 efflux rates between single-hole and multiple-hole nests. Our results suggest that in a tropical forest ecosystem the increase in CO2 efflux from subterranean ant nests is caused by species-specific activity of ants, the nest soil environment, and nest structure. PMID:25505521

  12. CO2 efflux from subterranean nests of ant communities in a seasonal tropical forest, Thailand.

    PubMed

    Hasin, Sasitorn; Ohashi, Mizue; Yamada, Akinori; Hashimoto, Yoshiaki; Tasen, Wattanachai; Kume, Tomonori; Yamane, Seiki

    2014-10-01

    Many ant species construct subterranean nests. The presence of their nests may explain soil respiration "hot spots", an important factor in the high CO2 efflux from tropical forests. However, no studies have directly measured CO2 efflux from ant nests. We established 61 experimental plots containing 13 subterranean ant species to evaluate the CO2 efflux from subterranean ant nests in a tropical seasonal forest, Thailand. We examined differences in nest CO2 efflux among ant species. We determined the effects of environmental factors on nest CO2 efflux and calculated an index of nest structure. The mean CO2 efflux from nests was significantly higher than those from the surrounding soil in the wet and dry seasons. The CO2 efflux was species-specific, showing significant differences among the 13 ant species. The soil moisture content significantly affected nest CO2 efflux, but there was no clear relationship between nest CO2 efflux and nest soil temperature. The diameter of the nest entrance hole affected CO2 efflux. However, there was no significant difference in CO2 efflux rates between single-hole and multiple-hole nests. Our results suggest that in a tropical forest ecosystem the increase in CO2 efflux from subterranean ant nests is caused by species-specific activity of ants, the nest soil environment, and nest structure.

  13. [HLA-A site genotyping on single blastomeres is studied by nest-PCR-SSP method].

    PubMed

    Xu, Bing-sen; Hu, Yong-wu; Huang, Xue-feng; Lin, Jin-ju; Zhou, Yin; Ye, Bi-lu; Xu, Li-xin; Xu, Kan-pu; Yang, Huan-ming

    2006-04-01

    To assess the accuracy and reliability of the nest-PCR-sequence specific primer(SSP) method in HLA-A site genotyping of single blastomeres retrieved from human pre-implantation embryos. By nest PCR on HLA-A exon 2, the success rate of first-round amplification was estimated for single blastomeres. Based on the first-round amplification, the HLA-A genotype of every single blastomeres was analyzed by commercially available PCR-SSP kits. The amplification of HLA-A exon 2 were performed to 120 blasotmeres retrieved from in vitro fertilization(IVF) surplus embryos donated by 10 couples. The average success rate of family 1-5 and 6-10 was 78.2%(43/55) and 93.8%(61/65), respectively. And 86.7%(104/120) in total. Eighty blastomeres were further tested by nest-PCR-SSP, among which 11 blastomeres failed to HLA-A exon 2 amplification and then failed to genotyping while the other 69 blastomeres succeed in HLA-A exon 2 amplification and succeed in genotyping. Except for 6 blastomeres that were uncertain for allele lost because of parents' homozygosity, the left 63 blastomeres had accurate HLA genotyping. Among these 63 blastomeres, 59 blastomeres had genotypes confirmed from their parents(93.6%), 3 blastomeres lost one of parents' alleles(4.8%), and only one blastomere had two more than parents' alleles(1.6%). The above research results indicated that based on the successful first round amplification of single blastomeres, nest-PCR-SSP strategy offers a convenient and reliable option for HLA genotyping on single blastomeres, which is a key process in pre-selecting HLA-identical sibling for allogeneic cord blood cell transplantation.

  14. Nested Tracking Graphs

    DOE PAGES

    Lukasczyk, Jonas; Weber, Gunther; Maciejewski, Ross; ...

    2017-06-01

    Tracking graphs are a well established tool in topological analysis to visualize the evolution of components and their properties over time, i.e., when components appear, disappear, merge, and split. However, tracking graphs are limited to a single level threshold and the graphs may vary substantially even under small changes to the threshold. To examine the evolution of features for varying levels, users have to compare multiple tracking graphs without a direct visual link between them. We propose a novel, interactive, nested graph visualization based on the fact that the tracked superlevel set components for different levels are related to eachmore » other through their nesting hierarchy. This approach allows us to set multiple tracking graphs in context to each other and enables users to effectively follow the evolution of components for different levels simultaneously. We show the effectiveness of our approach on datasets from finite pointset methods, computational fluid dynamics, and cosmology simulations.« less

  15. Best Development Practices: A Primer for Smart Growth

    EPA Pesticide Factsheets

    Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.

  16. Preliminary evaluation of a nest usage sensor to detect double nest occupations of laying hens.

    PubMed

    Zaninelli, Mauro; Costa, Annamaria; Tangorra, Francesco Maria; Rossi, Luciana; Agazzi, Alessandro; Savoini, Giovanni

    2015-01-26

    Conventional cage systems will be replaced by housing systems that allow hens to move freely. These systems may improve hens' welfare, but they lead to some disadvantages: disease, bone fractures, cannibalism, piling and lower egg production. New selection criteria for existing commercial strains should be identified considering individual data about laying performance and the behavior of hens. Many recording systems have been developed to collect these data. However, the management of double nest occupations remains critical for the correct egg-to-hen assignment. To limit such events, most systems adopt specific trap devices and additional mechanical components. Others, instead, only prevent these occurrences by narrowing the nest, without any detection and management. The aim of this study was to develop and test a nest usage "sensor", based on imaging analysis, that is able to automatically detect a double nest occupation. Results showed that the developed sensor correctly identified the double nest occupation occurrences. Therefore, the imaging analysis resulted in being a useful solution that could simplify the nest construction for this type of recording system, allowing the collection of more precise and accurate data, since double nest occupations would be managed and the normal laying behavior of hens would not be discouraged by the presence of the trap devices.

  17. Preliminary Evaluation of a Nest Usage Sensor to Detect Double Nest Occupations of Laying Hens

    PubMed Central

    Zaninelli, Mauro; Costa, Annamaria; Tangorra, Francesco Maria; Rossi, Luciana; Agazzi, Alessandro; Savoini, Giovanni

    2015-01-01

    Conventional cage systems will be replaced by housing systems that allow hens to move freely. These systems may improve hens' welfare, but they lead to some disadvantages: disease, bone fractures, cannibalism, piling and lower egg production. New selection criteria for existing commercial strains should be identified considering individual data about laying performance and the behavior of hens. Many recording systems have been developed to collect these data. However, the management of double nest occupations remains critical for the correct egg-to-hen assignment. To limit such events, most systems adopt specific trap devices and additional mechanical components. Others, instead, only prevent these occurrences by narrowing the nest, without any detection and management. The aim of this study was to develop and test a nest usage “sensor”, based on imaging analysis, that is able to automatically detect a double nest occupation. Results showed that the developed sensor correctly identified the double nest occupation occurrences. Therefore, the imaging analysis resulted in being a useful solution that could simplify the nest construction for this type of recording system, allowing the collection of more precise and accurate data, since double nest occupations would be managed and the normal laying behavior of hens would not be discouraged by the presence of the trap devices. PMID:25629704

  18. Design of primers and probes for quantitative real-time PCR methods.

    PubMed

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  19. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  20. PolyMarker: A fast polyploid primer design pipeline.

    PubMed

    Ramirez-Gonzalez, Ricardo H; Uauy, Cristobal; Caccamo, Mario

    2015-06-15

    The design of genetic markers is of particular relevance in crop breeding programs. Despite many economically important crops being polyploid organisms, the current primer design tools are tailored for diploid species. Bread wheat, for instance, is a hexaploid comprising of three related genomes and the performance of genetic markers is diminished if the primers are not genome specific. PolyMarker is a pipeline that generates SNP markers by selecting candidate primers for a specified genome using local alignments and standard primer design tools to test the viability of the primers. A command line tool and a web interface are available to the community. PolyMarker is available as a ruby BioGem: bio-polyploid-tools. Web interface: http://polymarker.tgac.ac.uk. © The Author 2015. Published by Oxford University Press.

  1. PyNEST: A Convenient Interface to the NEST Simulator.

    PubMed

    Eppler, Jochen Martin; Helias, Moritz; Muller, Eilif; Diesmann, Markus; Gewaltig, Marc-Oliver

    2008-01-01

    The neural simulation tool NEST (http://www.nest-initiative.org) is a simulator for heterogeneous networks of point neurons or neurons with a small number of compartments. It aims at simulations of large neural systems with more than 10(4) neurons and 10(7) to 10(9) synapses. NEST is implemented in C++ and can be used on a large range of architectures from single-core laptops over multi-core desktop computers to super-computers with thousands of processor cores. Python (http://www.python.org) is a modern programming language that has recently received considerable attention in Computational Neuroscience. Python is easy to learn and has many extension modules for scientific computing (e.g. http://www.scipy.org). In this contribution we describe PyNEST, the new user interface to NEST. PyNEST combines NEST's efficient simulation kernel with the simplicity and flexibility of Python. Compared to NEST's native simulation language SLI, PyNEST makes it easier to set up simulations, generate stimuli, and analyze simulation results. We describe how PyNEST connects NEST and Python and how it is implemented. With a number of examples, we illustrate how it is used.

  2. PyNEST: A Convenient Interface to the NEST Simulator

    PubMed Central

    Eppler, Jochen Martin; Helias, Moritz; Muller, Eilif; Diesmann, Markus; Gewaltig, Marc-Oliver

    2008-01-01

    The neural simulation tool NEST (http://www.nest-initiative.org) is a simulator for heterogeneous networks of point neurons or neurons with a small number of compartments. It aims at simulations of large neural systems with more than 104 neurons and 107 to 109 synapses. NEST is implemented in C++ and can be used on a large range of architectures from single-core laptops over multi-core desktop computers to super-computers with thousands of processor cores. Python (http://www.python.org) is a modern programming language that has recently received considerable attention in Computational Neuroscience. Python is easy to learn and has many extension modules for scientific computing (e.g. http://www.scipy.org). In this contribution we describe PyNEST, the new user interface to NEST. PyNEST combines NEST's efficient simulation kernel with the simplicity and flexibility of Python. Compared to NEST's native simulation language SLI, PyNEST makes it easier to set up simulations, generate stimuli, and analyze simulation results. We describe how PyNEST connects NEST and Python and how it is implemented. With a number of examples, we illustrate how it is used. PMID:19198667

  3. [Detection of JAK2V617F mutation rate by real-time fluorescent quantitative PCR using allele specific primer and TaqMan-MGB probe for dual inhibiting amplification of wild type alleles].

    PubMed

    Liang, Guo-Wei; Shao, Dong-Hua; He, Mei-Ling; Cao, Qing-Yun

    2012-12-01

    This study was purposed to develop a real-time PCR assay for sensitive quantification of JAK2V617F allele burden in peripheral blood and to evaluate the clinical value of this method. Both allele-specific mutant reverse primer and wild-type TaqMan-MGB probe were used for dual-inhibiting amplification of wild-type alleles in a real-time PCR, and then the JAK2V617F mutant alleles were amplified specially. The standard curve for quantification of JAK2V617F was established by percentages of JAK2V617F alleles with threshold cycle (Ct) values in a real-time PCR. Furthermore, 89 apparent healthy donors were tested by this method. The results showed that the quantitative lower limit of this method for JAK2V617F was 0.1%, and the intra- and inter-assay average variability for quantifying percentage of JAK2V617F in total DNA was 4.1% and 6.1%, respectively. Two JAK2V617F-positive individuals were identified (the percentage of JAK2V617F alleles were 0.64% and 0.98%, respectively) using this method in blood from 89 apparently healthy donors. It is concluded that the developed method with highly sensitive and reproducible quantification of JAK2V617F mutant burden can be used clinically for diagnosis and evaluation of disease prognosis and efficacy of therapy in patients with myeloproliferative neoplasms. Moreover, this technique can be also used for quantitative detection of variety of single nucleotide mutation.

  4. Why Wasp Foundresses Change Nests: Relatedness, Dominance, and Nest Quality

    PubMed Central

    Seppä, Perttu; Queller, David C.; Strassmann, Joan E.

    2012-01-01

    The costs and benefits of different social options are best understood when individuals can be followed as they make different choices, something that can be difficult in social insects. In this detailed study, we follow overwintered females of the social wasp Polistes carolina through different nesting strategies in a stratified habitat where nest site quality varies with proximity to a foraging area, and genetic relatedness among females is known. Females may initiate nests, join nests temporarily or permanently, or abandon nests. Females can become helpers or egglayers, effectively workers or queens. What they actually do can be predicted by a combination of ecological and relatedness factors. Advantages through increased lifetime success of individuals and nests drives foundresses of the social wasp Polistes from solitary to social nest founding. We studied reproductive options of spring foundresses of P. carolina by monitoring individually-marked wasps and assessing reproductive success of each foundress by using DNA microsatellites. We examined what behavioral decisions foundresses make after relaxing a strong ecological constraint, shortage of nesting sites. We also look at the reproductive consequences of different behaviors. As in other Polistes, the most successful strategy for a foundress was to initiate a nest as early as possible and then accept others as subordinates. A common feature for many P. carolina foundresses was, however, that they reassessed their reproductive options by actively monitoring other nests at the field site and sometimes moving permanently to new nests should that offer better (inclusive) fitness prospects compared to their original nests. A clear motivation for moving to new nests was high genetic relatedness; by the end of the foundress period all females were on nests with full sisters. PMID:23049791

  5. Why wasp foundresses change nests: relatedness, dominance, and nest quality.

    PubMed

    Seppä, Perttu; Queller, David C; Strassmann, Joan E

    2012-01-01

    The costs and benefits of different social options are best understood when individuals can be followed as they make different choices, something that can be difficult in social insects. In this detailed study, we follow overwintered females of the social wasp Polistes carolina through different nesting strategies in a stratified habitat where nest site quality varies with proximity to a foraging area, and genetic relatedness among females is known. Females may initiate nests, join nests temporarily or permanently, or abandon nests. Females can become helpers or egglayers, effectively workers or queens. What they actually do can be predicted by a combination of ecological and relatedness factors. Advantages through increased lifetime success of individuals and nests drives foundresses of the social wasp Polistes from solitary to social nest founding. We studied reproductive options of spring foundresses of P. carolina by monitoring individually-marked wasps and assessing reproductive success of each foundress by using DNA microsatellites. We examined what behavioral decisions foundresses make after relaxing a strong ecological constraint, shortage of nesting sites. We also look at the reproductive consequences of different behaviors. As in other Polistes, the most successful strategy for a foundress was to initiate a nest as early as possible and then accept others as subordinates. A common feature for many P. carolina foundresses was, however, that they reassessed their reproductive options by actively monitoring other nests at the field site and sometimes moving permanently to new nests should that offer better (inclusive) fitness prospects compared to their original nests. A clear motivation for moving to new nests was high genetic relatedness; by the end of the foundress period all females were on nests with full sisters.

  6. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  7. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  8. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  9. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  10. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  11. DNA sequencing technology, walking with modular primers. Final report

    SciTech Connect

    Ulanovsky, L.

    1996-12-31

    The success of the Human Genome Project depends on the development of adequate technology for rapid and inexpensive DNA sequencing, which will also benefit biomedical research in general. The authors are working on DNA technologies that eliminate primer synthesis, the main bottleneck in sequencing by primer walking. They have developed modular primers that are assembled from three 5-mer, 6-mer or 7-mer modules selected from a presynthesized library of as few as 1,000 oligonucleotides ({double_bond}4, {double_bond}5, {double_bond}7). The three modules anneal contiguously at the selected template site and prime there uniquely, even though each is not unique for the most part when used alone. This technique is expected to speed up primer walking 30 to 50 fold, and reduce the sequencing cost by a factor of 5 to 15. Time and expensive will be saved on primer synthesis itself and even more so due to closed-loop automation of primer walking, made possible by the instant availability of primers. Apart from saving time and cost, closed-loop automation would also minimize the errors and complications associated with human intervention between the walks. The author has also developed two additional approaches to primer-library based sequencing. One involves a branched structure of modular primers which has a distinctly different mechanism of achieving priming specificity. The other introduces the concept of ``Differential Extension with Nucleotide Subsets`` as an approach increasing priming specificity, priming strength and allowing cycle sequencing. These approaches are expected to be more robust than the original version of the modular primer technique.

  12. Post-diagnostic prescriptions for low-dose aspirin and breast cancer-specific survival: a nested case-control study in a breast cancer cohort from the UK Clinical Practice Research Datalink

    PubMed Central

    2014-01-01

    Introduction Recent observational studies indicate that post-diagnostic use of aspirin in breast cancer patients may protect against cancer progression perhaps by inhibiting cyclooxygenase-2 dependent mechanisms. Evidence also supports a crucial role for interactions between tumour cells and circulating platelets in cancer growth and dissemination, therefore, use of low-dose aspirin may reduce the risk of death from cancer in breast cancer patients. Methods A cohort of newly diagnosed breast cancer patients (1998 to 2006) were identified in the UK Clinical Practice Research Datalink (and confirmed by cancer registry linkage). Cancer-specific deaths were identified up to 2011 from Office for National Statistics mortality data. A nested case-control analysis was conducted using conditional logistic regression to compare post-diagnostic aspirin exposure using General Practice prescription data in 1,435 cases (breast cancer deaths) with 5,697 controls (matched by age and year of diagnosis). Results After breast cancer diagnosis, 18.3% of cancer-specific deaths and 18.5% of matched controls received at least one prescription for low-dose aspirin, corresponding to an odds ratio (OR) of 0.98 (95% CI 0.83, 1.15). Adjustment for potential confounders (including stage and grade) had little impact on this estimate. No dose response relationship was observed when the number of tablets was investigated and no associations were seen when analyses were stratified by receipt of prescriptions for aspirin in the pre-diagnostic period, by stage at diagnosis or by receipt of prescriptions for hormone therapy. Conclusions Overall, in this large population-based cohort of breast cancer patients, there was little evidence of an association between receipt of post-diagnostic prescriptions for low-dose aspirin and breast cancer-specific death. However, information was not available on medication compliance or over-the-counter use of aspirin, which may have contributed to the null findings

  13. Nest and nest site characterisitcs of some ground-nesting, non-passerine birds of northern grasslands

    USGS Publications Warehouse

    Kantrud, H.A.; Higgins, K.F.

    1992-01-01

    We summarized biological and ecologic characteristics of 2490 nests of 16 species of upland-nesting, non-passerine birds of northern grasslands found during 1963 through 1991. Nest initiation and hatch dates, clutch sizes, nest fates, causes of failure, success rates of nests among major habitat types and land uses, and vegetation measurements at nest sites are analyzed.

  14. EAGLES NEST WILDERNESS, COLORADO.

    USGS Publications Warehouse

    Tweto, Ogden; Williams, Frank E.

    1984-01-01

    On the basis of a geologic and mineral survey, a primitive area that constitutes the nucleus of the Eagles Nest Wilderness, Colorado was appraised to offer little promise for the occurrence of mineral or energy resources. Among the additional areas later incorporated in the wilderness, only a strip near a major fault west and northwest of Frisco and Dillon is classed as having probable mineral-resource potential. If mineral deposits exist, they probably are of the silver-lead-zinc or fluorspar types.

  15. On piecewise smooth vector fields tangent to nested tori

    NASA Astrophysics Data System (ADS)

    Carvalho, Tiago; Teixeira, Marco A.

    2016-10-01

    In this paper we present a number of results involving 3D nonsmooth dynamical systems tangent to a foliation. We study one-parameter families of systems Zε passing through a specific model Z0 whose phase portrait is foliated by invariant nested tori. For each positive integer k we, explicitly, construct a family Zεk possessing exactly k nested tori.

  16. Rapid and sensitive detection of Sclerotium rolfsii associated with collar rot disease of Amorphophallus paeoniifolius by species-specific polymerase chain reaction assay.

    PubMed

    Pravi, V; Jeeva, M L; Archana, P V

    2014-09-01

    Collar rot disease caused by Sclerotium rolfsii is an economically important disease prevailing in all Amorphophallus growing areas. The pathogen propagules surviving in soil and planting material are the major sources of inoculum. A nested PCR assay has been developed for specific detection of S. rolfsii in soil and planting material. The PCR detection limit was 10 pg in conventional assay whereas 0.1 pg in nested assay. The primers designed were found to be highly specific and could be used for accurate identification of pathogen up to species level. The protocol was standardized for detection of the pathogen in artificially and naturally infected field samples.

  17. ConservedPrimers 2.0: a high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery.

    PubMed

    You, Frank M; Huo, Naxin; Gu, Yong Q; Lazo, Gerard R; Dvorak, Jan; Anderson, Olin D

    2009-10-13

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they are located in exonic sequences which are usually conserved between related species, "conserved primers". They are useful for large-scale single nucleotide polymorphism (SNP) discovery and marker development, especially in species, such as wheat, for which a large number of ESTs are available but for which genome sequences and intron/exon boundaries are not available. To date, no suitable high-throughput tool is available for this purpose. We have developed, the ConservedPrimers 2.0 pipeline, for designing intron-flanking primers for large-scale SNP discovery and marker development, and demonstrated its utility in wheat. This tool uses non-redundant wheat EST sequences, such as wheat contigs and singleton ESTs, and related genomic sequences, such as those of rice, as inputs. It aligns the ESTs to the genomic sequences to identify unique colinear exon blocks and predicts intron lengths. Intron-flanking primers are then designed based on the intron/exon information using the Primer3 core program or BatchPrimer3. Finally, a tab-delimited file containing intron-flanking primer pair sequences and their primer properties is generated for primer ordering and their PCR applications. Using this tool, 1,922 bin-mapped wheat ESTs (31.8% of the 6,045 in total) were found to have unique colinear exon blocks suitable for primer design and 1,821 primer pairs were designed from these single- or low-copy genes for PCR amplification and SNP discovery. With these primers and subsequently designed genome-specific primers, a total of 1,527 loci were found to contain one or more genome-specific SNPs. The ConservedPrimers 2.0 pipeline for designing intron-flanking primers was developed and its

  18. Neste plans three projects

    SciTech Connect

    Not Available

    1993-02-03

    Neste Chemicals (Helsinki) is discussing three joint ventures with local authorities in China, says Mikko Haapavaara, v.p./Asia. The projects should help the Finnish producer to increase sales in Asia by a considerable amount by 2000, he says. The plan involves production of polyethylene (PE), unsaturated polyester resins and PE compounding-all core operations. Sites have not been selected, but Shanghai is the favored location for the PE operations. The company is also looking at a site in the south, near Hong Kong, and at locations near Beijing. The PE plant would need to be near an ethylene unit, says Haapavaara. The PE resin plant would be designed to produce about 150,000 m.t./year and would cost about No. 150 million. A part of the output would need to be exported to take care of the financing, the company says. A feasibility study now under way with the potential Chinese partners should be completed by the end of March. The plant would use Neste's linear low-density PE process, proved in a world-scale plant at Beringen, Belgium. The compounding units would produce specialty PE material for the wire and cable and pipe industry. The company is a joint venture partner in a propane dehydrogenation/polypropylene (PP) plant and a minority partner in a Qualipoly, the 20,000 m.t./year unsaturated polyester resin producer.

  19. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  20. Mono-allelic amplification of exons 2-4 using allele group-specific primers for sequence-based typing (SBT) of the HLA-A, -B and -C genes: preparation and validation of ready-to-use pre-SBT mini-kits.

    PubMed

    Dormoy, A; Froelich, N; Leisenbach, R; Weschler, B; Cazenave, J-P; Tongio, M-M

    2003-09-01

    Class I allelic typing based on sequencing is reliable, immutable and easy to analyse when only one allele is amplified using a specific mono-allelic technique. A strategy has been developed to selectively amplify exons 2, 3 and 4 of each allele of the three class I loci, previously identified by generic typing, in order to sequence these alleles from their intronic parts in only one direction. This procedure is based mainly on the polymorphism of exon 1 and intron 1 of the HLA-A, -B and -C genes with allele group-specific forward primers and locus-specific reverse primers so as to perform mono-allelic amplification in a 'One Step' pre-sequence-based typing (pre-SBT) PCR. The 5' polymorphism found at each locus is nevertheless not sufficient to discriminate all allelic combinations. Hence exon 2 and exon 3 polymorphism had to be used in a 'Two Step' pre-SBT PCR method to selectively amplify the two alleles in the 1.8%, 7.6% and 0.9% of unresolved combinations found in our laboratory for, respectively, the HLA-A, -B and -C loci. Preparation and validation of 'ready-to-use' aliquots of primer-mixes, pre-SBT buffer and sets of Dye terminator reaction mixtures containing locus-specific intronic primers makes the procedure easy and efficient. The SBT method is the only allelic typing technique used in our laboratory (to date, 742 HLA-A*, 802 HLA-B* and 615 HLA-Cw* alleles have been sequenced) and our successful participation in the national and international quality controls of 4 years ago testifies to the accuracy of the results.

  1. Lifespan Analyses of Forest Raptor Nests: Patterns of Creation, Persistence and Reuse

    PubMed Central

    Jiménez-Franco, María V.; Martínez, José E.; Calvo, José F.

    2014-01-01

    Structural elements for breeding such as nests are key resources for the conservation of bird populations. This is especially true when structural elements require a specific and restricted habitat, or if the construction of nests is costly in time and energy. The availability of nesting-platforms is influenced by nest creation and persistence. In a Mediterranean forest in southeastern Spain, nesting-platforms are the only structural element for three forest-dwelling raptor species: booted eagle Aquila pennata, common buzzard Buteo buteo and northern goshawk Accipiter gentilis. From 1998 to 2013, we tracked the fate of 157 nesting-platforms built and reused by these species with the aim of determining the rates of creation and destruction of nesting-platforms, estimating nest persistence by applying two survival analyses, describing the pattern of nest reuse and testing the effects of nest use on breeding success. Nest creation and destruction rates were low (0.14 and 0.05, respectively). Using Kaplan Meier survival estimates and Cox proportional-hazards regression models we found that median nest longevity was 12 years and that this was not significantly affected by nest characteristics, nest-tree dimensions, nest-builder species, or frequency of use of the platform. We also estimated a transition matrix, considering the different stages of nest occupation (vacant or occupied by one of the focal species), to obtain the fundamental matrix and the average life expectancies of nests, which varied from 17.9 to 19.7 years. Eighty six percent of nests were used in at least one breeding attempt, 67.5% were reused and 17.8% were successively occupied by at least two of the study species. The frequency of nest use had no significant effects on the breeding success of any species. We conclude that nesting-platforms constitute an important resource for forest raptors and that their longevity is sufficiently high to allow their reuse in multiple breeding attempts. PMID

  2. Lifespan analyses of forest raptor nests: patterns of creation, persistence and reuse.

    PubMed

    Jiménez-Franco, María V; Martínez, José E; Calvo, José F

    2014-01-01

    Structural elements for breeding such as nests are key resources for the conservation of bird populations. This is especially true when structural elements require a specific and restricted habitat, or if the construction of nests is costly in time and energy. The availability of nesting-platforms is influenced by nest creation and persistence. In a Mediterranean forest in southeastern Spain, nesting-platforms are the only structural element for three forest-dwelling raptor species: booted eagle Aquila pennata, common buzzard Buteo buteo and northern goshawk Accipiter gentilis. From 1998 to 2013, we tracked the fate of 157 nesting-platforms built and reused by these species with the aim of determining the rates of creation and destruction of nesting-platforms, estimating nest persistence by applying two survival analyses, describing the pattern of nest reuse and testing the effects of nest use on breeding success. Nest creation and destruction rates were low (0.14 and 0.05, respectively). Using Kaplan Meier survival estimates and Cox proportional-hazards regression models we found that median nest longevity was 12 years and that this was not significantly affected by nest characteristics, nest-tree dimensions, nest-builder species, or frequency of use of the platform. We also estimated a transition matrix, considering the different stages of nest occupation (vacant or occupied by one of the focal species), to obtain the fundamental matrix and the average life expectancies of nests, which varied from 17.9 to 19.7 years. Eighty six percent of nests were used in at least one breeding attempt, 67.5% were reused and 17.8% were successively occupied by at least two of the study species. The frequency of nest use had no significant effects on the breeding success of any species. We conclude that nesting-platforms constitute an important resource for forest raptors and that their longevity is sufficiently high to allow their reuse in multiple breeding attempts.

  3. Nest survival estimation: a review of alternatives to the Mayfield estimator

    USGS Publications Warehouse

    Jehle, G.; Yackel Adams, A.A.; Savidge, J.A.; Skagen, S.K.

    2004-01-01

    Reliable estimates of nest survival are essential for assessing strategies for avian conservation. We review the history of modifications and alternatives for estimating nest survival, with a focus on four techniques: apparent nest success, the Mayfield estimator, the Stanley method, and program MARK. The widely used Mayfield method avoids the known positive bias inherent in apparent nest success by estimating daily survival rates using the number of exposure days, eliminating the need to monitor nests from initiation. Concerns that some of Mayfield's assumptions were restrictive stimulated the development of new techniques. Stanley's method allows for calculation of stage-specific daily survival rates when transition and failure dates are unknown, and eliminates Mayfield's assumption that failure occurred midway through the nest-check interval. Program MARK obviates Mayfield's assumption of constant daily survival within nesting stages and evaluates variation in nest survival as a function of biologically relevant factors. These innovative methods facilitate the evaluation of nest survival using an information-theoretic approach. We illustrate use of these methods with Lark Bunting (Calamospiza melanocorys) nest data from the Pawnee National Grassland, Colorado. Nest survival estimates calculated using Mayfield, Stanley, and MARK methods were similar, but apparent nest success estimates ranged 1-24% greater than the other estimates. MARK analysis revealed that survival of Lark Bunting nests differed between site-year groups, declined with both nest age and time in season, but did not vary with weather parameters. We encourage researchers to use these approaches to gain reliable and meaningful nest survival estimates.

  4. Nest relocation using PVC "spotters"

    USGS Publications Warehouse

    Simon, John C.

    1998-01-01

    A simple device to aid in the rapid relocation of nests, composed on PVC pipe and tie wire, is described. A 16-18 cm length of pipe can be attached to a supporting structure with a section of wire and adjusted to point at the target nest by its discoverer. Used like an lensless spotting scope, the “spotter” allows other observers to quickly and reliably relocate the nest with minimal written or verbal description.

  5. A simple and rapid assay for specific identification of bovine derived products in biocomplex materials.

    PubMed

    Khairalla, Khairalla M S; Aradaib, Imadeldin E; Bakhiet, Amel O; Hassan, Tigani; Hago, Badr E; Saeed, Abdel-Rahman

    2007-04-15

    A simple and rapid method for specific identification of beef or bovine-derived products in processed food and in animal feed concentrates was developed and evaluated using Polymerase Chain Reaction (PCR). The mitochondrial cytochrome-b (mtcyt-b) gene was used as a target DNA for PCR amplification. Three primers derived from a highly conserved region of bovine mtcyt-b gene were used. The outer pair of primers (RSL1 and CSR2) produced a 365 base pair (bp) PCR ampilicon from bovine DNA, while the internal semi-nested pair of primers (CSL1 and CSR2) were used to amplify a 284 bp PCR ampilicon, internal to the annealing sites of primers (RSL1 and CSR2). Both ampilicons were identified easily after visualization on agarose gel stained with ethidium bromide. The specificity studies indicated that the primary or the semi-nested PCR products were not amplified from DNA extracted from different ruminant species including, sheep, goat and ghazals; or from non-ruminant animals including camels, horses and pigs. Also was found very sensitive because could detect 0.001% (W/V) of bovine mtcyt-b gene. The semi-nested amplification was necessary to increase the sensitivity of the PCR assay and to confirm the identity of the primary PCR ampilicons. The described PCR assay detected the primary and the semi-nested PCR ampilicons from different animal feed concentrates containing bovine-derived product including, canned food, poultry and dairy feed concentrates. The described PCR assay should facilitate rapid detection of beef and bovine-derived products in processed food and in animal feed concentrates.

  6. Collecting in collections: a PCR strategy and primer set for DNA barcoding of decades-old dried museum specimens.

    PubMed

    Mitchell, Andrew

    2015-09-01

    Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past.

  7. Detection of environmental sources of Histoplasma capsulatum in Chiang Mai, Thailand, by nested PCR.

    PubMed

    Norkaew, Treepradab; Ohno, Hideaki; Sriburee, Pojana; Tanabe, Koichi; Tharavichitkul, Prasit; Takarn, Piyawan; Puengchan, Tanpalang; Bumrungsri, Sara; Miyazaki, Yoshitsugu

    2013-12-01

    Histoplasmosis is a systemic mycosis caused by inhaling spores of Histoplasma capsulatum, a dimorphic fungus. This fungus grows in soil contaminated with bat and avian excreta. Each year, patients with disseminated histoplasmosis have been diagnosed in Chiang Mai, northern Thailand. No published information is currently available on the environmental sources of this fungus in Chiang Mai or anywhere else in Thailand. The aim of this study was to detect H. capsulatum in soil samples contaminated with bat guano and avian droppings by nested PCR. Two hundred and sixty-five samples were collected from the following three sources: soil contaminated with bat guano, 88 samples; soil contaminated with bird droppings, 86 samples; and soil contaminated with chicken droppings, 91 samples. Genomic DNA was directly extracted from each sample, and H. capsulatum was detected by nested PCR using a primer set specific to a gene encoding 100-kDa-like protein (HcI, HcII and HcIII, HcIV). Histoplasma capsulatum was detected in seven of 88 soil samples contaminated with bat guano, one of 21 soil samples contaminated with pigeon droppings and 10 of 91 soil samples contaminated with chicken droppings. The results indicate the possibility of the association of bat guano and chicken droppings with H. capsulatum in this area of Thailand.

  8. Inflatable nested toroid structure

    NASA Technical Reports Server (NTRS)

    Johnson, Christopher J. (Inventor); Raboin, Jasen L. (Inventor); Spexarth, Gary R. (Inventor)

    2011-01-01

    An inflatable structure comprises at least two generally toroidal, inflatable modules. When in a deployed mode, the first, inner module has a major diameter less than that of a second, outer module and is positioned within the inner circumference of the outer module such that the first module is nested circumferentially alongside the second module. The inflatable structure, in a non-deployed, non-inflated mode, is of compact configuration and adapted to be transported to a site of deployment. When deployed, the inflatable structure is of substantially increased interior volume. In one embodiment, access between the interior of the first module and the second module is provided by at least one port or structural pass-through. In another embodiment, the inflatable structure includes at least one additional generally toroidal module external of and circumferentially surrounding the second module.

  9. Reimagining the Cuckoo's Nest.

    PubMed

    Rochefort, David A

    2017-09-27

    One Flew Over the Cuckoo's Nest (1962) by Ken Kesey and The Devil in Silver (2012) by Victor LaValle are two novels that focus on mental hospitalization as a medical and social practice. Published fifty years apart, however, the books possess important differences in setting, method, and message reflecting the times that spawned them. The purpose of this paper is to examine the changing documentary and metaphorical uses of the asylum novel by comparing an iconic work in the genre with a respectful, but divergent, successor. What emerges from this comparison is an appreciation of the literary conventions shared by Kesey and LaValle but also the ingredients that separate their work. Whereas Kesey produced an enduring tribute to the virtue of nonconformity, LaValle's social criticism expresses itself as a disturbing portrayal of class-based disparities and administrative dysfunction inside the contemporary American mental health system.

  10. KSC Eagle's Nest

    NASA Image and Video Library

    2014-03-07

    CAPE CANAVERAL, Fla. - A bald eagle perches in its nest in a tree along State Road 3 at NASA’s Kennedy Space Center in Florida. The center shares a boundary with the Merritt Island National Wildlife Refuge. The refuge encompasses 140,000 acres that are a habitat for more than 330 species of birds, 31 mammals, 117 fishes, and 65 amphibians and reptiles. It contains more than 1,000 known plant species. The marshes and open water of the refuge provide wintering areas for 23 species of migratory waterfowl, as well as a year-round home for great blue herons, great egrets, wood storks, cormorants, brown pelicans and other species of marsh and shore birds, and a variety of insects.

  11. PD5: a general purpose library for primer design software.

    PubMed

    Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

  12. Plastid primers for angiosperm phylogenetics and phylogeography1

    PubMed Central

    Prince, Linda M.

    2015-01-01

    Premise of the study: PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Methods: Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Results: Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Discussion: Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. “Universal” primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications. PMID:26082876

  13. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design PMID:24278254

  14. Using Artificial Nests to Study Nest Predation in Birds

    ERIC Educational Resources Information Center

    Belthoff, James R.

    2005-01-01

    A simple and effective field exercise that demonstrates factors affecting predation on bird nests is described. With instructor guidance, students in high school biology or college-level biology, ecology, animal behavior, wildlife management or ornithology laboratory courses can collaborate to design field experiments related to nest depredation.

  15. Using Artificial Nests to Study Nest Predation in Birds

    ERIC Educational Resources Information Center

    Belthoff, James R.

    2005-01-01

    A simple and effective field exercise that demonstrates factors affecting predation on bird nests is described. With instructor guidance, students in high school biology or college-level biology, ecology, animal behavior, wildlife management or ornithology laboratory courses can collaborate to design field experiments related to nest depredation.

  16. Does nonrandom nest placement imply nonrandom nest predation? - A reply

    USGS Publications Warehouse

    Cooper, R.J.; Wilson, R.R.; Zenitsky, G.D.; Mullin, S.J.; Dececco, J.D.; Marshall, M.R.; Wolf, D.J.; Pomara, L.Y.

    1999-01-01

    In response to the critique by Schmidt and Whelan (Condor 101(4):916-920, 1999), we find that the relationship between nest success and tree selectivity is dependent upon inclusion or exclusion of particular tree species, whether or not years are pooled, and the selectivity index used. We question their use of point estimates of nest success with extremely high variances, defend our index, question the application of the Chesson (1983) index to our data, and explain the need to analyze years separately. Bottomland hardwood forest systems are extremely variable; hydroperiods alter the suitability of nesting substrates, availability of alternative food, and behavior of predators and their prey. Given these features, actively searching for Acadian Flycatcher (Empidonax virescens) nests is seldom an efficient predator foraging strategy. Therefore, these predation events are best described as random; nests are principally encountered opportunistically by generalist predators while searching for other prey.

  17. Nest morphology and body size of Ross' Geese and Lesser Snow Geese

    USGS Publications Warehouse

    McCracken, K.G.; Afton, A.D.; Alisauskas, R.T.

    1997-01-01

    Arctic-nesting geese build large, insulated nests to protect developing embryos from cold ambient temperatures. Ross' Geese (Chen rossii) are about two-thirds the mass of Lesser Snow Geese (C. caerulescens caerulescens), have higher mass-specific metabolic rate, and maintain lower nest attentiveness, yet they hatch goslings with more functionally mature gizzards and more protein for their size than do Lesser Snow Geese. We compared nest size (a reflection of nest insulation) in four distinct habitats in a mixed breeding colony of Ross' Geese and Lesser Snow Geese at Karrak Lake, Northwest Territories, Canada. After adjusting measurements for nest-specific egg size and clutch size, we found that overall nest morphology differed between species and among habitats. Nest size increased progressively among heath, rock, mixed, and moss habitats. When nesting materials were not limiting, nests were smaller in habitats that provided cover from wind and precipitation than in habitats that did not provide cover. Ross' Geese constructed relatively larger, more insulated nests than did Lesser Snow Geese, which may hasten embryonic development, minimize energy expenditure during incubation, and minimize embryonic cooling during recesses. We suggest that relative differences in nest morphology reflect greater selection for Ross' Geese to improve nest insulation because of their smaller size (adults and embryos), higher mass-specific metabolic rate, and lower incubation constancy.

  18. Quantitative PCR measurements of the effects of introducing inosines into primers provides guidelines for improved degenerate primer design.

    PubMed

    Zheng, Linda; Gibbs, Mark J; Rodoni, Brendan C

    2008-11-01

    Polymerase chain reaction (PCR) is used to detect groups of viruses with the use of group-specific degenerate primers. Inosine residues are sometimes used in the primers to match variable positions within the complementary target sequences, but there is little data on their effects on cDNA synthesis and amplification. A quantitative reverse-transcription PCR was used to measure the rate of amplification with primers containing inosine residues substituted at different positions and in increasing numbers. Experiments were conducted using standard quantities of cloned DNA copied from Potato virus Y genomic RNA and RNA (cRNA) transcribed from the cloned DNA. Single inosine residues had no affect on the amplification rate in the forward primer, except at one position close to the 3' terminus. Conversely, single inosine residues significantly reduced the amplification rate when placed at three out of four positions in the reverse primer. Four or five inosine substitutions could be tolerated with some decline in rates, but amplification often failed from cRNA templates with primers containing larger numbers of inosines. Greater declines in the rate of amplification were observed with RNA templates, suggesting that reverse transcription suffers more than PCR amplification when inosine is included in the reverse primer.

  19. Increased sensitivity and specificity of Borrelia burgdorferi 16S ribosomal DNA detection.

    PubMed

    Lee, Sin Hang; Vigliotti, Veronica S; Vigliotti, Jessica S; Jones, William; Pappu, Suri

    2010-04-01

    The DNA of Borrelia burgdorferi spirochetes extracted by ammonium hydroxide was used as the template for nested polymerase chain reaction (PCR) amplification of the species-specific 16S ribosomal DNA (rDNA). The primers were those well known to be specific for signature sequence amplification of the B burgdorferi sensu lato 16S ribosomal RNA gene. The positive 293-base-pair nested PCR amplicon was subjected to routine direct automated Sanger sequencing. A 50-base sequence excised randomly from the sequencing electrophoretogram between the 2 nested PCR primer binding sites was sufficient for the Basic Local Alignment Search Tool (BLAST) analysis to validate the B burgdorferi sensu lato 16S rDNA without a reasonable doubt. Nested PCR increased the sensitivity of DNA detection by 100- to 1,000-fold. DNA sequence validation based on BLAST algorithms using the GenBank database practically eliminates any possibility of false-positive results due to molecular misidentification. This technology may be a valuable supplement to the current serologic tests for Lyme disease.

  20. Modified tetra-primer ARMS PCR as a single-nucleotide polymorphism genotyping tool.

    PubMed

    Mesrian Tanha, Hamzeh; Mojtabavi Naeini, Marjan; Rahgozar, Soheila; Rasa, Seyed Mohammad Mahdi; Vallian, Sadeq

    2015-03-01

    Genotyping of single-nucleotide polymorphisms (SNPs) has been applied in various genetic contexts. Tetra-primer amplification refractory mutation system (ARMS) polymerase chain reaction (PCR) is reported as a prominent assay for SNP genotyping. However, there were published data that may question the reliability of this method on some occasions, in addition to a laborious and time-consuming procedure of the optimization step. In the current study, a new SNP genotyping method named modified tetra-primer ARMS (MTPA) PCR was developed based on tetra-primer ARMS PCR. The modified method has two improvements in its instruction, including equalization of outer primer and inner primer strength by additional mismatch in outer primers, and consideration of equal annealing temperature of specific fragments more than melting temperature of primers. Advantageously, a new computer software was provided for designing primers based on novel concepts. The usual tetra-primer ARMS PCR has a laborious process for optimization. In nonoptimal PCR programs, identification of the accurate genotype was found to be very difficult. However, in MTPA PCR, equalization of the amplicons and primer strength leads to increasing specificity and convenience of genotyping, which was validated by sequencing. In the MTPA PCR technique, a new mismatch at -2 positions of outer primers and equal annealing temperature improve the genotyping procedure. Together, the introduced method could be suggested as a powerful tool for genotyping single-nucleotide mutations and polymorphisms.

  1. USER-derived cloning methods and their primer design.

    PubMed

    Salomonsen, Bo; Mortensen, Uffe H; Halkier, Barbara A

    2014-01-01

    Uracil excision-based cloning through USER™ (Uracil-Specific Excision Reagent) is an efficient ligase-free cloning technique that comprises USER cloning, USER fusion, and USER cassette-free (UCF) USER fusion. These USER-derived cloning techniques enable seamless assembly of multiple DNA fragments in one construct. Though governed by a few simple rules primer design for USER-based fusion of PCR fragments can prove time-consuming for inexperienced users. The Primer Help for USER (PHUSER) software is an easy-to-use primer design tool for USER-based methods. In this chapter, we present a PHUSER software protocol for designing primers for USER-derived cloning techniques.

  2. New primers for DNA barcoding of digeneans and cestodes (Platyhelminthes).

    PubMed

    Van Steenkiste, Niels; Locke, Sean A; Castelin, Magalie; Marcogliese, David J; Abbott, Cathryn L

    2015-07-01

    Digeneans and cestodes are species-rich taxa and can seriously impact human health, fisheries, aqua- and agriculture, and wildlife conservation and management. DNA barcoding using the COI Folmer region could be applied for species detection and identification, but both 'universal' and taxon-specific COI primers fail to amplify in many flatworm taxa. We found that high levels of nucleotide variation at priming sites made it unrealistic to design primers targeting all flatworms. We developed new degenerate primers that enabled acquisition of the COI barcode region from 100% of specimens tested (n = 46), representing 23 families of digeneans and 6 orders of cestodes. This high success rate represents an improvement over existing methods. Primers and methods provided here are critical pieces towards redressing the current paucity of COI barcodes for these taxa in public databases. © 2014 Her Majesty the Queen in Right of Canada Molecular Ecology Resources © 2014 John Wiley & Sons Ltd.

  3. Broadly Reactive Nested Reverse Transcription-PCR Using an Internal RNA Standard Control for Detection of Noroviruses in Stool Samples

    PubMed Central

    Medici, Maria Cristina; Martinelli, Monica; Ruggeri, Franco Maria; Abelli, Laura Anna; Bosco, Simona; Arcangeletti, Maria Cristina; Pinardi, Federica; De Conto, Flora; Calderaro, Adriana; Chezzi, Carlo; Dettori, Giuseppe

    2005-01-01

    We developed a nested reverse transcription-PCR (nRT-PCR) for the detection of noroviruses in stools, using random primers for RT, the JV12/JV13 primer pair in the first round of nPCR, and a set of nine inner primers for the second, comprising the reverse sequences of primers SR46, SR48, SR50, and SR52, and five novel oligonucleotide sequences (113-1, 113-2, 115-1, 115-2, and 115-3). The specificity of the nRT-PCR was confirmed by testing 61 stools containing enteric viruses other than noroviruses. In comparative assays on either stools or RNA dilutions from two genogroup I and three genogroup II (GII) norovirus-positive samples, nRT-PCR was always at least as sensitive as RT-PCR and Southern hybridization. With some of the samples tested, the increase in sensitivity was 10-fold or higher. For GII viruses, the detectable range of nRT-PCR was estimated to be 8.4 × 104 to 2 RNA viral particles. When used on 85 stools from pediatric patients with acute gastroenteritis negative for viruses by electron microscopy and cell culture, the nRT-PCR detected norovirus in 19 samples (22.3%), while it failed to detect one reference RT-PCR-positive sample containing a Desert Shield strain. Sixteen of the 19 nRT-PCR-positive samples gave concordant results with reference RT-PCR and Southern hybridization, and all with sequence analysis. Partial sequencing of the polymerase region revealed that from January to April 2000 all GII strains except two (Rotterdam- and Leeds-like viruses) formed a tight cluster related to Hawaii virus. The nRT-PCR described could prove suitable for large epidemiological studies and for specialized clinical laboratories performing routine molecular testing. PMID:16081909

  4. Broadly reactive nested reverse transcription-PCR using an internal RNA standard control for detection of noroviruses in stool samples.

    PubMed

    Medici, Maria Cristina; Martinelli, Monica; Ruggeri, Franco Maria; Abelli, Laura Anna; Bosco, Simona; Arcangeletti, Maria Cristina; Pinardi, Federica; De Conto, Flora; Calderaro, Adriana; Chezzi, Carlo; Dettori, Giuseppe

    2005-08-01

    We developed a nested reverse transcription-PCR (nRT-PCR) for the detection of noroviruses in stools, using random primers for RT, the JV12/JV13 primer pair in the first round of nPCR, and a set of nine inner primers for the second, comprising the reverse sequences of primers SR46, SR48, SR50, and SR52, and five novel oligonucleotide sequences (113-1, 113-2, 115-1, 115-2, and 115-3). The specificity of the nRT-PCR was confirmed by testing 61 stools containing enteric viruses other than noroviruses. In comparative assays on either stools or RNA dilutions from two genogroup I and three genogroup II (GII) norovirus-positive samples, nRT-PCR was always at least as sensitive as RT-PCR and Southern hybridization. With some of the samples tested, the increase in sensitivity was 10-fold or higher. For GII viruses, the detectable range of nRT-PCR was estimated to be 8.4 x 10(4) to 2 RNA viral particles. When used on 85 stools from pediatric patients with acute gastroenteritis negative for viruses by electron microscopy and cell culture, the nRT-PCR detected norovirus in 19 samples (22.3%), while it failed to detect one reference RT-PCR-positive sample containing a Desert Shield strain. Sixteen of the 19 nRT-PCR-positive samples gave concordant results with reference RT-PCR and Southern hybridization, and all with sequence analysis. Partial sequencing of the polymerase region revealed that from January to April 2000 all GII strains except two (Rotterdam- and Leeds-like viruses) formed a tight cluster related to Hawaii virus. The nRT-PCR described could prove suitable for large epidemiological studies and for specialized clinical laboratories performing routine molecular testing.

  5. A 16S rDNA-based nested PCR protocol to detect Campylobacter gracilis in oral infections.

    PubMed

    Siqueira, José Freitas; Rôças, Isabela das Neves

    2003-01-01

    The aim of this study was to describe a 16S rDNA-based nested polymerase chain reaction (nPCR) assay to investigate the occurrence of Campylobacter gracilis in oral infections. Samples were collected from ten infected root canals, ten cases of acute periradicular abscesses and eight cases of adult marginal periodontitis. DNA extracted from the samples was initially amplified using universal 16S rDNA primers. A second round of amplification used the first PCR products to detect C. gracilis using oligonucleotide primers designed from species-specific 16S rDNA signature sequences. The nPCR assay used in this study showed a detection limit of 10 C. gracilis cells and no cross-reactivity was observed with nontarget bacteria. C. gracilis was detected in the three types of oral infections investigated - 4/10 infected root canals; 2/10 acute periradicular abscesses; and 1/8 subgingival specimens from adult periodontitis. The method proposed in this study showed both high sensitivity and high specificity to directly detect C. gracilis in samples from root canal infections, abscesses, and subgingival plaque. Our findings confirmed that C. gracilis may be a member of the microbiota associated with distinct oral infections, and its specific role in such diseases requires further clarification.

  6. Impact of special early harvest seasons on subarctic-nesting and temperate-nesting Canada geese

    USGS Publications Warehouse

    Sheaffer, S.E.; Kendall, W.L.; Bowers, E. Frank

    2005-01-01

    Dramatic changes in wintering distributions of Canada geese (Branta canadensis) have occurred over the past 50 years in eastern North America. Declines in numbers of subarctic-nesting geese wintering in southern states, and increases in numbers wintering in northern regions, have resulted in a northern shift in winter distributions. In contrast, numbers of temperate-nesting geese have increased throughout eastern North America. Management efforts to control overabundant temperate-nesting flocks have included the establishment of special early harvest seasons in September. However, the effect of early seasons on survival and harvest of subarctic-nesting populations has not been documented. Understanding the timing of migration movements and the fidelity of subarctic-nesting flocks to terminal winter refuges in the Southeast also is necessary to design early harvest seasons that target temperate-nesting flocks and protect subarctic-nesting populations. We used recoveries of marked geese to estimate survival and harvest rates before and after implementation of early harvest seasons within the Mississippi Flyway during 1976-1999. In addition, we used observations of neck-banded geese from the Southern James Bay Population (SJBP) to evaluate the hypothesis that subarctic-nesting geese arriving prior to mid-December on several key terminal winter refuges in the Southeast (early arriving migrants) were more likely to return to those refuges in subsequent years than were migrants, arriving after mid-December (late arriving migrants). September seasons during 1987-1994 were a minor source of mortality for subarctic-nesting populations and accounted for < 10% of their annual harvest mortality. The effectiveness of early seasons for increasing mortality of temperate-nesting flocks varied among the states we examined and was tempered by concurrent changes in state-specific harvest regulations during the regular harvest season. For SJBP Canada geese, annual fidelity to

  7. Do chimpanzee nests serve an anti-predatory function?

    PubMed

    Stewart, Fiona A; Pruetz, J D

    2013-06-01

    Sleep is a vulnerable state for animals as it compromises the ability to detect predators. The evolution of shelter construction in the great apes may have been a solution to the trade-off between restorative sleep and predation-risk, which allowed a large bodied ape to sleep recumbent in a safe, comfortable spot. In this article we review the evidence of predator pressure on great apes and specifically investigate the potential influence of predation-risk on chimpanzee nesting behavior by comparing nests between chimpanzees living in a habitat of several potential predators (Issa, Ugalla, Tanzania) and a habitat relatively devoid of predators (Fongoli, Senegal). Chimpanzees in Issa did not nest more frequently in forest vegetation than chimpanzees in Fongoli although forest vegetation is expected to provide greater opportunity for escape from terrestrial predators. Nor do chimpanzees in Issa nest in larger groups or aggregate together more than Fongoli chimpanzees, as would be expected if larger groups provide protection from or greater detection of predators. Nests in Issa also did not appear to provide greater opportunities for escape than nests in Fongoli. Chimpanzees in Issa nested more frequently within the same tree as other community members, which may indicate that these chimpanzees nest in greater proximity than chimpanzees in Fongoli. Finally, Issa chimpanzees built their nests proportionately higher and more peripherally within trees. The selection of high and peripheral nesting locations within trees may make Issa chimpanzees inaccessible to potential predators. Many factors influence nest site selection in chimpanzees, of which danger from terrestrial predators is likely to be one. © 2013 Wiley Periodicals, Inc.

  8. A Home Computer Primer.

    ERIC Educational Resources Information Center

    Stone, Antonia

    1982-01-01

    Provides general information on currently available microcomputers, computer programs (software), hardware requirements, software sources, costs, computer games, and programing. Includes a list of popular microcomputers, providing price category, model, list price, software (cassette, tape, disk), monitor specifications, amount of random access…

  9. A Home Computer Primer.

    ERIC Educational Resources Information Center

    Stone, Antonia

    1982-01-01

    Provides general information on currently available microcomputers, computer programs (software), hardware requirements, software sources, costs, computer games, and programing. Includes a list of popular microcomputers, providing price category, model, list price, software (cassette, tape, disk), monitor specifications, amount of r