Sample records for nested primers specific
-
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
-
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
-
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
-
2010-01-01
A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759
-
[Iditification of five imported cases of Plasmodium ovale wallikeri infection in Zhejiang Province].
Zhang, Ling-ling; Ruan, Wei; Chen, Hua-liang; Lu, Qiao-yi; Yao, Li-nong
2014-10-01
To identify and analyze Plasmodium ovale wallikeri in 5 imported malaria cases, who were detected positive by microscopy and negative by conventional PCR. Epidemiological information and blood samples were collected from the five patients. The detection was conducted by microscopy, Rapid Diagnostic Test (RDT) and nested PCR with Plasmodium genus-specific, species-specific and Plasmodium ovale wallikeri-specific primers. The amplified products were sequenced and Blast analysis was performed on line in NCBI. The five patients returned from Africa, and all had a history of malaria. They were microscopically positive for Plasmodium sp., and two cases showed Pan positive RDT result. All blood samples were negative for four Plasmodium spp. by conventional nested PCR, but positive by nested PCR with Plasmodium ovale wallikeri-specific primers. Blast analysis showed that the amplified sequences of the five cases had complete homology with P. ovale wallikeri clone RSH10 18S ribosomal RNA gene (Accession No. KF219561.1). The five cases which classified as positive by microscopy while negative by conventional PCR have been confirmed as Plasmodium ovale wallikeri infection by nested PCR with P. ovale wallikeri-specific primers.
-
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
-
[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].
Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng
2013-10-18
To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.
-
[Optimized application of nested PCR method for detection of malaria].
Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C
2017-04-28
Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P < 0.05). Conclusion The optimized PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.
-
Population diversity of ammonium oxidizers investigated by specific PCR amplification
Ward, B.B.; Voytek, M.A.; Witzel, K.-P.
1997-01-01
The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.
-
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S
Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.
-
Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.
2000-01-01
A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384
-
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
-
Zhao, Jun; Kong, Fanrong; Li, Ruoyu; Wang, Xiaohong; Wan, Zhe; Wang, Duanli
2001-01-01
Aspergillus fumigatus is the most common species that causes invasive aspergillosis. In order to identify A. fumigatus, partial ribosomal DNA (rDNA) from two to six strains of five different Aspergillus species was sequenced. By comparing sequence data from GenBank, we designed specific primer pairs targeting rDNA internal transcribed spacer (ITS) regions of A. fumigatus. A nested PCR method for identification of other A. fumigatus-related species was established by using the primers. To evaluate the specificities and sensitivities of those primers, 24 isolates of A. fumigatus and variants, 8 isolates of Aspergillus nidulans, 7 isolates of Aspergillus flavus and variants, 8 isolates of Aspergillus terreus, 9 isolates of Aspergillus niger, 1 isolate each of Aspergillus parasiticus, Aspergillus penicilloides, Aspergillus versicolor, Aspergillus wangduanlii, Aspergillus qizutongii, Aspergillus beijingensis, and Exophiala dermatitidis, 4 isolates of Candida, 4 isolates of bacteria, and human DNA were used. The nested PCR method specifically identified the A. fumigatus isolates and closely related species and showed a high degree of sensitivity. Additionally, four A. fumigatus strains that were recently isolated from our clinic were correctly identified by this method. Our results demonstrate that these primers are useful for the identification of A. fumigatus and closely related species in culture and suggest further studies for the identification of Aspergillus fumigatus species in clinical specimens. PMID:11376067
-
Mahmood, Shahid; Freitag, Thomas E; Prosser, James I
2006-06-01
PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.
-
Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR
Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru
2005-01-01
Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082
-
Identification of root rot fungi in nursery seedlings by nested multiplex PCR.
Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M
1996-01-01
The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993
-
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
-
Detection of small number of Giardia in biological materials prepared from stray dogs.
Esmailikia, Leila; Ebrahimzade, Elahe; Shayan, Parviz; Amininia, Narges
2017-12-20
Giardia lamblia is an intestinal protozoa with intermittent and low shedding especially in dogs, and the detection of Giardia is accompanied with problems such as sampling and diagnostic method. The objective of this study was to detection of Giardia in biological materials with low number of parasite using parasitological and molecular methods, and also to determine whether the examined stray dogs harbor known zoonotic genotype of Giardia. For this aim 85 fecal and duodenal samples were studied from which 1 was positive by Trichrome staining of stool, 4 were positive by staining of duodenal samples. The nested PCR analysis with primers derived from 18 SrRNA showed that the specific PCR product could be amplified in 4 stool and 4 duodenal samples. All positive samples in staining analysis were also positive in nested PCR. No amplification could be observed by nested PCR with primers derived from β giardin gene due to the single copy of gene. Interestingly, the extracted DNA from old fixed stained Giardia positive smears could be also amplified with primers derived from 18SrRNA gene. The sequence analysis of nested PCR products showed that they belong to the genotype D. In conclusion, it is to denote that the Trichrome or Giemsa methods were not suitable for the detection of small number of this parasite in stool and the nested PCR with primers derived from 18S rRNA gene can replace the traditional methods successfully. For detection of Giardia in stool, primers derived from β giardin will not be recommended.
-
Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.
Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R
2001-04-01
A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.
-
Lee, I M; Bartoszyk, I M; Gundersen, D E; Mogen, B; Davis, R E
1997-07-01
Oligonucleotide primers derived from sequences of the 16S rRNA gene (CMR16F1, CMR16R1, CMR16F2, and CMR16R2) and insertion element IS1121 of Clavibacter michiganensis subsp. sepedonicus (CMSIF1, CMSIR1, CMSIF2, and CMISR2) were used in nested PCR to detect the potato ring rot bacterium C. michiganensis subsp. sepedonicus. Nested PCR with primer pair CMSIF1-CMSIR1 followed by primer pair CMSIF2-CMSIR2 specifically detected C. michiganensis subsp. sepedonicus, while nested PCR with CMR16F1-CMR16R1 followed by CMR16F2-CMR16R2 detected C. michiganensis subsp. sepedonicus and the other C. michiganensis subspecies. In the latter case, C. michiganensis subsp. sepedonicus can be differentiated from the other subspecies by restriction fragment length polymorphism (RFLP) analyses of the nested PCR products (16S rDNA sequences). The nested PCR assays developed in this work allow ultrasensitive detection of very low titers of C. michiganensis subsp. sepedonicus which may be present in symptomiess potato plants or tubers and which cannot be readily detected by direct PCR (single PCR amplification). RFLP analysis of PCR products provides for an unambiguous confirmation of the identify of C. michiganensis subsp. sepedonicus.
-
Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2013-01-01
Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.
-
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori.
-
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-01-01
AIM: To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). METHODS: The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. RESULTS: The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. CONCLUSION: The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori. PMID:27433095
-
Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu
2017-01-01
In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis.
-
Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments
Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu
2017-01-01
In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249
-
A semi-nested PCR assay for molecular detection of Paracoccidioides brasiliensis in tissue samples.
Koishi, Andrea Cristine; Vituri, Débora Fonseca; Dionízio Filho, Pedro Sebastião Raimundo; Sasaki, Alexandre Augusto; Felipe, Maria Sueli Soares; Venancio, Emerson José
2010-01-01
Paracoccidioidomycosis is a systemic infection caused by Paracoccidioides brasiliensis. In this study, a semi-nested PCR for paracoccidioidomycosis diagnosis was developed. The primers ITS1 and ITS4 were used in the first reaction, while the primers MJ03 and ITS1 primer were used in the second reaction. The semi-nested PCR was used to investigate biopsies of five patients with oral lesions that resembled paracoccidioidomycosis. The semi-nested PCR was positive for four samples and negative for a sample from a patient later diagnosed with leishmaniasis. The new semi-nested PCR describe is useful for paracoccidioidomycosis diagnosis.
-
Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila
2015-01-01
Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940
-
Theeraapisakkun, M; Klinbunga, S; Sittipraneed, S
2010-05-18
A molecular maker for authenticating species origin of the stingless bee (Trigona collina) was developed. Initially, amplified fragment length polymorphism analysis was made of 11 stingless bee species using 64 primer combinations. A 316-bp band found only in T. collina was cloned and sequenced. A primer pair (CUTc1-F/R) was designed and tested for species-specificity in 15 stingless bee species (239 nests). The expected 259-bp fragment was consistently amplified in all T. collina individuals (134/134 nests, 100%). Cross-species amplification was observed in T. pagdeni (43/51 nests; 84.3%), but not in other species. SSCP analysis of CUTc1 unambiguously differentiated T. collina from T. pagdeni. CUTc1 generated three genotypes in Thai T. collina (134 nests). An AA (259/259 bp) genotype was found in all stingless bees from the north (21 nests) and northeast (32 nests), and 23/28 nests from the Central region, whereas a BB (253/253 bp) genotype was observed in most samples from peninsular Thailand (42/53 nests). Heterozygotes exhibiting the AB (253/259 bp) genotype were observed in 5 of 28 nests from Prachuap Khiri Khan located slightly above the Kra ecotone and 11 of 53 nests originated further south of the Kra ecotone. Genotype distribution patterns of CUTc1 clearly indicated intraspecific population differentiation of Thai T. collina.
-
Hou, J M; Ma, B C; Zuo, Y H; Guo, L L; Gao, S G; Wang, Y Y; Liu, T
2013-04-01
Curvularia lunata (Wakker) Boed, the causative agent of Curvularia leaf spot in maize, was determined according to conidiophore and conidium morphology in a previous study. In the current study, a sensitive polymerase chain reaction assay was developed for the detection of C. lunata. Two specific forward (ClgD1/ClgD2) and one reverse primers (ClgD3) were designed based on a Ras-related (Clg2p) gene. Eight C. lunata isolates that represent different virulent strains in maize, six other Curvularia spp., and 22 fungal plant pathogens were used to test the specificity of the primers. PCR amplification using ClgD1/ClgD3 as the first-round primers resulted in an 870-bp band from the C. lunata isolates. The detection sensitivity using ClgD1/ClgD3 was 100 pg of genomic DNA. In the second round of PCR, a 1 : 50 dilution of the first-round PCR products was used as a template with the ClgD2/ClgD3 primer pair, which increased the detection sensitivity to 1 fg. This semi-nested PCR procedure could also be used to detect C. lunata from infected maize leaves. The proposed PCR-based assay may be used for diagnosing and monitoring maize Curvularia leaf spot. The semi-nested PCR assay may provide researchers and laboratory technologists a tool to rapidly detect C. lunata, which causes maize Curvularia leaf spot, compared with histological examination. © 2012 The Society for Applied Microbiology.
-
USDA-ARS?s Scientific Manuscript database
A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...
-
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
-
Costa, Maria Eduarda S M; Oliveira, Claudio Bruno S; Andrade, Joelma Maria de A; Medeiros, Thatiany A; Neto, Valter F Andrade; Lanza, Daniel C F
2016-07-01
Toxoplasma gondii is a widespread parasite able to infect virtually any nucleated cells of warm-blooded hosts. In some cases, T. gondii detection using already developed PCR primers can be inefficient in routine laboratory tests, especially to detect atypical strains. Here we report a new nested-PCR protocol able to detect virtually all T. gondii isolates. Analyzing 685 sequences available in GenBank, we determine that GRA7 is one of the most conserved genes of T. gondii genome. Based on an alignment of 85 GRA7 sequences new primer sets that anneal in the highly conserved regions of this gene were designed. The new GRA7 nested-PCR assay providing sensitivity and specificity equal to or greater than the gold standard PCR assays for T. gondii detection, that amplify the B1 sequence or the repetitive 529bp element. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico
Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666
-
Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.
Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola
2016-01-01
Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.
-
ERIC Educational Resources Information Center
O'Dwyer, Laura M.; Parker, Caroline E.
2014-01-01
Analyzing data that possess some form of nesting is often challenging for applied researchers or district staff who are involved in or in charge of conducting data analyses. This report provides a description of the challenges for analyzing nested data and provides a primer of how multilevel regression modeling may be used to resolve these…
-
[Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].
Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan
2015-02-01
To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.
-
Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan
2013-05-01
This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.
-
Rapid nested PCR-based detection of Ramularia collo-cygni direct from barley.
Havis, Neil D; Oxley, Simonj P; Piper, Stephen R; Langrell, Stephen R H
2006-03-01
Ramularia collo-cygni is a barley pathogen of increasing importance in Northern and Central Europe, New Zealand and South America. Accurate visual and microscopic identification of the pathogen from diseased tissue is difficult. A nested PCR-based diagnostic test has been developed as part of an initiative to map the distribution of the pathogen in Scotland. The entire nuclear ribosomal internal transcribed spacer and 5.8S rRNA gene regions from 14 isolates of diverse global origin exhibited complete homology following sequence characterization. Two pairs of species-specific primers, based on inter-specific sequence divergence with closely related species, were designed and empirically evaluated for diagnostic nested PCR. Nested primers Rcc3 and Rcc4 consistently amplified a single product of 256 bp from DNA of 24 R. collo-cygni isolates of diverse global provenance, but not from other Ramularia species, or other fungi commonly encountered in cereal pathosystems, as well as Hordeum or Secale DNA preparations. Using this approach, R. collo-cygni was successfully identified from naturally infected barley leaf, awn and grain samples of diverse geographical provenance, in particular from symptoms that lacked the presence of characteristic conidiophores. It is envisaged that this assay will become established as an important tool in continuing studies into the ecology, aetiology and epidemiology of this poorly understood yet economically damaging plant pathogen.
-
2013-01-01
Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to < two hours. Analysis of the PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252
-
Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan
2015-02-01
AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.
-
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
-
A novel loop-mediated isothermal amplification-based test for detecting Neospora caninum DNA.
Ramos, Andrea Estefanía; Muñoz, Marina; Cortés-Vecino, Jesús Alfredo; Barato, Paola; Patarroyo, Manuel Alfonso
2017-11-29
Neospora caninum is a cyst-forming, coccidian parasite which is known to cause neurological disorders in dogs and abortion and neonatal mortality in cows and other livestock. This study reports the development of a loop-mediated isothermal amplification (LAMP) assay based on the Neospora caninum Nc-5 gene and compares its efficacy for detecting DNA to that of a semi-nested PCR test. Six primers were designed based on the Nc-5 repeat region of N. caninum. Specific LAMP primers led to successful amplification of N. caninum DNA at 63 °C in 30 min. The LAMP assay was highly specific (i.e. it did not reveal cross-reactivity with other parasite species) and had a low N. caninum plasmid DNA limit of detection (1 fg), which is ten times higher than that for the semi-nested PCR. LAMP applicability was evaluated using a set of naturally-infected samples (59 from canine faeces and five from bovine abortions). Thirty-nine percent (25/64) of the naturally-infected samples were positive for N. caninum DNA by LAMP and 36% (23/64) by semi-nested PCR. However, the LAMP assay is much faster to perform than semi-nested PCR and provides results in 30 min. The optimized reaction conditions described in this study resulted in a sensitive, specific and rapid technique for detecting N. caninum DNA. Considering the advantages of LAMP for detecting N. caninum DNA, further assays aimed at testing its usefulness on a wider range of field samples are recommended.
-
Development of a molecular approach to describe the composition of Trichoderma communities.
Meincke, Remo; Weinert, Nicole; Radl, Viviane; Schloter, Michael; Smalla, Kornelia; Berg, Gabriele
2010-01-01
Trichoderma and its teleomorphic stage Hypocrea play a key role for ecosystem functioning in terrestrial habitats. However, little is known about the ecology of the fungus. In this study we developed a novel Trichoderma-specific primer pair for diversity analysis. Based on a broad range master alignment, specific Trichoderma primers (ITSTrF/ITSTrR) were designed that comprise an approximate 650bp fragment of the internal transcribed spacer region from all taxonomic clades of the genus Trichoderma. This amplicon is suitable for identification with TrichoKey and TrichoBLAST. Moreover, this primer system was successfully applied to study the Trichoderma communities in the rhizosphere of different potato genotypes grown at two field sites in Germany. Cloning and sequencing confirmed the specificity of the primer and revealed a site-dependent Trichoderma composition. Based on the new primer system a semi-nested approach was used to generate amplicons suitable for denaturing gradient gel electrophoresis (DGGE) analysis and applied to analyse Trichoderma communities in the rhizosphere of potatoes. High field heterogeneity of Trichoderma communities was revealed by both DGGE. Furthermore, qPCR showed significantly different Trichoderma copy numbers between the sites. Copyright 2009 Elsevier B.V. All rights reserved.
-
Clinical Evaluation of a Loop-Mediated Amplification Kit for Diagnosis of Imported Malaria
Polley, Spencer D.; González, Iveth J.; Mohamed, Deqa; Daly, Rosemarie; Bowers, Kathy; Watson, Julie; Mewse, Emma; Armstrong, Margaret; Gray, Christen; Perkins, Mark D.; Bell, David; Kanda, Hidetoshi; Tomita, Norihiro; Kubota, Yutaka; Mori, Yasuyoshi; Chiodini, Peter L.; Sutherland, Colin J.
2013-01-01
Background. Diagnosis of malaria relies on parasite detection by microscopy or antigen detection; both fail to detect low-density infections. New tests providing rapid, sensitive diagnosis with minimal need for training would enhance both malaria diagnosis and malaria control activities. We determined the diagnostic accuracy of a new loop-mediated amplification (LAMP) kit in febrile returned travelers. Methods. The kit was evaluated in sequential blood samples from returned travelers sent for pathogen testing to a specialist parasitology laboratory. Microscopy was performed, and then malaria LAMP was performed using Plasmodium genus and Plasmodium falciparum–specific tests in parallel. Nested polymerase chain reaction (PCR) was performed on all samples as the reference standard. Primary outcome measures for diagnostic accuracy were sensitivity and specificity of LAMP results, compared with those of nested PCR. Results. A total of 705 samples were tested in the primary analysis. Sensitivity and specificity were 98.4% and 98.1%, respectively, for the LAMP P. falciparum primers and 97.0% and 99.2%, respectively, for the Plasmodium genus primers. Post hoc repeat PCR analysis of all 15 tests with discrepant results resolved 4 results in favor of LAMP, suggesting that the primary analysis had underestimated diagnostic accuracy. Conclusions. Malaria LAMP had a diagnostic accuracy similar to that of nested PCR, with a greatly reduced time to result, and was superior to expert microscopy. PMID:23633403
-
Detection of Bacillus spores using PCR and FTA filters.
Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A
2004-05-01
Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.
-
Francisco, Flávio de O; Brito, Rute M; Arias, Maria C
2006-01-01
In the present study we compare genetic characteristics (allele diversity and observed heterozygosity) of microsatellite loci, from three stingless bee species (Plebeia remota Holmberg, Partamona mulata Moure In Camargo and Partamona helleri Friese), amplified by using heterospecific primers originally designed for Melipona bicolor Lepeletier and Scaptotrigona postica Latreille. We analyzed 360 individuals of P. remota from 72 nests, 58 individuals of R. mulata from 58 nests, and 47 individuals of P. helleri from 47 nests. The three species studied showed low level of polymorphism for the loci amplified with primers derived from M. bicolor. However, for the loci amplified with primers derived from S. postica, only P. remota presented low level of polymorphism.
-
Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao
2015-01-01
The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.
-
Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.
Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong
2014-09-01
PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Kakumanu, Madhavi L.; Ponnusamy, Loganathan; Sutton, Haley T.; Meshnick, Steven R.; Nicholson, William L.
2016-01-01
A novel nested PCR assay was developed to detect Rickettsia spp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) of Rickettsia spp. The newly designed primers were evaluated using genomic DNA from 11 Rickettsia species belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to other Rickettsia-specific PCR targets (ompA, gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11 Rickettsia spp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from “Candidatus Rickettsia amblyommii.” Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adult Dermacentor variabilis ticks. The nested 23S-5S IGS assay detected Rickettsia DNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species of Rickettsia. The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species of Rickettsia in the ticks. “Candidatus Rickettsia amblyommii,” R. montanensis, R. felis, and R. bellii were frequently identified species, along with some potentially novel Rickettsia strains that were closely related to R. bellii and R. conorii. PMID:26818674
-
Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S
2016-04-01
A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. Copyright © 2016 Kakumanu et al.
-
USDA-ARS?s Scientific Manuscript database
In this study, an ultra sensitive and quantitative diagnostic system for “Candidatus Liberibacter asiaticus” was developed. This system adapts a nested PCR and Taq-Man PCR in a single closed tube. The procedure involves two steps of PCR using the species specific outer and inner primer pairs. Differ...
-
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
-
Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.
Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.
-
Fallahi, Shirzad; Mazar, Zahra Arab; Ghasemian, Mehrdad; Haghighi, Ali
2015-05-01
To compare analytical sensitivity and specificity of a newly described DNA amplification technique, LAMP and nested PCR assay targeting the RE and B1 genes for the detection of Toxoplasma gondii (T. gondii) DNA. The analytical sensitivity of LAMP and nested-PCR was obtained against10-fold serial dilutions of T. gondii DNA ranging from 1 ng to 0.01 fg. DNA samples of other parasites and human chromosomal DNA were used to determine the specificity of molecular assays. After testing LAMP and nested-PCR in duplicate, the detection limit of RE-LAMP, B1-LAMP, RE-nested PCR and B1-nested PCR assays was one fg, 100 fg, 1 pg and 10 pg of T. gondii DNA respectively. All the LAMP assays and nested PCRs were 100% specific. The RE-LAMP assay revealed the most sensitivity for the detection of T. gondii DNA. The obtained results demonstrate that the LAMP technique has a greater sensitivity for detection of T. gondii. Furthermore, these findings indicate that primers based on the RE are more suitable than those based on the B1 gene. However, the B1-LAMP assay has potential as a diagnostic tool for detection of T. gondii. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.
-
Detection of Mycoplasma hyopneumoniae by Air Sampling with a Nested PCR Assay
Stärk, Katharina D. C.; Nicolet, Jacques; Frey, Joachim
1998-01-01
This article describes the first successful detection of airborne Mycoplasma hyopneumoniae under experimental and field conditions with a new nested PCR assay. Air was sampled with polyethersulfone membranes (pore size, 0.2 μm) mounted in filter holders. Filters were processed by dissolution and direct extraction of DNA for PCR analysis. For the PCR, two nested pairs of oligonucleotide primers were designed by using an M. hyopneumoniae-specific DNA sequence of a repeated gene segment. A nested PCR assay was developed and used to analyze samples collected in eight pig houses where respiratory problems had been common. Air was also sampled from a mycoplasma-free herd. The nested PCR was highly specific and 104 times as sensitive as a one-step PCR. Under field conditions, the sampling system was able to detect airborne M. hyopneumoniae on 80% of farms where acute respiratory disease was present. No airborne M. hyopneumoniae was detected on infected farms without acute cases. The chance of successful detection was increased if air was sampled at several locations within a room and at a lower air humidity. PMID:9464391
-
Nielsen, D. S.; Møller, P. L.; Rosenfeldt, V.; Pærregaard, A.; Michaelsen, K. F.; Jakobsen, M.
2003-01-01
The distribution of mucosa-associated bacteria, bifidobacteria and lactobacilli and closely related lactic acid bacteria, in biopsy samples from the ascending, transverse, and descending parts of the colon from four individuals was investigated by denaturing gradient gel electrophoresis (DGGE). Bifidobacterial genus-specific, Lactobacillus group-specific, and universal bacterial primers were used in a nested PCR approach to amplify a fragment of the 16S rRNA gene. DGGE profiles of the bifidobacterial community were relatively simple, with one or two amplicons detected at most sampling sites in the colon. DGGE profiles obtained with Lactobacillus group-specific primers were complex and varied with host and sampling site in the colon. The overall bacterial community varied with host but not sampling site. PMID:14660412
-
Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A
2013-09-01
Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.
-
Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR
Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209
-
Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E
2013-10-01
Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling times, i.e. from 10 to 15days after inoculation, although fungal structures still remained present in the leaf tissues. These newly developed molecular protocols should facilitate the detection, quantification and monitoring of endophytic B. bassiana strains in different tissues and host plants and would help to unravel the factors and process governing the specific endophytic association between opium poppy and strain EABb 04/01-Tip providing key insights to formulate a sustainable strategy for I. luteipes management in the host. Copyright © 2013 Elsevier Inc. All rights reserved.
-
Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.
Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S
2016-02-01
Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.
-
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824
-
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.
-
Newsham, Kevin K; Bridge, Paul D
2010-06-01
The leafy liverwort Lophozia excisa, which is colonised by basidiomycete fungi in other biomes and which evidence suggests may be colonised by mycorrhizal fungi in Antarctica, was sampled from Léonie Island in the southern maritime Antarctic (67 degrees 36' S, 68 degrees 21' W). Microscopic examination of plants indicated that fungal hyphae colonised 78% of the rhizoids of the liverwort, apparently by entering the tips of rhizoids prior to growing into their bases, where they formed hyphal coils. Extensive colonisation of stem medullary cells by hyphae was also observed. DNA was extracted from surface-sterilised liverwort tissues and sequenced following nested PCR, using the primer set ITS1F/TW14, followed by a second round of amplification using the ITSSeb3/TW13 primer set. Neighbour-joining analyses showed that the sequences obtained nested in Sebacinales clade B as a 100% supported sister group to Sebacinales sequences from the leafy liverworts Lophozia sudetica, L. incisa and Calypogeia muelleriana sampled from Europe. Direct PCR using the fungal specific primer set ITS1F/ITS4 similarly identified fungi belonging to Sebacinales clade B as the principal colonists of L. excisa tissues. These observations indicate the presence of a second mycothallus in Antarctica and support the previous suggestion that the Sebacinales has a wide geographical distribution.
-
Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos
2003-03-01
SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.
-
Aradaib, Imadeldin E; Majid, Ali A
2006-01-01
A nested polymerase chain reaction (nPCR)-based assay, was developed and evaluated for rapid detection of Trypanosoma evansi in experimentally infected mice and naturally infected camels (Camelus dromedarius). Four oligonucleotide primers (TE1, TE2, TE3 and TE4), selected from nuclear repetitive gene of T. evansi, were designed and used for PCR amplifications. The first amplification, using a pair of outer primers TE1 and TE2, produced a 821-bp primary PCR product from T. evansi DNA. The second amplification, using nested (internal) pair of primers TE3 and TE4, produced a 270-bp PCR product. T. evansi DNAs extracted from blood samples of experimentally infected mice and naturally infected Sudanese breed of dromedary camels were detected by this nested PCR-based assay. The nested primers TE3 and TE4 increased the sensitivity of the PCR assay and as little as 10 fg of T. evansi DNA (equivalent to a single copy of the putative gene of the parasite) was amplified and visualized onto ethidium bromide-stained agarose gels. Amplification products were not detected when the PCR-based assay was applied to DNA from other blood parasites including Thieleria annulata, Babesia bigemina or nucleic acid free samples. Application of this nPCR-based assay to clinical samples resulted in direct detection of T. evansi from a variety of tissue samples collected from experimentally infected mice and blood from naturally infected camels. The described nPCR-based assay provides a valuable tool to study the epidemiology of T. evansi infection in camels and other susceptible animal populations. PMID:16712737
-
2013-01-01
Background Babesia parasites, mainly Babesia bovis and B. bigemina, are tick-borne hemoparasites inducing bovine babesiosis in cattle globally. The clinical signs of the disease include, among others, anemia, fever and hemoglobinuria. Babesiosis is known to occur in tropical and subtropical regions of the world. In this study, we aim to provide information about the occurrence and phylogenetic relationship of B. bigemina and B. bovis species in cattle from different locations in nine provinces of South Africa. A total of 430 blood samples were randomly collected from apparently healthy cattle. These samples were genetically tested for Babesia parasitic infections using nested PCR assays with species-specific primers. Results Nested PCR assays with Group I primer sets revealed that the overall prevalence of B. bigemina and B. bovis in all bovine samples tested was 64.7% (95% CI = 60.0-69.0) and 35.1% (95% CI = 30.6-39.8), respectively. Only 117/430 (27.2%) animals had a mixed infection. The highest prevalence of 87.5% (95% CI = 77.2-93.5) for B. bigemina was recorded in the Free State province collection sites (Ficksburg, Philippolis and Botshabelo), while North West collection sites had the highest number of animals infected with B. bovis (65.5%; 95% CI = 52.7-76.4). Phylograms were inferred based on B. bigemina-specific gp45 and B. bovis-specific rap-1 nucleotide sequences obtained with Group II nested PCR primers. Phylogenetic analysis of gp45 sequences revealed significant differences in the genotypes of B. bigemina isolates investigated, including those of strains published in GenBank. On the other hand, a phylogeny based on B. bovis rap-1 sequences indicated a similar trend of clustering among the sequences of B. bovis isolates investigated in this study. Conclusion This study demonstrates the occurrence of Babesia parasites in cattle from different provinces of South Africa. It was also noted that the situation of Babesia parasitic infection in cattle from certain areas within the surveyed provinces had either reached endemic stability or was progressing towards stability. PMID:23927555
-
Mtshali, Moses Sibusiso; Mtshali, Phillip Senzo
2013-08-08
Babesia parasites, mainly Babesia bovis and B. bigemina, are tick-borne hemoparasites inducing bovine babesiosis in cattle globally. The clinical signs of the disease include, among others, anemia, fever and hemoglobinuria. Babesiosis is known to occur in tropical and subtropical regions of the world. In this study, we aim to provide information about the occurrence and phylogenetic relationship of B. bigemina and B. bovis species in cattle from different locations in nine provinces of South Africa. A total of 430 blood samples were randomly collected from apparently healthy cattle. These samples were genetically tested for Babesia parasitic infections using nested PCR assays with species-specific primers. Nested PCR assays with Group I primer sets revealed that the overall prevalence of B. bigemina and B. bovis in all bovine samples tested was 64.7% (95% CI = 60.0-69.0) and 35.1% (95% CI = 30.6-39.8), respectively. Only 117/430 (27.2%) animals had a mixed infection. The highest prevalence of 87.5% (95% CI = 77.2-93.5) for B. bigemina was recorded in the Free State province collection sites (Ficksburg, Philippolis and Botshabelo), while North West collection sites had the highest number of animals infected with B. bovis (65.5%; 95% CI = 52.7-76.4). Phylograms were inferred based on B. bigemina-specific gp45 and B. bovis-specific rap-1 nucleotide sequences obtained with Group II nested PCR primers. Phylogenetic analysis of gp45 sequences revealed significant differences in the genotypes of B. bigemina isolates investigated, including those of strains published in GenBank. On the other hand, a phylogeny based on B. bovis rap-1 sequences indicated a similar trend of clustering among the sequences of B. bovis isolates investigated in this study. This study demonstrates the occurrence of Babesia parasites in cattle from different provinces of South Africa. It was also noted that the situation of Babesia parasitic infection in cattle from certain areas within the surveyed provinces had either reached endemic stability or was progressing towards stability.
-
Piri, Fahimeh; Zarei Mahmoudabadi, Ali; Ronagh, Ali; Ahmadi, Bahram; Makimura, Koichi; Rezaei-Matehkolaei, Ali
2018-06-26
Conventional direct microscopy with potassium hydroxide (KOH) and culture were found to lack the ability to establish a fast and specific diagnosis of dermatophytosis. A pan-dermatophyte nested-PCR assay was developed using a novel primer pair targeting the translation elongation factor 1-α (Tef-1α) sequences for direct detection and identification of most veterinary relevant dermatophytes in animal samples suspected to dermatophytosis. A total of 140 animal skin and hair samples were subjected to direct microscopy, culture, and ITS-RFLP/ITS-sequencing of culture isolates for the detection and identification of dermatophytosis agents. Nested-PCR sequencing was performed on all the extracted DNAs using a commercial kit after dissolving the specimens by mechanical beating. Nested-PCR was positive in 90% of samples, followed by direct microscopy (85.7%) and culture (75%). The degree of agreement between nested-PCR and direct microscopy (94.4%) was higher than with culture (83.3%). In 105 culture positive cases, the measures of agreement for the identification of dermatophytosis agents were as follows: 100% between nested-PCR sequencing and ITS-RFLP/ITS-sequencing and 63.8% between nested-PCR sequencing and culture. The developed nested-PCR was faster as well as more sensitive and specific than conventional methods for detection and identification of dermatophytes in clinical samples, which was particularly suitable for epidemiological studies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
-
Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax
Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis
2013-01-01
The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509
-
Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee
2011-01-01
Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089
-
Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung
2014-12-01
Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Lisle, John T.; Stellick, Sarah H.
2011-01-01
Microbial community genomic DNA was extracted from sediment samples collected along the Gulf of Mexico and Atlantic coasts from Texas to Florida. Sample sites were identified as being ecologically sensitive and (or) as having high potential of being impacted by Macondo-1 (M-1) well oil from the Deepwater Horizon blowout. The diversity within the microbial communities associated with the collected sediments provides a baseline dataset to which microbial community-diversity data from impacted sites could be compared. To determine the microbial community diversity in the samples, genetic fingerprints were generated and compared. Specific sequences within the community genomic DNA were first amplified using the polymerase chain reaction (PCR) with a primer set that provides possible resolution to the species level. A second nested PCR was performed on the primary PCR products using a primer set on which a GC-clamp was attached to one of the primers. The nested PCR products were separated using denaturing-gradient gel electrophoresis (DGGE) that resolves the nested PCR products based on sequence dissimilarities (or similarities), forming a genomic fingerprint of the microbial diversity within the respective samples. Samples with similar fingerprints were grouped and compared to oil-fingerprint data from the same sites (Rosenbauer and others, 2011). The microbial community fingerprints were generally grouped into sites that had been shown to contain background concentrations of non-Deepwater Horizon oil. However, these groupings also included sites where no oil signature was detected. This report represents some of the first information on naturally occurring microbial communities in sediment from shorelines along the Gulf of Mexico and Atlantic coasts from Texas to Florida.
-
Molecular diagnosis of rhino-orbito-cerebral mucormycosis from fresh tissue samples.
Zaman, Kamran; Rudramurthy, Shivaprakash Mandya; Das, Ashim; Panda, Naresh; Honnavar, Prasanna; Kaur, Harsimran; Chakrabarti, Arunaloke
2017-08-01
We aimed to evaluate a PCR-based technique for the diagnosis of mucormycosis and the identification of fungi from fresh tissue specimens in patients with rhino-orbito-cerebral-mucormycosis (ROCM). Fifty cases of ROCM were included in the study. Conventional identification was performed using microscopy and culture. Molecular diagnosis was performed by amplifying the ribosomal DNA using pan-fungal ITS primers and semi-nested Mucorales-specific primers of the 18S region. The amplified products were sequenced to identify the agents. The utility of PCR-RFLP of the 18S region of rDNA was evaluated to identify the Mucorales. The ROCM cases were diagnosed by the demonstration of aseptate ribbon-like hyphae in biopsy specimens collected from the patients. Isolation was possible in 24 (48 %) samples. The ITS2 PCR confirmed mucormycosis in 27 cases (54 %; CI 59.4-68.2). By comparison, Mucorales-specific PCR was able to amplify DNA and the sequence enabled the identification of Mucorales speciesin all the patients. PCR-RFLP of the 18S region of rDNA could only identify the agent to genus level. The molecular technique was able to identify Mucorales species in 26 (42 %) cases that were negative by culture. Mucorales-specific semi-nested PCR targeting the 18S region is a better technique than ITS2 PCR for diagnosis. PCR-RFLP of the 18S region helps in identification to genus level.
-
Polymerase chain displacement reaction.
Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang
2013-02-01
Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.
-
Development and Practical Use of RT-PCR for Seed-transmitted Prune dwarf virus in Quarantine
Lee, Siwon; Shin, Yong-Gil
2014-01-01
Among imported plants, seeds are the items that have many latent pathogens and are difficult to inspect. Also, they are the import and export items whose market is expected to expand. The biggest problem with seeds is viruses. Prune dwarf virus (PDV) is the virus that is commonly inspected in Prunus cerasifera, P. persica, P. armeniaca, P. mandshurica, P. cerasus, P. avium or P. serotina seeds. In this study, two RT-PCR primer sets, which can promptly and specifically diagnose plant quarantine seed-transmitted PDV, were developed; and nested PCR primers, where products amplify 739 and 673 nucleotides (nt), and an nested PCR-product, 305 nt, can be obtained as these products are amplified again, were developed. Also, a modified-positive control plasmid was developed, where the restriction enzyme XhoI, which can identify the contamination of samples from the control, was inserted. The method developed in this study has detected PDV in 18 cases since 2007, and is expected to continuously contribute to the plant quarantine in Korea. PMID:25289000
-
800,000 year old mammoth DNA, modern elephant DNA or PCR artefact?
Binladen, Jonas; Gilbert, M Thomas P; Willerslev, Eske
2007-02-22
Poulakakis and colleagues (Poulakakis et al. 2006: Biol. Lett. 2, 451-454), report the recovery of 'authentic' mammoth DNA from an 800,000-year-old fragment of bone excavated on the island of Crete. In light of results from other ancient DNA studies that indicate how DNA survival is unlikely in samples, which are recovered from warm environments and are relatively old (e.g. more than 100,000 years), these findings come as a great surprise. Here, we show that problems exist with the methodological approaches used in the study. First, the nested PCR technique as reported is nonsensical--one of the second round 'nested' primers falls outside the amplicon of the first round PCR. More worryingly, the binding region of one of the first round primers (Elcytb320R) falls within the short 43 base pair reported mammoth sequence, specifically covering two of the three reportedly diagnostic Elephas polymorphisms. Finally, we demonstrate using a simple BLAST search in GenBank that the claimed 'uniquely derived character state' for mammoths is in fact also found within modern elephants.
-
Development of a nested-PCR assay for the rapid detection of Pilidiella granati in pomegranate fruit
Yang, Xue; Hameed, Uzma; Zhang, Ai-Fang; Zang, Hao-Yu; Gu, Chun-Yan; Chen, Yu; Xu, Yi-Liu
2017-01-01
Pilidiella granati, a causal agent of twig blight and crown rot of pomegranate, is an emerging threat that may cause severe risk to the pomegranate industry in the future. Development of a rapid assay for the timely and accurate detection of P. granati will be helpful in the active surveillance and management of the disease caused by this pathogen. In this study, a nested PCR method was established for the detection of P. granati. Comparative analysis of genetic diversity within 5.8S rDNA internal transcribed spacer (ITS) sequences of P. granati and 21 other selected fungal species was performed to design species-specific primers (S1 and S2). This primer pair successfully amplified a 450 bp product exclusively from the genomic DNA of P. granati. The developed method can detect 10 pg genomic DNA of the pathogen in about 6 h. This technique was successfully applied to detect the natural infection of P. granati in the pomegranate fruit. The designed protocol is rapid and precise with a high degree of sensitivity. PMID:28106107
-
The role of pleural fluid MAGE RT-nested PCR in the diagnosis of malignant pleural effusion.
Jeon, Eun Ju; Park, Hye Kyeong; Jeon, Kyeongman; Koh, Won-Jung; Suh, Gee Young; Chung, Man Pyo; Kim, Hojoong; Kwon, O Jung; Ki, Chang-Seok; Kim, Jong-Won; Shim, Young Mog; Um, Sang-Won
2012-11-01
Melanoma antigen (MAGE) genes are expressed in tumor cells, the testis and the placenta. The purpose of this prospective study was to investigate the sensitivity, specificity, and accuracy of the carcinoembryonic antigen (CEA), MAGE reverse transcriptase-nested polymerase chain reaction (RT-nested PCR), and cytology of pleural fluid in the diagnosis of malignant pleural effusion. Patients in whom unilateral pleural effusion was identified on chest radiography from January to December 2009 were included in the study. MAGE genes were analyzed by RT-nested PCR using MAGE A1-6 common primers. Of 81 enrolled patients, 46 were diagnosed as malignant pleural effusion, and 24 were diagnosed as benign pleural effusion. The diagnoses of 11 patients were not confirmed in this study. The diagnostic sensitivity, specificity, and accuracy of MAGE RT-nested PCR were 61.4%, 95.7%, and 73.1%, respectively. The diagnostic sensitivities of cytology and CEA (>5 ng/mL) were 61.4% and 75.0%, respectively. Among 17 patients with negative cytology who had malignant pleural effusion, 12 and 10 patients were positive for CEA (>5.0 ng/mL) and MAGE RT-nested PCR, respectively. However, of five patients with malignant pleural effusion that was not recognized by cytology and CEA, MAGE RT-nested PCR correctly predicted a malignant etiology in only one additional patient (20%). MAGE RT-nested PCR seems to add little on the combination of conventional methods in the diagnosis of malignant effusion. © 2012 Tianjin Lung Cancer Institute and Wiley Publishing Asia Pty. Ltd.
-
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.
-
Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.
2003-01-01
The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.
-
Farhadi, Atieh; Haniloo, Ali; Fazaeli, Asghar; Moradian, Siamak; Farhadi, Mehdi
2017-01-01
The diagnosis of ocular toxoplasmosis is mainly based on clinical features. However, ocular fluid testing by PCR may be very helpful for approval or rejection of this etiology. In this study, we utilized a nested-PCR technique, targeting the B1 partial sequence to analyze the aqueous and vitreous samples for evaluating the presence of the Toxoplasma DNA. Fifty aqueous or vitreous humor samples were obtained from patients with clinical features of ocular toxoplasmosis admitted to ophthalmology hospitals and clinics in Iran, within 2014. The samples were subsequently subjected to DNA extraction and purification. For nested amplification of the Toxoplasma B1 gene, two primer pairs were used. The outer and inner primers are expected to produce a 193 bp and a 96 bp fragments, respectively. The first-round PCR resulted in the detection of T. gondii in 58% of samples by amplification of the expected 193bp DNA fragment. The nested-PCR using the inner primers, detected 15 additional samples from those with negative amplicons in the first round PCR (overall positivity of 88%). In addition, vitreous samples showed relatively more positive cases than aqueous humor in detection of the infection. The nested-PCR protocol using the B1 gene, with the high detection power, could be a useful complimentary method to clinical diagnose of ocular toxoplasmosis.
-
Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab
2016-07-01
The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.
-
Jalouli, Miranda; Jalouli, Jamshid; Ibrahim, Salah O; Hirsch, Jan-Michaél; Sand, Lars
2015-01-01
Infection with human papilloma virus (HPV) has been implicated as one of the risk factors for the development of oropharyngeal cancer. Many different HPV tests exist, and information regarding their specific technical, analytical, and clinical properties is increasing. This study aimed to compare the level of detection of HPV using two reliable polymerase chain reaction (PCR) methods, nested PCR (NPCR) and single PCR (SPCR), in archival paraffin-embedded oral squamous cell carcinoma (OSCC) samples and fresh oral mucosa specimens. The presence of HPV genome in two groups of tissue samples was analyzed: (i) 57 paraffin-embedded OSCC samples from Sudan and (ii) eight healthy fresh oral mucosal samples from Swedish volunteers. The specimens were tested by SPCR with primer pair MY9/MY11 and NPCR using GP5+/GP6+ primer sets. Eighteen (32%) out of the 57 paraffin-embedded OSCC samples, and five (62%) out of the eight fresh clinically healthy samples were found to be HPV-positive with NPCR. With SPCR, four (7%) out of the paraffin-embedded OSCC samples were HPV-positive. A statistically significant difference between HPV-positive and -negative samples was found when comparing NPCR and SPCR in OSCC and fresh oral mucosa (p<0.0001). The comparative test between SPCR and NPCR showed 100% sensitivity and 69% specificity for OSCC. The use of the GP5+/GP6+ nested PCR increased the positivity rate, efficiency rate and sensitivity of HPV detection in oral samples significantly and should be considered as the method of choice. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
-
Yao, Li-Nong; Zhang, Ling-Ling; Ruan, Wei; Chen, Hua-Liang; Lu, Qiao-Yi; Yang, Ting-Ting
2013-06-01
To identify the species of malaria parasites in 5 imported cases previously diagnosed as vivax malaria. Epidemiological information and blood samples were collected from five patients who returned from Africa and were diagnosed as vivax malaria. The detection was conducted by microscopy, right VIEW rapid malaria test (RDTs) and nested PCR with Plasmodium genus-specific and species-specific primers. The amplified products were sequenced and Blast analysis was performed. Three of the 5 cases had a history of malaria attack. Microscopically, 4 cases were confirmed as Plasmodium ovale infection, 1 (case 1) was co-infected with P. vivax and P. ovale. All 5 cases showed negative RDT results. Nested PCR detection revealed that the 5 cases had a P. ovale-specific fragment (800 bp), while case 1 had a P. vivax-specific fragment (120 bp) concurrently. Blast analysis showed that the amplified sequence of the 5 cases had a high sequence homology (99%) with P. ovale gene for small subunit ribosomal RNA from GenBank, and that of case 1 also shared 99% homology with P. vivax isolate SV5 18S ribosomal RNA gene (GenBank accession number: JQ627157.1). Among the five cases, four were infected by Plasmodium ovale, and one was co-infected with both P. vivax and P. ovale.
-
Rôças, I N; Siqueira, J F
2005-12-01
Recent evidence from molecular genetic studies has revealed that oral Treponema species are involved in infections of endodontic origin. This study assessed the occurrence of two newly named oral treponemes - Treponema parvum and Treponema putidum - in primary endodontic infections using a culture-independent identification technique. Genomic DNA was isolated directly from clinical samples, and a 16S rRNA gene-based nested polymerase chain reaction (PCR) assay was used to determine the presence of T. parvum and T. putidum. Species-specific primer pairs were developed by aligning closely related 16S rRNA gene sequences. The specificity for each primer pair was validated by running PCR against a panel of oral bacteria and by sequence analysis of PCR products from positive clinical samples. T. parvum was detected in 52% of the root canals associated with chronic apical periodontitis, in 20% of the cases diagnosed as acute apical periodontitis, and in no abscessed case. In general, T. parvum was detected in 26% of the samples from primary endodontic infections. T. putidum was found in only one case of acute apical periodontitis (2% of the total number of cases investigated). The devised nested PCR protocol was able to identify both T. parvum and T. putidum directly in clinical samples and demonstrated that these two treponemes can take part in endodontic infections.
-
Single-tube nested PCR assay for the detection of avian botulism in cecal contents of chickens.
Jang, Il; Lee, Jae-Il; Kwon, Yong-Kuk; Kang, Min-Su; Kim, Hye-Ryoung; Park, Ji-Young; Lee, Song-Hyun; Lee, Hee-Soo; Bae, You-Chan
2015-10-01
This paper describes a novel diagnostic method for the detection of avian botulism caused by Clostridium botulinum type C and C/D, using single-tube nested PCR assay. This assay was developed to overcome the disadvantages of bioassays used in experiments with mice. Three primer pairs including an antisense primer were designed to target the N-terminal of the toxin gene from C. botulinum types C and C/D. The specificity of the PCR assay was confirmed by using 33 bacterial strains and chicken cecal contents from farms that experienced botulism outbreaks. The detection limit for purified DNA was 1.1 fg/μl, and for bacterial spores was 4.3 spores/200 mg of cecal contents. While checking for specificity of the PCR assay, the reactions with the templates form C. botulinum type C and C/D which were tested became positive, but the rest of the reactions turned negative. However, the results for all clinical samples (n = 8) were positive. The PCR assay results for cecal samples obtained from 300 healthy chickens (150 Korean native chickens and 150 broilers) were all negative. This assay is rapid and straightforward and evades ethical issues associated with mouse bioassay. Moreover, it is more economical than real-time PCR. Copyright © 2015 Elsevier Ltd. All rights reserved.
-
Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples.
Alasaad, Noor; Alzubi, Hussein; Kader, Ahmad Abdul
2016-06-01
Food and feed samples were randomly collected from different sources, including local and imported materials from the Syrian local market. These included maize, barley, soybean, fresh food samples and raw material. GMO detection was conducted by PCR and nested PCR-based techniques using specific primers for the most used foreign DNA commonly used in genetic transformation procedures, i.e., 35S promoter, T-nos, epsps, cryIA(b) gene and nptII gene. The results revealed for the first time in Syria the presence of GM foods and feeds with glyphosate-resistant trait of P35S promoter and NOS terminator in the imported soybean samples with high frequency (5 out of the 6 imported soybean samples). While, tests showed negative results for the local samples. Also, tests revealed existence of GMOs in two imported maize samples detecting the presence of 35S promoter and nos terminator. Nested PCR results using two sets of primers confirmed our data. The methods applied in the brief data are based on DNA analysis by Polymerase Chain Reaction (PCR). This technique is specific, practical, reproducible and sensitive enough to detect up to 0.1% GMO in food and/or feedstuffs. Furthermore, all of the techniques mentioned are economic and can be applied in Syria and other developing countries. For all these reasons, the DNA-based analysis methods were chosen and preferred over protein-based analysis.
-
Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo
2011-07-01
Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.
-
Wang, Yong-Feng; Zhang, Fang-Qiu; Gu, Ji-Dong
2014-06-01
Denaturing gradient gel electrophoresis (DGGE) is a powerful technique to reveal the community structures and composition of microorganisms in complex natural environments and samples. However, positive and reproducible polymerase chain reaction (PCR) products, which are difficult to acquire for some specific samples due to low abundance of the target microorganisms, significantly impair the effective applications of DGGE. Thus, nested PCR is often introduced to generate positive PCR products from the complex samples, but one problem is also introduced: The total number of thermocycling in nested PCR is usually unacceptably high, which results in skewed community structures by generation of random or mismatched PCR products on the DGGE gel, and this was demonstrated in this study. Furthermore, nested PCR could not resolve the uneven representative issue with PCR products of complex samples with unequal richness of microbial population. In order to solve the two problems in nested PCR, the general protocol was modified and improved in this study. Firstly, a general PCR procedure was used to amplify the target genes with the PCR primers without any guanine cytosine (GC) clamp, and then, the resultant PCR products were purified and diluted to 0.01 μg ml(-1). Subsequently, the diluted PCR products were utilized as templates to amplify again with the same PCR primers with the GC clamp for 17 cycles, and the products were finally subjected to DGGE analysis. We demonstrated that this is a much more reliable approach to obtain a high quality DGGE profile with high reproducibility. Thus, we recommend the adoption of this improved protocol in analyzing microorganisms of low abundance in complex samples when applying the DGGE fingerprinting technique to avoid biased results.
-
Molecular and clinical analyses of Helicobacter pylori colonization in inflamed dental pulp.
Nomura, Ryota; Ogaya, Yuko; Matayoshi, Saaya; Morita, Yumiko; Nakano, Kazuhiko
2018-04-16
Recently, dental pulp has been considered a possible source of infection of Helicobacter pylori (H. pylori) in children. We previously developed a novel PCR system for H. pylori detection with high specificity and sensitivity using primer sets constructed based on the complete genome information for 48 H. pylori strains. This PCR system showed high sensitivity with a detection limit of 1-10 cells when serial dilutions of H. pylori genomic DNA were used as templates. However, the detection limit was lower (10 2 -10 3 cells) when H. pylori bacterial DNA was detected from inflamed pulp specimens. Thus, we further refined the system using a nested PCR method, which was much more sensitive than the previous single PCR method. In addition, we examined the distribution and virulence of H. pylori in inflamed pulp tissue. Nested PCR system was constructed using primer sets designed from the complete genome information of 48 H. pylori strains. The detection limit of the nested PCR system was 1-10 cells using both H. pylori genomic DNA and bacterial DNA isolated from inflamed pulp specimens. Next, distribution of H. pylori was examined using 131 inflamed pulp specimens with the nested PCR system. In addition, association between the detection of H. pylori and clinical information regarding endodontic-infected teeth were investigated. Furthermore, adhesion property of H. pylori strains to human dental fibroblast cells was examined. H. pylori was present in 38.9% of inflamed pulp specimens using the nested PCR system. H. pylori was shown to be predominantly detected in primary teeth rather than permanent teeth. In addition, samplings of the inflamed pulp were performed twice from the same teeth at 1- or 2-week intervals, which revealed that H. pylori was detected in most specimens in both samplings. Furthermore, H. pylori strains showed adhesion property to human dental fibroblast cells. Our results suggest that H. pylori colonizes inflamed pulp in approximately 40% of all cases through adhesion to human dental fibroblast cells.
-
Lisle, John T.
2011-01-01
Microbial community genomic DNA was extracted from sediment samples collected from the northern Gulf of Mexico (NGOM) coast. These samples had a high probability of being impacted by Macondo-1 (M-1) well oil from the Deepwater Horizon (DWH) drilling site. The hypothesis for this project was that presence of M-1 oil in coastal sediments would significantly alter the diversity within the microbial communities associated with the impacted sediments. To determine if community-level changes did or did not occur following exposure to M-1 oil, microbial community-diversity fingerprints were generated and compared. Specific sequences within the community's genomic DNA were first amplified using the polymerase chain reaction (PCR) using a primer set that provides possible resolution to the species level. A second nested PCR that was performed on the primary PCR products using a primer set on which a GC-clamp was attached to one of the primers. These nested PCR products were separated using denaturing-gradient gel electrophoresis (DGGE) that resolves the nested PCR products based on sequence dissimilarities (or similarities), forming a genomic fingerprint of the microbial diversity within the respective samples. Sediment samples with similar fingerprints were grouped and compared to oil-fingerprint data from Rosenbauer and others (2010). The microbial community fingerprints grouped closely when identifying those sites that had been impacted by M-1 oil (N=12) and/or some mixture of M-1 and other oil (N=4), based upon the oil fingerprints. This report represents some of the first information on naturally occurring microbial communities in sediment from shorelines along the NGOM coast. These communities contain microbes capable of degrading oil and related hydrocarbons, making this information relevant to response and recovery of the NGOM from the DWH incident.
-
Liang, Shih-Yu; Hsia, Kan-Tai; Chan, Yun-Hsien; Fan, Chia-Kwung; Jiang, Donald Dah-Shyong; Landt, Olfert; Ji, Dar-Der
2010-08-01
A single-tube multiprobe real-time PCR assay for simultaneous detection of Entamoeba histolytica and Entamoeba dispar was developed. One primer pair with 2 species-specific probes was designed based on new SSU RNA regions of the ribosomal DNA-containing episome. The sensitivity is 1 parasite per milliliter of feces and thus superior to the conventional nested PCR and comparable to other published real-time PCR protocols. The applicability for clinical diagnosis was validated with 218 stool specimens from patients. A total of 51 E. histolytica and 39 E. dispar positive samples was detected by the multiprobe real-time PCR compared to 39 and 22 by routine nested PCR diagnosis. The detection rate of Entamoeba species for the multiprobe real-time PCR assays was significantly higher than the nested PCR (40.8% vs. 28.0%, P < 0.01). The test did not show cross reactivity with DNA from Entamoeba moshkovskii, Giardia lamblia , Cryptosporidium sp., Escherichia coli , or other nonpathogenic enteric parasites. The multiprobe real-time PCR assay is simple and rapid and has high specificity and sensitivity. The assay could streamline the laboratory diagnosis procedure and facilitate epidemiological investigation.
-
An innovative and integrated approach based on DNA walking to identify unauthorised GMOs.
Fraiture, Marie-Alice; Herman, Philippe; Taverniers, Isabel; De Loose, Marc; Deforce, Dieter; Roosens, Nancy H
2014-03-15
In the coming years, the frequency of unauthorised genetically modified organisms (GMOs) being present in the European food and feed chain will increase significantly. Therefore, we have developed a strategy to identify unauthorised GMOs containing a pCAMBIA family vector, frequently present in transgenic plants. This integrated approach is performed in two successive steps on Bt rice grains. First, the potential presence of unauthorised GMOs is assessed by the qPCR SYBR®Green technology targeting the terminator 35S pCAMBIA element. Second, its presence is confirmed via the characterisation of the junction between the transgenic cassette and the rice genome. To this end, a DNA walking strategy is applied using a first reverse primer followed by two semi-nested PCR rounds using primers that are each time nested to the previous reverse primer. This approach allows to rapidly identify the transgene flanking region and can easily be implemented by the enforcement laboratories. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
-
DNA from uncultured organisms as a source of 2,5-diketo-L-gluconic acid reductases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eschenfeldt, W. H.; Stols, L.; Rosenbaum, H.
2001-09-01
Total DNA of a population of uncultured organisms was extracted from soil samples, and by using PCR methods, the genes encoding two different 2,5-diketo-D-gluconic acid reductases (DKGRs) were recovered. Degenerate PCR primers based on published sequence information gave internal gene fragments homologous to known DKGRs. Nested primers specific for the internal fragments were combined with random primers to amplify flanking gene fragments from the environmental DNA, and two hypothetical full-length genes were predicted from the combined sequences. Based on these predictions, specific primers were used to amplify the two complete genes in single PCRs. These genes were cloned and expressedmore » in Escherichia coli. The purified gene products catalyzed the reduction of 2,5-diketo-D-gluconic acid to 2-keto-L-gulonic acid. Compared to previously described DKGRs isolated from Corynebacterium spp., these environmental reductases possessed some valuable properties. Both exhibited greater than 20-fold-higher k{sub cat}/K{sub m} values than those previously determined, primarily as a result of better binding of substrate. The K{sub m} values for the two new reductases were 57 and 67 {mu}M, versus 2 and 13 mM for the Corynebacterium enzymes. Both environmental DKGRs accepted NADH as well as NADPH as a cosubstrate; other DKGRs and most related aldo-keto reductases use only NADPH. In addition, one of the new reductases was more thermostable than known DKGRs.« less
-
Molecular identification of Coccidioides spp. in soil samples from Brazil
2011-01-01
Background Since 1991 several outbreaks of acute coccidioidomycosis (CM) were diagnosed in the semi-arid Northeast of Brazil, mainly related to disturbance of armadillo burrows caused by hunters while digging them for the capture of these animals. This activity causes dust contaminated with arthroconidia of Coccidioides posadasii, which, once inhaled, cause the mycosis. We report on the identification of C. posadasii in soil samples related to outbreaks of CM. Results Twenty four soil samples had their DNA extracted and subsequently submitted to a semi-nested PCR technique using specific primers. While only 6 (25%) soil samples were positive for C. posadasii by mice inoculation, all (100%) were positive by the molecular tool. Conclusion This methodology represents a simple, sensitive and specific molecular technique to determine the environmental distribution of Coccidioides spp. in endemic areas, but cannot distinguish the species. Moreover, it may be useful to identify culture isolates. Key-words: 1. Coccidioidomycosis. 2. Coccidioides spp. 3. C. posadasii. 4. Semi-arid. 5. Semi-nested PCR PMID:21575248
-
Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.
Khadhair, A H; Evans, I R; Choban, B
2002-01-01
In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.
-
Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W
1996-01-01
Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716
-
Ventura, Marco; Reniero, Roberto; Zink, Ralf
2001-01-01
The species Bifidobacterium lactis, with its main representative strain Bb12 (DSM 10140), is a yoghurt isolate used as a probiotic strain and is commercially applied in different types of yoghurts and infant formulas. In order to ensure the genetic identity and safety of this bacterial isolate, species- and strain-specific molecular tools for genetic fingerprinting must be available to identify isolated bifidobacteria or lactic acid bacteria from, e.g., various clinical environments of relevance in medical microbiology. Two opposing rRNA gene-targeted primers have been developed for specific detection of this microorganism by PCR. The specificity of this approach was evaluated and verified with DNA samples isolated from single and mixed cultures of bifidobacteria and lactobacilli (48 isolates, including the type strains of 29 Bifidobacterium and 9 Lactobacillus species). Furthermore, we performed a Multiplex-PCR using oligonucleotide primers targeting a specific region of the 16S rRNA gene for the genus Bifidobacterium and a conserved eubacterial 16S rDNA sequence. The specificity and sensitivity of this detection with a pure culture of B. lactis were, respectively, 100 bacteria/ml after 25 cycles of PCR and 1 to 10 bacteria/ml after a 50-cycle nested-PCR approach. PMID:11375192
-
Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro
2016-10-11
Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.
-
Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L
2014-12-01
The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.
-
Gonzaga, Rosa Maria S.; Rodart, Itatiana F.; Reis, Mitermayer Galvão; Ramalho Neto, Cícero Eduardo; Silva, Denise Wanderlei
2008-01-01
We determined the frequency of hepatitis C virus (HCV) genotypes in anti-HCV seropositive patients in the state of Alagoas, Brazil, by means of nested-reverse transcription-polymerase chain reaction (RT-nested-PCR) followed by restriction fragment length polymorphism (RFLP) of amplified fragments of the 5´NCR. The nested-PCR with genotype-specific primers from the core region was carried out when detection was not possible by the first approach. Detectable HCV-RNA was present in 115 (74.7%) of 154 serum samples. Genotype 1 was the most frequent (77.4%), against 20.9% of genotype 3 and 0.8% of genotype 2. Subtype 1b was predominant (65.2%), followed by subtypes 1a (8.7%), and 3a (6.1%). Coinfection (1a/3a) was detected in 0.8% of the samples. Indeed, there was no significant differences in the prevalence of genotype 1 compared to what has been obtained from anti-HCV seropositive patients from other locations in Brazil. Here we report for the first time the genotype 2 in the state of Alagoas. PMID:24031281
-
2014-01-01
Background Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. Methods DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. Results The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Conclusions Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection. PMID:25047415
-
Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro
2014-07-21
Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.
-
Sinha, Pallavi; Gupta, Anamika; Prakash, Pradyot; Anupurba, Shampa; Tripathi, Rajneesh; Srivastava, G N
2016-03-12
Control of the global burden of tuberculosis is obstructed due to lack of simple, rapid and cost effective diagnostic techniques that can be used in resource poor-settings. To facilitate the early diagnosis of TB directly from clinical specimens, we have standardized and validated the use of nested multiplex PCR, targeting gene fragments IS6110, MTP40 and 32kD α-antigen encoding genes specific for Mycobacterium tuberculosis complex and non-tubercular mycobacteria (NTM), in comparison to smear microscopy, solid culture and single step multiplex PCR. The results were evaluated in comparison to a composite reference standard (CRS) comprising of microbiological results (smear and culture), clinical, radiological and cytopathological findings, clinical treatment and response to anti-tubercular therapy. The nested multiplex PCR (nMPCR) assay was evaluated to test its utility in 600 (535 pulmonary and 65 extra-pulmonary specimens) clinically suspected TB cases. All specimens were processed for smear, culture, single step multiplex PCR and nested multiplex PCR testing. Out of 535 screened pulmonary and 65 extra-pulmonary specimens, 329 (61.5%) and 19 (29.2%) cases were culture positive for M. tuberculosis. Based on CRS, 450 patients had "clinical TB" (definitive-TB, probable-TB and possible-TB). Remaining 150 were confirmed "non-TB" cases. For culture, the sensitivity was low, 79.3% for pulmonary and 54.3% for extra-pulmonary cases. The sensitivity and specificity results for nMPCR test were evaluated taken composite reference standard as a gold standard. The sensitivity of the nMPCR assay was 97.1% for pulmonary and 91.4% for extra-pulmonary TB cases with specificity of 100% and 93.3% respectively. Nested multiplex PCR using three gene primers is a rapid, reliable and highly sensitive and specific diagnostic technique for the detection and differentiation of M. tuberculosis complex from NTM genome and will be useful in diagnosing paucibacillary samples. Nested multiplex PCR assay was found to be better than single step multiplex PCR for assessing the diagnosis of TB.
-
Kejnovský, E; Vrána, J; Matsunaga, S; Soucek, P; Siroký, J; Dolezel, J; Vyskot, B
2001-07-01
The dioecious white campion Silene latifolia (syn. Melandrium album) has heteromorphic sex chromosomes, XX in females and XY in males, that are larger than the autosomes and enable their separation by flow sorting. The group of MROS genes, the first male-specifically expressed genes in dioecious plants, was recently identified in S. latifolia. To localize the MROS genes, we used the flow-sorted X chromosomes and autosomes as a template for PCR with internal primers. Our results indicate that the MROS3 gene is located in at least two copies tandemly arranged on the X chromosome with additional copy(ies) on the autosome(s), while MROS1, MROS2, and MROS4 are exclusively autosomal. The specificity of PCR products was checked by digestion with a restriction enzyme or reamplification using nested primers. Homology search of databases has shown the presence of five MROS3 homologues in A. thaliana, four of them arranged in two tandems, each consisting of two copies. We conclude that MROS3 is a low-copy gene family, connected with the proper pollen development, which is present not only in dioecious but also in other dicot plant species.
-
Comparison of diagnostic techniques for the detection of Cryptosporidium oocysts in animal samples
Mirhashemi, Marzieh Ezzaty; Zintl, Annetta; Grant, Tim; Lucy, Frances E.; Mulcahy, Grace; De Waal, Theo
2015-01-01
While a large number of laboratory methods for the detection of Cryptosporidium oocysts in faecal samples are now available, their efficacy for identifying asymptomatic cases of cryptosporidiosis is poorly understood. This study was carried out to determine a reliable screening test for epidemiological studies in livestock. In addition, three molecular tests were compared to identify Cryptosporidium species responsible for the infection in cattle, sheep and horses. A variety of diagnostic tests including microscopic (Kinyoun's staining), immunological (Direct Fluorescence Antibody tests or DFAT), enzyme-linked immunosorbent assay (ELISA), and molecular methods (nested PCR) were compared to assess their ability to detect Cryptosporidium in cattle, horse and sheep faecal samples. The results indicate that the sensitivity and specificity of each test is highly dependent on the input samples; while Kinyoun's and DFAT proved to be reliable screening tools for cattle samples, DFAT and PCR analysis (targeted at the 18S rRNA gene fragment) were more sensitive for screening sheep and horse samples. Finally different PCR primer sets targeted at the same region resulted in the preferential amplification of certain Cryptosporidium species when multiple species were present in the sample. Therefore, for identification of Cryptosporidium spp. in the event of asymptomatic cryptosporidiosis, the combination of different 18S rRNA nested PCR primer sets is recommended for further epidemiological applications and also tracking the sources of infection. PMID:25662435
-
Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear.
Hassanpour, Gholamreza; Mirhendi, Hossein; Mohebali, Mehdi; Raeisi, Ahmad; Zeraati, Hojjat; Keshavarz, Hossein
2016-01-01
We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan- Plasmodium real-time PCR for accurate screening of individuals suspected of malaria. A single primer/probe set for pan-species Plasmodium -specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction. The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum . All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR. By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.
-
Sulaiman, Irshad M; Anderson, Mickey; Oi, David H; Simpson, Steven; Kerdahi, Khalil
2012-08-01
The U.S. Food and Drug Administration utilizes the presence of filth and extraneous materials as one of the criteria for implementing regulatory actions and assessing adulteration of food products of public health importance. Twenty-two prevalent pest species (also known as the ''Dirty 22'' species) have been considered by this agency as possible vehicles for the spread of foodborne diseases, and the presence of these species is considered an indicator of unsanitary conditions in food processing and storage facilities. In a previous study, we further categorized the Dirty 22 species into four groups: group I includes four cockroach species, group II includes two ant species, group III includes 12 fly species, and group IV includes four rodent species. Here, we describe the development of three nested PCR primer sets and multilocus genetic characterization by amplifying the small subunit rRNA, elongation factor 1-alpha, and wingless (WNT-1) genes of group II Dirty 22 ant species Monomorium pharaonis and Solenopsis molesta. These novel group II Dirty 22 species-specific nested PCR primer sets can be used when the specimens cannot be identified using conventional microscopic methods. These newly developed assays will provide correct identification of group II Dirty 22 ant species, and the information can be used in the control of foodborne pathogens.
-
Talundzic, Eldin; Maganga, Mussa; Masanja, Irene M; Peterson, David S; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2014-01-27
Accurate diagnosis of malaria infections remains challenging, especially in the identification of submicroscopic infections. New molecular diagnostic tools that are inexpensive, sensitive enough to detect low-level infections and suitable in laboratory settings of resource-limited countries are required for malaria control and elimination programmes. Here the diagnostic potential of a recently developed photo-induced electron transfer fluorogenic primer (PET) real-time polymerase chain reaction (PCR) called PET-PCR was investigated. This study aimed to (i) evaluate the use of this assay as a method for the detection of both Plasmodium falciparum and other Plasmodium species infections in a developing country's diagnostic laboratory; and, (ii) determine the assay's sensitivity and specificity compared to a nested 18S rRNA PCR. Samples used in this study were obtained from a previous study conducted in the region of Iringa, Tanzania. A total of 303 samples from eight health facilities in Tanzania were utilized for this evaluation. All samples were screened using the multiplex PET-PCR assay designed to detect Plasmodium genus and P. falciparum initially in laboratory in Tanzania and then repeated at a reference laboratory at the CDC in the USA. Microscopy data was available for all the 303 samples. A subset of the samples were tested in a blinded fashion to find the sensitivity and specificity of the PET-PCR compared to the nested 18S rRNA PCR. Compared to microscopy, the PET-PCR assay was 59% more sensitive in detecting P. falciparum infections. The observed sensitivity and specificity were 100% (95% confidence interval (CI0.95) = 94-100%) and (CI0.95 = 96-100%), respectively, for the PET-PCR assay when compared to nested 18S rRNA PCR. When compared to 18S rRNA PCR, microscopy had a low sensitivity of 40% (CI0.95 = 23-61%) and specificity of 100% (CI0.95 = 96-100%). The PET-PCR results performed in the field laboratory in Tanzania were in 100% concordance with the results obtained at the reference laboratory in the USA. The PET-PCR is a new molecular diagnostic tool with similar performance characteristics as commonly used PCR methods that is less expensive, easy to use, and amiable to large scale-surveillance studies in developing country settings.
-
Hoyles, Lesley; Clear, Jessica A; McCartney, Anne L
2013-08-01
With the exceptions of the bifidobacteria, propionibacteria and coriobacteria, the Actinobacteria associated with the human gastrointestinal tract have received little attention. This has been due to the seeming absence of these bacteria from most clone libraries. In addition, many of these bacteria have fastidious growth and atmospheric requirements. A recent cultivation-based study has shown that the Actinobacteria of the human gut may be more diverse than previously thought. The aim of this study was to develop a denaturing gradient gel electrophoresis (DGGE) approach for characterizing Actinobacteria present in faecal samples. Amount of DNA added to the Actinobacteria-specific PCR used to generate strong PCR products of equal intensity from faecal samples of five infants, nine adults and eight elderly adults was anti-correlated with counts of bacteria obtained using fluorescence in situ hybridization probe HGC69A. A nested PCR using Actinobacteria-specific and universal PCR-DGGE primers was used to generate profiles for the Actinobacteria. Cloning of sequences from the DGGE bands confirmed the specificity of the Actinobacteria-specific primers. In addition to members of the genus Bifidobacterium, species belonging to the genera Propionibacterium, Microbacterium, Brevibacterium, Actinomyces and Corynebacterium were found to be part of the faecal microbiota of healthy humans. Copyright © 2013 Elsevier Ltd. All rights reserved.
-
Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle
2016-01-01
Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested-MSP, pyrosequencing, and MS-HRM varied, the prognostic effect seemed similar (HR 1.74, 95 % CI 0.97-3.15; HR 1.85, 95 % CI 0.93-3.86; HR 1.83, 95 % CI 0.92-3.65, respectively). Our results show that upon optimizing and aligning four RET methylation assays with regard to primer location and sensitivity, differences in methylation frequencies and clinical sensitivities are observed; however, the effect on the marker's prognostic outcome is minimal.
-
A multiplex PCR method for rapid identification of Brachionus rotifers.
Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J
2009-01-01
Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.
-
Marino, Anna Maria Fausta; Percipalle, Maurizio; Giunta, Renato Paolo; Salvaggio, Antonio; Caracappa, Giulia; Alfonzetti, Tiziana; Aparo, Alessandra; Reale, Stefano
2017-03-01
We report a rapid and reliable method for the detection of Toxoplasma gondii in meat and animal tissues based on real-time polymerase chain reaction (PCR). Samples were collected from cattle, small ruminants, horses, and pigs raised or imported into Sicily, Italy. All DNA preparations were assayed by real-time PCR tests targeted to a 98-bp long fragment in the AF 529-bp repeat element and to the B1 gene using specific primers. Diagnostic sensitivity (100%), diagnostic specificity (100%), limit of detection (0.01 pg), efficiency (92-109%), and precision (mean coefficient of variation = 0.60%), repeatability (100%), reproducibility (100%), and robustness were evaluated using 240 DNA extracted samples (120 positives and 120 negative as per the OIE nested PCR method) from different matrices. Positive results were confirmed by the repetition of both real-time and nested PCR assays. Our study demonstrates the viability of a reliable, rapid, and specific real-time PCR on a large scale to monitor contamination with Toxoplasma cysts in meat and animal specimens. This validated method can be used for postmortem detection in domestic and wild animals and for food safety purposes.
-
Nuclear Matrix Proteins in Disparity of Prostate Cancer
2011-07-01
using G3PDH 3’ primer and PCR primer 1 followed by two rounds of hybridization. In the first hybridization, the RsaI-digested driver cDNA was mixed...determined using β-actin to confirm the reduced relative abundance of the housekeeping gene after SSH. The SSH nested PCR products were cloned using pCR®2.1...variability of DNA concentration. Additionally, negative and positive controls ( housekeeping genes) from the Ambion™ ArrayControls™ Set were included
-
Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Dickinson, Matthew
2009-01-01
Primers and probes based on the 23S rRNA gene have been utilized to design a range of real-time PCR assays for routine phytoplasma diagnostics. These assays have been authenticated as phytoplasma specific and shown to be at least as sensitive as nested PCR. A universal assay to detect all phytoplasmas has been developed, along with a multiplex assay to discriminate 16SrI group phytoplasmas from members of all of the other 16Sr groups. Assays for the 16SrII, 16SrIV, and 16SrXII groups have also been developed to confirm that the 23S rRNA gene can be used to design group-specific assays. PMID:19270148
-
The use of singleplex and nested PCR to detect Batrachochytrium dendrobatidis in free-living frogs.
Coutinho, Selene Dall'Acqua; Burke, Julieta Catarina; de Paula, Catia Dejuste; Rodrigues, Miguel Trefaut; Catão-Dias, José Luiz
2015-06-01
Many microorganisms are able to cause diseases in amphibians, and in the past few years one of the most reported has been Batrachochytrium dendrobatidis. This fungus was first reported in Brazil in 2005; following this, other reports were made in specimens deposited in museum collections, captive and free-living frogs. The aim of this study was to compare singleplex and nested-PCR techniques to detect B. dendrobatidis in free-living and apparently healthy adult frogs from the Brazilian Atlantic Forest. The sample collection area was a protected government park, with no general entrance permitted and no management of the animals there. Swabs were taken from the skin of 107 animals without macroscopic lesions and they were maintained in ethanol p.a. Fungal DNA was extracted and identification of B. dendrobatidis was performed using singleplex and nested-PCR techniques, employing specific primers sequences. B. dendrobatidis was detected in 61/107 (57%) and 18/107 (17%) animals, respectively by nested and singleplex-PCR. Nested-PCR was statistically more sensible than the conventional for the detection of B. dendrobatidis (Chi-square = 37.1; α = 1%) and the agreement between both techniques was considered just fair (Kappa = 0.27). The high prevalence obtained confirms that these fungi occur in free-living frogs from the Brazilian Atlantic Forest with no macroscopic lesions, characterizing the state of asymptomatic carrier. We concluded that the nested-PCR technique, due to its ease of execution and reproducibility, can be recommended as one of the alternatives in epidemiological surveys to detect B. dendrobatidis in healthy free-living frog populations.
-
Seasonal and spatial community dynamics in the meromictic Lake Cadagno.
Bosshard, P P; Stettler, R; Bachofen, R
2000-09-01
The seasonal and spatial variations in the community structure of bacterioplankton in the meromictic alpine Lake Cadagno were examined by temporal temperature gradient gel electrophoresis (TTGE) of PCR-amplified 16S rDNA fragments. Two different amplifications were performed, one specific for the domain Bacteria (Escherichia coli positions 8-536) and another specific for the family Chromatiaceae (E. coli positions 8-1005). The latter was followed by semi-nested reamplification with the bacterial primer set, allowing comparison of the two PCR approaches by TTGE. The TTGE patterns of samples from the chemocline and the anoxic monimolimnion were essentially identical, whereas the oxic mixolimnion displayed distinctively different banding patterns. For samples from the chemocline and the monimolimnion, dominant bands in the Bacteria-specific TTGE profiles comigrated with bands obtained by the semi-nested PCR approach specific for Chromatiaceae. This observation suggested that Chromatiaceae are in high abundance in the anoxic water layer. All dominant bands were excised and sequenced. Changes in the community structure, as indicated by changes in the TTGE profiles, were observed in samples taken at different times of the year. In the chemocline, Chomatium okenii was dominant in the summer months, whereas Amoebobacter purpureus populations dominated in autumn and winter. This change was confirmed by fluorescent in situ hybridization.
-
Moriyama, Moriyama; Taira, Masaaki; Matsumura, Hiroshi; Aoki, Hiroshi; Mikuni, Morio; Kaneko, Miki; Shioda, Atsuo; Iwaguchi, Kayo; Arai, Shinobu; Ichijima, Sagiri; Iwasaki, Hiroko; Tanaka, Naohide; Abe, Kenji; Arakawa, Yasuyuki
2003-01-01
The aims of this study were to determine the hepatitis B virus (HBV) genotypes in hepatitis delta virus (HDV) RNA-positive patients and to characterize the HBV nucleotide sequences that may be found on a distant island of Japan. This study included three patients with chronic hepatitis who were positive for hepatitis B surface antigen (enzyme-linked immunosorbent assay; ELISA), HDV antibody (ELISA) and HDV RNA by polymerase chain reaction (PCR). The HBV genotype was determined by nested PCR using type-specific primers. The first-round PCR products from two patients were sequenced, followed by an investigation of nucleotide homology. Viruses from all three patients in this study were classified as HBV genotype B. Comparison with HBV isolates from geographically neighboring regions revealed that the two HBV isolates had 97.9-98.6% identity at the nucleotide level to a Chinese isolate, 98.3-98.6% identity to the Okinawa isolate and 98.6-98.8% identity to a Japanese isolate of genotype B. On phylogenetic analysis, the HBV isolates from the two patients were classified as HBV genotype B. The HBV isolates of cases 1 and 3 clustered in the same group as isolates from the Chinese mainland and Japanese mainland, which are geographically near Miyako Island. The HBV isolates coinfected with HDV found on Miyako Island were of genotype B. The PCR method based on genotype-specific primers was useful in determining HBV genotypes. Copyright 2003 S. Karger AG, Basel
-
Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa
2017-08-01
A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Izadi, Morteza; Jonaidi Jafari, Nematollah; Sadraei, Javid; Mahmoodzadeh Poornaki, Abbas; Rezavand, Babak; Zarrinfar, Hossein; Abdi, Jahangir; Mohammadi, Younes
2014-12-01
The use of immune suppressive drugs for organ transplant recipients predisposes them to opportunistic infections, especially by fungal agents. Pneumocystis jiroveci, as an opportunistic pathogen, endangers the patients' life in those with immune system disorders. Early detection of latent Pneumocystis infection in susceptible patients may help choose the optimal treatment for these patients. The aim of this study was to identify and determine the colonization of latent P. jiroveci infection among lung transplant recipients. This cross-sectional descriptive study was conducted on lung transplant recipients. Bronchoalveolar lavage (BAL) specimens were collected from 32 patients undergoing bronchoscopy. The samples were aseptically homogenized by 10 mM dithiothreitol, and their DNA was extracted. The mtLSUrRNA gene of P. jiroveci was amplified using nested PCR in two stages. Nested PCR was performed using external primers of pAZ-102-E and pAZ102-H followed by using the PCR product of the first stage and internal primers of pAZ-102-E and pAZ102-L2. The genome of P. jiroveci was revealed by a 346 bp PCR product in the initial amplification and a 120 bp product in the nested PCR. The results showed that seven BAL specimens (21.9%) from lung transplant recipients were positive for P. jiroveci. In molecular epidemiology studies, nested PCR has higher sensitivity than PCR. Results of this study support the colonization of P. jiroveci in patients receiving lung transplantation. Patients who are carriers of P. jiroveci are at a higher risk of P. jiroveci pneumonia.
-
Calvo, Eliana P; Sánchez-Quete, Fernando; Durán, Sandra; Sandoval, Isabel; Castellanos, Jaime E
2016-11-01
Dengue (DENV), chikungunya (CHIKV) and zika (ZIKV) are arthropod-borne viruses (arboviruses) sharing a common vector, the mosquito Aedes aegypti. At initial stages, patients infected with these viruses have similar clinical manifestations, however, the outcomes and clinical management of these diseases are different, for this reason early and accurate identification of the causative virus is necessary. This paper reports the development of a rapid and specific nested-PCR for detection of DENV, CHIKV and ZIKV infection in the same sample. A set of six outer primers targeting the C-preM, E1, and E gene respectively was used in a multiplex one-step RT-PCR assay, followed by the second round of amplification with specific inner primers for each virus. The specificity of the present assay was validated with positive and negative serum samples for viruses and supernatants of infected cells. The assay was tested using clinical samples from febrile patients. In these samples, we detected mono and dual infections and a case of triple co-infection DENV-CHIKV-ZIKV. This assay might be a useful and an inexpensive tool for detection of these infections in regions where these arboviruses co-circulate. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
-
Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188
-
Detection of porcine reproductive and respiratory syndrome virus in boar semen by PCR.
Christopher-Hennings, J; Nelson, E A; Nelson, J K; Hines, R J; Swenson, S L; Hill, H T; Zimmerman, J J; Katz, J B; Yaeger, M J; Chase, C C
1995-01-01
Porcine reproductive and respiratory syndrome virus (PRRSV) causes a devastating disease in swine. The presence and transmission of PRRSV by boar semen has been demonstrated by using a swine bioassay. In this assay, 4- to 8-week-old pigs were inoculated intraperitoneally with semen from PRRSV-infected boars. Seroconversion of these piglets indicated the presence of PRRSV in semen. Seroconversion in gilts has also been demonstrated following artificial insemination with semen from PRRSV-infected boars. These methods of detecting PRRSV in boar semen are time-consuming, laborious, and expensive. The objective of this study was to develop a reliable and sensitive PCR assay to directly detect PRRSV in boar semen. Primers from open reading frames 1b and 7 of the PRRSV genome were used in nested PCRs. Virus was detected at concentrations as low as 10 infectious virions per ml in PRRSV-spiked semen. Specificity was confirmed by using a nested PCR and a 32P-labeled oligonucleotide probe. The primers did not react with related arteriviruses or other swine viruses. The PCR assay showed good correlation with the swine bioassay, and both methods were superior to virus isolation. To consistently identify PRRSV in boar semen, the cell fraction was separated by centrifugation at 600 x g for 20 min, a lysis buffer without a reducing agent (2-mercaptoethanol) was used, and nondiluted and 1:20-diluted cell fractions were evaluated by PCR. PRRSV was not reliably detected in the seminal plasma fraction of boar semen. PMID:7665637
-
Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear
HASSANPOUR, Gholamreza; MIRHENDI, Hossein; MOHEBALI, Mehdi; RAEISI, Ahmad; ZERAATI, Hojjat; KESHAVARZ, Hossein
2016-01-01
Background: We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan-Plasmodium real-time PCR for accurate screening of individuals suspected of malaria. Methods: A single primer/probe set for pan-species Plasmodium-specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction. Results: The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum. All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR. Conclusion: By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples. PMID:28127357
-
Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein
2013-05-01
Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.
-
Mitchell, Andrew
2015-09-01
Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past. © 2015 John Wiley & Sons Ltd.
-
Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin
2016-08-03
A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients' serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions.
-
2014-01-01
Background Accurate diagnosis of malaria infections remains challenging, especially in the identification of submicroscopic infections. New molecular diagnostic tools that are inexpensive, sensitive enough to detect low-level infections and suitable in laboratory settings of resource-limited countries are required for malaria control and elimination programmes. Here the diagnostic potential of a recently developed photo-induced electron transfer fluorogenic primer (PET) real-time polymerase chain reaction (PCR) called PET-PCR was investigated. This study aimed to (i) evaluate the use of this assay as a method for the detection of both Plasmodium falciparum and other Plasmodium species infections in a developing country’s diagnostic laboratory; and, (ii) determine the assay’s sensitivity and specificity compared to a nested 18S rRNA PCR. Methods Samples used in this study were obtained from a previous study conducted in the region of Iringa, Tanzania. A total of 303 samples from eight health facilities in Tanzania were utilized for this evaluation. All samples were screened using the multiplex PET-PCR assay designed to detect Plasmodium genus and P. falciparum initially in laboratory in Tanzania and then repeated at a reference laboratory at the CDC in the USA. Microscopy data was available for all the 303 samples. A subset of the samples were tested in a blinded fashion to find the sensitivity and specificity of the PET-PCR compared to the nested 18S rRNA PCR. Results Compared to microscopy, the PET-PCR assay was 59% more sensitive in detecting P. falciparum infections. The observed sensitivity and specificity were 100% (95% confidence interval (CI0.95) = 94-100%) and (CI0.95 = 96-100%), respectively, for the PET-PCR assay when compared to nested 18S rRNA PCR. When compared to 18S rRNA PCR, microscopy had a low sensitivity of 40% (CI0.95 = 23-61%) and specificity of 100% (CI0.95 = 96-100%). The PET-PCR results performed in the field laboratory in Tanzania were in 100% concordance with the results obtained at the reference laboratory in the USA. Conclusion The PET-PCR is a new molecular diagnostic tool with similar performance characteristics as commonly used PCR methods that is less expensive, easy to use, and amiable to large scale-surveillance studies in developing country settings. PMID:24467985
-
Hopken, Matthew W; Orning, Elizabeth K; Young, Julie K; Piaggio, Antoinette J
2016-01-07
The greater sage-grouse (Centrocercus urophasianus) is a ground-nesting bird from the Northern Rocky Mountains and a species at risk of extinction in in multiple U.S. states and Canada. Herein we report results from a proof of concept that mitochondrial and nuclear DNAs from mammalian predator saliva could be non-invasively collected from depredated greater sage-grouse eggshells and carcasses and used for predator species identification. Molecular forensic approaches have been applied to identify predators from depredated remains as one strategy to better understand predator-prey dynamics and guide management strategies. This can aid conservation efforts by correctly identifying predators most likely to impact threatened and endangered species. DNA isolated from non-invasive samples around nesting sites (e.g. fecal or hair samples) is one method that can increase the success and accuracy of predator species identification when compared to relying on nest remains alone. Predator saliva DNA was collected from depredated eggshells and carcasses using swabs. We sequenced two partial fragments of two mitochondrial genes and obtained microsatellite genotypes using canid specific primers for species and individual identification, respectively. Using this multilocus approach we were able to identify predators, at least down to family, from 11 out of 14 nests (79%) and three out of seven carcasses (47%). Predators detected most frequently were canids (86%), while other taxa included rodents, a striped skunk, and cattle. We attempted to match the genotypes of individual coyotes obtained from eggshells and carcasses with those obtained from fecal samples and coyotes collected in the areas, but no genotype matches were found. Predation is a main cause of nest failure in ground-nesting birds and can impact reproduction and recruitment. To inform predator management for ground-nesting bird conservation, accurate identification of predator species is necessary. Considering predation can have a high impact on recruitment, predation events are very difficult to observe, and predator species are difficult to identify visually from nest remains, molecular approaches that reduce the need to observe or handle animals offer an additional tool to better understand predator-prey dynamics at nesting sites.
-
Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya
2016-01-01
Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178
-
Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma
2016-01-01
Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.
-
Improving molecular tools for global surveillance of measles virus.
Bankamp, Bettina; Byrd-Leotis, Lauren A; Lopareva, Elena N; Woo, Gibson K S; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W; Ramamurty, Nalini; Mulders, Mick N; Featherstone, David; Bellini, William J; Rota, Paul A
2013-09-01
The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. Published by Elsevier B.V.
-
Improving molecular tools for global surveillance of measles virus⋆
Bankamp, Bettina; Byrd-Leotis, Lauren A.; Lopareva, Elena N.; Woo, Gibson K.S.; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W.; Ramamurty, Nalini; Mulders, Mick N.; Featherstone, David; Bellini, William J.; Rota, Paul A.
2017-01-01
Background The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. Objectives The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. Study design A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. Results A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. Conclusions These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. PMID:23806666
-
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584
-
Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu
2017-08-01
Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.
-
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio; Kano, Shigeyuki
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.
-
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297
-
Detection of environmental sources of Histoplasma capsulatum in Chiang Mai, Thailand, by nested PCR.
Norkaew, Treepradab; Ohno, Hideaki; Sriburee, Pojana; Tanabe, Koichi; Tharavichitkul, Prasit; Takarn, Piyawan; Puengchan, Tanpalang; Bumrungsri, Sara; Miyazaki, Yoshitsugu
2013-12-01
Histoplasmosis is a systemic mycosis caused by inhaling spores of Histoplasma capsulatum, a dimorphic fungus. This fungus grows in soil contaminated with bat and avian excreta. Each year, patients with disseminated histoplasmosis have been diagnosed in Chiang Mai, northern Thailand. No published information is currently available on the environmental sources of this fungus in Chiang Mai or anywhere else in Thailand. The aim of this study was to detect H. capsulatum in soil samples contaminated with bat guano and avian droppings by nested PCR. Two hundred and sixty-five samples were collected from the following three sources: soil contaminated with bat guano, 88 samples; soil contaminated with bird droppings, 86 samples; and soil contaminated with chicken droppings, 91 samples. Genomic DNA was directly extracted from each sample, and H. capsulatum was detected by nested PCR using a primer set specific to a gene encoding 100-kDa-like protein (HcI, HcII and HcIII, HcIV). Histoplasma capsulatum was detected in seven of 88 soil samples contaminated with bat guano, one of 21 soil samples contaminated with pigeon droppings and 10 of 91 soil samples contaminated with chicken droppings. The results indicate the possibility of the association of bat guano and chicken droppings with H. capsulatum in this area of Thailand.
-
Smielewska-Loś, E
2003-01-01
Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.
-
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
-
Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W
2000-12-01
Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.
-
Pan, Xiaoming; Zhang, Yanfang; Sha, Xuejiao; Wang, Jing; Li, Jing; Dong, Ping; Liang, Xingguo
2017-03-28
White spot syndrome virus (WSSV) is a major threat to the shrimp farming industry and so far there is no effective therapy for it, and thus early diagnostic of WSSV is of great importance. However, at the early stage of infection, the extremely low-abundance of WSSV DNA challenges the detection sensitivity and accuracy of PCR. To effectively detect low-abundance WSSV, here we developed a pre-amplification PCR (pre-amp PCR) method to amplify trace amounts of WSSV DNA from massive background genomic DNA. Combining with normal specific PCR, 10 copies of target WSSV genes were detected from ~10 10 magnitude of backgrounds. In particular, multiple target genes were able to be balanced amplified with similar efficiency due to the usage of the universal primer. The efficiency of the pre-amp PCR was validated by nested-PCR and quantitative PCR, and pre-amp PCR showed higher efficiency than nested-PCR when multiple targets were detected. The developed method is particularly suitable for the super early diagnosis of WSSV, and has potential to be applied in other low-abundance sample detection cases.
-
Adamopoulos, Panagiotis G; Kontos, Christos K; Scorilas, Andreas
2018-03-31
Tissue kallikrein, kallikrein-related peptidases (KLKs), and plasma kallikrein form the largest group of serine proteases in the human genome, sharing many structural and functional properties. Several KLK transcripts have been found aberrantly expressed in numerous human malignancies, confirming their prognostic or/and diagnostic values. However, the process of alternative splicing can now be studied in-depth due to the development of Next-Generation Sequencing (NGS). In the present study, we used NGS to discover novel transcripts of the KLK1 and KLK2 genes, after nested touchdown PCR. Bioinformatics analysis and PCR experiments revealed a total of eleven novel KLK transcripts (two KLK1 and nine KLK2 transcripts). In addition, the expression profiles of each novel transcript were investigated with nested PCR experiments using variant-specific primers. Since KLKs are implicated in human malignancies, qualifying as potential biomarkers, the quantification of the presented novel transcripts in human samples may have clinical applications in different types of cancer. Copyright © 2018. Published by Elsevier Inc.
-
Pratap, Chandra Bhan; Kumar, Gopal; Patel, Saurabh Kumar; Shukla, Vijay K; Kumar, Kailash; Singh, Tej Bali
2014-01-01
Introduction: Enteric fever is a systemic disease caused by Salmonella organism such as serotypes Typhi and ParaTyphi A, B, C. Salmonella ParaTyphi A contributes more than 50% of all the enteric fever cases and it has recently been projected as an emerging pathogen. Materials and Methods: The present study was aimed to detect Salmonella Typhi and ParaTyphi A in urine, blood and stool specimens collected from cases of enteric fever (110), chronic typhoid carriers (46) and healthy controls (75) to explore the possibility of mixed infection by nested PCR. A new nested PCR primer was designed targeting putative fimbrial protein (stkG) gene which is one of the fimbrial gene families to Salmonella ParaTyphi A and for S. Typhi already reported primers targeting flagellin (fliC) gene. Results: Large volume of urine specimens (15 ml) was found to be the best for detection of Salmonella serotypes. The urine sample was found to have mixed-infection by both the serotypes in 40.9% of the cases but lower in blood (27.3%) and stool (13.6%). Conclusion: The present study concludes that occurrence of mixed infection may be quite frequent in typhoid and chronic typhoid carriers’ individuals, although the reported recent rise in ParaTyphi A incidence may not be real. PMID:25584217
-
Ide, Tatsuya; Kanzaki, Natsumi; Ohmura, Wakako; Okabe, Kimiko
2016-03-27
Lyctus brunneus(Stephens) is one of the most destructive and worldwide invasive pests of seasoned woods for wooden products. This and other pestLyctusspecies have had their distribution expanded by international and domestic human transportation of infested wood and wood products. Rapid detection and accurate identification ofLyctusspecies are effective tools for helping to eradicate them in new introduction sites. The accurate species-level identification of adults requires expert knowledge about their morphology. However, it takes much time and effort to recover suitable adult specimens because they are borers inside wood. Frass ofLyctusspecies can easily be detected and recovered in and around infested wood. Thus, frass was tested to see if it was a suitable sample to allow development of a rapid and technically easy molecular detection and identification method forL.brunneus.Species-specific primers were designed from the cytochrome c oxidase subunit I region ofL.brunneusand used in development and testing of methods for successfully identifying them from their frass using the loop-mediated isothermal amplification (LAMP) or species-specific nested polymerase chain reaction (PCR) assays. The LAMP assay was faster and more sensitive for detecting the presence of DNA derived fromL.brunneusin their frass than the nested PCR assay. These methodologies will be applicable for the rapid detection and identification of other wood-boring invasive pests in regulatory applications. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
-
Towards high-throughput molecular detection of Plasmodium: new approaches and molecular markers
Steenkeste, Nicolas; Incardona, Sandra; Chy, Sophy; Duval, Linda; Ekala, Marie-Thérèse; Lim, Pharath; Hewitt, Sean; Sochantha, Tho; Socheat, Doung; Rogier, Christophe; Mercereau-Puijalon, Odile; Fandeur, Thierry; Ariey, Frédéric
2009-01-01
Background Several strategies are currently deployed in many countries in the tropics to strengthen malaria control toward malaria elimination. To measure the impact of any intervention, there is a need to detect malaria properly. Mostly, decisions still rely on microscopy diagnosis. But sensitive diagnosis tools enabling to deal with a large number of samples are needed. The molecular detection approach offers a much higher sensitivity, and the flexibility to be automated and upgraded. Methods Two new molecular methods were developed: dot18S, a Plasmodium-specific nested PCR based on the 18S rRNA gene followed by dot-blot detection of species by using species-specific probes and CYTB, a Plasmodium-specific nested PCR based on cytochrome b gene followed by species detection using SNP analysis. The results were compared to those obtained with microscopic examination and the "standard" 18S rRNA gene based nested PCR using species specific primers. 337 samples were diagnosed. Results Compared to the microscopy the three molecular methods were more sensitive, greatly increasing the estimated prevalence of Plasmodium infection, including P. malariae and P. ovale. A high rate of mixed infections was uncovered with about one third of the villagers infected with more than one malaria parasite species. Dot18S and CYTB sensitivity outranged the "standard" nested PCR method, CYTB being the most sensitive. As a consequence, compared to the "standard" nested PCR method for the detection of Plasmodium spp., the sensitivity of dot18S and CYTB was respectively 95.3% and 97.3%. Consistent detection of Plasmodium spp. by the three molecular methods was obtained for 83% of tested isolates. Contradictory results were mostly related to detection of Plasmodium malariae and Plasmodium ovale in mixed infections, due to an "all-or-none" detection effect at low-level parasitaemia. Conclusion A large reservoir of asymptomatic infections was uncovered using the molecular methods. Dot18S and CYTB, the new methods reported herein are highly sensitive, allow parasite DNA extraction as well as genus- and species-specific diagnosis of several hundreds of samples, and are amenable to high-throughput scaling up for larger sample sizes. Such methods provide novel information on malaria prevalence and epidemiology and are suited for active malaria detection. The usefulness of such sensitive malaria diagnosis tools, especially in low endemic areas where eradication plans are now on-going, is discussed in this paper. PMID:19402894
-
Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N
2007-01-01
To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach can be adopted as a standard procedure for complete molecular characterization of Bt cotton. These assays will be of interest and use to importers, breeders, research laboratories, safety regulators, and food processors for detection of cry1Ac bearing GMOs.
-
Molecular etiopathology of naturally occurring reproductive diseases in female goats
Beena, V.; Pawaiya, R. V. S.; Gururaj, K.; Singh, D. D.; Mishra, A. K.; Gangwar, N. K.; Gupta, V. K.; Singh, R.; Sharma, A. K.; Karikalan, M.; Kumar, Ashok
2017-01-01
Aim: The aim of the present study was to investigate the molecular etiopathology of occurrence of reproductive diseases in female goats. Reproductive diseases in goats account for major economic losses to goat farmers in terms of valuable loss of offspring and animal productivity. Materials and Methods: A total of 660 female genitalia were examined for pathological conditions (macroscopic and microscopic lesions). The etiopathological study was carried out for the presence of pathogenic organisms such as Brucella, Chlamydia, and Campylobacter in the uterus and ovary. Based on the microscopic lesions, suspected samples were subjected to diagnostic polymerase chain reaction (PCR) for various etiological agents employing 16srRNA genus specific primers for Campylobacter and Chlamydophila and OMP31 gene-based PCR for Brucella melitensis and nested PCR using ITS-1 gene primers for Toxoplasma gondii. For Brucella suspected samples, immunohistochemistry (IHC) was also performed. Results: In studied female genitalia, 108 (16.30%) showed gross abnormalities with overall 23.32% occurrence of pathological conditions (macroscopic and microscopic lesions). Pathological involvement of the uterus was the highest 68 (62.96%), followed by the ovaries 27 (25%) and other organs. Major uterine condition observed was endometritis (5.60%). In uterine infections, 35 (5.30%) samples were found positive for Campylobacter spp., 12 (1.81%) samples for B. melitensis, and 3 (0.45%) samples were positive for Chlamydophila spp. Among the samples positive for B. melitensis by PCR, 3 were found positive by IHC also. Corynebacterium ovis was detected by PCR using specific primers in a case of hydrosalpinx. It was concluded that many pathological lesions in female genitalia of functional significance play a major role in infertility in goats. Conclusion: The present study concluded that many pathological lesions in female genitalia of functional significance play a major role in infertility in goats. PMID:28919691
-
Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P
1996-01-01
Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234
-
Le Bourhis, Anne-Gaëlle; Saunier, Katiana; Doré, Joël; Carlier, Jean-Philippe; Chamba, Jean-François; Popoff, Michel-Robert; Tholozan, Jean-Luc
2005-01-01
A nested-PCR temporal temperature gradient gel electrophoresis (TTGE) approach was developed for the detection of bacteria belonging to phylogenetic cluster I of the genus Clostridium (the largest clostridial group, which represents 25% of the currently cultured clostridial species) in cheese suspected of late blowing. Primers were designed based on the 16S rRNA gene sequence, and the specificity was confirmed in PCRs performed with DNAs from cluster I and non-cluster I species as the templates. TTGE profiles of the PCR products, comprising the V5-V6 region of the 16S rRNA gene, allowed us to distinguish the majority of cluster I species. PCR-TTGE was applied to analyze commercial cheeses with defects. All cheeses gave a signal after nested PCR, and on the basis of band comigration with TTGE profiles of reference strains, all the bands could be assigned to a clostridial species. The direct identification of Clostridium spp. was confirmed by sequencing of excised bands. C. tyrobutyricum and C. beijerinckii contaminated 15 and 14 of the 20 cheese samples tested, respectively, and C. butyricum and C. sporogenes were detected in one cheese sample. Most-probable-number counts and volatile fatty acid were determined for comparison purposes. Results obtained were in agreement, but only two species, C. tyrobutyricum and C. sporogenes, could be isolated by the plating method. In all cheeses with a high amount of butyric acid (>100 mg/100 g), the presence of C. tyrobutyricum DNA was confirmed by PCR-TTGE, suggesting the involvement of this species in butyric acid fermentation. These results demonstrated the efficacy of the PCR-TTGE method to identify Clostridium in cheeses. The sensitivity of the method was estimated to be 100 CFU/g. PMID:15640166
-
Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis
Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.
2005-01-01
Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538
-
A New Single-Step PCR Assay for the Detection of the Zoonotic Malaria Parasite Plasmodium knowlesi
Lucchi, Naomi W.; Poorak, Mitra; Oberstaller, Jenna; DeBarry, Jeremy; Srinivasamoorthy, Ganesh; Goldman, Ira; Xayavong, Maniphet; da Silva, Alexandre J.; Peterson, David S.; Barnwell, John W.; Kissinger, Jessica; Udhayakumar, Venkatachalam
2012-01-01
Background Recent studies in Southeast Asia have demonstrated substantial zoonotic transmission of Plasmodium knowlesi to humans. Microscopically, P. knowlesi exhibits several stage-dependent morphological similarities to P. malariae and P. falciparum. These similarities often lead to misdiagnosis of P. knowlesi as either P. malariae or P. falciparum and PCR-based molecular diagnostic tests are required to accurately detect P. knowlesi in humans. The most commonly used PCR test has been found to give false positive results, especially with a proportion of P. vivax isolates. To address the need for more sensitive and specific diagnostic tests for the accurate diagnosis of P. knowlesi, we report development of a new single-step PCR assay that uses novel genomic targets to accurately detect this infection. Methodology and Significant Findings We have developed a bioinformatics approach to search the available malaria parasite genome database for the identification of suitable DNA sequences relevant for molecular diagnostic tests. Using this approach, we have identified multi-copy DNA sequences distributed in the P. knowlesi genome. We designed and tested several novel primers specific to new target sequences in a single-tube, non-nested PCR assay and identified one set of primers that accurately detects P. knowlesi. We show that this primer set has 100% specificity for the detection of P. knowlesi using three different strains (Nuri, H, and Hackeri), and one human case of malaria caused by P. knowlesi. This test did not show cross reactivity with any of the four human malaria parasite species including 11 different strains of P. vivax as well as 5 additional species of simian malaria parasites. Conclusions The new PCR assay based on novel P. knowlesi genomic sequence targets was able to accurately detect P. knowlesi. Additional laboratory and field-based testing of this assay will be necessary to further validate its utility for clinical diagnosis of P. knowlesi. PMID:22363751
-
Detection of Bovine and Porcine Adenoviruses for Tracing the Source of Fecal Contamination
Maluquer de Motes, Carlos; Clemente-Casares, Pilar; Hundesa, Ayalkibet; Martín, Margarita; Girones, Rosina
2004-01-01
In this study, a molecular procedure for the detection of adenoviruses of animal origin was developed to evaluate the level of excretion of these viruses by swine and cattle and to design a test to facilitate the tracing of specific sources of environmental viral contamination. Two sets of oligonucleotides were designed, one to detect porcine adenoviruses and the other to detect bovine and ovine adenoviruses. The specificity of the assays was assessed in 31 fecal samples and 12 sewage samples that were collected monthly during a 1-year period. The data also provided information on the environmental prevalence of animal adenoviruses. Porcine adenoviruses were detected in 17 of 24 (70%) pools of swine samples studied, with most isolates being closely related to serotype 3. Bovine adenoviruses were present in 6 of 8 (75%) pools studied, with strains belonging to the genera Mastadenovirus and Atadenovirus and being similar to bovine adenoviruses of types 2, 4, and 7. These sets of primers produced negative results in nested PCR assays when human adenovirus controls and urban-sewage samples were tested. Likewise, the sets of primers previously designed for detection of human adenovirus also produced negative results with animal adenoviruses. These results indicate the importance of further studies to evaluate the usefulness of these tests to trace the source of fecal contamination in water and food and for environmental studies. PMID:15006765
-
Detection of bovine and porcine adenoviruses for tracing the source of fecal contamination.
Maluquer de Motes, Carlos; Clemente-Casares, Pilar; Hundesa, Ayalkibet; Martín, Margarita; Girones, Rosina
2004-03-01
In this study, a molecular procedure for the detection of adenoviruses of animal origin was developed to evaluate the level of excretion of these viruses by swine and cattle and to design a test to facilitate the tracing of specific sources of environmental viral contamination. Two sets of oligonucleotides were designed, one to detect porcine adenoviruses and the other to detect bovine and ovine adenoviruses. The specificity of the assays was assessed in 31 fecal samples and 12 sewage samples that were collected monthly during a 1-year period. The data also provided information on the environmental prevalence of animal adenoviruses. Porcine adenoviruses were detected in 17 of 24 (70%) pools of swine samples studied, with most isolates being closely related to serotype 3. Bovine adenoviruses were present in 6 of 8 (75%) pools studied, with strains belonging to the genera Mastadenovirus and Atadenovirus and being similar to bovine adenoviruses of types 2, 4, and 7. These sets of primers produced negative results in nested PCR assays when human adenovirus controls and urban-sewage samples were tested. Likewise, the sets of primers previously designed for detection of human adenovirus also produced negative results with animal adenoviruses. These results indicate the importance of further studies to evaluate the usefulness of these tests to trace the source of fecal contamination in water and food and for environmental studies.
-
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
-
Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.
West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D
1995-01-01
A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625
-
Murata, Fernando Henrique Antunes; Ferreira, Marina Neves; Pereira-Chioccola, Vera Lucia; Spegiorin, Lígia Cosentino Junqueira Franco; Meira-Strejevitch, Cristina da Silva; Gava, Ricardo; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia
2017-09-01
Toxoplasmosis during pregnancy can have severe consequences. The use of sensitive and specific serological and molecular methods is extremely important for the correct diagnosis of the disease. We compared the ELISA and ELFA serological methods, conventional PCR (cPCR), Nested PCR and quantitative PCR (qPCR) in the diagnosis of Toxoplasma gondii infection in pregnant women without clinical suspicion of toxoplasmosis (G1=94) and with clinical suspicion of toxoplasmosis (G2=53). The results were compared using the Kappa index, and the sensitivity, specificity, positive predictive value and negative predictive value were calculated. The results of the serological methods showed concordance between the ELISA and ELFA methods even though ELFA identified more positive cases than ELISA. Molecular methods were discrepant with cPCR using B22/23 primers having greater sensitivity and lower specificity compared to the other molecular methods. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
-
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
-
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
-
Verdin, E; Kobisch, M; Bové, J M; Garnier, M; Saillard, C
2000-12-01
We have previously reported a nested PCR assay for the detection of Mycoplasma hyopneumoniae directly in tracheobronchiolar washings from living pigs in field conditions. Here, we describe the construction and use of an internal control to monitor the presence of PCR inhibitors. A PCR modified target DNA was constructed by insertion of a small DNA fragment into the M. hyopneumoniae specific DNA target. We have demonstrated that the internal control failed to be amplified in only three tracheobronchiolar washings samples out of the 362 tested. This control molecule was inserted in a Spiroplasma citri derived plasmid vector and introduced into S. citri cells by electroporation. After a few passages we ensured that the recombinant plasmid became inserted into the genome of S. citri. PCR amplification of the DNA of this transformed S. citri strain using nested PCR primers led to amplification of a 900-bp fragment which can be discriminated from the M. hyopneumoniae PCR product 700 bp. The S. citri transformants with the integrated internal control were added to the tracheobronchiolar washings prior to PCR and used as an internal control to check the efficiency of sample processing, and to demonstrate the presence of inhibitors. Furthermore, we have been able to estimate the number of mycoplasma cells in the tracheobronchiolar washings. Quantitation was performed by comparing the PCR signal intensity of the specific M. hyopneumoniae template with known concentrations of the S. citri competitor. The titer in tracheobronchiolar washings ranged approximatively from 10(4)to 10(8)M. hyopneumoniae cells per ml of clinical specimen. Quantitative PCR can be a useful tool for monitoring the progression of M. hyopneumoniae in the disease process. Copyright 2000 Academic Press.
-
Wu, Y D; Xu, M J; Wang, Q Q; Zhou, C X; Wang, M; Zhu, X Q; Zhou, D H
2017-08-30
Toxoplasma gondii infects all warm-blooded vertebrates, resulting in a great threat to human health and significant economic loss to the livestock industry. Ingestion of infectious oocysts of T. gondii from the environment is the major source of transmission. Detection of T. gondii oocysts by existing methods is laborious, time-consuming and expensive. The objective of the present study was to develop a recombinase polymerase amplification (RPA) method combined with a lateral flow (LF) strip for detection of T. gondii oocysts in the soil and water. The DNA of T. gondii oocysts was amplified by a pair of specific primers based on the T. gondii B1 gene over 15min at a constant temperature ranging from 30°C to 45°C using RPA. The amplification product was visualized by the lateral flow (LF) strip within 5min using the specific probe added to the RPA reaction system. The sensitivity of the established assay was 10 times higher than that of nested PCR with a lower detection limit of 0.1 oocyst per reaction, and there was no cross-reactivity with other closely related protozoan species. Fifty environmental samples were further assessed for the detection validity of the LF-RPA assay (B1-LF-RPA) and compared with nested PCR based on the B1 gene sequence. The B1-LF-RPA and nested PCR both showed that 5 out of the 50 environmental samples were positive. The B1-LF-RPA method was also proven to be sufficiently tolerant of existing inhibitors in the environment. In addition, the advantages of simple operation, speediness and cost-effectiveness make B1-LF-RPA a promising molecular detection tool for T. gondii. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Mumps disease outbreak in Davangere district of Karnataka, India.
Raut, C G; Sinha, D P; Jayaprakash, H; Hanumiah, H; Manjunatha, M J
2015-01-01
Mumps is a vaccine-preventable disease that usually occurs as a parotitis, but it can also lead to several life- threatening complications, including pancreatitis, meningitis and encephalitis. To determine and diagnosis of mumps disease, which is communicable disease usually affects childrens. Although it is seen worldwide, but outbreaks not common in India. Thirty one suspected mumps cases, who presented to the unimmunized population of Chikkahallivana village in Davangere district of Karnataka, India in January 2014, with clinical evidence of fever, cervical lymphadenitis and ear pain, manifest with self-limited uni-or bilateral parotitis. A total of 31 cases consisting of 31 blood and 31 throat swabs were tested for diagnosis of mumps disease. Of the 31 suspected cases, laboratory results showed 18 positive for mumps IgM antibodies and 7 cases showed presence of mumps virus RNA by RT-PCR using MV specific nested primers. From 31 cases, 5 were positive with both the methods. We confirmed the cases by serological as well as a sensitive RT-nested PCR-based method and sequencing results for the molecular identification of mumps infection. Sequencing results of the SH gene identified outbreak strain as genotype C, which was consistent with other outbreaks in India.
-
Detection of Candida species by nested PCR method in one-humped camels (Camelus dromedarius).
Parin, Ugur; Erbas, Goksel; Kirkan, Sukru; Savasan, Serap; Tugba Yuksel, H; Balat, Gamze
2018-02-01
Systemic fungal diseases are the infections caused by false treatment protocols and generally are not taken into consideration especially in the veterinary field. One-humped camels are found in the western side of the Aegean region of our country and bred for wrestling. The aim of this study is the application of diagnosing systemic fungi infection from camel blood samples by the PCR method. In this study, specific primers for DNA topoisomerase II gene sequences were used. As a result, a systemic fungal infection was detected by the nested PCR method from 10 (20%) out of 50 DNA samples taken from camels located on the western side of the Aegean region. In this study, 3 (30%) samples were identified as Candida albicans, 3 (30%) samples were identified as C. glabrata, and 4 (40%) samples were identified as C. parapsilosis. In conclusion, the 20% positive systemic fungal infection rate in one-humped camels observed in the present study showed that the systemic fungal infections are not taken into considerations in veterinary medicine. Further studies are suggested in order to obtain and to maintain extensive data for systemic fungal diseases in our country for one-humped camels.
-
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
-
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
-
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
-
A new real-time PCR protocol for detection of avian haemosporidians.
Bell, Jeffrey A; Weckstein, Jason D; Fecchio, Alan; Tkach, Vasyl V
2015-07-19
Birds possess the most diverse assemblage of haemosporidian parasites; including three genera, Plasmodium, Haemoproteus, and Leucocytozoon. Currently there are over 200 morphologically identified avian haemosporidian species, although true species richness is unknown due to great genetic diversity and insufficient sampling in highly diverse regions. Studies aimed at surveying haemosporidian diversity involve collecting and screening samples from hundreds to thousands of individuals. Currently, screening relies on microscopy and/or single or nested standard PCR. Although effective, these methods are time and resource consuming, and in the case of microscopy require substantial expertise. Here we report a newly developed real-time PCR protocol designed to quickly and reliably detect all three genera of avian haemosporidians in a single biochemical reaction. Using available DNA sequences from avian haemosporidians we designed primers R330F and R480RL, which flank a 182 base pair fragment of mitochondrial conserved rDNA. These primers were initially tested using real-time PCR on samples from Malawi, Africa, previously screened for avian haemosporidians using traditional nested PCR. Our real time protocol was further tested on 94 samples from the Cerrado biome of Brazil, previously screened using a single PCR assay for haemosporidian parasites. These samples were also amplified using modified nested PCR protocols, allowing for comparisons between the three different screening methods (single PCR, nested PCR, real-time PCR). The real-time PCR protocol successfully identified all three genera of avian haemosporidians from both single and mixed infections previously detected from Malawi. There was no significant difference between the three different screening protocols used for the 94 samples from the Brazilian Cerrado (χ(2) = 0.3429, df = 2, P = 0.842). After proving effective, the real-time protocol was used to screen 2113 Brazilian samples, identifying 693 positive samples. Our real-time PCR assay proved as effective as two widely used molecular screening techniques, single PCR and nested PCR. However, the real-time protocol has the distinct advantage of detecting all three genera in a single reaction, which significantly increases efficiency by greatly decreasing screening time and cost. Our real-time PCR protocol is therefore a valuable tool in the quickly expanding field of avian haemosporidian research.
-
Kornegay, J R; Shepard, A P; Hankins, C; Franco, E; Lapointe, N; Richardson, H; Coutleé, F
2001-10-01
We assessed the value of a new digoxigenin (DIG)-labeled generic probe mix in a PCR-enzyme-linked immunosorbent assay format to screen for the presence of human papillomavirus (HPV) DNA amplified from clinical specimens. After screening with this new generic assay is performed, HPV DNA-positive samples can be directly genotyped using a reverse blotting method with product from the same PCR amplification. DNA from 287 genital specimens was amplified via PCR using biotin-labeled consensus primers directed to the L1 gene. HPV amplicons were captured on a streptavidin-coated microwell plate (MWP) and detected with a DIG-labeled HPV generic probe mix consisting of nested L1 fragments from types 11, 16, 18, and 51. Coamplification and detection of human DNA with biotinylated beta-globin primers served as a control for both sample adequacy and PCR amplification. All specimens were genotyped using a reverse line blot assay (13). Results for the generic assay using MWPs and a DIG-labeled HPV generic probe mix (DIG-MWP generic probe assay) were compared with results from a previous analysis using dot blots with a radiolabeled nested generic probe mix and type-specific probes for genotyping. The DIG-MWP generic probe assay resulted in high intralaboratory concordance in genotyping results (88% versus 73% agreement using traditional methods). There were 207 HPV-positive results using the DIG-MWP method and 196 positives using the radiolabeled generic probe technique, suggesting slightly improved sensitivity. Only one sample failed to test positive with the DIG-MWP generic probe assay in spite of a positive genotyping result. Concordance between the two laboratories was nearly 87%. Approximately 6% of samples that were positive or borderline when tested with the DIG-MWP generic probe assay were not detected with the HPV type-specific panel, perhaps representing very rare or novel HPV types. This new method is easier to perform than traditional generic probe techniques and uses more objective interpretation criteria, making it useful in studies of HPV natural history.
-
Lee, Chang Soo; Lee, Jiyoung
2010-09-01
A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.
-
2010-01-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499
-
Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia
2010-04-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
-
NASA Astrophysics Data System (ADS)
Hubbard, K.; Bruzek, S.
2016-02-01
The globally distributed marine diatom genus Pseudo-nitzschia consists of approximately 40 species, more than half of which occur in US coastal waters. Here, sensitive genetic tools targeting a variable portion of the internal transcribed spacer 1 (ITS1) region of the rRNA gene were used to assess Pseudo-nitzschia spp. diversity in more than 600 environmental DNA samples collected from US Atlantic, Pacific, and Gulf of Mexico waters. Community-based approaches employed genus-specific primers for environmental DNA fingerprinting and targeted sequencing. For the Gulf of Mexico samples especially, a nested PCR approach (with or without degenerate primers) improved resolution of species diversity. To date, more than 40 unique ITS1 amplicon sizes have been repeatedly observed in ITS1 fingerprints. Targeted sequencing of environmental DNA as well as single chains isolated from live samples indicate that many of these represent novel and known inter- and intra-specific Pseudo-nitzschia diversity. A few species (e.g., P. pungens, P. cuspidata) occur across all three regions, whereas other species and intraspecific variants occurred at local to regional spatial scales only. Generally, species frequently co-occur in complex assemblages, and transitions in Pseudo-nitzschia community composition occur seasonally, prior to bloom initiation, and across (cross-shelf, latitudinal, and vertical) environmental gradients. These observations highlight the dynamic nature of diatom community composition in the marine environment and the importance of classifying diversity at relevant ecological and/or taxonomic scales.
-
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
-
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
-
Valadares, Helder Magno Silva; Pimenta, Juliana Ramos; de Freitas, Jorge Marcelo; Duffy, Tomás; Bartholomeu, Daniella C; Oliveira, Riva de Paula; Chiari, Egler; Moreira, Maria da Consolação Vieira; Filho, Geraldo Brasileiro; Schijman, Alejandro Gabriel; Franco, Glória Regina; Machado, Carlos Renato; Pena, Sérgio Danilo Junho; Macedo, Andréa Mara
2008-06-01
The investigation of the importance of the genetics of Trypanosoma cruzi in determining the clinical course of Chagas disease will depend on precise characterisation of the parasites present in the tissue lesions. This can be adequately accomplished by the use of hypervariable nuclear markers such as microsatellites. However the unilocal nature of these loci and the scarcity of parasites in chronic lesions make it necessary to use high sensitivity PCR with nested primers, whose design depends on the availability of long flanking regions, a feature not hitherto available for any known T. cruzi microsatellites. Herein, making use of the extensive T. cruzi genome sequence now available and using the Tandem Repeats Finder software, it was possible to identify and characterise seven new microsatellite loci--six composed of trinucleotide (TcTAC15, TcTAT20, TcAAT8, TcATT14, TcGAG10 and TcCAA10) and one composed of tetranucleotide (TcAAAT6) motifs. All except the TcCAA10 locus were physically mapped onto distinct intergenic regions of chromosome III of the CL Brener clone contigs. The TcCAA10 locus was localised within a hypothetical protein gene in the T. cruzi genome. All microsatellites were polymorphic and useful for T. cruzi genetic variability studies. Using the TcTAC15 locus it was possible to separate the strains belonging to the T. cruzi I lineage (DTU I) from those belonging to T. cruzi II (DTU IIb), T. cruzi III (DTU IIc) and a hybrid group (DTU IId, IIe). The long flanking regions of these novel microsatellites allowed construction of nested primers and the use of full nested PCR protocols. This strategy enabled us to detect and differentiate T. cruzi strains directly in clinical specimens including heart, blood, CSF and skin tissues from patients in the acute and chronic phases of Chagas disease.
-
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
-
NASA Astrophysics Data System (ADS)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
-
McKinney, Nancy
2002-01-01
PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.
-
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
-
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
-
Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.
Jamjoom, Manal; Sultan, Amal H
2009-04-01
The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity. Though, it was less sensitive than kDNA minicircle primers, but easily discriminated between Leishmania species.
-
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
-
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
-
Santos, S A; Bronzato, A R; Moreira, B M T; Araujo, K F; Ronqui, L; Mangolin, C A; Toledo, V A A; Ruvolo-Takasusuki, M C C
2015-10-21
The Meliponinae are important pollinators of plant species, and one of the most managed species is Tetragonisca angustula. Initially, two subspecies were identified in T. angustula: T. angustula angustula and T. angustula fiebrigi. Subsequently, T. a. fiebrigi was considered a species, based on the coloration of its mesepisternum. The objective of the present study was to obtain genetic markers that could differentiate the two species by amplifying regions of mitochondrial DNA and conducting polymerase chain reaction-restriction fragment length polymorphism analysis. Worker bees were collected in three Brazilian states: Paraná (Maringá, Altônia, and Foz do Iguaçu), São Paulo (Dracena, São Carlos, and Santa Cruz do Rio Pardo), and Rondônia (Ariquemes). Ten pairs of insect heterologous primers were tested and four were used (primer pair 1, ND2 and COI; primer pair 2, COI; primer pair 8, 16S and 12S; and primer pair 9, COII). For the restriction analysis, 13 enzymes were tested: EcoRI, EcoRV, HindIII, HinfI, RsaI, PstI, XbaI, HaeIII, ClaI, XhoI, BglII, PvuII, and ScaI. Markers were obtained (primer pair 8 cleaved with EcoRV and XbaI and primer pair 9 cleaved with HaeIII, RsaI, and XbaI) that enabled matrilineage identification in the nests studied, which confirmed that hybridization could occur between both Tetragonisca species. The beginning of speciation was probably recent, and secondary contact has resulted in crosses between T. angustula females and T. fiebrigi males. Because of this hybridization, it would be appropriate to consider them as two subspecies of T. angustula.
-
GSP: A web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...
-
Sulaiman, Irshad M; Torres, Patricia; Simpson, Steven; Kerdahi, Khalil; Ortega, Ynes
2013-04-01
We have described the development of a 2-step nested PCR protocol based on the characterization of the 70-kDa heat shock protein (HSP70) gene for rapid detection of the human-pathogenic Cyclospora cayetanensis parasite. We tested and validated these newly designed primer sets by PCR amplification followed by nucleotide sequencing of PCR-amplified HSP70 fragments belonging to 16 human C. cayetanensis isolates from 3 different endemic regions that include Nepal, Mexico, and Peru. No genetic polymorphism was observed among the isolates at the characterized regions of the HSP70 locus. This newly developed HSP70 gene-based nested PCR protocol provides another useful genetic marker for the rapid detection of C. cayetanensis in the future.
-
D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J
2006-10-01
Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.
-
Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
-
Species-Specific TT Viruses and Cross-Species Infection in Nonhuman Primates
Okamoto, Hiroaki; Fukuda, Masako; Tawara, Akio; Nishizawa, Tsutomu; Itoh, Yukio; Hayasaka, Ikuo; Tsuda, Fumio; Tanaka, Takeshi; Miyakawa, Yuzo; Mayumi, Makoto
2000-01-01
Viruses resembling human TT virus (TTV) were searched for in sera from nonhuman primates by PCR with primers deduced from well-conserved areas in the untranslated region. TTV DNA was detected in 102 (98%) of 104 chimpanzees, 9 (90%) of 10 Japanese macaques, 4 (100%) of 4 red-bellied tamarins, 5 (83%) of 6 cotton-top tamarins, and 5 (100%) of 5 douroucoulis tested. Analysis of the amplification products of 90 to 106 nucleotides revealed TTV DNA sequences specific for each species, with a decreasing similarity to human TTV in the order of chimpanzee, Japanese macaque, and tamarin/douroucouli TTVs. Full-length viral sequences were amplified by PCR with inverted nested primers deduced from the untranslated region of TTV DNA from each species. All animal TTVs were found to be circular with a genomic length at 3.5 to 3.8 kb, which was comparable to or slightly shorter than human TTV. Sequences closely similar to human TTV were determined by PCR with primers deduced from a coding region (N22 region) and were detected in 49 (47%) of the 104 chimpanzees; they were not found in any animals of the other species. Sequence analysis of the N22 region (222 to 225 nucleotides) of chimpanzee TTV DNAs disclosed four genetic groups that differed by 36.1 to 50.2% from one another; they were 35.0 to 52.8% divergent from any of the 16 genotypes of human TTV. Of the 104 chimpanzees, only 1 was viremic with human TTV of genotype 1a. It was among the 53 chimpanzees which had been used in transmission experiments with human hepatitis viruses. Antibody to TTV of genotype 1a was detected significantly more frequently in the chimpanzees that had been used in transmission experiments than in those that had not (8 of 28 [29%] and 3 of 35 [9%], respectively; P = 0.038). These results indicate that species-specific TTVs are prevalent in nonhuman primates and that human TTV can cross-infect chimpanzees. PMID:10627523
-
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
-
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
-
Richardson, D S; Jury, F L; Blaakmeer, K; Komdeur, J; Burke, T
2001-09-01
We describe the development and initial application of a semiautomated parentage testing system in the Seychelles warbler (Acrocephalus sechellensis). This system used fluorescently labelled primers for 14 polymorphic microsatellite loci in two multiplex loading groups to genotype efficiently over 96% of the warbler population on Cousin island. When used in conjunction with the program CERVUS, this system provided sufficient power to assign maternity and paternity within the Seychelles warbler, despite the complications associated with its cooperative breeding system and a relatively low level of genetic variation. Parentage analyses showed that subordinate 'helper' females as well as the dominant 'primary' females laid eggs in communal nests, indicating that the Seychelles warbler has an intermediate level of female reproductive skew, in between the alternative extremes of helper-at-the-nest and joint nesting systems. Forty-four per cent of helpers bred successfully, accounting for 15% of all offspring. Forty per cent of young resulted from extra-group paternity.
-
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
-
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.
-
Molecular Tools for the Detection of Nitrogen Cycling Archaea
Rusch, Antje
2013-01-01
Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509
-
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502
-
Transplacental transmission of Human Papillomavirus
Rombaldi, Renato L; Serafini, Eduardo P; Mandelli, Jovana; Zimmermann, Edineia; Losquiavo, Kamille P
2008-01-01
This paper aimed at studying the transplacental transmission of HPV and looking at the epidemiological factors involved in maternal viral infection. The following sampling methods were used: (1) in the pregnant woman, (a) genital; (b) peripheral blood; (2) in the newborn, (a) oral cavity, axillary and inguinal regions; (b) nasopharyngeal aspirate, and (c) cord blood; (3) in the placenta. The HPV DNA was identified using two methods: multiplex PCR of human β-globin and of HPV using the PGMY09 and PGMY11 primers; and nested-PCR, which combines degenerated primers of the E6/E7 regions of the HPV virus, that allowed the identification of genotypes 6/11, 16, 18, 31, 33, 42, 52 and 58. Transplacental transmission was considered when type-specific HPV concordance was found between the mother, the placenta and the newborn or the mother and cord blood. The study included 49 HPV DNA-positive pregnant women at delivery. Twelve placentas (24.5%, n = 12/49) had a positive result for HPV DNA. Eleven newborn were HPV DNA positive in samples from the nasopharyngeal or buccal and body or cord blood. In 5 cases (10.2%, n = 5/49) there was HPV type-specific agreement between genital/placenta/newborn samples. In one case (2%, n = 1/49) there was type specific HPV concordance between genital/cord blood and also suggested transplacental transmission. A positive and significant correlation was observed between transplacental transmission of HPV infection and the maternal variables of immunodepression history (HIV, p = 0.011). In conclusion the study suggests placental infection in 23.3% of the cases studied and transplacental transmission in 12.2%. It is suggested that in future HPV DNA be researched in the normal endometrium of women of reproductive age. The possible consequence of fetal exposure to HPV should be observed. PMID:18817577
-
Marie, Veronna; Lin, Johnson
2017-10-01
Due to the continued persistence of waterborne viral-associated infections, the presence of enteric viruses is a concern. Notwithstanding the health implications, viral diversity and abundance is an indicator of water quality declination in the environment. The aim of this study was to evaluate the presence of viruses (bacteriophage and enteric viruses) in a highly polluted, anthropogenic-influenced river system over a 6-month period at five sampling points. Cytopathic-based tissue culture assays revealed that the isolated viruses were infectious when tested on Hep-G2, HEK293 and Vero cells. While transmission electron microscopy (TEM) revealed that the majority of the viruses were bacteriophages, a number of presumptive enteric virus families were visualized, some of which include Picornaviridae, Adenoviridae, Polyomaviridae and Reoviridae. Finally, primer specific nested polymerase chain reaction (nested-PCR)/reverse transcription-polymerase chain reaction (RT-PCR) coupled with BLAST analysis identified human adenovirus, polyomavirus and hepatitis A and C virus genomes in river water samples. Taken together, the complexity of both bacteriophage and enteric virus populations in the river has potential health implications. Finally, a systematic integrated risk assessment and management plan to identify and minimize sources of faecal contamination is the most effective way of ensuring water safety and should be established in all future guidelines.
-
Imai, Kazuo; Tarumoto, Norihito; Misawa, Kazuhisa; Runtuwene, Lucky Ronald; Sakai, Jun; Hayashida, Kyoko; Eshita, Yuki; Maeda, Ryuichiro; Tuda, Josef; Murakami, Takashi; Maesaki, Shigefumi; Suzuki, Yutaka; Yamagishi, Junya; Maeda, Takuya
2017-09-13
A simple and accurate molecular diagnostic method for malaria is urgently needed due to the limitations of conventional microscopic examination. In this study, we demonstrate a new diagnostic procedure for human malaria using loop mediated isothermal amplification (LAMP) and the MinION™ nanopore sequencer. We generated specific LAMP primers targeting the 18S-rRNA gene of all five human Plasmodium species including two P. ovale subspecies (P. falciparum, P. vivax, P. ovale wallikeri, P. ovale curtisi, P. knowlesi and P. malariae) and examined human blood samples collected from 63 malaria patients in Indonesia. Additionally, we performed amplicon sequencing of our LAMP products using MinION™ nanopore sequencer to identify each Plasmodium species. Our LAMP method allowed amplification of all targeted 18S-rRNA genes of the reference plasmids with detection limits of 10-100 copies per reaction. Among the 63 clinical samples, 54 and 55 samples were positive by nested PCR and our LAMP method, respectively. Identification of the Plasmodium species by LAMP amplicon sequencing analysis using the MinION™ was consistent with the reference plasmid sequences and the results of nested PCR. Our diagnostic method combined with LAMP and MinION™ could become a simple and accurate tool for the identification of human Plasmodium species, even in resource-limited situations.
-
Herpesviruses in Abscesses and Cellulitis of Endodontic Origin
Chen, Vicky; Chen, Yanwen; Li, Hong; Kent, Karla; Baumgartner, J. Craig; Machida, Curtis A.
2009-01-01
Acute apical abscesses and cellulitis are severe endodontic diseases caused by opportunistic bacteria with possible co-infection with latent herpesviruses. The objectives of this study are to identify herpesviruses, including human cytomegalovirus (HCMV), Epstein-Barr virus (EBV), herpes simplex virus-1 (HSV-1) and Varicella zoster virus (VZV), in patients (n=31) presenting with acute apical abscesses and cellulitis of endodontic origin. Primary and nested polymerase chain reaction (PCR) was conducted using virus-specific primers and DNA isolated from cell-free abscess fluid. From patients exhibiting concurrent spontaneous pain (n=28), nine abscesses contained HCMV, two abscesses contained EBV, one abscess contained HSV-1, and no abscesses contained VZV. Control PCR using genomic or recombinant templates demonstrated detection limits to a single genomic copy of HCMV, 100 genomic copies for EBV, and 1-10 copies for HSV-1, with no cross-amplification between herpesviral DNA targets. Nested PCR was required for detection of herpesviral DNA in the abscess specimens, indicating that these viruses were present in low copy number. Filtration of abscess specimens and virus transfer experiments using human fibroblastic MRC-5 cells confirmed the presence of HCMV particles in several abscess specimens. We conclude that herpesviruses are present, but not required for development of acute apical abscesses and cellulitis of endodontic origin. PMID:19166769
-
Robène-Soustrade, Isabelle; Laurent, Philippe; Gagnevin, Lionel; Jouen, Emmanuel; Pruvost, Olivier
2006-02-01
Efficient control of Xanthomonas axonopodis pv. dieffenbachiae, the causal agent of anthurium bacterial blight, requires a sensitive and reliable diagnostic tool. A nested PCR test was developed from a sequence-characterized amplified region marker identified by randomly amplified polymorphic DNA PCR for the detection of X. axonopodis pv. dieffenbachiae. Serological and pathogenicity tests were performed concurrently with the nested PCR test with a large collection of X. axonopodis pv. dieffenbachiae strains that were isolated worldwide and are pathogenic to anthurium and/or other aroids. The internal primer pair directed amplification of the expected product (785 bp) for all 70 X. axonopodis pv. dieffenbachiae strains pathogenic to anthurium tested and for isolates originating from syngonium and not pathogenic to anthurium. This finding is consistent with previous studies which indicated that there is a high level of relatedness between strains from anthurium and strains from syngonium. Strains originating from the two host genera can be distinguished by restriction analysis of the amplification product. No amplification product was obtained with 98 strains of unrelated phytopathogenic bacteria or saprophytic bacteria from the anthurium phyllosphere, except for a weak signal obtained for one X. axonopodis pv. allii strain. Nevertheless, restriction enzyme analysis permitted the two pathovars to be distinguished. The detection threshold obtained with pure cultures or plant extracts (10(3) CFU ml(-1)) allowed detection of the pathogen from symptomless contaminated plants. This test could be a useful diagnostic tool for screening propagation stock plant material and for monitoring international movement of X. axonopodis pv. dieffenbachiae.
-
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
-
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
-
Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using
Weier, H.U.G.; Gray, J.W.
1995-06-27
A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.
-
Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using
Weier, Heinz-Ulrich G.; Gray, Joe W.
1995-01-01
A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.
-
Development and evaluation of a nested-PCR assay for Senecavirus A diagnosis.
Feronato, Cesar; Leme, Raquel A; Diniz, Jaqueline A; Agnol, Alais Maria Dall; Alfieri, Alice F; Alfieri, Amauri A
2018-02-01
Senecavirus A (SVA) has been associated with vesicular disease in weaned and adult pigs and with high mortality of newborn piglets. This study aimed to establish a nested-PCR assay for the routine diagnosis of SVA infection. Tissue samples (n = 177) were collected from 37 piglets of 18 pig farms located in four different Brazilian states. For the nested-PCR, a primer set was defined to amplify an internal VP1 fragment of 316 bp of SVA genome. Of the 37 piglets, 15 (40.5%) and 23 (62.2%) were positive for the SVA in the RT-PCR and nested-PCR assays, respectively. The SVA RNA was detected in 61/177 (34.5%) samples with the RT-PCR, while the nested-PCR assay showed 84/177 (47.5%) samples with the virus (p < 0.05). According to the herds, 11 (61.1%) and 16 (88.9%) of the 18 pig herds were positive for the SVA in the RT-PCR and nested-PCR assays, respectively. Nucleotide sequencing analysis revealed similarities of 98.7-100% among SVA Brazilian strains and of 86.6-98% with SVA strains from other countries. The nested-PCR assay in this study was suitable to recover the SVA RNA in biological specimens, piglets, and/or herds that were considered as negative in the RT-PCR assay, and is proposed for the routine investigation of the SVA infection in piglets, especially when other techniques are not available or when a great number of samples has to be examined.
-
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
-
Real-time PCR and its application to mumps rapid diagnosis.
Jin, L; Feng, Y; Parry, R; Cui, A; Lu, Y
2007-11-01
A real-time polymerase chain reaction assay was initially developed in China to detect mumps genome. The primers and TaqMan-MGB probe were selected from regions of the hemagglutinin gene of mumps virus. The primers and probe for the real-time PCR were evaluated by both laboratories in China and in the UK using three different pieces of equipment, LightCycler (Roche), MJ DNA Engine Option 2 (BIO-RAD) and TaqMan (ABI Prism) on different samples. The reaction was performed with either a one-step (China) or two-step (UK) process. The sensitivity (10 copies) was estimated using a serial dilution of constructed mumps-plasmid DNA and a linear standard curve was obtained between 10 and 10(7) DNA copies/reaction, which can be used to quantify viral loads. The detection limit on cell culture-grown virus was approximately 2 pfu/ml with a two-step assay on TaqMan, which was equivalent to the sensitivity of the nested PCR routinely used in the UK. The specificity was proved by testing a range of respiratory viruses and several genotypes of mumps strains. The concentration of primers and probe is 22 pmol and 6.25 or 7 pmol respectively for a 25 microl reaction. The assay took 3 hr from viral RNA extraction to complete the detection using any of the three pieces of equipment. Three hundred forty-one (35 in China and 306 in the UK) clinical specimens were tested, the results showing that this real-time PCR assay is suitable for rapid and accurate detection of mumps virus RNA in various types of clinical specimens. (c) 2007 Wiley-Liss, Inc.
-
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
-
Real-time fluorescence loop mediated isothermal amplification for the diagnosis of malaria.
Lucchi, Naomi W; Demas, Allison; Narayanan, Jothikumar; Sumari, Deborah; Kabanywanyi, Abdunoor; Kachur, S Patrick; Barnwell, John W; Udhayakumar, Venkatachalam
2010-10-29
Molecular diagnostic methods can complement existing tools to improve the diagnosis of malaria. However, they require good laboratory infrastructure thereby restricting their use to reference laboratories and research studies. Therefore, adopting molecular tools for routine use in malaria endemic countries will require simpler molecular platforms. The recently developed loop-mediated isothermal amplification (LAMP) method is relatively simple and can be improved for better use in endemic countries. In this study, we attempted to improve this method for malaria diagnosis by using a simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in one platform. We refer to this as the RealAmp method. Published genus-specific primers were used to test the utility of this method. DNA derived from different species of malaria parasites was used for the initial characterization. Clinical samples of P. falciparum were used to determine the sensitivity and specificity of this system compared to microscopy and a nested PCR method. Additionally, directly boiled parasite preparations were compared with a conventional DNA isolation method. The RealAmp method was found to be simple and allowed real-time detection of DNA amplification. The time to amplification varied but was generally less than 60 minutes. All human-infecting Plasmodium species were detected. The sensitivity and specificity of RealAmp in detecting P. falciparum was 96.7% and 91.7% respectively, compared to microscopy and 98.9% and 100% respectively, compared to a standard nested PCR method. In addition, this method consistently detected P. falciparum from directly boiled blood samples. This RealAmp method has great potential as a field usable molecular tool for diagnosis of malaria. This tool can provide an alternative to conventional PCR based diagnostic methods for field use in clinical and operational programs.
-
[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].
Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu
2005-07-01
To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.
-
Sato, Naoki; Seo, Genichiro; Benno, Yoshimi
2014-01-01
Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.
-
Molecular method for determining sex of walruses
Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.
2008-01-01
We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.
-
Hoy, M.S.; Kelly, K.; Rodriguez, R.J.
2010-01-01
A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.
-
Diagnosis of Helicobacter pylori: What should be the gold standard?
Patel, Saurabh Kumar; Pratap, Chandra Bhan; Jain, Ashok Kumar; Gulati, Anil Kumar; Nath, Gopal
2014-01-01
Since the discovery of Helicobacter pylori (H. pylori) in 1983, numerous detection methods for the presence of the bacterium have been developed. Each one of them has been associated with advantages and disadvantages. Noninvasive tests such as serology, 13C urea breath test (UBT) and stool antigen tests are usually preferred by the clinicians. Serology has its own limitation especially in endemic areas while 13C UBT is technically very demanding. The stool antigen detection method, although specific, is usually associated with poor sensitivity. The 13C UBT is believed to be specific, but with present revelation of the fact that stomach is colonized by many other urease producing bacteria makes it questionable. Histology, culture, rapid urease test and polymerase chain reaction (PCR) are the tests which are carried out on antral biopsies collected by invasive means. Histology has been proposed to be very sensitive and specific but the question is how by simply looking the morphology of the bacteria in the microscope, one can claim that the curved bacterium is exclusively H. pylori. Rapid urease test (RUT), the doctor’s test, is also challenged because the presence of other urease producing bacteria in the stomach cannot be denied. Moreover, RUT has been reported with poor sensitivity specially, when density of the bacterium is low. Isolation of H. pylori is essential to investigate its growth requirements, antibiotic susceptibility testing, studying virulence factor to develop vaccine and many more explorations. It has also got several disadvantages i.e., special condition for transporting, media, incubation and few days waiting for the colonies to appear, apart from the speed essentially needed to process the specimens. Till date, majority of the microbiological laboratories in the world are not equipped and trained to isolate such fastidious bacterium. The option left is PCR methods to detect H. pylori’s DNA in gastric mucosa, gastric juice, saliva, dental plaques and environmental specimens. There are speculations for false positivity due to detection of non-pylori Helicobacters due to genetic sharing; and false negativity due to low bacterial counts and presence of PCR inhibitors. However, specimen collection, transportation and processing do not require speed and special conditions. PCR based diagnosis may be considered as gold standard by designing primers extremely specific to H. pylori and targeting at least more than one conserved genes. Similarly specificity of PCR may be improved by use of internal Primers. Further, nested PCR will take care of false negatives by countering the effect of PCR inhibitors and low bacterial counts. Therefore, nested PCR based methods if performed properly, may be proposed as gold standard test. PMID:25278682
-
WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations
Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades
2007-01-01
Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334
-
Impact of Soil Texture on Soil Ciliate Communities
NASA Astrophysics Data System (ADS)
Chau, J. F.; Brown, S.; Habtom, E.; Brinson, F.; Epps, M.; Scott, R.
2014-12-01
Soil water content and connectivity strongly influence microbial activities in soil, controlling access to nutrients and electron acceptors, and mediating interactions between microbes within and between trophic levels. These interactions occur at or below the pore scale, and are influenced by soil texture and structure, which determine the microscale architecture of soil pores. Soil protozoa are relatively understudied, especially given the strong control they exert on bacterial communities through predation. Here, ciliate communities in soils of contrasting textures were investigated. Two ciliate-specific primer sets targeting the 18S rRNA gene were used to amplify DNA extracted from eight soil samples collected from Sumter National Forest in western South Carolina. Primer sets 121F-384F-1147R (semi-nested) and 315F-959R were used to amplify soil ciliate DNA via polymerase chain reaction (PCR), and the resulting PCR products were analyzed by gel electrophoresis to obtain quantity and band size. Approximately two hundred ciliate 18S rRNA sequences were obtained were obtained from each of two contrasting soils. Sequences were aligned against the NCBI GenBank database for identification, and the taxonomic classification of best-matched sequences was determined. The ultimate goal of the work is to quantify changes in the ciliate community under short-timescale changes in hydrologic conditions for varying soil textures, elucidating dynamic responses to desiccation stress in major soil ciliate taxa.
-
Fava, Natália M. N.; Soares, Rodrigo M.; Scalia, Luana A. M.; Kalapothakis, Evanguedes; Pena, Isabella F.; Vieira, Carlos U.; Faria, Elaine S. M.; Cunha, Maria J.; Couto, Talles R.; Cury, Márcia Cristina
2013-01-01
Giardia duodenalis is a small intestinal protozoan parasite of several terrestrial vertebrates. This work aims to assess the genotypic variability of Giardia duodenalis isolates from cattle, sheep and pigs in the Southeast of Brazil, by comparing the standard characterization between glutamate dehydrogenase (gdh) and triose phosphate isomerase (tpi) primers. Fecal samples from the three groups of animals were analyzed using the zinc sulphate centrifugal flotation technique. Out of 59 positive samples, 30 were from cattle, 26 from sheep and 3 from pigs. Cyst pellets were stored and submitted to PCR and nested-PCR reactions with gdh and tpi primers. Fragment amplification of gdh and tpi genes was observed in 25 (42.4%) and 36 (61.0%) samples, respectively. Regarding the sequencing, 24 sequences were obtained with gdh and 20 with tpi. For both genes, there was a prevalence of E specific species assemblage, although some isolates have been identified as A and B, by the tpi sequencing. This has also shown a larger number of heterogeneous sequences, which have been attribute to mixed infections between assemblages B and E. The largest variability of inter-assemblage associated to the frequency of heterogeneity provided by tpi sequencing reinforces the polymorphic nature of this gene and makes it an excellent target for studies on molecular epidemiology. PMID:24308010
-
Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola
2017-10-01
ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
-
Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii
Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon
2005-01-01
Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482
-
TipMT: Identification of PCR-based taxon-specific markers.
Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C
2017-02-11
Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .
-
Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.
Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo
2017-05-28
Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.
-
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
-
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
-
Gonzales, J L; Loza, A; Chacon, E
2006-03-15
There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.
-
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
-
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
-
PCR detection of Burkholderia multivorans in water and soil samples.
Peeters, Charlotte; Daenekindt, Stijn; Vandamme, Peter
2016-08-12
Although semi-selective growth media have been developed for the isolation of Burkholderia cepacia complex bacteria from the environment, thus far Burkholderia multivorans has rarely been isolated from such samples. Because environmental B. multivorans isolates mainly originate from water samples, we hypothesized that water rather than soil is its most likely environmental niche. The aim of the present study was to assess the occurrence of B. multivorans in water samples from Flanders (Belgium) using a fast, culture-independent PCR assay. A nested PCR approach was used to achieve high sensitivity, and specificity was confirmed by sequencing the resulting amplicons. B. multivorans was detected in 11 % of the water samples (n = 112) and 92 % of the soil samples (n = 25) tested. The percentage of false positives was higher for water samples compared to soil samples, showing that the presently available B. multivorans recA primers lack specificity when applied to the analysis of water samples. The results of the present study demonstrate that B. multivorans DNA is commonly present in soil samples and to a lesser extent in water samples in Flanders (Belgium).
-
Estimating stage-specific daily survival probabilities of nests when nest age is unknown
Stanley, T.R.
2004-01-01
Estimation of daily survival probabilities of nests is common in studies of avian populations. Since the introduction of Mayfield's (1961, 1975) estimator, numerous models have been developed to relax Mayfield's assumptions and account for biologically important sources of variation. Stanley (2000) presented a model for estimating stage-specific (e.g. incubation stage, nestling stage) daily survival probabilities of nests that conditions on “nest type” and requires that nests be aged when they are found. Because aging nests typically requires handling the eggs, there may be situations where nests can not or should not be aged and the Stanley (2000) model will be inapplicable. Here, I present a model for estimating stage-specific daily survival probabilities that conditions on nest stage for active nests, thereby obviating the need to age nests when they are found. Specifically, I derive the maximum likelihood function for the model, evaluate the model's performance using Monte Carlo simulations, and provide software for estimating parameters (along with an example). For sample sizes as low as 50 nests, bias was small and confidence interval coverage was close to the nominal rate, especially when a reduced-parameter model was used for estimation.
-
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
Kapperud, G; Vardund, T; Skjerve, E; Hornes, E; Michaelsen, T E
1993-01-01
A two-step polymerase chain reaction (PCR) procedure with two nested pairs of primers specific for the yadA gene of Yersinia enterocolitica was developed. The PCR assay identified all common pathogenic serogroups (O:3, O:5,27, O:8, O:9, O:13, and O:21) from three continents and differentiated pathogenic Y. enterocolitica from Y. pseudotuberculosis and from a variety of nonpathogenic yersiniae representing 25 serogroups and four species. The performance of the method was evaluated with seeded food and water samples. We compared two procedures for sample preparation prior to PCR: one was based on immunomagnetic separation of the target bacteria from the sample, using magnetic particles coated with immunoglobulin antibodies to Y. enterocolitica serogroup O:3, and the other method consisted of a series of centrifugation steps combined with proteinase treatment. Regardless of the method used, the PCR assay was capable of detecting 10 to 30 CFU/g of meat in 10(6)-fold excess of indigenous bacteria. When the samples were enriched overnight in a nonselective medium, the sensitivity was increased to approximately 2 CFU/g, except for samples with an extremely high background flora (> 10(7) CFU/g). We compared gel electrophoretic detection of PCR products with a colorimetric detection method designated DIANA (detection of immobilized amplified nucleic acids), which enabled easy visualization of amplified fragments in a microtiter plate format with an optical density reader. DIANA and gel electrophoresis showed complete concordance in their discrimination between positive and negative samples. The combination of immunomagnetic separation, nested PCR, and DIANA makes possible the development of a fully automated analytic process which requires a minimum of laboratory manipulations. Images PMID:8215366
-
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
-
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
-
Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N
2008-01-01
Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory compliance.
-
Rachman, C N; Kabadjova, P; Prévost, H; Dousset, X
2003-01-01
The restriction fragment length polymorphism (RFLP) method was used to differentiate Lactobacillus species having closely related identities in the 16S-23S rDNA intergenic spacer region (ISR). Species-specific primers for Lact. farciminis and Lact. alimentarius were designed and allowed rapid identification of these species. The 16S-23S rDNA spacer region was amplified by primers tAla and 23S/p10, then digested by HinfI and TaqI enzymes and analysed by electrophoresis. Digestion by HinfI was not sufficient to differentiate Lact. sakei, Lact. curvatus, Lact. farciminis, Lact. alimentarius, Lact. plantarum and Lact. paraplantarum. In contrast, digestion carried out by TaqI revealed five different patterns allowing these species to be distinguished, except for Lact. plantarum from Lact. paraplantarum. The 16S-23S rDNA spacer region of Lact. farciminis and Lact. alimentarius were amplified and then cloned into vector pCR(R)2.1 and sequenced. The DNA sequences obtained were analysed and species-specific primers were designed from these sequences. The specificity of these primers was positively demonstrated as no response was obtained for 14 other species tested. The species-specific primers for Lact. farciminis and Lact. alimentarius were shown to be useful for identifying these species among other lactobacilli. The RFLP profile obtained upon digestion with HinfI and TaqI enzymes can be used to discriminate Lact. farciminis, Lact. alimentarius, Lact. sakei, Lact. curvatus and Lact. plantarum. In this paper, we have established the first species-specific primer for PCR identification of Lact. farciminis and Lact. alimentarius. Both species-specific primer and RFLP, could be used as tools for rapid identification of lactobacilli up to species level.
-
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms
David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart
2017-01-01
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161
-
Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S
2014-10-01
While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.
-
Detection of Fusarium oxysporum f.sp. basilici in substrates and roots by PCR.
Pugliese, M; Ferrocino, I; Gullino, M L; Garibaldi, A
2013-01-01
Fusarium oxysporum is a soil-borne fungus that causes vascular wilts in a wide variety of plant species. Basil is recognized as an ecological niche for Fusarium oxysporum f.sp. basilici (FOB) and this fungus is now present in most countries where basil is cultivated. The rapid identification of the species affecting basil plants is necessary to define a successful method for crop protection. The aim of this study was to develop a PCR method for the rapid detection of Fusarium oxysporum f. sp. basilici in substrates. The specificity of the primers used was tested using the DNA extracted directly from substrate samples. Fusarium oxysporum f.sp. basilici was artificially inoculated with decreasing amounts in a commercial substrate (sphagnum peat moss) and in a mixture with 40% of municipal compost, after steam disinfestation. Basil seeds (cv. Fine verde) were sown in pots that were laid on a bench in the greenhouse. At time 0 and after 7, 14 and 21 days from the inoculation, substrate and root samples were collected and prepared for microbial analysis and for the DNA extraction. DNA extraction was carried out using NucleoSpin Soil Kit (Macherey-Nagel, Germany). PCR amplification for the specific detection was carried out using primer sets Bik 1 (5'-ATT CAA GAG CTA AAG GTC C-3') and Bik 4 (5'-TTT GAC CAA GAT AGA TGC C-3') for the first PCR, while primers Bik 1 + Bik 2 (5'-AAA GGT AGT ATA TCG GAG G-3') for the nested PCR to increase detection sensitivity. Disease incidence was also assessed 21 days after seeding. The results showed the presence of amplified fragments of the expected size when the concentration of F. oxysporum f.sp. basilici was at least 3.5 Log CFU g(-1) by using DNA extract directly from substrate, before roots were infected by the pathogen. The detection of Fusarium oxysporum f. sp. basilici by PCR method developed in this study is certainly simple and fast and can be useful for its reliable detection in substrate samples, but not to guarantee that the substrate is totally free of pathogens.
-
S-genotype identification based on allele-specific PCR in Japanese pear
Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya
2015-01-01
Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617
-
Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank
2015-01-01
Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976
-
A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.
van der Linde, Sietse; Alexander, Ian; Anderson, Ian C
2008-09-01
To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.
-
An innovative SNP genotyping method adapting to multiple platforms and throughputs.
Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L
2017-03-01
An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.
-
Sakamoto, Yuma; Masaki, Ayako; Aoyama, Satsuki; Han, Shusen; Saida, Kosuke; Fujii, Kana; Takino, Hisashi; Murase, Takayuki; Iida, Shinsuke; Inagaki, Hiroshi
2017-09-01
The BIOMED-2 PCR protocol for targeting the IGH gene is widely employed for detecting clonality in B-cell malignancies. Unfortunately, the detection of clonality with this method is not very sensitive when paraffin sections are used as a DNA source. To increase the sensitivity, we devised a semi-nested modification of a JH consensus primer. The clonality detection rates of three assays were compared: the standard BIOMED-2, BIOMED-2 assay followed by BIOMED-2 re-amplification, and BIOMED-2 assay followed by semi-nested BIOMED-2. We tested more than 100 cases using paraffin-embedded tissues of various B-cell lymphomas, and found that the clonality detection rates with the above three assays were 63.9%, 79.6%, and 88.0%, respectively. While BIOMED-2 re-amplification was significantly more sensitive than the standard BIOMED-2, the semi-nested BIOMED-2 was significantly more sensitive than both the standard BIOMED-2 and BIOMED-2 re-amplification. An increase in sensitivity was observed in all lymphoma subtypes examined. In conclusion, tumor clonality may be detected in nearly 90% of B-cell lymphoma cases with semi-nested BIOMED-2. This ancillary assay may be useful when the standard BIOMED-2 fails to detect clonality in histopathologically suspected B-cell lymphomas. © 2017 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
-
Chen, Huaihai; Yu, Fangbo; Shi, Wei
2016-12-01
Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
-
Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L
1997-05-02
Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.
-
Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka
2007-01-01
Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.
-
Combination Antiangiogenic and Immunomodulatory Gene Therapy for Breast Cancer
2002-06-01
Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a positive control. The samples were run on a...cultured cells and specific primers for Flk-1 and endoglin cDNA. Specific primers for G3PDH housekeeping gene were included in each reaction as a...positive control. Arrows indicate the 500 bp, 410 bp and 109 bp amplified products of Flk-1, endoglin and G3PDH , respectively. Fig 3. Viral replication
-
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.
-
Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg
2002-12-01
The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.
-
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
-
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
-
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.
David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart
2017-01-04
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Nest morphology and body size of Ross' Geese and Lesser Snow Geese
McCracken, K.G.; Afton, A.D.; Alisauskas, R.T.
1997-01-01
Arctic-nesting geese build large, insulated nests to protect developing embryos from cold ambient temperatures. Ross' Geese (Chen rossii) are about two-thirds the mass of Lesser Snow Geese (C. caerulescens caerulescens), have higher mass-specific metabolic rate, and maintain lower nest attentiveness, yet they hatch goslings with more functionally mature gizzards and more protein for their size than do Lesser Snow Geese. We compared nest size (a reflection of nest insulation) in four distinct habitats in a mixed breeding colony of Ross' Geese and Lesser Snow Geese at Karrak Lake, Northwest Territories, Canada. After adjusting measurements for nest-specific egg size and clutch size, we found that overall nest morphology differed between species and among habitats. Nest size increased progressively among heath, rock, mixed, and moss habitats. When nesting materials were not limiting, nests were smaller in habitats that provided cover from wind and precipitation than in habitats that did not provide cover. Ross' Geese constructed relatively larger, more insulated nests than did Lesser Snow Geese, which may hasten embryonic development, minimize energy expenditure during incubation, and minimize embryonic cooling during recesses. We suggest that relative differences in nest morphology reflect greater selection for Ross' Geese to improve nest insulation because of their smaller size (adults and embryos), higher mass-specific metabolic rate, and lower incubation constancy.
-
Antigenic typing of canine parvovirus using differential PCR.
Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S
2014-12-01
Canine parvovirus (CPV) is an enteric pathogen causing hemorrhagic enteritis in pups of 3-6 months of age and is mainly transmitted via feco-oral route. In the present study, a total of 85 animals rectal swabs suspected of CPV were tested using a PCR, nested PCR and a newly designed differential PCR. Using PCR 7 (8.23 %) animals were positive whereas 39 (45.88 %) were positive by using nested PCR and 40 (47.05 %) were positive for either one or more than one antigenic types of CPV using differential PCR. Using differential PCR it was found that CPV-2a and CPV-2b were the most prevailing antigenic types. Also it was found that dogs that were vaccinated too yielded positive CPV indicating a possible presence of additional CPV antigenic types. Thus, the primers used in differential PCR can be used in a single PCR reaction to detect various antigenic types of CPV.
-
NASA Astrophysics Data System (ADS)
Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih
2017-04-01
Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.
-
NASA Astrophysics Data System (ADS)
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
-
Sun, Junying; Bingga, Gali; Liu, Zhicheng; Zhang, Chunhong; Shen, Haiyan; Guo, Pengju; Zhang, Jianfeng
2018-06-01
Differentiation of classical strains and highly pathogenic strains of porcine reproductive and respiratory syndrome virus is crucial for effective vaccination programs and epidemiological studies. We used nested PCR and high resolution melting curve analysis with unlabeled probe to distinguish between the classical and the highly pathogenic strains of this virus. Two sets of primers and a 20 bp unlabeled probe were designed from the NSP3 gene. The unlabeled probe included two mutations specific for the classical and highly pathogenic strains of the virus. An additional primer set from the NSP2 gene of the highly pathogenic vaccine strain JXA1-R was used to detect its exclusive single nucleotide polymorphism. We tested 107 clinical samples, 21 clinical samples were positive for PRRSV (consistent with conventional PCR assay), among them four were positive for the classical strain with the remainder 17 for the highly pathogenic strain. Around 10 °C difference between probe melting temperatures showed the high discriminatory power of this method. Among highly pathogenic positive samples, three samples were determined as positive for JXA1-R vaccine-related strain with a 95% genotype confidence percentage. All these genotyping results using the high resolution melting curve assay were confirmed with DNA sequencing. This unlabeled probe method provides an alternative means to differentiate the classical strains from the highly pathogenic porcine reproductive and respiratory syndrome virus strains rapidly and accurately. Copyright © 2018. Published by Elsevier Ltd.
-
Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J
2017-08-01
Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.
-
Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A
2004-09-01
Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.
-
Liu, Yun-Xi; Zhao, Zhong-Tang; Cao, Wu-Chun; Xu, Xiao-Qun; Suo, Ji-Jiang; Xing, Yu-Bin; Jia, Ning; Du, Ming-Mei; Liu, Bo-Wei; Yao, Yuan
2013-01-01
The aim of the present study was to evaluate the clinical usefulness of applying RT-nested PCR along with RFLP as a method for diagnosis and genotypic differentiation of Hantavirus in the acute-stage sera of HFRS patients as compared to the ELISA technique. A prospective study of patients with suspected HFRS patients was carried out. Sera were collected for serological evaluation by ELISA and RT-nested PCR testing. Primers were selected from the published sequence of the S segment of HTNV strain 76-118 and SEOV strain SR-11, which made it possible to obtain an amplicon of 403 bp by RT-nested PCR. The genotypic differentiations of the RT-nested PCR amplicons were carried out by RFLP. Sequence analyses of the amplicons were used to confirm the accuracy of the results obtained by RFLP. Of the 48 acute-stage sera from suspected HFRS patients, 35 were ELISA-positive while 41 were positive by RT-nested PCR. With Hind III and Hinf I, RFLP profiles of the RT-nested PCR amplicons of the 41 positive sera exhibited two patterns. 33 had RFLP profiles similar to the reference strain R22, and thus belonged to the SEOV type. The other 8 samples which were collected during October-December had RFLP profiles similar to the reference strain 76-118, and thus belonged to the HTNV type. Sequence phylogenetic analysis of RT-nested PCR amplicons revealed sdp1, sdp2 YXL-2008, and sdp3 as close relatives of HTNV strain 76-118, while sdp22 and sdp37 as close relatives of SEOV strain Z37 and strain R22 located in two separate clusters in the phylogenetic tree. These results were identical to those acquired by RFLP. RT-nested PCR integrated with RFLP was a rapid, simple, accurate method for detecting and differentiating the genotypes of Hantavirus in the acute-stage sera of suspected HFRS patients. In Shandong province, the main genotypes of Hantavirus belonged to the SEOV types, while the HTNV types were observed during the autumn-winter season.
-
Sugita, Takashi; Tajima, Mami; Takashima, Masako; Amaya, Misato; Saito, Masuyoshi; Tsuboi, Ryoji; Nishikawa, Akemi
2004-01-01
Over the last few years, new Malassezia species have been found regularly in Japanese subjects. We isolated another new Malassezia species from a Japanese patient with seborrheic dermatitis (SD), and named it M. yamatoensis. In its physiological characteristics and the utilization of Tween by M. yamatoensis is similar to that of M. furfur and M. dermatis. It is distinguished by its growth temperature. To examine the distribution of the microorganism in the skin of patients with SD and atopic dermatitis (AD), and healthy subjects, we applied transparent dressings to the skin, and detected M. yamatoensis DNA using a non-culture-based method that consisted of nested PCR with specific primers. M. yamatoensis DNA was detected from 3 of 31 SD patients (9.7%), 5 of 36 AD patients (13.9%), and 1 of 22 healthy subjects (4.6%). Therefore, M. yamatoensis is a rare member of the cutaneous microflora.
-
Alternative splicing of the tyrosinase gene transcript in normal human melanocytes and lymphocytes.
Fryer, J P; Oetting, W S; Brott, M J; King, R A
2001-11-01
We have identified and isolated ectopically expressed tyrosinase transcripts in normal human melanocytes and lymphocytes and in a human melanoma (MNT-1) cell line to establish a baseline for the expression pattern of this gene in normal tissue. Tyrosinase mRNA from human lymphoblastoid cell lines was reverse transcribed and amplified using specific "nested" primers. This amplification yielded eight identifiable transcripts; five that resulted from alternative splicing patterns arising from the utilization of normal and alternative splice sequences. Identical splicing patterns were found in transcripts from human primary melanocytes in culture and a melanoma cell line, indicating that lymphoblastoid cell lines provide an accurate reflection of transcript processing in melanocytes. Similar splicing patterns have also been found with murine melanocyte tyrosinase transcripts. Our results demonstrate that alternative splicing of human tyrosinase gene transcript produces a number of predictable and identifiable transcripts, and that human lymphoblastoid cell lines provide a source of ectopically expressed transcripts that can be used to study the biology of tyrosinase gene expression in humans.
-
First isolation and molecular characterization of Ehrlichia canis in Costa Rica, Central America.
Romero, L E; Meneses, A I; Salazar, L; Jiménez, M; Romero, J J; Aguiar, D M; Labruna, M B; Dolz, G
2011-08-01
The present study investigated Ehrlichia species in blood samples from dogs suspected of clinical ehrlichiosis, using molecular and isolation techniques in cell culture. From a total of 310 canine blood samples analyzed by 16S rRNA nested PCR, 148 (47.7%) were positive for Ehrlichia canis. DNA from Ehrlichia chaffeensis or Ehrlichia ewingii was not detected in any sample using species-specific primers in separated reactions. Leukocytes from five PCR-positive dogs were inoculated into DH82 cells; successful isolation of E. canis was obtained in four samples. Partial sequence of the dsb gene of eight canine blood samples (including the five samples for in vitro isolation) was obtained by PCR and their analyses through BLAST showed 100% of identity with the corresponding sequence of E. canis in GenBank. This study represents the first molecular diagnosis, isolation, and molecular characterization of E. canis in dogs from Costa Rica. Copyright © 2010 Elsevier Ltd. All rights reserved.
-
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
-
Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde
2014-11-01
To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
-
Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio
2008-10-15
Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.
-
SCAR marker specific to detect Magnaporthe grisea infecting finger millets (Eleusine coracana).
Gnanasing Jesumaharaja, L; Manikandan, R; Raguchander, T
2016-09-01
To determine the molecular variability and develop specific Sequence Characterized Amplified Region (SCAR) marker for the detection of Magnaporthe grisea causing blast disease in finger millet. Random amplified polymorphic DNA (RAPD) was performed with 14 isolates of M. grisea using 20 random primers. SCAR marker was developed for accurate and specific detection of M. grisea infecting only finger millets. The genetic similarity coefficient within each group and variation between the groups was observed. Among the primers, OPF-08 generated a RAPD polymorphic profile that showed common fragment of 478 bp in all the isolates. This fragment was cloned and sequenced. SCAR primers, Mg-SCAR-FP and Mg-SCAR-RP, were designed using sequence of the cloned product. The specificity of the SCAR primers was evaluated using purified DNA from M. grisea isolates from finger millets and other pathogens viz., Pyricularia oryzae, Colletotrichum gloeosporioides, Colletotrichum falcatum and Colletotrichum capcisi infecting different crops. The SCAR primers amplified only specific 460 bp fragment from DNA of M. grisea isolates and this fragment was not amplified in other pathogens tested. SCAR primers distinguish blast disease of finger millet from rice as there is no amplification in the rice blast pathogen. PCR-based SCAR marker is a convenient tool for specific and rapid detection of M. grisea in finger millets. Genetic diversity in fungal population helps in developing a suitable SCAR marker to identify the blast pathogen at the early stage of infection. © 2016 The Society for Applied Microbiology.
-
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
-
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
-
Jasalavich, Claudia A.; Ostrofsky, Andrea; Jellison, Jody
2000-01-01
We have developed a DNA-based assay to reliably detect brown rot and white rot fungi in wood at different stages of decay. DNA, isolated by a series of CTAB (cetyltrimethylammonium bromide) and organic extractions, was amplified by the PCR using published universal primers and basidiomycete-specific primers derived from ribosomal DNA sequences. We surveyed 14 species of wood-decaying basidiomycetes (brown-rot and white-rot fungi), as well as 25 species of wood-inhabiting ascomycetes (pathogens, endophytes, and saprophytes). DNA was isolated from pure cultures of these fungi and also from spruce wood blocks colonized by individual isolates of wood decay basidiomycetes or wood-inhabiting ascomycetes. The primer pair ITS1-F (specific for higher fungi) and ITS4 (universal primer) amplified the internal transcribed spacer region from both ascomycetes and basidiomycetes from both pure culture and wood, as expected. The primer pair ITS1-F (specific for higher fungi) and ITS4-B (specific for basidiomycetes) was shown to reliably detect the presence of wood decay basidiomycetes in both pure culture and wood; ascomycetes were not detected by this primer pair. We detected the presence of decay fungi in wood by PCR before measurable weight loss had occurred to the wood. Basidiomycetes were identified to the species level by restriction fragment length polymorphisms of the internal transcribed spacer region. PMID:11055916
-
Reiter, Matthew E.; Andersen, David E.; Raedeke, Andrew H.; Humburg, Dale D.
2017-01-01
Inter- and intra-specific interactions are potentially important factors influencing the distribution of populations. Aerial survey data, collected during range-wide breeding population surveys for Eastern Prairie Population (EPP) Canada Geese (Branta canadensis interior), 1987–2008, were evaluated to assess factors influencing their nesting distribution. Specifically, associations between nesting Lesser Snow Geese (Chen caerulescens caerulescens) and EPP Canada Geese were quantified; and changes in the spatial distribution of EPP Canada Geese were identified. Mixed-effects Poisson regression models of EPP Canada Goose nest counts were evaluated within a cross-validation framework. The total count of EPP Canada Goose nests varied moderately among years between 1987 and 2008 with no long-term trend; however, the total count of nesting Lesser Snow Geese generally increased. Three models containing factors related to previous EPP Canada Goose nest density (representing recruitment), distance to Hudson Bay (representing brood-habitat), nesting habitat type, and Lesser Snow Goose nest density (inter-specific associations) were the most accurate, improving prediction accuracy by 45% when compared to intercept-only models. EPP Canada Goose nest density varied by habitat type, was negatively associated with distance to coastal brood-rearing areas, and suggested density-dependent intra-specific effects on recruitment. However, a non-linear relationship between Lesser Snow and EPP Canada Goose nest density suggests that as nesting Lesser Snow Geese increase, EPP Canada Geese locally decline and subsequently the spatial distribution of EPP Canada Geese on western Hudson Bay has changed.
-
Lee, Bo-Ram; Lee, Sung-Geun; Park, Jong-Hyun; Kim, Kwang-Yup; Ryu, Sang-Ryeol; Rhee, Ok-Jae; Park, Jeong-Woong; Lee, Jeong-Su; Paik, Soon-Young
2013-07-02
This study aimed to inspect norovirus contamination of groundwater treatment systems used in food-catering facilities located in South Korea. A nationwide study was performed in 2010. Water samples were collected and, for the analysis of water quality, the temperature, pH, turbidity, and residual chlorine content were assessed. To detect norovirus genotypes GI and GII, RT-PCR and semi-nested PCR were performed with specific NV-GI and NV-GII primer sets, respectively. The PCR products amplified from the detected strains were then subjected to sequence analyses. Of 1,090 samples collected in 2010, seven (0.64%) were found to be norovirus-positive. Specifically, one norovirus strain was identified to have the GI-6 genotype, and six GII strains had the GII, GII-3, GII-4, and GII-17 genotypes. The very low detection rate of norovirus most likely reflects the preventative measures used. However, this virus can spread rapidly from person to person in crowded, enclosed places such as the schools investigated in this study. To promote better public health and sanitary conditions, it is necessary to periodically monitor noroviruses that frequently cause epidemic food poisoning in South Korea.
-
Lee, Bo-Ram; Lee, Sung-Geun; Park, Jong-Hyun; Kim, Kwang-Yup; Ryu, Sang-Ryeol; Rhee, Ok-Jae; Park, Jeong-Woong; Lee, Jeong-Su; Paik, Soon-Young
2013-01-01
This study aimed to inspect norovirus contamination of groundwater treatment systems used in food-catering facilities located in South Korea. A nationwide study was performed in 2010. Water samples were collected and, for the analysis of water quality, the temperature, pH, turbidity, and residual chlorine content were assessed. To detect norovirus genotypes GI and GII, RT-PCR and semi-nested PCR were performed with specific NV-GI and NV-GII primer sets, respectively. The PCR products amplified from the detected strains were then subjected to sequence analyses. Of 1,090 samples collected in 2010, seven (0.64%) were found to be norovirus-positive. Specifically, one norovirus strain was identified to have the GI-6 genotype, and six GII strains had the GII, GII-3, GII-4, and GII-17 genotypes. The very low detection rate of norovirus most likely reflects the preventative measures used. However, this virus can spread rapidly from person to person in crowded, enclosed places such as the schools investigated in this study. To promote better public health and sanitary conditions, it is necessary to periodically monitor noroviruses that frequently cause epidemic food poisoning in South Korea. PMID:23820792
-
Molecular typing of canine Giardia duodenalis isolates from Minas Gerais, Brazil.
Fava, Natália M N; Soares, Rodrigo M; Scalia, Luana A M; Cunha, Maria Júlia Rodrigues da; Faria, Elaine S M; Cury, Márcia Cristina
2016-02-01
Giardia duodenalis (syn. Giardia intestinalis and Giardia lamblia) is a widespread intestinal parasite in mammals, including humans and pets worldwide. It should be considered a species complex and comprises eight assemblage (A-H). This works aimed to determine the genotypic variability among G. duodenalis isolates from dogs from Minas Gerais state, Brazil. Fecal samples of 97 dogs, from 1-to-10 months old from 15 commercial kennels, were collected and analyzed by the zinc sulfate centrifugal flotation technique, to determine their positivity for G. duodenalis cysts. Cysts pellets were stored and submitted to PCR and nested-PCR reactions with gdh and tpi primers, and then sequencing. Among positive samples (n = 19), fragment amplifications of gdh and tpi genes was observed in 16 (84,2%) and 14 (73,6%), respectively. In total, 30 sequences were obtained. Sequencing analysis showed that for gdh, all isolates were identified as host-specific genotype D, and for tpi, besides host-specific genotype C, were also observed zoonotic genotypes A and B. This study provides, for the first time, current information about genetic characterization of G. duodenalis isolates found in dogs in Minas Gerais state. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Hall, Zachary J; Meddle, Simone L; Healy, Susan D
Despite centuries of observing the nest building of most extant bird species, we know surprisingly little about how birds build nests and, specifically, how the avian brain controls nest building. Here, we argue that nest building in birds may be a useful model behaviour in which to study how the brain controls behaviour. Specifically, we argue that nest building as a behavioural model provides a unique opportunity to study not only the mechanisms through which the brain controls behaviour within individuals of a single species but also how evolution may have shaped the brain to produce interspecific variation in nest-building behaviour. In this review, we outline the questions in both behavioural and comparative neuroscience that nest building could be used to address, summarize recent findings regarding the neurobiology of nest building in lab-reared zebra finches and across species building different nest structures, and suggest some future directions for the neurobiology of nest building.
-
Balamurugan, P; Joshi, M Hiren; Rao, T S
2011-10-01
Culture and molecular-based techniques were used to characterize bacterial diversity in the cooling water system of a fast breeder test reactor (FBTR). Techniques were selected for special emphasis on sulphate-reducing bacteria (SRB). Water samples from different locations of the FBTR cooling water system, in addition to biofilm scrapings from carbon steel coupons and a control SRB sample were characterized. Whole genome extraction of the water samples and SRB diversity by group specific primers were analysed using nested PCR and denaturing gradient gel electrophoresis (DGGE). The results of the bacterial assay in the cooling water showed that the total culturable bacteria (TCB) ranged from 10(3) to 10(5) cfu ml(-1); iron-reducing bacteria, 10(3) to 10(5) cfu ml(-1); iron oxidizing bacteria, 10(2) to 10(3) cfu ml(-1) and SRB, 2-29 cfu ml(-1). However, the counts of the various bacterial types in the biofilm sample were 2-3 orders of magnitude higher. SRB diversity by the nested PCR-DGGE approach showed the presence of groups 1, 5 and 6 in the FBTR cooling water system; however, groups 2, 3 and 4 were not detected. The study demonstrated that the PCR protocol influenced the results of the diversity analysis. The paper further discusses the microbiota of the cooling water system and its relevance in biofouling.
-
Liu, Ying; Lin, Huanjian; Bai, Yang; Qin, Xiaoshu; Zheng, Xin; Sun, Yong; Zhang, Yali
2008-08-01
The aims of our study were to determine the presence of Helicobacter pylori DNA in the dental plaque of Chinese children aged 3-6 years by nested polymerase chain reaction (PCR) and to investigate the relationship between this infection and the occurrence of dental caries or oral hygiene index. Two hundred and fourteen children from a kindergarten in Guangzhou City of China were evaluated. The children's plaques were assessed by plaque indices of Quigley-Hein. Dental plaque was analyzed using nested PCR for two sets of primers directed to the 860-bp fragment of H. pylori genomic DNA, which have been reported to be highly sensitive and specific by other researchers. H. pylori was detected in dental plaque samples from 126 children, and 70 children with dental caries carried H. pylori in dental plaque. Of these children without infection, only 36 of 88 suffered dental caries. Besides, the average dental plaque index of 126 H. pylori-positive children was higher than that of 88 children without infection. In the present study, there was a significant correlation between H. pylori infection and dental caries or dental hygiene. The oral cavity may be a reservoir for H. pylori infection in children. H. pylori in dental plaque may play a role in the occurrence of dental caries, and poor oral hygiene may represent a risk factor for H. pylori in the oral cavity.
-
MRPrimerV: a database of PCR primers for RNA virus detection
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo
2017-01-01
Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620
-
Frenkel, L M; Wagner, L E; Atwood, S M; Cummins, T J; Dewhurst, S
1995-01-01
The effectiveness of antiretroviral therapy may be limited by the development of human immunodeficiency virus type 1 (HIV-1) resistance. Monitoring for resistance will perhaps allow changes in therapy prior to deterioration in the patient's clinical or immunologic status. Our objective was to develop a rapid, specific, and sensitive genotypic assay for HIV-1 resistance to zidovudine (ZDV) and didanosine (ddI) which is simple to perform. In our assay the DNA of HIV-1 pol was amplified by PCR using two sets of nested oligonucleotide primers. Mutations of reverse transcriptase (RT) encoding amino acids (aa) 74 and 41, 70, and 215 which have been associated with HIV-1 resistance to ddI and ZDV, respectively, were detected with a ligase detection reaction (LDR) and indicated colorimetrically. The RT genotypes of 35 patient specimens (140 codons) blindly assessed for these mutations were in agreement by PCR-LDR and by dideoxynucleotide sequencing. To evaluate the limits of the assay, other specimens with mutations close to the ligation site were evaluated by PCR-LDR. The assay was sensitive and specific for all specimens except when mutations occurred within 2 bases on either side of the ligation site. In summary, this PCR-LDR assay specifically, sensitively, and rapidly detected pol mutations (RT aa 74, 41, 70, and 215) associated with HIV-1 resistance to ddI and ZDV. PMID:7714190
-
Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee
2007-01-01
Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.
-
Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G
2012-04-01
Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.
-
Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J
1994-01-01
Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912
-
Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel
2011-01-01
Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659
-
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
-
Courtot, Karen; Roby, Daniel D.; Kerr, Lauren H.; Lyons, Donald E.; Adkins, Jessica Y.
2016-01-01
Capturing breeding adults of colonially nesting species can entail risks of nest failure and even colony abandonment, especially in species that react strongly to human disturbance. A low-disturbance technique for capturing specific adult Double-crested Cormorants (Phalacrocorax auritus) at a ground-nesting colony was developed to reduce these risks and is described here. Nesting habitat enhancement was used to attract Doublecrested Cormorants to nest adjacent to above-ground tunnels constructed so that researchers could capture birds by hand. Using this technique, Double-crested Cormorants (n = 87) were captured during the incubation and chick-rearing stages of the nesting cycle. Unlike alternative capture techniques, this approach allowed targeting of specific individuals for capture and recapture, minimized local disturbance, and eliminated colony-wide disturbances. The tunnel-based system presented here could be adapted to capture adults or to access the nest contents of other ground-nesting colonial species that are inclined to nest in areas of enhanced nesting habitat and adapt to anthropogenic structures in their nesting area. This system would be particularly beneficial for other wary and easily disturbed species.
-
Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan
2013-11-01
The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.
-
Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25
Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan
2013-01-01
The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053
-
Evaluation of nested PCR in diagnosis of fungal rhinosinusitis.
Badiee, Parisa; Gandomi, Behrooz; Sabz, Gholamabbass; Khodami, Bijan; Choopanizadeh, Maral; Jafarian, Hadis
2015-02-01
Given the importance of rapid diagnosis for fungal rhinosinusitis, this study aimed to evaluate the use of nested PCR to identify Aspergillus and Mucor species in clinical samples from patients with suspected fungal rhinosinusitis. Functional endoscopic sinus surgery specimens were collected from 98 patients with rhinosinusitis from 2012 to 2013. All samples were ground and cultured on sabouraud dextrose agar. The isolated fungi were identified based on their macroscopic and microscopic features. Fungal DNA was extracted from the tissue samples and nested PCR was performed with two sets of primers for Mucor and Aspergillus. Direct microscopic showed that 5.1% contained fungal components and 9.2% exhibited growth of fungi in culture. The most common agents isolated were Aspergillus fumigatus (n= 3), Aspergillus flavus (n=2), Penicillium sp (n=3) and Alternaria sp. (n=1). Mucor sp. was identified in the pathology smear from 1 patient. Positive results for fungal rhinosinusitis were obtained for a total of 10.2% by culture or pathology smear. Positive PCR results were obtained in 72 samples for Aspergillus and 31 samples for Mucor. Our results suggest that endoscopic sinus surgery specimens are not suitable for nested PCR, probably because of the accumulation of fungi that contaminate the environmental air. This drawback is a limiting factor for diagnosis with nasal cavity specimens. Therefore, molecular methods and conventional culture techniques are helpful complementary diagnostic methods to detect fungal rhinosinusitis and determine appropriate management for these patients.
-
Dinzouna-Boutamba, Sylvatrie-Danne; Yang, Hye-Won; Joo, So-Young; Jeong, Sookwan; Na, Byoung-Kuk; Inoue, Noboru; Lee, Won-Ki; Kong, Hyun-Hee; Chung, Dong-Il; Goo, Youn-Kyoung; Hong, Yeonchul
2014-06-30
Malaria that is caused by Plasmodium vivax is the most widely distributed human malaria. Its recent resurgence in many parts of the world, including the Republic of Korea (ROK), emphasizes the importance of improved access to the early and accurate detection of P. vivax to reduce disease burden. In this study, a rapid and efficient loop-mediated isothermal amplification (LAMP)-based method was developed and validated using blood samples from malaria-suspected patients. A LAMP assay targeting the α-tubulin gene for the detection of P. vivax was developed with six primers that recognize different regions of the target gene. The diagnostic performance of the α-tubulin LAMP assay was compared to three other tests: microscopic examinations, rapid diagnostic tests (RDTs), and nested polymerase chain reactions (PCRs) using 177 whole blood specimens obtained from ROK military personnel from May to December 2011. The α-tubulin LAMP assay was highly sensitive with a detection limit of 100 copies of P. vivax α-tubulin gene per reaction within 50 min. It specifically amplified the target gene only from P. vivax. Validation of the α-tubulin LAMP assay showed that the assay had the highest sensitivity (P < 0.001 versus microscopy; P = 0.0023 versus RDT) when nested PCR was used as the gold standard and better agreement (concordance: 94.9%, kappa value: 0.865) with nested PCR than RDT and microscopy. A Receiver Operation Characteristics analysis showed that the diagnostic accuracy of the α-tubulin LAMP assay for vivax malaria was higher (Area Under Curve = 0.908) than RDT and microscopy. This study showed that the P. vivax α-tubulin LAMP assay, which can be used to diagnose early infections of vivax malaria, is an alternative molecular diagnostic tool and a point-of-care test that may help to prevent transmission in endemic areas.
-
Dalmastri, Claudia; Pirone, Luisa; Tabacchioni, Silvia; Bevivino, Annamaria; Chiarini, Luigi
2005-05-01
In this study, we evaluated if recA species-specific PCR assays could be successfully applied to identify environmental isolates of the widespread Burkholderia cepacia complex (Bcc) species. A total of 729 Bcc rhizosphere isolates collected in different samplings were assigned to the species B. cepacia genomovar I (61), B. cenocepacia recA lineage IIIB (514), B. ambifaria (124) and B. pyrrocinia (30), by means of recA (RFLP) analysis, and PCR tests were performed to assess sensitivity and specificity of recA species-specific primers pairs. B. cepacia genomovar I specific primers produced the expected amplicon with all isolates of the corresponding species (sensitivity, 100%), and cross-reacted with all B. pyrrocinia isolates. On the contrary, B. cenocepacia IIIB primers did not give the expected amplicon in 164 B. cenocepacia IIIB isolates (sensitivity, 68.1%), and isolates of distinct populations showed different sensitivity. B. ambifaria primers failed to amplify a recA-specific fragment only in a few isolates of this species (sensitivity, 93.5%). The absence of specific amplification in a high number of B. cenocepacia rhizosphere isolates indicates that recA specific PCR assays can lead to an underestimation of environmental microorganisms belonging to this bacterial species.
-
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-09-29
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.
-
Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.
Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won
2018-05-01
DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.
-
Hahm, J E; Kim, C W; Kim, S S
2018-04-06
A widespread scabies infestation, associated to long-term residence in nursing homes, is becoming a serious issue in developed countries. Mineral oil examination is regarded as the gold standard in diagnosing scabies, but the sensitivity of this method is generally low-approximately 50%. Molecular tests may contribute to enhance the sensitivity of current tests for laboratory diagnosis of human scabies. In this study, we developed new primers for a nested PCR for the cytochrome c oxidase subunit 1 (cox1) gene of Sarcoptes scabiei var. hominis to increase the sensitivity of a previously developed conventional PCR. Clinically suspected scabies patients underwent dermoscopy-guided skin scraping with microscopic examination. The diagnosis was positive for scabies when mites or eggs were found under the microscope, and patients were then designated as 'microscopy-positive'. Patients in the 'microscopy-negative' group presented with negative microscopic results. Skin scrapings were collected from both groups for PCR. Of the total 63 samples, 28 were microscopy-positive and 35 were negative with no differences in sex and age between the two groups. All microscopically proven scabies cases were positive with the cox1 nested PCR. Among microscopy-negative ones, S. scabiei DNA was detected in 9 samples. If sensitivity of the cox1 nested PCR is considered 100% (95% CI, 90.51-100), then sensitivity of microscopy is 75.68% (95% CI, 58.80-88.23; P = 0.004). Nested PCR can be successfully used as an alternative method for diagnosing suspected scabies patient. Therefore, infection control measures and treatments can be initiated before significant transmission occurs, minimizing the risk of outbreaks. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
-
A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts
Ealba, Erin L.; Schneider, Richard A.
2013-01-01
Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056
-
An N-targeting real-time PCR strategy for the accurate detection of spring viremia of carp virus.
Shao, Ling; Xiao, Yu; He, Zhengkan; Gao, Longying
2016-03-01
Spring viremia of carp virus (SVCV) is a highly pathogenic agent of several economically important Cyprinidae fish species. Currently, there are no effective vaccines or drugs for this virus, and prevention of the disease mostly relies on prompt diagnosis. Previously, nested RT-PCR and RT-qPCR detection methods based on the glycoprotein gene G have been developed. However, the high genetic diversity of the G gene seriously limits the reliability of those methods. Compared with the G gene, phylogenetic analyses indicate that the nucleoprotein gene N is more conserved. Furthermore, studies in other members of the Rhabdoviridae family reveals that their gene transcription level follows the order N>P>M>G>L, indicating that an N gene based RT-PCR should have higher sensitivity. Therefore, two pairs of primers and two corresponding probes targeting the conserved regions of the N gene were designed. RT-qPCR assays demonstrated all primers and probes could detect phylogenetically distant isolates specifically and efficiently. Moreover, in artificially infected fish, the detected copy numbers of the N gene were much higher than those of the G gene in all tissues, and both the N and G gene copy numbers were highest in the kidney and spleen. Testing in 1100 farm-raised fish also showed that the N-targeting strategy was more reliable than the G-targeting methods. The method developed in this study provides a reliable tool for the rapid diagnosis of SVCV. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Non-invasive surveillance for Plasmodium in reservoir macaque species.
Siregar, Josephine E; Faust, Christina L; Murdiyarso, Lydia S; Rosmanah, Lis; Saepuloh, Uus; Dobson, Andrew P; Iskandriati, Diah
2015-10-12
Primates are important reservoirs for human diseases, but their infection status and disease dynamics are difficult to track in the wild. Within the last decade, a macaque malaria, Plasmodium knowlesi, has caused disease in hundreds of humans in Southeast Asia. In order to track cases and understand zoonotic risk, it is imperative to be able to quantify infection status in reservoir macaque species. In this study, protocols for the collection of non-invasive samples and isolation of malaria parasites from naturally infected macaques are optimized. Paired faecal and blood samples from 60 Macaca fascicularis and four Macaca nemestrina were collected. All animals came from Sumatra or Java and were housed in semi-captive breeding colonies around West Java. DNA was extracted from samples using a modified protocol. Nested polymerase chain reactions (PCR) were run to detect Plasmodium using primers targeting mitochondrial DNA. Sensitivity of screening faecal samples for Plasmodium was compared to other studies using Kruskal Wallis tests and logistic regression models. The best primer set was 96.7 % (95 % confidence intervals (CI): 83.3-99.4 %) sensitive for detecting Plasmodium in faecal samples of naturally infected macaques (n = 30). This is the first study to produce definitive estimates of Plasmodium sensitivity and specificity in faecal samples from naturally infected hosts. The sensitivity was significantly higher than some other studies involving wild primates. Faecal samples can be used for detection of malaria infection in field surveys of macaques, even when there are no parasites visible in thin blood smears. Repeating samples from individuals will improve inferences of the epidemiology of malaria in wild primates.
-
An optimised protocol for molecular identification of Eimeria from chickens☆
Kumar, Saroj; Garg, Rajat; Moftah, Abdalgader; Clark, Emily L.; Macdonald, Sarah E.; Chaudhry, Abdul S.; Sparagano, Olivier; Banerjee, Partha S.; Kundu, Krishnendu; Tomley, Fiona M.; Blake, Damer P.
2014-01-01
Molecular approaches supporting identification of Eimeria parasites infecting chickens have been available for more than 20 years, although they have largely failed to replace traditional measures such as microscopy and pathology. Limitations of microscopy-led diagnostics, including a requirement for specialist parasitological expertise and low sample throughput, are yet to be outweighed by the difficulties associated with accessing genomic DNA from environmental Eimeria samples. A key step towards the use of Eimeria species-specific PCR as a sensitive and reproducible discriminatory tool for use in the field is the production of a standardised protocol that includes sample collection and DNA template preparation, as well as primer selection from the numerous PCR assays now published. Such a protocol will facilitate development of valuable epidemiological datasets which may be easily compared between studies and laboratories. The outcome of an optimisation process undertaken in laboratories in India and the UK is described here, identifying four steps. First, samples were collected into a 2% (w/v) potassium dichromate solution. Second, oocysts were enriched by flotation in saturated saline. Third, genomic DNA was extracted using a QIAamp DNA Stool mini kit protocol including a mechanical homogenisation step. Finally, nested PCR was carried out using previously published primers targeting the internal transcribed spacer region 1 (ITS-1). Alternative methods tested included sample processing in the presence of faecal material, DNA extraction using a traditional phenol/chloroform protocol, the use of SCAR multiplex PCR (one tube and two tube versions) and speciation using the morphometric tool COCCIMORPH for the first time with field samples. PMID:24138724
-
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
-
USDA-ARS?s Scientific Manuscript database
The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...
-
GSP: a web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...
-
Kang, Kang; Zhang, Xiaoying; Liu, Hongtao; Wang, Zhiwei; Zhong, Jiasheng; Huang, Zhenting; Peng, Xiao; Zeng, Yan; Wang, Yuna; Yang, Yi; Luo, Jun; Gou, Deming
2012-01-01
Background MicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases. Methodology/Principal Findings A novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518. Conclusions/Significance With excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers. PMID:23152780
-
Monti, Monia; Martini, Marta; Tedeschi, Rosemarie
2013-01-01
In this paper the validation and implementation of a Real-time PCR protocol based on ribosomal protein genes has been carried out for sensitive and specific quantification of 'Candidatus (Ca.) Phytoplasma mali' (apple proliferation phytoplasma, APP) in insects. The method combines the use of EvaGreen(®) dye as chemistry detection system and the specific primer pair rpAP15f-mod/rpAP15r3, which amplifies a fragment of 238 bp of the ribosomal protein rplV (rpl22) gene of APP. Primers specificity was demonstrated by running in the same Real-time PCR 'Ca. Phytoplasma mali' samples with phytoplasmas belonging to the same group (16SrX) as 'Ca. Phytoplasma pyri' and 'Ca. Phytoplasma prunorum', and also phytoplasmas from different groups, as 'Ca. Phytoplasma phoenicium' (16SrIX) and Flavescence dorée phytoplasma (16SrV). 'Ca. Phytoplasma mali' titre in insects was quantified using a specific approach, which relates the concentration of the phytoplasma to insect 18S rDNA. Absolute quantification of APP and insect 18S rDNA were calculated using standard curves prepared from serial dilutions of plasmids containing rplV-rpsC and a portion of 18S rDNA genes, respectively. APP titre in insects was expressed as genome units (GU) of phytoplasma per picogram (pg) of individual insect 18S rDNA. 'Ca. Phytoplasma mali' concentration in examined samples (Cacopsylla melanoneura overwintered adults) ranged from 5.94 × 10(2) to 2.51 × 10(4) GU/pg of insect 18S rDNA. Repeatability and reproducibility of the method were also evaluated by calculation of the coefficient of variation (CV%) of GU of phytoplasma and pg of 18S rDNA fragment for both assays. CV less than 14% and 9% (for reproducibility test) and less than 10 and 11% (for repeatability test) were obtained for phytoplasma and insect qPCR assays, respectively. Sensitivity of the method was also evaluated, in comparison with conventional 16S rDNA-based nested-PCR procedure. The method described has been demonstrated reliable, sensitive and specific for the quantification of 'Ca. Phytoplasma mali' in insects. The possibility to study the trend of phytoplasma titre in the vectors will allow a deepen investigation on the epidemiology of the disease. Copyright © 2013 Elsevier Ltd. All rights reserved.
-
Rapid identification of the Asian gypsy moth and its related species based on mitochondrial DNA.
Wu, Ying; Du, Qiuyang; Qin, Haiwen; Shi, Juan; Wu, Zhiyi; Shao, Weidong
2018-02-01
The gypsy moth- Lymantria dispar (Linnaeus)-is a worldwide forest defoliator and is of two types: the European gypsy moth and the Asian gypsy moth. Because of multiple invasions of the Asian gypsy moth, the North American Plant Protection Organization officially approved Regional Standards for Phytosanitary Measures No. 33. Accordingly, special quarantine measures have been implemented for 30 special focused ports in the epidemic areas of the Asian gypsy moth, including China, which has imposed great inconvenience on export trade. The Asian gypsy moth and its related species (i.e., Lymantria monocha and Lymantria xylina ) intercepted at ports are usually at different life stages, making their identification difficult. Furthermore, Port quarantine requires speedy clearance. As such, it is difficult to identify the Asian gypsy moth and its related species only by their morphological characteristics in a speedy measure. Therefore, this study aimed to use molecular biology technology to rapidly identify the Asian gypsy moth and its related species based on the consistency of mitochondrial DNA in different life stages. We designed 10 pairs of specific primers from different fragments of the Asian gypsy moth and its related species, and their detection sensitivity met the need for rapid identification. In addition, we determined the optimal polymerase chain reaction amplification temperature of the 10 pairs of specific primers, including three pairs of specific primers for the Asian gypsy moth ( L. dispar asiatic ), four pairs of specific primers for the nun moth ( L. monocha ), and three pairs of specific primers for the casuarina moth ( L. xylina ). In conclusion, using our designed primers, direct rapid identification of the Asian gypsy moth and its related species is possible, and this advancement can help improve export trade in China.
-
Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart
2014-11-01
In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Molecular Evidence of Different Rickettsia Species in Villeta, Colombia.
Faccini-Martínez, Álvaro A; Ramírez-Hernández, Alejandro; Forero-Becerra, Elkin; Cortés-Vecino, Jesús A; Escandón, Patricia; Rodas, Juan D; Palomar, Ana M; Portillo, Aránzazu; Oteo, José A; Hidalgo, Marylin
2016-02-01
The aim of this work was to detect and identify Rickettsia species in ticks collected in rural areas of Villeta, Colombia. Tick specimens were collected from domestic animals and walls of houses in five rural villages of Villeta town and from humans in Naranjal village (same town). Moreover, a flea collected from the same area was also processed. DNA was extracted and tested by conventional, semi-nested, and nested PCR reactions targeting rickettsial genes. In the ticks collected from humans from Naranjal village, a nymph of Amblyomma cajennense sensu lato was amplified using primers for ompA and sequenced (100% identity with "Candidatus Rickettsia amblyommii"). Last, three amplicons from the Ctenocephalides felis flea, corresponding to gltA, ompB, and 16S rRNA genes, showed high identity with R. felis (98.5%, 97.3%, and 99.2%, respectively) and "Candidatus Rickettsia asemboensis" (99.7% and 100%, respectively). To our knowledge, these results correspond to the first molecular detection in Colombia of "Candidatus Rickettsia amblyommii" and "Ca. Rickettsia asemboensis" in fleas.
-
SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery
Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David
2006-01-01
Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092
-
SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.
Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David
2006-07-01
Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.
-
Fraley, Stephanie I.; Athamanolap, Pornpat; Masek, Billie J.; Hardick, Justin; Carroll, Karen C.; Hsieh, Yu-Hsiang; Rothman, Richard E.; Gaydos, Charlotte A.; Wang, Tza-Huei; Yang, Samuel
2016-01-01
High Resolution Melt (HRM) is a versatile and rapid post-PCR DNA analysis technique primarily used to differentiate sequence variants among only a few short amplicons. We recently developed a one-vs-one support vector machine algorithm (OVO SVM) that enables the use of HRM for identifying numerous short amplicon sequences automatically and reliably. Herein, we set out to maximize the discriminating power of HRM + SVM for a single genetic locus by testing longer amplicons harboring significantly more sequence information. Using universal primers that amplify the hypervariable bacterial 16 S rRNA gene as a model system, we found that long amplicons yield more complex HRM curve shapes. We developed a novel nested OVO SVM approach to take advantage of this feature and achieved 100% accuracy in the identification of 37 clinically relevant bacteria in Leave-One-Out-Cross-Validation. A subset of organisms were independently tested. Those from pure culture were identified with high accuracy, while those tested directly from clinical blood bottles displayed more technical variability and reduced accuracy. Our findings demonstrate that long sequences can be accurately and automatically profiled by HRM with a novel nested SVM approach and suggest that clinical sample testing is feasible with further optimization. PMID:26778280
-
Serological and molecular diagnosis of Toxoplasma gondii in patients with schizophrenia.
Ebrahimzadeh, Adel; Shahraki, Mehdi Khoshsima; Mohammadi, Azad
2018-06-01
Schizophrenia is a persistent neuropsychiatric syndrome of uncertain source. Toxoplasmosis is the most prevalent parasitic protozoan infecting one-third of the worldwide human population. Infectious agents such as toxoplasma are the probable cause of schizophrenia. This study was aimed to evaluate the association between schizophrenia and toxoplasmosis using SAG1 and B1 Target gene. During February to December 2016, 92 patients with schizophrenia are imported in our study. All cases were assessed by serological (IgG and IgM antibodies) and molecular examinations. ELISA was performed by Commercial kits according to manufactures procedure. DNA was extracted and nested PCR was done using two pairs of primers. From 92 patients, 59 (64.13%) cases were positive for toxoplasmosis by serological examinations (14 samples positive for IgM and IgG, 40 samples positive for only IgG and 5 samples Positive for only IgM) and 58 (63.04%) were positive by Nested PCR technique. Based on the nested PCR method, 68.47 and 47.82% of samples were positive by B1 and SAG1 genes, respectively. Our results showed the importance of use both serological and molecular diagnostic methods for accurate recognition of T . gondii in patients with schizophrenia. Moreover our results indicated that B1 gene is more sensitive than SAG1 gene.
-
Xu, Jing; Zhu, Xing-Quan; Wang, Sheng-Yue; Xia, Chao-Ming
2012-01-01
Background Schistosomiasis japonica is a serious debilitating and sometimes fatal disease. Accurate diagnostic tests play a key role in patient management and control of the disease. However, currently available diagnostic methods are not ideal, and the detection of the parasite DNA in blood samples has turned out to be one of the most promising tools for the diagnosis of schistosomiasis. In our previous investigations, a 230-bp sequence from the highly repetitive retrotransposon SjR2 was identified and it showed high sensitivity and specificity for detecting Schistosoma japonicum DNA in the sera of rabbit model and patients. Recently, 29 retrotransposons were found in S. japonicum genome by our group. The present study highlighted the key factors for selecting a new perspective sensitive target DNA sequence for the diagnosis of schistosomiasis, which can serve as example for other parasitic pathogens. Methodology/Principal Findings In this study, we demonstrated that the key factors based on the bioinformatic analysis for selecting target sequence are the higher genome proportion, repetitive complete copies and partial copies, and active ESTs than the others in the chromosome genome. New primers based on 25 novel retrotransposons and SjR2 were designed and their sensitivity and specificity for detecting S. japonicum DNA were compared. The results showed that a new 303-bp sequence from non-long terminal repeat (LTR) retrotransposon (SjCHGCS19) had high sensitivity and specificity. The 303-bp target sequence was amplified from the sera of rabbit model at 3 d post-infection by nested-PCR and it became negative at 17 weeks post-treatment. Furthermore, the percentage sensitivity of the nested-PCR was 97.67% in 43 serum samples of S. japonicum-infected patients. Conclusions/Significance Our findings highlighted the key factors based on the bioinformatic analysis for selecting target sequence from S. japonicum genome, which provide basis for establishing powerful molecular diagnostic techniques that can be used for monitoring early infection and therapy efficacy to support schistosomiasis control programs. PMID:22479661
-
Poliovirus serotype-specific VP1 sequencing primers.
Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen
2011-06-01
The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.
-
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
-
Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti
Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig
2016-01-01
Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115
-
Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.
2007-01-01
Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397
-
Beekman, Madeleine; Oldroyd, Benjamin P
2018-05-19
During reproductive swarming, a honeybee swarm needs to decide on a new nest site and then move to the chosen site collectively. Most studies of swarming and nest-site selection are based on one species, Apis mellifera Natural colonies of A. mellifera live in tree cavities. The quality of the cavity is critical to the survival of a swarm. Other honeybee species nest in the open, and have less strict nest-site requirements, such as the open-nesting dwarf honeybee Apis florea Apis florea builds a nest comprised of a single comb suspended from a twig. For a cavity-nesting species, there is only a limited number of potential nest sites that can be located by a swarm, because suitable sites are scarce. By contrast, for an open-nesting species, there is an abundance of equally suitable twigs. While the decision-making process of cavity-nesting bees is geared towards selecting the best site possible, open-nesting species need to coordinate collective movement towards areas with potential nest sites. Here, we argue that the nest-site selection processes of A. florea and A. mellifera have been shaped by each species' specific nest-site requirements. Both species use the same behavioural algorithm, tuned to allow each species to solve their species-specific problem.This article is part of the theme issue 'Collective movement ecology'. © 2018 The Author(s).
-
Grapevine fleck virus-like viruses in Vitis.
Sabanadzovic, S; Abou-Ghanem, N; Castellano, M A; Digiaro, M; Martelli, G P
2000-01-01
Two sets of degenerate primers for the specific amplification of 572-575 nt and 386 nt segments of the methyltransferase and RNA- dependent RNA polymerase cistrons of members of the genera Tymovirus and Marafivirus and of the unassigned virus Grapevine fleck virus (GFkV) were designed on the basis of available sequences. These primers were used for amplifying and subsequent cloning and sequencing part of the open reading frame 1 of the genome of GFkV, Grapevine asteroid mosaic-associated virus (GAMaV) and of another previously unreported virus, for which the name Grapevine red globe virus (GRGV) is proposed. Computer-assisted analysis of the amplified genome portions showed that the three grapevine viruses are phylogenetically related with one another and with sequenced tymoviruses and marafiviruses. The relationships with tymoviruses was confirmed by the type of ultrastructural modifications induced in the host cells. RdRp-specific degenerate primers were successfully used for the aspecific detection of the three viruses in crude grapevine sap extracts. Specific virus identification was obtained with RT-PCR using antisense virus-specific primers.
-
Bashir, K M I; Awan, F S; Khan, I A; Khan, A I; Usman, M
2014-05-30
Roses (Rosa indica) belong to one of the most crucial groups of plants in the floriculture industry. Rosa species have special fragrances of interest to the perfume and pharmaceutical industries. The genetic diversity of plants based on morphological characteristics is difficult to measure under natural conditions due to the influence of environmental factors, which is why a reliable fingerprinting method was developed to overcome this problem. The development of molecular markers will enable the identification of Rosa species. In the present study, randomly amplified polymorphic DNA (RAPD) analysis was done on four Rosa species, Rosa gruss-an-teplitz (Surkha), Rosa bourboniana, Rosa centifolia, and Rosa damascena. A polymorphic RAPD fragment of 391 bp was detected in R. bourboniana, which was cloned, purified, sequenced, and used to design a pair of species-specific sequence-characterized amplified region (SCAR) primers (forward and reverse). These SCAR primers were used to amplify the specific regions of the rose genome. These PCR amplifications with specific primers are less sensitive to reaction conditions, and due to their high reproducibility, these species-specific SCAR primers can be used for marker-assisted selection and identification of Rosa species.
-
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
-
The first report of detection of a phytoplasma in olive trees in a botanic collection in Iran.
Ahangaran, A; Khezri, S; Habibi, M Koohi; Alizadeh, A; Mohammadi, Gh Mosahebi
2006-01-01
In a survey in 2005 some symptoms were observed on three olive trees in a collection of different olive cultivars in one of the central provinces in Iran (Yazd Province). Affected trees exhibited a variable range of symptoms: dwarfing, shoot proliferation, internode shortening, small leaves, leaf rolling, abortive buds, appearance of very small shoots, hypertrophied, and die- back. The possibility of association of a phytoplasma with the disease was evaluated using polymerase chain reaction (PCR). Total DNA was extracted from midribs of symptomatic and healthy olive plants using phytoplasma enriched procedure and tested for the presence of phytoplasma by nested-PCR using phytoplasmal- universal primers R16F2/R16R2, followed by primers fU5/rU3 which amplify 1200 and 880bp DNA fragments of 16SrDNA, respectively. PCR resulted in amplification of expected DNA fragments in symptomatic but not in healthy olive by both primer pairs. On the basis of symptoms and positive reaction in PCR, these plants can be infected with a phytoplasma. This is the first report of olive trees phytoplasmal disease in Iran. Identification of the agent and its comparison with other phytoplasmal isolates reported from other plants (hosts) in Iran are being studied. Based on the quarantine requirements, one of these trees was eradicated and two of them were transplanted in an isolated green house for further studies.
-
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
-
Frank R. Thompson; Dirk E. Burhans
2004-01-01
In the past two decades, many researchers have used artificial nest to measure relative rates of nest predation. Recent comparisons show that real and artificial nests may not be depredated at the same rate, but no one has examined the mechanisms underlying these patterns. We determined differences in predator-specific predation rates of real and artificial nests. we...
-
2014-01-01
Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675
-
Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian
2012-05-01
To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, P<0.05). Nested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, P<0.01). The detection sensitivity of Sanger sequencing varied with the viral loads, especially in samples with low viral copies (HBV DNA ≤3log10 copies/ml), where the sensitivity was 78%, significantly lower than that of pyrosequencing (100%, P<0.01). Neither of the two methods yielded positive results for the negative control samples, suggesting their good specificity. Compared with nested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.
-
Best Development Practices: A Primer for Smart Growth
Best Development Practices: A Primer for Smart Growth lists specific practices to achieve development principles that mix land uses, support transportation options, protect natural systems, and provide housing choices.
-
Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo
2007-10-01
Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.
-
Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan
2014-07-01
In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Jarausch, W; Saillard, C; Dosba, F; Bové, J M
1994-01-01
A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180
-
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
-
Jehee, Ivo; van der Veer, Charlotte; Himschoot, Michelle; Hermans, Mirjam; Bruisten, Sylvia
2017-12-01
Trichomonas vaginalis is the most common sexually transmitted parasitical infection worldwide. T. vaginalis can carry a virus: Trichomonas vaginalis virus (TVV). To date, four TVV species have been described. Few studies have investigated TVV prevalence and its clinical importance. We have developed a nested reverse-transcriptase PCR, with novel, type specific primers to directly detect TVV RNA in T. vaginalis positive clinical samples. A total of 119T. vaginalis positive clinical samples were collected in Amsterdam and "s-Hertogenbosch, the Netherlands, from 2012 to 2016. For all samples T. vaginalis was genotyped using multi-locus sequence typing. The T. vaginalis positive samples segregated into a two-genotype population: type I (n=64) and type II (n=55). All were tested for TVV with the new TVV PCR. We detected 3 of the 4 TVV species. Sequencing of the amplified products showed high homology with published TVV genomes (82-100%). Half of the T. vaginalis clinical samples (n=60, 50.4%) were infected with one or more TVV species, with a preponderance for TVV infections in T. vaginalis type I (n=44, 73.3%). Clinical data was available for a subset of samples (n=34) and we observed an association between testing positive for (any) TVV and reporting urogenital symptoms (p=0.023). The nested RT-PCR allowed for direct detection of TVV in T. vaginalis positive clinical samples. This may be helpful in studies and clinical settings, since T. vaginalis disease and/or treatment outcome may be influenced by the protozoa"s virus. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Ostberg, C.O.; Rodriguez, R.J.
2004-01-01
Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.
-
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
-
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
-
First report of Hibiscus infecting Cilevirus in Citrus sinensis in Meta and Casanare, Colombia
USDA-ARS?s Scientific Manuscript database
In February 2015, two sweet orange samples with severe citrus leprosis (CiL) symptoms were collected from Meta and Casanare states in Colombia and assayed for Cilevirus, Dichorhavirus and Higrevirus associated with CiL disease. PCR primers specific for CiLV-C2, but not primers specific for CiLV-C, C...
-
Role of TAF12 in the Increased VDR Activity in Paget’s Disease of Bone
2013-10-01
and 5’‐GCC AAA TGC AGT TTA AGC TCT GCT‐3’ (antisense). The gene‐specific primers for mouse b‐actin were 5’‐GGC CGT ACC ACT GGC ATC GTG ATG‐ 3...cycles. The gene‐specific primers for CYP24A1 mRNA were 5’‐CGG GTG GAC CAT TTA CAA CTC GG‐3’ (sense) and 5’‐CTC AAC AGG CTC ATT GTC TGT GG‐3’ (antisense...The gene specific designing primers for b‐actinwere 5’‐ GTG CGT GAC ATC AAA GAG‐3’ (sense) and 5’‐GCC ACA GGA TTC CAT ACC‐3’ (antisense). The
-
Yackel Adams, A.A.; Skagen, S.K.; Savidge, J.A.
2007-01-01
Many North American prairie bird populations have recently declined, and the causes of these declines remain largely unknown. To determine whether population limitation occurs during breeding, we evaluated the stability of a population of prairie birds using population-specific values for fecundity and postfledging survival. During 2001-2003, we radiomarked 67 female Lark Buntings (Calamospiza melanocorys) to determine annual fecundity and evaluate contributing factors such as nest survival and breeding response (number of breeding attempts and dispersal). Collectively, 67 females built 112 nests (1.67 ± 0.07 nests female−1 season−1; range: 1–3); 34 were second nests and 11 were third nests. Daily nest survival estimates were similar for initial and later nests with overall nest survival (DSR19) of 30.7% and 31.7%, respectively. Nest predation was the most common cause of failure (92%). Capture and radiomarking of females did not affect nest survival. Lark Bunting dispersal probabilities increased among females that fledged young from initial nests and females that lost their original nests late in the season. Conservative and liberal estimates of mean annual fecundity were 0.96 ±0.11 and 1.24 ± 0.09 female offspring per female, respectively. Given the fecundity and juvenile-survival estimates for this population, annual adult survival values of 71–77% are necessary to achieve a stable population. Because adult survival of prairie passerines ranges between 55% and 65%, this study area may not be capable of sustaining a stable population in the absence of immigration. We contrast our population assessment with one that assumes indirect values of fecundity and juvenile survival. To elucidate limiting factors, estimation of population-specific demographic parameters is desirable. We present an approach for selecting species and areas for evaluation of population stability.
-
Kim, Dong Wook; Kilgore, Paul Evan; Kim, Eun Jin; Kim, Soon Ae; Anh, Dang Duc; Seki, Mitsuko
2011-10-01
Haemophilus influenzae type b (Hib) is one of the leading causes of meningitis in developing countries. To establish and evaluate a novel loop-mediated isothermal amplification (LAMP) assay for Hib, we designed a LAMP primer set targeting the Hib-specific capsulation locus. LAMP detected 10 copies of purified DNA in a 60-min reaction. This indicated that the detection limit of LAMP was >100-fold lower than the detection limits of both a PCR for the detection of bexA and a nested PCR for Hib (Hib PCR). No H. influenzae, other than Hib or control bacteria, was detected. Linear determination ranged from 10 to 1,000,000 microorganisms per reaction mixture using real-time turbidimetry. We evaluated the Hib LAMP assay using a set of 52 randomly selected cerebrospinal fluid (CSF) specimens obtained from children with suspected meningitis. For comparison, the CSF specimens were tested using a conventional Hib PCR assay. Hib was detected in 30 samples using LAMP and in 22 samples using the Hib PCR assay. The Hib PCR showed a clinical sensitivity of 73.3% and a clinical specificity of 100% relative to the Hib LAMP assay. These results suggest that further development and evaluation of the Hib LAMP will enhance the global diagnostic capability for Hib detection.
-
Northam, Weston T; Allison, Lizabeth A; Cristol, Daniel A
2012-02-01
Bioaccumulation of contaminants can occur across ecosystem boundaries via transport by emergent aquatic insects. In the South River, Virginia, USA, aquatic mercury has contaminated songbirds nesting in adjacent riparian forests. Spiders contribute the majority of mercury to these songbirds' diets. We tested the hypothesis that massive annual mayfly emergences provide a vector for mercury from river sediments to the Lycosid spiders most frequently eaten by contaminated songbirds. We designed mayfly-specific PCR primers that amplified mtDNA from 76% of adult mayflies collected at this site. By combining this approach with an Agilent 2100 electrophoresis system, we created a highly sensitive test for mayfly predation by Lycosids, commonly known as wolf spiders. In laboratory spider feeding trials, mayfly DNA could be detected up to 192h post-ingestion; however, we detected no mayfly predation in a sample of 110 wolf spiders collected at the site during mayfly emergence. We suggest that mayfly predation is not an important mechanism for dietary transfer of mercury to wolf spiders and their avian predators at the South River. Instead, floodplain soil should be considered as a potential proximate source for mercury in the terrestrial food web. Copyright © 2011 Elsevier B.V. All rights reserved.
-
Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw
2011-05-01
A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)
-
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
-
Xylella fastidiosa: Host Range and Advance in Molecular Identification Techniques
Baldi, Paolo; La Porta, Nicola
2017-01-01
In the never ending struggle against plant pathogenic bacteria, a major goal is the early identification and classification of infecting microorganisms. Xylella fastidiosa, a Gram-negative bacterium belonging to the family Xanthmonadaceae, is no exception as this pathogen showed a broad range of vectors and host plants, many of which may carry the pathogen for a long time without showing any symptom. Till the last years, most of the diseases caused by X. fastidiosa have been reported from North and South America, but recently a widespread infection of olive quick decline syndrome caused by this fastidious pathogen appeared in Apulia (south-eastern Italy), and several cases of X. fastidiosa infection have been reported in other European Countries. At least five different subspecies of X. fastidiosa have been reported and classified: fastidiosa, multiplex, pauca, sandyi, and tashke. A sixth subspecies (morus) has been recently proposed. Therefore, it is vital to develop fast and reliable methods that allow the pathogen detection during the very early stages of infection, in order to prevent further spreading of this dangerous bacterium. To this purpose, the classical immunological methods such as ELISA and immunofluorescence are not always sensitive enough. However, PCR-based methods exploiting specific primers for the amplification of target regions of genomic DNA have been developed and are becoming a powerful tool for the detection and identification of many species of bacteria. The aim of this review is to illustrate the application of the most commonly used PCR approaches to X. fastidiosa study, ranging from classical PCR, to several PCR-based detection methods: random amplified polymorphic DNA (RAPD), quantitative real-time PCR (qRT-PCR), nested-PCR (N-PCR), immunocapture PCR (IC-PCR), short sequence repeats (SSRs, also called VNTR), single nucleotide polymorphisms (SNPs) and multilocus sequence typing (MLST). Amplification and sequence analysis of specific targets is also mentioned. The fast progresses achieved during the last years in the DNA-based classification of this pathogen are described and discussed and specific primers designed for the different methods are listed, in order to provide a concise and useful tool to all the researchers working in the field. PMID:28642764
-
Guo, Xu-Guang; Zhou, Shan
2014-01-01
Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360
-
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
-
Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia
2015-01-01
This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.
-
Kerishnan, Jesinda P; Gopinath, Subash C B; Kai, Sia Bik; Tang, Thean-Hock; Ng, Helen Lee-Ching; Rahman, Zainal Ariff Abdul; Hashim, Uda; Chen, Yeng
2016-01-01
The association between human papillomavirus type 16 (HPV16) and oral cancer has been widely reported. However, detecting anti-HPV antibodies in patient sera to determine risk for oral squamous cell carcinoma (OSCC) has not been well studied. In the present investigation, a total of 206 OSCC serum samples from the Malaysian Oral Cancer Database & Tissue Bank System, with 134 control serum samples, were analyzed by enzyme-linked immunosorbant assay (ELISA) to detect HPV16-specific IgG and IgM antibodies. In addition, nested PCR analysis using comprehensive consensus primers (PGMY09/11 and GP5(+)/6(+)) was used to confirm the presence of HPV. Furthermore, we have evaluated the association of various additional causal factors (e.g., smoking, alcohol consumption, and betel quid chewing) in HPV-infected OSCC patients. Statistical analysis of the Malaysian population indicated that OSCC was more prevalent in female Indian patients that practices betel quid chewing. ELISA revealed that HPV16 IgG, which demonstrates past exposure, could be detected in 197 (95.6%) OSCC patients and HPV16-specific IgM was found in a total of 42 (20.4%) OSCC patients, indicating current exposure. Taken together, our study suggest that HPV infection may play a significant role in OSCC (OR: 13.6; 95% CI: 3.89-47.51) and HPV16-specific IgG and IgM antibodies could represent a significant indicator of risk factors in OSCC patients.
-
Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu
2013-01-01
In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716
-
Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu
2015-08-01
Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
-
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-01-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less
-
Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...
2016-07-15
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less
-
Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S
2016-09-01
Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.
-
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
-
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-08-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.
-
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
-
Diagnosis of neonatal group B Streptococcus sepsis by nested-PCR of residual urine samples
Cezarino, Bruno Nicolino; Yamamoto, Lidia; Del Negro, Gilda Maria Barbaro; Rocha, Daisy; Okay, Thelma Suely
2008-01-01
Group B streptococcus (GBS) remains the most common cause of early-onset sepsis in newborns. Laboratory gold-standard, broth culture methods are highly specific, but lack sensitivity. The aim of this study was to validate a nested-PCR and to determine whether residue volumes of urine samples obtained by non invasive, non sterile methods could be used to confirm neonatal GBS sepsis. The nested-PCR was performed with primers of the major GBS surface antigen. Unavailability of biological samples to perform life supporting exams, as well as others to elucidate the etiology of infections is a frequent problem concerning newborn patients. Nevertheless, we decided to include cases according to strict criteria: newborns had to present with signs and symptoms compatible with GBS infection; at least one of the following biological samples had to be sent for culture: blood, urine, or cerebrospinal fluid; availability of residue volumes of the samples sent for cultures, or of others collected on the day of hospitalization, prior to antibiotic therapy prescription, to be analyzed by PCR; favorable outcome after GBS empiric treatment. In only one newborn GBS infection was confirmed by cultures, while infection was only presumptive in the other three patients (they fulfilled inclusion criteria but were GBS-culture negative). From a total of 12 biological samples (5 blood, 3 CSF and 4 urine specimen), eight were tested by culture methods (2/8 were positive), and 8 were tested by PCR (7/8 were positive), and only 4 samples were simultaneously tested by both methods (1 positive by culture and 3 by PCR). In conclusion, although based on a restricted number of neonates and samples, our results suggest that the proposed nested-PCR might be used to diagnose GBS sepsis as it has successfully amplified the three types of biological samples analyzed (blood, urine and cerebrospinal fluid), and was more sensitive than culture methods as PCR in urine confirmed diagnosis in all four patients. Moreover, PCR has enabled us to use residue volumes of urine samples collected by non invasive, non sterile methods, what is technically adequate as GBS is not part of the normal urine flora, thus avoiding invasive procedures such as suprapubic bladder punction or transurethral catheterization. At the same time, the use of urine instead of blood samples could help preventing newborns blood spoliation. PMID:24031170
-
Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm
2012-01-01
We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644
-
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
-
Methods and materials, for locating and studying spotted owls.
Eric D. Forsman
1983-01-01
Nocturnal calling surveys are the most effective and most frequently used technique for locating spotted owls. Roosts and general nest locations may be located during the day by calling in suspected roost or nest areas. Specific nest trees are located by: (1) baiting with a live mouse to induce owls to visit the nest, (2) calling in suspected nest areas to stimulate...
-
W. Andrew Cox; Frank R. III Thompson; John Faaborg
2012-01-01
Knowledge of the relative contributions of predator species to overall rates of nest predation can improve our understanding of why predation risk varies, but the identity of predators is seldom known. We used video technology to identify nest predators of the tree-nesting Acadian Flycatcher (Empidonax virescens) and the shrub-nesting Indigo Bunting...
-
Rohatensky, Mitchell G; Livingstone, Devon M; Mintchev, Paul; Barnes, Heather K; Nakoneshny, Steven C; Demetrick, Douglas J; Dort, Joseph C; van Marle, Guido
2018-02-08
Oropharyngeal Squamous Cell Carcinoma (OPSCC) is increasing in incidence despite a decline in traditional risk factors. Human Papilloma Virus (HPV), specifically subtypes 16, 18, 31 and 35, has been implicated as the high-risk etiologic agent. HPV positive cancers have a significantly better prognosis than HPV negative cancers of comparable stage, and may benefit from different treatment regimens. Currently, HPV related carcinogenesis is established indirectly through Immunohistochemistry (IHC) staining for p16, a tumour suppressor gene, or polymerase chain reaction (PCR) that directly tests for HPV DNA in biopsied tissue. Loop mediated isothermal amplification (LAMP) is more accurate than IHC, more rapid than PCR and is significantly less costly. In previous work we showed that a subtype specific HPV LAMP assay performed similar to PCR on purified DNA. In this study we examined the performance of this LAMP assay without DNA purification. We used LAMP assays using established primers for HPV 16 and 18, and new primers for HPV 31 and 35. LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum viral copy number detection thresholds. LAMP was then performed directly on different human cell line samples without DNA purification. Our LAMP assays could detect 10 5 , 10 3 , 10 4 , and 10 5 copies of plasmid DNA for HPV 16, 18, 31, and 35, respectively. All primer sets were subtype specific, with no cross-amplification. Our LAMP assays also reliably amplified subtype specific HPV DNA from samples without requiring DNA isolation and purification. The high risk OPSCC HPV subtype specific LAMP primer sets demonstrated, excellent clinically relevant, minimum copy number detection thresholds with an easy readout system. Amplification directly from samples without purification illustrated the robust nature of the assay, and the primers used. This lends further support HPV type specific LAMP assays, and these specific primer sets and assays can be further developed to test for HPV in OPSCC in resource and lab limited settings, or even bedside testing.
-
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
-
Clifton, D.R.; Rodriguez, R.J.
1997-01-01
A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.
-
Clifton, D.R.; Rodriguez, R.J.
1997-01-01
A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.
-
Identifying of meat species using polymerase chain reaction (PCR)
NASA Astrophysics Data System (ADS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-11-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
-
Arancia, Silvia; Sandini, Silvia; De Carolis, Elena; Vella, Antonietta; Sanguinetti, Maurizio; Norelli, Sandro; De Bernardis, Flavia
2016-10-01
Aspergillus species are the cause of invasive mold infections in immunocompromised patients: Aspergillus fumigatus, A. flavus and A. terreus account for most cases of invasive aspergillosis (IA). As certain species are associated with higher mortality and vary in their resistance to antifungal therapy, diagnosis requires increasingly rapid molecular methods that enable sensitive detection and species discrimination. We have developed PCR and Multiplex PCR assays for the detection of six medically important Aspergillus spp. species DNA in bronchoalveolar lavage (BAL) specimens from hematology and intensive care unit (ICU) patients at risk of IA, using different species and genus-specific PCR primers, selected within the SCW4 gene, encoding a cell wall glucanase of A. fumigatus, similar to mannoprotein Mp65 of Candida albicans. The genus-specific PCR primers were able to amplify only Aspergillus DNAs but not that belonging to other fungal genera tested. The species-specific PCR primers allowed differentiation of each Aspergillus species by the amplicon length produced. The methods described in this study are rapid (less than 4 h), reproducible, simple and specific and demonstrate potential application in the clinical laboratory.
-
Identifying of meat species using polymerase chain reaction (PCR)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Foong, Chow Ming; Sani, Norrakiah Abdullah
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less
-
Maheshwar, P.K.; Moharram, S. Ahmed; Janardhana, G.R.
2009-01-01
The study reports the occurrence of fumonisin producing Fusarium verticillioides in 90 samples of stored paddy (Oryza sativa L.) collected from different geographical regions of Karnataka, India. Fumonisin producing F. verticillioides was identified based on micromorphological characteristics and PCR using two sets of primers. One set of primers was F. verticillioides species specific, which selectively amplified the intergenic space region of rDNA. The other set of primers was specific to fumonisin producing F. verticillioides. Eight paddy samples were positive for F. verticillioides. Eleven isolates obtained from these samples were capable of producing fumonisin. PMID:24031332
-
This manuscript describes two years of field research on ground-nesting songbird species at Zumwalt Prairie Reserve, northeastern Oregon, USA. Cattle-grazing has long been suspected in declines of ground-nesting songbirds in grazed grassland, primarily due to increased trampling...
-
Detection of two fungal biocontrol agents against root-knot nematodes by RAPD markers.
Zhu, Ming Liang; Mo, Ming He; Xia, Zhen Yuan; Li, Yun Hua; Yang, Shu Jun; Li, Tian Fei; Zhang, Ke Qin
2006-05-01
The strain ZK7 of Pochonia chlamydosporia var. chlamydosporia and IPC of Paecilomyces lilacinus are highly effective in the biological control against root-knot nematodes infecting tobacco. When applied, they require a specific monitoring method to evaluate the colonization and dispersal in soil. In this work, the randomly amplified polymorphic DNA (RAPD) technique was used to differentiate between the two individual strains and 95 other isolates, including isolates of the same species and common soil fungi. This approach allowed the selection of specific fragments of 1.2 kb (Vc1200) and 2.0 kb (Vc2000) specific for ZK7, 1.4 kb (P1400) and 0.85 kb (P850) specific for IPC, using the random Primers OPL-02, OPD-05, OPD-05 and OPC-11, respectively. These fragments were cloned, sequenced, and used to design sequence-characterized amplification region (SCAR) primers specific for the two strains. In classical polymerase chain reaction (PCR), with serial dilution of ZK7 and IPC pure culture DNAs template, the detection limits of these oligonucleotide SCAR-PCR primers were found to be 10, 1000, 500, 100 pg, respectively. In the dot blotting, digoxigenin (DIG)-labeled amplicons from these four primers specifically recognized the corresponding fragments in the DNAs template of these two strains. The detection limit of these amplicons were 0.2, 0.2, 0.5, 0.5 mug, respectively.
-
Ikenoue, Takashi; Trindade, Michael C D; Lee, Mel S; Lin, Eric Y; Schurman, David J; Goodman, Stuart B; Smith, R Lane
2003-01-01
This study addressed the hypothesis that duration and magnitude of applied intermittent hydrostatic pressure (IHP) are critical parameters in regulation of normal human articular chondrocyte aggrecan and type II collagen expression. Articular chondrocytes were isolated from knee cartilage and maintained as primary, high-density monolayer cultures. IHP was applied at magnitudes of 1, 5 and 10 MPa at 1 Hz for durations of either 4 h per day for one day (4 x 1) or 4 h per day for four days (4 x 4). Total cellular RNA was isolated and analyzed for aggrecan and type II collagen mRNA signal levels using specific primers and reverse transcription polymerase chain reaction (RT-PCR) nested with beta-actin primers as internal controls. With a 4x1 loading regimen, aggrecan mRNA signal levels increased 1.3- and 1.5-fold at 5 and 10 MPa, respectively, relative to beta-actin mRNA when compared to unloaded cultures. Changing the duration of loading to a 4x4 regimen increased aggrecan mRNA signal levels by 1.4-, 1.8- and 1.9-fold at loads of 1, 5 and 10 MPa, respectively. In contrast to the effects of IHP on aggrecan, type II collagen mRNA signal levels were only upregulated at loads of 5 and 10 MPa with the 4x4 loading regimen. Analysis of cell-associated protein by western blotting confirmed that IHP increased aggrecan and type II collagen in chondrocyte extracts. These data demonstrate that duration and magnitude of applied IHP differentially alter chondrocyte matrix protein expression. The results show that IHP provides an important stimulus for increasing cartilage matrix anabolism and may contribute to repair and regeneration of damaged or diseased cartilage.
-
Frequent Detection and Genetic Diversity of Human Bocavirus in Urban Sewage Samples.
Iaconelli, M; Divizia, M; Della Libera, S; Di Bonito, P; La Rosa, Giuseppina
2016-12-01
The prevalence and genetic diversity of human bocaviruses (HBoVs) in sewage water samples are largely unknown. In this study, 134 raw sewage samples from 25 wastewater treatment plants (WTPs) in Italy were analyzed by nested PCR and sequencing using species-specific primer pairs and broad-range primer pairs targeting the capsid proteins VP1/VP2. A large number of samples (106, 79.1 %) were positive for HBoV. Out of these, 49 were classified as HBoV species 2, and 27 as species 3. For the remaining 30 samples, sequencing results showed mixed electropherograms. By cloning PCR amplicons and sequencing, we confirmed the copresence of species 2 and 3 in 29 samples and species 2 and 4 in only one sample. A real-time PCR assay was also performed, using a newly designed TaqMan assay, for quantification of HBoVs in sewage water samples. Viral load quantification ranged from 5.51E+03 to 1.84E+05 GC/L (mean value 4.70E+04 GC/L) for bocavirus 2 and from 1.89E+03 to 1.02E+05 GC/L (mean value 2.27E+04 GC/L) for bocavirus 3. The wide distribution of HBoV in sewages suggests that this virus is common in the population, and the most prevalent are the species 2 and 3. HBoV-4 was also found, representing the first detection of this species in Italy. Although there is no indication of waterborne transmission for HBoV, the significant presence in sewage waters suggests that HBoV may spread to other water environments, and therefore, a potential role of water in the HBoV transmission should not be neglected.
-
An optimised protocol for molecular identification of Eimeria from chickens.
Kumar, Saroj; Garg, Rajat; Moftah, Abdalgader; Clark, Emily L; Macdonald, Sarah E; Chaudhry, Abdul S; Sparagano, Olivier; Banerjee, Partha S; Kundu, Krishnendu; Tomley, Fiona M; Blake, Damer P
2014-01-17
Molecular approaches supporting identification of Eimeria parasites infecting chickens have been available for more than 20 years, although they have largely failed to replace traditional measures such as microscopy and pathology. Limitations of microscopy-led diagnostics, including a requirement for specialist parasitological expertise and low sample throughput, are yet to be outweighed by the difficulties associated with accessing genomic DNA from environmental Eimeria samples. A key step towards the use of Eimeria species-specific PCR as a sensitive and reproducible discriminatory tool for use in the field is the production of a standardised protocol that includes sample collection and DNA template preparation, as well as primer selection from the numerous PCR assays now published. Such a protocol will facilitate development of valuable epidemiological datasets which may be easily compared between studies and laboratories. The outcome of an optimisation process undertaken in laboratories in India and the UK is described here, identifying four steps. First, samples were collected into a 2% (w/v) potassium dichromate solution. Second, oocysts were enriched by flotation in saturated saline. Third, genomic DNA was extracted using a QIAamp DNA Stool mini kit protocol including a mechanical homogenisation step. Finally, nested PCR was carried out using previously published primers targeting the internal transcribed spacer region 1 (ITS-1). Alternative methods tested included sample processing in the presence of faecal material, DNA extraction using a traditional phenol/chloroform protocol, the use of SCAR multiplex PCR (one tube and two tube versions) and speciation using the morphometric tool COCCIMORPH for the first time with field samples. Copyright © 2013 Dirk Vulpius The Authors. Published by Elsevier B.V. All rights reserved.
-
Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E
1999-01-01
A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.
-
Dual phase multiplex polymerase chain reaction
Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL
2008-10-07
Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.
-
Lenzi, M; Bellentani, S; Saccoccio, G; Muratori, P; Masutti, F; Muratori, L; Cassani, F; Bianchi, F B; Tiribelli, C
1999-09-01
Several retrospective and prospective studies report an increased prevalence of non-organ-specific autoantibodies (NOSAs) in patients with hepatitis C virus (HCV) related chronic liver disease (CLD). Some of the data so far available are controversial and the true prevalence of NOSAs in the general population is still not known. To explore the prevalence of NOSAs, their relation to different HCV genotypes, and the presence and severity of CLD in the general population of Northern Italy. All 226 anti-HCV positive and 87 hepatitis B surface antigen (HBsAg) positive patients of the Dionysos cohort study were analysed and compared with sex and age matched cases (226) negative for both anti-HCV antibody and HBsAg selected from the same cohort. Sera tested for the presence of NOSAs (anti-nuclear antibody (ANA), anti-smooth muscle antibody (SMA), and anti-liver/kidney microsomes type 1 antibody (LKM1)) were screened by indirect immunofluorescence at a 1:40 serum dilution. HCV RNA and HCV genotypes were also determined by nested polymerase chain reaction (PCR) of the 5' non-coding region and by PCR amplification of the core region with type specific primers. The overall prevalence of NOSA reactivity was significantly higher in anti-HCV positive subjects than in both normal and pathological controls (25% v 6% and 7% respectively, p<0.05). ANA, SMA, and LKM1 occurred in 16, 10, and 1. 3% of cases respectively. No specific association between NOSAs and a specific HCV genotype was found. NOSAs were found more often associated with more than one genotype (35.7%) and with untypable genotypes (34.6%), although the association was not statistically significant. NOSAs were associated with HCV RNA and CLD but not with the presence of cirrhosis and/or hepatocellular carcinoma. On univariate analysis, NOSA reactivity was independently associated with abnormal alanine aminotransferase (p<0.01) and gamma-glutamyltranspeptidase levels (p<0.05). The risk for the presence of NOSAs was 5.1 times higher in anti-HCV subjects than in controls. In the general population the prevalence of NOSAs is higher in anti-HCV positive subjects than in normal or disease controls. Moreover NOSAs are associated with CLD and with a more active disease in terms of alanine aminotransferase activity.
-
Kokosková, B; Mráz, I; Fousek, J
2010-05-01
Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.
-
Phenology largely explains taller grass at successful nests in greater sage-grouse.
Smith, Joseph T; Tack, Jason D; Doherty, Kevin E; Allred, Brady W; Maestas, Jeremy D; Berkeley, Lorelle I; Dettenmaier, Seth J; Messmer, Terry A; Naugle, David E
2018-01-01
Much interest lies in the identification of manageable habitat variables that affect key vital rates for species of concern. For ground-nesting birds, vegetation surrounding the nest may play an important role in mediating nest success by providing concealment from predators. Height of grasses surrounding the nest is thought to be a driver of nest survival in greater sage-grouse ( Centrocercus urophasianus ; sage-grouse), a species that has experienced widespread population declines throughout their range. However, a growing body of the literature has found that widely used field methods can produce misleading inference on the relationship between grass height and nest success. Specifically, it has been demonstrated that measuring concealment following nest fate (failure or hatch) introduces a temporal bias whereby successful nests are measured later in the season, on average, than failed nests. This sampling bias can produce inference suggesting a positive effect of grass height on nest survival, though the relationship arises due to the confounding effect of plant phenology, not an effect on predation risk. To test the generality of this finding for sage-grouse, we reanalyzed existing datasets comprising >800 sage-grouse nests from three independent studies across the range where there was a positive relationship found between grass height and nest survival, including two using methods now known to be biased. Correcting for phenology produced equivocal relationships between grass height and sage-grouse nest survival. Viewed in total, evidence for a ubiquitous biological effect of grass height on sage-grouse nest success across time and space is lacking. In light of these findings, a reevaluation of land management guidelines emphasizing specific grass height targets to promote nest success may be merited.
-
Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.
Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L
2010-01-01
Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.
-
Plastid primers for angiosperm phylogenetics and phylogeography.
Prince, Linda M
2015-06-01
PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.
-
Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin
2015-01-01
To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p<0.05). Patients with early EOC had markedly lower serum CA125 than those with advanced EOC (p<0.05), but there was no significant difference in free DNA methylation (p>0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (p<0.05). In the detection of patients with advanced EOC, the PPV of CA125 detection was obviously lower than that of multiplex nested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.
-
A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR
Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven
2016-01-01
Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800
-
Taverniers, Isabel; Windels, Pieter; Vaïtilingom, Marc; Milcamps, Anne; Van Bockstaele, Erik; Van den Eede, Guy; De Loose, Marc
2005-04-20
Since the 18th of April 2004, two new regulations, EC/1829/2003 on genetically modified food and feed products and EC/1830/2003 on traceability and labeling of GMOs, are in force in the EU. This new, comprehensive regulatory framework emphasizes the need of an adequate tracing system. Unique identifiers, such as the transgene genome junction region or a specific rearrangement within the transgene DNA, should form the basis of such a tracing system. In this study, we describe the development of event-specific tracing systems for transgenic maize lines Bt11, Bt176, and GA21 and for canola event GT73. Molecular characterization of the transgene loci enabled us to clone an event-specific sequence into a plasmid vector, to be used as a marker, and to develop line-specific primers. Primer specificity was tested through qualitative PCRs and dissociation curve analysis in SYBR Green I real-time PCRs. The primers were then combined with event-specific TaqMan probes in quantitative real-time PCRs. Calibration curves were set up both with genomic DNA samples and the newly synthesized plasmid DNA markers. It is shown that cloned plasmid GMO target sequences are perfectly suitable as unique identifiers and quantitative calibrators. Together with an event-specific primer pair and a highly specific TaqMan probe, the plasmid markers form crucial components of a unique and straighforward tracing system for Bt11, Bt176, and GA21 maize and GT73 canola events.
-
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
-
Identification of hare meat by a species-specific marker of mitochondrial origin.
Santos, Cristina G; Melo, Vitor S; Amaral, Joana S; Estevinho, Letícia; Oliveira, M Beatriz P P; Mafra, Isabel
2012-03-01
Meat species identification in food has gained increasing interest in recent years due to public health, economic and legal concerns. Following the consumer trend towards high quality products, game meat has earned much attention. The aim of the present work was to develop a DNA-based technique able to identify hare meat. Mitochondrial cytochrome b gene was used to design species-specific primers for hare detection. The new primers proved to be highly specific to Lepus species, allowing the detection of 0.01% of hare meat in pork meat by polymerase chain reaction (PCR). A real-time PCR assay with the new intercalating EvaGreen dye was further proposed as a specific and fast tool for hare identification with increased sensitivity (1pg) compared to end-point PCR (10pg). It can be concluded that the proposed new primers can be used by both species-specific end-point PCR or real-time PCR to accurately authenticate hare meat. Copyright © 2011 Elsevier Ltd. All rights reserved.
-
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C
2004-11-01
To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.
-
Ohlendorf, Harry M.; Hothem, Roger L.; Welsh, Daniel
1989-01-01
During 1983-1985, we studied the reproductive success of several species of aquatic birds (coots, ducks, shorebirds, and grebes) nesting at two sites in Merced County, California: a selenium-contaminated site (Kesterson Reservoir) and a nearby reference site (Volta Wildlife Area). We used a computer program (MICROMORT) developed for the analysis of radiotelemetry data (Heisey and Fuller 1985) to estimate nest success and cause-specific failure rates, and then compared these parameters and hatchability between sites and among years. Nest success and causes of failure varied by species, site, and year. The most important causes of nest failure were usually predation, desertion, and water-level changes. However, embryotoxicosis (mortality, deformity, and lack of embryonic development) was the most important cause of nest failure in Eared Grebes (Podiceps nigricollis) at Kesterson Reservoir. Embryotoxicosis also reduced the hatchability of eggs of all other species at Kesterson in one or more years; embryonic mortality occurred rarely at Volta, and abnormalities were not observed.
-
Nehring, Volker; Dani, Francesca R; Calamai, Luca; Turillazzi, Stefano; Bohn, Horst; Klass, Klaus-Dieter; d'Ettorre, Patrizia
2016-08-05
Cockroaches of the genus Attaphila regularly occur in leaf-cutting ant colonies. The ants farm a fungus that the cockroaches also appear to feed on. Cockroaches disperse between colonies horizontally (via foraging trails) and vertically (attached to queens on their mating flights). We analysed the chemical strategies used by the cockroaches to integrate into colonies of Atta colombica and Acromyrmex octospinosus. Analysing cockroaches from nests of two host species further allowed us to test the hypothesis that nestmate recognition is based on an asymmetric mechanism. Specifically, we test the U-present nestmate recognition model, which assumes that detection of undesirable cues (non-nestmate specific substances) leads to strong rejection of the cue-bearers, while absence of desirable cues (nestmate-specific substances) does not necessarily trigger aggression. We found that nests of Atta and Acromyrmex contained cockroaches of two different and not yet described Attaphila species. The cockroaches share the cuticular chemical substances of their specific host species and copy their host nest's colony-specific cuticular profile. Indeed, the cockroaches are accepted by nestmate but attacked by non-nestmate ant workers. Cockroaches from Acromyrmex colonies bear a lower concentration of cuticular substances and are less likely to be attacked by non-nestmate ants than cockroaches from Atta colonies. Nest-specific recognition of Attaphila cockroaches by host workers in combination with nest-specific cuticular chemical profiles suggest that the cockroaches mimic their host's recognition labels, either by synthesizing nest-specific substances or by substance transfer from ants. Our finding that the cockroach species with lower concentration of cuticular substances receives less aggression by both host species fully supports the U-present nestmate recognition model. Leaf-cutting ant nestmate recognition is thus asymmetric, responding more strongly to differences than to similarities.
-
[Design of primers to DNA of lactic acid bacteria].
Lashchevskiĭ, V V; Kovalenko, N K
2003-01-01
Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.
-
Georges, Arthur
1989-11-01
Mean daily temperature in natural nests of freshwater turtles with temperature-dependent sex determination is known to be a poor predictor of hatchling sex ratios when nest temperatures fluctuate. To account for this, a model was developed on the assumption that females will emerge from eggs when more than half of embryonic development occurs above the threshold temperature for sex determination rather than from eggs that spend more than half their time above the threshold. The model is consistent with previously published data and in particular explains the phenomenon whereby the mean temperature that best distinguishes between male and female nests decreases with increasing variability in nest temperature. The model, if verified by controlled experiments, has important implications for our understanding of temperature-dependent sex determination in natural nests. Both mean nest temperature and "hours spent above the threshold" will be poor predictors of hatchling sex ratios. Studies designed to investigate latitudinal trends and inter-specific differences in the threshold temperature will need to consider latitudinal and inter-specific variation in the magnitude of diel fluctuations in nest temperature, and variation in factors influencing the magnitude of those fluctuations, such as nest depth. Furthermore, any factor that modifies the relationship between developmental rate and temperature can be expected to influence hatchling sex ratios in natural nests, especially when nest temperatures are close to the threshold.
-
Occurrence of Stolbur Phytoplasma Disease in Spreading Type Petunia hybrida Cultivars in Korea
Chung, Bong Nam; Jeong, Myeong Il; Choi, Seung Kook; Joa, Jae Ho; Choi, Kyeong San; Choi, In Myeong
2013-01-01
In January 2012, spreading type petunia cv. Wave Pink plants showing an abnormal growth habit of sprouting unusual multiple plantlets from the lateral buds were collected from a greenhouse in Gwacheon, Gyeonggi Province, Korea. The presence of phytoplasma was investigated using PCR with the primer pairs P1/P6, and R16F1/R1 for nested-PCR. In the nested PCR, 1,096 bp PCR products were obtained, and through sequencing 12 Pet-Stol isolates were identified. Comparison of the nucleotide sequences of 16S rRNA gene of the 12 Pet-Stol isolates with other phytoplasmas belonging to aster yellows or Stolbur showed that Pet-Stol isolates were members of Stolbur. The presence of phytoplasma in petunia was also confirmed by microscopic observation of the pathogens. In this study, Stolbur phytoplasma was identified from spreading type petunia cultivars by sequence analysis of 16S rRNA gene of phytoplasma and microscopic observation of phytoplasma bodies. This is the first report of Stolbur phytoplasma in commercial Petunia hybrida cultivars. PMID:25288978
-
Exploring Microbial Iron Oxidation in Wetland Soils
NASA Astrophysics Data System (ADS)
Wang, J.; Muyzer, G.; Bodelier, P. L. E.; den Oudsten, F.; Laanbroek, H. J.
2009-04-01
Iron is one of the most abundant elements on earth and is essential for life. Because of its importance, iron cycling and its interaction with other chemical and microbial processes has been the focus of many studies. Iron-oxidizing bacteria (FeOB) have been detected in a wide variety of environments. Among those is the rhizosphere of wetland plants roots which release oxygen into the soil creating suboxic conditions required by these organisms. It has been reported that in these rhizosphere microbial iron oxidation proceeds up to four orders of magnitude faster than strictly abiotic oxidation. On the roots of these wetland plants iron plaques are formed by microbial iron oxidation which are involved in the sequestering of heavy metals as well organic pollutants, which of great environmental significance.Despite their important role being catalysts of iron-cycling in wetland environments, little is known about the diversity and distribution of iron-oxidizing bacteria in various environments. This study aimed at developing a PCR-DGGE assay enabling the detection of iron oxidizers in wetland habitats. Gradient tubes were used to enrich iron-oxidizing bacteria. From these enrichments, a clone library was established based on the almost complete 16s rRNA gene using the universal bacterial primers 27f and 1492r. This clone library consisted of mainly α- and β-Proteobacteria, among which two major clusters were closely related to Gallionella spp. Specific probes and primers were developed on the basis of this 16S rRNA gene clone library. The newly designed Gallionella-specific 16S rRNA gene primer set 122f/998r was applied to community DNA obtained from three contrasting wetland environments, and the PCR products were used in denaturing gradient gel electrophoresis (DGGE) analysis. A second 16S rRNA gene clone library was constructed using the PCR products from one of our sampling sites amplified with the newly developed primer set 122f/998r. The cloned 16S rRNA gene sequences all represented novel culturable iron oxidizers most closely related to Gallionella spp. Based on their nucleotide sequences four groups could be identified, which were comparable to the DGGE banding pattern obtained before with the gradient tubes enrichments. The above mentioned nested PCR-DGGE method was used to study the distribution and community composition of Gallionella-like iron-oxidizing bacteria under the influence of plants species, soil depth, as well as season. Soil samples from Appels, Belgium, an intertidal, freshwater marsh known to hold intensive iron cycling, were taken from 5 different vegetation types in April, July and October 2007. Soil cores were sliced at 1-cm intervals and subjected to chemical and molecular analyses. The DGGE patterns showed that the community of iron-oxidizing bacteria differed with vegetation type, and sediment depth. Samples taken in autumn held lower diversity in Gallionella-related iron oxidizers than those sampled in spring and summer.
-
Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi
2013-03-01
Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
-
Koester, Meike; Gergs, René
2017-10-05
Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.
-
Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui
2016-11-22
Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.
-
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Macente, Sara; Fujimura Leite, Clarice Queico; Santos, Adolfo Carlos Barreto; Siqueira, Vera Lúcia Dias; Machado, Luzia Neri Cosmo; Marcondes, Nadir Rodrigues; Hirata, Mario Hiroyuki; Hirata, Rosário Dominguez Crespo
2013-01-01
Current study evaluated the hsp65 Nested PCR Restriction Fragment Length Polymorphism Analysis (hsp65 Nested PCR-PRA) to detect and identify Mycobacterium tuberculosis complex directly in clinical samples for a rapid and specific diagnosis of tuberculosis (TB). hsp65 Nested PCR-PRA was applied directly to 218 clinical samples obtained from 127 patients suspected of TB or another mycobacterial infection from July 2009 to July 2010. The hsp65 Nested PCR-PRA showed 100% sensitivity and 95.0 and 93.1% specificity in comparison with culture and microscopy (acid fast bacillus smear), respectively. hsp65 Nested PCR-PRA was shown to be a fast and reliable assay for diagnosing TB, which may contribute towards a fast diagnosis that could help the selection of appropriate chemotherapeutic and early epidemiological management of the cases which are of paramount importance in a high TB burden country. PMID:24260739
-
Asvapathanagul, P; Olson, B H
2017-01-01
To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.
-
Ryder, Thomas B; Reitsma, Robert; Evans, Brian; Marra, Peter P
2010-03-01
Despite the increasing pace of urbanization little is known about the factors that limit bird populations (i.e., population-level processes) within the urban/suburban land-use matrix. Here, we report rates of nest survival within the matrix of an urban land-use gradient in the greater Washington, D.C., USA, area for five common songbirds using data collected by scientists and citizens as part of a project called Neighborhood Nestwatch. Using program MARK, we modeled the effects of species, urbanization at multiple spatial scales (canopy cover and impervious surface), and observer (citizen vs. scientist) on nest survival of four open-cup and one cavity-nesting species. In addition, artificial nests were used to determine the relative impacts of specific predators along the land-use gradient. Our results suggest that predation on nests within the land-use matrix declines with urbanization but that there are species-specific differences. Moreover, variation in nest survival among species was best explained by urbanization metrics measured at larger "neighborhood" spatial scales (e.g., 1000 m). Trends were supported by data from artificial nests and suggest that variable predator communities (avian vs. mammalian) are one possible mechanism to explain differential nest survival. In addition, we assessed the quality of citizen science data and show that citizens had no negative effect on nest survival and provided estimates of nest survival comparable to Smithsonian biologists. Although birds nesting within the urban matrix experienced higher nest survival, individuals also faced a multitude of other challenges such as contaminants and invasive species, all of which could reduce adult survival.
-
Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun
2016-01-01
Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378
-
Kristensen, Lasse S; Andersen, Gitte B; Hager, Henrik; Hansen, Lise Lotte
2012-01-01
Sensitive and specific mutation detection is of particular importance in cancer diagnostics, prognostics, and individualized patient treatment. However, the majority of molecular methodologies that have been developed with the aim of increasing the sensitivity of mutation testing have drawbacks in terms of specificity, convenience, or costs. Here, we have established a new method, Competitive Amplification of Differentially Melting Amplicons (CADMA), which allows very sensitive and specific detection of all mutation types. The principle of the method is to amplify wild-type and mutated sequences simultaneously using a three-primer system. A mutation-specific primer is designed to introduce melting temperature decreasing mutations in the resulting mutated amplicon, while a second overlapping primer is designed to amplify both wild-type and mutated sequences. When combined with a third common primer very sensitive mutation detection becomes possible, when using high-resolution melting (HRM) as detection platform. The introduction of melting temperature decreasing mutations in the mutated amplicon also allows for further mutation enrichment by fast coamplification at lower denaturation temperature PCR (COLD-PCR). For proof-of-concept, we have designed CADMA assays for clinically relevant BRAF, EGFR, KRAS, and PIK3CA mutations, which are sensitive to, between 0.025% and 0.25%, mutated alleles in a wild-type background. In conclusion, CADMA enables highly sensitive and specific mutation detection by HRM analysis. © 2011 Wiley Periodicals, Inc.
-
[Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].
Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun
2009-10-01
To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.
-
Whittier, J M; Corrie, F; Limpus, C
1997-04-01
Plasma levels of four hormones-progesterone (P), testosterone (T), estradiol 17-beta (E2), and corticosterone (B)-were measured in samples taken from nesting female loggerhead turtles (Caretta caretta) by using specific radioimmunoassays. Samples were taken in an early, middle, or late period during the summer nesting season from females at first, second, third, or > fourth nesting episodes, defined as successive within-season nesting events, at Mon Repos Beach, Queensland, Australia. Data on individual patterns of nesting, collected over the past 20 years by the Queensland Turtle Research Project, and the seasonal nesting data, were analyzed with respect to influences on hormonal profiles. Circulating levels of E2 were mostly undetectable, suggesting either that this estrogen is not produced at this time of nesting, or that, perhaps, another estrogen may be present that is not detected by the specific radioimmunoassay. P, T, and B profiles in the nesting females were associated with the individual turtles' progression through successive nesting episodes, with a marked decline in all three hormones by the last (> 4) nesting episode of the season. Nesting episode accounted for significant changes that were related to season, in that nesting episode and season were significantly correlated. These patterns were observed in the population, when singly sampled at each time period or nesting episode, and in individual females sampled repeatedly over time. Moreover, T and B were highly and significantly correlated in females at all nesting episodes and time periods, and in the singly and repeatedly sampled females. The magnitude of change in T and B over time was also highly and significantly correlated in repeatedly sampled females. Together these results suggest the hypothesis that T and B interact over the period of successive nesting and may be involved in reproductive functions such as the mobilization of reserves for egg production in C. caretta.
-
Sclerotinia homoeocarpa Overwinters in Turfgrass and Is Present in Commercial Seed
Rioux, Renée A.; Shultz, Jeanette; Garcia, Michelle; Willis, David Kyle; Casler, Michael; Bonos, Stacy; Smith, Damon; Kerns, James
2014-01-01
Dollar spot is the most economically important disease of amenity turfgrasses in the United States, yet little is known about the source of primary inoculum for this disease. With the exception of a few isolates from the United Kingdom, Sclerotinia homoeocarpa, the causal agent of dollar spot, does not produce spores. Consequently, it was assumed that overwintering of this organism in soil, thatch, and plant debris provides primary inoculum for dollar spot epidemics. Overwintering of S. homoeocarpa in roots and shoots of symptomatic and asymptomatic creeping bentgrass turfgrass was quantified over the course of a three-year field experiment. Roots did not consistently harbor S. homoeocarpa, whereas S. homoeocarpa was isolated from 30% of symptomatic shoots and 10% of asymptomatic shoots in the spring of two out of three years. The presence of stroma-like pathogen material on leaf blades was associated with an increase in S. homoeocarpa isolation and colony diameter at 48 hpi. Commercial seed has also been hypothesized to be a potential source of initial inoculum for S. homoeocarpa. Two or more commercial seed lots of six creeping bentgrass cultivars were tested for contamination with S. homoeocarpa using culture-based and molecular detection methods. A viable, pathogenic isolate of S. homoeocarpa was isolated from one commercial seed lot and contamination of this lot was confirmed with nested PCR using S. homoeocarpa specific primers. A sensitive nested PCR assay detected S. homoeocarpa contamination in eight of twelve (75%) commercial seed lots. Seed source, but not cultivar or resistance to dollar spot, influenced contamination by S. homoeocarpa. Overall, this research suggests that seeds are a potential source of initial inoculum for dollar spot epidemics and presents the need for further research in this area. PMID:25333928
-
Lau, K C K; Osiowy, C; Giles, E; Lusina, B; van Marle, G; Burak, K W; Coffin, C S
2018-06-01
Recent studies suggest that withdrawal of hepatitis B immune globulin (HBIG) and nucleos(t)ide analogues (NA) prophylaxis may be considered in HBV surface antigen (HBsAg)-negative liver transplant (LT) recipients with a low risk of disease recurrence. However, the frequency of occult HBV infection (OBI) and HBV variants after LT in the current era of potent NA therapy is unknown. Twelve LT recipients on prophylaxis were tested in matched plasma and peripheral blood mononuclear cells (PBMCs) for HBV quasispecies by in-house nested PCR and next-generation sequencing of amplicons. HBV covalently closed circular DNA (cccDNA) was detected in Hirt DNA isolated from PBMCs with cccDNA-specific primers and confirmed by nucleic acid hybridization and Sanger sequencing. HBV mRNA in PBMC was detected with reverse-transcriptase nested PCR. In LT recipients on immunosuppressive therapy (10/12 male; median age 57.5 [IQR: 39.8-66.5]; median follow-up post-LT 60 months; 6 pre-LT hepatocellular carcinoma [HCC]), 9 were HBsAg-. HBV DNA was detected in all plasma and PBMC tested; cccDNA and/or mRNA was detected in the PBMC of 10/12 patients. Significant HBV quasispecies diversity (ie 143-2212 nonredundant HBV species) was noted in both sites, and single nucleotide polymorphisms associated with cirrhosis and HCC were detected at varying frequencies. In conclusion, OBI and HBV variants associated with severe liver disease persist in LT recipients on prophylaxis. Although HBV control and cccDNA transcriptional silencing may occur despite immunosuppression, complete virological eradication does not occur in LT recipients with a history of HBV-related end-stage liver disease. © 2018 John Wiley & Sons Ltd.
-
2014-01-01
Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511
-
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
-
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...
2018-03-27
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meagher, Robert J.; Priye, Aashish; Light, Yooli K.
Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less
-
Bokulich, Nicholas A.
2013-01-01
Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949
-
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
-
Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR
Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo
2005-01-01
A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001
-
Nest materials as a source of genetic data for avian ecological studies
Pearce, J.M.; Fields, R.L.; Scribner, K.T.
1997-01-01
We examined the utility of feathers and egg shell membranes, deposited in the nests of Spectacled Eiders (Somateria fischeri), as a source of DNA for genetic studies at both the population and individual level. The potential for feather DNA contamination as a result of female behavioral interactions (e.g. nest parasitism), reuse of nest sites from previous years, or other unknown occurrences was acknowledged and specifically tested. DNA was successfully extracted from both feathers and egg shell membranes and waterfowl microsatellite loci were used to construct individual genotypes. We found no difference in the genotypes obtained from nest feathers or blood of the incubating female. Detection of nest feather contamination was possible with as little as one feather when samples from multiple females were intentionally mixed. Triplicate DNA extractions from 33 nests provided a means of detecting contamination in 3 nests. Egg membranes proved a viable source of offspring DNA and can contribute valuable data to investigations of parentage when assayed jointly with maternal feather DNA. Nest materials provide an efficient, non-invasive method of genetic sampling that can be readily incorporated into field research. However, the natural history traits and mating strategies of a species must be considered during sample collection to identify the possible sources of nest materials (e.g., paternal, maternal, parasite, etc.). Specific experiments should also be designed to test sampling assumptions.
-
Winn-Deen
1998-12-01
Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.
-
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
-
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-01-01
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711
-
NASA Astrophysics Data System (ADS)
Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.
2015-12-01
Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.
-
[Mapping of seedlessness gene in grapes using SCAR markers].
Yang, Ke-Qiang; Wang, Yue-Jin; Zhang, Jin-Jin; Wang, Xi-Ping; W A N, Yi-Zhen; Zhang, Jian-Xia
2005-03-01
Nine primers (including UBC-269 and GSLP1) were designed and synthesized based on DNA sequences of UBC-269(484) and GSLP1(569). The template DNA from Red Globe (seeded paternal parent) and Flame Seedless (seedless maternal parent) were screened using these primers. For Flame Seedless,GSLP1 yielded specific marker GSLP1(569); No. 39970524-5 primer yielded specific marker 39970524-5-564; and No. 6 primer yielded specific marker 39970524-6-1538 and 39970524-6-1200. GSLP1, No. 39970524-5, and No. 39970524-6 primers were used specifically to screen template DNA from the experimental plant materials. The results showed that the specific markers GSLP1(569), 39970524-5-564,39970524-6-1538 and 39970524-6-1200 were cosegregating with the major seedlessness gene. All these specific loci were also present in Thompson Seedless which was the initial donor of the seedlessness gene. It suggests that these SCAR markers are linked to a major grape seedlessness gene S. Markers order and map distance were estimated using the software 'QTXb17'. This showed that GSLP1(569), 39970524-5-564,39970524-6-1538 and 39970524-6-1200 were tightly linked to gene S. When P = 0.01,confidence limits for map distance ranged from 0.2 to 9.9; standard errors of map distance were from 0.6 to 1.9; LOD for linkage were from 32.7 to 46.4. These markers and the gene S were found to be in the same group. The markers were located on either side of gene S, covering 12.3 cM of the grape genome. The genetic distances between gene S and 39970524-5-564, GSLP1(569), 39970524-6-1538 and 39970524-6-1200 were 0.6 cM, 1.2 cM, 4.9 cM and 11.1 cM respectively.
-
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
-
DNA authentication of animal-derived concentrated Chinese medicine granules.
Jiang, Li-Li; Lo, Yat-Tung; Chen, Wei-Ting; Shaw, Pang-Chui
2016-09-10
Concentrated Chinese medicine granules (CCMG) offer patients a convenient option for traditional therapy. However with morphological and microscopic characteristics lost, it is difficult to authenticate and control the quality of these medicinal products. This study is the first to examine the feasibility of using DNA techniques to authenticate animal-derived CCMG, which has so far lacking of effective means for authentication. Primers targeting amplicons of different sizes were designed to determine the presence of PCR-amplifiable DNA fragments in two types of CCMG, namely Zaocys and Scorpio. Species-specific primers were designed to differentiate the genuine drugs from their adulterants. The specificity of the designed primers was evaluated in crude drugs (including genuine and adulterant) and CCMG. Results showed that by using species-specific primers, DNA fragments of less than 200bp could be isolated from the CCMG and the concerned source materials. This study demonstrated the presence of small size DNA in animal-derived CCMG and the DNA is effective in species identification. The work has extended the application of DNA techniques in herbal medicine and this approach may be further developed for quality control and regulatory compliance in the CCMG industry. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T
1988-05-01
Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.
-
16S rDNA clone libraries were evaluated for detection of fecal source-identifying bacteria from a collapsed equine manure pile. Libraries were constructed using universal eubacterial primers and Bacteroides-Prevotella group-specific primers. Eubacterial sequences indicat...
-
FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS
Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...
-
Kerishnan, Jesinda P.; Gopinath, Subash C.B.; Kai, Sia Bik; Tang, Thean-Hock; Ng, Helen Lee-Ching; Rahman, Zainal Ariff Abdul; Hashim, Uda; Chen, Yeng
2016-01-01
The association between human papillomavirus type 16 (HPV16) and oral cancer has been widely reported. However, detecting anti-HPV antibodies in patient sera to determine risk for oral squamous cell carcinoma (OSCC) has not been well studied. In the present investigation, a total of 206 OSCC serum samples from the Malaysian Oral Cancer Database & Tissue Bank System, with 134 control serum samples, were analyzed by enzyme-linked immunosorbant assay (ELISA) to detect HPV16-specific IgG and IgM antibodies. In addition, nested PCR analysis using comprehensive consensus primers (PGMY09/11 and GP5+/6+) was used to confirm the presence of HPV. Furthermore, we have evaluated the association of various additional causal factors (e.g., smoking, alcohol consumption, and betel quid chewing) in HPV-infected OSCC patients. Statistical analysis of the Malaysian population indicated that OSCC was more prevalent in female Indian patients that practices betel quid chewing. ELISA revealed that HPV16 IgG, which demonstrates past exposure, could be detected in 197 (95.6%) OSCC patients and HPV16-specific IgM was found in a total of 42 (20.4%) OSCC patients, indicating current exposure. Taken together, our study suggest that HPV infection may play a significant role in OSCC (OR: 13.6; 95% CI: 3.89-47.51) and HPV16-specific IgG and IgM antibodies could represent a significant indicator of risk factors in OSCC patients. PMID:27279791
-
Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.
Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun
2007-10-01
Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.
-
Aerospace Non Chrome Corrosion Inhibiting Primer Systems
2009-09-01
Meet all HSE specifications, TSCA, REACh, Akzo • Strippable • No weight increase over current system • Meet specification requirements for corrosion, not...Positive and negative controls • Primer only and topcoated samples Aerospace Coatings | Title 9 OEM CF Optimization/ Down Selects •Usual issues...found to be true • Good NSS ≠ Good filiform ≠ Good cure ≠ Good application properties • Down select process is to minimize ≠ and move to a balance of
-
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
-
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
-
Use of species-specific PCR for the identification of 10 sea cucumber species
NASA Astrophysics Data System (ADS)
Wen, Jing; Zeng, Ling
2014-11-01
We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.
-
Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan
2013-01-01
Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949
-
Wellehan, James F. X.; Johnson, April J.; Harrach, Balázs; Benkö, Mária; Pessier, Allan P.; Johnson, Calvin M.; Garner, Michael M.; Childress, April; Jacobson, Elliott R.
2004-01-01
A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses. PMID:15542689
-
Wellehan, James F X; Johnson, April J; Harrach, Balázs; Benkö, Mária; Pessier, Allan P; Johnson, Calvin M; Garner, Michael M; Childress, April; Jacobson, Elliott R
2004-12-01
A consensus nested-PCR method was designed for investigation of the DNA polymerase gene of adenoviruses. Gene fragments were amplified and sequenced from six novel adenoviruses from seven lizard species, including four species from which adenoviruses had not previously been reported. Host species included Gila monster, leopard gecko, fat-tail gecko, blue-tongued skink, Tokay gecko, bearded dragon, and mountain chameleon. This is the first sequence information from lizard adenoviruses. Phylogenetic analysis indicated that these viruses belong to the genus Atadenovirus, supporting the reptilian origin of atadenoviruses. This PCR method may be useful for obtaining templates for initial sequencing of novel adenoviruses.
-
Nesting behaviour influences species-specific gas exchange across avian eggshells.
Portugal, Steven J; Maurer, Golo; Thomas, Gavin H; Hauber, Mark E; Grim, Tomáš; Cassey, Phillip
2014-09-15
Carefully controlled gas exchange across the eggshell is essential for the development of the avian embryo. Water vapour conductance (G(H2O)) across the shell, typically measured as mass loss during incubation, has been demonstrated to optimally ensure the healthy development of the embryo while avoiding desiccation. Accordingly, eggs exposed to sub-optimal gas exchange have reduced hatching success. We tested the association between eggshell G(H2O) and putative life-history correlates of adult birds, ecological nest parameters and physical characteristics of the egg itself to investigate how variation in G(H2O) has evolved to maintain optimal water loss across a diverse set of nest environments. We measured gas exchange through eggshell fragments in 151 British breeding bird species and fitted phylogenetically controlled, general linear models to test the relationship between G(H2O) and potential predictor parameters of each species. Of our 17 life-history traits, only two were retained in the final model: wet-incubating parent and nest type. Eggs of species where the parent habitually returned to the nest with wet plumage had significantly higher G(H2O) than those of parents that returned to the nest with dry plumage. Eggs of species nesting in ground burrows, cliffs and arboreal cups had significantly higher G(H2O) than those of species nesting on the ground in open nests or cups, in tree cavities and in shallow arboreal nests. Phylogenetic signal (measured as Pagel's λ) was intermediate in magnitude, suggesting that differences observed in the G(H2O) are dependent upon a combination of shared ancestry and species-specific life history and ecological traits. Although these data are correlational by nature, they are consistent with the hypothesis that parents constrained to return to the nest with wet plumage will increase the humidity of the nest environment, and the eggs of these species have evolved a higher G(H2O) to overcome this constraint and still achieve optimal water loss during incubation. We also suggest that eggs laid in cup nests and burrows may require a higher G(H2O) to overcome the increased humidity as a result from the confined nest microclimate lacking air movements through the nest. Taken together, these comparative data imply that species-specific levels of gas exchange across avian eggshells are variable and evolve in response to ecological and physical variation resulting from parental and nesting behaviours. © 2014. Published by The Company of Biologists Ltd.
-
Liu, Da-Fei; Liu, Chun-Guo; Tian, Jin; Jiang, Yi-Tong; Zhang, Xiao-Zhan; Chai, Hong-Liang; Yang, Tian-Kuo; Yin, Xiu-Chen; Zhang, Hong-Ying; Liu, Ming; Hua, Yu-Ping; Qu, Lian-Dong
2015-06-01
Although widespread vaccination against canine distemper virus (CDV) has been conducted for many decades, several canine distemper outbreaks in vaccinated animals have been reported frequently. In order to detect and differentiate the wild-type and vaccine strains of the CDV from the vaccinated animals, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed. A set of four primers-two internal and two external-were designed to target the H gene for the specific detection of wild-type CDV variants. The CDV-H RT-LAMP assay rapidly amplified the target gene, within 60 min, using a water bath held at a constant temperature of 65°C. The assay was 100-fold more sensitive than conventional RT-PCR, with a detection limit of 10(-1)TCID50ml(-1). The system showed a preference for wild-type CDV, and exhibited less sensitivity to canine parvovirus, canine adenovirus type 1 and type 2, canine coronavirus, and canine parainfluenza virus. The assay was validated using 102 clinical samples obtained from vaccinated dog farms, and the results were comparable to a multiplex nested RT-PCR assay. The specific CDV-H RT-LAMP assay provides a simple, rapid, and sensitive tool for the detection of canines infected with wild-type CDV from canines vaccinated with attenuated vaccine. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina
2013-02-01
Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.
-
Vickerman, M M; Brossard, K A; Funk, D B; Jesionowski, A M; Gill, S R
2007-01-01
Phylogenetic analysis of bacterial and archaeal 16S rRNA was used to examine polymicrobial communities within infected root canals of 20 symptomatic and 14 asymptomatic patients. Nucleotide sequences from approximately 750 clones amplified from each patient group with universal bacterial primers were matched to the Ribosomal Database Project II database. Phylotypes from 37 genera representing Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria and Proteobacteria were identified. Results were compared to those obtained with species-specific primers designed to detect Prevotella intermedia, Porphyromonas gingivalis, Porphyromonas endodontalis, Peptostreptococcus micros, Enterococcus sp., Streptococcus sp., Fusobacterium nucleatum, Tannerella forsythensis and Treponema denticola. Since members of the domain Archaea have been implicated in the severity of periodontal disease, and a recent report confirms that archaea are present in endodontic infections, 16S archaeal primers were also used to detect which patients carried these prokaryotes, to determine if their presence correlated with severity of the clinical symptoms. A Methanobrevibacter oralis-like species was detected in one asymptomatic and one symptomatic patient. DNA from root canals of these two patients was further analysed using species-specific primers to determine bacterial cohabitants. Trep. denticola was detected in the asymptomatic but not the symptomatic patient. Conversely, Porph. endodontalis was found in the symptomatic but not the asymptomatic patient. All other species except enterococci were detected with the species-specific primers in both patients. These results confirm the presence of archaea in root canals and provide additional insights into the polymicrobial communities in endodontic infections associated with clinical symptoms.
-
Comparative sequence analyses of sixteen reptilian paramyxoviruses
Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.
1999-01-01
Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.
-
Differentiation of the seven major lyssavirus species by oligonucleotide microarray.
Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun
2012-03-01
An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.
-
Phylogeny of the Celastraceae inferred from phytochrome B gene sequence and morphology.
Simmons, M P; Clevinger, C C; Savolainen, V; Archer, R H; Mathews, S; Doyle, J J
2001-02-01
Phylogenetic relationships within Celastraceae were inferred using a simultaneous analysis of 61 morphological characters and 1123 base pairs of phytochrome B exon 1 from the nuclear genome. No gaps were inferred, and the gene tree topology suggests that the primers were specific to a single locus that did not duplicate among the lineages sampled. This region of phytochrome B was most useful for examining relationships among closely related genera. Fifty-one species from 38 genera of Celastraceae were sampled. The Celastraceae sensu lato (including Hippocrateaceae) were resolved as a monophyletic group. Loesener's subfamilies and tribes of Celastraceae were not supported. The Hippocrateaceae were resolved as a monophyletic group nested within a paraphyletic Celastraceae sensu stricto. Goupia was resolved as more closely related to Euphorbiaceae, Corynocarpaceae, and Linaceae than to Celastraceae. Plagiopteron (Flacourtiaceae) was resolved as the sister group of Hippocrateoideae. Brexia (Brexiaceae) was resolved as closely related to Elaeodendron and Pleurostylia. Canotia was resolved as the sister group of Acanthothamnus within Celastraceae. Perrottetia and Mortonia were resolved as the sister group of the rest of the Celastraceae. Siphonodon was resolved as a derived member of Celastraceae. Maytenus was resolved as three disparate groups, suggesting that this large genus needs to be recircumscribed.
-
Identification of a novel box C/D snoRNA from mouse nucleolar cDNA library.
Zhou, Hui; Zhao, Jin; Yu, Chuan-He; Luo, Qing-Jun; Chen, Yue-Qin; Xiao, Yu; Qu, Liang-Hu
2004-02-18
By construction and screen of mouse nucleolar cDNA library, a novel mammalian small nucleolar RNAs (snoRNA) was identified. The novel snoRNA, 70 nt in length, displays structural features typical of C/D box snoRNA family. The snoRNA possesses an 11-nt-long rRNA antisense element and is predicted to guide the 2'-O-methylation of mouse 28S rRNA at G4043, a site unknown so far to be modified in vertebrates. The comparison of functional element of snoRNA guides among eukaryotes reveals that the novel snoRNA is a mammalian counterpart of yeast snR38 despite highly divergent sequence between them. Mouse and human snR38 and other cognates in distant vertebrates were positively detected with slight length variability. As expected, the rRNA ribose-methylation site predicted by mouse snR38 was precisely mapped by specific-primer extension assay. Furthermore, our analyses show that mouse and human snR38 gene have multiple variants and are nested in the introns of different host genes with unknown function. Thus, snR38 is a phylogenetically conserved methylation guide but exhibits different genomic organization in eukaryotes.
-
Adenoviral infection in a collection of juvenile inland bearded dragons (Pogona vitticeps).
Doneley, R J T; Buckle, K N; Hulse, L
2014-01-01
Juvenile inland bearded dragons (Pogona vitticeps) from a breeding collection in south-east Queensland were presented at age 6-10 weeks with neurological signs, poor growth and occasional deaths. Histopathological examination revealed that six of eight lizards had multifocal non-suppurative hepatitis associated with 5-10 μm diameter, smudgy, basophilic, hyaline intranuclear inclusion bodies that marginated the nuclear chromatin. These histological lesions were considered consistent with adenoviral hepatitis. Infection with adenovirus was confirmed positive in one of the eight dragons by PCR for adenoviral DNA. DNA was extracted from formalin-fixed paraffin-embedded pooled tissues of the juvenile inland bearded dragons and tested using a nested-PCR protocol with primers specific for identification of adenovirus. Sequencing of the one PCR-positive dragon showed 95% nucleotide sequence alignment with agamid atadenovirus 1. Further investigation involved testing the breeding population, including the parents of the affected juveniles. Blood and cloacal samples were collected from the adult population, DNA was extracted and tested by PCR for adenovirus. There was a high percentage of positive results from the samples collected from the breeding population. This is the first reported group outbreak of adenoviral disease in bearded dragons in Australia. © 2014 Australian Veterinary Association.
-
Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C
2001-10-31
Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.
-
Fassbinder-Orth, Carol A.; Barak, Virginia A.; Brown, Charles R.
2013-01-01
Invasive species often display different patterns of parasite burden and virulence compared to their native counterparts. These differences may be the result of variability in host-parasite co-evolutionary relationships, the occurrence of novel host-parasite encounters, or possibly innate differences in physiological responses to infection between invasive and native hosts. Here we examine the adaptive, humoral immune responses of a resistant, native bird and a susceptible, invasive bird to an arbovirus (Buggy Creek virus; Togaviridae: Alphavirus) and its ectoparasitic arthropod vector (the swallow bug; Oeciacus vicarius). Swallow bugs parasitize the native, colonially nesting cliff swallow (Petrochelidon pyrrhonota) and the introduced house sparrow (Passer domesticus) that occupies nests in cliff swallow colonies. We measured levels of BCRV-specific and swallow bug-specific IgY levels before nesting (prior to swallow bug exposure) and after nesting (after swallow bug exposure) in house sparrows and cliff swallows in western Nebraska. Levels of BCRV-specific IgY increased significantly following nesting in the house sparrow but not in the cliff swallow. Additionally, house sparrows displayed consistently higher levels of swallow bug-specific antibodies both before and after nesting compared to cliff swallows. The higher levels of BCRV and swallow bug specific antibodies detected in house sparrows may be reflective of significant differences in both antiviral and anti-ectoparasite immune responses that exist between these two avian species. To our knowledge, this is the first study to compare the macro- and microparasite-specific immune responses of an invasive and a native avian host exposed to the same parasites. PMID:23460922
-
Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.
Kalendar, Ruslan; Lee, David; Schulman, Alan H
2011-08-01
The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.
-
Multiplex primer prediction software for divergent targets
Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.
2009-01-01
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213
-
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
-
Lenzi, M; Bellentani, S; Saccoccio, G; Muratori, P; Masutti, F; Muratori, L; Cassani, F; Bianchi, F; Tiribelli, C
1999-01-01
BACKGROUND—Several retrospective and prospective studies report an increased prevalence of non-organ-specific autoantibodies (NOSAs) in patients with hepatitis C virus (HCV) related chronic liver disease (CLD). Some of the data so far available are controversial and the true prevalence of NOSAs in the general population is still not known. AIM—To explore the prevalence of NOSAs, their relation to different HCV genotypes, and the presence and severity of CLD in the general population of Northern Italy. PATIENTS—All 226 anti-HCV positive and 87 hepatitis B surface antigen (HBsAg) positive patients of the Dionysos cohort study were analysed and compared with sex and age matched cases (226) negative for both anti-HCV antibody and HBsAg selected from the same cohort. METHODS—Sera tested for the presence of NOSAs (anti-nuclear antibody (ANA), anti-smooth muscle antibody (SMA), and anti-liver/kidney microsomes type 1 antibody (LKM1)) were screened by indirect immunofluorescence at a 1:40 serum dilution. HCV RNA and HCV genotypes were also determined by nested polymerase chain reaction (PCR) of the 5' non-coding region and by PCR amplification of the core region with type specific primers. RESULTS—The overall prevalence of NOSA reactivity was significantly higher in anti-HCV positive subjects than in both normal and pathological controls (25% v 6% and 7% respectively, p<0.05). ANA, SMA, and LKM1 occurred in 16, 10, and 1.3% of cases respectively. No specific association between NOSAs and a specific HCV genotype was found. NOSAs were found more often associated with more than one genotype (35.7%) and with untypable genotypes (34.6%), although the association was not statistically significant. NOSAs were associated with HCV RNA and CLD but not with the presence of cirrhosis and/or hepatocellular carcinoma. On univariate analysis, NOSA reactivity was independently associated with abnormal alanine aminotransferase (p<0.01) and γ-glutamyltranspeptidase levels (p<0.05). The risk for the presence of NOSAs was 5.1 times higher in anti-HCV subjects than in controls. CONCLUSIONS—In the general population the prevalence of NOSAs is higher in anti-HCV positive subjects than in normal or disease controls. Moreover NOSAs are associated with CLD and with a more active disease in terms of alanine aminotransferase activity. Keywords: non-organ-specific autoantibodies; hepatitis C virus genotypes; chronic liver disease; cohort study; prevalence PMID:10446115
-
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
-
Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-01-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744
-
Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-08-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.
-
Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.
Navarro, B; Daròs, J A; Flores, R
1998-07-01
A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.
-
Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon
2012-06-01
The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.
-
Herzig, Eytan; Voronin, Nickolay
2012-01-01
The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446
-
Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A
2018-03-09
Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.
-
Feng, Shangguo; Zhu, Yujia; Yu, Chenliang; Jiao, Kaili; Jiang, Mengying; Lu, Jiangjie; Shen, Chenjia; Ying, Qicai; Wang, Huizhong
2018-01-01
Physalis is an important genus in the Solanaceae family. It includes many species of significant medicinal value, edible value, and ornamental value. However, many Physalis species are easily confused because of their similar morphological traits, which hinder the utilization and protection of Physalis resources. Therefore, it is necessary to create fast, sensitive, and reliable methods for the Physalis species authentication. Intended for that, in this study, species-specific sequence-characterized amplified region (SCAR) markers were developed for accurate identification of the closely related Physalis species P. angulata, P. minima, P. pubescens, and P. alkekengi var. franchetii, based on a simple and novel marker system, start codon targeted (SCoT) marker. A total of 34 selected SCoT primers yielded 289 reliable SCoT loci, of which 265 were polymorphic. Four species-specific SCoT fragments (SCoT3-1404, SCoT3-1589, SCoT5-550, and SCoT36-520) from Physalis species were successfully identified, cloned, and sequenced. Based on these selected specific DNA fragments, four SCAR primers pairs were developed and named ST3KZ, ST3MSJ, ST5SJ, and ST36XSJ. PCR analysis of each of these primer pairs clearly demonstrated a specific amplified band in all samples of the target Physalis species, but no amplification was observed in other Physalis species. Therefore, the species-specific SCAR primer pairs developed in this study could be used as powerful tools that can rapidly, effectively, and reliably identify and differentiate Physalis species.
-
Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi
2005-01-01
Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428
-
Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"
ERIC Educational Resources Information Center
Belfield, Clive
2008-01-01
Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth…
-
USDA-ARS?s Scientific Manuscript database
Five developmental stages of Chrysoperla rufilabris were tested using nine primer pairs. Three sequences were highly expressed at all life stages and six were differentially expressed. These primer pairs may be used as standards to quantitate functional gene expression associated with physiological ...
-
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
-
Li, Y M; Bai, C Y; Niu, W P; Yu, H; Yang, R J; Yan, S Q; Zhang, J Y; Zhang, M J; Zhao, Z H
2015-09-28
Microsatellite markers are widely and evenly distributed, and are highly polymorphic. Rapid and convenient detection through automated analysis means that microsatellite markers are widely used in the construction of plant and animal genetic maps, in quantitative trait loci localization, marker-assisted selection, identification of genetic relationships, and genetic diversity and phylogenetic tree construction. However, few microsatellite markers remain to be isolated. We used streptavidin magnetic beads to affinity-capture and construct a (CA)n microsatellite DNA-enriched library from sika deer. We selected sequences containing more than six repeats to design primers. Clear bands were selected, which were amplified using non-specific primers following PCR amplification to screen polymorphisms in a group of 65 unrelated sika deer. The positive clone rate reached 82.9% by constructing the enriched library, and we then selected positive clones for sequencing. There were 395 sequences with CA repeats, and the CA repeat number was 4-105. We selected sequences containing more than six repeats to design primers, of which 297 pairs were designed. We next selected clear bands and used non-specific primers to amplify following PCR amplification. In total, 245 pairs of primers were screened. We then selected 50 pairs of primers to randomly screen for polymorphisms. We detected 47 polymorphic and 3 monomorphic loci in 65 unrelated sika deer. These newly isolated and characterized microsatellite loci can be used to construct genetic maps and for lineage testing in deer. In addition, they can be used for comparative genomics between Cervidae species.
-
Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota
2006-12-20
We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.
-
Matsuoka, Takayuki; Shigemura, Katsumi; Yamamichi, Fukashi; Fujisawa, Masato; Kawabata, Masato; Shirakawa, Toshiro
2012-06-27
The objective of this study is to investigate and compare the sensitivity in conventional PCR, quantitative real time PCR, nested PCR and western blots for detection of prostate cancer tumor markers using prostate cancer (PCa) cells. We performed conventional PCR, quantitative real time PCR, nested PCR, and western blots using 5 kinds of PCa cells. Prostate specific antigen (PSA), prostate specific membrane antigen (PSMA), and androgen receptor (AR) were compared for their detection sensitivity by real time PCR and nested PCR. In real time PCR, there was a significant correlation between cell number and the RNA concentration obtained (R(2)=0.9944) for PSA, PSMA, and AR. We found it possible to detect these markers from a single LNCaP cell in both real time and nested PCR. By comparison, nested PCR reached a linear curve in fewer PCR cycles than real time PCR, suggesting that nested PCR may offer PCR results more quickly than real time PCR. In conclusion, nested PCR may offer tumor maker detection in PCa cells more quickly (with fewer PCR cycles) with the same high sensitivity as real time PCR. Further study is necessary to establish and evaluate the best tool for PCa tumor marker detection.
-
Diagnostic value of nested-PCR for identification of Malassezia species in dandruff
NASA Astrophysics Data System (ADS)
Jusuf, N. K.; Nasution, T. A.; Ullyana, S.
2018-03-01
Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.
-
Red-shouldered hawk nesting habitat preference in south Texas
Strobel, Bradley N.; Boal, Clint W.
2010-01-01
We examined nesting habitat preference by red-shouldered hawks Buteo lineatus using conditional logistic regression on characteristics measured at 27 occupied nest sites and 68 unused sites in 2005–2009 in south Texas. We measured vegetation characteristics of individual trees (nest trees and unused trees) and corresponding 0.04-ha plots. We evaluated the importance of tree and plot characteristics to nesting habitat selection by comparing a priori tree-specific and plot-specific models using Akaike's information criterion. Models with only plot variables carried 14% more weight than models with only center tree variables. The model-averaged odds ratios indicated red-shouldered hawks selected to nest in taller trees and in areas with higher average diameter at breast height than randomly available within the forest stand. Relative to randomly selected areas, each 1-m increase in nest tree height and 1-cm increase in the plot average diameter at breast height increased the probability of selection by 85% and 10%, respectively. Our results indicate that red-shouldered hawks select nesting habitat based on vegetation characteristics of individual trees as well as the 0.04-ha area surrounding the tree. Our results indicate forest management practices resulting in tall forest stands with large average diameter at breast height would benefit red-shouldered hawks in south Texas.
-
Hizi, Amnon
2008-01-01
The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5′ end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3′ end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs. PMID:18753200
-
Hizi, Amnon
2008-11-01
The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5' end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3' end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs.
-
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
-
Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison
2012-01-01
Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198
-
Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes
Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...
2014-01-01
Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less
-
Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E
2014-01-01
Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.
-
Ceccarelli, Marcello; Galluzzi, Luca; Migliazzo, Antonella; Magnani, Mauro
2014-01-01
Leishmaniasis is a neglected disease with a broad clinical spectrum which includes asymptomatic infection. A thorough diagnosis, able to distinguish and quantify Leishmania parasites in a clinical sample, constitutes a key step in choosing an appropriate therapy, making an accurate prognosis and performing epidemiological studies. Several molecular techniques have been shown to be effective in the diagnosis of leishmaniasis. In particular, a number of PCR methods have been developed on various target DNA sequences including kinetoplast minicircle constant regions. The first aim of this study was to develop a SYBR green-based qPCR assay for Leishmania (Leishmania) infantum detection and quantification, using kinetoplast minicircle constant region as target. To this end, two assays were compared: the first used previously published primer pairs (qPCR1), whereas the second used a nested primer pairs generating a shorter PCR product (qPCR2). The second aim of this study was to evaluate the possibility to discriminate among subgenera Leishmania (Leishmania) and Leishmania (Viannia) using the qPCR2 assay followed by melting or High Resolution Melt (HRM) analysis. Both assays used in this study showed good sensitivity and specificity, and a good correlation with standard IFAT methods in 62 canine clinical samples. However, the qPCR2 assay allowed to discriminate between Leishmania (Leishmania) and Leishmania (Viannia) subgenera through melting or HRM analysis. In addition to developing assays, we investigated the number and genetic variability of kinetoplast minicircles in the Leishmania (L.) infantum WHO international reference strain (MHOM/TN/80/IPT1), highlighting the presence of minicircle subclasses and sequence heterogeneity. Specifically, the kinetoplast minicircle number per cell was estimated to be 26,566±1,192, while the subclass of minicircles amplifiable by qPCR2 was estimated to be 1,263±115. This heterogeneity, also observed in canine clinical samples, must be taken into account in quantitative PCR-based applications; however, it might also be used to differentiate between Leishmania subgenera. PMID:24551178
-
Putri, Dwi Desmiyeni; Handharyani, Ekowati; Soejoedono, Retno Damajanti; Setiyono, Agus; Mayasari, Ni Luh Putu Ika; Poetri, Okti Nadia
2017-04-01
This research was conducted to differentiate and characterize eight Newcastle disease virus (NDV) isolates collected from vaccinated chicken at commercial flocks in West Java, Indonesia, in 2011, 2014 and 2015 by pathotype specific primers. A total of eight NDV isolates collected from clinical outbreaks among commercial vaccinated flocks in West Java, Indonesia, in 2011, 2014, and 2015 were used in this study. Reverse transcription-polymerase chain reaction was used to detect and differentiate virulence of NDV strains, using three sets of primers targeting their M and F gene. First primers were universal primers to detect NDV targeting matrix (M) gene. Other two sets of primers were specific for the fusion (F) gene cleavage site sequence of virulent and avirulent NDV strains. Our results showed that three isolates belong to NDV virulent strains, and other five isolates belong to NDV avirulent strains. The nucleotide sequence of the F protein cleavage site showed 112 K/R-R-Q/R-K-R/G-F 117 on NDV virulent strains and 112 G-K/R-Q-G-R-L 117 on NDV avirulent strain. Result from the current study suggested that NDV virulent strain were circulating among vaccinated chickens in West Java, Indonesia; this might possess a risk of causing ND outbreaks and causing economic losses within the poultry industry.
-
Ballard, S A; Grabsch, E A; Johnson, P D R; Grayson, M L
2005-01-01
We assessed the sensitivities and specificities of three previously described PCR primers on enrichment broth cultures of feces for the accurate detection of fecal carriage of vancomycin-resistant enterococci (VRE). In addition, we investigated specimens that were vanB PCR positive but VRE culture negative for the presence of other vanB-containing pathogens. Feces from 59 patients (12 patients carrying vanB Enterococcus faecium strains and 47 patients negative for VRE carriage) were cultured for 36 h in aerobic brain heart infusion (BHI) broth, anaerobic BHI (AnO(2)BHI) broth, or aerobic Enterococcosel (EC) broth. DNA was extracted from the cultures and tested for the presence of vanB by using the PCR primers of Dutka-Malen et al. (S. Dutka-Malen, S. Evers, and P. Courvalin, J. Clin. Microbiol. 33:24-27, 1995), Bell et al. (J. M. Bell, J. C. Paton, and J. Turnidge, J. Clin. Microbiol. 36:2187-2190, 1998), and Stinear et al. (T. P. Stinear, D. C. Olden, P. D. R. Johnson, J. K. Davies, and M. L. Grayson, Lancet 357:855-856, 2001). The sensitivity (specificity) of PCR compared with the results of culture on BHI, AnO(2)BHI, and EC broths were 67% (96%), 50% (94%), and 17% (100%), respectively, with the primers of Dutka-Malen et al.; 92% (60%), 92% (45%), and 92% (83%), respectively, with the primers of Bell et al.; and 92% (49%), 92% (43%), and 100% (51%) respectively, with the primers of Stinear et al. The primers of both Bell et al. and Stinear et al. were significantly more sensitive than those of Dutka-Malen et al. in EC broth (P = 0.001 and P < 0.001, respectively). The poor specificities for all primer pairs were due in part to the isolation and identification of six anaerobic gram-positive bacilli, Clostridium hathewayi (n = 3), a Clostridium innocuum-like organism (n = 1), Clostridium bolteae (n = 1), and Ruminococcus lactaris-like (n = 1), from five fecal specimens that were vanB positive but VRE culture negative. All six organisms were demonstrated to contain a vanB gene identical to that of VRE. VanB-containing bowel anaerobes may result in false-positive interpretation of PCR-positive fecal enrichment cultures as VRE, regardless of the primers and protocols used.
-
Panicker, Gitika; Bej, Asim K
2005-10-01
We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.
-
Can selection on nest size from nest predation explain the latitudinal gradient in clutch size?
Biancucci, Luis; Martin, Thomas E
2010-09-01
1. Latitudinal variation in clutch sizes of birds is a well described, but poorly understood pattern. Many hypotheses have been proposed, but few have been experimentally tested, and none have been universally accepted by researchers. 2. The nest size hypothesis posits that higher nest predation in the tropics favours selection for smaller nests and thereby constrains clutch size by shrinking available space for eggs and/or nestlings in the nest. We tested this hypothesis with an experiment in a tropical forest and a comparative study between temperate and tropical field sites. 3. Specifically, we tested if: (i) predation increased with nest size; (ii) tropical birds had smaller nests controlled for body size; and (iii) clutch size was explained by nest size controlled for body size. 4. Experimental swapping of nests of different sizes showed that nest predation increased with nest size in the tropical site. Moreover, nest predation rates were higher in species with larger nests in both sites. However, nest size, corrected for body mass and phylogeny, did not differ between sites and was not related to clutch size between sites. 5. Hence, nest predation can exert selection on nest size as predicted by the hypothesis. Nest size increased with adult body mass, such that adult size might indirectly influence reproductive success through effects on nest size and nest predation risk. Ultimately, however, selection from nest predation on nest size does not explain the smaller clutch sizes typical of the tropics.
-
Can selection on nest size from nest predation explain the latitudinal gradient in clutch size?
Biancucci, L.; Martin, T.E.
2010-01-01
1. Latitudinal variation in clutch sizes of birds is a well described, but poorly understood pattern. Many hypotheses have been proposed, but few have been experimentally tested, and none have been universally accepted by researchers. 2. The nest size hypothesis posits that higher nest predation in the tropics favours selection for smaller nests and thereby constrains clutch size by shrinking available space for eggs and/or nestlings in the nest. We tested this hypothesis with an experiment in a tropical forest and a comparative study between temperate and tropical field sites. 3. Specifically, we tested if: (i) predation increased with nest size; (ii) tropical birds had smaller nests controlled for body size; and (iii) clutch size was explained by nest size controlled for body size. 4. Experimental swapping of nests of different sizes showed that nest predation increased with nest size in the tropical site. Moreover, nest predation rates were higher in species with larger nests in both sites. However, nest size, corrected for body mass and phylogeny, did not differ between sites and was not related to clutch size between sites. 5. Hence, nest predation can exert selection on nest size as predicted by the hypothesis. Nest size increased with adult body mass, such that adult size might indirectly influence reproductive success through effects on nest size and nest predation risk. Ultimately, however, selection from nest predation on nest size does not explain the smaller clutch sizes typical of the tropics.
-
Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A
2005-12-01
Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.
-
Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M
2016-05-01
For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.
-
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-01-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168
-
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
-
A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.
Kemp, S J; Maillard, J C; Teale, A J
1993-04-01
A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.
-
Ecological consequences of colony structure in dynamic ant nest networks.
Ellis, Samuel; Franks, Daniel W; Robinson, Elva J H
2017-02-01
Access to resources depends on an individual's position within the environment. This is particularly important to animals that invest heavily in nest construction, such as social insects. Many ant species have a polydomous nesting strategy: a single colony inhabits several spatially separated nests, often exchanging resources between the nests. Different nests in a polydomous colony potentially have differential access to resources, but the ecological consequences of this are unclear. In this study, we investigate how nest survival and budding in polydomous wood ant ( Formica lugubris ) colonies are affected by being part of a multi-nest system. Using field data and novel analytical approaches combining survival models with dynamic network analysis, we show that the survival and budding of nests within a polydomous colony are affected by their position in the nest network structure. Specifically, we find that the flow of resources through a nest, which is based on its position within the wider nest network, determines a nest's likelihood of surviving and of founding new nests. Our results highlight how apparently disparate entities in a biological system can be integrated into a functional ecological unit. We also demonstrate how position within a dynamic network structure can have important ecological consequences.
-
Molecular Identification of Sex in Phoenix dactylifera Using Inter Simple Sequence Repeat Markers.
Al-Ameri, Abdulhafed A; Al-Qurainy, Fahad; Gaafar, Abdel-Rhman Z; Khan, Salim; Nadeem, M
2016-01-01
Early sex identification of Date Palm (Phoenix dactylifera L.) at seedling stage is an economically desirable objective, which will significantly increase the profits of seed based cultivation. The utilization of molecular markers at this stage for early and rapid identification of sex is important due to the lack of morphological markers. In this study, a total of two hundred Inter Simple Sequence Repeat (ISSR) primers were screened among male and female Date palm plants to identify putative sex-specific marker, out of which only two primers (IS_A02 and IS_A71) were found to be associated with sex. The primer IS_A02 produced a unique band of size 390 bp and was found clearly in all female plants, while it was absent in all male plants. Contrary to this, the primer IS_A71 produced a unique band of size 380 bp and was clearly found in all male plants, whereas it was absent in all the female plants. Subsequently, these specific fragments were excised, purified, and sequenced for the development of sequence specific markers further in future for the implementation on dioecious Date Palm for sex determination. These markers are efficient, highly reliable, and reproducible for sex identification at the early stage of seedling.
-
Miller, D M; Dudley, E G; Roberts, R F
2012-09-01
Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
-
Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R
2013-01-01
Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.
-
Kang, Jung-Mi; Cho, Pyo-Yun; Moe, Mya; Lee, Jinyoung; Jun, Hojong; Lee, Hyeong-Woo; Ahn, Seong Kyu; Kim, Tae Im; Pak, Jhang Ho; Myint, Moe Kyaw; Lin, Khin; Kim, Tong-Soo; Na, Byoung-Kuk
2017-03-16
Accurate diagnosis of Plasmodium infection is crucial for prompt malaria treatment and surveillance. Microscopic examination has been widely applied as the gold standard for malaria diagnosis in most part of malaria endemic areas, but its diagnostic value has been questioned, particularly in submicroscopic malaria. In this study, the diagnostic performance of microscopic examination and nested polymerase chain reaction (PCR) was evaluated to establish optimal malaria diagnosis method in Myanmar. A total of 1125 blood samples collected from residents in the villages and towns located in Naung Cho, Pyin Oo Lwin, Tha Beik Kyin townships and Mandalay of Upper Myanmar were screened by microscopic examination and species-specific nested PCR method. Among the 1125 blood samples, 261 samples were confirmed to be infected with malaria by microscopic examination. Evaluation of the 1125 samples by species-specific nested PCR analysis revealed that the agreement between microscopic examination and nested PCR was 87.3% (261/299). Nested PCR successfully detected 38 Plasmodium falciparum or Plasmodium vivax infections, which were missed in microscopic examination. Microscopic examinations also either misdiagnosed the infected Plasmodium species, or did not detect mixed infections with different Plasmodium species in 31 cases. The nested PCR method is more reliable than conventional microscopic examination for the diagnosis of malaria infections, and this is particularly true in cases of mixed infections and submicroscopic infections. Given the observed higher sensitivity and specificity of nested PCR, the molecular method holds enormous promise in malaria diagnosis and species differentiation, and can be applied as an effective monitoring tool for malaria surveillance, control and elimination in Myanmar.
-
Xincheng, Zhang; Kunci, Chen; Xinping, Zhu; Jian, Zhao; Qing, Luo; Xiaoyou, Hong; Wei, Li; Fengfang, Xiao
2015-08-01
The northern snakehead (Channa argus) and blotched snakehead (Channa maculata) and their reciprocal hybrids have played important roles in the Chinese freshwater aquaculture industry, with an annual production in China exceeding 400 thousand tons. While these are popular aquaculture breeds in China, it is not easy to identify northern snakehead, blotched snakehead, and their hybrids. Thus, a method should be developed to identify these varieties. To distinguish between the reciprocal hybrids (C. argus ♀ × C. maculata ♂ and C. maculata ♀ × C. argus ♂), the mitochondrial genome sequences of northern snakehead and blotched snakehead and their reciprocal hybrids were compared. Following the alignment and analysis of mtDNA sequences of northern snakehead, blotched snakehead and their hybrids, two pairs of specific primers were designed based on identified differences ranging from 12S rRNA to 16S rRNA gene. The BY1 primers amplified the same bands in the blotched snakehead and the hybrid (C. maculata ♀ × C. argus ♂), while producing no products in northern snakehead and the hybrid (C. argus ♀ × C. maculata ♂). Amplification with WY1 yielded the opposite results. Then, 30 individuals per fish were randomized to verify the primers, and the results showed that the primers were specific for breeds, as intended. The specific primers can not only simply distinguish between two kinds of hybrids, but also rapidly identify the two parents. This study provides a method of molecular marker identification to identify reciprocal hybrids.
-
USDA-ARS?s Scientific Manuscript database
Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...
-
Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes
USDA-ARS?s Scientific Manuscript database
TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...
-
Two methods for increased specificity and sensitivity in loop-mediated isothermal amplification
USDA-ARS?s Scientific Manuscript database
The technique of loop-mediated isothermal amplification (LAMP) utilizes 4 (or 6) primers targeting 6 (or 8) regions within a fairly small segment of a genome for amplification, with concentration higher than that used in traditional PCR methods. The high concentrations of primers used leads to an in...
-
Forest Interpreter's Primer on Fire Management.
ERIC Educational Resources Information Center
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
-
Bisset, S A; Knight, J S; Bouchet, C L G
2014-02-24
A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible PCR products (indicative of insufficient or poor quality DNA template). Of the reactions which yielded only generic products, 91% gave positive identifications in an assay re-run, resulting in a failure rate of just ∼ 0.4% for reactions containing amplifiable template. Although the method was developed primarily to provide a reliable way to identify individual strongylid larvae for downstream molecular applications, it potentially has a variety of other research and practical applications which are not readily achievable at present using other methods. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Brigidi, P; Vitali, B; Swennen, E; Altomare, L; Rossi, M; Matteuzzi, D
2000-10-01
For PCR specific detection of the strains Bifidobacterium longum Y 10, B. infantis Y 1 and B. breve Y 8 used in a new probiotic product (VSL-3), strains-specific rDNA primers have been developed. Spacer regions between the 16S and 23S rRNA genes (ITS) of the three strains were amplified by PCR with conserved primers and the nucleotide sequence of these ITSs were determined. On the basis of their comparison with the rDNA sequences retrieved from GenBank, we designed new primers which specifically recognize the species B. breve and the two strains B. infantis Y 1 and B. breve Y 8. Specificity of these primers was confirmed through the analysis of 60 bifidobacteria strains belonging to the more representative human species. The feasibility of this PCR method was investigated in commercial VSL-3 product and fecal samples collected from 4 patients affected by inflammatory bowel deseases and two healthy subjects before and after the VSL-3 administration. By PCR analysis of different VSL-3 commercial batches we were successful in differentiating and quantifying the strains B. longum Y 10, B. infantis Y 1 and B. breve Y 8. B. infantis Y 1 and B. breve Y 8 could be detected at high concentration in fecal specimens of both patients and subjects treated with the probiotic preparation, showing a different colonization behaviour. Seven days after the VSL-3 treatment suspension, no patients and subjects harbored B. infantis Y 1 and B. breve Y 8, indicating a transient presence of these exogenous strains.
-
Multiplex real-time PCR assay for Legionella species.
Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja
2015-12-01
Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
-
PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.
Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q
2007-01-01
Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.
-
Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David
2006-05-01
Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.
-
Strategies for nest-site selection by king eiders
Bentzen, R.L.; Powell, A.N.; Suydam, R.S.
2009-01-01
Nest site selection is a critical component of reproduction and has presumably evolved in relation to predation, local resources, and microclimate. We investigated nest-site choice by king eiders (Somateria spectabilis) on the coastal plain of northern Alaska, USA, 2003-2005. We hypothesized that nest-site selection is driven by predator avoidance and that a variety of strategies including concealment, seclusion, and conspecific or inter-specific nest defense might lead to improved nesting success. We systematically searched wetland basins for king eider nests and measured habitat and social variables at nests (n = 212) and random locations (n = 493). King eiders made use of both secluded and concealed breeding strategies; logistic regression models revealed that females selected nests close to water, on islands, and in areas with high willow (Salix spp.) cover but did not select sites near conspecific or glaucous gull (Larus hyperboreus) nests. The most effective nest-placement strategy may vary depending on density and types of nest predators; seclusion is likely a mammalian-predator avoidance tactic whereas concealment may provide protection from avian predators. We recommend that managers in northern Alaska attempt to maintain wetland basins with islands and complex shorelines to provide potential nest sites in the vicinity of water. ?? The Wildlife Society.