Estimation of 557.7 nm Emission Altitude using Co-located Lidars and Photometers over Arecibo
NASA Astrophysics Data System (ADS)
Franco, E.; Raizada, S.; Lautenbach, J.; Brum, C. G. M.
2017-12-01
Airglow at 557.7 nm (green line emission) is generated through the Barth mechanism in the E-region altitude and is sometimes associated with red line (630.0 nm) originating at F-region altitudes. Photons at 557.7 nm are produced through the quenching of excited atomic oxygen atoms, O(1S), while 630.0 nm results through the de-excitation of O(1D) atoms. Even though, the contribution of the green line from F-region is negligible and the significant component comes from the mesosphere, this uncertainty gives rise to a question related to its precise altitude. Previous studies have shown that perturbations generated by atmospheric gravity Waves (GWs) alter the airglow intensity and can be used for studying dynamics of the region where it originates. The uncertainty in the emission altitude of green line can be resolved by using co-located lidars, which provide altitude resolved metal densities. At Arecibo, the resonance lidars tuned to Na and K resonance wavelengths at 589 nm and 770 nm can be used in conjunction with simultaneous measurements from green line photometer to resolve this issue. Both photometer and lidars have narrow field of view as compared to airglow imagers, and hence provide an added advantage that these instruments sample same GW spectrum. Hence, correlation between density perturbations inferred from lidars and airglow intensity perturbations can shed light on the exact altitude of green line emission.
NASA Astrophysics Data System (ADS)
Yang, Chun-Chieh; Kim, Moon S.; Chuang, Yung-Kun; Lee, Hoyoung
2013-05-01
This paper reports the development of a multispectral algorithm, using the line-scan hyperspectral imaging system, to detect fecal contamination on leafy greens. Fresh bovine feces were applied to the surfaces of washed loose baby spinach leaves. A hyperspectral line-scan imaging system was used to acquire hyperspectral fluorescence images of the contaminated leaves. Hyperspectral image analysis resulted in the selection of the 666 nm and 688 nm wavebands for a multispectral algorithm to rapidly detect feces on leafy greens, by use of the ratio of fluorescence intensities measured at those two wavebands (666 nm over 688 nm). The algorithm successfully distinguished most of the lowly diluted fecal spots (0.05 g feces/ml water and 0.025 g feces/ml water) and some of the highly diluted spots (0.0125 g feces/ml water and 0.00625 g feces/ml water) from the clean spinach leaves. The results showed the potential of the multispectral algorithm with line-scan imaging system for application to automated food processing lines for food safety inspection of leafy green vegetables.
NASA Astrophysics Data System (ADS)
Britz, Steven; Caldwell, Charles; Mirecki, Roman; Slusser, James; Gao, Wei
2005-08-01
Eight cultivars each of red and green leaf lettuce were raised in a greenhouse with supplemental UV radiation, either UV-A (wavelengths greater than ca. 315 nm) or UV-A+UV-B (wavelengths greater than ca. 290 nm; 6.4 kJ m-2 daily biologically effective UV-B), or no supplemental UV (controls). Several phytonutrients were analyzed in leaf flours to identify lines with large differences in composition and response to UV-B. Red leaf lettuce had higher levels of phenolic acid esters, flavonols and anthocyanins than green lines. Both green and red lines exposed to UV-B for 9 days showed 2-3-fold increases in flavonoids compared to controls, but only 45% increases in phenolic acid esters, suggesting these compounds may be regulated by different mechanisms. There were large differences between cultivars in levels of phenolic compounds under control conditions and also large differences in UV-B effects. Among red varieties, cv. Galactic was notable for high levels of phenolics and a large response to UV-B. Among green varieties, cvs. Black-Seeded Simpson and Simpson Elite had large increases in phenolics with UV-B exposure. Photosynthetic pigments were also analyzed. Green leaf lettuce had high levels of pheophytin, a chlorophyll degradation product. Total chlorophylls (including pheophytin) were much lower in green compared to red varieties. Lutein, a carotenoid, was similar for green and red lines. Total chlorophylls and lutein increased 2-fold under supplemental UV-B in green lines but decreased slightly under UV-B in red lines. Lettuce appears to be a valuable crop to use to study phytochemical-environment interactions.
A compact frequency stabilized telecom laser diode for space applications
NASA Astrophysics Data System (ADS)
Philippe, C.; Holleville, D.; Le Targat, R.; Wolf, P.; Leveque, T.; Le Goff, R.; Martaud, E.; Acef, O.
2017-09-01
We report on a Telecom laser diode (LD) frequency stabilization to a narrow iodine hyperfine line in the green range, after frequency tripling process using fibered nonlinear waveguide PPLN crystals. We have generated up to 300 mW optical power in the green range ( 514 nm) from 800 mW of infrared power ( 1542 nm), corresponding to a nonlinear conversion efficiency h = P3?/P? 36%. Less than 10 mW of the generated green power are used for Doppler-free spectroscopy of 127I2 molecular iodine, and -therefore- for the frequency stabilization purpose. The frequency tripling optical setup is very compact (< 5 l), fully fibered, and could operate over the full C-band of the Telecom range (1530 nm - 1565 nm). Several thousands of hyperfine iodine lines may thus be interrogated in the 510 nm - 521 nm range. We build up an optical bench used at first in free space configuration, using the well-known modulation transfer spectroscopy technique (MTS), in order to test the potential of this new frequency standard based on the couple "1.5 ?m laser / iodine molecule". We have already demonstrated a preliminary frequency stability of 4.8 x 10-14 ? -1/2 with a minimum value of 6 x 10-15 reached after 50 s of integration time, conferred to a laser diode operating at 1542.1 nm. We focus now our efforts to expand the frequency stability to a longer integration time in order to meet requirements of many space experiments, such earth gravity missions, inters satellites links or space to ground communications. Furthermore, we investigate the potential of a new approach based on frequency modulation technique (FM), associated to a 3rd harmonic detection of iodine lines to increase the compactness of the optical setup.
Self-Assembled Combinatorial Nanoarrays for Multiplex Biosensing
2010-02-05
origami tiles containing two lines of apt-A (green dots) and two lines of apt-B thrombin (blue dots). The neighboring lines of apt-A and apt-B are...included helping to verify the positions of the lines in the AFM images, b, e, AFM height images of the DNA origami tiles (lOnM) with 60 nM thrombin... origami method we designed a rectangular- shaped DNA tile (Fig. 10a) that had a dimension of 60 x 90 nm. Stem-loops with apt-A and apt-B sequences were
Lu, Y.; Aguirre, A.A.; Work, Thierry M.; Balazs, G.H.; Nerurkar, V.R.; Yanagihara, R.
2000-01-01
Serial cultivation of cell lines derived from lung, testis, periorbital and tumor tissues of a green turtle (Chelonia mydas) with fibropapillomas resulted in the in vitro formation of tumor-like cell aggregates, ranging in size from 0.5 to 2.0 mm in diameter. Successful induction of tumor-like aggregates was achieved in a cell line derived from lung tissue of healthy green turtles, following inoculation with cell-free media from these tumor-bearing cell lines, suggesting the presence of a transmissible agent. Thin-section electron microscopy of the cell aggregates revealed massive collagen deposits and intranuclear naked viral particles, measuring 5095 nm in diameter. These findings, together with the morphological similarity between these tumor-like cell aggregates and the naturally occurring tumor, suggest a possible association between this novel virus and the disease. Further characterization of this small naked virus will clarify its role in etiology of green turtle fibropapilloma, a life-threatening disease of this endangered marine species.
Aequorea green fluorescent protein analysis by flow cytometry
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ropp, J.D.; Cuthbertson, R.A.; Donahue, C.J.
The isolation and expression of the cDNA for the green fluorescent protein (GFP) from the bioluminescent jellyfish Aequorea victoria has highlighted its potential use as a marker for gene expression in a variety of cell types. The longer wavelength peak (470 nm) of GFP`s bimodal absorption spectrum better matches standard fluorescein filter sets; however, it has a considerably lower amplitude than the major absorption peak at 395. In an effort to increase the sensitivity of GFP with routinely available instrumentation, Heim et al. have generated a GFP mutant (serine-65 to threonine; S65T-GFP) which possesses a single absorption peak centered atmore » 490 nm. We have constructed this mutant in order to determine whether it or wild-type GFP (wt-GFP) afforded greater sensitivity when excited near their respective absorption maxima. Using the conventionally available 488 nm and ultraviolet (UV) laser lines from the argon ion laser as well as the 407 nm line from a krypton ion laser with enhanced violet emission, we were able to closely match the absorption maxima of both the S65T and wild-type forms of Aequorea GFP and analyze differences in fluorescence intensity of transiently transfected 293 cells with flow cytometry. The highest fluorescence signal was observed with 488 nm excitation of S65T-GFP relative to all other laser line/GFP pairs. The wt-GFP fluorescence intensity, in contrast, was significantly higher at 407 nm relative to either 488 nm or UV. These results were consistent with parallel spectrofluorometric analysis of the emission spectrum for wt-GFP and S65T- GFP. The relative contribution of cellular autofluorescence at each wavelength was also investigated and shown to be significantly reduced at 407 nm relative to either UV or 488 nm. 29 refs., 5 figs.« less
Green binary and phase shifting mask
NASA Astrophysics Data System (ADS)
Shy, S. L.; Hong, Chao-Sin; Wu, Cheng-San; Chen, S. J.; Wu, Hung-Yu; Ting, Yung-Chiang
2009-12-01
SixNy/Ni thin film green mask blanks were developed , and are now going to be used to replace general chromium film used for binary mask as well as to replace molydium silicide embedded material for AttPSM for I-line (365 nm), KrF (248 nm), ArF (193 nm) and Contact/Proximity lithography. A bilayer structure of a 1 nm thick opaque, conductive nickel layer and a SixNy layer is proposed for binary and phase-shifting mask. With the good controlling of plasma CVD of SixNy under silane (50 sccm), ammonia (5 sccm) and nitrogen (100 sccm), the pressure is 250 mTorr. and RF frequency 13.56 MHz and power 50 W. SixNy has enough deposition latitude to meet the requirements as an embedded layer for required phase shift 180 degree, and the T% in 193, 248 and 365 nm can be adjusted between 2% to 20% for binary and phase shifting mask usage. Ni can be deposited by E-gun, its sheet resistance Rs is less than 1.435 kΩ/square. Jeol e-beam system and I-line stepper are used to evaluate these thin film green mask blanks, feature size less than 200 nm half pitch pattern and 0.558 μm pitch contact hole can be printed. Transmission spectrums of various thickness of SixNy film are inspected by using UV spectrometer and FTIR. Optical constants of the SixNy film are measured by n & k meter and surface roughness is inspected by using Atomic Force Microscope (AFM).
Textile Fingerprinting for Dismount Analysis in the Visible, Near, and Shortwave Infrared Domain
2014-03-01
Laboratory setup of reflectance data collection. The green, 100% cotton shirt sample, contact probe, and black calibration panel used are labeled...32 3.2 100 Instances of Cotton Reflectance from ASD FieldSpec ® 3 Hi-Res Spectroradiometer using a contact probe, with a black reflectance panel as...eight a-class colors. The solid vertical black line represents the wavelength selected as a feature (430nm, 481nm, 530nm, 588nm
REMPI-TOFMS for on-line monitoring and controlling the coffee roasting process
NASA Astrophysics Data System (ADS)
Dorfner, Ralph; Ferge, Thomas; Yeretzian, Chahan; Zimmermann, Ralf; Kettrup, Antonius
2001-08-01
REMPI@266nm-TOFMS is used for on-line analysis of the coffee roasting process. Volatile and flavor active compounds of coffee were ionized by REMPI@266nm and monitored on-line and in real-time by TOFMS during the coffee roasting process. The phenol and 4-vinylguaiacol time-intensity profiles, for example, show typical behavior for different roasting temperatures and provide an indicator to the achieved degree of roasting. The impact of the moisture level of the green coffee beans on the time shift of a typical (commercial) roasting time, correlates with REMPI-TOFMS measurements and literature data.
NASA Astrophysics Data System (ADS)
Komori, Yuichi; Ishii, Yukihiro
2010-08-01
A doubly-doped LiNbO3 (LN) crystal has been well used as a nonvolatile two-wavelength recording material. By using two levels of the crystal, two-kind holograms can be recorded on one crystal; a hologram is recorded with a 405-nm blue laser diode (LD) for a deep Mn level, and another hologram is with a 532-nm green laser for a shallow Fe level. The recording capacity doubles. A 780-nm LD is non-volatile reconstructing source since the LD line is insensitive to both levels. Multiplexed reconstructed images are demonstrated by using a sharp angular selectivity of a volume LN crystal keeping Bragg condition with spherical reconstructions.
Satellite Studies of Storm-Time Thermospheric Winds
NASA Technical Reports Server (NTRS)
Fejer, Bela G.
2005-01-01
In this project we have studied the climatology and storm-time dependence of longitude-averaged mid- and low-latitude thermospheric neutral winds observed by the WINDII instrument on board the UARS satellite. This satellite is in a circular, 57 deg inclination orbit at a height of 585 km; the orbit precesses at a rate of 5 deg per day. WINDII is a Michelson interferometer that measures Doppler shifts of the green line (557.7 nm) and red line (630.0 nm) airglow emissions at the Earth's limb, covering latitudes up to 72 deg.
The green corona database and the coronal index of solar activity
NASA Astrophysics Data System (ADS)
Minarovjech, M.; Rušin, V.; Saniga, M.
2011-10-01
The green coronal line Fe XIV 530.3 nm ranks amongst the most pronounced emission lines in the visible part of the solar spectrum. Its observations outside solar eclipses started sporadically in 1939 (the Arosa coronal station), being extended, in 1946, to more coronal stations. It was found that the green corona intensities vary with solar cycle, so they are a good candidate to express solar activity in the corona. Several attempts have been made to create a single homogeneous coronal data set from different coronal stations. We will present our homogeneous coronal data set, based on the Lomnický Štít photometric scale. Also, the coronal index of solar activity as created from this database in the period 1939—2010 will be discussed.
NASA Astrophysics Data System (ADS)
Harlander, J.; Englert, C. R.; Brown, C. M.; Marr, K. D.; Miller, I. J.; Zastera, V.; Bach, B.; Mende, S. B.
2016-12-01
The Michelson Interferometer for Global High-resolution Thermospheric Imaging (MIGHTI) is one of four instruments on the NASA-sponsored Ionospheric Connection (ICON) Explorer mission. ICON investigates the extreme variability of the Earth's ionosphere with a unique combination of sensors on-board a low Earth orbit satellite. MIGHTI uses the Doppler Asymmetric Spatial Heterodyne (DASH) Spectroscopy technique to derive thermospheric winds by measuring Doppler shifts of atomic oxygen airglow emission lines in the visible spectrum over an altitude range generally not accessible to in-situ probes. Specifically, MIGHTI measures neutral winds utilizing the atomic oxygen O(1S - 1D) transition at 557.7 nm (green line) and the O(1D - 3P) transition at 630.0 nm (red line). In addition, it uses a multiband photometric technique to derive thermospheric temperatures from the spectral shape of the molecular oxygen A-band in the near infrared near 760 nm. Two identical MIGHTI interferometers, oriented on the spacecraft to view a common atmospheric volume from orthogonal lines of sight. Both instruments use the Doppler Asymmetric Spatial Heterodyne (DASH) approach with low order Echelle gratings optimized for the red, green, and near infrared wavelengths detected by MIGHTI. The design of the monolithic DASH interferometers which are the heart of the MIGHTI instrument will be reviewed followed by a description of the interferometer element fabrication, assembly and their as-built performance.
An Examination of the Feasibility of Ultrasonic Communications Links
2010-06-01
14 Figure 6. Building 19472 compound on WSMR, NM, and its environs...21 Figure 11. Parabolic dish (narrow beam...21 Figure 12. Parabolic dish antenna pattern. Sonic intensities at 5-, 10-, and 20-kHz frequencies (green, blue, and red lines
NASA Astrophysics Data System (ADS)
Everard, Colm D.; Kim, Moon S.; Lee, Hoyoung
2014-05-01
The production of contaminant free fresh fruit and vegetables is needed to reduce foodborne illnesses and related costs. Leafy greens grown in the field can be susceptible to fecal matter contamination from uncontrolled livestock and wild animals entering the field. Pathogenic bacteria can be transferred via fecal matter and several outbreaks of E.coli O157:H7 have been associated with the consumption of leafy greens. This study examines the use of hyperspectral fluorescence imaging coupled with multivariate image analysis to detect fecal contamination on Spinach leaves (Spinacia oleracea). Hyperspectral fluorescence images from 464 to 800 nm were captured; ultraviolet excitation was supplied by two LED-based line light sources at 370 nm. Key wavelengths and algorithms useful for a contaminant screening optical imaging device were identified and developed, respectively. A non-invasive screening device has the potential to reduce the harmful consequences of foodborne illnesses.
Comparative study of the photodynamic effect in tumor and nontumor animal cell lines
NASA Astrophysics Data System (ADS)
Stoykova, Elena V.; Alexandrova, R.; Shurulinkov, Stanislav; Sabotinov, O.; Minchev, Georgi
2004-09-01
In this study we evaluate the cytotoxicity of two photosensitisers with absorption peaks in the green and red part of the spectrum on animal cell lines. The cytotoxicity assessment was performed for a tumor cell line LSCC-SF-Mc29, obtained from a transplantable chicken hepatoma induced by the myelocytomatosis virus Mc29, a tumor line LSR-SF-SR, obtained from a transplantable sarcoma in rat induced by Rous sarcoma virus strain Schmidt-Ruppin and for normal mouse and bovine cell lines. Up to now the effect of the photodynamic therapy on virus-induced cancers has not been clarified. The cells were treated with 5,10,15,20 - tetra (4-sulfophenyl) porphyrin with main absorption peak at 519 nm and a dye activated with a red light. The cells were seeded in 96-well plates at 2 x 104 cells/well. The cells were exposed to irradiation from a pulsed CuBr vapor laser at 510.6 nm and 578.2 nm and exposure rate 50 mW/cm2, from an Ar-ion laser at 514 nm and 1 mW/cm2 and to 655 nm-irradiation from a semiconductor laser at 10 mW/cm2. The biological activity of the tested compounds was measured by the neutral red uptake cytotoxicity test. The light dose-response curves and light exposures that ensure 50% drop in the treated cells viability in comparison with the cells grown in non-modified medium were obtained for each cell line. The cytotoxic effect of both photosensitisers is most distinguished for the tumor line LSCC-SF-Mc29. The 2-4 times higher viability of the normal cell lines in comparison with the tumor lines is established. The bovine cell lines are more vulnerable than the mouse lines.
X-mode artificial optical emissions and attendant phenomena at EISCAT/Heating
NASA Astrophysics Data System (ADS)
Blagoveshchenskaya, Nataly; Sergienko, Tima; Rietveld, Michael; Brandstrom, Urban; Senior, Andrew; Haggstrom, Ingemar; Kosch, Michael; Borisova, Tatiana; Yeoman, Tim
We present the experimental evidence for the formation of the artificial optical emissions induced by the X-mode powerful HF radio waves injected towards the magnetic zenith (MZ) into the high latitude F region of the ionosphere. The experiments were conducted in the course of Russian EISCAT heating campaigns in October 2012 and October 2013 at the Heating facility at Tromsø, Norway. The HF pump wave with the X-mode polarization was radiated at 7.1 or 6.2 MHz. The phased array 1, resulting in an ERP = 430 - 600 MW was used. Optical emissions at red (630 nm) and green (557 nm) lines were imaged from Tromsø site by the digital All-Sky Imager mark 2 (DASI - 2) and from a remote site at Abisco by the Auroral Large Imaging System (ALIS) in Scandinavia. The intensities of X-mode emissions at red and green lines varied between about of 150 - 1000 R and 50 - 300 R above the background respectively in different experiments. The artificial optical emissions were accompanied by very strong HF-enhanced ion lines and HF induced plasma lines from the EISCAT UHF incoherent scatter radar measurements and artificial small-scale field-aligned irregularities from CUTLASS (SuperDARN) HF coherent radar in Finland. The results obtained are discussed.
Maurya, Renu; Gopal, R
2008-04-01
Laser-induced fluorescence spectra were used to characterize the effect of cadmium on the pigment status of the leaves of Cajanus cajan L. Laser-induced fluorescence spectra of untreated as well as cadmium treated (0.01 mM, 0.10 mM, and 1.00 mM) Cajanus cajan L. were recorded using the 355 nm line of a Nd:YAG laser as the excitation source and a monochromator with an intensified charge-coupled device as a detector in the region 400-800 nm. The fluorescence intensity ratios (FIR) of control as well as treated Cajanus cajan L. have been calculated by evaluating curve fitted parameters using a Gaussian spectral function. In addition, some growth parameters, such as photosynthetic pigment content, were also measured. The 355 nm line of the laser-light-excited leaves not only showed a fluorescence emission in the red spectral region (650-800 nm), but also in the blue-green region (400-570 nm). The chlorophyll FIR F690/F740 strongly correlated with the photosynthetic pigment content (total chlorophyll and carotenoids) and its ratio. Consequently, a correlation was also seen between the ratio of the blue-green fluorescence F470/F540 and the photosynthetic pigment content. The results indicated that the plants treated with 0.01 mM of cadmium exhibited better growth, while higher concentrations of cadmium were hazardous for Cajanus cajan L.
3D model of auroral emissions for Europa
NASA Astrophysics Data System (ADS)
Cessateur, G.; Barthelemy, M.; Rubin, M.; Lilensten, J.; Maggiolo, R.; De Keyser, J.; Gunell, H.; Loreau, J.
2017-12-01
As archetype of icy satellites, Europa will be one of the primary targets of the ESA JUICE and NASA Europa Clipper missions. Through surface sputtering, Europa does possess a thin neutral gas atmosphere, mainly composed of O2 and H2O. Valuable information can therefore be retrieved from auroral and airglow measurements. We present here a 3D electron-excitation-transport-emission coupled model of oxygen line emissions produced through precipitating electrons. The density and temperature of the electrons are first derived from the multifluid MHD model from Rubin et al. (2015). Oxygen emission lines in the UV have first been modelled, such as those at 130.5 and 135.6 nm, and there is a nonhomogenous distribution of the emission. For 135.6 nm, the line emission can be significant and reach 700 Rayleigh close to the surface for a polar limb viewing angle. Visible emissions with the red-doublet (630-636.4 nm) and green (577.7 nm) oxygen lines are also considered with emission intensities reaching 7150 R and 200 R, respectively, for limb polar viewing. Using different cross section data, a sensitivity study has also been performed to assess the impact of the uncertainties on the auroral emissions.
Williamson-Hall analysis and optical properties of small sized ZnO nanocrystals
NASA Astrophysics Data System (ADS)
Kalita, Amarjyoti; Kalita, Manos P. C.
2017-08-01
We apply Williamson-Hall (WH) method of X-ray diffraction (XRD) line profile analysis for lattice strain estimation of small sized ZnO nanocrystals (crystallite size≈4 nm). The ZnO nanocrystals are synthesized by room temperature chemical co-precipitation followed by heating at 40 °C. Zinc acetate, sodium hydroxide and 2-mercaptoethanol (ME) are used for the synthesis of the nanocrystals. {100}, {002}, {101} and {200}, {112}, {201} line profiles in the XRD pattern are significantly merged, therefore determination of the full width at half maximum values and peak positions of the line profiles required for WH analysis has been carried out by executing Rietveld refinement of the XRD pattern. Lattice strain of the 4 nm sized ZnO nanocrystals is found to be 5.8×10-3 which is significantly higher as compared to the literature reported values for larger ones (crystallite size≈17-47 nm). Role of ME as capping agent is confirmed by Fourier transform infrared spectroscopy. The band gap of the nanocrystals is determined from the UV-Visible absorption spectrum and is found to be 3.68 eV. The photoluminescence spectrum exhibits emissions in the visible (408 nm-violet, 467 nm-blue and 538 nm-green) regions showing presence of zinc interstitial and oxygen vacancy in the ZnO nanocrystals.
NASA Astrophysics Data System (ADS)
Vasilyev, Roman; Artamonov, Maksim; Beletsky, Aleksandr; Zherebtsov, Geliy; Medvedeva, Irina; Mikhalev, Aleksandr; Syrenova, Tatyana
2017-09-01
We describe the Fabry–Perot interferometer designed to study Earth’s upper atmosphere. We propose a modification of the existing data processing method for determining the Doppler shift and Doppler widening and also for separating the observed line intensity and the background intensity. The temperature and wind velocity derived from these parameters are compared with physical characteristics obtained from modeling (NRLMSISE-00, HWM14). We demonstrate that the temperature is determined from the oxygen 630 nm line irrespective of the hydroxyl signal existing in interference patterns. We show that the interferometer can obtain temperature from the oxygen 557.7 nm line in case of additional calibration of the device. The observed wind velocity mainly agrees with model data. Night variations in the red and green oxygen lines quite well coincide with those in intensities obtained by devices installed nearby the interferometer.
NASA Astrophysics Data System (ADS)
Grach, S. M.; Klimenko, V. V.; Shindin, A. V.; Nasyrov, I. A.; Sergeev, E. N.; A. Yashnov, V.; A. Pogorelko, N.
2012-06-01
We present the results of studying the structure and dynamics of the HF-heated volume above the Sura facility obtained in 2010 by measurements of ionospheric airglow in the red (λ = 630 nm) and green (λ = 557.7 nm) lines of atomic oxygen. Vertical sounding of the ionosphere (followed by modeling of the pump-wave propagation) and measurements of stimulated electromagnetic emission were used for additional diagnostics of ionospheric parameters and the processes occurring in the heated volume.
Quantum dots transparent display (QDs-TPD) using a liquid QDs layer and N2 barrier discharge
NASA Astrophysics Data System (ADS)
Kim, Hong Tak; Lee, Sung-Youp; Sohn, Sang Ho
2017-07-01
Quantum dots transparent display (QDs-TPD) was realized using a liquid QDs layer and N2 barrier discharge panel. In the N2 discharge, the 2nd+ lines of N2 in the range of 300 - 400 nm (C3Πu - B3Πg), and the 1st- lines of N2+ at 391.4 and 427.8 nm (B2Σu+ - X2 Σg+) were mainly observed, while the visible emission lines were rarely observed. This implies the N2 discharge is suitable for the excitation source of the QDs, due to the strong ultra-violet radiations and the weak visible emissions. The emission centers for red, green, and blue color in QDs-TPD were positioned at 452, 540, and 638 nm, respectively, and the N2 emission peaks were seldom observed in the visible region. The transmittance of QDs-TPD was approximately 40% in the visible region and the luminescence was about 70 cd/m2. The CIE (x, y) coordinates of red, green, and blue colors were (0.670, 0.309), (0.378, 0.640), and (0.183, 0.118), respectively, and the color gamut was 71% of a NTSC standard. Thus, the QDs-TPD is expected as a way for realizing the TPD, due to its good transparency, excellent visibility, wide viewing-angle, aesthetical design, low cost production, and good scalability to large sizes.
Green fluorescent protein as a reporter of gene expression and protein localization.
Kain, S R; Adams, M; Kondepudi, A; Yang, T T; Ward, W W; Kitts, P
1995-10-01
The green fluorescent protein (GFP) from the jellyfish Aequorea victoria is rapidly becoming an important reporter molecule for monitoring gene expression and protein localization in vivo, in situ and in real time. GFP emits bright green light (lambda max = 509 nm) when excited with UV or blue light (lambda max = 395 nm, minor peak at 470 nm). The fluorescence excitation and emission spectra of GFP are similar to those of fluorescein, and the conditions used to visualize this fluorophore are also suitable for GFP. Unlike other bioluminescent reporters, the chromophore in GFP is intrinsic to the primary structure of the protein, and GFP fluorescence does not require a substrate or cofactor. GFP fluorescence is stable, species-independent and can be monitored non-invasively in living cells and, in the case of transparent organisms, whole animals. Here we demonstrate GFP fluorescence in bacterial and mammalian cells and introduce our Living Colors line of GFP reporter vectors, GFP protein and anti-GFP antiserum. The reporter vectors for GFP include a promoterless GFP vector for monitoring the expression of cloned promoters/enhancers in mammalian cells and a series of six vectors for creating fusion protein to either the N or C terminus of GFP.
Gaddam, Rohit Ranganathan; Mukherjee, Sudip; Punugupati, Neelambaram; Vasudevan, D; Patra, Chitta Ranjan; Narayan, Ramanuj; Vsn Kothapalli, Raju
2017-04-01
Synthesis of carbon dots (Cdots) via chemical route involves disintegration of carbon materials into nano-domains, wherein, after extraction of Cdots, the remaining carbon material is discarded. The present work focuses on studying even the leftover carbon residue namely, carbon nanobeads (CNBs) as an equally important material for applications on par with that of carbon dot. It employs oxidative treatment of carbonised gum olibanum resin (GOR) to produce the carbons namely Cdots and CNBs (as the residue). The Cdots (~5-10nm) exhibit blue-green fluorescence with an optical absorption at ~300nm unlike the CNBs (40-50nm) which fail to exhibit fluorescence. The fluorescence behaviour exhibited by Cdots were utilized for heavy metal ion sensing of Pb 2+ , Hg 2+ and Cd 2+ ions in aqueous media. Interestingly, both Cdots and CNBs are biocompatible to normal cell lines but cytotoxic to cancer cell lines, observed during several in vitro experiments (cell viability assay, cell cycle assay, apoptosis assay, ROS determination assay, caspase-9 activity assay). Additionally, Cdots exhibit bright green fluorescence in B16F10 cells. The Cdots and CNB's demonstrate multifunctional activities (sensor, cellular imaging and cancer therapy) in biomedical applications. Copyright © 2016 Elsevier B.V. All rights reserved.
Eder, Stephan H. K.; Gigler, Alexander M.; Hanzlik, Marianne; Winklhofer, Michael
2014-01-01
The ferrimagnetic mineral magnetite is biomineralized by magnetotactic microorganisms and a diverse range of animals. Here we demonstrate that confocal Raman microscopy can be used to visualize chains of magnetite crystals in magnetotactic bacteria, even though magnetite is a poor Raman scatterer and in bacteria occurs in typical grain sizes of only 35–120 nm, well below the diffraction-limited optical resolution. When using long integration times together with low laser power (<0.25 mW) to prevent laser induced damage of magnetite, we can identify and map magnetite by its characteristic Raman spectrum (303, 535, 665 ) against a large autofluorescence background in our natural magnetotactic bacteria samples. While greigite (cubic ; Raman lines of 253 and 351 ) is often found in the Deltaproteobacteria class, it is not present in our samples. In intracellular sulfur globules of Candidatus Magnetobacterium bavaricum (Nitrospirae), we identified the sole presence of cyclo-octasulfur (: 151, 219, 467 ), using green (532 nm), red (638 nm) and near-infrared excitation (785 nm). The Raman-spectra of phosphorous-rich intracellular accumulations point to orthophosphate in magnetic vibrios and to polyphosphate in magnetic cocci. Under green excitation, the cell envelopes are dominated by the resonant Raman lines of the heme cofactor of the b or c-type cytochrome, which can be used as a strong marker for label-free live-cell imaging of bacterial cytoplasmic membranes, as well as an indicator for the redox state. PMID:25233081
NASA Astrophysics Data System (ADS)
Aryal, Saurav; Finn, Susanna C.; Hewawasam, Kuravi; Maguire, Ryan; Geddes, George; Cook, Timothy; Martel, Jason; Baumgardner, Jeffrey L.; Chakrabarti, Supriya
2018-05-01
Energies and fluxes of precipitating electrons in an aurora over Lowell, MA on 22-23 June 2015 were derived based on simultaneous, high-resolution (≈ 0.02 nm) brightness measurements of N2+ (427.8 nm, blue line), OI (557.7 nm, green line), and OI (630.0 nm, red line) emissions. The electron energies and energy fluxes as a function of time and look direction were derived by nonlinear minimization of model predictions with respect to the measurements. Three different methods were compared; in the first two methods, we constrained the modeled brightnesses and brightness ratios, respectively, with measurements to simultaneously derive energies and fluxes. Then we used a hybrid method where we constrained the individual modeled brightness ratios with measurements to derive energies and then constrained modeled brightnesses with measurements to derive fluxes. Derived energy, assuming Maxwellian distribution, during this storm ranged from 109 to 262 eV and the total energy flux ranged from 0.8 to 2.2 ergs·cm-2·s-1. This approach provides a way to estimate energies and energy fluxes of the precipitating electrons using simultaneous multispectral measurements.
Arumai Selvan, D; Mahendiran, D; Senthil Kumar, R; Kalilur Rahiman, A
2018-03-01
Phyto-synthesis of silver nanoparticles (AgNPs) was achieved using aqueous garlic, green tea and turmeric extracts, and characterized by different spectroscopic techniques. Phytochemical analysis revealed the presence of rich amount of biochemicals in these extracts, which serve as reducing and capping agents for converting silver nitrate into AgNPs. FT IR spectroscopy confirmed the role of biomolecules in the bioreduction and efficient stabilization of AgNPs. UV-Vis DRS spectra showed a band around 450 nm characteristics of AgNPs. XRD patterns revealed the crystalline nature of the synthesized AgNPs with fcc structure. SEM and TEM analysis revealed the spherical shape of the synthesized AgNPs with an average particle size of 8 nm. EDX analysis confirmed the purity of the synthesized AgNPs with a strong signal at 3.2 keV. The antioxidant activity was assessed by ABTS, DPPH, p-NDA, H 2 O 2 and DMSO scavenging assays, in which the AgNPs synthesized using green method showed remarkable activity with respect to the standard antioxidants ascorbic acid and rutin. In vitro cytotoxicity activity was tested on four cancer cell lines such as human breast adenocarcinoma (MCF-7), cervical (HeLa), epithelioma (Hep-2) and lung (A549) along with one normal human dermal fibroblasts (NHDF) cell line. The AgNPs synthesized using turmeric extract exhibits excellent antioxidant and cytotoxicity activity compared to that synthesized using other extracts. Copyright © 2018 Elsevier B.V. All rights reserved.
Singh, Hina; Du, Juan; Yi, Tae-Hoo
2017-11-01
This study highlights the facile, reliable, cost effective, and ecofriendly synthesis of silver nanoparticles (AgNPs) using Borago officinalis leaves extract efficiently. The biosynthesis of AgNPs was verified by UV-Vis spectrum which showed the surface plasmon resonance (SPR) band at 422 nm. Transmission electron microscope (TEM) analysis revealed that the particles were spherical, hexagonal, and irregular in shape and had size ranging from 30 to 80 nm. The energy dispersive X-ray spectroscopy (EDX) and elemental mapping have displayed the purity and maximum distribution of silver in the AgNPs. The crystalline nature of AgNPs had been identified using X-ray diffraction (XRD) and selected area diffraction pattern (SAED). The particle size analysis revealed that the Z-average diameter of the AgNPs was 50.86 nm with polydispersity index (PDI) 0.136. Zeta potential analysis displayed the colloidal stability of AgNPs. This work also showed the efficacy of AgNPs against lung cancer cell lines (A549) and cervical cancer cell line (HeLa), in vitro. The AgNPs showed cytotoxicity to the A549 and HeLa cancer cell line at the concentrations 5 and 2 μg/ml. The AgNPs were also explored for the antibacterial activity including biofilm inhibition against pathogenic bacteria. The B. officinalis leaves extract can be used efficiently for green synthesis AgNPs. The biosynthesized AgNPs demonstrated potentials as anticancer and antibacterial agents. This work provides helpful insight into the development of new anticancer and antimicrobial agents.
Two-dimensional HID light source radiative transfer using discrete ordinates method
NASA Astrophysics Data System (ADS)
Ghrib, Basma; Bouaoun, Mohamed; Elloumi, Hatem
2016-08-01
This paper shows the implementation of the Discrete Ordinates Method for handling radiation problems in High Intensity Discharge (HID) lamps. Therefore, we start with presenting this rigorous method for treatment of radiation transfer in a two-dimensional, axisymmetric HID lamp. Furthermore, the finite volume method is used for the spatial discretization of the Radiative Transfer Equation. The atom and electron densities were calculated using temperature profiles established by a 2D semi-implicit finite-element scheme for the solution of conservation equations relative to energy, momentum, and mass. Spectral intensities as a function of position and direction are first calculated, and then axial and radial radiative fluxes are evaluated as well as the net emission coefficient. The results are given for a HID mercury lamp on a line-by-line basis. A particular attention is paid on the 253.7 nm resonance and 546.1 nm green lines.
Zheng, Jie; Ge, Chun; Wagner, Clark J; Lu, Meng; Cunningham, Brian T; Hewitt, J Darby; Eden, J Gary
2012-06-18
Continuous tuning over a 1.6 THz region in the near-infrared (842.5-848.6 nm) has been achieved with a hybrid ring/external cavity laser having a single, optically-driven grating reflector and gain provided by an injection-seeded semiconductor amplifier. Driven at 532 nm and incorporating a photonic crystal with an azobenzene overlayer, the reflector has a peak reflectivity of ~80% and tunes at the rate of 0.024 nm per mW of incident green power. In a departure from conventional ring or external cavity lasers, the frequency selectivity for this system is provided by the passband of the tunable photonic crystal reflector and line narrowing in a high gain amplifier. Sub - 0.1 nm linewidths and amplifier extraction efficiencies above 97% are observed with the reflector tuned to 842.5 nm.
MONTE CARLO SIMULATION OF METASTABLE OXYGEN PHOTOCHEMISTRY IN COMETARY ATMOSPHERES
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bisikalo, D. V.; Shematovich, V. I.; Gérard, J.-C.
2015-01-01
Cometary atmospheres are produced by the outgassing of material, mainly H{sub 2}O, CO, and CO{sub 2} from the nucleus of the comet under the energy input from the Sun. Subsequent photochemical processes lead to the production of other species generally absent from the nucleus, such as OH. Although all comets are different, they all have a highly rarefied atmosphere, which is an ideal environment for nonthermal photochemical processes to take place and influence the detailed state of the atmosphere. We develop a Monte Carlo model of the coma photochemistry. We compute the energy distribution functions (EDF) of the metastable O({supmore » 1}D) and O({sup 1}S) species and obtain the red (630 nm) and green (557.7 nm) spectral line shapes of the full coma, consistent with the computed EDFs and the expansion velocity. We show that both species have a severely non-Maxwellian EDF, that results in broad spectral lines and the suprathermal broadening dominates due to the expansion motion. We apply our model to the atmosphere of comet C/1996 B2 (Hyakutake) and 103P/Hartley 2. The computed width of the green line, expressed in terms of speed, is lower than that of the red line. This result is comparable to previous theoretical analyses, but in disagreement with observations. We explain that the spectral line shape does not only depend on the exothermicity of the photochemical production mechanisms, but also on thermalization, due to elastic collisions, reducing the width of the emission line coming from the O({sup 1}D) level, which has a longer lifetime.« less
Eder, Stephan H K; Gigler, Alexander M; Hanzlik, Marianne; Winklhofer, Michael
2014-01-01
The ferrimagnetic mineral magnetite Fe3O4 is biomineralized by magnetotactic microorganisms and a diverse range of animals. Here we demonstrate that confocal Raman microscopy can be used to visualize chains of magnetite crystals in magnetotactic bacteria, even though magnetite is a poor Raman scatterer and in bacteria occurs in typical grain sizes of only 35-120 nm, well below the diffraction-limited optical resolution. When using long integration times together with low laser power (<0.25 mW) to prevent laser induced damage of magnetite, we can identify and map magnetite by its characteristic Raman spectrum (303, 535, 665 cm(-1)) against a large autofluorescence background in our natural magnetotactic bacteria samples. While greigite (cubic Fe3S4; Raman lines of 253 and 351 cm(-1)) is often found in the Deltaproteobacteria class, it is not present in our samples. In intracellular sulfur globules of Candidatus Magnetobacterium bavaricum (Nitrospirae), we identified the sole presence of cyclo-octasulfur (S8: 151, 219, 467 cm(-1)), using green (532 nm), red (638 nm) and near-infrared excitation (785 nm). The Raman-spectra of phosphorous-rich intracellular accumulations point to orthophosphate in magnetic vibrios and to polyphosphate in magnetic cocci. Under green excitation, the cell envelopes are dominated by the resonant Raman lines of the heme cofactor of the b or c-type cytochrome, which can be used as a strong marker for label-free live-cell imaging of bacterial cytoplasmic membranes, as well as an indicator for the redox state.
Wang, Yuguang; Huang, Ying-Ying; Wang, Yong; Lyu, Peijun; Hamblin, Michael R
2017-08-10
We previously showed that blue (415 nm) and green (540 nm) wavelengths were more effective in stimulating osteoblast differentiation of human adipose-derived stem cells (hASC), compared to red (660 nm) and near-infrared (NIR, 810 nm). Intracellular calcium was higher after blue/green, and could be inhibited by the ion channel blocker, capsazepine. In the present study we asked what was the effect of these four wavelengths on proliferation of the hASC? When cultured in proliferation medium there was a clear difference between blue/green which inhibited proliferation and red/NIR which stimulated proliferation, all at 3 J/cm 2 . Blue/green reduced cellular ATP, while red/NIR increased ATP in a biphasic manner. Blue/green produced a bigger increase in intracellular calcium and reactive oxygen species (ROS). Blue/green reduced mitochondrial membrane potential (MMP) and lowered intracellular pH, while red/NIR had the opposite effect. Transient receptor potential vanilloid 1 (TRPV1) ion channel was expressed in hADSC, and the TRPV1 ligand capsaicin (5uM) stimulated proliferation, which could be abrogated by capsazepine. The inhibition of proliferation caused by blue/green could also be abrogated by capsazepine, and by the antioxidant, N-acetylcysteine. The data suggest that blue/green light inhibits proliferation by activating TRPV1, and increasing calcium and ROS.
NASA Astrophysics Data System (ADS)
Cai, Zhiping; Chardon, Alain; Xu, Huiying; Féron, Patrice; Michel Stéphan, Guy
2002-03-01
An Er:Yb codoped phosphate glass microchip laser has been studied under pumping with a Ti:sapphire laser ranging from 945 to 990 nm. The characteristics (threshold, slope efficiency) are first described for an optimized laser. The gain spectrum is calculated for the transition 4I13/2→ 4I15/2 around 1535 nm from fundamental spectroscopic data and from experimental results. Red-shift effect on the frequency of a single mode is experimentally observed when the pump power is increased, originating from thermal effects. Temperature inside the microchip cavity and thermal expansion coefficient were determined by employing the intensity ratio of two green upconversion emission line centered at 530 and 554 nm, respectively, which quantitatively explain this red shift.
A nutrient mixture inhibits glioblastoma xenograft U-87 MG growth in male nude mice.
Roomi, M W; Kalinovsky, T; Rath, M; Niedzwiecki, A
2016-03-01
Brain tumors are highly aggressive tumors characterized by secretions of high levels of matrix metalloproteinase-2 and -9, leading to tumor growth, invasion and metastasis by digesting the basement membrane and extracellular matrix components. We previously demonstrated the effectiveness of a nutrient mixture (NM) containing ascorbic acid, lysine, proline, and green tea extract in vitro: on activity of urokinase plasminogen activator, matrix metalloproteinases and TIMPs in various human glioblastoma (LN-18, T-98G and A-172) cell lines and on glioblastoma A-172 cell proliferation and Matrigel invasion. Our main objective in this study was to investigate the effect of the NM in vivo on human glioblastoma U-87 MG cell line. Athymic male nude mice inoculated with 3·10(6) U-87 MG cells subcutaneously and were fed a regular diet or a regular diet supplemented with 0.5% NM. Four weeks later, the mice were sacrificed, the tumors were weighed and measured. The samples were studied histologically. NM inhibited tumor weight and tumor burden by 53% (p = 0.015) and 48% (p = 0.010), respectively. These results suggest the therapeutic potential of NM as an adjuvant in the treatment of glioblastoma.
GOMOS serendipitous data products
NASA Astrophysics Data System (ADS)
Fussen, D.; Gomos Team
The GOMOS experiment on board ENVISAT has been measuring more than 200 000 star occultations through the Earth's limb since March 2002. With 4 spectrometers, the wavelength coverage of 245 nm to 942 nm allows to monitor ozone, H2O, NO2, NO3, BrO, OClO, air, aerosols, O2 and the temperature profiles. During the commissioning phase, GOMOS turned out to be a successful remote sounder of the Earth's atmosphere between 10 and 120 km. On the other hand, an intensive statistical processing of a large data set (about 5000 occultations) has produced high quality transmittance spectra. A preliminary investigation allowed the discovery of extremely interesting spectral signatures in the GOMOS spectra. Keeping in mind that all possible instrument artefacts should be carefully checked, we nevertheless obtained the following results that may become unexpected GOMOS data products in a near future: the excited oxygen "green line" (O(1S)->O(3P)) at 557.7 nm has been clearly identified and will be inverted the D2 sodium absorption at 589.1 nm is easily recognized in the mesosphere. The inversion of the slant path optical thickness (about 0.0025) has produced the first GOMOS Na vertical profile, in close agreement with the local climatological lidar data of Fort Collins a few possible emission or absorption lines are under investigation and need more statistical tests. However a spectral signature at 280 nm and h=˜ 103 km might probably be attributed to a mesospheric Mg+ layer a group of not yet identified stratospheric emission lines between 390 and 400 nm has been detected. Interestingly, the same lines seem to have also been observed by the SALOMON balloon borne experiment operated in night time conditions.
The MIGHTI Wind Retrieval Algorithm: Description and Verification
NASA Astrophysics Data System (ADS)
Harding, Brian J.; Makela, Jonathan J.; Englert, Christoph R.; Marr, Kenneth D.; Harlander, John M.; England, Scott L.; Immel, Thomas J.
2017-10-01
We present an algorithm to retrieve thermospheric wind profiles from measurements by the Michelson Interferometer for Global High-resolution Thermospheric Imaging (MIGHTI) instrument on NASA's Ionospheric Connection Explorer (ICON) mission. MIGHTI measures interferometric limb images of the green and red atomic oxygen emissions at 557.7 nm and 630.0 nm, spanning 90-300 km. The Doppler shift of these emissions represents a remote measurement of the wind at the tangent point of the line of sight. Here we describe the algorithm which uses these images to retrieve altitude profiles of the line-of-sight wind. By combining the measurements from two MIGHTI sensors with perpendicular lines of sight, both components of the vector horizontal wind are retrieved. A comprehensive truth model simulation that is based on TIME-GCM winds and various airglow models is used to determine the accuracy and precision of the MIGHTI data product. Accuracy is limited primarily by spherical asymmetry of the atmosphere over the spatial scale of the limb observation, a fundamental limitation of space-based wind measurements. For 80% of the retrieved wind samples, the accuracy is found to be better than 5.8 m/s (green) and 3.5 m/s (red). As expected, significant errors are found near the day/night boundary and occasionally near the equatorial ionization anomaly, due to significant variations of wind and emission rate along the line of sight. The precision calculation includes pointing uncertainty and shot, read, and dark noise. For average solar minimum conditions, the expected precision meets requirements, ranging from 1.2 to 4.7 m/s.
NASA Astrophysics Data System (ADS)
Ojha, Sunita; Sett, Arghya; Bora, Utpal
2017-09-01
In this study, we report synthesis of silver nanoparticles (RcAgNPs) from silver nitrate solution using methanolic leaf extract of Ricinus communis var. carmencita. The polyphenols present in the leaves reduce Ag++ ions to Ag0 followed by a color change. Silver nanoparticle formation was ensured by surface plasmon resonance between 400 nm to 500 nm. Crystallinity of the synthesized nanoparticles was confirmed by UHRTEM, SAED and XRD analysis. The capping of phytochemicals and thermal stability of RcAgNPs were assessed by FTIR spectra and TGA analysis, respectively. It also showed antibacterial activity against both gram positive and gram negative strains. RcAgNPs were non-toxic against normal cell line (mouse fibroblast cell line L929) at lower concentrations (80 µg ml-1).
NASA Astrophysics Data System (ADS)
Sugumaran, Sathish; Jamlos, Mohd Faizal; Ahmad, Mohd Noor; Bellan, Chandar Shekar; Sivaraj, Manoj
2016-08-01
Indium zinc oxide (InZnO) thin films with thicknesses of 100 nm and 200 nm were deposited on glass plate by thermal evaporation technique. Fourier transform infrared spectra showed a strong metal-oxide bond. X-ray diffraction patterns revealed amorphous nature for as-deposited film whereas polycrystalline structure for annealed films. Scanning electron microscope images showed a uniform distribution of spherical shape grains. Grain size was found to be higher for 200 nm film than 100 nm film. The presence of elements (In, Zn and O) was confirmed from energy dispersive X-ray analysis. Photoluminescence study of 200 nm film showed a blue, blue-green and blue-yellow emission whereas 100 nm film showed a broad green and green-yellow emissions. Both 100 nm and 200 nm films showed good oxygen sensitivity from room temperature to 400 °C. The observed optical and sensor results indicated that the prepared InZnO films are highly potential for room temperature gas sensor and blue, green and yellow emissive opto-electronic devices.
Prasad, P Reddy; Kanchi, S; Naidoo, E B
2016-08-01
In this study, Broccoli green extract was reported as a green and environmental friendly precursor for the one-pot biosynthesis of copper nanoparticles. The synthesized nanoparticles were characterized by UV-vis, FTIR, TEM, DLS, XRD and cyclic voltammetry. The TEM and DLS results showed that the NPs are in spherical and monodispersed with an average particle size of ~4.8nm. The FTIR results confirmed the occurrence of bioactive functional groups that are responsible for reducing cupric sulphate to copper ions. The UV-vis spectrophotometry was used for catalytic reduction of 4-nitrophenol and its dynamic reaction in Britton-Robinson buffer solution. This catalytic activity was further supported with methylene blue and methyl red dyes degradation. The nanocatalyst can be recovered from the reaction mixture and reused many times with none vital loss of catalytic activity. The Broccoli green extract modified copper nanoparticles coated on screen printing electrode laid a new sensing platform and has an excellent electrocatalytic activity. Furthermore, surface modified CuNPs with Broccoli green extract exhibited no cytotoxicity at the concentration ranging from 0.5 to 1.5μM on the prostate cancer (PC-3) cell lines. The maximum scavenging % of Broccoli green extract modified CuNPs was found to be >70.50% at the concentration of 0.25mM against 1,1-diphenyl-2-picrylhydrazyl. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Guo, Bing; Qiu, Z. R.; Wong, K. S.
2003-04-01
We report room-temperature time-integrated and time-resolved photoluminescence (PL) measurements on a nominally undoped wurtzite ZnO thin film grown on (001) silicon. A linear and sublinear excitation intensity Iex dependence of the PL intensity were observed for the 379.48-nm exciton line and the weak broad green band (˜510 nm), respectively. The green luminescence was found to decay as hyperbolic t-1, and its peak energy was observed to increase nearly logarithmically with increased Iex. These results are in an excellent agreement with the tunnel-assisted donor-deep-acceptor pair (DAP) model so that its large blueshifts of about 25 meV per decade increase in Iex can be accounted for by the screening of the fluctuating impurity potential. Also, the 30-ps fast decay of the exciton emission was attributed to the rapid trapping of carriers at luminescent impurities, while the short lifetime of τ1/e=200 ps for the green luminescence may be due to an alternative trapping by deeper centers in the ZnO. Finally, singly ionized oxygen and zinc vacancies have been tentatively invoked to act as donor-deep-acceptor candidates for the DAP luminescence, respectively.
Non-hazardous anticancerous and antibacterial colloidal 'green' silver nanoparticles.
Barua, Shaswat; Konwarh, Rocktotpal; Bhattacharya, Satya Sundar; Das, Pallabi; Devi, K Sanjana P; Maiti, Tapas K; Mandal, Manabendra; Karak, Niranjan
2013-05-01
Poly(ethylene glycol) stabilized colloidal silver nanoparticles were prepared using the reductive potency of the aqueous extract of Thuja occidentalis leaves under ambient conditions. The nanoparticles were well dispersed within a narrow size spectrum (7-14 nm) and displayed characteristic surface plasmon resonance peak at around 420 nm and Bragg's reflection planes of fcc structure. MTT assay revealed the dose-dependent cytocompatibility and toxicity of the nanoparticles with the L929 normal cell line. On the other hand, the antiproliferative action of the nanoparticles was evaluated on HeLa cell (cancerous cells) line. Fluorescence and phase contrast microscopic imaging indicated the appearance of multinucleate stages with aggregation and nuclear membrane disruption of the HeLa cells post treatment with the nanoparticles. The interaction at the prokaryotic level was also assessed via differential antibacterial efficacy against Staphylococcus aureus (MTCC 3160) and Escherichia coli (MTCC 40). Under these perspectives, it is also necessary to observe the environmental impact of the prepared silver nanoparticles. Hence, the dose dependent toxicity of silver nanoparticles was evaluated upon the earthworm species Eisenia fetida. Neither the survival nor the reproduction was affected by the addition of silver nanoparticles up to 1000 ppm. Thus these 'green' silver nanoparticles have promising potential as future materials. Copyright © 2012 Elsevier B.V. All rights reserved.
A simplified scheme for generating narrow-band mid-ultraviolet laser radiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Almog, G.; Ludwig-Maximilians-Universität, Geschwister-Scholl-Platz 1, 80539 München; Scholz, M., E-mail: Matthias.Scholz@toptica.com
2015-03-15
We report on the development and characterization of continuous, narrow-band, and tunable laser systems that use direct second-harmonic generation from blue and green diode lasers with an output power level of up to 11.1 mW in the mid-ultraviolet. One of our laser systems was tuned to the mercury 6{sup 1}S{sub 0} → 6{sup 3}P{sub 1} intercombination line at 253.7 nm. We could perform Doppler-free saturation spectroscopy on this line and were able to lock our laser to the transition frequency on long time scales.
Shemesh, Colby S; Hardy, Claire W; Yu, David S; Fernandez, Brian; Zhang, Hailing
2014-06-01
The goal of the current research is to evaluate the potential of photodynamic therapy (PDT) in the treatment of triple negative breast cancer (TNBC) with the development of a theranostic thermosensitive liposome platform to deliver indocyanine green (ICG) as the near-infrared (NIR) photosensitizer excited by an 808 nm diode laser. In the PDT protocol, an optimized thermosensitive liposome formulation is investigated to formulate ICG as the photosensitizer, which is exited by laser light at the wavelength of 808 nm delivered by a fiber-coupled laser system. ICG in both free solution and thermosensitive liposomal formulation were evaluated as the NIR photosensitizer and compared in the PDT treatment on a panel of triple negative breast cancer cell lines along with the nontumorigenic mammary epithelial cell line MCF-10A. In addition to cytotoxicity, and clonogenic survival assessment, the role of DNA double strand break damage was evaluated. Both MTT and clonogenic assays revealed that PDT using ICG inhibited the growth of several TNBC cell lines as well as the non-tumorigenic human breast epithelial cell line MCF-10A; and the liposomal formulation of ICG did not compromise the in vitro treatment potency, though free ICG performed slightly more effective in certain cell lines, but was not statistically significant. Cell viability was dose dependent in regards to ICG concentration and irradiation energy. Interestingly, PDT using the described protocol was more potent to inhibit the growth of MDA-MB-468 and HCC-1806 cells, coinciding with the observation that these cells are more sensitive toward DNA damaging agents. In comparison, cell lines HCC-70, BT-549, and MCF-10A were found to have less of an inhibitory effect. Furthermore, substantial DNA double strand breaks (DSBs) were observed 30 min after the PDT treatment via a γ-H2AX staining assay. PDT induced DNA damage has the potential to lead to mutagenicity, which may have various responses depending on the repair capabilities of the cells. Our results suggest that PDT using indocyanine green loaded liposomes were effective in inhibiting tumor cell growth to varying extents with higher responses observed for MDA-MB-468 and HCC-1806 cells. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Xu, H.; Shiokawa, K.; Oyama, S. I.; Otsuka, Y.
2017-12-01
We studied the high-latitude thermospheric wind variations near the onset time of isolated substorms. Substorm-related energy input from the magnetosphere to the polar ionosphere modifies the high-latitude ionosphere and thermosphere. For the first time, this study showed the characteristics of high-latitude thermospheric wind variations at the substorm onset. We also investigated the possibility of these wind variations as a potential trigger of substorm onset by modifying the ionospheric current system (Kan, 1993). A Fabry-Perot interferometer (FPI) at Tromsoe, Norway provided wind measurements estimated from Doppler shift of both red-line (630.0 nm for the F region) and green-line (557.7 nm for the E region) emissions of aurora and airglow. We used seven-year data sets obtained from 2009 to 2015 with a time resolution of 13 min. We first identified the onset times of local isolated substorms using ground-based magnetometer data obtained at the Tromsoe and Bear Island stations, which belongs to the IMAGE magnetometer chain. We obtained 4 red-line events and 5 green-line events taken place at different local times. For all these events, the peak locations of westward ionospheric currents identified by the ground-based magnetometer chain were located at the poleward side of Tromsoe. Then, we calculated two weighted averages of wind velocities for 30 min around the onset time and 30 min after the onset time of substorms. We evaluated differences between these two weighted averages to estimate the strength of wind changes. The observed wind changes at these substorm onsets were less than 49 m/s (26 m/s) for red-line (green-line) events, which are much smaller than the typical plasma convection speed. This indicates that the plasma motion caused by substorm-induced thermospheric winds through ion-neutral collisions is a minor effect as the driver of high-latitude plasma convection, as well as the triggering of substorm onset. We discuss possible causes of these observed wind changes at the onset of substorms based on the mechanisms of thermospheric diurnal tides, arc-induced electric field and Joule heating caused by the auroral activities that were identified by the cross sections of all-sky images, as well as the IMF-associated plasma convection model.
Laser diode and pumped Cr:Yag passively Q-switched yellow-green laser at 543 nm
NASA Astrophysics Data System (ADS)
Yao, Y.; Ling, Zhao; Li, B.; Qu, D. P.; Zhou, K.; Zhang, Y. B.; Zhao, Y.; Zheng, Q.
2013-03-01
Efficient and compact yellow green pulsed laser output at 543 nm is generated by frequency doubling of a passively Q-switched end diode-pumped Nd:YVO4 laser at 1086 nm under the condition of sup-pressing the higher gain transition near 1064 nm. With 15 W of diode pump power and the frequency doubling crystal LBO, as high as 1.58 W output power at 543 nm is achieved. The optical to optical conversion efficiency from the corresponding Q-switched fundamental output to the yellow green output is 49%. The peak power of the Q-switched yellow green pulse laser is up to 30 kW with 5 ns pulse duration. The output power stability over 8 hours is better than 2.56% at the maximum output power. To the best of our knowledge, this is the highest watt-level laser at 543 nm generated by frequency doubling of a passively Q-switched end diode pumped Nd:YVO4 laser at 1086 nm.
Real-time trichromatic holographic interferometry: preliminary study
NASA Astrophysics Data System (ADS)
Albe, Felix; Bastide, Myriam; Desse, Jean-Michel; Tribillon, Jean-Louis H.
1998-08-01
In this paper we relate our preliminary experiments on real- time trichromatic holographic interferometry. For this purpose a CW `white' laser (argon and krypton of Coherent- Radiation, Spectrum model 70) is used. This laser produces about 10 wavelengths. A system consisting of birefringent plates and polarizers allows to select a trichromatic TEM00 triplet: blue line ((lambda) equals 476 nm, 100 mW), green line ((lambda) equals 514 nm, 100 mW) and red line ((lambda) equals 647 nm, 100 mW). In a first stage we recorded a trichromatic reflection hologram with a separate reference beam on a single-layer silver-halide panchromatic plate (PFG 03C). After processing, the hologram is put back into the original recording set-up, as in classical experiments on real-time monochromatic holographic interferometry. So we observe interference fringes between the 3 reconstructed waves and the 3 actual waves. The interference fringes of the phenomenon are observed on a screen and recorded by a video camera at 25 frames per second. A color video film of about 3 minutes of duration is presented. Some examples related to phase objects are presented (hot airflow from a candle, airflow from a hand). The actual results show the possibility of using this technique to study, in real time, aerodynamic wakes and mechanical deformation.
NASA Astrophysics Data System (ADS)
Englert, Christoph R.; Harlander, John M.; Brown, Charles M.; Marr, Kenneth D.; Miller, Ian J.; Stump, J. Eloise; Hancock, Jed; Peterson, James Q.; Kumler, Jay; Morrow, William H.; Mooney, Thomas A.; Ellis, Scott; Mende, Stephen B.; Harris, Stewart E.; Stevens, Michael H.; Makela, Jonathan J.; Harding, Brian J.; Immel, Thomas J.
2017-10-01
The Michelson Interferometer for Global High-resolution Thermospheric Imaging (MIGHTI) instrument was built for launch and operation on the NASA Ionospheric Connection Explorer (ICON) mission. The instrument was designed to measure thermospheric horizontal wind velocity profiles and thermospheric temperature in altitude regions between 90 km and 300 km, during day and night. For the wind measurements it uses two perpendicular fields of view pointed at the Earth's limb, observing the Doppler shift of the atomic oxygen red and green lines at 630.0 nm and 557.7 nm wavelength. The wavelength shift is measured using field-widened, temperature compensated Doppler Asymmetric Spatial Heterodyne (DASH) spectrometers, employing low order échelle gratings operating at two different orders for the different atmospheric lines. The temperature measurement is accomplished by a multichannel photometric measurement of the spectral shape of the molecular oxygen A-band around 762 nm wavelength. For each field of view, the signals of the two oxygen lines and the A-band are detected on different regions of a single, cooled, frame transfer charge coupled device (CCD) detector. On-board calibration sources are used to periodically quantify thermal drifts, simultaneously with observing the atmosphere. The MIGHTI requirements, the resulting instrument design and the calibration are described.
[The Emission Spectroscopy of Nitrogen Discharge under Low Voltage at Room Temperature].
Shen, Li-hua; Yu, Chun-xia; Yan, Bei; Zhang, Cheng-xiao
2015-03-01
A set of direct current (DC) discharge device of N2 plasma was developed, carbon nanotubes (CNT) modified ITO electrode was used as anode, aluminum plate as cathode, with -80 μm separation between them. Nitrogen emission spectra was observed at room temperature and low DC voltage (less than 150 V), and the emission spectrometry was used to diagnose the active species of the process of nitrogen discharge. Under DC discharge, the strongest energy band N2 (C3π(u)), the weak Gaydon's Green system N2 (H3 -Φ(u)-G3 Δ(g)) and the emission line of nitrogen atoms (4 p-4 p0) at 820 nm were observed. Found that metastable state of nitrogen molecules were the main factors leading to a series of excited state nitrogen atoms and nitrogen ionization. Compared the emission spectra under DC with that under alternating current (AC) (1.1 kV), and it can be seen that under DC the spectra band of nitrogen atoms can be obviously observed, and there was a molecular band in the range of 500 - 800 nm. The effect of oxygen and hydrogen on the emission spectra of nitrogen was investigated. The results showed that the oxygen inhibited the luminescence intensity of nitrogen, but the shape of spectra unchanged. All of the second positive system, Gaydon's Green system and atomic lines of nitrogen can be observed. The second positive system and Gaydon's Green system of nitrogen will be greatly affected when the volume ratio of nitrogen and hydrogen greatly affected is 1 : 1, which was due to the hydrogen. The hydrogen can depresse nitrogen plasma activation, and make the Gaydon's Green System disappeared. CNT modified ITO electrode can reduce the breakdown voltage, and the optical signal generated by the weakly ionized gas can be observed by the photo-multiplier tube at low voltage of 10 V.
Silver metal nanoparticles study for biomedical and green house applications
NASA Astrophysics Data System (ADS)
Rauwel, E.; Simón-Gracia, L.; Guha, M.; Rauwel, P.; Kuunal, S.; Wragg, D.
2017-02-01
Metallic nanoparticles (MNP) with diameters ranging from 2 to 100nm have received extensive attention during the past decades due to their many potential applications. This paper presents a structural and cytotoxicity study of silver metal nanoparticles targeted towards biomedical applications. Spherical Ag MNPs of diameter from 20 to 50 nm have been synthesized. The encapsulation of Ag MNPs inside pH-sensitive polymersomes has been also studied for the development of biomedical applications. A cytotoxicity study of the Ag MNPs against primary prostatic cancer cell line (PPC-1) has demonstrated a high mortality rate for concentrations ranging from 100 to 200mg/L. The paper will discuss the potential for therapeutic treatments of these Ag MNPs.
Wiltschko, Roswitha; Dehe, Lars; Gehring, Dennis; Thalau, Peter; Wiltschko, Wolfgang
2013-01-01
When magnetic compass orientation of migratory robins was tested, the birds proved well oriented under low intensity monochromatic light of shorter wavelengths up to 565 nm green; from 583 nm yellow onward, they were disoriented. In the present study, we tested robins under bichromatic lights composed (1) of 424 nm blue and 565 nm green and (2) of 565 nm green and 583 nm yellow at two intensities. Under dim blue-green light with a total quantal flux of ca. 8 × 10(15)quanta/sm(2), the birds were well oriented in their migratory direction by their inclination compass; under blue-green light of twice this intensity, their orientation became axial. In both cases, the magnetic directional information was mediated by the radical pair processes in the eye. When green and yellow light were combined, however, the nature of the behavior changed. Under green-yellow light of the higher intensity, the birds showed a 'fixed direction' response that was polar, no longer controlled by the normal inclination compass; under dim green-yellow light, the response became axial. Under these two light conditions, the respective directional information was mediated by the magnetite-based receptors in the skin of the upper beak. Apparently, yellow light leads to a change from one magnetoreception system to the other. How this change is effected is still unknown; it appears to reflect complex interactions between the visual and the two magnetoreception systems. Copyright © 2012 Elsevier Ltd. All rights reserved.
High speed printing with polygon scan heads
NASA Astrophysics Data System (ADS)
Stutz, Glenn
2016-03-01
To reduce and in many cases eliminate the costs associated with high volume printing of consumer and industrial products, this paper investigates and validates the use of the new generation of high speed pulse on demand (POD) lasers in concert with high speed (HS) polygon scan heads (PSH). Associated costs include consumables such as printing ink and nozzles, provisioning labor, maintenance and repair expense as well as reduction of printing lines due to high through put. Targets that are applicable and investigated include direct printing on plastics, printing on paper/cardboard as well as printing on labels. Market segments would include consumer products (CPG), medical and pharmaceutical products, universal ID (UID), and industrial products. In regards to the POD lasers employed, the wavelengths include UV(355nm), Green (532nm) and IR (1064nm) operating within the repetition range of 180 to 250 KHz.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tuchina, E S; Tuchin, Valerii V; Khlebtsov, B N
2011-04-30
The effect of IR laser radiation ({lambda} = 805 - 808 nm) on the bacteria of the strain Staphylococcus aureus 209 P, incubated in indocyanine green solutions, is studied, as well as that of colloid gold nanoshells, nanocages and their conjugates with indocyanine green. It is found that the S. aureus 209 P cells are equally subjected to the IR laser radiation ({lambda} = 805 nm) after preliminary sensitisation with indocyanine green and gold nanoparticles separately and with conjugates of nanoparticles and indocyanine green. The enhancement of photodynamic and photothermal effects by 5 % is observed after 30 min ofmore » laser illumination ({lambda} = 808 nm) of bacteria, treated with conjugates of indocyanine green and nanocages. (optical technologies in biophysics and medicine)« less
NASA Astrophysics Data System (ADS)
Moulika, G.; Sailaja, S.; Reddy, B. Naveen Kumar; Reddy, V. Sahadeva; Dhoble, S. J.; Reddy, B. Sudhakar
2018-04-01
In this article we report on alkali oxide modified borophosphate glasses doped with Eu3+and Tb3+ ions, with the chemical composition of 69.5 B2O3+10P2O5 + 10CaF2 + 5 Li2O+ 5ZnO+ R+ 0.5 Eu2O3 [where R = 5 (LiO2/Na2O/K2O)] have been prepared by conventional melt quenching technique, and the spectroscopic properties of the prepared glasses have been studied by XRD, Optical absorption, excitation and emission spectral analysis. XRD spectrum of the glasses have shown the amorphous nature of the glasses. The red emission corresponding to 5D0 → 7F2 (613 nm) transition was observed under the excitation of 394 nm wavelength, corresponding to Eu3+ ions, for all the prepared glasses. For Eu3+ ion doped glasses, emission bands were observed, such as; 5D1→ 7F1 (538 nm), 5D0→ 7F0 (580 nm), 5D0→ 7F1 (592 nm), 5D0→ 7F2 (613 nm), 5D0→ 7F3 (613 nm) and 5D0→ 7F4 (702 nm) are identified. In the case of Tb3+ ion doped glasses, four emission lines were observed, such as 5D4→ (7F6, 7F5, 7F4), which are located at 489 nm, 545 nm and 585 nm, respectively, after the samples were excited with 376 nm ultraviolet source. The green emission corresponding to 5D4 → 7F5 (543 nm) transition was observed under excitation wavelength 376 nm of the Tb3+ ions for all the prepared glasses. For all these emission bands, the decay curves were recorded to evaluate the emission life times. The mechanism underlying the observed emission from the glasses was explained in terms of energy levels.
Promotion of neural sprouting using low-level green light-emitting diode phototherapy
NASA Astrophysics Data System (ADS)
Alon, Noa; Duadi, Hamootal; Cohen, Ortal; Samet, Tamar; Zilony, Neta; Schori, Hadas; Shefi, Orit; Zalevsky, Zeev
2015-02-01
We irradiated neuroblastoma SH-SY5Y cell line with low-level light-emitting diode (LED) illumination at a visible wavelength of 520 nm (green) and intensity of 100 mW/cm2. We captured and analyzed the cell morphology before LED treatment, immediately after, and 12 and 24 h after treatment. Our study demonstrated that LED illumination increases the amount of sprouting dendrites in comparison to the control untreated cells. This treatment also resulted in more elongated cells after treatment in comparison to the control cells and higher levels of expression of a differentiation related gene. This result is a good indication that the proposed method could serve in phototherapy treatment for increasing sprouting and enhancing neural network formation.
Mudgil, A V; To, K W; Balachandran, R M; Janigian, R H; Tsiaras, W G
1999-01-01
To determine the optimal wavelength for subconjunctival laser suture lysis. 130 black monofilament 10-0 nylon sutures were sewn subconjunctivally into the bare sclera of enucleated rabbit globes. The lowest energy levels facilitating laser suture lysis were determined for the argon green (514.5 NM), argon blue-green (488.0 NM, 514.5 NM), and krypton red (647.1 NM) wavelengths. In addition, absorption spectroscopy was performed on the suture material and conjunctiva using the Perkin Elmer W/VIS Lambda 2 spectrometer. Krypton red produced the fewest buttonhole defects, and it was also the most efficient energy source for suture lysis (P = 0.0001) under nontenectomized conjunctiva. Absorbance spectra studies revealed peak absorbance at 628 NM for the 10-0 nylon suture material. Based on animal and absorption spectroscopy studies, krypton red may be a safer and more efficient wavelength for subconjunctival laser suture lysis.
Li, Dongyu; Tian, Linlin; Huang, Zhen; Shao, Lexi; Quan, Jun; Wang, Yuxiao
2016-04-01
Hexagonal phase NaLuF4:Yb3+/Er3+ nanorods were synthesized hydrothermally. An analysis of the intense green upconversion emissions at 525 nm and 550 nm in hexagonal phase NaLuF4:Yb3/+Er3+ nanorods under excitation power density of 4.2 W/cm2 available from a diode laser emitting at 976 nm, have been undertaken. Fluorescence intensity ratio (FIR) variation of temperature-sensitive green upconversion emissions at 525 nm and 550 nm in this material was recorded in the physiological range from 295 to 343 K. The maximum sensitivity derived from the FIR technique of the green upconversion emissions is approximately 0.0044 K-1. Experimental results implied that hexagonal phase NaLuF4:Yb3/+Er3+ nanorods was a potential candidate for optical temperature sensor.
Light-induced Changes in Allophycocyanin 1
Ohad, Itzhak; Schneider, Hans-Jörg A. W.; Gendel, Steven; Bogorad, Lawrence
1980-01-01
Several lines of evidence indicate that allophycocyanin is the previously unidentified “phycochrome” observed in extracts of blue-green algae. Fractions containing phycoerythrin, phycocyanin, and allophycocyanin and exhibiting light-induced absorbance changes were prepared from extracts of Nostoc muscorum and Fremyella diplosiphon by isoelectric focusing. Illumination of such fractions with red light (650 nanometers) causes a reduction in absorbance at 620 nm (≃1 to 2%) and an increase at 560 nm. The effect, (previously observed by Björn and Björn [1976 Physiol Plant 36: 297-304]) is reversible, upon illumination with green light (550 nm). Selective immunoprecipitation of the phycobiliproteins indicates that allophycocyanin is the photoresponsive pigment. At pH 4.0 to 4.2, allophycocyanin purified from the same algae or from Phormidium luridum exhibits a light-induced absorbance change at 620 nm, which coincides with its absorption maximum at this pH; the fluorescence emission of allophycocyanin under these conditions is at 647 nm and its S20,w is 2.28, compatible with an α1β1 polypeptide composition. At neutral pH (5.8 to 7.0), allophycocyanin aggregates have a sedimentation coefficient of 4.8 (≃α3β3) and an additional absorption peak at 640 nm appears while that at 620 nm remains unaffected. The fluorescence emission maximum of the larger aggregate is at 667 nm and the light-induced change in its absorption is shifted to 650 nm. The effect of pH changes in the range 4.0 to 7.0 on the spectral and aggregation properties of allophycocyanin is completely reversible. Changes in pH which affect allophycocyanin aggregation have parallel effects on absorption and fluorescence maxima as well as on the light-induced absorbance changes of the biliprotein. No evidence is provided to resolve whether this phycochrome plays the role of an adaptochrome. PMID:16661143
Individual Differences in Chromatic Brightness Matching.
1984-10-03
very unreliable..." More recently, Boynton (15) has written, "Consider... a 555-nm green light on one side of a bi-partite field with a 4 6 5-nm blue...field immediately adjacent to it... We ask an observer to adjust the intensity of the blue field until it looks ’equally bright’ as the green one. This...clearly being blue, blue- green , green , yellow- green , yellow, and red. Their spectral transmittance curves are shown in Fig. 2. All were broad-band filters
Magnetic upconverting fluorescent NaGdF4:Ln3+ and iron-oxide@NaGdF4:Ln3+ nanoparticles
NASA Astrophysics Data System (ADS)
Shrivastava, Navadeep; Rocha, Uéslen; Muraca, Diego; Jacinto, Carlos; Moreno, Sergio; Vargas, J. M.; Sharma, S. K.
2018-05-01
Microwave assisted solvothermal method has been employed to synthesize multifunctional upconverting β-NaGdF4:Ln3+ and magnetic-upconverting Fe3O4/γ-Fe2O3@NaGdF4:Ln3+ (Ln = Yb and Er) nanoparticles. The powder x-ray diffraction data confirms the hexagonal structure of NaGdF4:Ln3+ and high resolution transmission electron microscopy shows the formation of rod shaped NaGdF4:Ln3+ (˜ 20 nm) and ovoid shaped Fe3O4/γ-Fe2O3@NaGdF4:Ln3+ (˜ 15 nm) nanoparticles. The magnetic hysteresis at 300 K for β-NaGdF4:Ln3+ demonstrates paramagnetic features, whereas iron-oxide@β-NaGdF4:Ln3+ exhibits superparamagnetic behavior along with a linear component at large applied field due to paramagnetic NaGdF4 matrix. Both nanoparticle samples provide an excellent green emitting [(2H11/2, 4S3/2)→4I15/2 (˜ 540 nm)] upconversion luminescence emission under excitation at 980 nm. The energy migration between Yb and Er in NaGdF4 matrix has been explored from 300-800 nm. Intensity variation of blue, green and red lines and the observed luminescence quenching due to the presence of Fe3O4/γ-Fe2O3 in the composite has been proposed. These kinds of materials contain magnetic and luminescence characteristics into single nanoparticle open new possibility for bioimaging applications.
Wezel, Felix; Wendt-Nordahl, Gunnar; Huck, Nina; Bach, Thorsten; Weiss, Christel; Michel, Maurice Stephan; Häcker, Axel
2010-04-01
Several diode laser systems were introduced in recent years for the minimal-invasive surgical therapy of benign prostate enlargement. We investigated the ablation capacities, hemostatic properties and extend of tissue necrosis of different diode lasers at wavelengths of 980, 1,318 and 1,470 nm and compared the results to the 120 W GreenLight HPS laser. The laser devices were evaluated in an ex vivo model using isolated porcine kidneys. The weight difference of the porcine kidneys after 10 min of laser vaporization defined the amount of ablated tissue. Blood loss was measured in blood-perfused kidneys following laser vaporization. Histological examination was performed to assess the tissue effects. The side-firing 980 and 1,470 nm diode lasers displayed similar ablative capacities compared to the GreenLight HPS laser (n.s.). The 1,318-nm laser, equipped with a bare-ended fiber, reached a higher ablation rate compared to the other laser devices (each P < 0.05). A calculated 'output power efficiency per watt' revealed that the 1,318-nm laser with a bare-ended fiber reached the highest rate compared to the side-firing devices (each P < 0.0001). All three diode lasers showed superior hemostatic properties compared to the GreenLight HPS laser (each P < 0.01). The extend of morphological tissue necrosis was 4.62 mm (1,318 nm), 1.30 mm (1,470 nm), 4.18 mm (980 nm) and 0.84 mm (GreenLight HPS laser), respectively. The diode lasers offered similar ablative capacities and improved hemostatic properties compared to the 120 W GreenLight HPS laser in this experimental ex vivo setting. The higher tissue penetration of the diode lasers compared to the GreenLight HPS laser may explain improved hemostasis.
Miniature solid-state lasers for pointing, illumination, and warning devices
NASA Astrophysics Data System (ADS)
Brown, D. C.; Singley, J. M.; Yager, E.; Kowalewski, K.; Lotito, B.; Guelzow, J.; Hildreth, J.; Kuper, J. W.
2008-04-01
In this paper we review the current status of and progress towards higher power and more wavelength diverse diode-pumped solid-state miniature lasers. Snake Creek Lasers now offers unprecedented continuous wave (CW) output power from 9.0 mm and 5.6 mm TO type packages, including the smallest green laser in the world, the MicroGreen TM laser, and the highest density green laser in the world, the MiniGreen TM laser. In addition we offer an infrared laser, the MiniIR TM, operating at 1064 nm, and have just introduced a blue Mini laser operating at 473 nm in a 9.0 mm package. Recently we demonstrated over 1 W of output power at 1064 nm from a 12 mm TO type package, and green output power from 300-500 mW from the same 12 mm package. In addition, the company is developing a number of other innovative new miniature CW solid-state lasers operating at 750 nm, 820 nm, 458 nm, and an eye-safe Q-switched laser operating at 1550 nm. We also review recently demonstrated combining volume Bragg grating (VBG) technology has been combined with automatic power control (APC) to produce high power MiniGreen TM lasers whose output is constant to +/- 10 % over a wide temperature range, without the use of a thermoelectric cooler (TEC). This technology is expected to find widespread application in military and commercial applications where wide temperature operation is particularly important. It has immediate applications in laser pointers, illuminators, and laser flashlights, and displays.
Choi, Seung-Hwan; Seo, Jeong-Wan; Kim, Ki-Ho
2018-05-03
Acne vulgaris is one of the most common dermatological problems, and its therapeutic options include topical and systemic retinoids and antibiotics. However, increase in problems associated with acne treatment, such as side-effects from conventional agents and bacterial resistance to antibiotics, has led to greater use of photodynamic therapy. The purpose of this study was to compare the bactericidal effects of indocyanine green- and methyl aminolevulinate-based photodynamic therapy on Propionibacterium acnes. P. acnes were cultured under anaerobic conditions; then they were divided into three groups (control, treated with indocyanine green and treated with methyl aminolevulinate) and illuminated with different lights (630-nm light-emitting diode, 805-nm diode laser and 830-nm light-emitting diode). The bactericidal effects were evaluated by comparing each group's colony-forming units. The cultured P. acnes were killed with an 805-nm diode laser and 830-nm light-emitting diode in the indocyanine green group. No bactericidal effects of methyl aminolevulinate-based photodynamic therapy were identified. The clinical efficacy of indocyanine green-based photodynamic therapy in 21 patients was retrospectively analyzed. The Korean Acne Grading System was used to evaluate treatment efficacy, which was significantly decreased after treatment. The difference in the efficacy of the 805-nm diode laser and 830-nm light-emitting diode was not statistically significant. Although the methyl aminolevulinate-based photodynamic therapy showed no bactericidal effect, the indocyanine green-based photodynamic therapy has bactericidal effect and clinical efficacy. © 2018 Japanese Dermatological Association.
Green fiber lasers: An alternative to traditional DPSS green lasers for flow cytometry
Telford, William G.; Babin, Sergey A.; Khorev, Serge V.; Rowe, Stephen H.
2009-01-01
Green and yellow diode-pumped solid state (DPSS) lasers (532 and 561 nm) have become common fixtures on flow cytometers, due to their efficient excitation of phycoerythrin (PE) and its tandems, and their ability to excite an expanding array of expressible red fluorescent proteins. Nevertheless, they have some disadvantages. DPSS 532 nm lasers emit very close to the fluorescein bandwidth, necessitating optical modifications to permit detection of fluorescein and GFP. DPSS 561 nm lasers likewise emit very close to the PE detection bandwidth, and also cause unwanted excitation of APC and its tandems, requiring high levels of crossbeam compensation to reduce spectral overlap into the PE tandems. In this paper, we report the development of a new generation of green fiber lasers that can be engineered to emit in the range between 532 and 561 nm. A 550 nm green fiber laser was integrated into both a BD LSR II™ cuvette and FACSVantage DiVa™ jet-in-air cell sorter. This laser wavelength avoided both the fluorescein and PE bandwidths, and provided better excitation of PE and the red fluorescent proteins DsRed and dTomato than a power-matched 532 nm source. Excitation at 550 nm also caused less incidental excitation of APC and its tandems, reducing the need for crossbeam compensation. Excitation in the 550 nm range therefore proved to be a good compromise between 532 and 561 nm sources. Fiber laser technology is therefore providing the flexibility necessary for precisely matching laser wavelengths to our flow cytometry applications. PMID:19777600
Yang, Kangwen; Li, Wenxue; Yan, Ming; Shen, Xuling; Zhao, Jian; Zeng, Heping
2012-06-04
A high-power ultra-broadband frequency comb covering the spectral range from ultraviolet to infrared was generated directly by nonlinear frequency conversion of a multi-stage high-power fiber comb amplifier. The 1030-nm infrared spectral fraction of a broadband Ti:sapphire femtosecond frequency comb was power-scaled up to 100 W average power by using a large-mode-area fiber chirped-pulse amplifier. We obtained a frequency-doubled green comb at 515 nm and frequency-quadrupled ultraviolet pulses at 258 nm with the average power of 12.8 and 1.62 W under the input infrared power of 42.2 W, respectively. The carrier envelope phase stabilization was accomplished with an ultra-narrow line-width of 1.86 mHz and a quite low accumulated phase jitter of 0.41 rad, corresponding to a timing jitter of 143 as.
Optical properties of implanted Xe color centers in diamond
Sandstrom, Russell; Ke, Li; Martin, Aiden; ...
2017-12-20
Optical properties of color centers in diamond have been the subject of intense research due to their promising applications in quantum photonics. Here in this work we study the optical properties of Xe related color centers implanted into nitrogen rich (type IIA) and an ultrapure, electronic grade diamond. The Xe defect has two zero phonon lines at 794 nm and 811 nm, which can be effectively excited using both green and red excitation, however, its emission in the nitrogen rich diamond is brighter. Near resonant excitation is performed at cryogenic temperatures and luminescence is probed under strong magnetic field. Finally,more » our results are important towards the understanding of the Xe related defect and other near infrared color centers in diamond.« less
Optical properties of implanted Xe color centers in diamond
NASA Astrophysics Data System (ADS)
Sandstrom, Russell; Ke, Li; Martin, Aiden; Wang, Ziyu; Kianinia, Mehran; Green, Ben; Gao, Wei-bo; Aharonovich, Igor
2018-03-01
Optical properties of color centers in diamond have been the subject of intense research due to their promising applications in quantum photonics. In this work we study the optical properties of Xe related color centers implanted into nitrogen rich (type IIA) and an ultrapure, electronic grade diamond. The Xe defect has two zero phonon lines at ∼794 nm and 811 nm, which can be effectively excited using both green and red excitation, however, its emission in the nitrogen rich diamond is brighter. Near resonant excitation is performed at cryogenic temperatures and luminescence is probed under strong magnetic field. Our results are important towards the understanding of the Xe related defect and other near infrared color centers in diamond.
Optical properties of implanted Xe color centers in diamond
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sandstrom, Russell; Ke, Li; Martin, Aiden
Optical properties of color centers in diamond have been the subject of intense research due to their promising applications in quantum photonics. Here in this work we study the optical properties of Xe related color centers implanted into nitrogen rich (type IIA) and an ultrapure, electronic grade diamond. The Xe defect has two zero phonon lines at 794 nm and 811 nm, which can be effectively excited using both green and red excitation, however, its emission in the nitrogen rich diamond is brighter. Near resonant excitation is performed at cryogenic temperatures and luminescence is probed under strong magnetic field. Finally,more » our results are important towards the understanding of the Xe related defect and other near infrared color centers in diamond.« less
NASA Astrophysics Data System (ADS)
Shao, Yongni; Xie, Chuanqi; Jiang, Linjun; Shi, Jiahui; Zhu, Jiajin; He, Yong
2015-04-01
Visible/near infrared spectroscopy (Vis/NIR) based on sensitive wavelengths (SWs) and chemometrics was proposed to discriminate different tomatoes bred by spaceflight mutagenesis from their leafs or fruits (green or mature). The tomato breeds were mutant M1, M2 and their parent. Partial least squares (PLS) analysis and least squares-support vector machine (LS-SVM) were implemented for calibration models. PLS analysis was implemented for calibration models with different wavebands including the visible region (400-700 nm) and the near infrared region (700-1000 nm). The best PLS models were achieved in the visible region for the leaf and green fruit samples and in the near infrared region for the mature fruit samples. Furthermore, different latent variables (4-8 LVs for leafs, 5-9 LVs for green fruits, and 4-9 LVs for mature fruits) were used as inputs of LS-SVM to develop the LV-LS-SVM models with the grid search technique and radial basis function (RBF) kernel. The optimal LV-LS-SVM models were achieved with six LVs for the leaf samples, seven LVs for green fruits, and six LVs for mature fruits, respectively, and they outperformed the PLS models. Moreover, independent component analysis (ICA) was executed to select several SWs based on loading weights. The optimal LS-SVM model was achieved with SWs of 550-560 nm, 562-574 nm, 670-680 nm and 705-715 nm for the leaf samples; 548-556 nm, 559-564 nm, 678-685 nm and 962-974 nm for the green fruit samples; and 712-718 nm, 720-729 nm, 968-978 nm and 820-830 nm for the mature fruit samples. All of them had better performance than PLS and LV-LS-SVM, with the parameters of correlation coefficient (rp), root mean square error of prediction (RMSEP) and bias of 0.9792, 0.2632 and 0.0901 based on leaf discrimination, 0.9837, 0.2783 and 0.1758 based on green fruit discrimination, 0.9804, 0.2215 and -0.0035 based on mature fruit discrimination, respectively. The overall results indicated that ICA was an effective way for the selection of SWs, and the Vis/NIR combined with LS-SVM models had the capability to predict the different breeds (mutant M1, mutant M2 and their parent) of tomatoes from leafs and fruits.
NASA Astrophysics Data System (ADS)
Schuitmaker, J. J.; Van Best, Jaap A.; van Delft, J. L.; Jannink, J. E.; Oosterhuis, J. A.; Vrensen, Gijs F.; Ms Wolff-Rouendaal, Didi; Dubbelman, T. M.
1996-01-01
Efficient photodynamic therapy (PDT) of malignant melanoma may be possible with photosensitizers having absorption maxima in the far-red region e.g., above 700 nm. Bacteriochlorin a (BCA), a non toxic derivative of bacteriochlorphyllin a, has a high molecular absorption coefficient (32.000 M-1.cm-1) at 760 nm. At this wavelength tissue penetration of light is almost optimal and melanin absorption is relatively low. In several series of experiments BCA was proven to be a very effective photosensitizer, in vitro and in vivo. It is preferentially retained in experimental hamster Greene melanoma, rhabdomyosarcoma, RIF- and mamma tumors. Its fluorescence can be detected in vivo, thus enabling early tumor detection and it is rapidly cleared from the tissues which promises no, or minor skin photosensitivity. The effects of BCA-PDT were studied in vitro and in vivo using the heavily pigmented Hamster Greene Melanoma (HGM) cell line as a model. In vitro it was found that the uptake of BCA was time, concentration and temperature dependant. Upon illumination (10 Mw/cm2, 756 nm) after incubation with 2.5 (mu) g/ml BCA for 1 h, almost complete cell kill was obtained within seconds. Hamster Greene Melanoma implanted in the anterior eye chamber of rabbits is an accepted in vivo model for ocular melanoma. The effects of BCA-PDT using this model were studied by light- and electron microscopy. Immediately after PDT intracellular spaces were enlarged and blood vessels were clotted with swollen erythrocytes. Electron microscopy showed fused inner and outer membranes and affected cristae mitchondriales of some mitochondria. With time, the severity of tissue and cell damage increased. One day after irradiation tumor growth had stopped; fluorescein angiography showed non perfusion of the tumor. Histopathology showed almost complete tumor necrosis with occasionally viable cells at the tumor periphery. It is concluded that the direct mitochondrial damage and the vascular damage both contribute to BCA-PDT induced tumor necrosis.
Zhang, Hui; Fang, Congcong; Wu, Shijia; Duan, Nuo; Wang, Zhouping
2015-11-15
In this work, a biosensor based on luminescence resonance energy transfer (LRET) from NaYF4:Yb,Tm upconversion nanoparticles (UCNPs) to SYBR Green I has been developed. The aptamers are covalently linked to UCNPs and hybridized with their complementary strands. The subsequent addition of SYBR Green allows SYBR Green I to insert into the formed double-stranded DNA (dsDNA) duplex and brings the energy donor and acceptor into close proximity, leading to the fluorescence of UCNPs transferred to SYBR Green I. When excited at 980 nm, the UCNPs emit luminescence at 477 nm, and this energy is transferred to SYBR Green I, which emits luminescence at 530 nm. In the presence of oxytetracycline (OTC), the aptamers prefer to bind to its corresponding analyte and dehybridize with the complementary DNA. This dehybridization leads to the liberation of SYBR Green I, which distances SYBR Green I from the UCNPs and recovers the UCNPs' luminescence. Under optimal conditions, a linear calibration is obtained between the ratio of I530 to I477 nm (I530/I477) and the OTC concentration, which ranges from 0.1 to 10 ng/ml with a limit of detection (LOD) of 0.054 ng/ml. Copyright © 2015 Elsevier Inc. All rights reserved.
Continuous-wave Nd:YVO4/KTiOPO4 green laser at 542 nm under diode pumping into the emitting level
NASA Astrophysics Data System (ADS)
Liu, J. H.
2012-10-01
We report a green laser at 542 nm generation by intracavity frequency doubling of a continuous wave (CW) laser operation of a 1086 nm Nd:YVO4 laser under 880 nm diode pumping into the emitting level 4 F 3/2. A KTiOPO4 (KTP) crystal, cut for critical type I phase matching at room temperature is used for second harmonic generation of the laser. At an incident pump power of 14.5 W, as high as 1.33 W of CW output power at 542 nm is achieved. The optical-to-optical conversion efficiency is up to 9.2%, and the fluctuation of the green output power was better than 3.8% in the given 30 min.
Green synthesis of anisotropic gold nanoparticles for photothermal therapy of cancer.
Fazal, Sajid; Jayasree, Aswathy; Sasidharan, Sisini; Koyakutty, Manzoor; Nair, Shantikumar V; Menon, Deepthy
2014-06-11
Nanoparticles of varying composition, size, shape, and architecture have been explored for use as photothermal agents in the field of cancer nanomedicine. Among them, gold nanoparticles provide a simple platform for thermal ablation owing to its biocompatibility in vivo. However, the synthesis of such gold nanoparticles exhibiting suitable properties for photothermal activity involves cumbersome routes using toxic chemicals as capping agents, which can cause concerns in vivo. Herein, gold nanoparticles, synthesized using green chemistry routes possessing near-infrared (NIR) absorbance facilitating photothermal therapy, would be a viable alternative. In this study, anisotropic gold nanoparticles were synthesized using an aqueous route with cocoa extract which served both as a reducing and stabilizing agent. The as-prepared gold nanoparticles were subjected to density gradient centrifugation to maximize its NIR absorption in the wavelength range of 800-1000 nm. The particles also showed good biocompatibility when tested in vitro using A431, MDA-MB231, L929, and NIH-3T3 cell lines up to concentrations of 200 μg/mL. Cell death induced in epidermoid carcinoma A431 cells upon irradiation with a femtosecond laser at 800 nm at a low power density of 6 W/cm(2) proved the suitability of green synthesized NIR absorbing anisotropic gold nanoparticles for photothermal ablation of cancer cells. These gold nanoparticles also showed good X-ray contrast when tested using computed tomography (CT), proving their feasibility for use as a contrast agent as well. This is the first report on green synthesized anisotropic and cytocompatible gold nanoparticles without any capping agents and their suitability for photothermal therapy.
Planned Visible Emission Line Space Solar Coronagraph on-board Aditya-1
NASA Astrophysics Data System (ADS)
Singh, Jagdev
2012-07-01
An imaging visible emission line internally occulted coronagraph using 20 cm off axis parabolic mirror has been designed and planned to be launched in 2014. The coronagraph will have the facility to take images of the solar simultaneously, in the green [Fe xiv] and the red [Fe x] emission lines up to 1.5 solar radii with a frequency of about 3 Hz using 0.5 nm pass band filters and the images in continuum at 580 nm up to 3 solar radii. The satellite has been named as Aditya-1 and the scientific objectives of this payload are: (i) to investigate the existence of intensity oscillations for the study of wave driven coronal heating, (ii) to study the dynamics and formation of coronal loops and temperature structure of the coronal features, (iii) to study the origin, cause and acceleration of Coronal Mass Ejections (CME's) and other solar active features, and (iv) Coronal magnetic field topology and the 3-dimensional structures of the CMEs using polarization information. The fabrication of the pay load will be done in the laboratories of LEOS, SAC, ISAC, IIA and USO and launched by ISRO. Here we shall discuss the design and the realization of the mission.
Development of fiber optic spectroscopy for in-vitro and in-planta detection of fluorescent proteins
NASA Astrophysics Data System (ADS)
Liew, Oi Wah; Chen, Jun-Wei; Asundi, Anand K.
2001-10-01
The objective of this project is to apply photonics technology to bio-safety management of genetically modified (GM) plants. The conventional method for screening GM plants is through selection using antibiotic resistance markers. There is public concern with such approaches and these are associated with food safety issues, escape of antibiotic resistance genes to pathogenic microorganisms and interference with antibiotic therapy. Thus, the strategy taken in this project is to replace antibiotic resistance markers with fluorescent protein markers that allow for rapid and non-invasive optical screening of genetically modified plants. In this paper, fibre optic spectroscopy was developed to detect and quantify recombinant green (EGFP) and red (DsRED) fluorescent proteins in vitro and in planta. In vitro detection was first carried out to optimize the sensitivity of the optical system. The bacterial expression vectors carrying the coding regions of EGFP and DsRED were introduced into Escherichia coli host cells and fluorescent proteins were produced following induction with IPTG. Soluble EGFP and DsRED proteins were isolated from lysed bacterial cells and serially diluted for quantitative analysis by fibre optic spectroscopy using different light sources, namely, blue LED (475 nm), tungsten halogen (350 - 1000 nm) and double frequency Nd:YAG green laser (532 nm). Fluorescence near the expected emission wavelengths could be detected up to 320X dilution for EGFP and DsRED with blue LED and 532 nm green laser, respectively, as the excitation source. Tungsten halogen was found to be unsuitable for excitation of both EGFP and DsRED. EGFP was successfully purified by size separation under non-denaturing electrophoretic conditions and quantified. The minimum concentration of EGFP detectable with blue LED excitation was 5 mg/ml. To determine the capability of spectroscopy detection in planta, transgenic potato hairy roots and whole modified plant lines expressing the fluorescent markers were regenerated. T
NASA Technical Reports Server (NTRS)
Joiner, J.; Yoshida, Y.; Vasilkov, A. P.; Middleton, E. M.; Campbell, P. K. E.; Yoshida, Y.; Kuse, A.; Corp, L. A.
2012-01-01
Mapping of terrestrial vegetation fluorescence from space is of interest because it can potentially provide global information on the functional status of vegetation including light use efficiency and global primary productivity that can be used for global carbon cycle modeling. Space-based measurement of solar-induced chlorophyll fluorescence is challenging, because its signal is small as compared with the much larger reflectance signal. Ground- and aircraft-based approaches have made use of the dark and spectrally-wide O2-A ( approx 760 nm) and O2-B (approx 690 nm) atmospheric features to detect the weak fluorescence signal. More recently, Joiner et al. and Frankenberg et al. focused on longer-wavelength solar Fraunhofer lines that can be observed with space-based instruments such as the currently operational GOSAT. They showed that fluorescence can be detected using Fraunhofer lines away from the far-red chlorophyll-a fluorescence peak even when the surface is relatively bright. Here, we build on that work by developing methodology to correct for instrumental artifacts that produce false filling-in signals that can bias fluorescence retrievals. We also examine other potential sources of filling-in at far-red and NIR wavelengths. Another objective is to explore the possibility of making fluorescence measurements from space with lower spectral resolution instrumentation than the GOSAT interferometer. We focus on the 866nm Ca II solar Fraunhofer line. Very few laboratory and ground-based measurements of vegetation fluorescence have been reported at wavelengths longer than 800 nm. Some results of fluorescence measurements of corn leaves acquired in the laboratory using polychromatic excitation at wavelengths shorter than 665nm show that at 866 nm, the measured signal is of the order of 0.1-0.2 mW/sq m/nm/sr. In this work, we use the following satellite observations: We use SCIAMACHY channel 5 in nadir mode that covers wavelengths between 773 and 1063nm at a spectral resolution of 0.54 nm. GOSAT has two instrument packages: the Thermal And Near-infrared Sensor for carbon Observation-Fourier Transform Spectrometer (TANSO-FTS) and the Cloud and Aerosol Imager (CAI). We use TANSO-FTS band 1, which extends from approximately 758 to 775nm and we use cloud fraction derived from the CAI. We compare satellite-derived fluorescence with the Enhanced Vegetation Index (EVI), an Aqua/MODIS-derived vegetation reflectance-based index that indicates relative greenness and is used to infer photosynthetic function.
Scharf, John Edward
1998-11-03
A reflectance pulse oximeter that determines oxygen saturation of hemoglobin using two sources of electromagnetic radiation in the green optical region, which provides the maximum reflectance pulsation spectrum. The use of green light allows placement of an oximetry probe at central body sites (e.g., wrist, thigh, abdomen, forehead, scalp, and back). Preferably, the two green light sources alternately emit light at 560 nm and 577 nm, respectively, which gives the biggest difference in hemoglobin extinction coefficients between deoxyhemoglobin, RHb, and oxyhemoglobin, HbO.sub.2.
Crook, Damon J; Francese, Joseph A; Zylstra, Kelley E; Fraser, Ivich; Sawyer, Alan J; Bartels, David W; Lance, David R; Mastro, Victor C
2009-12-01
Retinal sensitivity of Agrilus planipennis Fairmaire (Coleoptera: Buprestidae) was examined with an aim to improve trap efficacy for the beetle. Electroretinogram (ERG) recordings from dark-adapted compound eyes of male and female were measured at different wavelengths across the spectrum ranging from 300 to 700 nm. The spectral sensitivity curves revealed peaks in the UV (340 nm), the violet/purple (420-430 nm), blue (460 nm), and green (540-560 nm) regions of the spectrum. Females were sensitive to red regions of the spectrum (640-670 nm), whereas males were not. A spectrophotometer was used to measure the wavelength and reflectance for ash foliage, purple corrugated plastic traps, as well as the elytra and abdomen of adult A. planipennis. Traps were painted using colors based on ERG and spectrophotometer measurements and compared with purple corrugated plastic traps currently used by the USDA-APHIS-PPQ-EAB National Survey. In a field assay conducted along the edges of several A. planipennis-infested ash stands, there were no significant differences in trap catch among green, red, or purple treatments. Dark blue traps caught significantly fewer A. planipennis than red, light green, or dark purple traps. In a second assay where purple and green treatments were placed in the mid canopy of ash trees (approximately 13 m in height), trap catch was significantly higher on green treatments. We hypothesize that when placed in the mid-canopy, green traps constitute a foliage-type stimulus that elicits food-seeking and/or host seeking behavior by A. planipennis.
All-periodically poled, high-power, continuous-wave, single-frequency tunable UV source.
Aadhi, A; Chaitanya N, Apurv; Jabir, M V; Singh, R P; Samanta, G K
2015-01-01
We report on experimental demonstration of an all-periodically poled, continuous-wave (CW), high-power, single-frequency, ultra-violet (UV) source. Based on internal second-harmonic-generation (SHG) of a CW singly resonant optical parametric oscillator (OPO) pumped in the green, the UV source provides tunable radiation across 398.94-417.08 nm. The compact source comprising of a 25-mm-long MgO-doped periodically poled stoichiometric lithium tantalate (MgO:sPPLT) crystal of period Λ(SLT)=8.5 μm for OPO and a 5-mm-long, multi-grating (Λ(KTP)=3.3, 3.4, 3.6 and 3.8 μm), periodically poled potassium titanium phosphate (PPKTP) for intra-cavity SHG, provides as much as 336 mW of UV power at 398.94 nm, corresponding to a green-to-UV conversion efficiency of ∼6.7%. In addition, the singly resonant OPO (SRO) provides 840 mW of idler at 1541.61 nm and substantial signal power of 108 mW at 812.33 nm transmitted through the high reflective cavity mirrors. UV source provides single-frequency radiation with instantaneous line-width of ∼18.3 MHz and power >100 mW in Gaussian beam profile (ellipticity >92%) across the entire tuning range. Access to lower UV wavelengths requires smaller grating periods to compensate high phase-mismatch resulting from high material dispersion in the UV wavelength range. Additionally, we have measured the normalized temperature and spectral acceptance bandwidth of PPKTP crystal in the UV wavelength range to be ∼2.25°C·cm and ∼0.15 nm·cm, respectively.
Hammer, Martin; Königsdörffer, Ekkehart; Liebermann, Christiane; Framme, Carsten; Schuch, Günter; Schweitzer, Dietrich; Strobel, Jürgen
2008-01-01
Post-translational protein modification by lipid peroxidation products or glycation is a feature of aging as well as pathologic processes in postmitotic cells at the ocular fundus exposed to an oxidative environment. The accumulation of modified proteins such as those found in lipofuscin and advanced glycation end products (AGEs) contribute greatly to the fundus auto-fluorescence. The distinct fluorescence spectra of lipofuscin and AGE enable their differentiation in multispectral fundus fluorescence imaging. A dual-centre consecutive case series of 78 pseudo-phacic patients is reported. Digital colour fundus photographs as well as auto-fluorescence images were taken from 33 patients with age related macular degeneration (AMD), 13 patients with diabetic retinopathy (RD), or from 32 cases without pathologic findings (controls). Fluorescence was excited at 475-515 nm or 476-604 nm and recorded in the emission bands 530-675 nm or 675-715 nm, respectively. Fluorescence images excited at 475-515 nm were taken by a colour CCD-camera (colour-fluorescence imaging) enabling the separate recording of green and red fluorescence. The ratio of green versus red fluorescence was calculated within a representative region of each image. The 530-675 nm auto-fluorescence in AMD patients was dominated by the red emission (green vs. red ratio, g/r = 0.861). In comparison, the fluorescence of the diabetics was green-shifted (g/r = 0.946; controls: g/r = 0.869). Atrophic areas (geographic atrophy, laser scars) showed massive hypo-fluorescence in both emission bands. Hyper-fluorescent drusen and exudates, unobtrusive in the colour fundus images as well as in the fluorescence images with emission >667 nm, showed an impressive green-shift in the colour-fluorescence image. Lipofuscin is the dominant fluorophore at long wavelengths (>675 nm or red channel of the colour fluorescence image). In the green spectral region, we found an additional emission of collagen and elastin (optic disc, sclera) as well as deposits in drusen and exudates. The green shift of the auto-fluorescence in RD may be a hint of increased AGE concentrations.
Can cathodoluminescence of feldspar be used as provenance indicator?
NASA Astrophysics Data System (ADS)
Scholonek, Christiane; Augustsson, Carita
2016-05-01
We have studied feldspar from crystalline rocks for its textural and spectral cathodoluminescence (CL) characteristics with the aim to reveal their provenance potential. We analyzed ca. 60 rock samples of plutonic, volcanic, metamorphic, and pegmatitic origin from different continents and of 16 Ma to 2 Ga age for their feldspar CL textures and ca. 1200 feldspar crystals from these rocks for their CL color spectra. Among the analyzed rocks, igneous feldspar is most commonly zoned, whereby oscillatory zoning can be confirmed to be typical for volcanic plagioclase. The volcanic plagioclase also less commonly contains twin lamellae that are visible in CL light than crystals from other rock types. Alkali feldspar, particularly from igneous and pegmatitic rocks, was noted to be most affected by alteration features, visible as dark spots, lines and irregular areas. The size of all textural features of up to ca. 150 μm, in combination with possible alteration in both the source area and the sedimentary system, makes the CL textures of feldspar possible to use for qualitative provenance research only. We observed alkali feldspar mostly to luminesce in a bluish color and sometimes in red, and plagioclase in green to yellow. The corresponding CL spectra are dominated by three apparent intensity peaks at 440-520 nm (mainly blue), 540-620 nm (mainly green) and 680-740 nm (red to infrared). A dominance of the peak in the green wavelength interval over the blue one for plagioclase makes CL particularly useful for the differentiation of plagioclase from alkali feldspar. An apparent peak position in red to infrared at < 710 nm for plagioclase mainly is present in mafic rocks. Present-day coastal sand from Peru containing feldspar with the red to infrared peak position mainly exceeding 725 nm for northern Peruvian sand and a larger variety for sand from southern Peru illustrates a discriminative effect of different source areas. We conclude that the provenance application particularly can reveal first-cycle input from mafic rocks and source variations for detritus from arid areas that has been affected by little feldspar alteration.
Green light emitting curcumin dye in organic solvents
NASA Astrophysics Data System (ADS)
Mubeen, Mohammad; Deshmukh, Abhay D.; Dhoble, S. J.
2018-05-01
In this modern world, the demand for the white light emission has increased because of its wide applications in various display and lighting devices, sensors etc. This white light can be produced by mixing red, green and blue lights. Thus this green light can be produced from the plant extract i.e., Turmeric. Curcumin is the essential element present in turmeric to generate the green light. The Photoluminescence (PL) emission is observed at 540 nm at 380nm excitation. This method of generating green light is very simple, cost effective and efficient when compared to other methods.
Green high-power tunable external-cavity GaN diode laser at 515 nm.
Chi, Mingjun; Jensen, Ole Bjarlin; Petersen, Paul Michael
2016-09-15
A 480 mW green tunable diode laser system is demonstrated for the first time to our knowledge. The laser system is based on a GaN broad-area diode laser and Littrow external-cavity feedback. The green laser system is operated in two modes by switching the polarization direction of the laser beam incident on the grating. When the laser beam is p-polarized, an output power of 50 mW with a tunable range of 9.2 nm is achieved. When the laser beam is s-polarized, an output power of 480 mW with a tunable range of 2.1 nm is obtained. This constitutes the highest output power from a tunable green diode laser system.
Over 0.5 MW green laser from sub-nanosecond giant pulsed microchip laser
NASA Astrophysics Data System (ADS)
Zheng, Lihe; Taira, Takunori
2016-03-01
A sub-nanosecond green laser with laser head sized 35 × 35 × 35 mm3 was developed from a giant pulsed microchip laser for laser processing on organic superconducting transistor with a flexible substrate. A composite monolithic Y3Al5O12 (YAG) /Nd:YAG/Cr4+:YAG/YAG crystal was designed for generating giant pulsed 1064 nm laser. A fibercoupled 30 W laser diode centered at 808 nm was used with pump pulse duration of 245 μs. The 532 nm green laser was obtained from a LiB3O5 (LBO) crystal with output energy of 150 μJ and pulse duration of 268 ps. The sub-nanosecond green laser is interesting for 2-D ablation patterns.
Shao, Yongni; Xie, Chuanqi; Jiang, Linjun; Shi, Jiahui; Zhu, Jiajin; He, Yong
2015-04-05
Visible/near infrared spectroscopy (Vis/NIR) based on sensitive wavelengths (SWs) and chemometrics was proposed to discriminate different tomatoes bred by spaceflight mutagenesis from their leafs or fruits (green or mature). The tomato breeds were mutant M1, M2 and their parent. Partial least squares (PLS) analysis and least squares-support vector machine (LS-SVM) were implemented for calibration models. PLS analysis was implemented for calibration models with different wavebands including the visible region (400-700 nm) and the near infrared region (700-1000 nm). The best PLS models were achieved in the visible region for the leaf and green fruit samples and in the near infrared region for the mature fruit samples. Furthermore, different latent variables (4-8 LVs for leafs, 5-9 LVs for green fruits, and 4-9 LVs for mature fruits) were used as inputs of LS-SVM to develop the LV-LS-SVM models with the grid search technique and radial basis function (RBF) kernel. The optimal LV-LS-SVM models were achieved with six LVs for the leaf samples, seven LVs for green fruits, and six LVs for mature fruits, respectively, and they outperformed the PLS models. Moreover, independent component analysis (ICA) was executed to select several SWs based on loading weights. The optimal LS-SVM model was achieved with SWs of 550-560 nm, 562-574 nm, 670-680 nm and 705-71 5 nm for the leaf samples; 548-556 nm, 559-564 nm, 678-685 nm and 962-974 nm for the green fruit samples; and 712-718 nm, 720-729 nm, 968-978 nm and 820-830 nm for the mature fruit samples. All of them had better performance than PLS and LV-LS-SVM, with the parameters of correlation coefficient (rp), root mean square error of prediction (RMSEP) and bias of 0.9792, 0.2632 and 0.0901 based on leaf discrimination, 0.9837, 0.2783 and 0.1758 based on green fruit discrimination, 0.9804, 0.2215 and -0.0035 based on mature fruit discrimination, respectively. The overall results indicated that ICA was an effective way for the selection of SWs, and the Vis/NIR combined with LS-SVM models had the capability to predict the different breeds (mutant M1, mutant M2 and their parent) of tomatoes from leafs and fruits. Copyright © 2015 Elsevier B.V. All rights reserved.
Unusual Cathodoluminescence in Diamonds: Evidence for Metamorphism or a Source Characteristic
NASA Astrophysics Data System (ADS)
Bruce, L. F.; Longo, M.; Kopylova, M.; Ryder, J.
2009-05-01
Cathodoluminescence (CL) is a useful means of diamond "fingerprinting". CL-active cratonic macrodiamonds usually cathodoluminesce blue or yellow, and always exhibit prominent wide CL emittance peaks at 430-450 nm and 480-490 nm. Exceptions to this norm are diamond suites recently discovered in the Archean rocks metamorphosed in the greenschist facies. These macrodiamonds cathodoluminesce red, orange and yellow, and invariably exhibit the most prominent CL peak at 520 nm. The diamond suites with the unusual CL are derived from two different locations within the Michipicoten Greenstone Belt (Southern Superior craton), near the town of Wawa (Ontario). One suite is extracted from the 2.68-2.74 Ga polymict volcanic breccias and lamprophyres and the other suite - from the 2.68 Ga sedimentary conglomerates grading into overlying sandstones of the Dore assemblage. The diamondiferous conglomerates are found in an area 8 km south of the breccias and 12 km northeast of Wawa. CL emittance of macrodiamonds (> 0.5 mm) extracted from the breccias consists of a broad band at 520 nm, a sharp peak at 575.5 nm, and several lines at 550-670 nm. The conglomerate macrodiamonds mostly show a dominant peak at 520 nm, whereas corresponding microdiamonds exhibit two peaks at about 576 and 600 nm. None of the diamonds show a maximum peak at 420 nm. Polycrystalline stones from conglomerates show distinct CL spectra and colours for all intergrown crystals in the same diamond. The relative abundances of the CL colors of the conglomerate diamonds are orange-red (46%), yellow (28%), orange-green (10%), green (6%), and non-uniform colors (10%). These colours are more diverse than mostly orange CL colours in the breccia diamonds; this results from a larger variety of positions and intensity of CL peaks in the conglomerate diamonds. We propose two models for explaining the presence of the 520 nm CL peak in the breccia and conglomerate diamonds in Wawa. The first model suggests metamorphism as the main factor influencing the CL colors of the suites. Diamonds in the volcaniclastic breccias and sedimentary conglomerates may have come from different deep sources, but acquired similar cathodoluminescence due to a metamorphic overprint. Metamorphic fluids have been shown to have a potential to percolate through diamond fractures and affect diamond inclusions. Furthermore, diamonds found in the Kokchetav metamorphic massif are reported to have green CL with an emission at 514-537 nm. The "metamorphic" model is supported by the contrast in the diamond indicator minerals recovered from the volcaniclastic breccias and sedimentary conglomerates. Only the latter contain kimberlite indicator minerals from a proximal source, such as diopside and garnet with preserved kelyphitic rims. The second model suggests the presence of the 520 nm CL peak controlling the green-red CL visible colors is an internal characteristic of the two Wawa diamond suites related to their origin from the same deep source. Currently, we are studying the N content and aggregation state of the conglomerate diamonds using the Fourier transform infrared technique to compare these data with the corresponding values for the breccia diamonds. Further work is needed to determine if either model can explain all observed properties of the Wawa diamond suites.
Color transitions in coral's fluorescent proteins by site-directed mutagenesis
Gurskaya, Nadya G; Savitsky, Alexander P; Yanushevich, Yurii G; Lukyanov, Sergey A; Lukyanov, Konstantin A
2001-01-01
Background Green Fluorescent Protein (GFP) cloned from jellyfish Aequorea victoria and its homologs from corals Anthozoa have a great practical significance as in vivo markers of gene expression. Also, they are an interesting puzzle of protein science due to an unusual mechanism of chromophore formation and diversity of fluorescent colors. Fluorescent proteins can be subdivided into cyan (~ 485 nm), green (~ 505 nm), yellow (~ 540 nm), and red (>580 nm) emitters. Results Here we applied site-directed mutagenesis in order to investigate the structural background of color variety and possibility of shifting between different types of fluorescence. First, a blue-shifted mutant of cyan amFP486 was generated. Second, it was established that cyan and green emitters can be modified so as to produce an intermediate spectrum of fluorescence. Third, the relationship between green and yellow fluorescence was inspected on closely homologous green zFP506 and yellow zFP538 proteins. The following transitions of colors were performed: yellow to green; yellow to dual color (green and yellow); and green to yellow. Fourth, we generated a mutant of cyan emitter dsFP483 that demonstrated dual color (cyan and red) fluorescence. Conclusions Several amino acid substitutions were found to strongly affect fluorescence maxima. Some positions primarily found by sequence comparison were proved to be crucial for fluorescence of particular color. These results are the first step towards predicting the color of natural GFP-like proteins corresponding to newly identified cDNAs from corals. PMID:11459517
Intense excitation source of blue-green laser
NASA Astrophysics Data System (ADS)
Han, Kwang S.
1986-10-01
An intense and efficient source for blue green laser useful for the space-based satellite laser applications, underwater strategic communication, and measurement of ocean bottom profile is being developed. The source in use, the hypocycloidal pinch plasma (HCP), and the dense plasma focus (DPF) can produce intense uv photons (200 to 400nm) which match the absorption spectra of both near UV and blue green dye lasers (300 to 400nm). As a result of optimization of the DPF light at 355nm, the blue green dye (LD490) laser output exceeding 4mJ was obtained at the best cavity tunning of the laser system. With the HCP pumped system a significant enhancement of the blue green laser outputs with dye LD490 and coumarin 503 has been achieved through the spectrum conversion of the pumping light by mixing a converter dye BBQ. The maximum increase of laser output with the dye mixture of LD490+BBQ and coumarin 503+BBQ was greater than 80%. In addition, the untunned near UV lasers were also obtained. The near UV laser output energy of P-terphenyl dye was 0.5mJ at lambda sub C=337nm with the bandwidth of 3n m for the pulse duration of 0.2us. Another near UV laser output energy obtained with BBQ dye was 25 mJ at lambda sub C=383nm with the bandwidth of 3nm for the pulse duration of 0.2us. Another near UV laser output energy obtained with BBQ dye was 25 mJ at lambda sub C=383nm with the bandwidth of 3nm for the pulse duration of 0.2microsec.
Uchida, Yumiko; Morimoto, Yukihiro; Uchiike, Takao; Kamamoto, Tomoyuki; Hayashi, Tamaki; Arai, Ikuyo; Nishikubo, Toshiya; Takahashi, Yukihiro
2015-07-01
Phototherapy using blue light-emitting diodes (LED) is effective against neonatal jaundice. However, green light phototherapy also reduces unconjugated jaundice. We aimed to determine whether mixed blue and green light can relieve jaundice with minimal oxidative stress as effectively as either blue or green light alone in a rat model. Gunn rats were exposed to phototherapy with blue (420-520 nm), filtered blue (FB; 440-520 nm without<440-nm wavelengths, FB50 (half the irradiance of filtered blue), mixed (filtered 50% blue and 50% green), and green (490-590 nm) LED irradiation for 24h. The effects of phototherapy are expressed as ratios of serum total (TB) and unbound (UB) bilirubin before and after exposure to each LED. Urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG) was measured by HPLC before and after exposure to each LED to determine photo-oxidative stress. Values < 1.00 indicate effective phototherapy. The ratios of TB and UB were decreased to 0.85, 0.89, 1.07, 0.90, and 1.04, and 0.85, 0.94, 0.93, 0.89, and 1.09 after exposure to blue, filtered blue, FB50, and filtered blue mixed with green LED, respectively. In contrast, urinary 8-OHdG increased to 2.03, 1.25, 0.96, 1.36, 1.31, and 1.23 after exposure to blue, filtered blue, FB50, mixed, green LED, and control, indicating side-effects (> 1.00), respectively. Blue plus green phototherapy is as effective as blue phototherapy and it attenuates irradiation-induced oxidative stress. Combined blue and green spectra might be effective against neonatal hyperbilirubinemia. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Yu, Jie; Javier, David; Yaseen, Mohammad A.; Nitin, Nitin; Richards-Kortum, Rebecca; Anvari, Bahman; Wong, Michael S.
2010-01-01
New colloidal materials that can generate heat upon irradiation are being explored for photothermal therapy as a minimally invasive approach to cancer treatment. The near-infrared dye indocyanine green (ICG) could serve as a basis for such a material, but its encapsulation and subsequent use is very difficult to carry out. We report the three-step room-temperature synthesis of ~120-nm capsules loaded with ICG within salt-crosslinked polyallylamine aggregates, and coated with anti-epidermal growth factor receptor (anti-EGFR) antibodies for tumor cell targeting capability. We studied the synthesis conditions such as temperature and water dilution to control the capsule size and characterized the size distribution via dynamic light scattering and scanning electron microscopy. We further studied the specificity of tumor cell targeting using three carcinoma cell lines with different levels of EGFR expression, and investigated the photothermal effects of ICG containing nanocapsules on EGFR-rich tumor cells. Significant thermal toxicity was observed for encapsulated ICG as compared to free ICG at 808 nm laser irradiation with radiant exposure of 6 W/cm2. These results illustrate the ability to design a colloidal material with cell targeting and heat generating capabilities using non-covalent chemistry. PMID:20092330
NASA Astrophysics Data System (ADS)
Shi, Lihong; Li, Yanyan; Li, Xiaofeng; Wen, Xiangping; Zhang, Guomei; Yang, Jun; Dong, Chuan; Shuang, Shaomin
2015-04-01
We report a facile and eco-friendly strategy for the fabrication of green fluorescent carbon nanodots (CDs), and demonstrate their applications for bio-imaging, patterning, and staining. A one-pot hydrothermal method using various plant petals yields bright green-emitting CDs, providing an easy way for the production of green fluorescent CDs without the need for a tedious synthetic methodology or the use of toxic/expensive solvents and starting materials. The as-prepared CDs show small size distribution and excellent dispersibility. Their strong green fluorescence is observed when the excitation wavelength is between 430 nm and 490 nm. Moreover, they exhibit high tolerance to various external conditions, such as pH values, external cations, and continuous excitation. Due to minimum toxicity as well as good photoluminescence properties, these CDs can be applied to in vitro and in vivo imaging, patterning, and staining. According to confocal fluorescence imaging of human uterine cervical squamous cell carcinoma cells, CDs penetrate into the cell and enter the cytoplasm and the nucleus. More strikingly, carp is directly fed with CDs for in vivo imaging and shows bright green fluorescence at an excitation wavelength of 470 nm. In addition, the obtained CDs are used as fluorescent inks for drawing luminescence patterns. Finally, we also apply the CDs as a fluorescent dye. Interestingly, the absorbent filter paper with staining emits dramatic fluorescence under 470 nm excitation.We report a facile and eco-friendly strategy for the fabrication of green fluorescent carbon nanodots (CDs), and demonstrate their applications for bio-imaging, patterning, and staining. A one-pot hydrothermal method using various plant petals yields bright green-emitting CDs, providing an easy way for the production of green fluorescent CDs without the need for a tedious synthetic methodology or the use of toxic/expensive solvents and starting materials. The as-prepared CDs show small size distribution and excellent dispersibility. Their strong green fluorescence is observed when the excitation wavelength is between 430 nm and 490 nm. Moreover, they exhibit high tolerance to various external conditions, such as pH values, external cations, and continuous excitation. Due to minimum toxicity as well as good photoluminescence properties, these CDs can be applied to in vitro and in vivo imaging, patterning, and staining. According to confocal fluorescence imaging of human uterine cervical squamous cell carcinoma cells, CDs penetrate into the cell and enter the cytoplasm and the nucleus. More strikingly, carp is directly fed with CDs for in vivo imaging and shows bright green fluorescence at an excitation wavelength of 470 nm. In addition, the obtained CDs are used as fluorescent inks for drawing luminescence patterns. Finally, we also apply the CDs as a fluorescent dye. Interestingly, the absorbent filter paper with staining emits dramatic fluorescence under 470 nm excitation. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr00783f
Optoelectronic pH Meter: Further Details
NASA Technical Reports Server (NTRS)
Jeevarajan, Antony S.; Anderson, Mejody M.; Macatangay, Ariel V.
2009-01-01
A collection of documents provides further detailed information about an optoelectronic instrument that measures the pH of an aqueous cell-culture medium to within 0.1 unit in the range from 6.5 to 7.5. The instrument at an earlier stage of development was reported in Optoelectronic Instrument Monitors pH in a Culture Medium (MSC-23107), NASA Tech Briefs, Vol. 28, No. 9 (September 2004), page 4a. To recapitulate: The instrument includes a quartz cuvette through which the medium flows as it is circulated through a bioreactor. The medium contains some phenol red, which is an organic pH-indicator dye. The cuvette sits between a light source and a photodetector. [The light source in the earlier version comprised red (625 nm) and green (558 nm) light-emitting diodes (LEDs); the light source in the present version comprises a single green- (560 nm)-or-red (623 nm) LED.] The red and green are repeatedly flashed in alternation. The responses of the photodiode to the green and red are processed electronically to obtain the ratio between the amounts of green and red light transmitted through the medium. The optical absorbance of the phenol red in the green light varies as a known function of pH. Hence, the pH of the medium can be calculated from the aforesaid ratio.
Shibata, Yutaka; Katoh, Wataru; Tahara, Yukari
2013-04-01
Fluorescence microspectroscopy observations were used to study the processes of cell differentiation and assemblies of photosynthesis proteins in Zea mays leaves under the greening process. The observations were done at 78K by setting the sample in a cryostat to avoid any undesired progress of the greening process during the measurements. The lateral and axial spatial resolutions of the system were 0.64μm and 4.4μm, respectively. The study revealed the spatial distributions of protochlorophyllide (PChld) in both the 632-nm-emitting and 655-nm-emitting forms within etiolated Zea mays leaves. The sizes of the fluorescence spots attributed to the former were larger than those of the latter, validating the assignment of the former and latter to the prothylakoid and prolamellar bodies, respectively. In vivo microspectroscopy observations of mature Zea mays leaves confirmed the different photosystem II (PS I)/photosystem I (PS II) ratio between the bundle sheath (BS) and mesophyll (MS) cells, which is specific for C4-plants. The BS cells in Zea mays leaves 1h after the initiation of the greening process tended to show fluorescence spectra at shorter wavelength side (at around 679nm) than the MS cells (at around 682nm). The 679-nm-emitting chlorophyll-a form observed mainly in the BS cells was attributed to putative precursor complexes to PS I. The BS cells under 3-h greening showed higher relative intensities of the PS I fluorescence band at around 735nm, suggesting the reduced PS II amount in the BS cells in this greening stage. Copyright © 2013 Elsevier B.V. All rights reserved.
The 557.7 and 297.2 nm lines of O(1S) in the atmospheres of the terrestrial planets
NASA Astrophysics Data System (ADS)
Slanger, Tom; Sharpee, Brian; Pejakovic, Dusan; Gattinger, Richard; Llewellyn, Edward J.; McDade, Ian; Siskind, David; Minschwaner, Kenneth
There are few examples of spectral features in nightglows or in auroras which can be used for relative intensity calibration from space, particularly over a broad wavelength region. One potential candidate is the atomic oxygen line pair at 297.2 nm (the trans-auroral line) and 557.7 nm (the green line). They share the common O(1 S0 ) upper level, and therefore the observed intensity ratio of the O(1 S0 -1 D2 ) and O(1 S0 -3 P1 ) lines has a value that is a quantum-mechanical constant, equal to the ratio of the respective transition probabilities. The recently-published figure of 9.3 ± 0.5 [Gattinger et al., 2009] for I557.7 /I297.2 confirms the earlier value of 9.8 ± 1.0 [Slanger et al., 2006] as well as a previous estimate of 9 [Sharp and Siskind,1989] (all expressed in photon units). Such good agreement suggests that this value can be used for a two-point calibration of orbiting spectrometers where both lines can be observed. O(1 S) emission is seen in the atmospheres of all three terrestrial planets -Venus, Earth, Mars. Comparison with theory is less satisfactory. The current ratio of these transition probabilities recommended by NIST is 16.7, based on numerous calculations. This emphasizes the uncertain-ties inherent in making calculations on strongly forbidden transitions. For the O(1 S) case, the transition to O(3 P) proceeds by spin-orbit interaction, whereas that to O(1 D) involves electric quadrupole interaction. References Gattinger, R.L., et al., Can. J. Phys. 87, 1133, 2009 Sharp, W.E. and D.E. Siskind, Geophys. Res. Lett. 16, 1453, 1989 Slanger, T.G., et al., J. Geophys. Res. 111, A12318, 2006
Micronutrient Synergy in the Fight against Hepatocellular Carcinoma.
Roomi, M Waheed; Roomi, Nusrath W; Kalinovsky, Tatiana; Niedzwiecki, Aleksandra; Rath, Matthias
2012-03-23
The incidence of hepatocellular carcinoma (HCC), once thought to be a rare tumor in North America, has rapidly increased in recent years in the United States. Current treatment modalities to halt the progression of this disease are only marginally effective. The mainstay treatment is liver transplantation, which is often confronted with donor shortage. Invasion, metastasis and recurrence contribute to the high mortality rate of this disease. Matrix metalloproteinases (MMPs) that degrade the extracellular matrix (ECM) have been associated with the progression, invasion and metastasis of the disease. We have developed strategies to strengthen the ECM collagen and inhibit MMPs through micronutrients such as lysine, proline and ascorbic acid. Addition of epigallocatechin gallate or green tea extract to these micronutrients synergistically enhanced anti-carcinogenic activity in HepG2 cells. Addition of certain other micronutrients, such as N-acetylcysteine, selenium, copper and zinc (NM) synergistically enhanced the anticancer activity of the mixture in a model of hepatocellular carcinoma using HepG2 cells. In vitro studies using HepG2 demonstrated that NM was very effective in inhibiting cell proliferation (by MTT assay), MMPs secretion (by gelatinase zymography), cell invasion (through Matrigel) and induction of apoptosis (by live green caspase). In addition, NM was shown to down-regulate urokinase plasminogen activator (by fibrin zymography) and up-regulate tissue inhibitors of metalloproteinases (by reverse zymography) in another HCC cell line, SK-Hep-1. MMP-2 and MMP-9 activities were further modulated by phorbol 12-myristate 13-acetate (PMA) induction and inhibited by NM. In previous studies, NM inhibited Sk-Hep-1 xenografts in nude mice and also inhibited hepatic metastasis of B16FO melanoma cells. Our results suggest that NM is an excellent candidate for therapeutic use in the treatment HCC by inhibiting critical parameters in cancer development and progression, such as proliferation, invasion and metastasis, and by inducing apoptosis.
Enhanced frequency upconversion study in Er3+/Yb3+ doped/codoped TWTi glasses
NASA Astrophysics Data System (ADS)
Azam, Mohd; Rai, Vineet Kumar
2018-04-01
Er3+/Yb3+ doped/codoped TeO2-WO3-TiO2 (TWTi) glasses have been prepared by using the melt-quenching technique. The upconversion (UC) emission spectra of the developed glasses have been recorded upon 980 nm laser excitation. Three intense UC emission bands have been observed within the green and red region centered at ˜532 nm, ˜553 nm and ˜669 nm corresponding to the 2H11/2→4I15/2, 4S3/2→4I15/2 and 4F9/2→4I15/2 transitions respectively in the singly Er3+ doped glass. On introducing Yb3+ ions in the singly Er3+ doped glass, an enhancement of about ˜ 12 times and ˜50 times in the green and red bands respectively have been observed even at low pump power ˜ 364 mW followed by two photon absorption process. Colour tunability from yellowish green to pure green colour region has been observed on varying the pump power. The prepared glass can be used to produce NIR to green upconverter and colour tunable display devices.
Ezhilarasi, A Angel; Vijaya, J Judith; Kaviyarasu, K; Maaza, M; Ayeshamariam, A; Kennedy, L John
2016-11-01
Green protocols for the synthesis of nickel oxide nanoparticles using Moringa oleifera plant extract has been reported in the present study as they are cost effective and ecofriendly, moreover this paper records that the nickel oxide (NiO) nanoparticles prepared from green method shows better cytotoxicity and antibacterial activity. The NiO nanoparticles were characterized by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), High resolution transmission electron microscopy (HRTEM), Energy dispersive X-ray analysis (EDX), and Photoluminescence spectroscopy (PL). The formation of a pure nickel oxide phase was confirmed by XRD and FTIR. The synthesized NiO nanoparticles was single crystalline having face centered cubic phase and has two intense photoluminescence emissions at 305.46nm and 410nm. The formation of nano- and micro-structures was confirmed by HRTEM. The in-vitro cytotoxicity and cell viability of human cancer cell HT-29 (Colon Carcinoma cell lines) and antibacterial studies against various bacterial strains were studied with various concentrations of nickel oxide nanoparticles prepared from Moringa oleifera plant extract. MTT assay measurements on cell viability and morphological studies proved that the synthesized NiO nanoparticles posses cytotoxic activity against human cancer cells and the various zones of inhibition (mm), obtained revealed the effective antibacterial activity of NiO nanoparticles against various Gram positive and Gram negative bacterial pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.
Full-color laser cathode ray tube (L-CRT) projector
NASA Astrophysics Data System (ADS)
Kozlovskiy, Vladimir; Nasibov, Alexander S.; Popov, Yuri M.; Reznikov, Parvel V.; Skasyrsky, Yan K.
1995-04-01
A full color TV projector based on three laser cathode-ray tubes (L-CRT) is described. A water-cooled laser screen (LS) is the radiation element of the L-CRT. We have produced three main colors (blue, green and red) by using the LS made of three II-VI compounds: ZnSe ((lambda) equals 475 nm), CdS ((lambda) equals 530 nm) and ZnCdSe (630 nm). The total light flow reaches 1500 Lm, and the number of elements per line is not less than 1000. The LS efficiency may be about 10 Lm/W. In our experiments we have tested new electron optics: - (30 - 37) kV are applied to the cathode unit of the electron gun; the anode of the e-gun and the e-beam intensity modulator are under low potential; the LS has a potential + (30 - 37) kV. The accelerating voltage is divided into two parts, and this enables us to diminish the size and weight of the projector.
Generation of spectral clusters in a mixture of noble and Raman-active gases.
Hosseini, Pooria; Abdolvand, Amir; St J Russell, Philip
2016-12-01
We report a novel scheme for the generation of dense clusters of Raman sidebands. The scheme uses a broadband-guiding hollow-core photonic crystal fiber (HC-PCF) filled with a mixture of H2, D2, and Xe for efficient interaction between the gas mixture and a green laser pump pulse (532 nm, 1 ns) of only 5 μJ of energy. This results in the generation from noise of more than 135 rovibrational Raman sidebands covering the visible spectral region with an average spacing of only 2.2 THz. Such a spectrally dense and compact fiber-based source is ideal for applications where closely spaced narrow-band laser lines with high spectral power density are required, such as in spectroscopy and sensing. When the HC-PCF is filled with a H2-D2 mixture, the Raman comb spans the spectral region from the deep UV (280 nm) to the near infrared (1000 nm).
Prediction of blue, red and green aurorae at Mars
NASA Astrophysics Data System (ADS)
Lilensten, J.; Bernard, D.; Barthélémy, M.; Gronoff, G.; Simon Wedlund, C.; Opitz, A.
2015-09-01
The upper atmosphere of Mars is a laboratory for better understanding the planetary atmosphere evolution, and is an example of the interaction of the solar wind with an unmagnetized planet that has only patches of crustal magnetic field. In that context, several space missions were launched to study the Martian environment and its aurorae, notably ESA's Mars Express discovered the first aurora-like structures, and more recently NASA's MAVEN, which is dedicated to understand the atmospheric escape. However, none of the existing missions have spectrometers in the visible spectral range for the observation of the upper atmosphere and the aurorae, but there are UV spectrometer which can be used to infer visible aurora emission. The UV aurorae on Mars have a counterpart in the visible spectral range which should be detectable under the right conditions. We discuss what are the most favorable conditions to observe these aurorae discernible with the naked eye. In this paper, we simulate the Martian aurora in the visible spectral range both with an experimental setup (the Planeterrella, which we use to measure intensity with respect to the naked eye) and with a numerical ionosphere simulation model (Trans*/Aeroplanets). We show that the electron impact on CO2 produces strong emissions at 412 nm and 434 nm, i.e., in the blue part of the visible spectrum which are due to the CO2+(A) Fox-Duffendack-Barker bands. The modeling of the electron transport at Mars shows that these blue emissions as well as the emissions of the 630 nm (red) and 557.7 nm (green) lines of atomic oxygen may be observable several times during a solar cycle during strong solar events. The absence of visible spectrometers dedicated to these observations onboard existing space missions and the location of the different Martian rovers, far from the vertically aligned crustal magnetic field lines of Mars, have prevented so far the observations of such an aurora. In the foreseeable future, two missions may help observing these aurorae: the exo-Mars/Trace Gas Orbiter mission will carry a visible spectrometer which could be used to detect these events in the visible spectral range. NOMAD (Nadir and Occultation for Mars Discovery) will carry a UV-visible spectrometer in the 200-650 nm range.
Wang, Fei; Zhou, Jiaqi; Lu, Yi; Chu, Renyuan
2011-02-01
To investigate (i) the effect of monochromatic light on inhibiting induction of light-induced melatonin and (ii) the roles of melanopsin and MT1 receptor in light-induced myopia in the guinea pig. Forty-eight guinea pigs were randomly distributed into three treatment groups: white-light (control), green-light (530 nm), and blue-light (480 nm) groups. Levels of pineal gland melatonin were measured twice daily--10:00 a.m. and 10:00 p.m.--10 days after initial light treatment. Thirty additional guinea pigs were also assigned to these groups and treated similarly. For these latter animals, refractive status, ocular length, and vitreous depth were measured before and after light treatment. Eight weeks after light treatment, retinal and sceral levels of melanopsin, melatonin receptor type (MT) 1, and mRNA protein were determined by Western blotting, real-time polymerase chain reaction (RT-PCR), and immunohistochemistry. The level of pineal gland melatonin in the green-light group was significantly higher than that in the blue-light group. Biometric measurements showed that guinea pigs in the green-light group had a somewhat myopic refractive status. Expressions of retinal melanopsin mRNA and protein were significantly higher in the blue-light group and lower in the green-light group when compared to controls. Conversely, expressions of MT1 receptor mRNA and protein in retina and sclera were significantly higher in the green-light group and lower in the blue-light group when compared to controls. Green light appears to suppress induction of melatonin production. In addition, 530 nm of green light is involved in the development of myopia. In the guinea pig, MT1 receptor and melanopsin appear to play roles in the development of myopia induced by 530 nm of light.
NASA Technical Reports Server (NTRS)
Joiner, J.; Yoshida, Y.; Vasilkov, A. P.; Middleton, E. M.; Campbell, P. K. E.; Kuze, A.; Corp, L. A.
2012-01-01
Mapping of terrestrial vegetation fluorescence from space is of interest because it can potentially provide global information on the functional status of vegetation including light use efficiency and global primary productivity that can be used for global carbon cycle modeling. Space-based measurement of solar-induced chlorophyll fluorescence is challenging, because its signal is small as compared with the much larger reflectance signal. Ground- and aircraft-based approaches have made use of the dark and spectrally-wide 02-A (approx 760 nm) and O2-B (approx 690 nm) atmospheric features to detect the weak fluorescence signal. More recently, Joiner et a1. and Frankenberg et a1. focused on longer-wavelength solar Fraunhofer lines that can be observed with space-based instruments such as the currently operational GOSAT. They showed that fluorescence can be detected using Fraunhofer lines away from the far-red chlorophyll-a fluorescence peak even when the surface is relatively bright. Here, we build on that work by developing methodology to correct for instrumental artifacts that produce false filling-in signals that can bias fluorescence retrievals. We also examine other potential sources of filling-in at far-red and NIR wavelengths. Another objective is to explore the possibility of making fluorescence measurements from space with lower spectral resolution instrumentation than the GOSAT interferometer. We focus on the 866 nm Ca II solar Fraunhofer line. Very few laboratory and ground-based measurements of vegetation fluorescence have been reported at wavelengths longer than 800 mn. Some results of fluorescence measurements of corn leaves acquired in the laboratory using polychromatic excitation at wavelengths shorter than 665 nm show that at 866 nm, the measured signal is of the order of 0.1-0.2 mw/sq m/nm/sr. In this work we use the following satellite observations: We use SCIAMACHY channel 5 in nadir mode that covers wavelengths between 773 and 1063 nm at a spectral resolution of 0.54 nm. GOSAT has two instrument packages: the Thermal And Near-infrared Sensor for carbon Observation-Fourier Transform Spectrometer (TANSO-FTS) and the Cloud and Aerosol Imager (CAI). We use TANSO-FTS band 1, which extends from approximately 758 to 775 mn and we use cloud fraction derived from the CAL We compare satellite-derived fluorescence with the Enhanced Vegetation Index (EVI), an Aqua/MODIS-derived vegetation reflectance-based index that indicates relative greenness and is used to infer photosynthetic function.
NASA Astrophysics Data System (ADS)
Morrill, Waldirene B. B.; Barnabé, Janice M. C.; da Silva, Tatiana P. N.; Pandorfi, Héliton; Gouveia-Neto, Artur S.; Souza, Wellington S.
2014-03-01
Growth performance, behavior, and development of broilers reared under red, green, and blue monochromatic and/or multicolor LED-based illuminants is investigated. The lighting treatments were performed on a 24h lighting basis during six weeks. Monochromatic red(630 nm), green(520 nm), and blue(460 nm), and simultaneous blue-green, and whitelight housing illumination was employed. Bodyweight, food consumption, and behavior were monitored and compared amongst light treatments. The behavioral data showed that broilers reared under green lighting presented the lowest respiratory rate (87 mov. min-1) while those under red lighting presented the highest (96 mov. min-1). Results also showed that broilers under blue and/or green monochromatic illumination exhibited up to 6%, and 8.9 % increase in final bodyweight when compared to those under red or white-light, respectively. The highest feed intake, and lowest body weight gain was observed in broilers reared under blue and red illumination, respectively.
Autophagy Signaling in Prostate Cancer: Identification of a Novel Phosphatase
2013-01-01
be attributed to, we measured the activity of wildtype or mutant PTPsigma using a phospho-tyrosine (pTyr) peptide and malachite green free... malachite green (Upstate) and absorbance measured at 650 nm. Background levels from enzyme-only and substrate-only (T yr-P or PtdIns3P) reactions were...peptide at the indicated concentrations for 15 minutes at 37°C and released phosphates measured by malachite green quenching and 650 nm absorbance. (B
Intense Excitation Source of Blue-Green Laser.
1985-10-15
plasma focus (DPF) can produce intense uv photons (200-300nm) which match the absorption spectra of both near uv and blue green dye lasers (300-400nm...existing blue green dye laser. On the other hand the dense- plasma focus (DPF) with new optical coupling has been designed and constructed. For the...optimization of the DPF device as the uv pumping light source, the velocity of current sheath and the formation of plasma focus have been measured as
Shi, Lihong; Li, Yanyan; Li, Xiaofeng; Wen, Xiangping; Zhang, Guomei; Yang, Jun; Dong, Chuan; Shuang, Shaomin
2015-04-28
We report a facile and eco-friendly strategy for the fabrication of green fluorescent carbon nanodots (CDs), and demonstrate their applications for bio-imaging, patterning, and staining. A one-pot hydrothermal method using various plant petals yields bright green-emitting CDs, providing an easy way for the production of green fluorescent CDs without the need for a tedious synthetic methodology or the use of toxic/expensive solvents and starting materials. The as-prepared CDs show small size distribution and excellent dispersibility. Their strong green fluorescence is observed when the excitation wavelength is between 430 nm and 490 nm. Moreover, they exhibit high tolerance to various external conditions, such as pH values, external cations, and continuous excitation. Due to minimum toxicity as well as good photoluminescence properties, these CDs can be applied to in vitro and in vivo imaging, patterning, and staining. According to confocal fluorescence imaging of human uterine cervical squamous cell carcinoma cells, CDs penetrate into the cell and enter the cytoplasm and the nucleus. More strikingly, carp is directly fed with CDs for in vivo imaging and shows bright green fluorescence at an excitation wavelength of 470 nm. In addition, the obtained CDs are used as fluorescent inks for drawing luminescence patterns. Finally, we also apply the CDs as a fluorescent dye. Interestingly, the absorbent filter paper with staining emits dramatic fluorescence under 470 nm excitation.
Diode-pumped Nd:GAGG-LBO laser at 531 nm
NASA Astrophysics Data System (ADS)
Zou, J.; Chu, H.; Wang, L. R.
2012-03-01
We report a green laser at 531 nm generation by intracavity frequency doubling of a continuous wave (cw) laser operation of a 1062 nm Nd:GAGG laser under in-band diode pumping at 808 nm. A LiB3O5 (LBO) crystal, cut for critical type I phase matching at room temperature is used for second harmonic generation of the laser. At an incident pump power of 18.5 W, as high as 933 mW of cw output power at 531 nm is achieved. The fluctuation of the green output power was better than 3.5% in the given 4 h.
A novel method for size uniform 200nm particles: multimetallic particles and in vitro gene delivery
NASA Astrophysics Data System (ADS)
Mair, Lamar; Ford, Kris; Superfine, Richard
2008-10-01
We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts. Metal particles evaporated on cylindrical structures 0.20μm in diameter and 0.33μm tall are released via photoresist dissolution, resulting in freely suspended, shape defined particles. These Post-Particles have highly tunable composition, as demonstrated by our deposition of five different multimetallic particle blends. We calculate the susceptibility and magnetization of 200nm Fe particles in an applied 0.081T magnetic field. In order to evaluate their usefulness as magnetofection agents an antisense oligonucleotide designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA was successfully attached to Fe Post-Particles via a polyethyleneimine linker and transfected into a modified HeLa cell line.
Mohanty, Ranjeet Kumar; Thennarasu, Sathiah; Mandal, Asit Baran
2014-02-01
The green synthesis of gold nanoparticles was achieved by exploiting the antioxidant property of resveratrol (R). The formation of resveratrol stabilized gold nanoparticles (R-GNPs) was confirmed by the observation of the surface plasmon resonance band at 537 nm. The average size of R-GNPs produced in resveratrol medium was ~35nm. The geometrical shape and zeta potential of the gold nanoparticles were spherical and -21.2 mV, respectively. R-GNPs showed excellent stability in saline and other buffers mimicking the physiological pH. The MTT assay using fibroblast cells from explants tissue revealed the biocompatibility of R-GNPs. The cytotoxic activity of doxorubicin loaded R-GNPs against glioma carcinoma cell line (LN 229), showed the suitability of R-GNPs as a carrier for anticancer drugs. Copyright © 2013 Elsevier B.V. All rights reserved.
Elemental detection of arabica and robusta green bean coffee using laser-induced plasma spectroscopy
NASA Astrophysics Data System (ADS)
Abdulmadjid, Syahrun Nur; Meilina, Hesti; Hedwig, Rinda; Kurniawan, Koo Hendrik
2017-01-01
The elemental detection of green bean of arabica and robusta coffee from Gayo Highland, Aceh-Indonesia, has been identified by using fundamental Nd-YAG Laser at 10 Torr of surrounding air gas pressure for distinguishing the characteristics of both coffees. As the preliminary study, we have detected the elements of K 766.49 nm, Na 588.9 nm, Ca 393.3 nm, CN band at 388.3 nm, N 337.13 nm and C 247.8 nm of both coffees. It is noticed that the order of elements concentration from highest to lowest are Ca>K>CN> Na>N> C for arabica and K>Ca>CN >Na>C>N for robusta. The emission intensity of K 766.49 nm is almost same for both of coffee. However, the emission intensity of Na 588.9 nm is lower in Arabica coffee. To distinguish the Arabica coffee and Robusta Coffee, we take the ratio intensity of K/C, Na/C, CN/C, and Ca/C. It is found that the ratio intensities of CN/C and Ca/C in arabica bean are significantly different with robusta bean. That ratio intensities can be used as a marker to discriminate kind of coffee. We also noted that the arabica green bean is 1.3 harder than robusta green bean. These findings prove that the technique of laser-induced plasma spectroscopy can be used to make rapid identification of elements in coffee and can potentially be applied to measure the concentration of blended coffee for the purpose of authentication.
NASA Astrophysics Data System (ADS)
Pahlavan Noghabi, Mohammad; Parizadeh, Mohammad Reza; Ghayour-Mobarhan, Majid; Taherzadeh, Danial; Hosseini, Hasan Ali; Darroudi, Majid
2017-10-01
The "Green" synthesis of metallic nanoparticles and investigation of their optical properties has become a useful application between nanoscience and medicine. In this work, silver nanoparticles (Ag-NPs) were successfully prepared through a facile and green method by treating silver ions with chitosan. Preparation of Ag-NPs in silver nitrate solution (0.01 M) resulted in small and spherical shapes of Ag-NPs with a mean diameter of 10.2 nm. The formation of Ag-NPs was approved by surface Plasmon resonance (SPR) absorption peaks, using UV-vis spectrophotometer, while Ag-NPs were successfully employed in colorimetric sensing of H2O2 via an analytical procedure. Degradation process of Ag-NPs, encouraged by the catalytic decomposition of H2O2, causes a significant change in the absorbance intensity of SPR band depending on the H2O2 concentration. The cytotoxicity effect of synthesized Ag-NPs was examined on HEK293 cell line. The results illustrate a concentration-dependent toxicity for the tested cells, while15.07 μg/mL of IC50 was obtained.
Moldovan, Bianca; David, Luminita; Vulcu, Adriana; Olenic, Liliana; Perde-Schrepler, Maria; Fischer-Fodor, Eva; Baldea, Ioana; Clichici, Simona; Filip, Gabriela Adriana
2017-10-01
A green, rapid and cost effective method for the bio-synthesis of silver nanoparticles (AgNPs), using polyphenols present in European cranberry bush fruit extracts was developed. The obtained AgNPs were characterized by ultra-violet visible spectroscopy (UV-VIS), Fourier transform - infrared spectroscopy (FT-IR), transmission electron microscopy (TEM) and X-ray diffraction patterns (XRD). The average size of the spherical AgNPs was found to be 25nm. The anti-inflammatory effect of the biomaterials was investigated, both in vitro (on HaCaT cell line, exposed to UVB radiation) and in vivo (on acute inflammation model in Wistar rats). Our results support the conclusion that the photosynthesized silver nanoparticles present a potent anti-inflammatory activity and could be successfully used as therapeutic tools for treatment of inflammation. Copyright © 2017 Elsevier B.V. All rights reserved.
First Look at the 3-channel Photometer Data from RENU2
NASA Astrophysics Data System (ADS)
Hecht, J. H.; Brinkman, D. G.; Clemmons, J. H.; Walterscheid, R. L.; Evans, J. S.; Fritz, B.; Lessard, M.
2016-12-01
The Rocket Experiment for Neutral Upwelling-2 (RENU2) rocket launched north towards the cusp region from Andoya, Norway at 735 UT on December 12th 2015. It included a 3-channel forward looking photometer which included narrow-band interference filters at the following wavelengths: (1) 391.4 nm to measure the relatively bright N2+(0,0) band, primarily excited in cusp aurora via resonant scattering of solar light, (2) 557.7 nm, the auroral green line, which is seen in both dayglow emission (very weakly) and when auroral precipitation is present, and (3) 630.0 nm, the auroral redline, which is also excited in the dayglow and by low energy auroral electrons typically present in the cusp. Averaging over the 2 seconds, to minimize out the rocket spin modulation, revealed a volume emission rate profile as a function of altitude that showed dayglow and resonant scattering emission from all three features on the up leg before the cusp aurora region was entered, and a combination of this and auroral emission on the down leg. Noteworthy on the down leg was a sudden increase in the 391.4 nm emission strongly suggestive of an increase in N2+ ions above the rocket. The data are compared to results of AURIC and B3C model runs where electron data from the EPLAS instrument were used to provide the electron spectra. This comparison revealed information not only about the N2+ ion and atomic oxygen density but also showed, via the effects of the different lifetime of the red and green emissions, that there were many short timescale bursts of precipitation lasting much less than 1 second.
Nguyen, D.C.; Faulkner, G.E.
1990-08-14
A blue-green laser (450--550 nm) uses a host crystal doped with Tm[sup 3+]. The Tm[sup 3+] is excited through upconversion by a red pumping laser and an IR pumping laser to a state which transitions to a relatively lower energy level through emissions in the blue-green band, e.g., 450.20 nm at 75 K. The exciting laser may be tunable dye lasers or may be solid-state semiconductor laser, e.g., GaAlAs and InGaAlP. 3 figs.
Nguyen, Dinh C.; Faulkner, George E.
1990-01-01
A blue-green laser (450-550 nm) uses a host crystal doped with Tm.sup.3+. The Tm.sup.+ is excited through upconversion by a red pumping laser and an IR pumping laser to a state which transitions to a relatively lower energy level through emissions in the blue-green band, e.g., 450.20 nm at 75 K. The exciting laser may be tunable dye lasers or may be solid-state semiconductor laser, e.g., GaAlAs and InGaAlP.
A potential green emitting citrate gel synthesized NaSrBO3:Tb3+ phosphor for display application
NASA Astrophysics Data System (ADS)
Bedyal, A. K.; Kumar, Vinay; Swart, H. C.
2018-04-01
A potential green emitting NaSrBO3:Tb3+ (1-9 mol%) phosphor was synthesized by a citrate gel combustion method. X-ray diffraction patterns confirmed the monoclinic phase of the phosphor. The phosphor emitted intense green emission under near-UV and electron excitation due to the characteristic transitions 5D4→7F6(488 nm),5D4→7F5(544 nm),5D4→7F4(586 nm) and 5D4→7F3(622 nm) of Tb3+ ions. The optimal molar concentration of Tb3+ ions was found to be 6 mol%, after that concentration quenching occurred. The dipole-dipole interaction was found to be accountable for energy transfer between the Tb3+ ions. X-ray photoelectron spectroscopy was carried out to analyze the chemical states of the elements and suggest that terbium was mostly presented in the (+3) valance state in the phosphor. The approximated Commission Internationale de l‧Eclairage coordinates for the PL (0.31, 0.61) and CL (0.33, 0.57) were found to be very close to the well-known green emitting phosphor. The obtained results suggest that the studied phosphor could be an ultimate choice for green emission in display applications.
Ostroverkhova, Oksana; Galindo, Gracie; Lande, Claire; Kirby, Julie; Scherr, Melissa; Hoffman, George; Rao, Sujaya
2018-06-05
Bees have a trichromatic vision with ultraviolet, blue, and green photoreceptors in their compound eyes. While the three photoreceptor types comprise the 'color space' at the perceptual level, preferential excitation of one or two of the photoreceptor types has been shown to play an important role in innate color preferences of bumble bees. Bees have been shown to exhibit strong attraction to fluorescence emission exclusively in the blue spectral region. It is not known if emission exclusively in the green spectral region produces similar attraction. Here, we examined responses of wild bees to traps designed to selectively stimulate either the blue or the green photoreceptor using sunlight-induced fluorescence in the 420-480 or 510-540 nm region, respectively. Additionally, we probed how subtle changes in the spectral characteristics of the traps affect the bee captures once a highly selective excitation of the blue photoreceptor is achieved. It was established that selective excitation of the green photoreceptor type was not attractive, in contrast to that of the blue photoreceptor type. However, once a highly selective excitation of the blue photoreceptor type (at ~ 400-480 nm) was achieved, the wild bees favored strong excitation at 430-480 nm over that in the 400-420 nm region.
Inhibited-coupling HC-PCF based beam-delivery-system for high power green industrial lasers
NASA Astrophysics Data System (ADS)
Chafer, M.; Gorse, A.; Beaudou, B.; Lekiefs, Q.; Maurel, M.; Debord, B.; Gérôme, F.; Benabid, F.
2018-02-01
We report on an ultra-low loss Hollow-Core Photonic Crystal Fiber (HC-PCF) beam delivery system (GLO-GreenBDS) for high power ultra-short pulse lasers operating in the green spectral range (including 515 nm and 532 nm). The GLOBDS- Green combines ease-of-use, high laser-coupling efficiency, robustness and industrial compatible cabling. It comprises a pre-aligned laser-injection head, a sheath-cable protected HC-PCF and a modular fiber-output head. It enables fiber-core gas loading and evacuation in a hermetic fashion. A 5 m long GLO-BDS were demonstrated for a green short pulse laser with a transmission coefficient larger than 80%, and a laser output profile close to single-mode (M2 <1.3).
Kawamura, Shoji; Kasagi, Satoshi; Kasai, Daisuke; Tezuka, Ayumi; Shoji, Ayako; Takahashi, Akiyoshi; Imai, Hiroo; Kawata, Masakado
2016-10-01
The guppy (Poecilia reticulata) shows remarkable variation of photoreceptor cells in the retina, especially those sensitive to middle-to-long wavelengths of light. Microspectrophotometry (MSP) has revealed varying "green", "green-yellow" and "yellow" cone cells among guppies in Trinidad and Venezuela (Cumana). In the guppy genome, there are four "long-wave" opsin loci (LWS-1, -2, -3 and -4). Two LWS-1 alleles have potentially differing spectral sensitivity (LWS-1/180Ser and LWS-1/180Ala). In addition, two "middle-wave" loci (RH2-1 and -2), two "short-wave" loci (SWS2-A and -B), and a single "ultraviolet" locus (SWS1) as well as a single "rhodopsin" locus (RH1) are present. However, the absorption spectra of these photopigments have not been measured directly and the association of cell types with these opsins remains speculative. In the present study, we reconstituted these opsin photopigments in vitro. The wavelengths of maximal absorbance (λmax) were 571nm (LWS-1/180Ser), 562nm (LWS-1/180Ala), 519nm (LWS-3), 516nm (LWS-2), 516nm (RH2-1), 476nm (RH2-2), 438nm (SWS2-A), 408nm (SWS2-B), 353nm (SWS1) and 503nm (RH1). The λmax of LWS-3 is much shorter than the value expected (560nm) from the "five-sites" rule. The two LWS-1 alleles could explain difference of the reported MSP λmax values for the yellow cone class between Trinidad and Cumana guppies. Absence of the short-wave-shifted LWS-3 and the green-yellow cone in the green swordtail supports the hypothesis that this cell class of the guppy co-expresses the LWS-1 and LWS-3. These results reveal the basis of variability in the guppy visual system and provide insight into the behavior and ecology of these tropical fishes. Copyright © 2016. Published by Elsevier Ltd.
NASA Technical Reports Server (NTRS)
Middleton, E. M.; McMurtrey, J. E.; Campbell, P. K. Entcheva; Corp, L. A.; Butcher, L. M.; Chappelle, E. W.
2003-01-01
Vegetation productivity is driven by nitrogen (N) availability in soils. Both excessive and low soil N induce physiological changes in plant foliage. In 2001, we examined the use of spectral fluorescence and reflectance measurements to discriminate among plants provided different N fertilizer application rates: 20%, 50%, 100% and 150% of optimal N levels. A suite of optical, fluorescence, and biophysical measurements were collected on leaves from field grown corn (Zea mays L.) and soybean plants (Glycine max L.) grown in pots (greenhouse + ambient sunlight daily). Three types of steady state laser-induced fluorescence measurements were made on adaxial and abaxial surfaces: 1) fluorescence images in four 10 nm bands (blue, green, red, far-red) resulting from broad irradiance excitation; 2) emission spectra (5 nm resolution) produced by excitation at single wavelengths (280,380 or 360, and 532 nm); and 3) excitation spectra (2 nm resolution), with emission wavelengths fixed at wavelengths centered on selected solar Fraunhofer lines (532,607,677 and 745 nm). Two complementary sets of high resolution (less than 2 nm) optical spectra were acquired for both adaxial and abaxial leaf surfaces: 1) optical properties (350-2500 nm) for reflectance, transmittance, and absorptance; and 2) reflectance spectra (500-1000 nm) acquired with and without a short pass filter at 665 nm to determine the fluorescence contribution to apparent reflectance in the 650-750 spectrum, especially at the 685 and 740 nm chlorophyll fluorescence (ChIF) peaks. The strongest relationships between foliar chemistry and optical properties were demonstrated for C/N content and two optical parameters associated with the red edge inflection point. Select optical properties and ChIF parameters were highly correlated for both species. A significant contribution of ChIF to apparent reflectance was observed, averaging 10-25% at 685 nm and 2 - 6% at 740 nm over all N treatments. Discrimination of N treatment groups was possible with specific fluorescence band ratios (e.g., F740/F525 obtained with 380EX). From all measurements assessing fluorescence, higher ChIF and blue/green emissions were measured from the abaxial leaf surfaces; Abaxial surfaces also produced higher reflectances in the 400-800 nm spectrum. Fluorescence information collected in Fraunhofer regions located on the shoulders of ChIF features compared favorably with peak emissions. This supports the potential capability of a future space-born interferometer sensor to capture plant canopy fluorescence.
Reddy, N Jayachandra; Nagoor Vali, D; Rani, M; Rani, S Sudha
2014-01-01
Silver nanoparticles synthesized through bio-green method has been reported to have biomedical applications to control pathogenic microbes as it is cost effective compared to commonly used physical and chemical methods. In present study, silver nanoparticles were synthesized using aqueous Piper longum fruit extract (PLFE) and confirmed by UV-visible spectroscopy. The nanoparticles were spherical in shape with an average particle size of 46nm as determined by scanning electronic microscopy (SEM) and dynamic light scattering (DLS) particle size analyzer respectively. FT-IR spectrum revealed the capping of the phytoconstituents, probably polyphenols from P. longum fruit extract and stabilizing the nanoparticles. Further the ferric ion reducing test, confirmed that the capping agents were condensed tannins. The aqueous P. longum fruit extract (PLFE) and the green synthesized silver nanoparticles (PLAgNPs) showed powerful antioxidant properties in in vitro antioxidant assays. The results from the antimicrobial assays suggested that green synthesized silver nanoparticles (PLAgNPs) were more potent against pathogenic bacteria than the P. longum fruit extract (PLFE) alone. The nanoparticles also showed potent cytotoxic effect against MCF-7 breast cancer cell lines with an IC 50 value of 67μg/ml/24h by the MTT assay. These results support the advantages of using bio-green method for synthesizing silver nanoparticles with antioxidant, antimicrobial and cytotoxic activities those are simple and cost effective as well. © 2013.
Diameter Control and Photoluminescence of ZnO Nanorods from Trialkylamines
Andelman, Tamar; Gong, Yinyan; Neumark, Gertrude; ...
2007-01-01
A novel solution method to control the diameter of ZnO nanorods is reported. Small diameter (2-3 nm) nanorods were synthesized from trihexylamine, and large diameter (50–80 nm) nanorods were synthesized by increasing the alkyl chain length to tridodecylamine. The defect (green) emission of the photoluminescence (PL) spectra of the nanorods varies with diameter, and can thus be controlled by the diameter control. The small ZnO nanorods have strong green emission, while the large diameter nanorods exhibit a remarkably suppressed green band. We show that this observation supports surface oxygen vacancies as the defect that gives rise to the green emission.
Violet and blue light-induced green fluorescence emissions from dental caries.
Shakibaie, F; Walsh, L J
2016-12-01
The objective of this laboratory study was to compare violet and visible blue LED light-elicited green fluorescence emissions from enamel and dentine in healthy or carious states. Microscopic digital photography was undertaken using violet and blue LED illumination (405 nm and 455 nm wavelengths) of tooth surfaces, which were photographed through a custom-made stack of green compensating filters which removed the excitation light and allowed green fluorescence emissions to pass. Green channel pixel data were analysed. Dry sound enamel and sound root surfaces showed strong green fluorescence when excited by violet or blue lights. Regions of cavitated dental caries gave lower green fluorescence, and this was similar whether the dentine in the lesions was the same colour as normal dentine or was darkly coloured. The presence of saliva on the surface did not significantly change the green fluorescence, while the presence of blood diluted in saliva depressed green fluorescence. Using violet or blue illumination in combination with green compensating filters could potentially aid in the assessment of areas of mineral loss. © 2016 Australian Dental Association.
A CW green laser emission by self-sum-frequency-mixing in Nd:GdCOB crystal
NASA Astrophysics Data System (ADS)
Shao, Y.; Jin, H. J.; Lin, J.; Zhang, D.; Tao, Z. H.; Zhang, T. Y.; Li, Y. L.; Ruan, Q. R.
2011-10-01
A compact and efficient green laser light at 538 nm produced by self-sum-frequency-mixing of both fundamental infrared laser waves (1061 and 1091 nm) in Nd:GdCa4O(BO3)3 (Nd:GdCOB) crystal is demonstrated. With 18.2 W of diode pump power, a maximum output power of 1.73 W in the green spectral range at 538 nm has been achieved, corresponding to an optical-to-optical conversion efficiency of 9.5%; the output power stability over 30 min is better than 3%. To the best of our knowledge, this is first work on self-sum-frequency-mixing of a diode pumped Nd:GdCOB laser.
A multispectral sorting device for wheat kernels
USDA-ARS?s Scientific Manuscript database
A low-cost multispectral sorting device was constructed using three visible and three near-infrared light-emitting diodes (LED) with peak emission wavelengths of 470 nm (blue), 527 nm (green), 624 nm (red), 850 nm, 940 nm, and 1070 nm. The multispectral data were collected by rapidly (~12 kHz) blin...
Short-wavelength light beam in situ monitoring growth of InGaN/GaN green LEDs by MOCVD
2012-01-01
In this paper, five-period InGaN/GaN multiple quantum well green light-emitting diodes (LEDs) were grown by metal organic chemical vapor deposition with 405-nm light beam in situ monitoring system. Based on the signal of 405-nm in situ monitoring system, the related information of growth rate, indium composition and interfacial quality of each InGaN/GaN QW were obtained, and thus, the growth conditions and structural parameters were optimized to grow high-quality InGaN/GaN green LED structure. Finally, a green LED with a wavelength of 509 nm was fabricated under the optimal parameters, which was also proved by ex situ characterization such as high-resolution X-ray diffraction, photoluminescence, and electroluminescence. The results demonstrated that short-wavelength in situ monitoring system was a quick and non-destroyed tool to provide the growth information on InGaN/GaN, which would accelerate the research and development of GaN-based green LEDs. PMID:22650991
NASA Astrophysics Data System (ADS)
Palamy, Sysay; Ruengsitagoon, Wirat
2018-02-01
A novel reverse flow injection spectrophotometric method for the determination of ciprofloxacin was successfully combined with the on-line introduction of an iron solution extracted from soil as green reagent. The assay was optimized by a univariate method to select the optimum conditions for the highest absorbance and highest stability of the complex. Beer-Lambert's law (λmax = 440 nm) is obeyed in the range 0.5-50 μg mL- 1 with a correlation coefficient (r2) of 0.9976 and 0.9996 using soil as green reagent from Khon Kaen, Thailand and Vientiane, Laos, respectively. The average percentage recoveries were in the range of 98.55-102.14% and the precision was in the range of 0.80-1.73%. The limit of detection and the limit of quantitation were 0.20 and 0.69 μg mL- 1, respectively, with a sampling rate of over 46 samples h- 1. The method was successfully applied to the determination of ciprofloxacin in commercial pharmaceutical formulations. The results were in good agreement with those obtained by the reference HPLC method using a t-test at 95% of confidence level for comparison. This method is suitable for laboratories looking for alternative analytical methods using green reagents.
NASA Astrophysics Data System (ADS)
Prasannaraj, Govindaraj; Venkatachalam, Perumal
2017-06-01
This report describes the synthesis of metallic silver nanoparticles (AgNPs) using extracts of four medicinal plants (Aegle marmelos (A. marmelos), Alstonia scholaris (A. scholaris), Andrographis paniculata (A. paniculata) and Centella asiatica (C. asiatica)). The bio-conjugates were characterized by UV-visible spectroscopy, scanning electron microscopy-energy dispersive spectroscopy (SEM-EDS), Fourier transform infrared spectrometry (FTIR), x-ray diffraction (XRD) and zeta potential. This analysis confirmed that UV-Vis spectral peaks at 375 nm, 380 nm, 420 nm and 380 nm are corresponding to A. marmelos, A. scholaris, A. paniculata and C. asiatica mediated AgNPs, respectively. SEM images revealed that all the obtained four AgNPs are predominantly spherical, fibres and rectangle in shape with an average size of 36-97 nm. SEM-EDS and XRD analysis confirmed the presence of elemental AgNPs in crystalline form for all the four nanoparticle samples. The phytochemicals of various medicinal plant extracts with different functional groups were responsible for reduction of Ag+ to AgNPs, which act as capping and stabilizing agent. Among four types of AgNPs tested for anticancer activity, the Ap mediated AgNPs had shown enhanced activity against HepG2 cells (27.01 µg ml-1) and PC3 cells (32.15 µg ml-1).
Rasheed, Tahir; Bilal, Muhammad; Iqbal, Hafiz M N; Li, Chuanlong
2017-10-01
Biosynthesis of nanoparticles from plant extracts is receiving enormous interest due to their abundant availability and a broad spectrum of bioactive reducing metabolites. In this study, the reducing potential of Artemisia vulgaris leaves extract (AVLE) was investigated for synthesizing silver nanoparticles without the addition of any external reducing or capping agent. The appearance of blackish brown color evidenced the complete synthesis of nanoparticles. The synthesized silver nanoparticles were characterized by UV-vis spectroscopy, scanning electron microscope (SEM), energy dispersive X-ray spectroscopy (EDX), transmission electron microscope (TEM), atomic force microscopy (AFM) and Fourier transforms infrared spectroscopy (FT-IR) analysis. UV-vis absorption profile of the bio-reduced sample elucidated the main peak around 420nm, which correspond to the surface plasmon resonance of silver nanoparticles. SEM and AFM analyses confirmed the morphology of the synthesized nanoparticles. Similarly, particles with a distinctive peak of silver were examined with EDX. The average diameter of silver nanoparticles was about 25nm from Transmission Electron Microscopy (TEM). FTIR spectroscopy scrutinized the involvement of various functional groups during nanoparticle synthesis. The green synthesized nanoparticles presented effective antibacterial activity against pathogenic bacteria than AVLE alone. In-vitro antioxidant assays revealed that silver nanoparticles (AV-AgNPs) exhibited promising antioxidant properties. The nanoparticles also displayed a potent cytotoxic effect against HeLa and MCF-7 cell lines. In conclusion, the results supported the advantages of employing a bio-green approach for developing silver nanoparticles with antimicrobial, antioxidant, and antiproliferative activities in a simple and cost- competitive manner. Copyright © 2017 Elsevier B.V. All rights reserved.
Spectro-Imaging Polarimetry of the Local Corona During Solar Eclipse
NASA Astrophysics Data System (ADS)
Qu, Z. Q.; Dun, G. T.; Chang, L.; Murray, G.; Cheng, X. M.; Zhang, X. Y.; Deng, L. H.
2017-02-01
Results are presented from spectro-imaging polarimetry of radiation from the local solar corona during the 2013 total solar eclipse in Gabon. This polarimetric observation was performed from 516.3 nm to 532.6 nm using a prototype Fiber Arrayed Solar Optical Telescope (FASOT). A polarimetric noise level on the order of 10^{-3} results from a reduced polarimetric optical switching demodulation (RPOSD) procedure for data reduction. It is revealed that the modality of fractional linear polarization profiles of the green coronal line shows a diversity, which may indicate complex mechanisms. The polarization degree can approach 3.2 % above the continuum polarization level on a scale of 1500 km, and the nonuniform spatial distribution in amplitude and polarization direction is found even within a small field of view of 7500 km. All of this implies that the coronal polarization is highly structured and complex even on a small scale.
LED lighting and seasonality effects antioxidant properties of baby leaf lettuce.
Samuolienė, Giedrė; Sirtautas, Ramūnas; Brazaitytė, Aušra; Duchovskis, Pavelas
2012-10-01
We report on the application of supplementary light-emitting diode (LED) lighting within a greenhouse for cultivation of red, green and light green leaf baby lettuces (Lactuca sativa L.) grown under natural illumination and high-pressure sodium (HPS) lamps (16-h; PPFD-170 μmol m(-2)s(-1)) during different growing season. Supplementary lighting from blue 455/470 nm and green 505/530 nm LEDs was applied (16-h; PPFD-30 μmol m(-2)s(-1)). Our results showed that to achieve solely a positive effect is complicated, because metabolism of antioxidant properties in lettuce depended on multicomponent exposure of variety, light quality or seasonality. The general trend of a greater positive effect of supplemental LED components on the vitamin C and tocopherol contents was in order: 535>505>455>470 nm; on the total phenol content: 505>535=470>455 nm; on the DPPH free-radical scavenging capacity: 535=470>505>455 nm; on the total anthocyanins: 505>455>470>535 nm. Further investigations are needed for understanding the mechanism and interaction between antioxidants and light signal transduction pathways. Copyright © 2012 Elsevier Ltd. All rights reserved.
Excited-state absorption in Er: BaY2F8 and Cs3Er2Br9 and comparison with Er: LiYF4
NASA Astrophysics Data System (ADS)
Pollnau, M.; Lüthy, W.; Weber, H. P.; Krämer, K.; Güdel, H. U.; McFarlane, R. A.
1996-04-01
The influence of Excited-State Absorption (ESA) on the green laser transition and the overlap of Ground-State Absorption (GSA) and ESA for 970 nm upconversion pumping in erbium is investigated in Er3+ : BaY2F8 and Cs3Er2Br9. Results are compared to Er3+ : LiYF4. In Er3+: BaY2F8, a good overlap between GSA and ESA is found at 969 nm in one polarization direction. The emission cross section at 550 nm is a factor of two smaller than in LiYF4. In Cs3Er2Br9, the smaller Stark splitting of the levels shifts the wavelengths of the green emission and ESA from4 I 1 3/2 off resonance. It enhances, however, ground-state reabsorption. The emission cross section at 550 nm is comparable to LiYF4. Upconversion leads to significant green fluorescence from2 H 9/2. A significant population of the4 I 11/2 level and ESA at 970 nm are not present under 800 nm pumping.
NASA Astrophysics Data System (ADS)
Rathi Sre, P. R.; Reka, M.; Poovazhagi, R.; Arul Kumar, M.; Murugesan, K.
2015-01-01
Simple, yet an effective and rapid approach for the green synthesis of silver nanoparticles (Ag NPs) using root extract of Erythrina indica and its in vitro antibacterial activity was tried against human pathogenic bacteria and its cytotoxic effect in breast and lung cancer cell lines has been demonstrated in this study. Various instrumental techniques were adopted to characterize the synthesized Ag NPs viz. UV-Vis (Ultra violet), FTIR (Fourier Transform Infrared), XRD (X-ray diffraction), DLS (Dynamic light scattering), HR TEM (High-resolution transmission electron microscopy), EDX (Energy-dispersive X-ray spectroscopy). Surface plasmon spectra for Ag NPs are centered nearly at 438 nm with dark brown color. FTIR analysis revealed the presence of terpenes, phenol, flavonols and tannin act as effective reducing and capping agents for converting silver nitrate to Ag NPs. The synthesized Ag NPs were found to be spherical in shape with size in the range of 20-118 nm. Moreover, the synthesized Ag NPs showed potent antibacterial activity against Gram positive and Gram negative bacteria and these biologically synthesized nanoparticles were also proved to exhibit excellent cytotoxic effect on breast and lung cancer cell lines.
Violet-green excitation for NIR luminescence of Yb3+ ions in Bi2O3-B2O3-SiO2-Ga2O3 glasses.
Li, Weiwei; Cheng, Jimeng; Zhao, Guoying; Chen, Wei; Hu, Lili; Guzik, Malgorzata; Boulon, Georges
2014-04-21
60Bi(2)O(3)-20B(2)O(3)-10SiO(2)-10Ga(2)O(3) glasses doped with 1-9 mol% Yb(2)O(3) were prepared and investigated mainly on their violet-green excitation for the typical NIR emission of Yb(3+), generally excited in the NIR. Two violet excitation bands at 365 nm and 405 nm are related to Yb(2+) and Bi(3+). 465 nm excitation band and 480 nm absorption band in the blue-green are assigned to Bi(0) metal nanoparticles/grains. Yb-content-dependence of the excitation and absorption means that Bi(0) is the reduced product of Bi(3+), but greatly competed by the redox reaction of Yb(2+) ↔ Yb(3+). It is proved that the violet-green excitations result in the NIR emission of Yb(3+). On the energy transfer, the virtual level of Yb(3+)-Yb(3+) as well as Bi(0) dimers probably plays an important role. An effective and controllable way is suggested to achieve nano-optical applications by Bi(0) metal nanoparticles/grains and Yb(3+).
Upconversion emission study of Er{sup 3+} doped CaMoO{sub 4} phosphor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sinha, Shriya, E-mail: Shriya.sinha6@gmail.com; Mahata, Manoj Kumar; Kumar, Kaushal
2016-05-06
The infrared to visible upconversion emission in Er{sup 3+} doped CaMoO{sub 4} phosphor has been investigated upon 980 nm diode laser excitation. The X-ray diffraction analysis reveals well crystalline nature and tetragonal phase structure of the prepared phosphor annealed at 800 °C. The Er{sup 3+} doped CaMoO{sub 4} phosphor has shown intense green upconversion emission upon 980 nm didode laser excitation. The green emission bands at 530 nm and 552 nm corresponds to the {sup 2}H{sub 11/2}→{sup 4}I{sub 15/2} and {sup 4}S{sub 3/2}→{sup 4}I{sub 15/2} electronic transitions, respectively of Er{sup 3+} ion. The very weak red emission band around 656more » nm is assigned to the {sup 4}F{sub 9/2}→{sup 4}I{sub 15/2} transition of Er{sup 3+} ion. The CIE color coordinate exhibits the emission color in intense green region, indicating the use of present phosphor in display device applications.« less
Efficient generation of 509 nm light by sum-frequency mixing between two tapered diode lasers
NASA Astrophysics Data System (ADS)
Tawfieq, Mahmoud; Jensen, Ole Bjarlin; Hansen, Anders Kragh; Sumpf, Bernd; Paschke, Katrin; Andersen, Peter E.
2015-03-01
We demonstrate a concept for visible laser sources based on sum-frequency generation of beam combined tapered diode lasers. In this specific case, a 1.7 W sum-frequency generated green laser at 509 nm is obtained, by frequency adding of 6.17 W from a 978 nm tapered diode laser with 8.06 W from a 1063 nm tapered diode laser, inside a periodically poled MgO doped lithium niobate crystal. This corresponds to an optical to optical conversion efficiency of 12.1%. As an example of potential applications, the generated nearly diffraction-limited green light is used for pumping a Ti:sapphire laser, thus demonstrating good beam quality and power stability. The maximum output powers achieved when pumping the Ti:sapphire laser are 226 mW (CW) and 185 mW (mode-locked) at 1.7 W green pump power. The optical spectrum emitted by the mode-locked Ti:sapphire laser shows a spectral width of about 54 nm (FWHM), indicating less than 20 fs pulse width.
NASA Astrophysics Data System (ADS)
Zampiva, Rúbia Young Sun; Acauan, Luiz Henrique; Venturini, Janio; Garcia, Jose Augusto Martins; da Silva, Diego Silverio; Han, Zhaohong; Kassab, Luciana Reyes Pires; Wetter, Niklaus Ursus; Agarwal, Anuradha; Alves, Annelise Kopp; Bergmann, Carlos Pérez
2018-02-01
Nanoparticles represent a promising platform for diagnostics and therapy of human diseases. For biomedical applications, these nanoparticles are usually coated with photosensitizers regularly activated in a spectral window of 530-700 nm. The emissions at 530 nm (green) and 660 nm (red) are of particular interest for imaging and photodynamic therapy, respectively. This work presents the Mg2SiO4:Er3+ system, produced by reverse strike co-precipitation, with up to 10% dopant and no secondary phase formation. These nanoparticles when excited at 985 nm show upconversion emission with peaks around 530 and 660 nm, although excitation at 808 nm leads to only a single emission peak at around 530 nm. The direct upconversion of this biomaterial without a co-dopant, and its tunability by the excitation source, renders Mg2SiO4:Er3+ nanoparticles a promising system for biomedical applications.
NASA Astrophysics Data System (ADS)
Tuchina, Elena S.; Tuchin, Valery V.
2009-02-01
In the present work we have investigated in vitro sensitivity of microorganisms P. acnes and S. epidermidis to action of red (625 nm and 405 nm) and infrared (805 nm) radiations in combination with photosensitizes Methylene Blue and Indocyanine Green.
NASA Astrophysics Data System (ADS)
Shindin, Alexey; Nasyrov, Igor; Grach, Savely; Sergeev, Evgeny; Klimenko, Vladimir; Beletsky, Alexandr
We present results of artificial optical emission observations in the red (630 nm) and green (557.7 nm) lines of the atomic oxygen during ionosphere HF pumping at the Sura facility (56.1°N, 46.1°E, magnetic field dip angle 71.5°) in Sep. 2012. Pump wave (PW) of O-polarization at frequencies f0 = 4.74 - 5.64 MHz was used in the experiment according to ionospheric conditions after sunset. Two CCD cameras (S1C/079-FP(FU) and KEO Sentinel with fields of view 20° and 145°, respectively, and 3 photometers were used for the emission registration. For estimation of a relation between the PW frequency f0 and 4th electron gyroharmonic 4fce Stimulated Electromagnetic Emission (SEE) registration was applied (for details see [1]). On September 11 the pump beam was inclined by 12° to the South, the PW frequencies f0 = 5.40 and 5.42 MHz were slightly above 4fce. On September 13, for vertical pumping, f0 was 5.64 MHz (well above 4fce), 5.32 - 5.42 MHz (around 4fce) and 4.74 MHz (well below 4fce). On September 14 the vertical pumping at f0 = 5.30 - 5.36 MHz and 4.74 MHz was used. In the latter day due to natural motion of the ionosphere and concurrent SEE measurements we were able to obtain a fine dependence of the optical brightness on the proximity f0 and 4fce. For the red line no essential dependence, as well of the shape and position of the airglow spot on the proximity was obtained with one exception: on Sep. 14 when, according to the SEE spectra, f0 was just below 4fce (by 15-20 kHz), the brightness essentially increased, by 1.25-1.5 times. For the green line, the brightest emission occurred when f0 was passing through 4fce (Sep. 14) and when f0 = 5.64 MHz (Sep. 13, well above 4fce). Also, on Sep. 14 the airglow enhancement in the red line during the pumping was replaced by the suppression of the background emission when the ionosphere critical frequency approached to f0 by less than 500 kHz. Similar effect was obtained on Sep. 11 and in [2] for south-inclined pump beam, but never observed at the Sura facility for vertical pumping. The data of KEO Sentinel camera obtained on Sep. 11 have shown the suppression of the background existed even for vertical direction while the pump beam was South-inclined by 12° and the spot of enhanced airglow was observed, similar to [2], in the magnetic zenith. Note that earlier experiments near 4fce performed at EISCAT facility during previous Solar maximum did not show any clear dependence of the red and green line brightness of the relation between f0 and 4fce [3]. 1. Layser T.B. // Space Sci. Rev., V. 98, 223 (2001). 2. Grach S.M., et al. // Radiophys. Quantum Electron. V. 55, P. 33-50 (2012). 3. Gustavsson B., et al. // Phys. Rev. Lett., 97, 195002 (2006).
In vitro energy transfer in Renilla bioluminescence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ward, W.W.; Cormier, M.J.
1976-09-23
A quantitative study of in vitro energy transfer in a natural biological system is reported. The in vitro bioluminescent oxidation of Renilla (sea pansy) luciferin by luciferase produces a broad, structureless emission, peaking in the blue at 490 nm. In contrast, the live animal produces a structured emission peaking in the green at 509 nm. This difference in emission characteristics is due to the presence, in Renilla, of a green fluorescent protein (GFP). Addition of GFP in vitro sensitizes the oxyluciferin product excited state, resulting in the narrow, structured green emission characteristic of GFP fluorescence (lambda/sub max/ 509 nm). Undermore » conditions of efficient in vitro energy transfer (2.7 x 10/sup -6/ M GFP) the radiative quantum yield (with respect to luciferin) increases 5.7-fold from 5.3% (blue pathway) to 30% (green pathway). The fluorescence quantum yield of the Renilla GFP has been measured as 30%; thus, within the precision of our measurements (15% coefficient of variation) the in vitro energy transfer efficiency is a surprising 100%.« less
NASA Astrophysics Data System (ADS)
Yugandhar, Pulicherla; Vasavi, Thirumalanadhuni; Uma Maheswari Devi, Palempalli; Savithramma, Nataru
2017-10-01
In recent times, nanoparticles are attributed to green nanotechnology methods to know the synergistic biological activities. To accomplish this phenomenon, present study was aimed to synthesize copper oxide nanoparticles (CuO NPs) by using Syzygium alternifolium stem bark, characterized those NPs using expository tools and to elucidate high prioritized antimicrobial and anticancer activities. Synthesized particles exhibited a color change pattern upon synthesis and affirmed its respective broad peak at 285 nm which was analyzed through UV-vis spectroscopy. FT-IR study confirmed that phenols and primary amines were mainly involved in capping and stabilization of nanoparticles. DLS and Zeta potential studies revealed narrow size of particles with greater stability. XRD studies revealed the crystallographic nature of particles with 17.2 nm average size. Microscopic analysis by using TEM revealed that particle size range from 5-13 nm and most of them were spherical in shape, non-agglomerated and poly-dispersed in condition. Antimicrobial studies of particles showed highest inhibitory activity against E. coli and T. harzianum among bacterial and fungal strains, respectively. The scope of this study is extended by examining anticancer activity of CuO NPs. This study exhibited potential anticancer activity towards MDA-MB-231 human breast cancer lines. Overall, these examinations relate that the S. alternifolium is described as efficient well-being plant and probabilistically for the design and synthesis of nanoparticles for human health. This study paves a way to better understand antimicrobial and anticancer therapeutic drug potentials of nanoparticles to design and analysis of pharmaceuticals by in vivo and in vitro approaches.
Measuring atmospheric visibility cavity attenuated phase shift spectroscopy
NASA Astrophysics Data System (ADS)
Jie, Guo; Ye, Shan-Shan; Yang, Xiao; Han, Ye-Xing; Tang, Huai-Wu; Yu, Zhi-Wei
2016-10-01
In the paper, an accurate and sensitive cavity attenuated phase shift spectroscopy (CAPS) system was used to monitor the atmospheric visibility coefficient in urban areas. The CAPS system, which detects the atmospheric visibility within a 10 nm bandpass centered at 532 nm, comprises a green LED with center wavelength in 532nm, a resonant optical cavity (36 cm length), a Photo Multiplier Tube detector and a lock in amplifier. The performance of the CAPS system was evaluated by measuring of the stability and response of the system. The minima ( 0.06 Mm-1) in the Allan plots show the optimum average time( 80s) for optimum detection performance of the CAPS system. The 2L/min flow rate, the CAPS system rise and fall response time is about 15 s, so as to realize the fast measurement of visibility. By comparing the forward scatter visibility meter measurement results, the CAPS system measurement results are verified reliably, and have high precision measurement. These figures indicate that this method has the potential to become one of the most sensitive on-line analytical techniques for atmospheric visibility detection.
NASA Astrophysics Data System (ADS)
Kornienko, Vladimir V.; Kitaeva, Galiya Kh.; Sedlmeir, Florian; Leuchs, Gerd; Schwefel, Harald G. L.
2018-05-01
We study a calibration scheme for terahertz wave nonlinear-optical detectors based on spontaneous parametric down-conversion. Contrary to the usual low wavelength pump in the green, we report here on the observation of spontaneous parametric down-conversion originating from an in-growth poled lithium niobate crystal pumped with a continuous wave 50 mW, 795 nm diode laser system, phase-matched to a terahertz frequency idler wave. Such a system is more compact and allows for longer poling periods as well as lower losses in the crystal. Filtering the pump radiation by a rubidium-87 vapor cell allowed the frequency-angular spectra to be obtained down to ˜0.5 THz or ˜1 nm shift from the pump radiation line. The presence of an amplified spontaneous emission "pedestal" in the diode laser radiation spectrum significantly hampers the observation of spontaneous parametric down-conversion spectra, in contrast to conventional narrowband gas lasers. Benefits of switching to longer pump wavelengths are pointed out, such as collinear optical-terahertz phase-matching in bulk crystals.
NASA Astrophysics Data System (ADS)
Fu, S. C.; Wang, X.; Chu, H.
2013-02-01
We report the generation of a green laser at 543 nm by intracavity frequency doubling of the continuous-wave (cw) laser operation of a 1086 nm Nd:YVO4 laser under 888 nm diode pumping into the emitting level 4F3/2. An LiB3O5 (LBO) crystal, cut for critical type I phase matching at room temperature, is used for the laser second-harmonic generation. At an incident pump power of 17.8 W, as high as 4.53 W cw output power at 543 nm is achieved. The optical-to-optical conversion efficiency is up to 25.4%, and the fluctuation of the green output power is better than 2.3% in a 30 min period.
New stable tunable solid-state dye laser in the red
NASA Astrophysics Data System (ADS)
Gvishi, Raz; Reisfeld, Renata; Burshtein, Zeev; Miron, Eli
1993-08-01
A red perylene derivative was impregnated into a composite silica-gel glass, and characterized as a dye laser material. The absorption spectrum in the range 480 - 600 nm belongs to the S0 - S1 electronic transition, with a structure reflecting the perylene skeletal vibrations, of typical energy 1100 - 1200 cm-1. An additional peak between 400 and 460 nm belongs to the S0 - S2 transition. The fluorescence exhibits a mirror image relative to the S0 - S1 absorption, with a Stokes shift of about 40 nm for the 0 - 0 transition. Laser tunability was obtained in the range 605 - 630 nm using a frequency-doubled Nd:YAG laser for pumping ((lambda) equals 532 nm). This wavelength range is important for medical applications, such as photodynamic therapy of some cancer tumors. Maximum laser efficiency of approximately 2.5% was obtained at 617 nm. Maximum output was approximately 0.36 mJ/pulse at a repetition rate of 10 Hz. Minimum laser threshold obtained was 0.45 mJ/pulse. The medium losses are attributed to an excited-state singlet-singlet absorption, with an upper limit cross-section of approximately 2.5 X 10-16 cm2. The laser output was stable over more than approximately 500,000 pulses, under excitation with the green line of a copper vapor laser (510 nm), of energy density approximately 40 mJ/cm2 per pulse. Good prospects exist for a considerable enhancement in laser output efficiency.
NASA Technical Reports Server (NTRS)
2007-01-01
The Tvashtar plume on Io, seen by the Hubble Space Telescope (HST) and by New Horizons. (A): The image in which the plume was discovered, taken by HST in ultraviolet light on Feb. 14, 2007, at a wavelength of 260 nm. The red diamond indicates location of the Tvashtar hot spot seen later by New Horizons. (B): An HST image of Io and the Tvashtar plume seen against Jupiter; sulfur gas in the plume absorbs ultraviolet light, making the plume look reddish in this color composite. The composite is composed of images taken at 260 nm (blue), 330 nm (green), and 410 nm (red). Other images in this montage are in visible light from the Long-Range Reconnaissance Imager (LORRI). The scale bar is 200 kilometers long and the yellow star indicates the projected location of the hot spot at the Tvashtar plume source. The dashed line is the terminator, the line dividing day from night on Io. (C): The highest-resolution view of the full plume, at a resolution of 12.4 kilometers (7.7 miles) per pixel and a solar phase angle of 102 degrees, showing the complex filamentary structure of the plume. The images are sharpened by un-sharp masking; the dark line at the edge of the disk is an artifact of this sharpening. (D): An image at 145-degree phase angle at 22.4 kilometers (13.8 miles) per pixel, showing the time variability of the details of the plume structure and its persistent bright top. (F-J): Sequence of frames at 2-minute intervals showing dynamics in the upper part of the plume (the source is on the far side of Io). Colored diamonds track individual features whose speeds, projected on the plane of the sky, are shown in (E). This image appears in the Oct. 12, 2007, issue of Science magazine, in a paper by John Spencer, et al.ERIC Educational Resources Information Center
Naser, Rina Abdallah
2016-01-01
The current study seeks to identify the level of creative behavior among teachers of public schools within the Green Line, based on gender, academic qualification, years of experience and level of school. The sample consisted of (502) teachers, selected randomly, from public schools within the Green Line in Israel. The tool utilized is a…
NASA Astrophysics Data System (ADS)
Karunakaran, Gopalu; Jagathambal, Matheswaran; Van Minh, Nguyen; Kolesnikov, Evgeny; Kuznetsov, Denis
2018-05-01
Nickel ferrite (NiFe2O4) spinel-structured nanoparticles (NPs) were synthesized by a green synthesis approach using Hydrangea paniculata flower extract. Green synthesis of NPs was preliminary monitored by a color change. Further confirmation was carried out using different techniques. X-ray diffraction analysis confirmed the cubic crystalline system (fcc) of NiFe2O4. Energy-dispersive spectrum analysis showed the presence of iron, nickel, oxygen, and carbon. Scanning electron microscopy revealed the agglomerating nature of the NPs (30-50 nm). The specific surface area was found to be 46.73 m2/g, revealing the average size D of NPs to be 24 nm. Transmission electron microscopy confirmed the spherical, oval, and irregular shapes of the NPs with a size range between 10 nm and 45 nm, and an average size of 28 nm. The magnetization of the obtained NiFe2O4 NPs in a high magnetic field of 20 kOe was found to be 20 emu/g. The values of remanent magnetization (M r) and coercive field (H c) were found to be 1.1 emu/g and 28 Oe, respectively. In the process of magnetization reversal (with a small value of M r/M s, 0.055), NiFe2O4 NPs had a loop with low energy loss, showing that the obtained NiFe2O4 NPs were soft magnetic materials. The magnetization curve with a sigmoidal shape indicated that the obtained NiFe2O4 NPs are super-paramagnetic material. In addition, the comparison of green synthesis with the methods available in the literature proved that the green synthesis is the best method. Thus, it is clear that green synthesis is a novel eco-friendly approach for the synthesis of magnetic NiFe2O4 NPs.
Multicolor upconversion emission from Tm3++Ho3++Yb3+ codoped tellurite glass on NIR excitations
NASA Astrophysics Data System (ADS)
Giri, N. K.; Rai, D. K.; Rai, S. B.
2008-06-01
Multicolor emission has been produced using 798 nm and 980 nm laser excitation in a Tm3++Ho3++Yb3+ codoped tellurite based glass. This glass generates simultaneously red, green and blue (RGB) emission on 798 nm excitation. Multicolor emission thus obtained was tuned to white luminescence by adjusting the Ho3+ ion concentration. There is a close match between the calculated color coordinate for the white luminescence obtained here and the point of equal energy which represents white in the 1931 CIE chromaticity diagram. The 980 nm excitation of the same sample on the other hand gives intense green and red emission and the glass appears greenish.
Diode pumped Yb:CN laser at 1082 nm and intracavity doubling to the green spectral range
NASA Astrophysics Data System (ADS)
Liu, B.; Li, Y. L.; Jiang, H. L.
2011-08-01
A diode pumped Yb:CaNb2O6 (Yb:CN) laser at 1082 nm with a maximum output of 1.35 W at 13.3 W pump power has been demonstrated. The slope efficiency was 12.4%. Moreover, intracavity second-harmonic generation (SHG) has also been achieved with a maximum green power of 374 mW by using a LiB3O5 (LBO) nonlinear crystal. To the best of our knowledge, this is the first report on continuous wave (CW) green generation by intracavity frequency doubling Yb:CN laser.
Compact efficient microlasers (Invited Paper)
NASA Astrophysics Data System (ADS)
Brown, David C.; Kuper, Jerry W.
2005-04-01
In this paper we discuss the design and performance of high-density microlaser devices we have been developing, including a series of compact Nd:Vanadate lasers operating at 1064 and 532 nm, and miniature green lasers producing 1-100 mW single-transverse-mode output at 532 nm. In particular, our miniature green lasers have been designed and tested in both 9 mm and 5.6 mm industry standard modified TO cans. These packages pave the way for mass production of low cost yet reliable green lasers that may eventually substitute for red diode lasers in many consumer-oriented applications.
Influence of skin type and wavelength on light wave reflectance.
Fallow, Bennett A; Tarumi, Takashi; Tanaka, Hirofumi
2013-06-01
A new application of photoplethysmography (PPG) has emerged recently to provide the possibility of heart rate monitoring without a telemetric chest strap. The aim of this study was to determine if a new device could detect pulsation over a broad range of skin types, and what light wavelength would be most suitable for detecting the signals. A light emitting diode-based PPG system was used to detect changes in pulsatile blood flow on 23 apparently healthy individuals (11 male and 12 female, 20-59 years old) of varying skin types classified according to a questionnaire in combination with digital photographs with a skin type chart. Four different light wavelengths (470, 520, 630, and 880 nm) were tested. Normalized modulation level is calculated as the AC/DC component ratio and represents the change in flow over the underlying constant state of flow or perfusion. In the resting condition, green light wavelength (520 nm) displayed greater modulation (p < 0.001) than all the other wavelengths analyzed regardless of skin types. Type V (dark brown) skin type was significantly lower in modulation than all other skin types. In the exercise condition, both blue (470 nm) and green (520 nm) light wavelengths displayed greater signal-to-noise ratios than red (630 nm) or infrared (880 nm) light wavelengths (p < 0.001). We concluded that a PPG-based device can detect pulsation across all skin types and that a greater resolution was obtained using a green light wavelength at rest and a green or blue light wavelength during exercise.
Novel cosmetic formulations containing a biosurfactant from Lactobacillus paracasei.
Ferreira, A; Vecino, X; Ferreira, D; Cruz, J M; Moldes, A B; Rodrigues, L R
2017-07-01
Cosmetic and personal care products including toothpaste, shampoo, creams, makeup, among others, are usually formulated with petroleum-based surfactants, although in the last years the consume trend for "green" products is inducing the replacement of surface-active agents in these formulations by natural surfactants, so-called biosurfactants. In addition to their surfactant capacity, many biosurfactants can act as good emulsifiers, which is an extra advantage in the preparation of green cosmetic products. In this work, a biosurfactant obtained from Lactobacillus paracasei was used as a stabilizing agent in oil-in-water emulsions containing essential oils and natural antioxidant extract. In the presence of biosurfactant, maximum percentages of emulsion volumes (EV=100%) were observed, with droplets sizes about 199nm. These results were comparable with the ones obtained using sodium dodecyl sulfate (SDS), a synthetic well known surfactant with high emulsify capacity. Moreover, the biosurfactant and emulsions cytotoxicity was evaluated using a mouse fibroblast cell line. Solutions containing 5g/L of biosurfactant presented cell proliferation values of 97%, whereas 0.5g/L of SDS showed a strong inhibitory effect. Overall, the results herein gathered are very promising towards the development of new green cosmetic formulations. Copyright © 2017 Elsevier B.V. All rights reserved.
Yang, Yefeng; Pan, Chenhao; Zhong, Renhai; Pan, Jinming
2018-06-01
Although many experiments have been conducted to clarify the response of broiler chickens to light-emitting diode (LED) light, those published results do not provide a solid scientific basis for quantifying the response of broiler chickens. This study used a meta-analysis to establish light spectral models of broiler chickens. The results indicated that 455 to 495 nm blue LED light produced the greatest positive response in body weight by 10.66% (BW; P < 0.001) and 515 to 560 nm green LED light increased BW by 6.27% (P < 0.001) when compared with white light. Regression showed that the wavelength (455 to 660 nm) was negatively related to BW change of birds, with a decrease of about 4.9% BW for each 100 nm increase in wavelength (P = 0.002). Further analysis suggested that a combination of the two beneficial light sources caused a synergistic effect. BW was further increased in birds transferred either from green LED light to blue LED light (17.23%; P < 0.001) or from blue LED light to green LED light (17.52%; P < 0.001). Moreover, birds raised with a mixture of green and blue LED light showed a greater BW promotion (10.66%; P < 0.001) than those raised with green LED light (6.27%). A subgroup analysis indicated that BW response to monochromatic LED light was significant regardless of the genetic strain, sex, control light sources, light intensity and regime of LED light, environmental temperature, and dietary ME and CP (P > 0.05). However, there was an interaction between the FCR response to monochromatic LED light with those covariant factors (P < 0.05). Additionally, green and yellow LED light played a role in affecting the meat color, quality, and nutrition of broiler chickens. The results indicate that the optimal ratio of green × blue of mixed LED light or shift to green-blue of combined LED light may produce the optimized production performance, whereas the optimal ratio of green/yellow of mixed or combined LED light may result in the optimized meat quality.
NASA Astrophysics Data System (ADS)
Naganathan, Kiruthika; Thirunavukkarasu, Somanathan
2017-04-01
Green synthesis of silver nanoparticles (SNP) opens a new path to kill and prevent various infectious diseases and also tumor. In this study, we have synthesized silver nanoparticles using multiple fruit peel waste (pomegranate, orange, banana and apple (POBA)). The primarily nanoparticles formation has been confirmed by the color change. The synthesized SNP were analyzed by various physicochemical techniques such as UV- Visible spectroscopy, x-ray diffraction (XRD), fourier transform infra red (FT-IR) spectroscopy and transmission electron microscope (TEM). The formation of SNP was confirmed by its absorbance peak observed at 430 nm in UV-Visible spectrum. Further, the obtained SNP were identified by XRD and TEM, respectively to know the crystalline nature and size and shape of the particles. The activities of SNP were checked with human pathogens (Salmonella, E.coli and Pseudomonas), plant pathogen (Fusarium) and marine pathogen (Aeromonas hydrophila) and also studied the scavenging effect and anticancer properties against MCF-7 cell lines. This studies proves that the SNP prepared from fruit waste peel extract approach appears extremely fast, cost efficient, eco-friendly and alternative for conventional methods of SNP synthesis to promote the usage of these nanoparticles in medicinal application.
NASA Astrophysics Data System (ADS)
Singh, Vijay; Kumar Rai, Vineet; Haase, Markus
2012-09-01
CaZrO3 phosphors co-doped with Er3+ and Yb3+ ions have been prepared by the urea combustion route. The formation of the orthorhombic phase of CaZrO3 was confirmed by powder x-ray diffraction. The absorption in the 280-1800 nm region and excitation spectrum corresponding to the emission at 545 nm for CaZrO3:Er3+/CaZrO3:Er3+,Yb3+ phosphors have been recorded. Upon excitation at 978 nm, the material displays strong energy transfer upconversion emission in the green and red spectral regions. The upconversion emission of the CaZrO3:Er3+,Yb3+ co-doped material shows an increased red-to-green ratio, indicating cross relaxation between Er3+ ions.
Kasturi, S; Sivakumar, V; Varadaraju, U V
2017-05-01
A series of Eu 2+ -activated barium orthosilicates (BaZnSiO 4 ) were synthesized using a high-temperature solid-state reaction. A photoluminescence excitation study of Eu 2 + shows a broad absorption band in the range of 270-450 nm, with multiple absorption peak maxima (310, 350 and 400 nm) due to 4f-5d electronic transition. The emission spectra of all the compositions show green color emission (in the spectral region 450-550 nm with a peak maximum at 502 nm and a shoulder at ~ 490 nm) with appropriate Comission Internationale de l'Eclairage (CIE) color coordinates. The two emission peaks are due to the presence of Eu 2 + in two different Ba sites in the BaZnSiO 4 host lattice. The energy transfers between the Eu 2 + ions in BaZnSiO 4 host are elucidated from the critical concentration quenching data based on the electronic multipolar interaction. All Eu 2 + -activated BaZnSiO 4 phosphor materials can be efficiently excited in the ultraviolet (UV) to near UV-region (270-420 nm), making them attractive candidate as a green phosphor for solid state lighting-white light-emitting diodes. Copyright © 2016 John Wiley & Sons, Ltd.
Generation of energetic femtosecond green pulses based on an OPCPA-SFG scheme.
Mero, M; Sipos, A; Kurdi, G; Osvay, K
2011-05-09
Femtosecond green pulses were generated from broadband pulses centered at 800 nm and quasi-monochromatic pulses centered at 532 nm using noncollinear optical parametric chirped pulse amplification (NOPCPA) followed by sum frequency mixing. In addition to amplifying the 800-nm pulses, the NOPCPA stage pumped by a Q-switched, injection seeded Nd:YAG laser also provided broadband idler pulses at 1590 nm. The signal and idler pulses were sum frequency mixed using achromatic and chirp assisted phase matching yielding pulses near 530 nm with a bandwidth of 12 nm and an energy in excess of 200 μJ. The generated pulses were recompressed with a grating compressor to a duration of 150 fs. The technique is scalable to high energies, broader bandwidths, and shorter pulse durations with compensation for higher order chirps and dedicated engineering of the interacting beams. © 2011 Optical Society of America
NASA Astrophysics Data System (ADS)
Majeed, Shahnaz; Danish, Mohammed; Muhadi, Nur Farisyah Bahriah Binti
2018-06-01
The study focussed on the synthesis of magnesium oxide (MgO) nanoparticles from an aqueous extract of Penicillium species isolated from soil. A suitable amount of magnesium nitrate (MgNO3) was mixed with the aqueous extract of Penicillium. Then the colour of the solution changed due to the formation of MgO nanoparticles. These nascent formed MgO nanoparticles were further confirmed by using UV spectrophotometry which showed the maximum absorption at 215 nm indicating the formation of MgO nanoparticles. Fourier transform infrared spectroscopy (FTIR) was used to find the possible functional groups and proteins involving the stabilization of MgO nanoparticles. Transmission electron microscopy (TEM) study revealed the size, the shape as well as the dispersity of the prepared MgO nanoparticles and showed that they were well dispersed around 12–24 nm (scale 200 nm). The anticancer activity against A-549 cell line of these green synthesized MgO nanoparticles was evaluated. The result showed good anticancer effect after 24 h of incubation. Nevertheless these MgO nanoparticles showed less effect on normal Vero cells. Further apoptotic study clearly displayed the effect of MgO nanoparticles on cancer cells. The effect was observed through chromatin condensation by forming apoptotic bodies using propidium iodide, acridine orange and ethidium bromide (AO/EB) staining technique. The DNA was isolated to confirm the DNA damage; the observation clearly showed DNA damage when compared with DNA ladder.
Tuning from green to red the upconversion emission of Y2O3:Er3+-Yb3+ nanophosphors
NASA Astrophysics Data System (ADS)
Diaz-Torres, L. A.; Salas, P.; Oliva, J.; Resendiz-L, E.; Rodriguez-Gonzalez, C.; Meza, O.
2017-01-01
In this work, the structural, morphological and luminescent properties of Y2O3 nanophosphors doped with Er3+ (1 mol%) and different Yb3+ concentrations (2-12 mol%) have been studied. Those nanophosphors were synthesized using a simple hydrothermal method. XRD analysis indicates that all the samples presented a pure cubic phase even for Yb concentrations as high as 12 mol%. In addition, SEM images show nanoparticles with quasi-spherical shapes with average sizes in the range of 300-340 nm. Photoluminescence measurements obtained after excitation at 967 nm revealed that our samples have strong green (563 nm) and red emissions (660 nm) corresponding to 2H11/2 + 4S3/2 → 4I15/2 and 4F9/2 → 4I15/2 transitions of Er3+ ions, respectively. We also observed that the green band is quenched and the red emission enhanced as the Yb concentration increases. In consequence, the CIE coordinates changed from (0.35, 0.64) in the green region to (0.59, 0.39) in the red region. Thus, the tuning properties of Y2O3 nanophosphors suggest that they are good candidates for applications in lighting.
Compact 151 W green laser with U-type resonator for prostate surgery
NASA Astrophysics Data System (ADS)
Bazyar, Hossein; Aghaie, Mohammad; Daemi, Mohammad Hossein; Bagherzadeh, Seyed Morteza
2013-04-01
We analyzed, designed and fabricated a U-type resonator for intra-cavity frequency doubling of a diode-side-pumped Q-switched Nd:YAG rod laser with high power and high stability for surgery of prostatic tissue. The resonator stability conditions were analyzed graphically in the various configurations for a U-type resonator. We obtained green light at 532 nm using a single KTP crystal, with average output power of 151 W at 10 kHz repetition rate, and with 113 ns pulse duration at 810 W input pump power. We achieved 1064-532 nm conversion efficiency of 75.8%, and pump-to-green optical-optical efficiency of 18.6%. The green power fluctuation was ±1.0% and pointing stability was better than 4 μrad. The green laser output was coupled to a side-firing medical fiber to transfer the laser beam to the prostatic tissue.
Studies of Minerals, Organic and Biogenic Materials through Time-Resolved Raman Spectroscopy
NASA Technical Reports Server (NTRS)
Garcia, Christopher S.; Abedin, M. Nurul; Ismail, Syed; Sharma, Shiv K.; Misra, Anupam K.; Nyugen, Trac; Elsayed-Ali, hani
2009-01-01
A compact remote Raman spectroscopy system was developed at NASA Langley Research center and was previously demonstrated for its ability to identify chemical composition of various rocks and minerals. In this study, the Raman sensor was utilized to perform time-resolved Raman studies of various samples such as minerals and rocks, Azalea leaves and a few fossil samples. The Raman sensor utilizes a pulsed 532 nm Nd:YAG laser as excitation source, a 4-inch telescope to collect the Raman-scattered signal from a sample several meters away, a spectrograph equipped with a holographic grating, and a gated intensified CCD (ICCD) camera system. Time resolved Raman measurements were carried out by varying the gate delay with fixed short gate width of the ICCD camera, allowing measurement of both Raman signals and fluorescence signals. Rocks and mineral samples were characterized including marble, which contain CaCO3. Analysis of the results reveals the short (approx.10-13 s) lifetime of the Raman process, and shows that Raman spectra of some mineral samples contain fluorescence emission due to organic impurities. Also analyzed were a green (pristine) and a yellow (decayed) sample of Gardenia leaves. It was observed that the fluorescence signals from the green and yellow leaf samples showed stronger signals compared to the Raman lines. Moreover, it was also observed that the fluorescence of the green leaf was more intense and had a shorter lifetime than that of the yellow leaf. For the fossil samples, Raman shifted lines could not be observed due the presence of very strong short-lived fluorescence.
Jacob, S Justin Packia; Finub, J S; Narayanan, Anand
2012-03-01
There is an increasing commercial demand for various nanoparticles due to their extensive applicability in various areas such as electronics, catalysis, chemistry, energy and medicine. Wet chemical techniques were used for the traditional synthesis of metallic nanoparticles, where the chemicals used are quite often toxic and flammable. In the present study, we describe a cost effective and eco-friendly technique for green synthesis of silver nanoparticles from 1 mM AgNO(3) solution using the extract of Piper longum leaf as reducing as well as capping agent. Nanoparticles were characterized using UV-vis absorption spectroscopy, FTIR, and SEM. SEM analysis showed the spherical nanoparticles with 17.6-41 nm in size. These biologically synthesized nanoparticles were also exhibiting excellent cytotoxic effect on HEp-2 cell lines. Copyright © 2011 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Francisco-Rodriguez, H. I.; Lira, A.; Soriano-Romero, O.; Meza-Rocha, A. N.; Bordignon, S.; Speghini, A.; Lozada-Morales, R.; Caldiño, U.
2018-05-01
A spectroscopic analysis of Tb3+ and Tb3+/Eu3+ doped lithium-aluminum-zinc phosphate glasses is performed through their absorbance and photoluminescence spectra, and decay time profiles. Laser parameter values (stimulated emission cross section, effective bandwidth, gain bandwidth and optical gain) were obtained for the terbium 5D4 → 7F5 green emission from the Tb3+ singly-doped glass (LAZT) excited at 350 nm to judge the suitability of the glass phosphor for fiber lasers. A quantum yield of (47.68 ± 0.49)% was measured for the 5D4 level luminescence. Upon 350 nm excitation the LAZT glass phosphor emits green light with a color purity of 65.6% and chromaticity coordinates (0.285, 0.585) very close to those (0.29, 0.60) of European Broadcasting Union illuminant green. The Tb3+/Eu3+codoped glass emission color can be tuned from reddish-orange of 1865 K upon 318 nm excitation to warm white of 3599 K and neutral white of 4049 K upon 359 and 340 nm excitations, respectively. Upon Tb3+ excitation at 340 nm Eu3+ is sensitized by Tb3+ through a non-radiative energy transfer with an efficiency of 0.23-0.26. An electric dipole-dipole interaction might be the dominant mechanism in the Tb3+ to Eu3+ energy transfer taking place into Tb3+ - Eu3+ clusters.
Assessment of remotely sensed chlorophyll-a concentration in Guanabara Bay, Brazil
NASA Astrophysics Data System (ADS)
Oliveira, Eduardo N.; Fernandes, Alexandre M.; Kampel, Milton; Cordeiro, Renato C.; Brandini, Nilva; Vinzon, Susana B.; Grassi, Renata M.; Pinto, Fernando N.; Fillipo, Alessandro M.; Paranhos, Rodolfo
2016-04-01
The Guanabara Bay (GB) is an estuarine system in the metropolitan region of Rio de Janeiro (Brazil), with a surface area of ˜346 km2 threatened by anthropogenic pressure. Remote sensing can provide frequent data for studies and monitoring of water quality parameters, such as chlorophyll-a concentration (Chl-a). Different combination of Medium Resolution Imaging Spectrometer (MERIS) remote sensing reflectance band ratios were used to estimate Chl-a. Standard algorithms such as Ocean Color 3-band, Ocean Color-4 band, fluorescence line height, and maximum chlorophyll index were also tested. The MERIS Chl-a estimates were statistically compared with a dataset of in situ Chl-a (2002 to 2012). Good correlations were obtained with the use of green, red, and near-infrared bands. The best performing algorithm was based on the red (665 nm) and green (560 nm) band ratio, named "RG3" algorithm (r2=0.71, chl-a=62,565*x1.6118). The RG3 was applied to a time series of MERIS images (2003- to 2012). The GB has a high temporal and spatial variability of Chl-a, with highest values found in the wet season (October to March) and in some of the most internal regions of the estuary. Lowest concentrations are found in the central circulation channel due to the flushing of ocean water masses promoted by pumping tide.
NASA Astrophysics Data System (ADS)
Maiwald, M.; Müller, A.; Sumpf, B.
2017-02-01
In-situ shifted excitation Raman difference spectroscopy (SERDS) experiments are presented using a portable sensor system. Key elements of this system are an in-house developed handheld probe with an implemented dual-wavelength diode laser at 785 nm. An optical power of 120 mW is achieved ex probe. Raman experiments are carried out in the laboratory for qualification using polystyrene as test sample. Here, a shot-noise limited signal-to-noise ratio (SNR) of 120 is achieved. Stability tests were performed and show a stable position of the Raman line under study within 0.1 cm-1 and a stable Raman intensity better +/- 2% mainly limited by shot noise interference. SERDS experiments are carried out in an apple orchard for demonstration. Green apple leafs are used as test samples. The Raman spectra show huge background interferences by fluorescence and ambient daylight which almost obscure Raman signals from green leafs. The selected excitation power is 50 mW and the exposure time is 0.2 s to avoid detector saturation. SERDS efficiently separates the Raman signals from fluorescence and daylight contributions and generates an 11-fold improvement of the signal-to-background noise with respect to the measured Raman signals. The results demonstrate the capability of the portable SERDS system and enable rapid in-situ and undisturbed Raman investigations under daylight conditions.
Cosmic Ray Measurements Inside Mir With Sileye-2
NASA Astrophysics Data System (ADS)
Casolino, M.; Sileye-2 Team
smallIntensity of the coronal green line (small = 5303cm) is considered as an impor- tant parameter to characterize the changes of diffusion coefficient of galactic cosmic rays versus the solar activity. A contribution of the coronal green line intensity in GCR diffusion coefficient is taken into account using its real distribution on the whole disk of the Sun averaging for three days. An assumption is made that the observed changes of the intensity of the coronal green line on the Sun's surface is taken away to the in- terplanetary space with the average solar wind velocity, U = 400 km/s. Thus, to cover the modulation region of the size of the 100 AU there is necessary data of the coronal green line intensity of the one-year duration. Alternating the coefficient of proportion- ality between the intensity of coronal green line and the diffusion coefficient of GCR the appropriate correspondence between the observation of GCR intensity sensitive to neutron monitors and solution of the Parker's transport equation have been found. The best correspondence between the observation of GCR intensity and solution of the Parker's transport equation has been found when the role of the coronal green line intensity in diffusion coefficient of GCR is gradually diminished versus the distance from the Sun.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lai, C.-M.; Chang, K.-H.; Yang, Z.-Y.
Spectrally broad frequency comb generation over 510–555 nm range was reported on chirped quasi-phase-matching (QPM) χ{sup (2)} nonlinear photonic crystals of 12 mm length with periodicity stepwise increased from 5.9 μm to 7.1 μm. When pumped with nanosecond infrared (IR) frequency comb derived from a QPM optical parametric oscillator (OPO) and spanned over 1040 nm to 1090 nm wavelength range, the 520 nm to 545 nm up-converted green spectra were shown to consist of contributions from (a) second-harmonic generation among the signal or the idler modes, and (b) sum-frequency generation (SFG) from the neighboring pairs of the signal or the idler modes. These mechanisms led the up-converted greenmore » frequency comb to have the same mode spacing of 450 GHz as that in the IR-OPO pump comb. As the pump was further detuned from the aforementioned near-degeneracy point and moved toward the signal (1020–1040 nm) and the idler (1090–1110 nm) spectral range, the above QPM parametric processes were preserved in the chirped QPM devices to support up-converted green generation in the 510–520 nm and the 545–555 nm spectral regime. Additional 530–535 nm green spectral generation was also observed due to concurrence of multi-wavelength SFG processes between the (signal, idler) mode pairs. These mechanisms facilitate the chirped QPM device to support a single-pass up-conversion efficiency ∼10% when subject to an IR-OPO pump comb with 200 mW average power operated near- or off- the degeneracy point.« less
Teerman, S.C.; Crelling, J.C.; Glass, G.B.
1987-01-01
Flourescence spectral analysis indicates that resinite macerals from Tertiary Hanna Formation coals (Hanna Coal Field, southcentral Wyoming, U.S.A.) can be separated into five distinct groups. The first resinite group fluoresces a a medium green (in blue light); its average spectral maximum occurs at or below 440 mm with a red/green quotient of 0.22. The second resinite group fluoresces yellow-green with an average spectral maximum of 500 nm and a red/green quotient of 0.53. The third resinite group displays a yellow fluorescence having an average spectral maximum of 580 nm and a red/green quotient of 0.86. The fourth resinite group fluorescence orange-brown having an average spectral maximum of 610 nm and a red/green quotient of 1.20. These four groups mostly occur as primary globular resinites exhibiting scratches and fractures, indicating that they are brittle, solid substances. Primary cell-filling and secondary fracture-filling resinites also occur in these four groups. The fifth group only occurs as a secondary void-filling material and lacks evidence of br of brittle properties. It fluoresces a reddish-brown, has a spectral maximum at 690 nm, and a red/green quotient of 1.54. The fifth group has properties resembling exsudatinite. The five resinite groups can be separated on the basis of their nine spectral properties alone, without qualitative petrographic interpretation. The relative quantities of the five resinite groups vary among Hanna Formation coals. The origins of these five resinite groups are probably related to their botanical properties and pre- and post-depossitional conditions. Overall, Hanna Formation resinites have petrographic characteristics similar to other North American resinites; however, only four resinite groups have been distinguished in in certain coals from Utah and New Mexico (U.S.A.), and western Canada. ?? 1987.
NASA Astrophysics Data System (ADS)
Omri, K.; Alyamani, A.; Mir, L. El
2018-02-01
Mn2+-doped Zn2SiO4 (ZSM2+) was synthesized by a facile sol-gel technique. The obtained samples were characterized by X-ray diffraction (XRD), Raman spectroscopy, photoluminescence (PL) and cathodoluminescence (CL) techniques. Under UV excitation, spectra showed that the α-ZSM2+ phosphor exhibited a strong green emission around 525 nm and reached the highest luminescence intensity with the Mn doping concentration of 5 at.%. However, for the β-ZSM2+ phase, an interesting yellow emission band centered at 575 nm of Mn2+ at the Zn2+ tetrahedral sites was observed. In addition, an unusual red shift with increasing Mn2+ content was also found and attributed to an exchange interaction between Mn2+. Both PL and CL spectra exhibit an intense green and yellow emission centered at 525 and 573 nm, respectively, due to the 4T1 (4G)-6A1 (6S) transition of Mn2+. Furthermore, these results indicated that the Mn2+-doped zinc silicate phosphors may have potential applications in green and yellow emissions displays like field emission displays (FEDs).
Optical properties of P ion implanted ZnO
NASA Astrophysics Data System (ADS)
Pong, Bao-Jen; Chou, Bo-Wei; Pan, Ching-Jen; Tsao, Fu-Chun; Chi, Gou-Chung
2006-02-01
Red and green emissions are observed from P ion implanted ZnO. Red emission at ~680 nm (1.82 eV) is associated with the donor-acceptor pair (DAP) transition, where the corresponding donor and acceptor are interstitial zinc (Zn i) and interstitial oxygen (O i), respectively. Green emission at ~ 516 nm (2.40 eV) is associated with the transition between the conduction band and antisite oxygen (O Zn). Green emission at ~516nm (2.403 eV) was observed for ZnO annealed at 800 oC under ambient oxygen, whereas, it was not visible when it was annealed in ambient nitrogen. Hence, the green emission is most likely not related to oxygen vacancies on ZnO sample, which might be related to the cleanliness of ZnO surface, a detailed study is in progress. The observed micro-strain is larger for N ion implanted ZnO than that for P ion implanted ZnO. It is attributed to the larger straggle of N ion implanted ZnO than that of P ion implanted ZnO. Similar phenomenon is also observed in Be and Mg ion implanted GaN.
Highly efficient color filter array using resonant Si3N4 gratings.
Uddin, Mohammad Jalal; Magnusson, Robert
2013-05-20
We demonstrate the design and fabrication of a highly efficient guided-mode resonant color filter array. The device is designed using numerical methods based on rigorous coupled-wave analysis and is patterned using UV-laser interferometric lithography. It consists of a 60-nm-thick subwavelength silicon nitride grating along with a 105-nm-thick homogeneous silicon nitride waveguide on a glass substrate. The fabricated device exhibits blue, green, and red color response for grating periods of 274, 327, and 369 nm, respectively. The pixels have a spectral bandwidth of ~12 nm with efficiencies of 94%, 96%, and 99% at the center wavelength of blue, green, and red color filter, respectively. These are higher efficiencies than reported in the literature previously.
Bluish-green color emitting Ba2Si3O8:Eu2+ ceramic phosphors for white light-emitting diodes.
Xiao, F; Xue, Y N; Zhang, Q Y
2009-10-15
This paper reports on the structural and optical properties of Eu(2+) activated Ba(2)Si(3)O(8) ceramic phosphors synthesized by a sol-gel method. The ceramic phosphors have been characterized by X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM) and fluorescence measurements. The structural characterization results suggest that the as-prepared phosphors are of single phase monoclinic Ba(2)Si(3)O(8) with rod-like morphology. A broad excitation band ranging from 300 to 410 nm matches well with the ultraviolet (UV) radiation of light-emitting diodes (LEDs). Upon 380 nm UV light excitation, these phosphors emit bluish-green emission centered at 500 nm with color coordination (x=0.25, y=0.40). All the obtained results indicate that the Ba(2)Si(3)O(8):Eu(2+) ceramic phosphors are promising bluish-green candidates for the phosphor-converted white LEDs.
High-power, continuous-wave, second-harmonic generation at 532 nm in periodically poled KTiOPO(4).
Samanta, G K; Kumar, S Chaitanya; Mathew, M; Canalias, C; Pasiskevicius, V; Laurell, F; Ebrahim-Zadeh, M
2008-12-15
We report efficient generation of high-power, cw, single-frequency radiation in the green in a simple, compact configuration based on single-pass, second-harmonic generation of a cw ytterbium fiber laser at 1064 nm in periodically poled KTiOPO(4). Using a crystal containing a 17 mm single grating with period of 9.01 microm, we generate 6.2 W of cw radiation at 532 nm for a fundamental power of 29.75 W at a single-pass conversion efficiency of 20.8%. Over the entire range of pump powers, the generated green output is single frequency with a linewidth of 8.5 MHz and has a TEM(00) spatial profile with M(2)<1.34. The demonstrated green power can be further improved by proper thermal management of crystal heating effects at higher pump powers and also by optimized design of the grating period to include thermal issues.
NASA Astrophysics Data System (ADS)
Lee, Dicky; Moulton, Peter F.
2001-03-01
In this paper we discuss our red, green, and blue (RGB) optical parametric oscillator (OPO) light source for projection display applications. Our source consists of a diode-pumped pump laser and a LBO-based OPO. Based on our Nd:YLF gain-module design, the pump laser is frequency doubled to serve as the pump source for the OPO. The unconverted pump power is recycled as the green light for projection. The singly resonant, non-critically phase- matched OPO has, to date, generated 13 W of 898-nm signal power and an estimated 9.3 W of intra-cavity idler power at 1256 nm. With approximately 76% of pump depletion, the power of the residual green light for projection is about 5.8 W. We have extra-cavity doubled the signal to produce approximately 3.5 W of 449-nm blue light and intra-cavity doubled the idler to produce approximately 6 W of 628-nm red light. The OPO-based RGB source generates about 4000 lumens of D65-balanced white light. The overall electrical power luminous efficiency (diodes only) is about 14.6 lumens/Watt.
Structural studies of a green-emitting terbium doped calcium zinc phosphate phosphor
NASA Astrophysics Data System (ADS)
Ramesh, B.; Dillip, G. R.; Rambabu, B.; Joo, S. W.; Raju, B. Deva Prasad
2018-03-01
In this study, a new green emitting CaZn2(PO4)2:Tb3+ phosphors were synthesized through solid-state reaction route. The phosphors were characterized structurally by X-ray diffraction, Fourier transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS). All the synthesized phosphors were crystallized in triclinic crystal structure with P 1 bar space group. The phosphate groups in the phosphors were confirmed by FTIR analysis. The surface elements O 1s, P 2p, Ca 2p, Zn 2p and Tb 3d were studied by high-resolution XPS spectra. Upon excitation at 378 nm, the dominant green emission of CaZn2(PO4)2:Tb3+ phosphors at 542 nm were noticed in the emission spectra. For various emission wavelengths (at 435 and 489 nm) and constant excitation wavelength (at 378 nm), the decay curves have shown two different decay dynamics of phosphors. The lighting properties such as Commission International de l'Eclairage (x = 0.319, y = 0.398) and color temperature (5995 K) were calculated.
Investigating the Role of Radiation Therapy Breast Cancer Clinical and Translational Research
2006-05-01
radiosensitizing and anticancer properties of green tea and curcumin and found a complex response cascade in cell lines. For example, the anticancer ...this fall. 5. Arber Kodra: Effect of Green Tea and Curcumin on Breast Cancer Cell Lines Mentor: Gary Kao, MD PhD Arber examined the...Breast Cancer Elizabeth Gurney Mentor: Gary Kao, MD, PhD Effect of Green Tea and Curcumin on Breast Cancer Cell Lines Arber Kodra Mentor
NASA Astrophysics Data System (ADS)
Avram, Daniel; Florea, Mihaela; Tiseanu, Ion; Tiseanu, Carmen
2015-09-01
Herein, we report on the emission color tunability of Er doped BiOCl measured under up—conversion as well as x-ray excitation modes. The dependence of red (670 nm) to green emission (543 nm) ratio on Er concentration (1 and 5%), excitation wavelength into different (656.4, 802 and 976 nm) or across single Er absorption levels (965 ÷ 990 nm) and delay after the laser pulse (0.001 ÷ 1 ms) is discussed in terms of ground state absorption/excited state absorption and energy transfer up-conversion mechanisms. A first example of extended Er x-ray emission measured in the range of 500 to 1700 nm shows comparable emission intensities corresponding to 543 nm and 1500 nm based transitions. The present results together with our earlier report on the upconversion emission of Er doped BiOCl excited at 1500 nm, suggest that Er doped BiOCl may be considered an attractive system for optical and x-ray imaging applications.
Identification of New Hot Bands in the Blue and Green Band Systems of FeH
NASA Astrophysics Data System (ADS)
Wilson, Catherine; Brown, John M.
1999-10-01
A particularly rich region of the electronic spectrum of FeH from 525 to 545 nm was investigated using the techniques of dispersed and undispersed laser-induced fluorescence. Analysis has led to the discovery that several different electronic transitions are embedded in this region; the (0, 0) and (1, 1) bands of the e6Π-a6Δ (green) system, the (0, 2) band of the g6Φ-X4Δ (intercombination) system, the (0, 1) band of the g6Φ-a6Δ (blue) system, and the (0, 0) band of the g6Φ-b6Π system. Seventy-five lines were assigned in the (0, 1) band of the g6Φ-a6Δ transition. These, with the assignment of an additional 14 lines in the 583 nm region to the (0, 1) band of the e6Π-a6Δ transition, led to the extension of the known term values to higher J values for the Ω = 9/2, 7/2, and 5/2 spin components of the v = 1 level of the a6Δ state and the novel characterization of the a6Δ3/2 (v = 1) and g6Φ5/2 (v = 0) components. A further 73 lines were assigned to the first four subbands of the (1, 1) band of the e6Π-a6Δ transition and term values for the lowest four spin components of the v = 1 level of the e6Π state were determined. This provides the first experimental measurement of a vibrational interval in one of the higher lying electronic states of FeH. The interval does not appear to vary strongly between the spin components (ΔG1/2 = 1717, 1713, 1710 cm-1 for Ω = 7/2, 5/2, 3/2, respectively). Remarkably few of the hot-band transitions assigned in this work could be identified in the complex, high-temperature spectrum of FeH recorded by P. McCormack and S. O'Connor [Astron. Astrophys. Suppl. 26, 373-380 (1976)].
Structural and optical investigation in Er3+ doped Y2MoO6 phosphors
NASA Astrophysics Data System (ADS)
Mondal, Manisha; Rai, Vineet Kumar
2018-05-01
The Er3+ doped Y2MoO6 phosphors have been structurally and optically characterized by X-ray Diffraction (XRD), Field emission scanning electron microscopy (FESEM), UV-Vis absorption spectroscopy and frequency upconversion (UC) emission studies. The crystal and the particles size are found to be ˜ 85 nm and ˜ 200 nm from XRD and FESEM analysis. The intense peak at ˜ 206 nm in the UV-Vis absorption spectroscopy is attributed due to the charge transfer transition between the Mo6+ and the O2- ions in the MoO4 group in the host molybdate. The frequency UC emission studies of the prepared phosphors under 980 nm diode laser excitation shows the intense UC emission in the 0.3 mol% concentrations for the Er3+ ions. In the UC emission spectra, the emission peaks at green (˜ 525 nm and ˜ 546 nm) and red (˜ 656 nm) bands are corresponding to the 2H11/2, 4S3/2 → 4I15/2 and 4F9/2 → 4I15/2 transitions of Er3+ ions. The mechanisms involved in the UC process have been explored with the help of energy level diagram. Moreover, the CIE point (0.31, 0.60) lie in the green colour region which indicates that the developed phosphor have suitable applications in NIR to visible upconverter and in making green light display devices.
NASA Astrophysics Data System (ADS)
Franek, James B.
Argon emission lines, particularly those in the near-infrared region (700-900nm), are used to determine plasma properties in low-temperature, partially ionized plasmas to determine effective electron temperature [Boffard et al., 2012], and argon excited state density [Boffard et al., 2009] using appropriately assumed electron energy distributions. While the effect of radiation trapping influences the interpretation of plasma properties from emission-line ratio analysis, eliminating the need to account for these effects by directly observing the 3px-to-1sy transitions [ Boffard et al., 2012] is preferable in most cases as this simplifies the analysis. In this dissertation, a 1-Torr argon, pulsed positive column in a hollow-cathode discharge is used to study the correlation between four quantities: 420.1-419.8nm emission-line ratio, metastable-atom density, reduced electric field, and electron energy distribution. The extended coronal model is used to acquire an expression for 420.1-419.8nm emission-line ratio, which is sensitive to direct electron-impact excitation of argon excited states as well as stepwise electron-impact excitation of argon excited states for the purpose of inferring plasma quantities from experimental measurements. Initial inspection of the 420.1-419.8nm emission-line ratio suggests the pulse may be empirically divided into three distinct stages labelled the Initiation Stage, Transient Stage, and Post-Transient stage. Using equilibrium electron energy distributions from simulation to deduce excitation rates [Adams et al., 2012] in the extended coronal model affords agreement between predicted and observed metastable density in the Post-Transient stage of the discharge [Franek et al., 2015]. Applying this model-assisted diagnostic technique to the characterization of plasma systems utilizing lower-resolution spectroscopic systems is not straightforward, however, as the 419.8nm and 420.1nm emission-line profiles are convolved and become insufficiently resolved for treating the convolution as two separate emission-lines. To remedy this, the argon 425.9nm emission-line is evaluated as a proxy for the 419.8 nm emission-line. Both emission-lines (419.8nm and 425.9nm) are attributed to direct excitation from the argon ground state. The intensity of the 425.9nm emission-line is compared to the intensity of the 419.8nm emission-line over a range of plasma conditions to infer the same plasma quantities from similar experimental measurements. Discrepancies between the observed intensities of the emission-lines (419.8nm, 425.9nm) are explained by electron-impact cross-sections of their parent states. It is shown that the intensity of the argon 425.9nm emission-line is similar to that of the 419.8nm emission-line. The difference between the observed emission lines (425.9nm, 419.8nm) is attributed to the electron energy distribution in the plasma.
Modified Homogeneous Data Set of Coronal Intensities
NASA Astrophysics Data System (ADS)
Dorotovič, I.; Minarovjech, M.; Lorenc, M.; Rybanský, M.
2014-07-01
The Astronomical Institute of the Slovak Academy of Sciences has published the intensities, recalibrated with respect to a common intensity scale, of the 530.3 nm (Fe xiv) green coronal line observed at ground-based stations up to the year 2008. The name of this publication is Homogeneous Data Set (HDS). We have developed a method that allows one to successfully substitute the ground-based observations by satellite observations and, thus, continue with the publication of the HDS. For this purpose, the observations of the Extreme-ultraviolet Imaging Telescope (EIT), onboard the Solar and Heliospheric Observatory (SOHO) satellite, were exploited. Among other data the EIT instrument provides almost daily 28.4 nm (Fe xv) emission-line snapshots of the corona. The Fe xiv and Fe xv data (4051 observation days) taken in the period 1996 - 2008 have been compared and good agreement was found. The method to obtain the individual data for the HDS follows from the correlation analysis described in this article. The resulting data, now under the name of Modified Homogeneous Data Set (MHDS), are identical up to 1996 to those in the HDS. The MHDS can be used further for studies of the coronal solar activity and its cycle. These data are available at http://www.suh.sk.
Protanomaly without darkened red is deuteranopia with rods.
Shevell, Steven K; Sun, Yang; Neitz, Maureen
2008-11-01
The Rayleigh match, a color match between a mixture of 545+670 nm lights and 589 nm light in modern instruments, is the definitive measurement for the diagnosis of inherited red-green color defects. All trichromats, whether normal or anomalous, have a limited range of 545+670 nm mixtures they perceive to match 589 nm: a typical color-normal match range is about 50-55% of 670 nm in the mixture (deutan mode), while deuteranomals have a range that includes mixtures with less 670 nm than normal and protanomals a range that includes mixtures with more 670 nm than normal. Further, the matching luminance of the 589 nm light for deuteranomals is the same as for normals but for protanomals is below normal. An example of an unexpected Rayleigh match, therefore, is a match range above normal (typical of protanomaly) and a normal luminance setting for 589 nm (typical of deuteranomaly), a match called protanomaly "when the red end of the spectrum is not darkened" [Pickford, R.W. (1950). Three pedigrees for color blindness. Nature, 165, 182.]. In this case, Rayleigh matching does not yield a clear diagnosis. Aside from Pickford, we are aware of only one other report of a similar observer [Pokorny, J., & Smith, V. C. (1981). A variant of red-green color defect. Vision Research, 21, 311-317]; this study predated modern genetic techniques that can reveal the cone photopigment(s) in the red-green range. We recently had the opportunity to conduct genetic and psychophysical tests on such an observer. Genetic results predict he is a deuteranope. His Rayleigh match is consistent with L cones and a contribution from rods. Further, with a rod-suppressing background, his Rayleigh match is characteristic of a single L-cone photopigment (deuteranopia).
Zhu, Qi; Song, Caiyun; Li, Xiaodong; Sun, Xudong; Li, Ji-Guang
2018-04-09
Submicron sized, monodispersed spheres of Mn2+, Yb3+/Er3+ and Mn2+/Yb3+/Er3+ doped α-NaYF4 were easily autoclaved from mixed solutions of the component nitrates and ammonium fluoride (NH4F), in the presence of EDTA-2Na. Detailed characterizations of the resultant phosphors were obtained using XRD, Raman spectroscopy, FE-SEM, HR-TEM, STEM, PLE/PL spectroscopy, and fluorescence decay analysis. Finer structure and better crystal perfection was observed at a higher calcination temperature, and the spherical shape and excellent dispersion of the original particles was retained at temperatures up to 600 °C. Under the 980 nm infrared excitation, the Yb3+/Er3+-doped sample (calcined at 400 °C) exhibits a stronger green emission centered at ∼524 nm (2H11/2 → 4I15/2 transition of Er3+) and a weaker red emission centered at ∼657 nm (4F9/2 → 4I15/2 transition of Er3+). A 200 °C increase in the temperature from 400 °C to 600 °C resulted in the dominant red emission originating from the 4F9/2 → 4I15/2 transition of Er3+, instead of the previously dominant green one. Mn2+ doping induced a remarkable more enhanced intensity at ∼657 nm and ∼667 nm (red emission area) than that at ∼524 nm and ∼546 nm (green emission area), because of the non-radiative energy transfer between Mn2+ and Er3+. However, a poor thermal stability was induced by Mn2+ doping. The observed upconversion luminescence of the samples calcined at 400 °C and 600 °C followed the two photon process and the four photon process, respectively.
Cytotoxicity and antimicrobial activities of green synthesized silver nanoparticles.
Lokina, S; Stephen, A; Kaviyarasan, V; Arulvasu, C; Narayanan, V
2014-04-09
Bio-inspired silver nanoparticles are synthesized using Malus domestica (apple) extract. Polyphenols present in the apple extract act as a reducing and capping agent to produce the silver nanoparticles. UV-Visible analysis shows the surface plasmon resonance (SPR) absorption at 420 nm. The FTIR analysis was used to identify the functional groups responsible for the bio-reduction of silver ion. The XRD and HRTEM images confirm the formation of silver nanoparticles. The minimal inhibitory concentration (MIC) of silver nanoparticles was recorded against most of the bacteria and fungus. Further, MCF-7 human breast adenocarcinoma cancer cell line was employed to observe the efficacy of cancer cell killing. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Green Synthesis of Ag-Cu Nanoalloys Using Opuntia ficus- indica
NASA Astrophysics Data System (ADS)
Rocha-Rocha, O.; Cortez-Valadez, M.; Hernández-Martínez, A. R.; Gámez-Corrales, R.; Alvarez, Ramón A. B.; Britto-Hurtado, R.; Delgado-Beleño, Y.; Martinez-Nuñez, C. E.; Pérez-Rodríguez, A.; Arizpe-Chávez, H.; Flores-Acosta, M.
2017-02-01
Bimetallic Ag/Cu nanoparticles have been obtained by green synthesis using Opuntia ficus- indica plant extract. Two synthesis methods were applied to obtain nanoparticles with core-shell and Janus morphologies by reversing the order of precursors. Transmission electronic microscopy revealed size of 10 nm and 20 nm for the core-shell and Janus nanoparticles, respectively. Other small particles with size of up to 2 nm were also observed. Absorption bands attributed to surface plasmon resonance were detected at 440 nm and 500 nm for the core-shell and Janus nanoparticles, respectively. Density functional theory predicted a breathing mode type (BMT) located at low wavenumber due to small, low-energy clusters of (AgCu) n with n = 2 to 9, showing a certain correlation with the experimental one (at 220 cm-1). The dependence of the BMT on the number of atoms constituting the cluster is also studied.
Hydrothermal synthesis infrared to visible upconversion luminescence of SrMoO4: Er3+/Yb3+ phosphor
NASA Astrophysics Data System (ADS)
Sinha, Shriya; Kumar, Kaushal
2018-04-01
The upconversion emission properties in Er3+/Yb3+ doped SrMoO4 phosphor synthesized via hydrothermal method is investigated upon 980 nm laser light excitation. The crystal structure and morphology of the synthesized phosphor are characterized by X-ray diffraction and field emission scanning electron microscopy. The X-ray diffraction pattern suggests that SrMoO4 phosphor has tetragonal phase structure. The phosphor emits strong green (525 and 552 nm) and red (665 nm) UC emissions along with weak blue (410 and 488 nm) and near infrared (798 nm) emission bands. The color emitted from the phosphor is shifted from yellow to green region with increasing the power density from 15 to 65 W/cm2. The result indicates that the present material is suitable for making infrared to visible up-converts and display devices.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klein, T., E-mail: tklein@ifp.uni-bremen.de; Klembt, S.; Institut Néel, Université Grenoble Alpes and CNRS, B.P. 166, 38042 Grenoble
2015-03-21
ZnSe-based electron-beam pumped vertical-cavity surface-emitting lasers for the green (λ = 530 nm) and blue (λ = 462 nm) spectral region have been realized. Structures with and without epitaxial bottom distributed Bragg reflector have been fabricated and characterized. The samples consist of an active region containing 20 quantum wells with a cavity length varying between an optical thickness of 10 λ to 20 λ. The active material is ZnCdSSe in case of the green devices and ZnSe for the blue ones. Room temperature single mode lasing for structures with and without epitaxial bottom mirror with a maximum output power up to 5.9 W (green) and 3.3 W (blue)more » is achieved, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Panlai, E-mail: li_panlai@126.com; Wang, Zhijun, E-mail: wangzj1998@126.com; Yang, Zhiping
2014-12-15
A novel green phosphor SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} is synthesized by a high temperature solid-state method, and its luminescent property is investigated. X-ray diffraction patterns of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} indicate a similarity crystalline phase to SrZn{sub 2}(PO{sub 4}){sub 2}. SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} shows green emission under 369 nm excitation, and the prominent luminescence in green (544 nm) due to {sup 5}D{sub 4}–{sup 7}F{sub 5} transition of Tb{sup 3+}. For the 544 nm emission, excitation spectrum has several excitation band from 200 nm to 400 nm. Emission intensity of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} is influencedmore » by Tb{sup 3+} concentration, and concentration quenching effect of Tb{sup 3+} in SrZn{sub 2}(PO{sub 4}){sub 2} is also observed. With incorporating A{sup +} (A=Li, Na, and K) as compensator charge, the emission intensity of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} can be obviously enhanced. CIE color coordinates of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} locate in the green region. The results indicate this phosphor may be a potential application in white LEDs. - Graphical abstract: SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} can produce green emission under near-UV excitation, and its luminescent properties can be improved by incorporating A{sup +} (A=Li, Na, and K). - Highlights: • SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} can produce green emission under near-UV excitation. • Concentration quenching effect of Tb{sup 3+} in SrZn{sub 2}(PO{sub 4}){sub 2} is observed. • Emission intensities of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} are enhanced by codoped A{sup +} (A=Li, Na, K)« less
Sathishkumar, Palanivel; Preethi, Johnson; Vijayan, Raji; Mohd Yusoff, Abdull Rahim; Ameen, Fuad; Suresh, Sadhasivam; Balagurunathan, Ramasamy; Palvannan, Thayumanavan
2016-10-01
In this present investigation, AgNPs were green synthesised using Coriandrum sativum leaf extract. The physicochemical properties of AgNPs were characterised using UV-visible spectrophotometer, field emission scanning microscopy/energy dispersive X-ray (FESEM/EDX), Fourier transformed infrared spectroscopy (FT-IR), X-ray diffraction (XRD) and Brunauer-Emmett-Teller (BET) analysis. Further, in vitro anti-acne, anti-dandruff and anti-breast cancer efficacy of green synthesised AgNPs were assessed against Propionibacterium acnes MTCC 1951, Malassezia furfur MTCC 1374 and human breast adenocarcinoma (MCF-7) cell line, respectively. The flavonoids present in the plant extract were responsible for the AgNPs synthesis. The green synthesised nanoparticles size was found to be ≈37nm. The BET analysis result shows that the surface area of the synthesised AgNPs was found to be 33.72m(2)g(-1). The minimal inhibitory concentration (MIC) of AgNPs for acne causative agent P. acnes and dandruff causative agent M. furfur was found to be at 3.1 and 25μgmL(-1), respectively. The half maximal inhibitory concentration (IC50) value of the AgNPs for MCF-7 cells was calculated as 30.5μgmL(-1) and complete inhibition was observed at a concentration of 100μgmL(-1). Finally, our results proved that green synthesised AgNPs using C. sativum have great potential in biomedical applications such as anti-acne, anti-dandruff and anti-breast cancer treatment. Copyright © 2016. Published by Elsevier B.V.
Green leaf lettuce breeding lines with resistance to corky root, 06-831 and 06-833.
USDA-ARS?s Scientific Manuscript database
The Agricultural Research Service, United States Department of Agriculture (USDA) announces the release of two breeding lines of green leaf lettuce (Lactuca sativa L.). The lines 06-831 and 06-833 look similar to ‘Waldmann’s Green’ and related cultivars. The lines may be suitable for commercial pro...
Nanoparticle optical notch filters
NASA Astrophysics Data System (ADS)
Kasinadhuni, Pradeep Kumar
Developing novel light blocking products involves the design of a nanoparticle optical notch filter, working on the principle of localized surface plasmon resonance (LSPR). These light blocking products can be used in many applications. One such application is to naturally reduce migraine headaches and light sensitivity. Melanopsin ganglion cells present in the retina of the human eye, connect to the suprachiasmatic nucleus (SCN-the body's clock) in the brain, where they participate in the entrainment of the circadian rhythms. As the Melanopsin ganglion cells are involved in triggering the migraine headaches in photophobic patients, it is necessary to block the part of visible spectrum that activates these cells. It is observed from the action potential spectrum of the ganglion cells that they absorb light ranging from 450-500nm (blue-green part) of the visible spectrum with a λmax (peak sensitivity) of around 480nm (blue line). Currently prescribed for migraine patients is the FL-41 coating, which blocks a broad range of wavelengths, including wavelengths associated with melanopsin absorption. The nanoparticle optical notch filter is designed to block light only at 480nm, hence offering an effective prescription for the treatment of migraine headaches.
Efficient Green Emission from Wurtzite Al xIn1- xP Nanowires.
Gagliano, L; Kruijsse, M; Schefold, J D D; Belabbes, A; Verheijen, M A; Meuret, S; Koelling, S; Polman, A; Bechstedt, F; Haverkort, J E M; Bakkers, E P A M
2018-06-13
Direct band gap III-V semiconductors, emitting efficiently in the amber-green region of the visible spectrum, are still missing, causing loss in efficiency in light emitting diodes operating in this region, a phenomenon known as the "green gap". Novel geometries and crystal symmetries however show strong promise in overcoming this limit. Here we develop a novel material system, consisting of wurtzite Al x In 1- x P nanowires, which is predicted to have a direct band gap in the green region. The nanowires are grown with selective area metalorganic vapor phase epitaxy and show wurtzite crystal purity from transmission electron microscopy. We show strong light emission at room temperature between the near-infrared 875 nm (1.42 eV) and the "pure green" 555 nm (2.23 eV). We investigate the band structure of wurtzite Al x In 1- x P using time-resolved and temperature-dependent photoluminescence measurements and compare the experimental results with density functional theory simulations, obtaining excellent agreement. Our work paves the way for high-efficiency green light emitting diodes based on wurtzite III-phosphide nanowires.
Green rusts synthesis by coprecipitation of Fe II-Fe III ions and mass-balance diagram
NASA Astrophysics Data System (ADS)
Ruby, Christian; Aïssa, Rabha; Géhin, Antoine; Cortot, Jérôme; Abdelmoula, Mustapha; Génin, Jean-Marie
2006-06-01
A basic solution is progressively added to various mixed Fe II-Fe III solutions. The nature and the relative quantities of the compounds that form can be visualised in a mass-balance diagram. The formation of hydroxysulphate green rust {GR( SO42-)} is preceded by the precipitation of a sulphated ferric basic salt that transforms in a badly ordered ferric oxyhydroxide. Then octahedrally coordinated Fe II species and SO42- anions are adsorbed on the FeOOH surface and GR( SO42-) is formed at the solid/solution interface. By using the same method of preparation, other types of green rust were synthesised, e.g. hydroxycarbonate green rust {GR( CO32-)}. Like other layered double hydroxides, green rusts obey the general chemical formula [ṡ[ṡmHO]x+ with x⩽1/3. Al-substituted hydroxysulphate green rust consists of small hexagonal crystals with a lateral size ˜50 nm, which is significantly smaller than the size of the GR( SO42-) crystals (˜500 nm). To cite this article: C. Ruby et al., C. R. Geoscience 338 (2006).
NASA Astrophysics Data System (ADS)
Lintang, H. O.; Ghazalli, N. F.; Yuliati, L.
2018-04-01
We report on systematic study on vapochromic sensing of ethanol by using phosphorescent trinuclear metal pyrazolate complexes with supramolecular assembly of weak intermolecular metal-metal interactions using 4-(3,5-dimethoxybenzyl)-3,5-dimethyl pyrazole ligand (1) and group 11 metal ions (Cu(I), Ag(I), Au(I)). Upon excitation at 284, the resulting complexes showed emission bands with a peak centered at 616, 473 and 612 nm for 2(Cu), 2(Ag) and 2(Au), respectively. Chemosensor 2(Cu) showed positive response to ethanol vapors in 5 mins by blue-shifting its emission band from 616 to 555 nm and emitting bright orange to green. Otherwise 2(Au) gave shifting from its emission band centered at 612 to 587 nm with Δλ of 25 nm (41%) and color changes from red-orange to light green-orange while 2(Ag) showed quenching in its original emission intensity at 473 nm in 40% with color changes from dark green to less emissive. These results demonstrate that sensing capability of chemosensor 2(Cu) with suitable molecular design of ligand and metal ion in the complex is due to the formation of a weak intermolecular hydrogen bonding interaction of O atom at the methoxy of the benzyl ring with the OH of the vapors at the outside of the molecules.
Discipline in Organizations: A Field Study.
1982-09-01
with the job and supervisor? In this study we will also investigate discipline from an attributional perspective. Mitchell, Green , & Wood (I%1) hove...representing two major d mr nm stability and locus of control. Mitchell, Green , & Wood (1980 and Green & Mitchell (I0) preent a discussion of the kinds...Attributions to external causes prompt the leader to focus on changing the situation. In addition, Mitchell, Green , & Wood (1981) indicate that if the
Angiographic Method Using Green Porphyrinew In Primmate Eyes
Miller, Joan W.; Young, Lucy H.Y.; Gragoudas, Evangelos S.
1998-01-13
An angiographic method to observe the condition of blood vessels, including neovasculature in the eyes of living primates using green porphyrins and light at a wavelength of 550-700 nm to effect fluorescence is disclosed.
Synthesis of brushite particles in reverse microemulsions of the biosurfactant surfactin.
Maity, Jyoti Prakash; Lin, Tz-Jiun; Cheng, Henry Pai-Heng; Chen, Chien-Yen; Reddy, A Satyanarayana; Atla, Shashi B; Chang, Young-Fo; Chen, Hau-Ren; Chen, Chien-Cheng
2011-01-01
In this study the "green chemistry" use of the biosurfactant surfactin for the synthesis of calcium phosphate using the reverse microemulsion technique was demonstrated. Calcium phosphates are bioactive materials that are a major constituent of human teeth and bone tissue. A reverse microemulsion technique with surfactin was used to produce nanocrystalline brushite particles. Structural diversity (analyzed by SEM and TEM) resulted from different water to surfactin ratios (W/S; 250, 500, 1000 and 40,000). The particle sizes were found to be in the 16-200 nm range. Morphological variety was observed in the as-synthesized microemulsions, which consisted of nanospheres (~16 nm in diameter) and needle-like (8-14 nm in diameter and 80-100 nm in length) noncalcinated particles. However, the calcinated products included nanospheres (50-200 nm in diameter), oval (~300 nm in diameter) and nanorod (200-400 nm in length) particles. FTIR and XRD analysis confirmed the formation of brushite nanoparticles in the as-synthesized products, while calcium pyrophosphate was produced after calcination. These results indicate that the reverse microemulsion technique using surfactin is a green process suitable for the synthesis of nanoparticles.
2017-08-01
accessories for mounting e. Laser power supply f. TEC power supply 12. Optical filters from SEMROCK ®, THORLABS Inc., EDMUND OPTICS® a. 532-nm, laser...line filter ( SEMROCK ®) b. 550-nm, hard-coated, short-pass filter (THORLABS Inc.) c. 532-nm long-pass filter ( SEMROCK ®) d. 808-nm laser-line filter... SEMROCK ®) e. 850-nm /10-nm full width at half maximum (FWHM) bandpass filter ( SEMROCK ®) f. 980-nm bandpass filter ( SEMROCK ®) g. 976-nm laser-line
Preparation and characterization of green graphene using grape seed extract for bioapplications.
Yaragalla, Srinivasarao; Rajendran, Rajakumari; Jose, Jiya; AlMaadeed, Mariam A; Kalarikkal, Nandakumar; Thomas, Sabu
2016-08-01
The development of functionalized graphene materials concerning health and environmental aspects via green approaches is currently the most recent topic in the field of nanoscience and nanotechnology. Herein, we report the green reduction of graphene oxide (GO) to reduced graphene oxide (RGO) using grape seed extract (GSE). Structural properties of the prepared RGO were investigated using Fourier transform infrared spectroscopy (FT-IR), Raman spectroscopy, thermogravimetric analysis (TGA), UV-Visible spectroscopy and X-ray diffraction analysis. These all characterization techniques clearly revealed that the RGO has been successfully prepared. Moreover, the average thickness (4.2nm) of RGO layers was also confirmed by transmission electron microscopy (TEM). Optical properties such as band gap and photoluminescence of the synthesized RGO were evaluated. The band gap of RGO was found to be 3.84eV and it showed emission in the visible region. Efficient antimicrobial activity against Escherichia coli and Staphylococcus aureus was observed with 4μgml(-1) & 5μgml(-1) of RGO and also the cell wall damage of these strains has been proved by atomic force microscopy (AFM). The in vitro study of RGO (500μg) disclosed the effective anti-proliferative activity (88%) against HCT-116 cell lines. Copyright © 2016 Elsevier B.V. All rights reserved.
Effect of LED irradiation on the ripening and nutritional quality of postharvest banana fruit.
Huang, Jen-Yi; Xu, Fengying; Zhou, Weibiao
2018-04-24
With the ability to tailor wavelengths necessary to the photosynthetically active radiation spectrum of plant pigments, light-emitting diodes (LEDs) offer vast possibilities in horticultural lighting. The influence of LED light irradiation on major postharvest features of banana was investigated. Mature green bananas were treated daily with selected blue (464-474 nm), green (515-525 nm) and red (617-627 nm) LED lights for 8 days, and compared with non-illuminated control. The positive effect of LED lighting on the acceleration of ripening in bananas was greatest for blue, followed by red and green. Under the irradiation of LED lights, faster peel de-greening and flesh softening, and increased ethylene production and respiration rate in bananas were observed during storage. Furthermore, the accumulations of ascorbic acid, total phenols, and total sugars in banana fruit were enhanced by LED light exposure. LED light treatment can induce the ripening of bananas and improve their quality and nutrition potential. These findings might provide new chemical-free strategies to shorten the time to ripen banana after harvest by using LED light source. This article is protected by copyright. All rights reserved.
Choi, Cheol Young; Shin, Hyun Suk; Choi, Young Jae; Kim, Na Na; Lee, Jehee; Kil, Gyung-Suk
2012-11-01
The present study aimed to test starvation-induced oxidative stress in the cinnamon clownfish Amphiprion melanopus illuminated by light-emitting diodes (LEDs): red (peak at 630 nm), green (peak at 530 nm), and blue (peak at 450 nm) within a visible light. We investigated the oxidative stress induced by starvation for 12 days during illumination with 3 LED light spectra through measuring antioxidant enzyme (superoxide dismutase [SOD] and catalase [CAT]) mRNA expression and activity; CAT western blotting; and measuring lipid peroxidation [LPO]), plasma H(2)O(2), lysozyme, glucose, alanine aminotransferase (AlaAT), aspartate aminotransferase (AspAT), and melatonin levels. In green and blue lights, expression and activity of antioxidant enzyme mRNA were significantly lower than those of other light spectra, results that are in agreement with CAT protein expression level by western blot analysis. Also, in green and blue lights, plasma H(2)O(2), lysozyme, glucose, AlaAT, AspAT, and melatonin levels were significantly lower than those in other light spectra. These results indicate that green and blue LEDs inhibit oxidative stress and enhance immune function in starved cinnamon clownfish. Copyright © 2012 Elsevier Inc. All rights reserved.
The Isolation and Characterization of Human Prostate Cancer Stem Cells
2015-05-01
GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance
Photosynthetic Energy Transduction | Bioenergy | NREL
a large lighter green oval. There is a black line moving from one green bar to the other indicating blue oval labeled "FDX" and one green arrow pointing into the oval, labeled "electrons images with the third red line connecting the top of one L-shape to the bottom of the next L-shape
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Hsiao-Hsuan; Carlsson, Mats; Leenaarts, Jorrit, E-mail: mats.carlsson@astro.uio.no, E-mail: jorrit.leenaarts@astro.su.se
The C i 135.58 nm line is located in the wavelength range of NASA’s Interface Region Imaging Spectrograph ( IRIS ) small explorer mission. We study the formation and diagnostic potential of this line by means of non local-thermodynamic-equilibrium modeling, employing both 1D and 3D radiation-magnetohydrodynamic models. The C i/C ii ionization balance is strongly influenced by photoionization by Ly α emission. The emission in the C i 135.58 nm line is dominated by a recombination cascade and the line forming region is optically thick. The Doppler shift of the line correlates strongly with the vertical velocity in its linemore » forming region, which is typically located at 1.5 Mm height. With IRIS , the C i 135.58 nm line is usually observed together with the O i 135.56 nm line, and from the Doppler shift of both lines, we obtain the velocity difference between the line forming regions of the two lines. From the ratio of the C i/O i line core intensity, we can determine the distance between the C i and the O i forming layers. Combined with the velocity difference, the velocity gradient at mid-chromospheric heights can be derived. The C i/O i total intensity line ratio is correlated with the inverse of the electron density in the mid-chromosphere. We conclude that the C i 135.58 nm line is an excellent probe of the middle chromosphere by itself, and together with the O i 135.56 nm line the two lines provide even more information, which complements other powerful chromospheric diagnostics of IRIS such as the Mg ii h and k lines and the C ii lines around 133.5 nm.« less
Photoluminescence and afterglow luminescence properties of a green-emitting Na2BeGeO4:Mn2+ phosphor
NASA Astrophysics Data System (ADS)
Lu, Jie; Shen, Linjiang
2018-07-01
Recently, developing free rare-earth (RE) doped afterglow phosphors has received great attentions in the lighting field. In this work, we prepare and report a RE-free phosphor, Na2BeGeO4:Mn2+, which can simultaneously emit the green fluorescence and afterglow luminescence upon excitation at UV light. Our results reveal that the as-prepared samples crystallize in orthorhombic type with the space group of Pmn21 (31). The green emission is a broad band centered at 525 nm, corresponds to the 4T1(4G)-6A1(6S) transition of Mn2+ ions. After exposing to a 254 nm UV lamp for 10 min, the green afterglow luminescence seen with naked eyes can last more than 5 h. Together with the structural analysis and thermoluminescence (TL) spectra, the afterglow luminescence mechanism is also discussed in this work.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luck, R. E.; Andrievsky, S. M.; Korotin, S. N.
2013-07-01
Oxygen abundances in later-type stars, and intermediate-mass stars in particular, are usually determined from the [O I] line at 630.0 nm, and to a lesser extent, from the O I triplet at 615.7 nm. The near-IR triplets at 777.4 nm and 844.6 nm are strong in these stars and generally do not suffer from severe blending with other species. However, these latter two triplets suffer from strong non-local thermodynamic equilibrium (NLTE) effects and thus see limited use in abundance analyses. In this paper, we derive oxygen abundances in a large sample of Cepheids using the near-IR triplets from an NLTEmore » analysis, and compare those abundances to values derived from a local thermodynamic equilibrium (LTE) analysis of the [O I] 630.0 nm line and the O I 615.7 nm triplet as well as LTE abundances for the 777.4 nm triplet. All of these lines suffer from line strength problems making them sensitive to either measurement complications (weak lines) or to line saturation difficulties (strong lines). Upon this realization, the LTE results for the [O I] lines and the O I 615.7 nm triplet are in adequate agreement with the abundance from the NLTE analysis of the near-IR triplets.« less
NASA Astrophysics Data System (ADS)
dos Santos, J. F. M.; Terra, I. A. A.; Astrath, N. G. C.; Guimarães, F. B.; Baesso, M. L.; Nunes, L. A. O.; Catunda, T.
2015-02-01
Trivalent Tb-doped materials exhibit strong emission in the green and weak emission in the UV-blue levels. Usually, this behavior is attributed to the cross relaxation (CR) process. In this paper, the luminescence properties of Tb3+-doped low silica calcium aluminosilicate glasses are analyzed for UV (λexc = 325 nm) and visible (488 nm) excitations. Under 325 nm excitation, the intensity of green luminescence increases proportionally to Tb3+ concentration. However, the blue luminescence intensity is strongly reduced with the increase of concentration from 0.5-15.0 wt. %. In the case of 488 nm excitation, a saturation behavior of the green emission is observed at intensities two orders of magnitude smaller than expected for bleaching of the ground state population. Using a rate equation model, we showed that this behavior can be explained by an excited state absorption cross section two orders of magnitude larger than the ground state absorption. The blue emission is much weaker than expected from our rate equations (325 nm and 488 nm excitation). We concluded that only the CR process cannot explain the overall feature of measured luminescence quenching in the wide range of Tb3+ concentrations. Cooperative upconversion from a pair of excited ions (5D3:5D3 or 5D3:5D4) and other mechanisms involving upper lying states (4f5d, charge transfer, host matrix, defects, etc.) may play a significant role.
SrMoO4:Er3+-Yb3+ upconverting phosphor for photonic and forensic applications
NASA Astrophysics Data System (ADS)
Soni, Abhishek Kumar; Rai, Vineet Kumar
2016-08-01
The Er3+-Yb3+ codoped strontium molybdate (SrMoO4) phosphors have been synthesized via chemical co-precipitation method by adding ammonium hydroxide as a base reagent. The phase, crystal structure and formation of spindle-like particles present in the prepared phosphors have been recognized by using the X-ray powder diffraction (XRPD) and Field emission scanning electron microscopy (FE-SEM) techniques. The Fourier transform infrared (FTIR) spectroscopy of the developed phosphors has been analyzed to mark the different functional groups present in synthesized phosphors. The multicolour upconversion emissions observed upon excitation with 980 nm and 808 nm laser diode have been explained on the basis of dopants ions concentration, pump power dependence, energy level structure and decay curve analysis. The colour co-ordinate study confirmed that the codoped phosphor emits non-tunable green colour when excited with the 980 nm laser diode, whereas it shows the colour tunability from yellow to green region upon excitation with the 808 nm laser diode. The applicability of non-tunable green colour emission has been demonstrated in the security ink and latent finger print detection. This shows the utility of the developed phosphors in the photonic and forensic applications.
NASA Astrophysics Data System (ADS)
Wang, Yu; Akiyama, Hidefumi; Terakado, Kanako; Nakatsu, Toru
2013-08-01
Firefly bioluminescence has attracted great interest because of its high quantum yield and intriguing modifiable colours. Modifications to the structure of the enzyme luciferase can change the emission colour of firefly bioluminescence, and the mechanism of the colour change has been intensively studied by biochemists, structural biologists, optical physicists, and quantum-chemistry theorists. Here, we report on the quantitative spectra of firefly bioluminescence catalysed by wild-type and four site-directed mutant luciferases. While the mutation caused different emission spectra, the spectra differed only in the intensity of the green component (λmax ~ 560 nm). In contrast, the orange (λmax ~ 610 nm) and red (λmax ~ 650 nm) components present in all the spectra were almost unaffected by the modifications to the luciferases and changes in pH. Our results reveal that the intensity of the green component is the unique factor that is influenced by the luciferase structure and other reaction conditions.
Sharma, Bhavana; Deswal, Renu
2018-04-04
A facile one-pot green synthesis of gold nanoparticles (AuNPs) with different geometries was achieved using an underutilized Himalayan bioresource Hippophae rhamnoides. Aqueous leaf (LE) and berry extracts (BE) showed rapid synthesis of monodispersed spherical LEAuNPs (27 ± 3.2 nm) and anisotropic BEAuNPs (55 ± 4.5 nm) within 2 and 15 min, respectively. The Fourier-transform infrared (FTIR) spectroscopy showed involvement of polyphenolics/flavonoids in AuNPs reduction. LE AuNPs (IC 50 49 µg) exhibited higher antioxidant potential than BE AuNPs (IC 50 57 µg). Both BE nanotriangles and LE nanospheres exhibited cytotoxicity against Jurkat cell lines. These nanocatalysts also exhibited effective (80-99%) reductive degradation of structurally different carcinogenic azo dyes. Kinetic studies revealed that BE nanotriangles exhibited higher catalytic efficiency (14-67%) than LE nanospheres suggesting shape-dependent regulation of biological activities. The gas chromatography-mass spectrometry (GC-MS) analysis confirmed conversion of toxic methyl orange dye to non-toxic intermediates. Probable degradation mechanism involving adsorption and catalytic reduction of azo bonds was proposed. The present synthesis protocol provided a facile and energy saving procedure for rapid synthesis of highly stable nanoparticles with significant antioxidant and anticancer potential. This is the first report of H. rhamnoides-mediated green synthesis of multipurpose AuNPs as antioxidant, anticancer and nanocatalytic agents for treatment of dye contaminated waste water and future therapeutic applications.
Yang, T T; Kain, S R; Kitts, P; Kondepudi, A; Yang, M M; Youvan, D C
1996-01-01
The green fluorescent protein (GFP) from the jellyfish, Aequorea victoria, has become a versatile reporter for monitoring gene expression and protein localization in a variety of cells and organisms. GFP emits bright green light (lambda max = 510 nm) when excited with ultraviolet (UV) or blue light (lambda max = 395 nm, minor peak at 470 nm). The chromophore in GFP is intrinsic to the primary structure of the protein, and fluorescence from GFP does not require additional gene products, substrates or other factors. GFP fluorescence is stable, species-independent and can be monitored noninvasively using the techniques of fluorescence microscopy and flow cytometry [Chalfie et al., Science 263 (1994) 802-805; Stearns, Curr. Biol. 5 (1995) 262-264]. The protein appears to undergo an autocatalytic reaction to create the fluorophore [Heim et al., Proc. Natl. Acad. Sci. USA 91 (1994) 12501-12504] in a process involving cyclization of a Tyr66 aa residue. Recently [Delagrave et al., Bio/Technology 13 (1995) 151-154], a combinatorial mutagenic strategy was targeted at aa 64 through 69, which spans the chromophore of A. victoria GFP, yielding a number of different mutants with red-shifted fluorescence excitation spectra. One of these, RSGFP4, retains the characteristic green emission spectra (lambda max = 505 nm), but has a single excitation peak (lambda max = 490 nm). The fluorescence properties of RSGFP4 are similar to those of another naturally occurring GFP from the sea pansy, Renilla reniformis [Ward and Cormier, Photobiochem. Photobiol. 27 (1978) 389-396]. In the present study, we demonstrate by fluorescence microscopy that selective excitation of A. victoria GFP and RSGFP4 allows for spectral separation of each fluorescent signal, and provides the means to image these signals independently in a mixed population of bacteria or mammalian cells.
Response of adult mosquitoes to light-emitting diodes placed in resting boxes and in the field.
Bentley, Michael T; Kaufman, Phillip E; Kline, Daniel L; Hogsette, Jerome A
2009-09-01
The response of adult mosquitoes to 4 light-emitting diode (LED) wavelengths was evaluated using diode-equipped sticky cards (DESCs) and diode-equipped resting boxes at 2 sites in north central Florida. Wavelengths evaluated were blue (470 nm), green (502 nm), red (660 nm), and infrared (IR) (860 nm). When trapping with DESCs, 15 mosquito species from 7 genera (Aedes, Anopheles, Coquillettidia, Culex, Mansonia, Psorophora, and Uranotaenia) were captured. Overall, approximately 43.8% of all mosquitoes were trapped on DESCs fitted with green LEDs. Significantly more females of Aedes infirmatus, Aedes vexans, and Culex nigripalpus were captured on DESCs fitted with blue LEDs compared with red or IR LEDs. DESCs with blue LEDs captured significantly more Culex erraticus females than those with IR LEDs. Using resting boxes, 12 species from 5 genera (Anopheles, Coquillettidia, Culex, Mansonia, and Uranotaenia) were collected. Resting boxes without LEDs captured 1,585 mosquitoes (22.2% of total). The fewest number of mosquitoes (16.7%) were collected from boxes affixed with the blue LEDs. Significantly more Anopheles quadrimaculatus females were aspirated from resting boxes fitted with red and IR LEDs than from those with blue or green LEDs, or from the unlit control. Blood-fed mosquitoes were recovered in highest numbers from unlit resting boxes, followed by resting boxes fitted with green, IR, and blue LEDs. Culex erraticus accounted for the majority of blood-fed mosquitoes followed by Coquillettidia perturbans. No blood-fed mosquitoes were recovered from resting boxes fitted with red LEDs.
Protesescu, Loredana; Yakunin, Sergii; Bodnarchuk, Maryna I; Krieg, Franziska; Caputo, Riccarda; Hendon, Christopher H; Yang, Ruo Xi; Walsh, Aron; Kovalenko, Maksym V
2015-06-10
Metal halides perovskites, such as hybrid organic-inorganic CH3NH3PbI3, are newcomer optoelectronic materials that have attracted enormous attention as solution-deposited absorbing layers in solar cells with power conversion efficiencies reaching 20%. Herein we demonstrate a new avenue for halide perovskites by designing highly luminescent perovskite-based colloidal quantum dot materials. We have synthesized monodisperse colloidal nanocubes (4-15 nm edge lengths) of fully inorganic cesium lead halide perovskites (CsPbX3, X = Cl, Br, and I or mixed halide systems Cl/Br and Br/I) using inexpensive commercial precursors. Through compositional modulations and quantum size-effects, the bandgap energies and emission spectra are readily tunable over the entire visible spectral region of 410-700 nm. The photoluminescence of CsPbX3 nanocrystals is characterized by narrow emission line-widths of 12-42 nm, wide color gamut covering up to 140% of the NTSC color standard, high quantum yields of up to 90%, and radiative lifetimes in the range of 1-29 ns. The compelling combination of enhanced optical properties and chemical robustness makes CsPbX3 nanocrystals appealing for optoelectronic applications, particularly for blue and green spectral regions (410-530 nm), where typical metal chalcogenide-based quantum dots suffer from photodegradation.
Eu/Tb codoped spindle-shaped fluorinated hydroxyapatite nanoparticles for dual-color cell imaging
NASA Astrophysics Data System (ADS)
Ma, Baojin; Zhang, Shan; Qiu, Jichuan; Li, Jianhua; Sang, Yuanhua; Xia, Haibing; Jiang, Huaidong; Claverie, Jerome; Liu, Hong
2016-06-01
Lanthanide doped fluorinated hydroxyapatite (FAp) nanoparticles are promising cell imaging nanomaterials but they are excited at wavelengths which do not match the light sources usually found in a commercial confocal laser scanning microscope (CLSM). In this work, we have successfully prepared spindle-shaped Eu/Tb codoped FAp nanoparticles by a hydrothermal method. Compared with single Eu doped FAp, Eu/Tb codoped FAp can be excited by a 488 nm laser, and exhibit both green and red light emission. By changing the amounts of Eu and Tb peaks, the emission in the green region (500-580 nm) can be decreased to the benefit of the emission in the red region (580-720 nm), thus reaching a balanced dual color emission. Using MC3T3-E1 cells co-cultured with Eu/Tb codoped FAp nanoparticles, it is observed that the nanoparticles are cytocompatible even at a concentration as high as 800 μg ml-1. The Eu/Tb codoped FAp nanoparticles are located in the cytoplasm and can be monitored by dual color--green and red imaging with a single excitation light at 488 nm. At a concentration of 200 μg ml-1, the cytoplasm is saturated in 8 hours, and Eu/Tb codoped FAp nanoparticles retain their fluorescence for at least 3 days. The cytocompatible Eu/Tb codoped FAp nanoparticles with unique dual color emission will be of great use for cell and tissue imaging.Lanthanide doped fluorinated hydroxyapatite (FAp) nanoparticles are promising cell imaging nanomaterials but they are excited at wavelengths which do not match the light sources usually found in a commercial confocal laser scanning microscope (CLSM). In this work, we have successfully prepared spindle-shaped Eu/Tb codoped FAp nanoparticles by a hydrothermal method. Compared with single Eu doped FAp, Eu/Tb codoped FAp can be excited by a 488 nm laser, and exhibit both green and red light emission. By changing the amounts of Eu and Tb peaks, the emission in the green region (500-580 nm) can be decreased to the benefit of the emission in the red region (580-720 nm), thus reaching a balanced dual color emission. Using MC3T3-E1 cells co-cultured with Eu/Tb codoped FAp nanoparticles, it is observed that the nanoparticles are cytocompatible even at a concentration as high as 800 μg ml-1. The Eu/Tb codoped FAp nanoparticles are located in the cytoplasm and can be monitored by dual color--green and red imaging with a single excitation light at 488 nm. At a concentration of 200 μg ml-1, the cytoplasm is saturated in 8 hours, and Eu/Tb codoped FAp nanoparticles retain their fluorescence for at least 3 days. The cytocompatible Eu/Tb codoped FAp nanoparticles with unique dual color emission will be of great use for cell and tissue imaging. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02137a
ATOTA-a very promising green fluorophore
NASA Astrophysics Data System (ADS)
Doan, Hung The
Despite the fact that fluorescence community nowadays has invested in developing near-infrared probes, green fluorescence dyes like fluorescein and substitutes are still among the most widely used fluorophores for labeling in cellular imaging and biomedical research. Trioxatriangulenium dye ATOTA + is a very promising green fluorophore with high extinction coefficient and outstanding fluorescence quantum yield. This study focuses on characterizing ATOTA+'s fundamental spectroscopic properties, including fluorescence and orientation of the transition moments. ATOTA's aggregation in aqueous solution and lipid bilayer membrane are also investigated. ATOTA+ has absorption maxima between 470 nm and 476 nm and emission maxima between 496 nm and 511 nm depending on the solvent. The molar extinction coefficient varies from 135,000 mol-1cm-1 in nonpolar dichloromethane to above 90,000 mol-1cm-1 in polar solvents such as methanol. The quantum yield of ATOTA+ is close to 1 in nonpolar DCM and decreases to 0.44 in polar DMF. ATOTA+'s fluorescence lifetimes vary between 3.25 ns in aprotic low polarity triacetin to 1.66 ns in polar DMF. Furthermore, both radiative and non-radiative rates are affected by solvent polarity. ATOTA+ has very low water solubility due to the presence of 6 diethyl substitutions, and forms H-aggregates with a blue-shifted absorption maxima around 450 nm and red-shifted emission maxima of 580 nm respectively with fluorescence lifetime above 20 ns. The excitation anisotropy approaches 0.35 at red edge of the absorption spectrum and shape of polarization spectrum suggests the presence of overlapping transition moments in a S0-S1 band which is confirmed by linear dichroism in stretched PVA film. In DMPC lipid vesicles, ATOTA + forms a tight ion pair with a counter anion and localizes in the hydrocarbon interior. Overall we conclude that ATOTA+ will be a highly useful and superior member of the green fluorophore family.
Viviani, V R; Amaral, D T; Neves, D R; Simões, A; Arnoldi, F G C
2013-01-08
Beetle luciferases emit different bioluminescence colors from green to red; however, no clear relationship between the identity of the luciferin binding site residues and bioluminescence colors was found in different luciferases, and it is unclear whether critical interactions affecting emission spectra occur on the thiazolyl or on the benzothiazolyl sides of the luciferin binding site. Through homology modeling and site-directed mutagenesis using our multicolor set of beetle luciferases (Pyrearinus termitilluminans larval click beetle, Pte, λ(max) = 534 nm; Phrixothrix hirtus railroad worm red emitting, PxRE, λ(max) = 623 nm; and Macrolampis sp2 firefly, Mac, λ(max) = 564 nm), we show that the residues C/T311 (S314) play an important role in bioluminescence color determination. Modeling studies indicate that the main-chain carbonyls of these residues are close to both oxyluciferin phenolate and AMP, whereas the side chains pack against second-shell residues. The C311(S314)A mutation considerably red shifts the spectra of the green-yellow-emitting luciferases (Pte λ(max) = 534 to 590 nm; Mac λ(max) = 564 to 583/613 nm) and affects the K(M) values for luciferin and ATP, but not the spectrum of the red-emitting luciferase. On the other hand, whereas the exchange between C/T311 (S314) caused smaller effects on the emission spectra of green-yellow-emitting luciferases, the C311T substitution (naturally found in green-emitting railroad worm luciferases) resulted in the largest reported blue shift in P. hirtus red-emitting luciferase (λ(max) = 623 to 606 nm). Altogether, these results indicate that the stability of residues C/T311 (S314) and the size of the cavity around oxyluciferin phenolate affect bioluminescence colors and suggest, for the first time, the occurrence of a critical interaction between main-chain carbonyls of position 311 (314) residues and oxyluciferin phenolate.
USDA-ARS?s Scientific Manuscript database
The Virescent Yellow leaf cotton line Seed Accession 30 (SA30) was crossed with four modern parental lines (DP5690, DES119, SG747 and MD51ne) to develop four sets of near isogenic lines (NILs) segregating for green and yellow leaves. Comparisons of these lines were made in the field in a two year re...
Temperature Dependence of Molecular Line Strengths and Fei 1565 nm Zeeman Splitting in a Sunspot
NASA Astrophysics Data System (ADS)
Penn, M. J.; Walton, S.; Chapman, G.; Ceja, J.; Plick, W.
2003-03-01
Spectroscopic observations at 1565 nm were made in the eastern half of the main umbra of NOAA 9885 on 1 April 2002 using the National Solar Observatory McMath-Pierce Telescope at Kitt Peak with a tip-tilt image stabilization system and the California State University Northridge-National Solar Observatory infrared camera. The line depth of the OH blend at 1565.1 nm varies with the observed continuum temperature; the variation fits previous observations except that the continuum temperature is lower by 600 K. The equivalent width of the OH absorption line at 1565.2 nm shows a temperature dependence similar to previously published umbral molecular observations at 640 nm. A simple model of expected OH abundance based upon an ionization analogy to molecular dissociation is produced and agrees well with the temperature variation of the line equivalent width. A CN absorption line at 1564.6 nm shows a very different temperature dependence, likely due to complicated formation and destruction processes. Nonetheless a numerical fit of the temperature variation of the CN equivalent width is presented. Finally a comparison of the Zeeman splitting of the Fei 1564.8 nm line with the sunspot temperature derived from the continuum intensity shows an umbra somewhat cooler for a given magnetic field strength than previous comparisons using this infrared 1564.8 nm line, but consistent with these previous infrared measurements the umbra is hotter for a given magnetic field strength than magnetic and temperature measurements at 630.2 nm would suggest. Differences between the 630.2 nm and 1564.8 nm umbral temperature and magnetic field relations are explained with the different heights of formation of the lines and continua at these wavelengths.
NASA Astrophysics Data System (ADS)
Seeger, Tassia S.; Machado, Eduarda Q.; Flores, Erico M. M.; Mello, Paola A.; Duarte, Fabio A.
2018-03-01
In this study, Na and K were determined in desalted crude oil by direct sampling graphite furnace atomic absorption spectrometry (DS-GF AAS), with the use of a Zeeman-effect background correction system with variable magnetic field. The analysis was performed in low and high sensitivity conditions. Sodium determination was performed in two low-sensitivity conditions: 1) main absorption line (589.0 nm), gas stop flow during the atomization step and 3-field dynamic mode (0.6-0.8 T); and 2) secondary absorption line (330.3 nm), gas stop flow during the atomization and 2-field mode (0.8 T). In K determination, some parameters, such as high-sensitivity mode, main absorption line (766.5 nm), gas stop flow during the atomization and 2-field mode (0.8 T), were used. Suitability of chemical modifiers, such as Pd and W-Ir was also evaluated. The heating program for Na and K was based on the pyrolysis and atomization curves. Calibration was performed by aqueous standards. Accuracy was evaluated by the analysis of Green Petroleum Coke (SRM NIST 2718) and Trace Elements in Fuel Oil (SRM NIST 1634c). Recovery tests were also performed and results were compared with those obtained by GF AAS after crude oil digestion by microwave-assisted digestion. The characteristic mass of Na was 17.1 pg and 0.46 ng in conditions 1 and 2, respectively, while the one of K was 1.4 pg. Limits of detection and quantification by DS-GF AAS were 30 and 40 ng g-1 for Na and 3.2 and 4.2 ng g-1 for K, respectively. Sodium and K were determined in three crude oil samples with API density ranging from 20.9 to 28.0. Sodium and K concentration ranged from 1.5 to 73 μg g-1 and from 23 to 522 ng g-1, respectively.
NASA Astrophysics Data System (ADS)
Caffau, E.; Ludwig, H.-G.; Malherbe, J.-M.; Bonifacio, P.; Steffen, M.; Monaco, L.
2013-06-01
Context. In the Sun, the two forbidden [O i] lines at 630 and 636 nm were previously found to provide discrepant oxygen abundances. Aims: We investigate whether this discrepancy is peculiar to the Sun or whether it is also observed in other stars. Methods: We make use of high-resolution, high signal-to-noise ratio spectra of four dwarf to turn-off stars, five giant stars, and one sub-giant star observed with THEMIS, HARPS, and UVES to investigate the coherence of the two lines. Results: The two lines provide oxygen abundances that are consistent, within observational errors, in all the giant stars examined by us. On the other hand, for the two dwarf stars for which a measurement was possible, for Procyon, and for the sub-giant star Capella, the 636 nm line provides systematically higher oxygen abundances, as already seen for the Sun. Conclusions: The only two possible reasons for the discrepancy are a serious error in the oscillator strength of the Ni i line blending the 630 nm line or the presence of an unknown blend in the 636 nm line, which makes the feature stronger. The CN lines blending the 636 nm line cannot be responsible for the discrepancy. The Ca i autoionisation line, on the red wing of which the 636 nm line is formed, is not well modelled by our synthetic spectra. However, a better reproduction of this line would result in even higher abundances from the 636 nm, thus increasing the discrepancy. Based on observations collected at ESO Paranal Observatory, Programme 182.D-5053(A).
Han, Pei-pei; Sun, Ying; Jia, Shi-ru; Zhong, Cheng; Tan, Zhi-lei
2014-05-25
The influences of different wavelengths of light (red 660nm, yellow 590nm, green 520nm, blue 460nm, purple 400nm) and white light on extracellular polysaccharide (EPS) and capsular polysaccharide (CPS) production by Nostoc flagelliforme in liquid culture were demonstrated in this study. The results showed that, compared with white light, red and blue lights significantly increased both EPS and CPS production while yellow light reduced their production; purple and green lights stimulated EPS production but inhibited CPS formation. Nine constituent monosaccharides and one uronic acid were detected in both EPS and CPS, and their ratios showed significant differences among treatment with different light wavelengths. However, the advanced structure of EPS and CPS from various light conditions did not present obvious difference through Fourier transform infrared spectroscopy and X-ray diffraction characterization. These findings establish a basis for development of high-yielding polysaccharide production process and understanding their regulation. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
C, Rajkumar; Srivastava, Rajneesh K.
2018-05-01
Zinc oxide (ZnO) nanoparticle has been synthesized by cost effective Co-precipitation method and studied its photo-response activity. The synthesized ZnO nanomaterial was characterized by using various analytical techniques such as x-ray diffraction (XRD), UV–visible spectroscopy, FTIR spectroscopy, photoluminescence (PL) spectroscopy, and Scanning Electron Microscopy (SEM). From the XRD results, it is confirmed that synthesized ZnO nanomaterial possess hexagonal wurtzite phase structure with an average crystallite size of ∼16–17 nm. The UV-Visible absorption spectrum shows that it has blue shift compared to their bulk counterparts. Photoluminescence spectra of ZnO nanoparticles have a strong violet band at 423 nm and three weak bands at 485 nm (blue), 506 nm (green), and 529 nm (green). The presence of hydroxyl group was confirmed by FTIR. The photo-response analysis was studied by the time-dependent rise and decay photocurrent of ZnO nanoparticle was tested in the air as well as vacuum medium.
Yokoyama, Shozo; Takenaka, Naomi
2005-04-01
Red-green color vision is strongly suspected to enhance the survival of its possessors. Despite being red-green color blind, however, many species have successfully competed in nature, which brings into question the evolutionary advantage of achieving red-green color vision. Here, we propose a new method of identifying positive selection at individual amino acid sites with the premise that if positive Darwinian selection has driven the evolution of the protein under consideration, then it should be found mostly at the branches in the phylogenetic tree where its function had changed. The statistical and molecular methods have been applied to 29 visual pigments with the wavelengths of maximal absorption at approximately 510-540 nm (green- or middle wavelength-sensitive [MWS] pigments) and at approximately 560 nm (red- or long wavelength-sensitive [LWS] pigments), which are sampled from a diverse range of vertebrate species. The results show that the MWS pigments are positively selected through amino acid replacements S180A, Y277F, and T285A and that the LWS pigments have been subjected to strong evolutionary conservation. The fact that these positively selected M/LWS pigments are found not only in animals with red-green color vision but also in those with red-green color blindness strongly suggests that both red-green color vision and color blindness have undergone adaptive evolution independently in different species.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Jin Ah; Kim, Na Na; Choi, Young Jae
We investigated the effect of light spectra on retinal damage and stress in goldfish using green (530 nm) and red (620 nm) light emitting diodes (LEDs) at three intensities each (0.5, 1.0, and 1.5 W/m{sup 2}). We measured the change in the levels of plasma cortisol and H{sub 2}O{sub 2} and expression and levels of caspase-3. The apoptotic response of green and red LED spectra was assessed using the terminal transferase dUTP nick end labeling (TUNEL) assay. Stress indicator (cortisol and H{sub 2}O{sub 2}) and apoptosis-related genes (caspase-3) decreased in green light, but increased in red light with higher light intensities over time.more » The TUNEL assay revealed that more apoptotic cells were detected in outer nuclear layers after exposure to red LED over time with the increase in light intensity, than the other spectra. These results indicate that green light efficiently reduces retinal damage and stress, whereas red light induces it. Therefore, red light-induced retina damage may induce apoptosis in goldfish retina. -- Highlights: •Green light efficiently reduces retinal damage and stress. •Green spectra reduce caspase production and apoptosis. •Red light-induced retina damage may induce apoptosis in goldfish retina. •The retina of goldfish recognizes green spectra as a stable environment.« less
Fluorescent sensing with Fresnel microlenses for optofluidic systems
NASA Astrophysics Data System (ADS)
Siudzińska, Anna; Miszczuk, Andrzej; Marczak, Jacek; Komorowska, Katarzyna
2017-05-01
The concept of fluorescent sensing in a microchannel equipped with focusing light Fresnel lenses has been demonstrated. The concept employs a line or array of Fresnel lenses generating a line or array of focused light spots within a microfluidic channel, to increase the sensitivity of fluorescent signal detection in the system. We have presented efficient methods of master mold fabrication based on the lithography method and focused ion beam milling. The flexible microchannel was fabricated by an imprint process with new thiolene-epoxy resin with a good ability to replicate even submicron-size features. For final imprinted lenses, the measured background to peak signal level shows more than nine times the increase in brightness at the center of the focal spot for the green part of the spectrum (532 nm). The effectiveness of the microlenses in fluorescent-marked Escherichia coli bacteria was confirmed in a basic fluoroscope experiment, showing the increase of the sensitivity of the detection by the order of magnitude.
Improving the performance of methylene blue sensitized photopolymer by doping with nickel ion
NASA Astrophysics Data System (ADS)
Aswathy, G.; Rajesh, C. S.; Sreekumar, K.; Joseph, R.; Kartha, C. Sudha
2016-05-01
Holographic performance of an economically cheap metal ion doped photopolymer material is presented. We investigated the effect of incorporation of nickel ion into the methylene blue sensitized poly (vinyl alcohol)/acrylamide (MBPVA/AA) photopolymer system. The composition and preliminary characterization of the developed photopolymer material is reported. The presence of nickel ion improves the diffraction efficiency, stability of the material and it operates in a wide range of spatial frequencies (550-2000 lines/mm) at exposure energy of 100 mJ/cm2. When nickel ion concentration was 0.01 mM, maximum diffraction efficiency of 84% at exposure energy of 100 mJ/cm2 with spatial frequency 1335 lines/mm could be achieved for gratings recorded using wavelength of 632.8 nm. The material showed panchromaticity with more than 70% diffraction efficiency in both blue and green regions. Effects of humidity and temperature on the stored gratings were studied by keeping films in different environmental conditions. Suitability of recording large area holograms was also explored.
MU06-857, a Green Leaf Lettuce Breeding Line with Resistance to Leafminer and Lettuce Mosaic Virus.
USDA-ARS?s Scientific Manuscript database
The Agricultural Research Service, United States Department of Agriculture announces the release of a breeding line of green leaf lettuce (Lactuca sativa L.) with resistance to leafminers (Liriomyza langei Frick) and lettuce mosaic. The line MU06-857 is similar to cultivar ‘Lolla Rossa’ (‘Lollo Ros...
Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J
2008-05-01
We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.
[Identification of green tea brand based on hyperspectra imaging technology].
Zhang, Hai-Liang; Liu, Xiao-Li; Zhu, Feng-Le; He, Yong
2014-05-01
Hyperspectral imaging technology was developed to identify different brand famous green tea based on PCA information and image information fusion. First 512 spectral images of six brands of famous green tea in the 380 approximately 1 023 nm wavelength range were collected and principal component analysis (PCA) was performed with the goal of selecting two characteristic bands (545 and 611 nm) that could potentially be used for classification system. Then, 12 gray level co-occurrence matrix (GLCM) features (i. e., mean, covariance, homogeneity, energy, contrast, correlation, entropy, inverse gap, contrast, difference from the second-order and autocorrelation) based on the statistical moment were extracted from each characteristic band image. Finally, integration of the 12 texture features and three PCA spectral characteristics for each green tea sample were extracted as the input of LS-SVM. Experimental results showed that discriminating rate was 100% in the prediction set. The receiver operating characteristic curve (ROC) assessment methods were used to evaluate the LS-SVM classification algorithm. Overall results sufficiently demonstrate that hyperspectral imaging technology can be used to perform classification of green tea.
Human-Friendly Light-Emitting Diode Source Stimulates Broiler Growth.
Pan, Jinming; Yang, Yefeng; Yang, Bo; Dai, Wenhua; Yu, Yonghua
2015-01-01
Previous study and our laboratory have reported that short-wavelength (blue and green) light and combination stimulate broiler growth. However, short-wavelength stimuli could have negative effects on poultry husbandry workers. The present study was conducted to evaluate the effects of human-friendly yellow LED light, which is acceptable to humans and close to green light, on broiler growth. We also aimed to investigate the potential quantitative relationship between the wavelengths of light used for artificial illumination and growth parameters in broilers. After hatching, 360 female chicks ("Meihuang" were evenly divided into six lighting treatment groups: white LED strips (400-700 nm, WL); red LED strips (620 nm, RL); yellow LED strips (580 nm, YL); green LED strips (514 nm, GL); blue LED strips (455 nm, BL); and fluorescent strips (400-700 nm, FL). From 30 to 72 days of age, broilers reared under YL and GL were heavier than broilers treated with FL (P < 0.05). Broilers reared under YL obtained the similar growth parameters with the broilers reared under GL and BL (P > 0.05). Moreover, YL significantly improved feeding efficiency when compared with GL and BL at 45 and 60 days of age (P < 0.05). In addition, we found an age-dependent effect of light spectra on broiler growth and a quantitative relationship between LED light spectra (455 to 620 nm) and the live body weights of broilers. The wavelength of light (455 to 620 nm) was found to be negatively related (R2 = 0.876) to live body weight at an early stage of development, whereas the wavelength of light (455 to 620 nm) was found to be positively correlated with live body weight (R2 = 0.925) in older chickens. Our results demonstrated that human-friendly yellow LED light (YL), which is friendly to the human, can be applied to the broilers production.
Human-Friendly Light-Emitting Diode Source Stimulates Broiler Growth
Yang, Bo; Dai, Wenhua; Yu, Yonghua
2015-01-01
Previous study and our laboratory have reported that short-wavelength (blue and green) light and combination stimulate broiler growth. However, short-wavelength stimuli could have negative effects on poultry husbandry workers. The present study was conducted to evaluate the effects of human-friendly yellow LED light, which is acceptable to humans and close to green light, on broiler growth. We also aimed to investigate the potential quantitative relationship between the wavelengths of light used for artificial illumination and growth parameters in broilers. After hatching, 360 female chicks (“Meihuang” were evenly divided into six lighting treatment groups: white LED strips (400–700 nm, WL); red LED strips (620 nm, RL); yellow LED strips (580 nm, YL); green LED strips (514 nm, GL); blue LED strips (455 nm, BL); and fluorescent strips (400–700 nm, FL). From 30 to 72 days of age, broilers reared under YL and GL were heavier than broilers treated with FL (P < 0.05). Broilers reared under YL obtained the similar growth parameters with the broilers reared under GL and BL (P > 0.05). Moreover, YL significantly improved feeding efficiency when compared with GL and BL at 45 and 60 days of age (P < 0.05). In addition, we found an age-dependent effect of light spectra on broiler growth and a quantitative relationship between LED light spectra (455 to 620 nm) and the live body weights of broilers. The wavelength of light (455 to 620 nm) was found to be negatively related (R 2 = 0.876) to live body weight at an early stage of development, whereas the wavelength of light (455 to 620 nm) was found to be positively correlated with live body weight (R 2 = 0.925) in older chickens. Our results demonstrated that human-friendly yellow LED light (YL), which is friendly to the human, can be applied to the broilers production. PMID:26270988
NASA Astrophysics Data System (ADS)
Ansari, Ghizal F.; Mahajan, S. K.
2012-02-01
The bright white upconversion emission ( tri-colour UC) is generated in Er/Tm/Yb tri -doped oxy-fluoride lithium tungsten tellurite (TWLOF)glass ceramics containing crystalline phase LiYbF4 under the excitation of 980nm laser diode. The most appropriate combination of rare-earth ions (2mol% YbF3 1mol% ErF3 and 1mol%TmF3 )of glass ceramic sample has been determined to tune the primary colour (RGB and generate white light emission. By varying the pump power, intense and weak blue (487nm, 437nm), green (525nm and 545nm) and red (662nm) emission are simultaneously observed at room temperature. The dependence of upconversion emission intensity suggest that a theephoton process is responsible for the blue emission of Tm3+ ions and red emission due to both Tm3+ and Er3+ ions , while green emission originated from two photon processes in Er3+ ions. Also tri colour upconvesion and energy transfer in this glass ceramics sample were studied under 808nm laser diode excitation. The Upconversion mechanisms and Tm3+ ions plays role of both emitter and activator (transfer energy to Er) were discussed.
Synthesis of Brushite Particles in Reverse Microemulsions of the Biosurfactant Surfactin
Maity, Jyoti Prakash; Lin, Tz-Jiun; Cheng, Henry Pai-Heng; Chen, Chien-Yen; Reddy, A. Satyanarayana; Atla, Shashi B.; Chang, Young-Fo; Chen, Hau-Ren; Chen, Chien-Cheng
2011-01-01
In this study the “green chemistry” use of the biosurfactant surfactin for the synthesis of calcium phosphate using the reverse microemulsion technique was demonstrated. Calcium phosphates are bioactive materials that are a major constituent of human teeth and bone tissue. A reverse microemulsion technique with surfactin was used to produce nanocrystalline brushite particles. Structural diversity (analyzed by SEM and TEM) resulted from different water to surfactin ratios (W/S; 250, 500, 1000 and 40,000). The particle sizes were found to be in the 16–200 nm range. Morphological variety was observed in the as-synthesized microemulsions, which consisted of nanospheres (~16 nm in diameter) and needle-like (8–14 nm in diameter and 80–100 nm in length) noncalcinated particles. However, the calcinated products included nanospheres (50–200 nm in diameter), oval (~300 nm in diameter) and nanorod (200–400 nm in length) particles. FTIR and XRD analysis confirmed the formation of brushite nanoparticles in the as-synthesized products, while calcium pyrophosphate was produced after calcination. These results indicate that the reverse microemulsion technique using surfactin is a green process suitable for the synthesis of nanoparticles. PMID:21747709
Synthesis, energy transfer and tunable emission properties of SrSb2O6:Eu3 +, Bi3 + phosphor
NASA Astrophysics Data System (ADS)
Cao, Renping; Fu, Ting; Peng, Dedong; Cao, Chunyan; Ruan, Wen; Yu, Xiaoguang
2016-12-01
Host SrSb2O6, SrSb2O6:Bi3 +, SrSb2O6:Eu3 +, and SrSb2O6:Eu3 +, Bi3 + phosphors are synthesized by solid state reaction method in air. Host SrSb2O6 with excitation 254 nm shows weak green-yellow emission in the range of 320-780 nm due to Sb5 + → O2- transition. SrSb2O6:Bi3 + phosphor with excitation 365 nm emits green light within the range 400-650 nm owing to the 3P1 → 1S0 transition of Bi3 + ion. SrSb2O6:Eu3 + phosphor with excitation 254 nm exhibits a systematically varied hue from green to orange-red light by increasing Eu3 + concentration from 0 to 7 mol%, and that with excitation 394 nm only shows orange-red light. The optimal Eu3 + concentration is 4 mol% in SrSb2O6:Eu3 + phosphor. SrSb2O6:Eu3 +, Bi3 + phosphor with excitation 254 and 394 nm emits orange-red light. Emission intensity of SrSb2O6:Eu3 + phosphor may be enhanced > 2 times by co-doping Bi3 + ion because of the fluxing agent and energy transfer roles of Bi3 + ion in SrSb2O6:Eu3 +, Bi3 + phosphor. The luminous mechanism of SrSb2O6:Eu3 +, Bi3 + phosphor is analyzed and explained by the simplified energy level diagrams of Sb2O62 - group, Bi3 + and Eu3 + ions, and energy transfer processes between them.
NASA Astrophysics Data System (ADS)
Yao, Yuhong; Knox, Wayne H.
2015-03-01
We report the optical system design of a novel speckle-free ultrafast Red-Green-Blue (RGB) source based on angularly multiplexed simultaneous second harmonic generation from the efficiently generated Stokes and anti-Stokes pulses from a commercially available photonic crystal fiber (PCF) with two zero dispersion wavelengths (TZDW). We describe the optimized configuration of the TZDW fiber source which supports excitations of dual narrow-band pulses with peak wavelengths at 850 nm, 1260 nm and spectral bandwidths of 23 nm, 26 nm, respectively within 12 cm of commercially available TZDW PCF. The conversion efficiencies are as high as 44% and 33% from the pump source (a custom-built Yb:fiber master-oscillator-power-amplifier). As a result of the nonlinear dynamics of propagation, the dual pulses preserve their ultrashort pulse width (with measured autocorrelation traces of 200 fs and 227 fs,) which eliminates the need for dispersion compensation before harmonic generation. With proper optical design of the free-space harmonic generation system, we achieve milli-Watt power level red, green and blue pulses at 630 nm, 517 nm and 425 nm. Having much broader spectral bandwidths compared to picosecond RGB laser sources, the source is inherently speckle-free due to the ultra-short coherence length (<37 μm) while still maintaining an excellent color rendering capability with >99.4% excitation purities of the three primaries, leading to the coverage of 192% NTSC color gamut (CIE 1976). The reported RGB source features a very simple system geometry, its potential for power scaling is discussed with currently available technologies.
Anguissola, Sergio; Garry, David; Salvati, Anna; O'Brien, Peter J; Dawson, Kenneth A
2014-01-01
The fast-paced development of nanotechnology needs the support of effective safety testing. We have developed a screening platform measuring simultaneously several cellular parameters for exposure to various concentrations of nanoparticles (NPs). Cell lines representative of different organ cell types, including lung, endothelium, liver, kidney, macrophages, glia, and neuronal cells were exposed to 50 nm amine-modified polystyrene (PS-NH2) NPs previously reported to induce apoptosis and to 50 nm sulphonated and carboxyl-modified polystyrene NPs that were reported to be silent. All cell lines apart from Raw 264.7 executed apoptosis in response to PS-NH2 NPs, showing specific sequences of EC50 thresholds; lysosomal acidification was the most sensitive parameter. Loss of mitochondrial membrane potential and plasma membrane integrity measured by High Content Analysis resulted comparably sensitive to the equivalent OECD-recommended assays, allowing increased output. Analysis of the acidic compartments revealed good cerrelation between size/fluorescence intensity and dose of PS-NH2 NPs applied; moreover steatosis and phospholipidosis were observed, consistent with the lysosomal alterations revealed by Lysotracker green; similar responses were observed when comparing astrocytoma cells with primary astrocytes. We have established a platform providing mechanistic insights on the response to exposure to nanoparticles. Such platform holds great potential for in vitro screening of nanomaterials in highthroughput format.
Pan, Yuexiao; Li, Li; Lu, Jing; Pang, Ran; Wan, Li; Huang, Shaoming
2016-06-21
A green long-lasting phosphorescence (LLP) phosphor Zn2GeO4:Mn(2+) (ZGOM) has been synthesized by a solid-state method at 1100 °C in air. The luminescence intensity has been improved up to 9 and 6 times through mixing GeO2 and MgF2 into the composition, respectively. The phosphorescence duration of the sample has been prolonged to 5 h. The phosphor, composed of a mixture of Zn2GeO4 (ZGO), GeO2, and MgGeO3 phases, emits enhanced green luminescence with a broad excitation band between 250 nm to 400 nm. Under identical measurement conditions, the optimized phosphor ZGOM has a higher emission intensity and shows longer wavelength emission than those of the commercial green LLP phosphor SrAl2O4:Eu,Dy (SAOED) under an excitation at 336 nm. The quantum yield of the sample modified by GeO2 and MgF2 is as high as 95.0%. Understanding of the formation mechanism for enhancement of emission intensity and prolonging of phosphorescence duration of ZGOM is fundamentally important, which might be extended to other identified solid-state inorganic phosphor materials for advanced properties.
Luminescence in microcrystalline green emitting Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor
NASA Astrophysics Data System (ADS)
Panse, V. R.; Kokode, N. S.; Shinde, K. N.; Dhoble, S. J.
2018-03-01
Green emitting Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor powders were synthesized via the wet chemical synthesis and the luminescent proprieties were studied when excited at 380 nm and present a dominant and strong green luminescence peak at 543 nm, due to D-F transition. The preparation of Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor powders were confirmed by X-ray diffraction (XRD) results without any secondary or impurity phases. The size and morphology of the Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor powders were further examined by scanning electron microscopy (SEM). Photoluminescence (PL) results have shown strongest green emission at 543 nm, which is originated due to 5D4-7F5 transition of Tb3+ ion, for the Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor. The addition of concentration Tb3+ was greatly improved the photoluminescence properties of present phosphors. The present study suggests that the Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor is a strong candidate as a green component for phosphor-converted white light-emitting diodes (LEDs).
Near-infrared lasers and self-frequency-doubling in Nd:YCOB cladding waveguides.
Ren, Yingying; Chen, Feng; Vázquez de Aldana, Javier R
2013-05-06
A design of cladding waveguides in Nd:YCOB nonlinear crystals is demonstrated in this work. Compact Fabry-Perot oscillation cavities are employed for waveguide laser generation at 1062 nm and self-frequency-doubling at 531 nm, under optical pump at 810 nm. The waveguide laser shows slope efficiency as high as 55% at 1062 nm. The SFD green waveguide laser emits at 531 nm with a maximum power of 100 μW.
Exploration of BEOL line-space patterning options at 12 nm half-pitch and below
NASA Astrophysics Data System (ADS)
Decoster, S.; Lazzarino, F.; Petersen Barbosa Lima, L.; Li, W.; Versluijs, J.; Halder, S.; Mallik, A.; Murdoch, G.
2018-03-01
While the semiconductor industry is almost ready for high-volume manufacturing of the 7 nm technology node, research centers are defining and troubleshooting the patterning options for the 5 nm technology node (N5) and below. The target dimension for imec's N5 BEOL applications is 20-24 nm Metal Pitch (MP), which requires Self-Aligned multiple (Double/Quadruple/Octuple) Patterning approaches (SAxP) in combination with EUV or immersion lithography at 193 nm. There are numerous technical challenges to enable gratings at the hard mask level such as good uniformity across wafer, low line edge/width roughness (LER/LWR), large process window, and all of this at low cost. An even greater challenge is to transfer these gratings into the dielectric material at such critical dimensions, where increased line edge roughness, line wiggling and even pattern collapse can be expected for materials with small mechanical stability such as highly porous low-k dielectrics. In this work we first compare three different patterning options for 12 nm half-pitch gratings at the hard mask level: EUV-based SADP and 193i-based SAQP and SAOP. This comparison will be based on process window, line edge/width roughness and cost. Next, the transfer of 12 nm line/space gratings in the dielectric material is discussed and presented. The LER of the dielectric lines is investigated as a function of the dielectric material, the trench depth, and the stress in the sacrificial hard mask. Finally, we elaborate on the different options to enable scaling down from 24 nm MP to 16 nm MP, and demonstrate 8 nm line/space gratings with 193i-based SAOP.
Sato, Yuka; Seimiya, Masanori; Yoshida, Toshihiko; Sawabe, Yuji; Hokazono, Eisaku; Osawa, Susumu; Matsushita, Kazuyuki
2017-01-01
Background The indocyanine green retention rate is important for assessing the severity of liver disorders. In the conventional method, blood needs to be collected twice. In the present study, we developed an automated indocyanine green method that does not require blood sampling before intravenous indocyanine green injections and is applicable to an automated biochemical analyser. Methods The serum samples of 471 patients collected before and after intravenous indocyanine green injections and submitted to the clinical laboratory of our hospital were used as samples. The standard procedure established by the Japan Society of Hepatology was used as the standard method. In the automated indocyanine green method, serum collected after an intravenous indocyanine green injection was mixed with the saline reagent containing a surfactant, and the indocyanine green concentration was measured at a dominant wavelength of 805 nm and a complementary wavelength of 884 nm. Results The coefficient of variations of the within- and between-run reproducibilities of this method were 2% or lower, and dilution linearity passing the origin was noted up to 10 mg/L indocyanine green. The reagent was stable for four weeks or longer. Haemoglobin, bilirubin and chyle had no impact on the results obtained. The correlation coefficient between the standard method (x) and this method (y) was r=0.995; however, slight divergence was noted in turbid samples. Conclusion Divergence in turbid samples may have corresponded to false negativity with the standard procedure. Our method may be highly practical because blood sampling before indocyanine green loading is unnecessary and measurements are simple.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santos, J. F. M. dos; Terra, I. A. A.; Nunes, L. A. O.
Trivalent Tb-doped materials exhibit strong emission in the green and weak emission in the UV-blue levels. Usually, this behavior is attributed to the cross relaxation (CR) process. In this paper, the luminescence properties of Tb{sup 3+}-doped low silica calcium aluminosilicate glasses are analyzed for UV (λ{sub exc} = 325 nm) and visible (488 nm) excitations. Under 325 nm excitation, the intensity of green luminescence increases proportionally to Tb{sup 3+} concentration. However, the blue luminescence intensity is strongly reduced with the increase of concentration from 0.5–15.0 wt. %. In the case of 488 nm excitation, a saturation behavior of the green emission is observed at intensities two ordersmore » of magnitude smaller than expected for bleaching of the ground state population. Using a rate equation model, we showed that this behavior can be explained by an excited state absorption cross section two orders of magnitude larger than the ground state absorption. The blue emission is much weaker than expected from our rate equations (325 nm and 488 nm excitation). We concluded that only the CR process cannot explain the overall feature of measured luminescence quenching in the wide range of Tb{sup 3+} concentrations. Cooperative upconversion from a pair of excited ions ({sup 5}D{sub 3}:{sup 5}D{sub 3} or {sup 5}D{sub 3}:{sup 5}D{sub 4}) and other mechanisms involving upper lying states (4f5d, charge transfer, host matrix, defects, etc.) may play a significant role.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Hsiao-Hsuan; Carlsson, Mats, E-mail: h.h.lin@astro.uio.no, E-mail: mats.carlsson@astro.uio.no
The O i 135.56 nm line is covered by NASA's Interface Region Imaging Spectrograph (IRIS) small explorer mission which studies how the solar atmosphere is energized. We study here the formation and diagnostic potential of this line by means of non-local thermodynamic equilibrium modeling employing both 1D semi-empirical and 3D radiation magnetohydrodynamic models. We study the basic formation mechanisms and derive a quintessential model atom that incorporates essential atomic physics for the formation of the O i 135.56 nm line. This atomic model has 16 levels and describes recombination cascades through highly excited levels by effective recombination rates. The ionizationmore » balance O i/O ii is set by the hydrogen ionization balance through charge exchange reactions. The emission in the O i 135.56 nm line is dominated by a recombination cascade and the line is optically thin. The Doppler shift of the maximum emission correlates strongly with the vertical velocity in its line forming region, which is typically located at 1.0–1.5 Mm height. The total intensity of the line emission is correlated with the square of the electron density. Since the O i 135.56 nm line is optically thin, the width of the emission line is a very good diagnostic of non-thermal velocities. We conclude that the O i 135.56 nm line is an excellent probe of the middle chromosphere, and compliments other powerful chromospheric diagnostics of IRIS such as the Mg ii h and k lines and the C ii lines around 133.5 nm.« less
Chaitanya Kumar, S; Parsa, S; Ebrahim-Zadeh, M
2016-01-01
We report a stable, Yb-fiber-laser-based, green-pumped, picosecond optical parametric oscillator (OPO) for the near-infrared based on periodically poled potassium titanyl phosphate (PPKTP) nonlinear crystal, using fan-out grating design and operating near room temperature. The OPO is continuously tunable across 726-955 nm in the signal and 1201-1998 nm in the idler, resulting in a total signal plus idler wavelength coverage of 1026 nm by grating tuning at a fixed temperature. The device generates up to 580 mW of average power in the signal at 765 nm and 300 mW in the idler at 1338 nm, with an overall extraction efficiency of up to 52% and a pump depletion >76%. The extracted signal at 765 nm and idler at 1746 nm exhibit excellent passive power stability better than 0.5% and 0.8% rms, respectively, over 1 h with good beam quality in TEM00 mode profile. The output signal pulses have a Gaussian temporal duration of 13.2 ps, with a FWHM spectral bandwidth of 3.4 nm at 79.5 MHz repetition rate. Power scaling limitations of the OPO due to the material properties of PPKTP are studied.
Noise test-resilient wheels Massachusetts Bay Transportation Authority green line
DOT National Transportation Integrated Search
1982-11-30
This document presents the results of noise and ground-borne vibration measurements made for three rail transit vehicles operating on the Green Line of the Massachusetts Bay Transportation Authority (MBTA). The purpose of these measurements was to as...
First demonstration of green and amber LED-pumped Nd:YAG laser
NASA Astrophysics Data System (ADS)
Tarkashvand, M.; Farahbod, A. H.; Hashemizadeh, S. A.
2018-05-01
For the first time, to the best of our knowledge, a green (520 nm) and amber (592 nm) light emitting diode-pumped Nd:YAG laser is reported. The laser oscillator is a stable semi-planar resonator with a total length of 140 mm. The green (amber) light emitting diode-pumped laser produced a 107 (52) µJ laser energy, at 2.6 (0.7) J electrical pump energy. The oscillator operated at a low repetition rate (about 0.1 Hz) in free-running mode, where the laser spikes were initiated about 210–280 µs after the leading edge of the pump pulse. Moreover, the transverse mode profiles of the resonator, pump absorption efficiency, and optical gain have been studied in some detail.
NASA Astrophysics Data System (ADS)
Qi, Yaoyao; Yu, Haijuan; Zhang, Jingyuan; Zhang, Ling; He, Chaojian; Lin, Xuechun
2018-05-01
We demonstrated a high efficiency and high average power picosecond green light source based on SHG (second harmonic generation) of an unpolarized ytterbium-doped fiber amplifier chain. Using single-pass frequency doubling in two temperature-tuned type-I phase-matching LBO crystals, we were able to generate 46 W, >70 ps pulses at 532 nm from a fundamental beam at 1064 nm, whose output is 96 W, 4.8 μJ, with a repetition frequency of 20 MHz and nearly diffraction limited. The optical conversion efficiency was ∼48% in a highly compact design. To the best of our knowledge, this is the first reported on ps green source through SHG of an unpolarized fiber laser with such a high output and high efficiency.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karabourniotis, D.; Couris, S.; Damelincourt, J.J.
The partial pressure of thallium in high-pressure Hg-TlI discharges with different mercury, thallium, and electron pressures has been measured by using the optically thin line Tl 655 nm and the self-reversed line Tl 535 nm. The partial pressure of the arc axis has been measured from the line Tl 655nm. The effective partial pressure has been measured from the self-reversed line Tl 535 nm on the basis of the multiparameter method, and it has been calculated from the known axis pressure of thallium and the calculation of its radial variation by taking into account the chemical reactions. The experimental resultsmore » confirm the dispersion character of the blue wing of the line Tl 535 nm. The systematic difference obtained between the measured and calculated effective pressure, particularly at the moment of minimum electron density, may be interpreted by deviations from the local thermodynamic equilibrium (LTE) caused by overpopulation of the upper level of the line Tl 535 nm.« less
The effect of red, green and blue lasers on healing of oral wounds in diabetic rats.
Fekrazad, Reza; Mirmoezzi, Amir; Kalhori, Katayoun Am; Arany, Praveen
2015-07-01
Many studies have demonstrated that low-level laser therapy (LLLT) can improve wound healing in non-diabetic and diabetic animals. We compared the effects of red, green, and blue lasers in terms of accelerating oral wound healing in diabetic rats. Diabetes was successfully induced in 32 male Wistar rats using intraperitoneal injection of Streptozotocin (150 mg/kg). After intraperitoneal injection of the anesthetic agent, a full-thickness oral wound (10 mm × 2 mm) was created aseptically with a scalpel on hard palate of the diabetic rats. The study was performed using red (630 nm), green (532 nm), and blue (425 nm) lasers and a control group. We used an energy density of 2J/cm2 and a treatment schedule of 3 times/week for 10 days. The area of wounds was measured and recorded on a chart for all rats. On the 10th day, the samples were then sacrificed and a full-thickness sample of wound area was prepared for pathological study. We observed a significant difference (p<0.001) in the mean slope values of wound healing between treatment and control groups. Moreover, the mean slope of wound healing differed significantly between red laser and two other lasers - blue and green (p<0.001). The mean slopes of wound healing were not significantly different between blue laser and green laser (p=0.777). The results of the present study provide evidence that wound healing is slower in control rats compared to the treatment groups. Moreover, the findings suggest that wound healing occurs faster with red laser compared to blue and green lasers. Copyright © 2015 Elsevier B.V. All rights reserved.
A High-resolution Multi-wavelength Simultaneous Imaging System with Solar Adaptive Optics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rao, Changhui; Zhu, Lei; Gu, Naiting
A high-resolution multi-wavelength simultaneous imaging system from visible to near-infrared bands with a solar adaptive optics system, in which seven imaging channels, including the G band (430.5 nm), the Na i line (589 nm), the H α line (656.3 nm), the TiO band (705.7 nm), the Ca ii IR line (854.2 nm), the He i line (1083 nm), and the Fe i line (1565.3 nm), are chosen, is developed to image the solar atmosphere from the photosphere layer to the chromosphere layer. To our knowledge, this is the solar high-resolution imaging system with the widest spectral coverage. This system wasmore » demonstrated at the 1 m New Vaccum Solar Telescope and the on-sky high-resolution observational results were acquired. In this paper, we will illustrate the design and performance of the imaging system. The calibration and the data reduction of the system are also presented.« less
Jellies, John
2014-11-01
Medicinal leeches are predatory annelids that exhibit countershading and reside in aquatic environments where light levels might be variable. They also leave the water and must contend with terrestrial environments. Yet, leeches generally maintain a dorsal upward position despite lacking statocysts. Leeches respond visually to both green and near-ultraviolet (UV) light. I used LEDs to test the hypothesis that ventral, but not dorsal UV would evoke compensatory movements to orient the body. Untethered leeches were tested using LEDs emitting at red (632 nm), green (513 nm), blue (455 nm) and UV (372 nm). UV light evoked responses in 100 % of trials and the leeches often rotated the ventral surface away from it. Visible light evoked no or modest responses (12-15 % of trials) and no body rotation. Electrophysiological recordings showed that ventral sensilla responded best to UV, dorsal sensilla to green. Additionally, a higher order interneuron that is engaged in a variety of parallel networks responded vigorously to UV presented ventrally, and both the visible and UV responses exhibited pronounced light adaptation. These results strongly support the suggestion that a dorsal light reflex in the leech uses spectral comparisons across the dorsal-ventral axis rather than, or in addition to, luminance.
Jaffri, Shaan Bibi; Ahmad, Khuram Shahzad
2018-06-13
Present study has for the first time reported Prunus cerasifera leaf extract mediated zinc oxide nanoparticles in a green and one pot synthetic mode without utilization of any chemical reducing agents. Synthesized nanoparticles were analyzed by ultraviolet-visible (UV-Vis) spectroscopy, X-ray diffraction (XRD), fourier transmission infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). UV-Vis peak was detected at 380 nm due to surface plasmon resonance (SPR). Variety of biomolecules were revealed by FTIR involved in reduction cum stabilization of zinc oxide nanoparticles. Wurtzite hexagonal geometry with an average crystallite size of 12 nm was obtained from XRD diffraction pattern. SEM exhibited size ranges of 80-100 nm and 60- 100 nm for 200 ℃ and 600 ℃ calcination temperatures. Synthesized nanoparticles were used as bio-cleaning photocatalysts against organic pollutants i.e. bromocresol green, bromophenol blue, methyl red and methyl blue, which yielded pseudo first order reaction kinetics (R 2 = 0.98, 0.92, 0.92, 0.90 respectively). Pollutants expressed higher degradation percentages in less than 14 min in direct solar irradiance. Moreover, synthesized nanoparticles were tested against resistant microbes i.e. Aspergillus niger, Aspergillus flavus, Aspergillus fumigatus, Aspergillus terreus, Penicillium chrysogenum, Fusarium solani, Lasiodiplodia theobromae, Xanthomonas axonopodis pv. citri and Psuedomonas syringae for development of new generation of antimicrobial agents.
Rechner, Ole; Neugart, Susanne; Schreiner, Monika; Wu, Sasa; Poehling, Hans-Michael
2017-01-01
Light of different wavelengths is essential for plant growth and development. Short-wavelength radiation such as UV can shift the composition of flavonoids, glucosinolates, and other plant metabolites responsible for enhanced defense against certain herbivorous insects. The intensity of light-induced, metabolite-based resistance is plant- and insect species-specific and depends on herbivore feeding guild and specialization. The increasing use of light-emitting diodes (LEDs) in horticultural plant production systems in protected environments enables the creation of tailor-made light scenarios for improved plant cultivation and induced defense against herbivorous insects. In this study, broccoli (Brassica oleracea var. italica) plants were grown in a climate chamber under broad spectra photosynthetic active radiation (PAR) and were additionally treated with the following narrow-bandwidth light generated with LEDs: UV-A (365 nm), violet (420 nm), blue (470 nm), or green (515 nm). We determined the influence of narrow-bandwidth light on broccoli plant growth, secondary plant metabolism (flavonol glycosides and glucosinolates), and plant-mediated light effects on the performance and behavior of the specialized cabbage aphid Brevicoryne brassicae. Green light increased plant height more than UV-A, violet, or blue LED treatments. Among flavonol glycosides, specific quercetin and kaempferol glycosides were increased under violet light. The concentration of 3-indolylmethyl glucosinolate in plants was increased by UV-A treatment. B. brassicae performance was not influenced by the different light qualities, but in host-choice tests, B. brassicae preferred previously blue-illuminated plants (but not UV-A-, violet-, or green-illuminated plants) over control plants.
Spectral inputs and ocellar contributions to a pitch-sensitive descending neuron in the honeybee.
Hung, Y-S; van Kleef, J P; Stange, G; Ibbotson, M R
2013-02-01
By measuring insect compensatory optomotor reflexes to visual motion, researchers have examined the computational mechanisms of the motion processing system. However, establishing the spectral sensitivity of the neural pathways that underlie this motion behavior has been difficult, and the contribution of the simple eyes (ocelli) has been rarely examined. In this study we investigate the spectral response properties and ocellar inputs of an anatomically identified descending neuron (DNII(2)) in the honeybee optomotor pathway. Using a panoramic stimulus, we show that it responds selectively to optic flow associated with pitch rotations. The neuron is also stimulated with a custom-built light-emitting diode array that presented moving bars that were either all-green (spectrum 500-600 nm, peak 530 nm) or all-short wavelength (spectrum 350-430 nm, peak 380 nm). Although the optomotor response is thought to be dominated by green-sensitive inputs, we show that DNII(2) is equally responsive to, and direction selective to, both green- and short-wavelength stimuli. The color of the background image also influences the spontaneous spiking behavior of the cell: a green background produces significantly higher spontaneous spiking rates. Stimulating the ocelli produces strong modulatory effects on DNII(2), significantly increasing the amplitude of its responses in the preferred motion direction and decreasing the response latency by adding a directional, short-latency response component. Our results suggest that the spectral sensitivity of the optomotor response in honeybees may be more complicated than previously thought and that ocelli play a significant role in shaping the timing of motion signals.
Neugart, Susanne; Schreiner, Monika; Wu, Sasa; Poehling, Hans-Michael
2017-01-01
Light of different wavelengths is essential for plant growth and development. Short-wavelength radiation such as UV can shift the composition of flavonoids, glucosinolates, and other plant metabolites responsible for enhanced defense against certain herbivorous insects. The intensity of light-induced, metabolite-based resistance is plant- and insect species-specific and depends on herbivore feeding guild and specialization. The increasing use of light-emitting diodes (LEDs) in horticultural plant production systems in protected environments enables the creation of tailor-made light scenarios for improved plant cultivation and induced defense against herbivorous insects. In this study, broccoli (Brassica oleracea var. italica) plants were grown in a climate chamber under broad spectra photosynthetic active radiation (PAR) and were additionally treated with the following narrow-bandwidth light generated with LEDs: UV-A (365 nm), violet (420 nm), blue (470 nm), or green (515 nm). We determined the influence of narrow-bandwidth light on broccoli plant growth, secondary plant metabolism (flavonol glycosides and glucosinolates), and plant-mediated light effects on the performance and behavior of the specialized cabbage aphid Brevicoryne brassicae. Green light increased plant height more than UV-A, violet, or blue LED treatments. Among flavonol glycosides, specific quercetin and kaempferol glycosides were increased under violet light. The concentration of 3-indolylmethyl glucosinolate in plants was increased by UV-A treatment. B. brassicae performance was not influenced by the different light qualities, but in host-choice tests, B. brassicae preferred previously blue-illuminated plants (but not UV-A-, violet-, or green-illuminated plants) over control plants. PMID:29190278
Moreno-Martin, Gustavo; Pescuma, Micaela; Pérez-Corona, Teresa; Mozzi, Fernanda; Madrid, Yolanda
2017-11-01
Selenium nanoparticles (SeNPs) were synthesized by a green technology using lactic acid bacteria (LAB, Lactobacillus acidophilus, L. delbrueckii subsp. bulgaricus and L. reuteri). The exposure of aqueous sodium selenite to LAB led to the synthesis of SeNPs. Characterization of SeNPs by transmission electron microscopy with energy dispersive X-ray spectrum (EDXS) analysis revealed the presence of stable, predominantly monodispersed and spherical SeNPs of an average size of 146 ± 71 nm. Additionally, SeNPs hydrodynamic size was determined by dispersive light scattering (DLS) and nanoparticle tracking analysis (NTA). For this purpose, a methodology based on the use of surfactants in basic medium was developed for isolating SeNPs from the bacterial pellet. The hydrodynamic size values provided by DLS and NTA were 258 ± 4 and 187 ± 56 nm, respectively. NTA measurements of number-based concentration reported values of (4.67±0.30)x10 9 SeNPs mL -1 with a relative standard deviation lower than 5% (n = 3). The quantitative results obtained by NTA were supported by theoretical calculations. Asymmetrical flow field flow fractionation (AF 4 ) on line coupled to the inductively couple plasma mass spectrometry (ICP-MS) and off-line coupled to DLS was further employed to characterize biogenic SeNPs. The distribution of the particle size for the Se-containing peak provide an average size of (247 ± 14) nm. The data obtained by independent techniques were in good agreement and the developed methodology could be implemented for characterizing NPs in complex matrices such as biogenic nanoparticles embedded inside microbial material. Copyright © 2017. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Selvakumari, J. Celina; Ahila, M.; Malligavathy, M.; Padiyan, D. Pathinettam
2017-09-01
Tin oxide (SnO2) nanoparticles were cost-effectively synthesized using nontoxic chemicals and green tea ( Camellia sinensis) extract via a green synthesis method. The structural properties of the obtained nanoparticles were studied using X-ray diffraction, which indicated that the crystallite size was less than 20 nm. The particle size and morphology of the nanoparticles were analyzed using scanning electron microscopy and transmission electron microscopy. The morphological analysis revealed agglomerated spherical nanoparticles with sizes varying from 5 to 30 nm. The optical properties of the nanoparticles' band gap were characterized using diffuse reflectance spectroscopy. The band gap was found to decrease with increasing annealing temperature. The O vacancy defects were analyzed using photoluminescence spectroscopy. The increase in the crystallite size, decreasing band gap, and the increasing intensities of the UV and visible emission peaks indicated that the green-synthesized SnO2 may play future important roles in catalysis and optoelectronic devices.
NASA Astrophysics Data System (ADS)
Rajendran, Kalimuthu; Rajendiran, Nagappan
2018-02-01
A simple, economical, and green method for the preparation of water soluble, high fluorescent carbon quantum dots (CQDs) has been prepared via hydrothermal process using jackfruit (Artocarpus heterophyllus) as a carbon source. The optical properties of synthesized CQDs were characterized by UV- visible and fluorescence spectroscopy. Fourier transform infrared spectroscopy (FT-IR), x-ray Diffraction (XRD) and high resolution transmission electron microscopy (HR-TEM) techniques were used to study the composition and size of the CQDs. The prepared CQDs were spherical in shape with an average size of 2.5 nm along with uniform distribution and showed bright bluish green emission properties, without any further surface modification. The prepared CQDs were exhibit high stability at neutral pH and showed high photo-stability under UV light irradiation at 365 nm. The obtained CQDs were effectively utilized as fluorescent probe for highly selective and sensitive detection of Hg2+ and Cr6+ ions in environmental samples with a limit of detection of about 8 and 10 nM respectively.
One-pot green synthesis of luminescent gold nanoparticles using imidazole derivative of chitosan.
Nazirov, Alexander; Pestov, Alexander; Privar, Yuliya; Ustinov, Alexander; Modin, Evgeny; Bratskaya, Svetlana
2016-10-20
Water soluble luminescent gold nanoparticles with average size 2.3nm were for the first time synthesized by completely green method of Au(III) reduction using chitosan derivative-biocompatible nontoxic N-(4-imidazolyl)methylchitosan (IMC) as both reducing and stabilizing agent. Reduction of Au(III) to gold nanoparticles in IMC solution is a slow process, in which coordination power of biopolymer controls both reducing species concentration and gold crystal growth rate. Gold nanoparticles formed in IMC solution do not manifest surface plasmon resonance, but exhibit luminescence at 375nm under UV light excitation at 230nm. Due to biological activity of imidazolyl-containing polymers and their ability to bind proteins and drugs, the obtained ultra-small gold nanoparticles can find an application for biomolecules detection, bio-imaging, drug delivery, and catalysis. Very high catalytic activity (as compared to gold nanoparticles obtained by other green methods) was found for Au/IMC nanoparticles in the model reaction of p-nitrophenol reduction providing complete conversion of p-nitrophenol to p-aminophenol within 180-190s under mild conditions. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Bing; Shen, Chao; Zhang, Mengya
Green synthesis of CdSe quantum dots for application in the quantum-dots-sensitized solar cells (QDSCs) is investigated in this work. The CdSe QDs were prepared with glycerol as the solvent, with sharp emission peak, full width at half maximum around 30 nm, and absorption peak from 475 nm to 510 nm. The reaction is environmental friendly and energy saving. What's more, the green synthesized CdSe QDs are coherence to the maximum remittance region of the solar spectrum and suitable as sensitizers to assemble onto TiO{sub 2} electrodes for cell devices application. What's more, the dynamic procedure of the carriers' excitation, transportation, and recombination inmore » the QDSCs are discussed. Because the recombination of the electrons from the conduction band of TiO{sub 2}'s to the electrolyte affects the efficiency of the solar cells greatly, 3-Mercaptopropionic acid capped water-dispersible QDs were used to cover the surface of TiO{sub 2}. The resulting green synthesized CdSe QDSCs with Cu{sub 2}S as the electrode show a photovoltaic performance with a conversion efficiency of 3.39%.« less
NASA Astrophysics Data System (ADS)
Maeno, Akihiro; Kato, Yuko; Jimbo, Mitsuru; Amada, Kei; Mita, Hajime; Akasaka, Kazuyuki
2017-04-01
We have investigated conformational fluctuations in a new green fluorescent protein(GFP)-like protein rb-Akane found in a red-brown-colored octocoral, Scleronephthya gracillima (Kuekenthal)), with high pressure fluorescence spectroscopy at 0.1-700 MPa. Besides the green fluorescence at 510 nm, two red fluorescence peaks are observed at 590 and 629 nm, the relative intensity of which varies reversibly with pressure. The phenomenon is interpreted as representing the cis-trans isomerization of the chromophore accompanied by the conformational transition between two sub-states of the red fluorescence form of rb-Akane. The two sub-states are separated only marginally in free energy (ΔG0 = 1.9 ± 0.4 kJ mol-1), but significantly in partial molar volume (ΔV0 = -19.8 ± 1.4 ml mol-1) at 0.1 MPa (pH 7.5, 25°C). Above 500 MPa, the fluorescence at λmax 629 nm undergoes another reversible change with pressure, showing the onset of unfolding.
A new solid-state, frequency-doubled neodymium-YAG photocoagulation system.
Jalkh, A E; Pflibsen, K; Pomerantzeff, O; Trempe, C L; Schepens, C L
1988-06-01
We have developed a solid-state laser system that produces a continuous green monochromatic laser beam of 532 nm by doubling the frequency of a neodymium-YAG laser wavelength of 1064 nm with a potassium-titamyl-phosphate crystal. Photocoagulation burns of equal size and intensity were placed in two rabbit eyes with the solid-state laser system and the regular green argon laser system, respectively, using the same slit-lamp mode of delivery. Histologic findings of lesion sections revealed no important differences between the two systems. In theory, the longer wavelength of the solid-state laser offers the advantages of less scattering in ocular media, higher absorption by oxyhemoglobin, and less absorption by macular xanthophyll than the 514-nm wavelength of the regular green argon laser. The solid-state laser has impressive technical advantages: it contains no argon-ion gas tube that wears out and is expensive to replace; it is much more power efficient, and thus considerably smaller and compact; it is sturdier and easily movable; it does not require external cooling; it uses a 220-V monophasic alternating current; and it requires little maintenance.
Jinu, U; Gomathi, M; Saiqa, I; Geetha, N; Benelli, G; Venkatachalam, P
2017-04-01
This research focused on green engineering and characterization of silver (PcAgNPs) and copper nanoparticles (PcCuNPs) using Prosopis cineraria (Pc) leaf extract prepared by using microwave irradiation. We studied their enhanced antimicrobial activity on human pathogens as well as cytotoxicity on breast cancer cells (MCF-7). Biofabricated silver and copper nanoparticles exhibited UV-Visible absorbance peaks at 420 nm and 575 nm, confirming the bioreduction and stabilization of nanoparticles. Nanoparticles were characterized by FTIR, XRD, FESEM, and EDX analysis. FTIR results indicated the presence of alcohols, alkanes, aromatics, phenols, ethers, benzene, amines and amides that were possibly involved in the reduction and capping of silver and copper ions. XRD analysis was performed to confirm the crystalline nature of the silver and copper nanoparticles. FESEM analysis suggested that the nanoparticles were hexagonal or spherical in shape with size ranging from 20 to 44.49 nm and 18.9-32.09 nm for AgNPs and CuNPs, respectively. EDX analysis confirmed the presence of silver and copper elemental signals in the nanoparticles. The bioengineered silver and copper nanohybrids showed enhanced antimicrobial activity against Gram-positive and Gram-negative MDR human pathogens. MTT assay results indicated that CuNPs show potential cytotoxic effect followed by AgNPs against MCF-7 cancer cell line. IC 50 were 65.27 μg/ml, 37.02 μg/ml and 197.3 μg/ml for PcAgNPs, PcCuNPs and P. cineraria leaf extracts, respectively, treated MCF-7 cells. The present investigation highlighted an effective protocol for microwave-assisted synthesis of biomolecule-loaded silver and copper nanoparticles with enhanced antibacterial and anticancer activity. Results strongly suggested that bioengineered AgNPs and CuNPs could be used as potential tools against microbial pathogens and cancer cells. Copyright © 2017 Elsevier Ltd. All rights reserved.
Huang, Jingfeng; Wei, Chen; Zhang, Yao; Blackburn, George Alan; Wang, Xiuzhen; Wei, Chuanwen; Wang, Jing
2015-01-01
Passive optical hyperspectral remote sensing of plant pigments offers potential for understanding plant ecophysiological processes across a range of spatial scales. Following a number of decades of research in this field, this paper undertakes a systematic meta-analysis of 85 articles to determine whether passive optical hyperspectral remote sensing techniques are sufficiently well developed to quantify individual plant pigments, which operational solutions are available for wider plant science and the areas which now require greater focus. The findings indicate that predictive relationships are strong for all pigments at the leaf scale but these decrease and become more variable across pigment types at the canopy and landscape scales. At leaf scale it is clear that specific sets of optimal wavelengths can be recommended for operational methodologies: total chlorophyll and chlorophyll a quantification is based on reflectance in the green (550–560nm) and red edge (680–750nm) regions; chlorophyll b on the red, (630–660nm), red edge (670–710nm) and the near-infrared (800–810nm); carotenoids on the 500–580nm region; and anthocyanins on the green (550–560nm), red edge (700–710nm) and near-infrared (780–790nm). For total chlorophyll the optimal wavelengths are valid across canopy and landscape scales and there is some evidence that the same applies for chlorophyll a. PMID:26356842
Venugopal, K; Rather, H A; Rajagopal, K; Shanthi, M P; Sheriff, K; Illiyas, M; Rather, R A; Manikandan, E; Uvarajan, S; Bhaskar, M; Maaza, M
2017-02-01
In the present report, silver nanoparticles were synthesized using Piper nigrum extract for in vitro cytotoxicity efficacy against MCF-7 and HEP-2 cells. The silver nanoparticles (AgNPs) were formed within 20min and after preliminarily confirmation by UV-Visible spectroscopy (strong peak observed at ~441nm), they were characterized by using FT-IR and HR-TEM. The TEM images show spherical shape of biosynthesized AgNPs with particle size in the range 5-40nm while as compositional analysis were observed by EDAX. MTT assays were carried out for cytotoxicity of various concentrations of biosynthesized silver nanoparticles and Piper nigrum extract ranging from 10 to 100μg. The biosynthesized silver nanoparticles showed a significant anticancer activity against both MCF-7 and Hep-2 cells compared to Piper nigrum extract which was dose dependent. Our study thus revealed an excellent application of greenly synthesized silver nanoparticles using Piper nigrum. The study further suggested the potential therapeutic use of these nanoparticles in cancer study. Copyright © 2016. Published by Elsevier B.V.
White random lasing in mixture of ZnSe, CdS and CdSSe micropowders
NASA Astrophysics Data System (ADS)
Alyamani, A. Y.; Leanenia, M. S.; Alanazi, L. M.; Aljohani, M. M.; Aljariwi, A. A.; Rzheutski, M. V.; Lutsenko, E. V.; Yablonskii, G. P.
2016-03-01
Room temperature random lasing with white light emission in a mixture of AIIBVI semiconductor powders was achieved for the first time. The scattering gain media was formed by the mixture of closely packed active micron sized crystallites of ZnSe, CdS, CdSSe semiconductors. The micropowders were produced by grinding bulk crystals of each compound. Optical excitation was performed by 10-nanosecond pulses of tuned Ti:Al2O3-laser at 390 nm. The lasing in the mixture of semiconductor powders was achieved simultaneously at four wavelengths in blue, green, yellow and red spectral regions after exceeding the threshold excitation power density. A drastic integral intensity increase, spectrum narrowing and appearance of mode structure accompanied the laser action. ZnSe crystallites produce the laser light at about 460 nm while CdS particles - at about 520 nm. Two types of CdSSe semiconductor micropowders with different sulfur content lase at 580 nm and 660 nm. The threshold excitation power densities for all laser lines in the emission spectrum are approximately the same of about 0.9 MW/cm2. The sum of the emission spectrum of the mixture of the micropowders forms white light with high brightness. Lasing is due to an appearance of random feedback for amplified radiation in the active medium of closely packed light scattering crystallites. The presented results may find their applications for visualization systems, lighting technology, data transmission, medicine as biosensors and in identification systems. The key feature of random lasers is low cost of its production and possibility to be deposited on any type of surface.
Yang, Jun; Zhang, Cuimiao; Peng, Chong; Li, Chunxia; Wang, Lili; Chai, Ruitao; Lin, Jun
2009-01-01
Light fantastic! Lu(2)O(3):Yb(3+)/Er(3+)/Tm(3+) nanocrystals with controllable red, green, blue (RGB) and bright white upconversion luminescence by a single laser excitation of 980 nm have been successfully synthesized (see picture). Due to abundant UC PL colors, it can potentially be used as fluorophores in the field of color displays, back light, UC lasers, photonics, and biomedicine.Lu(2)O(3):Yb(3+)/Er(3+)/Tm(3+) nanocrystals have been successfully synthesized by a solvothermal process followed by a subsequent heat treatment at 800 degrees C. Powder X-ray diffraction, transmission electron microscopy, upconversion photoluminescence spectra, and kinetic decay were used to characterize the samples. Under single-wavelength diode laser excitation of 980 nm, the bright blue emissions of Lu(2)O(3):Yb(3+), Tm(3+) nanocrystals near 477 and 490 nm were observed due to the (1)G(4)-->(3)H(6) transition of Tm(3+). The bright green UC emissions of Lu(2)O(3):Er(3+) nanocrystals appeared near 540 and 565 nm were observed and assigned to the (2)H(11/2)-->(4)I(15/2) and (4)S(3/2)-->(4)I(15/2) transitions, respectively, of Er(3+). The ratio of the intensity of green luminescence to that of red luminescence decreases with an increase of concentration of Yb(3+) in Lu(2)O(3):Er(3+) nanocrystals. In sufficient quantities of Yb(3+) with resprct to Er(3+), the bright red UC emission of Lu(2)O(3):Yb(3+)/Er(3+) centered at 662 nm was predominant, due to the (4)F(9/2)-->(4)I(15/2) transition of Er(3+). Based on the generation of red, green, and blue emissions in the different doped Lu(2)O(3):RE(3+) nanocrystals, it is possible to produce the luminescence with a wide spectrum of colors, including white, by the appropriate doping of Yb(3+), Tm(3+), and Er(3+) in the present Lu(2)O(3) nanocrystals. Namely, Lu(2)O(3):3 %Yb(3+)/0.2 %Tm(3+)/0.4 %Er(3+) nanocrystals show suitable intensities of blue, green, and red (RGB) emission, resulting in the production of perfect and bright white light with CIE-x=0.3456 and CIE-y=0.3179, which is very close to the standard equal energy white light illuminate (x=0.33, y=0.33). Because of abundant luminescent colors from RGB to white in Lu(2)O(3):Yb(3+)/Er(3+)/Tm(3+) nanocrystals under 980 nm laser diode (LD) excitation, they can potentially be used as fluorophores in the field of color displays, back light, UC lasers, photonics, and biomedicine.
Autophagy Signaling in Prostate Cancer: Identification of a Novel Phosphatase
2011-08-01
the transmembrane and cytosolic residues). We measured PTPRS activity using a phospho-tyrosine (pTyr) peptide with malachite green free phosphate...vitro using a 100 uM phosphotyrosine peptide substrate and malachite green detection of released free phosphates. Activity is expressed as picomoles...Upstate) at 37°C for 15 minutes. Released phosphates were detected with malachite green (Upstate) and absorbance measured at 650 nm. Background levels
Rehana, Dilaveez; Mahendiran, D; Kumar, R Senthil; Rahiman, A Kalilur
2017-05-01
Copper oxide (CuO) nanoparticles were synthesized by green chemistry approach using different plant extracts obtained from the leaves of Azadirachta indica, Hibiscus rosa-sinensis, Murraya koenigii, Moringa oleifera and Tamarindus indica. In order to compare their efficiency, the same copper oxide nanoparticles was also synthesized by chemical method. Phytochemical screening of the leaf extracts showed the presence of carbohydrates, flavonoids, glycosides, phenolic compounds, saponins, tannins, proteins and amino acids. FT IR spectra confirmed the possible biomolecules responsible for the formation of copper oxide nanoparticles. The surface plasmon resonance absorption band at 220-235nm in the UV-vis spectra also supports the formation of copper oxide nanoparticles. XRD patterns revealed the monoclinic phase of the synthesized copper oxide nanoparticles. The average size, shape and the crystalline nature of the nanoparticles were determined by SEM, TEM and SAED analysis. EDX analysis confirmed the presence of elements in the synthesized nanoparticles. The antioxidant activity was evaluated by three different free radical scavenging assays. The cytotoxicity of copper oxide nanoparticles was evaluated against four cancer cell lines such as human breast (MCF-7), cervical (HeLa), epithelioma (Hep-2) and lung (A549), and one normal human dermal fibroblast (NHDF) cell line. The morphological changes were evaluated using Hoechst 33258 staining assay. Copper oxide nanoparticles synthesized by green method exhibited high antioxidant and cytotoxicity than that synthesized by chemical method. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Valcic, S; Timmermann, B N; Alberts, D S; Wächter, G A; Krutzsch, M; Wymer, J; Guillén, J M
1996-06-01
Green tea is an aqueous infusion of dried unfermented leaves of Camellia sinensis (family Theaceae) from which numerous biological activities have been reported including antimutagenic, antibacterial, hypocholesterolemic, antioxidant, antitumor and cancer preventive activities. From the aqueous-alcoholic extract of green tea leaves, six compounds (+)-gallocatechin (GC), (-)-epicatechin (EC), (-)-epigallocatechin (EGC), (-)-epicatechin gallate (ECG), (-)-epigallocatechin gallate (EGCG) and caffeine, were isolated and purified. Together with (+)-catechin, these compounds were tested against each of four human tumor cells lines (MCF-7 breast carcinoma, HT-29 colon carcinoma, A-427 lung carcinoma and UACC-375 melanoma). The three most potent green tea components against all four tumor cell lines were EGCG, GC and EGC. EGCG was the most potent of the seven green tea components against three out of the four cell lines (i.e. MCF-7 breast cancer, HT-29 colon cancer and UACC-375 melanoma). On the basis of these extensive in vitro studies, it would be of considerable interest to evaluate all three of these components in comparative preclinical in vivo animal tumor model systems before final decisions are made concerning which of these potential chemopreventive drugs should be taken into broad clinical trials.
NASA Astrophysics Data System (ADS)
Matsuta, Hideyuki
2017-06-01
The coherent forward scattering (CFS) spectra of O I 844.6 nm and Ar I 842.5 nm lines in a radio frequency (RF) glow discharge were measured using a CFS spectrometer that functions in the Faraday configuration with permanent double-ring magnets and a diode-laser source. A significant change in the CFS spectrum of the Ar I 842.5 nm line was observed when the partial pressures of argon in a Hesbnd Ar RF glow discharge were changed . Based on the theoretical calculations of the CFS spectra performed using Faraday functions, a comparison between the observed and calculated spectra was performed. The CFS line profile of O I 844.6 nm and changes in the Ar I 842.5 nm CFS spectrum are explained by theoretical calculations.
75 FR 64692 - Green Technology Pilot Program
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-20
... DEPARTMENT OF COMMERCE Patent and Trademark Office Green Technology Pilot Program ACTION: Proposed...- 0062 Green Technology Pilot Program comment'' in the subject line of the message. Fax: 571-273-0112... permits patent applications pertaining to green technologies, including greenhouse gas reduction, to be...
2007-05-25
of-the-art optical filters. Specifically, a FF01 -510/84 Semrock green band-pass filter (transmission >95% with 1% standard deviation between 467nm...used to reject the UV laser light (-390nm) exciting the CH radicals, and a NF0I-532U Semrock notch filter (transmission ə 04 % at 527nm, and >95
Chaloupka, Milani; Work, Thierry M.; Balazs, George H.; Murakawa, Shawn K. K.; Morris, Robert
2008-01-01
We investigated cause-specific temporal and spatial trends in sea turtle strandings in the Hawaiian Archipelago. Five species of sea turtle were recorded in 3,861 strandings over a 22-year period (1982–2003). Green turtles comprised 97% of these strandings with size and gender composition reflecting the demographic structure of the resident green turtle population and relative green turtle abundance in Hawaiian waters. The cause of strandings was determined by necropsy based on a complete gross external and internal examination. Totally 75% of the 3,732 green turtle strandings were from Oahu where strandings occur year-round. The most common known cause of the green turtle strandings was the tumour-forming disease, fibropapillomatosis (28%) followed by hook-and-line fishing gear-induced trauma (7%), gillnet fishing gear-induced trauma (5%), boat strike (2.5%), and shark attack (2.7%). Miscellaneous causes comprised 5.4% of strandings whereas 49% of green turtle strandings could not be attributed to any known cause. Green turtle strandings attributable to boat strike were more likely from Kauai and Oahu while fibropapilloma strandings were more likely from Oahu and Maui. Hook-and-line gear strandings were more likely from Oahu due to higher per capita inshore fishing effort. The specific mortality rate (conditional probability) for fibropapillomatosis was 88%, 69% for gillnet gear and 52% for hook-and-line gear. The probability of a dead green turtle stranding increased from 1982 but levelled off by the mid-1990s. The declining mortality risk was because the prevalence and severity of fibropapillomatosis has decreased recently and so has the mortality risk attributable to gillnet gear. Despite exposure to disease and inshore fishing gears, the Hawaiian green turtle stock continues to recover following protection since the late 1970s. Nevertheless, measures to reduce incidental capture of sea turtles in coastal Hawaiian fisheries would be prudent, especially since strandings attributable to hook-and-line fishing gear have increased steadily since 1982.
Green synthesis, structure and fluorescence spectra of new azacyanine dyes
NASA Astrophysics Data System (ADS)
Enchev, Venelin; Gadjev, Nikolai; Angelov, Ivan; Minkovska, Stela; Kurutos, Atanas; Markova, Nadezhda; Deligeorgiev, Todor
2017-11-01
A series of symmetric and unsymmetric monomethine azacyanine dyes (monomethine azacyanine and merocyanine sulfobetaines) were synthesized with moderate to high yields via a novel method using microwave irradiation. The compounds are derived from a condensation reaction between 2-thiomethylbenzotiazolium salts and 2-imino-3-methylbenzothiazolines proceeded under microwave irradiation. The synthetic approach involves the use of green solvent and absence of basic reagent. TD-DFT calculations were performed to simulate absorption and fluorescent spectra of synthesized dyes. Absorption maxima, λmax, of the studied dyes were found in the range 364-394 nm. Molar absorbtivities were evaluated in between 40300 and 59200 mol-1 dm3 cm-1. Fluorescence maxima, λfl, were registered around 418-448 nm upon excitation at 350 nm. A slight displacements of theoretically estimated absorption maxima according to experimental ones is observed. The differences are most probably due to the fact that the DFT calculations were carried out without taking into account the solvent effect. In addition, the merocyanine sulfobetaines also fluorescence in blue optical range (420-480 nm) at excitation in red range (630-650 nm).
Anomalous pH Effect of Blue Proteorhodopsin.
Yamada, Keisuke; Kawanabe, Akira; Yoshizawa, Susumu; Inoue, Kentaro; Kogure, Kazuhiro; Kandori, Hideki
2012-04-05
Proteorhodopsin (PR) is a light-driven proton pump found in marine bacteria, and thousands of PRs are classified into blue-absorbing PR (B-PR; λmax ≈ 490 nm) and green-absorbing PR (G-PR; λmax ≈ 525 nm). In this report, we present conversion of B-PR into G-PR using anomalous pH effect. B-PR in LC1-200, marine γ-proteobacteria, absorbs 497 and 513 nm maximally at pH 7 and 4, respectively, whose pH titration was reversible (pKa = 4.8). When pH was lowered from 4, the λmax was further red-shifted (528 nm at pH 2). This is unusual because blue shift occurs by chloride binding in the case of bacteriorhodopsin. Surprisingly, when pH was increased from 2 to 7, the λmax of this B-PR was further red-shifted to 540 nm, indicating that green-absorbing PR (PR540) is created only by changing pH. The present study reports the conformational flexibility of microbial rhodopsins, leading to the switch of absorbing color by a simple pH change.
Plasmon-Induced Selective Enhancement of Green Emission in Lanthanide-Doped Nanoparticles.
Zhang, Weina; Li, Juan; Lei, Hongxiang; Li, Baojun
2017-12-13
By introducing an 18 nm thick Au nanofilm, selective enhancement of green emission from lanthanide-doped (β-NaYF 4 :Yb 3+ /Er 3+ ) upconversion nanoparticles (UCNPs) is demonstrated. The Au nanofilm is deposited on a microfiber surface by the sputtering method and then covered with the UCNPs. The plasma on the surface of the Au nanofilm can be excited by launching a 980 nm wavelength laser beam into the microfiber, resulting in an enhancement of the local electric field and a strong thermal effect. A 36-fold luminescence intensity enhancement of the UCNPs at 523 nm is observed, with no obvious reduction in the photostability of the UCNPs. Further, the intensity ratios of the emissions at 523-545 nm and at 523-655 nm are enhanced with increasing pump power, which is attributed to the increasing plasmon-induced thermal effect. Therefore, the fabricated device is further demonstrated to exhibit an excellent ability in temperature sensing. By controlling the pump power and the UCNP concentration, a wide temperature range (325-811 K) and a high temperature resolution (0.035-0.046 K) are achieved in the fabricated device.
[Research of spectrum characteristics for light conversion agricultural films].
Zhang, Song-pei; Li, Jian-yu; Chen, Juan; Xiao, Yang; Sun, Yu-e
2004-10-01
The solar spectrum and the function spectrum in chrysanthemum and tomato were determined in this paper. The research for a relation plant growth to solar spectrum showed that the efficiency of plant making use of ultraviolet light of 280-380 nm and yellow-green light of 500-600 nm and near IR spectra over 720 nm are lower, that the blue-purple light of 430-480 nm and red light of 630-690 nm are beneficial to enhancing photosynthesis and promoting plant growth. According to plant photosynthesis and solar spectrum characteristic, the author developed CaS:Cu+, Cl- blue light film, and red light film added with CaS:Eu2+, Mn2+, Cl- to convert green light into red light, and discussed the spectrum characteristic of red-blue double peak in agricultural film and rare earth organic complex which could convert ultraviolet light into red light. Just now, the study on light conversion regents in farm films is going to face new breakthrough and the technology of anti-stocks displacement to study red film which can convert near infrared light are worth to attention.
Swamy, Mallappa Kumara; Akhtar, Mohd Sayeed; Mohanty, Sudipta Kumar; Sinniah, Uma Rani
2015-12-05
Plant mediated synthesis of nanoparticles has been considered as green route and a reliable technique for the synthesis of nanoparticles due to its eco-friendly approach. In this study, we report a simple and eco-friendly approach for the synthesis of silver nanoparticles (AgNPs) using methanolic Momordica cymbalaria fruit extract as reducing agent. The fruit extract of M. cymbalaria exposed to AgNO3 solution showed the change in color from green to light yellow at room temperature within 1h of incubation confirms the synthesis of AgNPs. UV-vis spectra analysis revealed that the synthesized AgNPs had a sharp surface plasmon resonance at around 450 nm, while, the X-ray Diffraction (XRD) patterns confirmed distinctive peaks indices to the crystalline planes of the face centered cubic silver. The Atomic Force Microscopy (AFM) and Scanning Electron Microscopy (SEM) analysis results confirmed the presence of spherical shaped AgNPs by a huge disparity in the particle size distribution with an average size of 15.5 nm. The synthesized AgNPs showed strong antibacterial activity against all the tested multidrug resistant human pathogenic bacterial strains and also exhibited highest free radical scavenging activity (74.2%) compared to fruit extract (60.4%). Moreover, both fruit extract and the synthesized AgNPs showed the cytotoxicity towards Rat L6 skeletal muscle cell line at different concentrations, but the highest inhibition percentage was recorded for AgNPs at concentration of 100 μg/ml. Copyright © 2015. Published by Elsevier B.V.
Observation of the 162Dy-164Dy Isotope Shift for the 0 → 16 717.79 cm-1 Optical Transition.
Nardin Barreta, Luiz Felipe; Victor, Alessandro Rogério; Bueno, Patrícia; Dos Santos, Jhonatha Ricardo; da Silveira, Carlos Alberto Barbosa; Neri, José Wilson; Neto, Jonas Jakutis; Sbampato, Maria Esther; Destro, Marcelo Geraldo
2017-08-01
In this work, we report a newly observed isotope shift between 162 Dy and 164 Dy isotopes for the 0 → 16 717.79 cm -1 (598.003 nm) optical transition. We compared the newly observed results against two other lines (597.452 nm and 598.859 nm), which we measured in this work, and were already reported in the literature. The newly observed 162-164 Dy isotope shift, shows at least a 20% larger isotope shift than the isotope shifts for the other two lines investigated. The larger 162-164 isotope shift observed for the 598.003 nm line could lead to an increased isotope selectivity for atomic vapor laser isotope separation (AVLIS). Hence, this line could be a good choice for application in AVLIS. Experimental data available in the literature for the 597.452 nm and 598.859 nm lines, enabled us to perform simulations of spectra for both lines, in order to confirm the accuracy of our experimental measurements.
Terminalia chebula mediated green and rapid synthesis of gold nanoparticles
NASA Astrophysics Data System (ADS)
Mohan Kumar, Kesarla; Mandal, Badal Kumar; Sinha, Madhulika; Krishnakumar, Varadhan
2012-02-01
Biologically inspired experimental process in synthesising nanoparticles is of great interest in present scenario. Biosynthesis of nanoparticles is considered to be one of the best green techniques in synthesising metal nanoparticles. Here, an in situ green biogenic synthesis of gold nanoparticles using aqueous extracts of Terminalia chebula as reducing and stabilizing agent is reported. Gold nanoparticles were confirmed by surface plasmon resonance in the range of 535 nm using UV-visible spectrometry. TEM analysis revealed that the morphology of the particles thus formed contains anisotropic gold nanoparticles with size ranging from 6 to 60 nm. Hydrolysable tannins present in the extract of T. chebula are responsible for reductions and stabilization of gold nanoparticles. Antimicrobial activity of gold nanoparticles showed better activity towards gram positive S. aureus compared to gram negative E. coli using standard well diffusion method.
Ramasamy, Parthiban; Kim, Bumjin; Lee, Min-Sang; Lee, Jong-Soo
2016-10-21
We demonstrate that the presence of a small amount of water as an impurity during the hot-injection synthesis can significantly decrease the emission lines full width at half-maximum (FWHM) and improve the quantum yield (QY) of InP/ZnS quantum dots (QDs). By utilizing the water present in the indium precursor and solvent, we obtained InP/ZnS QDs emitting around 530 nm with a FWHM as narrow as 46 nm and a QY up to 45%. Without water, the synthesized QDs have emission around 625 nm with a FWHM of 66 nm and a QY of about 33%. Absorption spectra, XRD and XPS analyses revealed that when water is present, an amorphous phosphate layer is formed over the InP QDs and inhibits the QD growth. This amorphous layer favors the formation of a very thick ZnS shell by decreasing the lattice mismatch between the InP core and the ZnS shell. We further show the possibility to tune the emission wavelengths of InP/ZnS QDs by simply adjusting the amount of water present in the system while keeping all the other reaction parameters (i.e., precursor concentration, reaction temperature and time) constant. As an example of their application in light-emitting diodes (LEDs), the green and red InP/ZnS QDs are combined with a blue LED chip to produce white light.
NASA Astrophysics Data System (ADS)
Dubey, Vikas; Tiwari, Ratnesh; Tamrakar, Raunak Kumar; Rathore, Gajendra Singh; Sharma, Chitrakant; Tiwari, Neha
2014-11-01
The paper reports upconversion luminescence behaviour and infra-red spectroscopic pattern of erbium doped yttrium (III) oxide phosphor. Sample was synthesized by solid state reaction method with variable concentration or erbium (0.5-2.5 mol%). The conventional solid state method is suitable for large scale production and eco-friendly method. The prepared sample was characterized by X-ray diffraction (XRD) technique. From structural analysis by XRD technique shows cubic structure of prepared sample with variable concentration of erbium and no impurity phase were found when increase the concentration of Er3+. Particle size was calculated by Scherer's formula and it varies from 67 nm to 120 nm. The surface morphology of prepared phosphor was determined by field emission gun scanning electron microscopy (FEGSEM) technique. The surface morphology of the sample shows good connectivity with grains as well as some agglomerates formation occurs in sample. The functional group analysis was done by Fourier transform infra-red technique (FTIR) analysis which confirm the formation of Y2O3:Er3+ phosphor was prepared. The results indicated that the Y2O3:Er3+ phosphors might have high upconversion efficiency because of their low vibrational energy. Under 980 nm laser excitation sample shows intense green emission at 555 nm and orange emission at 590 nm wavelength. For green emission transition occurs 2H11/2 → 4I15/2, 4S3/2 → 4I15/2 for upconversion emissions. Excited state absorption and energy transfer process were discussed as possible upconversion mechanisms. The near infrared luminescence spectra was recorded. The upconversion luminescence intensity increase with increasing the concentration or erbium up to 2 mol% after that luminescence intensity decreases due to concentration quenching occurs. Spectrophotometric determinations of peaks are evaluated by Commission Internationale de I'Eclairage (CIE) technique. From CIE technique the dominant peak of from PL spectra shows intense green emission so the prepared phosphor is may be useful for green light emitting diode (GLED) application.
NASA Astrophysics Data System (ADS)
Kozawa, Takahiro
2015-09-01
Electron beam (EB) lithography is a key technology for the fabrication of photomasks for ArF immersion and extreme ultraviolet (EUV) lithography and molds for nanoimprint lithography. In this study, the temporal change in the chemical gradient of line-and-space patterns with a 7 nm quarter-pitch (7 nm space width and 21 nm line width) was calculated until it became constant, independently of postexposure baking (PEB) time, to clarify the feasibility of single nano patterning on quartz substrates using EB lithography with chemically amplified resist processes. When the quencher diffusion constant is the same as the acid diffusion constant, the maximum chemical gradient of the line-and-space pattern with a 7 nm quarter-pitch did not differ much from that with a 14 nm half-pitch under the condition described above. Also, from the viewpoint of process control, a low quencher diffusion constant is considered to be preferable for the fabrication of line-and-space patterns with a 7 nm quarter-pitch on quartz substrates.
2001-08-01
Utilization of green fluorescent protein for the identification of metastasis in an in vivo breast cancer model system. In Preparation. REPRINTS OF ALL...phenotype. Utilizing the SUM-159PT cell line stably transfected with pEGFP-Ci (enhanced green fluorescent protein ) we have been able to successfully...accurately detected. To develop a model with enhanced resolution of micrometastases we created a stable cell line expressing green fluorescent protein
N J, Shivaramu; B N, Lakshminarasappa; K R, Nagabhushana; H C, Swart; Fouran, Singh
2018-01-15
Nanocrystalline Er 3+ doped Y 2 O 3 crystals were prepared by a sol gel technique. X-ray diffraction (XRD) patterns showed the cubic structure of Y 2 O 3 and the crystallite size was found to be ~25nm. Optical absorption showed absorption peaks at 454, 495 and 521nm. These peaks are attributed to the 4 F 3/2 + 4 F 5/2 , 4 F 7/2 and 2 H 11/2 + 4 S 3/2 transitions of Er 3+ . Under excitation at 378nm, the appearance of strong green (520-565nm) down conversion emission assigned to the ( 2 H 11/2, 4 S 3/2 )→ 4 I 15/2 transition and the feeble red (650-665nm) emission is assigned to the 4 F 9/2 → 4 I 15/2 transition. The color chromaticity coordinates showed emission in the green region. The strong green emission of Y 2 O 3 :Er 3+ nanophosphor may be useful for applications in solid compact laser devices. Thermoluminescence (TL) studies of γ-irradiated Y 2 O 3 :Er 3+ showed a prominent TL glow peak maximum at 383K along with a less intense shoulder peak at ~425K and a weak glow at 598K. TL emission peaks with maxima at 545, 490, 588 and 622nm for the doped sample were observed at a temperature of 383K and these emissions were due to defect related to the host material. TL kinetic parameters were calculated by a glow curve deconvolution (GCD) method and the obtained results are discussed in detail for their possible usage in high dose dosimetry. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
N. J., Shivaramu; B. N., Lakshminarasappa; K. R., Nagabhushana; H. C., Swart; Fouran, Singh
2018-01-01
Nanocrystalline Er3 + doped Y2O3crystals were prepared by a sol gel technique. X-ray diffraction (XRD) patterns showed the cubic structure of Y2O3 and the crystallite size was found to be 25 nm. Optical absorption showed absorption peaks at 454, 495 and 521 nm. These peaks are attributed to the 4F3/2 + 4F5/2, 4F7/2 and 2H11/2 + 4S3/2 transitions of Er3 +. Under excitation at 378 nm, the appearance of strong green (520-565 nm) down conversion emission assigned to the (2H11/2,4S3/2) → 4I15/2 transition and the feeble red (650-665 nm) emission is assigned to the 4F9/2 → 4I15/2 transition. The color chromaticity coordinates showed emission in the green region. The strong green emission of Y2O3:Er3 + nanophosphor may be useful for applications in solid compact laser devices. Thermoluminescence (TL) studies of γ-irradiated Y2O3:Er3 + showed a prominent TL glow peak maximum at 383 K along with a less intense shoulder peak at 425 K and a weak glow at 598 K. TL emission peaks with maxima at 545, 490, 588 and 622 nm for the doped sample were observed at a temperature of 383 K and these emissions were due to defect related to the host material. TL kinetic parameters were calculated by a glow curve deconvolution (GCD) method and the obtained results are discussed in detail for their possible usage in high dose dosimetry.
Song, Jin Ah; Kim, Na Na; Choi, Young Jae; Choi, Cheol Young
2016-07-22
We investigated the effect of light spectra on retinal damage and stress in goldfish using green (530 nm) and red (620 nm) light emitting diodes (LEDs) at three intensities each (0.5, 1.0, and 1.5 W/m(2)). We measured the change in the levels of plasma cortisol and H2O2 and expression and levels of caspase-3. The apoptotic response of green and red LED spectra was assessed using the terminal transferase dUTP nick end labeling (TUNEL) assay. Stress indicator (cortisol and H2O2) and apoptosis-related genes (caspase-3) decreased in green light, but increased in red light with higher light intensities over time. The TUNEL assay revealed that more apoptotic cells were detected in outer nuclear layers after exposure to red LED over time with the increase in light intensity, than the other spectra. These results indicate that green light efficiently reduces retinal damage and stress, whereas red light induces it. Therefore, red light-induced retina damage may induce apoptosis in goldfish retina. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Choi, Yoonho; Kang, Sehyeon; Cha, Song-Hyun; Kim, Hyun-Seok; Song, Kwangho; Lee, You Jeong; Kim, Kyeongsoon; Kim, Yeong Shik; Cho, Seonho; Park, Youmie
2018-01-01
A green synthesis of gold and silver nanoparticles is described in the present report using platycodon saponins from Platycodi Radix ( Platycodon grandiflorum) as reducing agents. Platycodin D (PD), a major triterpenoidal platycodon saponin, was enriched by an enzymatic transformation of an aqueous extract of Platycodi Radix. This PD-enriched fraction was utilized for processing reduction reactions of gold and silver salts to synthesize gold nanoparticles (PD-AuNPs) and silver nanoparticles (PD-AgNPs), respectively. No other chemicals were introduced during the reduction reactions, providing an entirely green, eco-friendly, and sustainable method. UV-visible spectra showed the surface plasmon resonance bands of PD-AuNPs at 536 nm and PD-AgNPs at 427 nm. Spherically shaped nanoparticles were observed from high-resolution transmission electron microscopy with average diameters of 14.94 ± 2.14 nm for PD-AuNPs and 18.40 ± 3.20 nm for PD-AgNPs. Minor triangular and other polygonal shapes were also observed for PD-AuNPs along with spherical ones. Atomic force microscopy (AFM) images also demonstrated that both nanoparticles were mostly spherical in shape. Curvature-dependent evolution was employed to enhance the AFM images and precisely measure the sizes of the nanoparticles. The sizes were measured as 19.14 nm for PD-AuNPs and 29.93 nm for PD-AgNPs from the enhanced AFM images. Face-centered cubic structures for both nanoparticles were confirmed by strong diffraction patterns from high-resolution X-ray diffraction analyses. Fourier transform infrared spectra revealed the contribution of -OH, aromatic C=C, C-O, and C-H functional groups to the synthesis. Furthermore, the catalytic activity of PD-AuNPs was assessed with a reduction reaction of 4-nitrophenol to 4-aminophenol in the presence of sodium borohydride. The catalytic activity results suggest the potential application of these gold nanoparticles as catalysts in the future. The green strategy reported in this study using saponins as reducing agents will pave new roads to develop novel nanomaterials with versatile applications.
Viviani, Vadim R; Neves, Deimison Rodrigues; Amaral, Danilo Trabuco; Prado, Rogilene A; Matsuhashi, Takuto; Hirano, Takashi
2014-08-19
Beetle luciferases produce different bioluminescence colors from green to red using the same d-luciferin substrate. Despite many studies of the mechanisms and structural determinants of bioluminescence colors with firefly luciferases, the identity of the emitters and the specific active site interactions responsible for bioluminescence color modulation remain elusive. To address these questions, we analyzed the bioluminescence spectra with 6'-amino-D-luciferin (aminoluciferin) and its 5,5-dimethyl analogue using a set of recombinant beetle luciferases that naturally elicit different colors and different pH sensitivities (pH-sensitive, Amydetes vivianii λmax=538 nm, Macrolampis sp2 λmax=564 nm; pH-insensitive, Phrixotrix hirtus λmax=623 nm, Phrixotrix vivianii λmax=546 nm, and Pyrearinus termitilluminans λmax=534 nm), a luciferase-like enzyme (Tenebrionidae, Zophobas morio λmax=613 nm), and mutants of C311 (S314). The green-yellow-emitting luciferases display red-shifted bioluminescence spectra with aminoluciferin in relation to those with D-luciferin, whereas the red-emitting luciferases displayed blue-shifted spectra. Bioluminescence spectra with 5,5-dimethylaminoluciferin, in which enolization is blocked, were almost identical to those of aminoluciferin. Fluorescence probing using 2-(4-toluidino)naphthalene-6-sulfonate and inference with aminoluciferin confirm that the luciferin binding site of the red-shifted luciferases is more polar than in the case of the green-yellow-emitting luciferases. Altogether, the results show that the keto form of excited oxyluciferin is the emitter in beetle bioluminescence and that bioluminescence colors are essentially modulated by interactions of the 6'-hydroxy group of oxyluciferin and basic moieties under the influence of the microenvironment polarity of the active site: a strong interaction between a base moiety and oxyluciferin phenol in a hydrophobic microenvironment promotes green-yellow emission, whereas a more polar environment weakens such interaction promoting red shifts. In pH-sensitive luciferases, a pH-mediated switch from a closed hydrophobic conformation to a more open polar conformation promotes the typical red shift.
Chicken manure enhanced yield and quality of field-grown kale and collard greens.
Antonious, George F; Turley, Eric T; Hill, Regina R; Snyder, John C
2014-01-01
Organic matter and nutrients in municipal sewage sludge (SS) and chicken manure (CM) could be recycled and used for land farming to enhance fertility and physical properties of soils. Three soil management practices were used at Kentucky State University Research Farm, Franklin County, to study the impact of soil amendments on kale (Brassica oleracea cv. Winterbar) and collard (Brassica oleracea cv. Top Bunch) yields and quality. The three soil management practices were: (i) SS mixed with native soil at 15 t acre(-1), (ii) CM mixed with native soil at 15 t acre(-1), and (iii) no-mulch (NM) native soil for comparison purposes. At harvest, collard and kale green plants were graded according to USDA standards. Plants grown in CM and SS amended soil produced the greatest number of U.S. No. 1 grade of collard and kale greens compared to NM native soil. Across all treatments, concentrations of ascorbic acid and phenols were generally greater in kale than in collards. Overall, CM and SS enhanced total phenols and ascorbic acid contents of kale and collard compared to NM native soil. We investigated the chemical and physical properties of each of the three soil treatments that might explain variability among treatments and the impact of soil amendments on yield, phenols, and ascorbic acid contents of kale and collard green grown under this practice.
Chlorophyll as a biomarker for early disease diagnosis
NASA Astrophysics Data System (ADS)
Manzoor Atta, Babar; Saleem, M.; Ali, Hina; Arshad, Hafiz Muhammad Imran; Ahmed, M.
2018-06-01
The current study was designed to identify the stage for the diagnosis of disease before visible symptoms appeared. Fluorescence spectroscopy has been employed to identify disease signatures for its early diagnosis in rice plant leaves. Bacterial leaf blight (BLB) diseased and healthy leaf samples were collected from the rice fields in September, 2017 which were then used to record spectra using an excitation wavelength at 410 nm. The spectral range of emission was set from 420 to 800 nm which covers the blue–green and the chlorophyll bands. It was found that diseased leaves have a narrower ‘chlorophyll a’ band than healthy ones, and furthermore, that the emission band at 730 nm was either declined or depleted in the sample with high infection symptoms. In contrast, the blue–green region was observed to increase due to the emergence of disease. As the band intensity of chlorophyll decreases during infection, this decrease in chlorophyll content and increase in the blue–green spectral region could provide a new approach for predicting BLB at an early stage. The important finding was that the chlorophyll degradation and rise in the blue–green region take place in leaves with BLB or during BLB infection. Principal component analysis has been applied to spectral data which successfully separated diseased samples from healthy ones even with very small spectral variations.
Synthesis and Crystal Structure of Highly Strained [4]Cyclofluorene: Green-Emitting Fluorophore.
Liu, Yu-Yu; Lin, Jin-Yi; Bo, Yi-Fan; Xie, Ling-Hai; Yi, Ming-Dong; Zhang, Xin-Wen; Zhang, Hong-Mei; Loh, Teck-Peng; Huang, Wei
2016-01-15
[4]Cyclo-9,9-dipropyl-2,7-fluorene ([4]CF) with the strain energy of 79.8 kcal/mol is synthesized in high quantum yield. Impressively, hoop-shaped [4]CF exhibits a green fluorescence emission around 512 nm offering a new explanation for the green band (g-band) in polyfluorenes. The solution-processed [4]CF-based organic light emitting diode (OLED) has also been fabricated with the a stronger green band emission. Strained semiconductors offer a promising approach to fabricating multifunctional optoelectronic materials in organic electronics and biomedicine.
NASA Technical Reports Server (NTRS)
Heath, D. F.; Repoff, T. P.; Donnelly, R. F.
1984-01-01
Observations of temporal variations of the solar UV spectral irradiance over several days to a few weeks in the 160-400 nm wavelength range are presented. Larger 28-day variations and a second episode of 13-day variations occurred during the second year of measurements. The thirteen day periodicity is not a harmonic of the 28-day periodicity. The 13-day periodicity dominates certain episodes of solar activity while others are dominated by 28-day periods accompanied by a week 14-day harmonic. Techniques for removing noise and long-term trends are described. Time series analysis results are presented for the Si II lines near 182 nm, the Al I continuum in the 190 nm to 205 nm range, the Mg I continuum in the 210 nm to 250 nm range, the MgII H & K lines at 280 nm, the Mg I line at 285 nm, and the Ca II K & H lines at 393 and 397 nm.
Molecular Iodine Fluorescence Using a Green Helium-Neon Laser
ERIC Educational Resources Information Center
Williamson, J. Charles
2011-01-01
Excitation of molecular iodine vapor with a green (543.4 nm) helium-neon laser produces a fluorescence spectrum that is well suited for the upper-level undergraduate physical chemistry laboratory. Application of standard evaluation techniques to the spectrum yields ground electronic-state molecular parameters in good agreement with literature…
Generation of intensity covariations of the oxygen green and red lines in the nightglow
NASA Astrophysics Data System (ADS)
Misawa, K.; Takeuchi, I.; Kato, Y.; Aoyama, I.
1984-02-01
The cause of intensity covariations of the oxygen green and red lines is studied. Intensity covariations are compared with the auroral-electrojet-activity index AE, the substorm Pi2, and the magnetogram. It is suggested that intensity covariations or double-intensity maxima of the red line occur in association with intense auroral substorms, and that they are the direct experimental evidences of Testud's theory (1973).
NASA Astrophysics Data System (ADS)
Bodner, George M.
2017-08-01
When the author first became involved with the Green Chemistry movement, he noted that his colleagues in industry who were involved in one of the ACS Green Chemistry Institute® industrial roundtables emphasized the take-home message they described as the "triple bottom line." They noted that introducing Green Chemistry in industrial settings had economic, social, and environmental benefits. As someone who first went to school at age 5, and has been "going to school" most days for 65 years, it was easy for the author to see why introducing Green Chemistry into academics had similar beneficial effects within the context of economic, social and environmental domains at the college/university level. He was prepared to understand why faculty who had taught traditional courses often saw the advantage of incorporating Green Chemistry into the courses they teach. What was not as obvious is why students who were encountering chemistry for the first time were often equally passionate about the Green Chemistry movement. Recent attention has been paid, however, to a model that brings clarity to the hitherto vague term of "relevance" that might explain why integrating Green Chemistry into the undergraduate chemistry classroom can achieve a "quadruple bottom-line" for students because of potentially positive effects of adding a domain of "relevance" to the existing economic, social, and environmental domains.
Lee, Jihyoung; Matsumura, Kenta; Yamakoshi, Ken-ichi; Rolfe, Peter; Tanaka, Shinobu; Yamakoshi, Takehiro
2013-01-01
Reflection photoplethysmography (PPG) using 530 nm (green) wavelength light has the potential to be a superior method for monitoring heart rate (HR) during normal daily life due to its relative freedom from artifacts. However, little is known about the accuracy of pulse rate (PR) measured by 530 nm light PPG during motion. Therefore, we compared the HR measured by electrocadiography (ECG) as a reference with PR measured by 530, 645 (red), and 470 nm (blue) wavelength light PPG during baseline and while performing hand waving in 12 participants. In addition, we examined the change of signal-to-noise ratio (SNR) by motion for each of the three wavelengths used for the PPG. The results showed that the limit of agreement in Bland-Altman plots between the HR measured by ECG and PR measured by 530 nm light PPG (±0.61 bpm) was smaller than that achieved when using 645 and 470 nm light PPG (±3.20 bpm and ±2.23 bpm, respectively). The ΔSNR (the difference between baseline and task values) of 530 and 470nm light PPG was significantly smaller than ΔSNR for red light PPG. In conclusion, 530 nm light PPG could be a more suitable method than 645 and 470nm light PPG for monitoring HR in normal daily life.
Profiling USGA putting greens using GPR
USDA-ARS?s Scientific Manuscript database
All USGA-specification putting greens require a subsurface drainage system. A typical subsurface installation is a herringbone pattern of buried 100-mm dia. PVC drainage pipes, designed such that the central main line is placed along the line of maximum slope. Laterals are spaced no more than 5 m, r...
Broadband, Achromatic Twyman-Green Interferometer
NASA Technical Reports Server (NTRS)
Steimle, Lawrence J.
1991-01-01
Improved Twyman-Green interferometer used in wave-front testing optical components at wavelengths from 200 to 1,100 nm, without having to readjust focus when changing wavelength. Built to measure aberrations of light passing through optical filters. Collimating and imaging lenses of classical Twyman-Green configuration replaced by single spherical mirror. Field lens replaced by field mirror. Mirrors exhibit no axial chromatic aberration and made to reflect light efficiently over desired broad range of wavelengths.
A photoswitchable orange-to-far-red fluorescent protein, PSmOrange.
Subach, Oksana M; Patterson, George H; Ting, Li-Min; Wang, Yarong; Condeelis, John S; Verkhusha, Vladislav V
2011-07-31
We report a photoswitchable monomeric Orange (PSmOrange) protein that is initially orange (excitation, 548 nm; emission, 565 nm) but becomes far-red (excitation, 636 nm; emission, 662 nm) after irradiation with blue-green light. Compared to its parental orange proteins, PSmOrange has greater brightness, faster maturation, higher photoconversion contrast and better photostability. The red-shifted spectra of both forms of PSmOrange enable its simultaneous use with cyan-to-green photoswitchable proteins to study four intracellular populations. Photoconverted PSmOrange has, to our knowledge, the most far-red excitation peak of all GFP-like fluorescent proteins, provides diffraction-limited and super-resolution imaging in the far-red light range, is optimally excited with common red lasers, and can be photoconverted subcutaneously in a mouse. PSmOrange photoswitching occurs via a two-step photo-oxidation process, which causes cleavage of the polypeptide backbone. The far-red fluorescence of photoconverted PSmOrange results from a new chromophore containing N-acylimine with a co-planar carbon-oxygen double bond.
A green chemical approach for synthesis of shape anisotropic gold nanoparticles
NASA Astrophysics Data System (ADS)
Kalyan Kamal, S. S.; Vimala, J.; Sahoo, P. K.; Ghosal, P.; Ram, S.; Durai, L.
2014-06-01
A complete green chemical reaction between aurochloric acid and tea polyphenols resulted in the reduction of Au3+ → Au0. The reaction was carried out in a Teflon-coated bomb digestion vessel at 200 °C. It was observed that with increasing the reaction time from 1 to 5 h, the shape of the nanoparticles changed from spherical- to rod-like structures. The reaction was followed with the help of UV-vis spectrometer, which showed a single absorption peak at 548 nm for 1-h reaction product and two peaks for a 5-h reaction product at 533 and 745 nm corresponding to the transverse and longitudinal surface plasmon resonance bands. Microstructures obtained from transmission electron microscope revealed that the samples obtained after 1-h reaction are predominantly spherical in shape with an average size of 15 nm. Whereas samples obtained after 5 h of reaction exhibited rod-like structures with an average size of 45 nm.
The red and green lines of atomic oxygen in the nightglow of Venus
NASA Technical Reports Server (NTRS)
Fox, J. L.
1990-01-01
O(1D) and O(1S), the excited states that give rise to the atomic oxygen red and green lines, are produced in the Venus nightglow in dissociative recombination of O2(+). The emissions should also be excited by precipitation of soft electrons, the suggested source of the 'auroral' emission features of atomic oxygen at 1304 and 1356 A, which have been reported from observations of the Pioneer Venus Orbiter Ultraviolet Spectrometer. No emisison at 6300 or 5577 A was detected, however, by the visible spectrophotometers on the Soviet spacecraft Veneras 9 and 10; upper limits have been placed on the intensities of these features. The constraints placed on models for the auroral production mechanism by the Venera upper limits by modeling the intensities of the red and green lines in the nightglow are evaluated, combining a model for the vibrational distribution of O2(+) on the nightside of Venus with rate coefficients recently computed by Guberman for production of O(1S) and O(1D) in dissociative recombination of O2(+) from different vibrational levels. The integrated overhead intensities are 1 - 2 R for the green line and about 46 R for the red line.
de Azevedo, Lyvia Vidinho; de Barros, Henrique Lins; Keim, Carolina Neumann; Acosta-Avalos, Daniel
2013-09-01
'Candidatus Magnetoglobus multicellularis' is a magnetotactic microorganism composed of several bacterial cells. Presently, it is the best known multicellular magnetotactic prokaryote (MMP). Recently, it has been observed that MMPs present a negative photoresponse to high intensity ultraviolet and violet-blue light. In this work, we studied the movement of 'Candidatus Magnetoglobus multicellularis' under low intensity light of different wavelengths, measuring the average velocity and the time to reorient its trajectory when the external magnetic field changes its direction (U-turn time). Our results show that the mean average velocity is higher for red light (628 nm) and lower for green light (517 nm) as compared to yellow (596 nm) and blue (469 nm) light, and the U-turn time decreased for green light illumination. The light wavelength velocity dependence can be understood as variation in flagella rotation speed, being increased by the red light and decreased by the green light relative to yellow and blue light. It is suggested that the dependence of the U-turn time on light wavelength can be considered a form of light-dependent magnetotaxis, because this time represents the magnetic sensibility of the magnetotactic microorganisms. The cellular and molecular mechanisms for this light-dependent velocity and magnetotaxis are unknown and deserve further studies to understand the biochemical interactions and the ecological roles of the different mechanisms of taxis in MMPs.
NASA Technical Reports Server (NTRS)
Theisen, Arnold F.
2000-01-01
Solar-stimulated chlorophyll fluorescence measured with the Fraunhofer line depth method has correlated well with vegetation stress in previous studies. However, the instruments used in those studies were limited to a single solar absorption line (e.g. 656.3 nm), obviating the red/far-red ratio (R/FR) method. Optics and detector technology have reached the level whereby multiple, very narrow Fraunhofer lines are resolvable. Thirteen such lines span the visible spectrum in the red to far-red region where chlorophyll fluorescence occurs. Fluorescence intensities at the 13 Fraunhofer line wavelengths were used to model emission spectra. The source data were collected for summer and fall bean crops (Phaseolus vulgaris L.) subjected to various levels of nitrogen fertilization. The intensities were adjusted to account for Fraunhofer line depth and atmospheric transmittance. Multiple R/FR fluorescence ratios, calculated from the modeled fluorescence spectra, correlated strongly with leaf chlorophyll concentration and well with applied nitrogen. The ratio yielding the best correlation with chlorophyll utilized red fluorescence at the 694.5 nm Fraunhofer line and farred fluorescence at the 755.6 nm Fraunhofer line. Twenty R/FR ratios, each evaluated for the maximum differential between low and high (optimal) nitrogen treatments, ranked higher in some cases and lower in others, possibly related to the time of year the crops were grown and the stage of growth of the crops. Ratios with 728.9 nm and 738.9 nm in the denominator consistently ranked in the lowest and next lowest quartile, respectively. Ratios of the 656.3 nm Fraunhofer line and the 755.6 nm line consistently ranked highest for the summer crop. Ratios with 755.6 nm in the denominator ranked in the upper quartile for 10 out of 12 measurement dates. Differences in ratio ranking indicate that physiological conditions may be estimated using selected ratios of Fraunhofer lines within the context of R/FR analysis. A passive instrument designed to monitor R/FR chlorophyll fluorescence (i.e. vegetation stress) from orbit could be built today.
Nanostructures of Indium Gallium Nitride Crystals Grown on Carbon Nanotubes.
Park, Ji-Yeon; Man Song, Keun; Min, Yo-Sep; Choi, Chel-Jong; Seok Kim, Yoon; Lee, Sung-Nam
2015-11-16
Nanostructure (NS) InGaN crystals were grown on carbon nanotubes (CNTs) using metalorganic chemical vapor deposition. The NS-InGaN crystals, grown on a ~5-μm-long CNT/Si template, were estimated to be ~100-270 nm in size. Transmission electron microscope examinations revealed that single-crystalline InGaN NSs were formed with different crystal facets. The observed green (~500 nm) cathodoluminescence (CL) emission was consistent with the surface image of the NS-InGaN crystallites, indicating excellent optical properties of the InGaN NSs on CNTs. Moreover, the CL spectrum of InGaN NSs showed a broad emission band from 490 to 600 nm. Based on these results, we believe that InGaN NSs grown on CNTs could aid in overcoming the green gap in LED technologies.
Electro-holographic display using a ZBLAN glass as the image space.
Son, Jung-Young; Lee, Hyoung; Byeon, Jina; Zhao, Jiangbo; Ebendorff-Heidepriem, Heike
2017-04-01
An Er3+-doped ZBLAN glass is used to display a 360° viewable reconstructed image from a hologram on a DMD. The reconstructed image, when the hologram is illuminated by a 852 nm wavelength laser beam, is situated at the inside of the glass, and then a 1530 nm wavelength laser beam is crossed through the image to light it with an upconversion green light, which is viewable at all surrounding directions. This enables us to eliminate the limitation of the viewing zone angle imposed by the finite size of pixels in electro-holographic displays based on digital display chips/panels. The amount of the green light is much higher than that known previously. This is partly caused by the upconversion luminescence induced by 852 and 1530 nm laser beams.
Efe, Lale; Killi, Fatih; Mustafayev, Sefer A
2009-10-15
In the study carried out in 2002-2003 in the East Mediterranean region of Turkey (in Kahramanmaras Province), four different naturally coloured cotton (Gossypium hirsutum L.) (dark brown, light brown, cream and green) lines from Azerbaijan and two white linted cotton varieties (Maras-92 and Sayar-314 (G. hirsutum L.)) of the region were used as material. The aim of this study was to determine seed cotton yield and yield components and major lint quality traits of investigated coloured cotton lines comprising white linted local standard cotton varieties. Field trials were established in randomized block design with four blocks. According to two year's results, it was determined that naturally coloured cottons were found similar to both white linted standard cotton varieties for sympodia number and seed cotton yield. For boll number per plant, except green cotton line all coloured cotton lines were similar to standard varieties or even some of them were better than standards. For ginning outturn, dark brown, cream and green cotton lines were found statistically similar to standard Maras-92. But all naturally coloured cotton lines had lower seed cotton weight per boll and generally lower fiber quality than white linted standard varieties. For fiber length and fiber strength cream cotton line was the best coloured cotton. And for fiber fineness only green cotton line was better than both standards. It can be said that naturally coloured cotton lines need to be improved especially for fiber quality characters in the East Mediterranean region of Turkey.
Gong, Deyan; Han, Shi-Chong; Iqbal, Anam; Qian, Jing; Cao, Ting; Liu, Wei; Liu, Weisheng; Qin, Wenwu; Guo, Huichen
2017-12-19
Two fluorescent, m-nitrophenol-substituted difluoroboron dipyrromethene dyes have been designed by nucleophilic substitution reaction of 3,5-dichloro-4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY). Nonsymmetric and symmetric probes, that is. BODIPY 1 (with one nitrophenol group at the position 3) and BODIPY 2 (with two nitrophenol groups at the positions 3 and 5) were applied to ratiometric fluorescent glutathione detection. The detection is based on the two-step nucleophilic aromatic substitution of the nitrophenol groups of the probes by glutathione in buffer solution containing CTAB. In the first stage, probe 1 showed ratiometric fluorescent color change from green (λ em = 530 nm) to yellow (λ em = 561 nm) because of monosubstitution with glutathione (I 561nm /I 530nm ). Addition of excess glutathione caused the second stage of ratiometric fluorescent color change from yellow to reddish orange (λ em = 596 nm, I 596nm /I 561nm ) due to disubstitution with glutathione. Therefore, different concentration ranges of glutathione (from less to excess) could be rapidly detected by the two-stage ratiometric fluorescent probe 1 in 5 min. While, probe 2 shows single-stage ratiometric fluorescent detection to GSH (from green to reddish orange, I 596nm /I 535nm ). Probes 1 and 2 exhibit excellent properties with sensitive, specific colorimetric response and ratiometric fluorescent response to glutathione over other sulfur nucleophiles. Application to cellular ratiometric fluorescence imaging indicated that the probes were highly responsive to intracellular glutathione.
The advantages of wearable green reflected photoplethysmography.
Maeda, Yuka; Sekine, Masaki; Tamura, Toshiyo
2011-10-01
This report evaluates the efficacy of reflected-type green light photoplethysmography (green light PPG). Transmitted infrared light was used for PPG and the arterial pulse was monitored transcutaneously. The reflected PPG signal contains AC components based on the heartbeat-related signal from the arterial blood flow and DC components, which include reflectance and scattering from tissue. Generally, changes in AC components are monitored, but the DC components play an important role during heat stress. In this study, we compared the signal of green light PPG to infrared PPG and ECG during heat stress. The wavelengths of the green and infrared light were 525 nm and 880 nm, respectively. Experiments were performed on young healthy subjects in cold (10°C), hot (45°C), and normal environments. The pulse rates were compared among three measurement devices and the AC and DC components of the PPG signal were evaluated during heat stress. The pulse rates obtained from green light PPG were strongly correlated with the R-R interval of an electrocardiogram in all environments, but those obtained from infrared light PPG displayed a weaker correlation with cold exposure. The AC components were of similar signal output for both wavelengths during heat stress. Also, the DC components for green light PPG were similar during heat stress, but showed less signal output for infrared light PPG during hot exposure. The main reason for the reduced DC components was speculated to be the increased blood flow at the vascular bed. Therefore, reflected green light PPG can be useful for pulse rate monitoring because it is less influenced by the tissue and vein region.
Ohad, Itzakh; Clayton, Roderick K.; Bogorad, Lawrence
1979-01-01
Preparations of allophycocyanin isolated from the alga Fremyella diplosiphon show light-induced optical absorbance changes that suggest the presence of a photoconvertible component [Formula: see text] similar to the algal pigments described by J. Scheibe [(1972) Science 176, 1037-1039]. At pH < 4 the allophycocyanin has an absorption maximum at 620 nm. Red illumination causes a loss of absorbance in the red, centered at 620 nm, and subsequent green illumination restores the lost absorbance. We have studied this photoconversion at temperatures between 200 K and 307 K, analyzing the results in terms of photostationary states established under red (640 nm) and green (550 nm) light. As the temperature was lowered to 260 K, the state Pr became progressively favored; the reaction Pr → Pg induced by red light was attenuated but the reaction Pg → Pr induced by green light was not. Decreasing the temperature from 260 K to 200 K had no further effect. Two distinct and simple models can account for this curious temperature dependence. By analyzing the kinetic and steady-state data, with reasonable estimates of the molar extinction coefficients of Pr and Pg, we computed quantum efficiencies greater than 15% for the photoconversion at 300 K. We deduced that a conversion of “all Pr” to “all Pg” should produce a fractional absorbance change ΔA/A at 620 nm equal to 0.1. If the chromatic adaptation response of intact F. diplosiphon shows the unusual temperature dependence reported here, the system Pr ⇌ Pg will be implicated in mediating this response. PMID:16592721
Shehata, Mostafa A; Fawaz, Esraa M; El-Rahman, Mohamed K Abd; Abdel-Moety, Ezzat M
2017-11-30
Acquisition of the dissolution profiles of more than single active ingredient in a multi-analyte pharmaceutical formulation is a mandatory manufacturing practice that is dominated by utilization of the off-line separation-based chromatographic methods. This contribution adopts a new "Double-Track" approach with the ultimate goal of advancing the in-line potentiometric sensors to their most effective applicability for simultaneous acquisition of the dissolution profiles of two active ingredients in a binary pharmaceutical formulation. The unique abilities of these sensors for real-time measurements is the key driver for adoption of "green analytical chemistry" (GAC) principles aiming to expand the application of eco-friendly analytical methods With the aim of performing a side-by-side comparison, this work investigates the degree of adherence of ISEs to the 12 principles of GAC in multicomponent dissolution profiling with respect to the HPLC. For the proof of concept, a binary mixture of naproxen sodium (NAPR) and diphenhydramine hydrochloride (DIPH) marketed as Aleve pm ® tablets was selected as a model for which dissolution profiles were attained by two techniques. The first "Double-Track" in-line strategy depends on dipping two highly integrated membrane sensors for continuous monitoring of the dissolution of each active pharmaceutical ingredient (API) by tracing the e.m.f change over the time scale. For the determination of NAPR, sensor I was developed using tridodecyl methyl ammonium chloride as an anion exchanger, while sensor II was developed for the determination of DIPH using potassium tetrakis (4-chlorophenyl) borate as a cation exchanger. The second off-line strategy utilizes a separation-based HPLC method via off-line tracking the increase of peak area by UV detection at 220nm over time using a mobile phase of acetonitrile: water (90:10) pH 3. The advantages of the newly introduced "Double-Track" approach regarding GAC principles are highlighted, and the merits of these benign real-time analyzers (ISEs) that can deliver equivalent analytical results as HPLC while significantly reducing solvent consumption/waste generation are described. Copyright © 2017 Elsevier B.V. All rights reserved.
Intense excitation source of blue-green laser
NASA Astrophysics Data System (ADS)
Han, K. S.
1985-10-01
An intense and efficient excitation source for blue-green lasers useful for the space-based satellite laser applications, underwater strategic communication, and measurement of ocean bottom profile is being developed. The source in use, hypocycloidal pinch plasma (HCP), and a newly designed dense-plasma focus (DPF) can produce intense UV photons (200 to 300 nm) which match the absorption spectra of both near UV and blue green dye lasers (300 to 400 nm). During the current project period, the successful enhancement of blue-green laser output of both Coumarin 503 and LD490 dye through the spectral conversion of the HCP pumping light has been achieved with a converter dye BBQ. The factor of enhancement in the blue-green laser output energy of both Coumarin 503 and LD490 is almost 73%. This enhancement will definitely be helpful in achieving the direct high power blue-green laser (> 1 MW) with the existing blue green dye laser. On the other hand the dense-plasma focus (DPF) with new optical coupling has been designed and constructed. For the optimization of the DPF device as the UV pumping light source, the velocity of current sheath and the formation of plasma focus have been measured as function of argon or argon-deuterium fill gas pressure. Finally, the blue-green dye laser (LD490) has been pumped with the DPF device for preliminary tests. Experimental results with the DPF device show that the velocity of the current sheath follows the inverse relation of sq st. of pressure as expected. The blue-green dye (LD490) laser output exceeded 3.1 m at the best cavity tuning of laser system. This corresponds to 3J/1 cu cm laser energy extraction.
High-Temperature Spintronic Devices and Circuits in Absence of Magnetic Field
2012-04-23
non-equilibrium Green’s function (NEGF) formalism. • Molecular beam epitaxy (MBE) growth of ferromagnetic metals (Fe, MnAs) and...measured for two diode injection currents in the Faraday geometry. The quantum dot microcavity device was grown by molecular beam epitaxy with a low...channel (10 nm, lxlOl9j Mn-doped) / undoped-AlAs (1 nm) tunnel barrier / undoped-GaAs (0.5 nm) / MnAs (25 nm) were grown by molecular beam epitaxy (MBE
A water marker monitored by satellites to predict seasonal endemic cholera.
Jutla, Antarpreet; Akanda, Ali Shafqat; Huq, Anwar; Faruque, Abu Syed Golam; Colwell, Rita; Islam, Shafiqul
2013-01-01
The ability to predict an occurrence of cholera, a water-related disease, offers a significant public health advantage. Satellite based estimates of chlorophyll, a surrogate for plankton abundance, have been linked to cholera incidence. However, cholera bacteria can survive under a variety of coastal ecological conditions, thus constraining the predictive ability of the chlorophyll, since it provides only an estimate of greenness of seawater. Here, a new remote sensing based index is proposed: Satellite Water Marker (SWM), which estimates condition of coastal water, based on observed variability in the difference between blue (412 nm) and green (555 nm) wavelengths that can be related to seasonal cholera incidence. The index is bounded between physically separable wavelengths for relatively clear (blue) and turbid (green) water. Using SWM, prediction of cholera with reasonable accuracy, with at least two month in advance, can potentially be achieved in the endemic coastal regions.
Stavenga, Doekele G.; Wilts, Bodo D.; Leertouwer, Hein L.; Hariyama, Takahiko
2011-01-01
The elytra of the Japanese jewel beetle Chrysochroa fulgidissima are metallic green with purple stripes. Scanning electron microscopy and atomic force microscopy demonstrated that the elytral surface is approximately flat. The accordingly specular green and purple areas have, with normal illumination, 100–150 nm broad reflectance bands, peaking at about 530 and 700 nm. The bands shift progressively towards shorter wavelengths with increasing oblique illumination, and the reflection then becomes highly polarized. Transmission electron microscopy revealed that the epicuticle of the green and purple areas consists of stacks of 16 and 12 layers, respectively. Assuming gradient refractive index values of the layers between 1.6 and 1.7 and applying the classical multilayer theory allowed modelling of the measured polarization- and angle-dependent reflectance spectra. The extreme polarized iridescence exhibited by the elytra of the jewel beetle may have a function in intraspecific recognition. PMID:21282175
33 CFR 80.110 - Casco Bay, ME.
Code of Federal Regulations, 2010 CFR
2010-07-01
... northernmost extremity of Jewell Island. (b) A line drawn from the tower on Jewell Island charted in approximate position latitude 43°40.6′ N. longitude 70°05.9′ W. to the northeasternmost extremity of Outer Green Island. (c) A Line drawn from the southwesternmost extremity of Outer Green Island to Ram Island...
NASA Astrophysics Data System (ADS)
Wang, Bin; Zhao, Jinsheng; Cui, Chuansheng; Wang, Min; Wang, Zhong; He, Qingpeng
2012-05-01
Electrochemical copolymerization of 1,4-bis(2-thienyl)naphthalene (BTN) with pyrene is carried out in acetonitrile (ACN) solution containing sodium perchlorate (NaClO4) as a supporting electrolyte. Characterizations of the resulting copolymer P(BTN-co-pyrene) are performed by cyclic voltammetry (CV), UV-vis spectroscopy, Fourier transform infrared spectroscopy (FT-IR) and scanning electron microscopy (SEM). The P(BTN-co-pyrene) film has distinct electrochromic properties and exhibits three different colors (yellowish green, green and blue) under various potentials. Maximum contrast (ΔT%) and response time of the copolymer film are measured as 37.8% and 1.71 s at 687 nm. An electrochromic device (ECD) based on P(BTN-co-pyrene) and poly(3,4-ethylenedioxythiophene) (PEDOT) is constructed and characterized. Neutral state of device shows green color while oxidized state reveals blue color. This ECD shows a maximum optical contrast (ΔT%) of 24.4% with a response time of 0.43 s at 635 nm. The coloration efficiency (CE) of the device is calculated to be 349 cm2 C-1 at 635 nm. In addition, the ECD also has satisfactory optical memories and redox stability.
USDA-ARS?s Scientific Manuscript database
The use of "green" processes for the synthesis of nanoparticles is a new branch of nanotechnology. However, knowledge of the bioactivity of nanoparticles against mosquitoes and malaria parasites is limited. We tested silver nanoparticles (average size 450 nm) bio-reduced in 5% Cassia occidentalis ...
Interfering with DNA Damage Signals: Radiosensitizing Prostate Cancer Using Small Peptides
2009-05-01
25-l sample of the supernatant was analyzed for free phosphate in the malachite green assay by dilution with 100 l of a developing solution... malachite green). After incubation for 15 min, the release of phosphate was quantified by measuring the absorbance at 650 nm in a microtiter plate reader
Interfering with DNA Damage Signals: Radiosensitizing Prostate Cancer using Small Peptides
2007-11-01
were pelleted, and a 25-l sample of the supernatant was analyzed for free phosphate in the malachite green assay by dilution with 100 l of a...developing solution ( malachite green). After incubation for 15 min, the release of phosphate was quantified by measuring the absorbance at 650 nm in a
The First Mutant of the Aequorea victoria Green Fluorescent Protein That Forms a Red Chromophore†
Mishin, Alexander S.; Subach, Fedor V.; Yampolsky, Ilia V.; King, William; Lukyanov, Konstantin A.; Verkhusha, Vladislav V.
2010-01-01
Green fluorescent protein (GFP) from a jellyfish, Aequorea victoria, and its mutants are widely used in biomedical studies as fluorescent markers. In spite of the enormous efforts of academia and industry toward generating its red fluorescent mutants, no GFP variants with emission maximum at more than 529 nm have been developed during the 15 years since its cloning. Here, we used a new strategy of molecular evolution aimed at generating a red-emitting mutant of GFP. As a result, we have succeeded in producing the first GFP mutant that substantially matures to the red-emitting state with excitation and emission maxima at 555 and 585 nm, respectively. A novel, nonoxidative mechanism for formation of the red chromophore in this mutant that includes a dehydration of the Ser65 side chain has been proposed. Model experiments showed that the novel dual-color GFP mutant with green and red emission is suitable for multicolor flow cytometry as an additional color since it is clearly separable from both green and red fluorescent tags. PMID:18366185
Green synthesis of carbon quantum dots from lignite coal and the application in Fe3+ detection
NASA Astrophysics Data System (ADS)
Liu, Xuexia; Hao, Juanyuan; Liu, Jianhui; Tao, Hongcai
2018-02-01
Carbon quantum dots (CQDs) had attracted much attention due to their unique structures and excellent properties. Their green preparation was one of the research frontiers. However, most of the CQDs were prepared by strong acid oxidation, the way of which was not friendly to the environment. In this study, CQDs were prepared by green ozone oxidation of lignite coal, which is abundant and inexpensive. The CQDs were well dispersed, the size distribution of the obtained CQDs centralized from 2 to 4 nm with the average diameter of about 2.8 nm. In addition, the as-prepared CQDs containing rich oxygen functional groups exhibited good water-solubility and optical properties with yield reached 35%. The CQDs showed a highly sensitive and selective quenching effect to Fe3+ with desirable anti-interference performance. Moreover, the fluorescence intensity of CQDs had a good linear response to the Fe3+ concentration ranging from 10 to 150 µmol/L with the detection limit of 0.26 µmol/L. This green and facile synthesis method had the prospect of large-scale preparation of CQDs.
Lu, Y.; Nerurkar, V.R.; Aguirre, A.A.; Work, Thierry M.; Balazs, G.H.; Yanagihara, R.
1999-01-01
Thirteen cell lines were established and characterized from brain, kidney, lung, spleen, heart, liver, gall bladder, urinary bladder, pancreas, testis, skin, and periorbital and tumor tissues of an immature male green turtle (Chelonia mydas) with fibropapillomas. Cell lines were optimally maintained at 30A? C in RPMI 1640 medium supplemented with 10% fetal bovine serum. Propagation of the turtle cell lines was serum dependent, and plating efficiencies ranged from 13 to 37%. The cell lines, which have been subcultivated more than 20 times, had a doubling time of approximately 30 to 36 h. When tested for their sensitivity to several fish viruses, most of the cell lines were susceptible to a rhabdovirus, spring viremia carp virus, but refractory to channel catfish virus (a herpesvirus), infectious pancreatic necrosis virus (a birnavirus), and two other fish rhabdoviruses, infectious hematopoietic necrosis virus and viral hemorrhagic septicemia virus. During in vitro subcultivation, tumor-like cell aggregates appeared in cell lines derived from lungs, testis, and periorbital and tumor tissues, and small, naked intranuclear virus particles were detected by thin-section electron microscopy. These cell lines are currently being used in attempts to isolate the putative etiologic virus of green turtle fibropapilloma.
Yao, Shun-chun; Chen, Jian-chao; Lu, Ji-dong; Shen, Yue-liang; Pan, Gang
2015-06-01
In coal-fired plants, Unburned carbon (UC) in fly ash is the major determinant of combustion efficiency in coal-fired boiler. The balance between unburned carbon and NO(x) emissions stresses the need for rapid and accurate methods for the measurement of unburned carbon. Laser-induced breakdown spectroscopy (LIBS) is employed to measure the unburned carbon content in fly ash. In this case, it is found that the C line interference with Fe line at about 248 nm. The interference leads to C could not be quantified independently from Fe. A correction approach for extracting C integrated intensity from the overlapping peak is proposed. The Fe 248.33 nm, Fe 254.60 nm and Fe 272.36 nm lines are used to correct the Fe 247.98 nm line which interference with C 247.86 nm, respectively. Then, the corrected C integrated intensity is compared with the uncorrected C integrated intensity for constructing calibration curves of unburned carbon, and also for the precision and accuracy of repeat measurements. The analysis results show that the regression coefficients of the calibration curves and the precision and accuracy of repeat measurements are improved by correcting C-Fe interference, especially for the fly ash samples with low level unburned carbon content. However, the choice of the Fe line need to avoid a over-correction for C line. Obviously, Fe 254.60 nm is the best
NaK (DX) stimulated emission in the visible
NASA Astrophysics Data System (ADS)
Dinev, S. G.; Hadjichristov, G. B.
1990-12-01
Using optical pumping in the blue 450-470 nm and green 510.6 nm, we have observed molecular laser action in the D→X electronic transition of the heteronuclear NaK molecule. Pumping, emission and competing mechanisms are discussed together with the energy balance of the system.
Jung, Hyunchul; Chung, Wonkeun; Lee, Chang Hun; Kim, Sung Hyun
2012-07-01
White light-emitting diodes (LEDs) were fabricated using GaN-based 380-nm UV LEDs precoated with the composite of blue-emitting polymer (poly[(9,9-dihexylfluorenyl-2,7-diyl)-alt-co-(2-methoxy-5-{2-ethylhexyloxy)-1 ,4-phenylene)]), yellow green-emitting polymer (poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-(1,4-benzo-{2,1',3}-thiadiazole)]), and 605-nm red-emitting quantum dots (QDs). CdSe cores were obtained by solvothermal route using CdO, Se precursors and ZnS shells were synthesized by using diethylzinc, and hexamethyldisilathiane precursors. The optical properties of CdSe/ZnS QDs were characterized by UV-visible and photoluminescence (PL) spectra. The structural data and composition of the QDs were transmission electron microscopy (TEM), and EDX technique. The quantum yield and size of the QDs were 58.7% and about 6.7 nm, respectively. Three-band white light was generated by hybridizing blue (430 nm), green (535 nm), and red (605 nm) emission. The color-rendering index (CRI) of the device was extremely improved by introducing the QDs. The CIE-1931 chromaticity coordinate, color temperature, and CRI of a white LED at 20 mA were (0.379, 0.368), 3969 K, and 90, respectively.
Size-uniform 200 nm particles: fabrication and application to magnetofection.
Mair, Lamar; Ford, Kris; Alam, M d Rowshon; Kole, Ryszard; Fisher, Michael; Superfine, Richard
2009-04-01
We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts, as well as the magnetic force calibration and successful magnetofection of iron particles grown via this method. This work represents the first instance in which metal evaporation onto post structures was used for the formation of released, shape-defined metal particles. Also, our work represents the first use of lithographically defined particles as agents of magnetofection. Using these techniques it is possible to create particles with complex shapes and lateral dimensions as small as 40 nm. Our demonstrated compositionally flexible particles are highly size-uniform due to their photolithographically defined growth substrates, with particle dimensions along two axes fixed at 200 nm; the third axis dimension can be varied from 20 nm to 300 nm during the deposition procedure. Atomic percent of metals incorporated into the particle volume is highly tunable and particles have been synthesized with as many as four different metals. We performed magnetic force calibrations on a single particle size for iron particles using an axially magnetized NeFeB permanent magnet and comparisons are made with commercially available magnetic beads. In order to evalutate their usefulness as magnetofection agents, an antisense oligonucleotide (ODN) designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA, was successfully transfected into a modified HeLa cell line. Magnetically enhanced gene delivery was accomplished in vitro using antisense ODN-laden iron particles followed by application of a field gradient. Magnetically enhanced transfection resulted in a 76% and 139% increase in fluorescence intensity when compared to Lipofectamine and antisense ODN-loaded particles delivered without magnetic treatment, respectively. To our knowledge, these experiments constitute the first use of lithographically defined particles as successful agents for magnetically enhanced transfection of an antisense oligonucleotide.
High-power, continuous-wave, solid-state, single-frequency, tunable source for the ultraviolet.
Aadhi, A; Apurv Chaitanya, N; Singh, R P; Samanta, G K
2014-06-15
We report the development of a compact, high-power, continuous-wave, single-frequency, ultraviolet (UV) source with extended wavelength tunability. The device is based on single-pass, intracavity, second-harmonic-generation (SHG) of the signal radiation of a singly resonant optical parametric oscillator (SRO) working in the visible and near-IR wavelength range. The SRO is pumped in the green with a 25-mm-long, multigrating, MgO doped periodically poled stoichiometric lithium tantalate (MgO:sPPLT) as nonlinear crystal. Using three grating periods, 8.5, 9.0, and 9.5 μm of the MgO:sPPLT crystal and a single set of cavity mirrors, the SRO can be tuned continuously across 710.7-836.3 nm in the signal and corresponding idler across 2115.8-1462.1 nm with maximum idler power of 1.9 W and maximum out-coupled signal power of 254 mW. By frequency-doubling the intracavity signal with a 5-mm-long bismuth borate (BIBO) crystal, we can further tune the SRO continuously over 62.8 nm across 355.4-418.2 nm in the UV with maximum single-frequency UV power, as much as 770 mW at 398.28 nm in a Gaussian beam profile. The UV radiation has an instantaneous line-width of ∼14.5 MHz and peak-peak frequency stability of 151 MHz over 100 s. More than 95% of the tuning range provides UV power >260 mW. Access to lower UV wavelengths can in principle be realized by operating the SRO in the visible using shorter grating periods.
Saturn aurora movies in visible and near-IR observed by Cassini ISS
NASA Astrophysics Data System (ADS)
Dyudina, U.; Wellington, D.; Ewald, S. P.; Ingersoll, A. P.; Porco, C.
2010-12-01
New 2009-2010 movies from the Cassini camera show Saturn’s auroral curtains move and change in both the northern and southern hemispheres. The observations reveal reddish color of the aurora observed in filters spanning different wavelengths. The aurora was detected in H-alpha (652-661 nm), red (574-724 nm), and broad-band infrared (668-833 nm) wavelengths, and also faintly in blue (405-505 nm) and green (507-632 nm) wavelengths. The prominent H-alpha line and the overall spectral shape agrees with predicted spectra for Saturnian auroras (Aguilar, 2008). Along with the spectra and brightness measurements, we will present two 400+ frame movies taken in the clear filter, one showing aurora in the northern hemisphere from October 5-9, 2009, and the other showing the aurora in the southern hemisphere, from June 26, 2010. These movies show the aurora varying dramatically with longitude and rotating together with Saturn. The main longitudinal structure of the aurora can persist for ~3 days, as seen on the repeated views of the same longitudes several Saturn rotations later. Besides the steady main structure, aurora may brighten suddenly on the timescales on the order of 10 minutes. Near the limb the height of the auroral curtains above its base can be measured; this height can reach more than 1200 km. The main auroral oval in the northern hemisphere appears near 75° latitude. The main auroral oval in the southern hemisphere appears near -72° latitude, with smaller instances of auroral activity near -75° and -77°. Reference: Aguilar, A., J. M. Ajello, R. S. Mangina, G. K. James, H. Abgrall, and E. Roueff, “The electron-excited middle UV to near IR spectrum of H2 : Cross-sections and transition probabilities”, Astrophys. J. Supp. Ser., 177 (2008).
Growth Chambers on the International Space Station for Large Plants
NASA Technical Reports Server (NTRS)
Massa, G. D.; Wheeler, R. M.; Morrow, R. C.; Levine, H. G.
2016-01-01
The International Space Station (ISS) now has platforms for conducting research on horticultural plant species under LED lighting, and those capabilities continue to expand. The 'Veggie' vegetable production system was deployed to the ISS as an applied research platform for food production in space. Veggie is capable of growing a wide array of horticultural crops. It was designed for low power usage, low launch mass and stowage volume, and minimal crew time requirements. The Veggie flight hardware consists of a light cap containing red (630 nm), blue, (455 nm) and green (530 nm) LEDs. Interfacing with the light cap is an extendable bellows/baseplate for enclosing the plant canopy. A second large plant growth chamber, the Advanced Plant Habitat (APH), is will fly to the ISS in 2017. APH will be a fully controllable environment for high-quality plant physiological research. APH will control light (quality, level, and timing), temperature, CO2, relative humidity, and irrigation, while scrubbing any cabin or plant-derived ethylene and other volatile organic compounds. Additional capabilities include sensing of leaf temperature and root zone moisture, root zone temperature, and oxygen concentration. The light cap will have red (630 nm), blue (450 nm), green (525 nm), far red (730 nm) and broad spectrum white LEDs (4100K). There will be several internal cameras (visible and IR) to monitor and record plant growth and operations. Veggie and APH are available for research proposals.
NASA Astrophysics Data System (ADS)
Gillespie, Jonathan B.; Maclean, Michelle; Wilson, Mark P.; Given, Martin J.; MacGregor, Scott J.
2017-03-01
This study details the design, build and testing of a prototype antimicrobial blended white light unit containing pulsed red, yellow, green and 405nm LEDs. With a push for alternative methods of disinfection, optical methods have become a topic of interest. Ultra-violet (UV) light is widely known for its antimicrobial properties however; 405nm light has demonstrated significant antimicrobial properties against many common hospital acquired pathogens. In this study, a pulsed, blended, white-light prototype with a high content of 405 nm antimicrobial light, was designed, built and tested. Antimicrobial efficacy testing of the prototype was conducted using Staphylococcus aureus and Pseudomonas. aeruginosa, two bacteria which are common causes of hospital acquired infections. These were exposure to 3 different light outputs from the prototype and the surviving bacteria enumerated. Results showed that the mixed light output provided a much better CRI and light output under which to work. Also, the light output containing 405 nm light provided an antimicrobial effect, with decontamination of 103 CFUml-1 populations of both bacterial species. The other light content (red, yellow, green) had no beneficial or adverse effects on the antimicrobial properties of the 405nm light. The results suggest that with further development, it could be possible to produce an antimicrobial blended white light containing pulsed 405nm light that could supplement or even replace standard white lighting in certain environments.
NASA Astrophysics Data System (ADS)
Ledemi, Yannick; Manzani, Danilo; Ribeiro, Sidney J. L.; Messaddeq, Younes
2011-10-01
Multicolor and white light emissions have been achieved in Yb 3+, Tm 3+ and Ho 3+ triply doped heavy metal oxide glasses upon laser excitation at 980 nm. The red (660 nm), green (547 nm) and blue (478 nm) up conversion emissions of the rare earth (RE) ions triply doped TeO 2-GeO 2-Bi 2O 3-K 2O glass (TGBK) have been investigated as a function of the RE concentration and excitation power of the 980 nm laser diode. The most appropriate combination of RE in the TGBK glass host (1.6 wt% Yb 2O 3, 0.6 wt% Tm 2O 3 and 0.1 wt% Ho 2O 3) has been determined with the purpose to tune the primary colors (RGB) respective emissions and generate white light emission by varying the pump power. The involved infrared to visible up conversion mechanisms mainly consist in a three-photon blue up conversion of Tm 3+ ions and a two-photon green and red up conversions of Ho 3+ ions. The resulting multicolor emissions have been described according to the CIE-1931 standards.
Long, Dan-Dan; Zhang, Qing-Xia; Wang, Yu; Zhang, Fan; Wang, Yan-Fei; Zhou, Xin; Qi, Xiao-Hua; Zhang, Heng; Yan, Jing-Hui; Zou, Ming-Qiang
2013-08-01
NaYF4 : Yb3+, Er3+, Tm3+ nanoparticles were prepared by microemulsion-hydrothermal method. Crystal phase, morphology and structure of the samples were characterized by X-ray diffraction (XRD) and scanning electron microscopy (SEM). The luminescence properties were studied by up-conversional fluorescence spectroscopy. The XRD patterns of as-prepared samples were in agreement with the PDF # 77-2042 of cubic NaYF4. SEM images of the particles showed that the samples were cotton-like spherical in shape and which were assembled by smaller nano-particles. The average size was 120 nm, while the shape was regular and the particle size was homogeneous. Under the excitation of 980 nm, the as-prepared particles could emit blue (438 and 486 nm), green (523 and 539 nm) and red (650 nm) light simultaneously. It can be seen from the color coordinates figure (CIE) that when doping concentration ratio of Tm3+ and E3+ increased from 0 to 2, the whole emitting light color of samples movedto green region. While the ratio was 1 : 1, pseudo white light was obtained. As the ratio changed from 2 to 7, the luminous color was moved to red region.
Ultra-small (r<2 nm), stable (>1 year) copper oxide quantum dots with wide band gap
NASA Astrophysics Data System (ADS)
Talluri, Bhusankar; Prasad, Edamana; Thomas, Tiju
2018-01-01
Practical use of quantum dots (QDs) will rely on processes that enable (i) monodispersity, (ii) scalability, (iii) green approaches to manufacturing them. We demonstrate, a green, rapid, soft chemical, and industrial viable approach for obtaining quasi-spherical, ultra-small (size ∼2.4 ± 0.5 nm), stable (>1 yr), and monodispersed copper oxide QDs (r < 2 nm) based on digestive ripening (DR). These QDs show wide band gap (Eg∼5.3 eV), this substantial band gap increase is currently inexplicable using Brus' equation, and is likely due to surface chemistry of these strongly confined QDs. Capping with triethanolamine (TEA) results in reduction in the average particle diameter from 9 ± 4 nm to 2.4 ± 0.5 nm and an increase of zeta potential (ξ) from +12 ± 2 mV to +31 ± 2 mV. XPS and electron diffraction studies indicate that capped copper oxide QDs which have TEA chemisorbed on its surface are expected to partly stabilize Cu (I) resulting in mixed phase in these QDs. This result is likely to inform efforts that involve achieving monodisperse microstructures and nano-structures, of oxides with a tendency for multivalency.
NASA Astrophysics Data System (ADS)
Yang, Victor X.; Yeow, Jenny; Lilge, Lothar D.; Kost, James; Mang, Thomas S.; Wilson, Brian C.
1999-07-01
A system for in vivo, fluorescence image-guided, non-contact point fluorescence spectroscopy is presented. A 442 nm HeCd laser is used as the fluorescence excitation source. An intensified CCD serves as the detector for both imaging and spectroscopy, on which two regions of 300 X 300 pixels were used for green (500 +/- 18 nm) and red (630 +/- 18 nm) imaging channels, and a strip of 600 X 120 pixels are used for emission spectroscopy (450 - 750 nm). At a working distance of 40 mm, the system has a spatial resolution of 0.16 mm and a spectral resolution of 5 nm. System performance is demonstrated in a carcinogenesis model in hamsters, where tumors were induced by painting DMBA in the cheek pouch. Autofluorescence and Photofrin-induced fluorescence measurements were performed every 2 weeks during the 18 weeks of tumor induction. Punch biopsies on selected animals were taken for histological staging. The results show that autofluorescence fluorescence can distinguish dysplasia from normal mucosal tissue model, utilizing the peak red intensity (or the red-to-green intensity ratio). Photofrin-induced fluorescence was superior to autofluorescence for differentiating high grade dysplasia from invasive cancer.
NASA Astrophysics Data System (ADS)
Reddy Prasad, V.; Damodaraiah, S.; Ratnakaram, Y. C.
2018-04-01
Ho3+ doped zinc fluorophosphate (ZFP) glasses with molar chemical compositions, (60-x) NH4H2PO4+20ZnO+10BaF2+10NaF+xHo2O3 (where x = 0.1, 0.3, 0.5, 1.0 and 1.5 mol%) were prepared by melt quenching technique. These glasses were characterized through physical, structural, optical, excitation, luminescence and decay curve analysis. From the absorption spectra, spectral intensities (fexp and fcal), Judd-Ofelt intensity parameters (Ω2, Ω4 and Ω6), radiative transition probabilities (AT), radiative lifetimes (τR) and branching ratios (βR) were evaluated for all Ho3+ doped ZFP glass matrices. From the photoluminescence spectra, peak stimulated emission cross-sections (σP) were calculated for all Ho3+ doped ZFP glasses. The Ho3+ doped ZFP glasses show strong green emission at 545 nm and red emission at 656 nm under excitation, 450 nm. The measured lifetimes (τmeas) of (5S2)5F4 level of Ho3+ doped ZFP glasses were obtained from decay profiles. The CIE color coordinates of Ho3+ doped ZFP glasses were calculated from emission spectra and 1.0 mol% of Ho3+ doped ZFP glass matrix gives green emission. Hence, these results confirm that the Ho3+ doped ZFP glasses could be considered as a promising candidate for visible green laser applications.
Near-infrared fluorescence imaging with a mobile phone (Conference Presentation)
NASA Astrophysics Data System (ADS)
Ghassemi, Pejhman; Wang, Bohan; Wang, Jianting; Wang, Quanzeng; Chen, Yu; Pfefer, T. Joshua
2017-03-01
Mobile phone cameras employ sensors with near-infrared (NIR) sensitivity, yet this capability has not been exploited for biomedical purposes. Removing the IR-blocking filter from a phone-based camera opens the door to a wide range of techniques and applications for inexpensive, point-of-care biophotonic imaging and sensing. This study provides proof of principle for one of these modalities - phone-based NIR fluorescence imaging. An imaging system was assembled using a 780 nm light source along with excitation and emission filters with 800 nm and 825 nm cut-off wavelengths, respectively. Indocyanine green (ICG) was used as an NIR fluorescence contrast agent in an ex vivo rodent model, a resolution test target and a 3D-printed, tissue-simulating vascular phantom. Raw and processed images for red, green and blue pixel channels were analyzed for quantitative evaluation of fundamental performance characteristics including spectral sensitivity, detection linearity and spatial resolution. Mobile phone results were compared with a scientific CCD. The spatial resolution of CCD system was consistently superior to the phone, and green phone camera pixels showed better resolution than blue or green channels. The CCD exhibited similar sensitivity as processed red and blue pixels channels, yet a greater degree of detection linearity. Raw phone pixel data showed lower sensitivity but greater linearity than processed data. Overall, both qualitative and quantitative results provided strong evidence of the potential of phone-based NIR imaging, which may lead to a wide range of applications from cancer detection to glucose sensing.
Innate colour preference, individual learning and memory retention in the ant Camponotus blandus.
Yilmaz, Ayse; Dyer, Adrian G; Rössler, Wolfgang; Spaethe, Johannes
2017-09-15
Ants are a well-characterized insect model for the study of visual learning and orientation, but the extent to which colour vision is involved in these tasks remains unknown. We investigated the colour preference, learning and memory retention of Camponotus blandus foragers under controlled laboratory conditions. Our results show that C. blandus foragers exhibit a strong innate preference for ultraviolet (UV, 365 nm) over blue (450 nm) and green (528 nm) wavelengths. The ants can learn to discriminate 365 nm from either 528 nm or 450 nm, independent of intensity changes. However, they fail to discriminate between 450 nm and 528 nm. Modelling of putative colour spaces involving different numbers of photoreceptor types revealed that colour discrimination performance of individual ants is best explained by dichromacy, comprising a short-wavelength (UV) receptor with peak sensitivity at about 360 nm, and a long-wavelength receptor with peak sensitivity between 470 nm and 560 nm. Foragers trained to discriminate blue or green from UV light are able to retain the learned colour information in an early mid-term (e-MTM), late mid-term (l-MTM), early long-term (e-LTM) and late long-term (l-LTM) memory from where it can be retrieved after 1 h, 12 h, 24 h, 3 days and 7 days after training, indicating that colour learning may induce different memory phases in ants. Overall, our results show that ants can use chromatic information in a way that should promote efficient foraging in complex natural environments. © 2017. Published by The Company of Biologists Ltd.
Cone pigments in human deutan colour vision defects.
Alpern, M; Wake, T
1977-01-01
1. The Nagel anomaloscope, neutral points and dichromatic matches to a spectral green light identified a population of seventy red-green dichromats. 2. The anomaloscope settings allow the calculation of the relative action spectrum of the match at the wave-length of the red (645 nm) and green (535 nm) primaries. The distribution of this ratio is bimodal; there are two clusters with a gap of about 0-75 long units between. Among the thirty-eight deuteranopes there are wide differences in anomaloscope matches; similar differences appear among the thirty-two protanopes. 3. Retinal densitometry of the foveas of fifteen of the deuteranopes is compared and contrasted with measurements on trichromats. In the former, only one photolabile pigment is found in the red-green region of the spectrum; normals always have two. The view of Rushton (1965a) that deuteranopes have erythrolabe but no measurable chlorolabe is confirmed for each member of this group. 4. Simple deuteranomalous show two red-green cone pigments. The difference spectra of extreme deuteranomalous are very similar to those found in deuteranopia. 5. Individual differnce in kinetics (photosensitivity, time constant of regeneration) and in the density and lambdamax of the difference spectrum of erythrolabe in deuteranopia are appreciable; the reasons for these differences are not clear. PMID:301185
Luminescent properties of Tb3+- doped TeO2-WO3-GeO2 glasses for green laser applications
NASA Astrophysics Data System (ADS)
Subrahmanyam, T.; Rama Gopal, K.; Padma Suvarna, R.; Jamalaiah, B. C.; Vijaya Kumar, M. V.
2018-06-01
Different concentrations of Tb3+ -doped oxyfluoro tellurite (TWGTb) glasses were prepared by conventional melt quenching technique and characterized for green laser applications. The Judd-Ofelt theory was applied to evaluate various spectroscopic and radiative parameters. The TWGTb glasses exhibit 5D3 → 7F5-3 and 5D4 → 7F6-0 transitions when excited at 316 nm radiation. The variation of intensity of 5D4 → 7F5 (Green) and 5D3 → 7F4 (Blue) transitions and the green to blue (IG/IB) intensity ratios were studied as a function of Tb3+ ions concentration. The laser characteristic parameters such as effective bandwidth (Δλeff), stimulated emission cross-section (σe), gain bandwidth (σe × Δλeff) and optical gain (σe × τR) were determined using the three phenomenological Judd-Ofelt intensity parameters. The fluorescence decay profiles of 5D4 metastable level exhibit single-exponential nature for all the samples. Based on the experimental results we suggest that the 1.0 mol% of Tb3+ -doped TWGTb glass could be a suitable laser host material to emit intense green luminescence at 545 nm.
Jiang, Shengxiang; Feng, Yulong; Chen, Zhizhong; Zhang, Lisheng; Jiang, Xianzhe; Jiao, Qianqian; Li, Junze; Chen, Yifan; Li, Dongsan; Liu, Lijian; Yu, Tongjun; Shen, Bo; Zhang, Guoyi
2016-01-01
An anodic aluminum oxide (AAO) patterned sapphire substrate, with the lattice constant of 520 ± 40 nm, pore dimension of 375 ± 50 nm, and height of 450 ± 25 nm was firstly used as a nanoimprint lithography (NIL) stamp and imprinted onto the surface of the green light-emitting diode (LED). A significant light extraction efficiency (LEE) was improved by 116% in comparison to that of the planar LED. A uniform broad protrusion in the central area and some sharp lobes were also obtained in the angular resolution photoluminescence (ARPL) for the AAO patterned LED. The mechanism of the enhancement was correlated to the fluctuations of the lattice constant and domain orientation of the AAO-pattern, which enabled the extraction of more guided modes from the LED device. PMID:26902178
NASA Astrophysics Data System (ADS)
Saghafi, S.; Penjweini, R.; Becker, K.; Kratky, K. W.; Dodt, H.-U.
2010-09-01
When moulds are illuminated by visible electromagnetic-EM radiations, several effects on nucleus materials and nucleotides can be detected. These effects have a significant influence on mould generation or destruction. This paper presents the effects and implications of a red diode laser beam (660 nm), a second-harmonics of a Nd:YAG laser emitting green beam (532 nm), or the combination of both, on the eradication of Pistachio mould fungus. Incident doses (ID) of both beams are kept identical throughout the experiment. The absorption spectrums of irradiated mouldy samples and the bright-greenish-yellow-fluorescence (BGYF) of fungus occurring in mould texture due to electronic excitation are investigated. We found that a combination of a green and a red laser beam with an ID of 0.5 J/cm2 provides the optimal effects on Pistachio mould fungus eradication.
NASA Technical Reports Server (NTRS)
Katsukawa, Yukio; Ishikawa, Ryoko; Kano, Ryohei; Kubo, Masahito; Noriyuki, Narukage; Kisei, Bando; Hara, Hirohisa; Yoshiho, Suematsu; Goto, Motouji; Ishikawa, Shinnosuke;
2017-01-01
The CLASP (Chromospheric Lyman-Alpha Spectro- Polarimeter) rocket experiment, in addition to the ultraviolet region of the Ly alpha emission line (121.57 nm), emission lines of Si III (120.65 nm) and OV (121.83 nm) is can be observed. These are optically thin line compared to a Ly alpha line, if Rarere captured its polarization, there is a possibility that dripping even a new physical diagnosis chromosphere-transition layer. In particular, OV bright light is a release from the transition layer, further, three P one to one S(sub 0) is a forbidden line (cross-triplet transition between lines), it was not quite know whether to polarization.
USDA-ARS?s Scientific Manuscript database
Preliminary analyses by HPLC-MS of methanolic extracts of two sets of orange leaves that are symptomatic of the Greening Disease (HLB) have shown several consistent differences. The main flavonoids in symptomatic and nonsymptomatic leaves were monitored in the HPLC chromatograms at 330 nm, and signi...
Bringing Catalysis with Gold Nanoparticles in Green Solvents to Graduate Level Students
ERIC Educational Resources Information Center
Raghuwanshi, Vikram Singh; Wendt, Robert; O'Neill, Maeve; Ochmann, Miguel; Som, Tirtha; Fenger, Robert; Mohrmann, Marie; Hoell, Armin; Rademann, Klaus
2017-01-01
We demonstrate here a novel laboratory experiment for the synthesis of gold nanoparticles (AuNPs) by using a low energy gold-sputtering method together with a modern, green, and biofriendly deep eutectic solvent (DES). The strategy is straightforward, economical, ecofriendly, rapid, and clean. It yields uniform AuNPs of 5 nm in diameter with high…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Jijian; Liu, Ni; Xu, Ling, E-mail: xuling@snnu.edu.cn
Graphical abstract: The doping ions tune the UC luminescence of the T- AgGd(W,Mo){sub 2}O{sub 8}:Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} material. - Highlights: • AgGd(W,Mo){sub 2}O{sub 8}:Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} phosphors show color-tunable blue, green, and red UC emissions. • The samples’ UC emission color can be switched with the concentrations of doped ions. • The blue, green and red UC mechanisms are interpreted reasonably as three- and two- photon process. - Abstract: Tetragonal Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} tri-doped AgGd(W,Mo){sub 2}O{sub 8} phosphors were prepared by the high-temperature solid-state method. When the phosphors were excited at 980 nm, the UC emission ofmore » blue at 475 nm, green at 525 and 550 nm, and red at 656 nm were corresponding to the {sup 1}G{sub 4} → {sup 3}H{sub 6} transition of Tm{sup 3+} ions, the {sup 2}H{sub 11/2},{sup 4}S{sub 3/2} → {sup 4}I{sub 15/2} transitions of Er{sup 3+} ions, and the {sup 4}F{sub 9/2} → {sup 4}I{sub 15/2} transition of Er{sup 3+} ions, respectively. The blue UC emissions originate from a three-photon mechanism, while the green and red ones of Er{sup 3+} from two-photon process. The UC emission color of the Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} tri-doped AgGdW{sub 2}O{sub 8} samples switched from green to white, and then to red depending on the concentrations of Er{sup 3+} and Tm{sup 3+}. After doping with Mo(VI), tetragonal AgGdW{sub 2}O{sub 8} was transformed into tetragonal AgGdMo{sub 2}O{sub 8}, resulting in a slightly enhanced UC luminescence intensity with the favor of the red emission of Er{sup 3+} ion.« less
Aigner, Siegfried; Remias, Daniel; Karsten, Ulf; Holzinger, Andreas
2013-01-01
The filamentous green alga Zygogonium ericetorum (Zygnematophyceae, Streptophyta) was collected in a high-alpine rivulet in Tyrol, Austria. Two different morphotypes of this alga were found: a purple morph with a visible purple vacuolar content and a green morph lacking this coloration. These morphotypes were compared with respect to their secondary metabolites, ultrastructure, and ecophysiological properties. Colorimetric tests with aqueous extracts of the purple morph indicated the presence of soluble compounds such as phenolics and hydrolyzable tannins. High-performance liquid chromatography-screening showed that Z. ericetorum contained several large phenolic peaks with absorption maxima at ∼280 nm and sometimes with minor maxima at ∼380 nm. Such compounds are uncommon for freshwater green microalgae, and could contribute to protect the organism against increased UV and visible (VIS) irradiation. The purple Z. ericetorum contained larger amounts (per dry weight) of the putative phenolic substances than the green morph; exposure to irradiation may be a key factor for accumulation of these phenolic compounds. Transmission electron microscopy of the purple morph showed massive vacuolization with homogenous medium electron-dense content in the cell periphery, which possibly contains the secondary compounds. In contrast, the green morph had smaller, electron-translucent vacuoles. The ecophysiological data on photosynthesis and desiccation tolerance indicated that increasing photon fluence densities led to much higher relative electron transport rates (rETR) in the purple than in the green morph. These data suggest that the secondary metabolites in the purple morph are important for light acclimation in high-alpine habitats. However, the green morph recovered better after 4 d of rehydration following desiccation stress. PMID:25810559
Multiplex Superconducting Transmission Line for green power consolidation on a Smart Grid
NASA Astrophysics Data System (ADS)
McIntyre, P.; Gerity, J.; Kellams, J.; Sattarov, A.
2017-12-01
A multiplex superconducting transmission line (MSTL) is being developed for applications requiring interconnection of multi-MW electric power generation among a number of locations. MSTL consists of a cluster of many 2- or 3-conductor transmission lines within a coaxial cryostat envelope. Each line operates autonomously, so that the interconnection of multiple power loads can be done in a failure-tolerant network. Specifics of the electrical, mechanical, and cryogenic design are presented. The consolidation of transformation and conditioning and the failure-tolerant interconnects have the potential to offer important benefit for the green energy components of a Smart Grid.
Rapid synthesis of gold and silver nanoparticles using tryptone as a reducing and capping agent
NASA Astrophysics Data System (ADS)
Mehta, Sourabh M.; Sequeira, Marilyn P.; Muthurajana, Harries; D'Souza, Jacinta S.
2018-02-01
Due to its eco-friendliness, recent times have seen an immense interest in the green synthesis of metallic nanoparticles. We present here, a protocol for the rapid and cheap synthesis of Au and Ag nanoparticles (NPs) using 1 mg/ml tryptone (trypsinized casein) as a reducing and capping agent. These nanoparticles are spherical, 10 nm in diameter and relatively monodispersed. The atoms of these NPs are arranged in face-centered cubic fashion. Further, when tested for their cytotoxic property against HeLa and VERO cell lines, gold nanoparticles were more lethal than silver nanoparticles, with a more or less similar trend observed against both Gram-positive and Gram-negative bacteria. On the other hand, the NPs were least cytotoxic against a unicellular alga, Chlamydomonas reinhardtii implying their eco-friendly property.
OPO-based compact laser projection display
NASA Astrophysics Data System (ADS)
Lee, Dicky; Moulton, Peter F.; Bergstedt, Robert; Flint, Graham W.
2001-09-01
In this paper we discuss our red, green, and blue (RGB) optical parametric oscillator (OPO) based laser projection display. The complete project display consists of two subsystems, the RGB-OPO laser head and the light modulation unit. The RGB lights from rack-mounted laser head are fibers coupled to the projection unit for independent placement. The light source consists of a diode-pumped pump laser and a LBO-based OPO. Based on our Nd:YLF gain module design, the pump laser is frequency doubled to serve as the pump source for the OPO. The unconverted pump power is recycled as the green light for projection. The singly resonant, non- critically phase-matched (NCPM) OPO has, to date, generated 13 W of 898-nm signal power and an estimated 9.3 W of intra- cavity idler power at 1256 nm. With approximately 76% of pump depletion, the power of the residual green light for projection is about 5.8 W. We have extra-cavity doubled the signal to produce approximately 3.5 W of 449-nm blue light and intra-cavity doubled the idler to produce approximately 6 W of 628-nm red light. The OPO-based RGB source generates about 4000 lumens of D65-balanced white light. The overall electrical power on a commercially available JVC's three- panel D-ILA (reflective LCD) projector with the arc-lamp removed and extensive modifications. The projector has a native resolution of 1365 x 1024 and the expected on screen lumens from our laser display is about 1200 lumens.
NASA Astrophysics Data System (ADS)
Park, Jungho; Park, Youngjun; Hwang, Young M.
1997-10-01
Cut-off filters reject all the radiation below and transmit all the above a certain wavelength and vice versa. In this paper, we will study the design and fabrication of a short wave pass or a long wave pass dichroic mirrors for color separation and recombination from the R.G.B. color beam source. In the laser display system, color separation and recombination is very important. We designed the coating layers so that the best performance may be obtained from a 45 degree incident s-polarized light. The following fabrication specification is satisfied in our color separation/recombination of the Kr-Ar laser source. The first dichroic mirror for the blue color separation, maximized on reflectance and transmittance as R > 99% in the blue regions (400 approximately 490 nm) and T > 90% in the green and red region (510 approximately 700 nm). The second dichroic mirror for the color recombination maximized the reflectance and transmittance as R > 99% in the range of 510 approximately 700 nm and T > 90% in the blue color region. In the third dichroic mirror for which it used the color separation and recombination of the green and red simultaneously, maximized the reflectance and transmittance as R > 99% in the green region (510 approximately 560 nm) and T > 90% in the red region. These fabricated mirrors were applied in our laser display projection system. We obtained an excellent result.
Ulloa, G; Collao, B; Araneda, M; Escobar, B; Álvarez, S; Bravo, D; Pérez-Donoso, J M
2016-12-01
The use of bacterial cells to produce fluorescent semiconductor nanoparticles (quantum dots, QDs) represents a green alternative with promising economic potential. In the present work, we report for the first time the biosynthesis of CdS QDs by acidophilic bacteria of the Acidithiobacillus genus. CdS QDs were obtained by exposing A. ferrooxidans, A. thiooxidans and A. caldus cells to sublethal Cd 2+ concentrations in the presence of cysteine and glutathione. The fluorescence of cadmium-exposed cells moves from green to red with incubation time, a characteristic property of QDs associated with nanocrystals growth. Biosynthesized nanoparticles (NPs) display an absorption peak at 360nm and a broad emission spectra between 450 and 650nm when excited at 370nm, both characteristic of CdS QDs. Average sizes of 6 and 10nm were determined for green and red NPs, respectively. The importance of cysteine and glutathione on QDs biosynthesis in Acidithiobacillus was related with the generation of H 2 S. Interestingly, QDs produced by acidophilic bacteria display high tolerance to acidic pH. Absorbance and fluorescence properties of QDs was not affected at pH 2.0, a condition that totally inhibits the fluorescence of QDs produced chemically or biosynthesized by mesophilic bacteria (stable until pH 4.5-5.0). Results presented here constitute the first report of the generation of QDs with improved properties by using extremophile microorganisms. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Malleshappa, J.; Nagabhushana, H.; Kavyashree, D.; Prashantha, S. C.; Sharma, S. C.; Premkumar, H. B.; Shivakumara, C.
2015-06-01
CeO2:Ho3+ (1-9 mol%) nanopowders have been prepared by efficient and environmental friendly green combustion method using Aloe vera gel as fuel for the first time. The final products are well characterized by powder X-ray diffraction (PXRD), scanning electron microscopy (SEM), fourier transform infrared (FTIR). Bell, urchin, core shell and flower like morphologies are observed with different concentrations of the A. vera gel. It is apparent that by adjusting the concentration of the gel, considerable changes in the formation of CeO2:Ho3+ nano structures can be achieved. Photoluminescence (PL) studies show green (543, 548 nm) and red (645, 732 nm) emissions upon excited at 400 nm wavelength. The emission peaks at ∼526, 548, 655 and 732 nm are associated with the transitions of 5F3 → 5I8, 5S2 → 5I8, 5F5 → 5I8 and 5S2 → 5I7, respectively. Three TL glow peaks are observed at 118, 267 and 204 °C for all the γ irradiated samples which specify the surface and deeper traps. Linear TL response in the range 0.1-2 kGy shows that phosphor is fairly useful as γ radiation dosimeter. Kinetic parameters associated with the glow peaks are estimated using Chen's half width method. The CIE coordinate values show that phosphor is quite useful for the possible applications in WLEDs as orange red phosphor.
Liu, Xiaoming; Chen, Chen; Li, Shuailong; Dai, Yuhua; Guo, Huiqin; Tang, Xinghua; Xie, Yu; Yan, Liushui
2016-10-17
Up to now, GdNbO 4 has always been regarded as an essentially inert material in the visible region with excitation of UV light and electron beams. Nevertheless, here we demonstrate a new recreating blue emission of GdNbO 4 nanocrystalline phosphors with a quantum efficiency of 41.6% and host sensitized luminescence in GdNbO 4 :Ln 3+ (Ln 3+ = Eu 3+ /Tb 3+ /Tm 3+ ) nanocrystalline phosphors with abundant color in response to UV light and electron beams. The GdNbO 4 and GdNbO 4 :Ln 3+ (Ln 3+ = Eu 3+ /Tb 3+ /Tm 3+ ) nanocrystalline phosphors were synthesized by a Pechini-type sol-gel process. With excitation of UV light and low-voltage electron beams, the obtained GdNbO 4 nanocrystalline phosphor presents a strong blue luminescence from 280 to 650 nm centered around 440 nm, and the GdNbO 4 :Ln 3+ nanocrystalline phosphors show both host emission and respective emission lines derived from the characterize f-f transitions of the doping Eu 3+ , Tb 3+ , and Tm 3+ ions. The luminescence color of GdNbO 4 :Ln 3+ nanocrystalline phosphors can be tuned from blue to green, red, blue-green, orange, pinkish, white, etc. by varying the doping species, concentration, and relative ratio of the codoping rare earth ions in GdNbO 4 host lattice. A single-phase white-light-emission has been realized in Eu 3+ /Tb 3+ /Tm 3+ triply doped GdNbO 4 nanocrystalline phosphors. The luminescence properties and mechanisms of GdNbO 4 and GdNbO 4 :Ln 3+ (Ln 3+ = Eu 3+ /Tb 3+ /Tm 3+ ) are updated.
NASA Astrophysics Data System (ADS)
Kumara Swamy, M.; Sudipta, K. M.; Jayanta, K.; Balasubramanya, S.
2015-01-01
Biosynthesis of silver nanoparticles (Ag Nps) was carried out using methanol leaves extract of L. reticulata. Ag Nps were characterized based on the observations of UV-visible spectroscopy, transmission electron microscopy, and X-ray diffraction (XRD) analysis. These Ag Nps were tested for antimicrobial activity by agar well diffusion method against different pathogenic microorganisms and antioxidant activity was performed using DPPH assay. Further, the in vitro cytotoxic effects of Ag Nps were screened against HCT15 cancer cell line and viability of tumor cells was confirmed using MTT ((3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a yellow tetrazole)) assay. The nuclear condensation was studied using the propidium iodide-staining method. The color change from green to dark brown and the absorbance peak at about 420 nm indicated the formation of nanoparticles. XRD pattern showed characteristic peaks indexed to the crystalline planes (111), (200) and (220) of face-centered cubic silver. The nanoparticles were of spherical shape with varying sizes ranging from 50 to 70 nm. Biosynthesized Ag Nps showed potent antibacterial activity and effective radical scavenging activity. MTT assay revealed a dose-dependent decrease in cell viability. Microscopic observations showed distinct cellular morphological changes indicating unhealthy cells, whereas the control appeared normal. Increase in the number of propidium iodide positive cells were observed in maximum concentration. Methanolic leaf extract of L. reticulata acts as an excellent capping agent for the formation of silver nanoparticles and demonstrates immense biological activities. Hence, these Ag NPs can be used as antibacterial, antioxidant as well as cytotoxic agent in treating many medical complications.
Large laser projection displays utilizing all-solid-state RGB lasers
NASA Astrophysics Data System (ADS)
Xu, Zuyan; Bi, Yong
2005-01-01
RGB lasers projection displays have the advantages of producing large color triangle, high color saturation and high image resolution. In this report, with more than 4W white light synthesized by red (671nm), green (532nm) and blue (473nm) lasers, a RGB laser projection display system based on diode pumped solid-state lasers is developed and the performance of brilliant and vivid DVD dynamitic pictures on 60 inch screen is demonstrated.
A Clementine Collection: Moonglow
1994-06-01
View of the Sun and Moon 54 West of Apollo 17 56 Tycho Crater 58 Copernicus Crater Mosaic 60 Limb of Gagarin 62 Night and Day 64 Lake Victoria 66 Sunrise...Color composite Red = 1000 nm Green = 900 nm Blue = 415 nm 56 57 57 Sopernicus Crater Mosaic Mosaic of the lunar crater Copernicus produced using...half of Copernicus . This color mosaic was prepared using images obtained through filters of three different coiors chosen to allow small lunar color
Balashanmugam, Pannerselvam; Durai, Prabhu; Balakumaran, Manickam Dakshinamoorthi; Kalaichelvan, Pudupalayam Thangavelu
2016-12-01
Gold nanoparticles are considered of great importance compared to other noble metal nanoparticles and its wide range of applications like pharmaceutics, therapeutics and diagnostics etc. During the past decade, phytosynthesized gold nanoparticles (AuNPs) are more focused in in vitro and in vivo study. The present study was focused on the gold chloride and phytosynthesized gold nanoparticles from aqueous leaf extract of Cassia roxburghii and their toxic effects on African green monkey normal kidney Vero cell line and three different cancer cell lines such as HepG2, MCF7 and HeLa. Phytosynthesized AuNPs were characterized by HRTEM, EDX, XRD and FTIR analysis. The particles size range of 25-35nm was confirmed by HRTEM. The elemental gold and the crystalline nature of AuNPs were confirmed by EDX and XRD, respectively. The reduction of functional groups was confirmed by FTIR. In in vitro study, the IC 50 of HepG2 cells was found to be 30μg/ml compared to other cell lines, HeLa and MCF7 cell line showing IC 50 of 50μg/ml and normal Vero cell line also nontoxic up to 75μg/ml confirmed by MTT assay. Further, apoptosis in HepG2 was analyzed by fluorescence microscope and DNA fragmentation was observed in HepG2 treated cells. These results suggested that phytosynthesized AuNPs of C. roxburghii extract clearly limited toxic on normal cells but toxic in cancer cells. Copyright © 2016 Elsevier B.V. All rights reserved.
Growth and laser properties of Yb : Ca 4YO(BO 3) 3 crystal
NASA Astrophysics Data System (ADS)
Zhang, Huaijin; Meng, Xianlin; Zhu, Li; Wang, Pu; Liu, Xuesong; Cheng, Ruiping; Dawes, Judith; Dekker, Peter; Zhang, Shaojun; Sun, Lianke
1999-04-01
Yb : Ca 4YO(BO 3) 3 (Yb : YCOB) crystal has been grown by the Czochralski method. The absorption and fluorescence spectra have been measured. The green luminescence is also observed. The output laser at 1032 nm has been demonstrated pumped by laser diode (LD) at 976.4 nm.
Zheng, Mingda; Wang, Chenge; Wang, Yingying; Wei, Wei; Ma, Shuang; Sun, Xiaohan; He, Jiang
2018-08-01
In this work, Lycii Fructus as raw materials for green synthesis of fluorescent carbon dots (CDs) reduce AgNO 3 . The CDs-AgNPs were synthesized by one-step method. CDs were applied to stabilize AgNPs due to abundant functional groups on the surface of CDs. In presence of phoxim, the dispersed CDs-AgNPs get aggregated and the absorption peak with red shift from 400 nm to 525 nm, resulting in the color changed from yellow to red. Under optimized conditions, the absorbance ratio at A 525 nm /A 400 nm was related linearly to the concentrations of phoxim in the range of 0.1-100 μM. The detection limit was calculated to 0.04 μM, which is lower than maximum residue limits of phoxim in samples in China. The colorimetric sensor was successfully utilized to monitoring phoxim in environmental and fruit samples with good recoveries ranges from 87% to 110.0%. These results showed the sensor had a promising application prospect in real samples. Copyright © 2018 Elsevier B.V. All rights reserved.
MOCVD growth of vertically aligned InGaN nanowires
NASA Astrophysics Data System (ADS)
Kuo, H. C.; Su Oh, Tae; Ku, P.-C.
2013-05-01
In this work, we report the growth of vertically aligned bulk InGaN nanowires (NWs) on r-plane sapphire substrate by metal organic chemical vapor deposition (MOCVD). Through the optimization process of growth conditions, such as growth temperature and pressure, we obtained high density InGaN NWs consisting of one (0001) polar- and two equivalent {1101} semi-polar planes. We have shown the highest InGaN NWs wire density of 8×108 cm-2,with an average diameter of 300 nm and a length of 2 μm. From results of photoluminescence (PL) at 30 K and 300 K, we observed the intense and broad emission peak from InGaN NWs at around 595 nm, and confirmed that the luminescence could be tuned from 580 nm to 660 nm by controlling the indium flow (TMIn) rate. Our results indicate that MOCVD-grown InGaN NWs can be effective absorbers of the blue-green range of solar spectrum and may be one of the good candidates for high efficiency photovoltaic devices targeting at blue-green photons.
Lu, Zhijuan; Mao, Zhiyong; Chen, Jingjing; Wang, Dajian
2015-09-21
In this work, tunable emission from green to red and the inverse tuning from red to green in α-(Ca, Sr)2SiO4:Eu(2+) phosphors were demonstrated magically by varying the incorporation content of Eu(2+) and Sr(2+) ions, respectively. The tunable emission properties and the tuning mechanism of red-shift resulting from the Eu(2+) content as well as that of blue-shift induced by the Sr(2+) content were investigated in detail. As a result of fine-controlling the incorporation content of Eu(2+), the emission peak red-shifts from 541 nm to 640 nm. On the other hand, the emission peak inversely blue-shifts from 640 nm to 546 nm through fine-adjusting the incorporation content of Sr(2+). The excellent tuning characteristics for α-(Ca, Sr)2SiO4:Eu(2+) phosphors presented in this work exhibited their various application prospects in solid-state lighting combining with a blue chip or a near-UV chip.
Peripheral visual response time to colored stimuli imaged on the horizontal meridian
NASA Technical Reports Server (NTRS)
Haines, R. F.; Gross, M. M.; Nylen, D.; Dawson, L. M.
1974-01-01
Two male observers were administered a binocular visual response time task to small (45 min arc), flashed, photopic stimuli at four dominant wavelengths (632 nm red; 583 nm yellow; 526 nm green; 464 nm blue) imaged across the horizontal retinal meridian. The stimuli were imaged at 10 deg arc intervals from 80 deg left to 90 deg right of fixation. Testing followed either prior light adaptation or prior dark adaptation. Results indicated that mean response time (RT) varies with stimulus color. RT is faster to yellow than to blue and green and slowest to red. In general, mean RT was found to increase from fovea to periphery for all four colors, with the curve for red stimuli exhibiting the most rapid positive acceleration with increasing angular eccentricity from the fovea. The shape of the RT distribution across the retina was also found to depend upon the state of light or dark adaptation. The findings are related to previous RT research and are discussed in terms of optimizing the color and position of colored displays on instrument panels.
Water line positions in the 782-840 nm region
NASA Astrophysics Data System (ADS)
Hu, S.-M.; Chen, B.; Tan, Y.; Wang, J.; Cheng, C.-F.; Liu, A.-W.
2015-10-01
A set of water transitions in the 782-840 nm region, including 38 H216O lines, 12 HD16O lines, and 30 D216O lines, were recorded with a cavity ring-down spectrometer calibrated using precise atomic lines. Absolute frequencies of the lines were determined with an accuracy of about 5 MHz. Systematic shifts were found in the line positions given in the HITRAN database and the upper energy levels given in recent MARVEL studies.
Pisarski, Wojciech A; Goryczka, Tomasz; Pisarska, Joanna; Ryba-Romanowski, Witold
2007-03-15
Lead borate based glasses have been analyzed using Raman and infrared spectroscopy. The formation of different borate groups and the direction of BO3 <--> BO4 conversion strongly depends on the PbO- and/or PbF2-to-B2O3 ratio in chemical composition. PbF2-PbO-B2O3 based glasses containing Er3+ ions have been studied after annealing. The orthorhombic PbF2 crystallites are formed during thermal treatment, which was evidenced by X-ray diffraction analysis. Near-infrared luminescence at 1530 nm and green up-conversion at 545 nm have been registered for samples before and after annealing. The luminescence bands correspond to 4I13/2-4I15/2 and 4S3/2-4I15/2 transitions of Er3+ ions, respectively. In comparison to the precursor glasses, the luminescence intensities are higher in the studied transparent oxyfluoride glass ceramics. Simultaneously, the half-width of the luminescence lines slightly decreases. It can be the evidence that a small amount of the Er3+ ions is incorporated into the orthorhombic PbF2 phase.
Schrell, Adrian M.; Roper, Michael G.
2014-01-01
A frequency-modulated fluorescence encoding method was used as a means to increase the number of fluorophores monitored during infrared-mediated polymerase chain reaction. Laser lines at 488-nm and 561-nm were modulated at 73- and 137-Hz, respectively, exciting fluorescence from the dsDNA intercalating dye, EvaGreen, and the temperature insensitive dye, ROX. Emission was collected in a color-blind manner using a single photomultiplier tube for detection and demodulated by frequency analysis. The resulting frequency domain signal resolved the contribution from the two fluorophores as well as the background from the IR lamp. The detection method was successfully used to measure amplification of DNA samples containing 104 – 107 starting copies of template producing an amplification efficiency of 96%. The utility of this methodology was further demonstrated by simultaneous amplification of two genes from human genomic DNA using different color TaqMan probes. This method of multiplexing fluorescence detection with IR-qPCR is ideally suited as it allowed isolation of the signals of interest from the background in the frequency domain and is expected to further reduce the complexity of multiplexed microfluidic IR-qPCR instrumentation. PMID:24448431
NASA Astrophysics Data System (ADS)
Salprima Yudha, S.; Angasa, Eka; Suharto, Totok Eka; Nishina, Yuta; Mardlia, Zulfikri Achid; Sipriyadi
2016-02-01
Many reports recently show that some plant and animal extracts were useful to prepare some desired materials. In line with the statement, this report will present a bioresources candidate that can be used for green preparation of gold nanoparticles. The Scaevola fruteschen (Mill.) Krause was obtained from Enggano island, Bengkulu Province, Indonesia. The current research include synthesis, characterization and application study of the obtained nanoparticles in their original medium/reduction system as antibacterial agent of Escherichia coli. Besides that, the interaction study of the nanoparticles solution with Pb2+ ions was also studied. The results, shows that the present reduction system (aqueous extract of the plant leaves) successfully reduced gold (III) ions to gold metals as shown by new peak at 544 nm in spectrophotometry analysis. The average nanopartiles size was 96 nm based on Particles Size Analyzer (PSA) result. The stability study revealed that the nanoparticles solution was not stable in the persence of Pb(OAc)2 at high concentration. The nanoparticles were effective enough toward E. coli as shown by inhibition zone that indicates the degree of sensitivity of bacteria to nanoparticles.
Oxycarbonitride phosphors and light emitting devices using the same
Li, Yuanqiang; Romanelli, Michael Dennis; Tian, Yongchi
2013-10-08
Disclosed herein is a novel family of oxycarbidonitride phosphor compositions and light emitting devices incorporating the same. Within the sextant system of M--Al--Si--O--N--C--Ln and quintuplet system of M--Si--O--N--C--Ln (M=alkaline earth element, Ln=rare earth element), the phosphors are composed of either one single crystalline phase or two crystalline phases with high chemical and thermal stability. In certain embodiments, the disclosed phosphor of silicon oxycarbidonitrides emits green light at wavelength between 530-550 nm. In further embodiments, the disclosed phosphor compositions emit blue-green to yellow light in a wavelength range of 450-650 nm under near-UV and blue light excitation.
Oxycarbonitride phosphors and light emitting devices using the same
Li, Yuanqiang; Romanelli, Michael Dennis; Tian, Yongchi
2014-07-08
Disclosed herein is a novel family of oxycarbonitride phosphor compositions and light emitting devices incorporating the same. Within the sextant system of M--Al--Si--O--N--C--Ln and quintuplet system of M--Si--O--N--C--Ln (M=alkaline earth element, Ln=rare earth element), the phosphors are composed of either one single crystalline phase or two crystalline phases with high chemical and thermal stability. In certain embodiments, the disclosed phosphor of silicon oxycarbonitrides emits green light at wavelength between 530-550 nm. In further embodiments, the disclosed phosphor compositions emit blue-green to yellow light in a wavelength range of 450-650 nm under near-UV and blue light excitation.
NASA Astrophysics Data System (ADS)
Chen, Chen; He, Ruiyun; Tan, Yang; Wang, Biao; Akhmadaliev, Shavkat; Zhou, Shengqiang; de Aldana, Javier R. Vázquez; Hu, Lili; Chen, Feng
2016-01-01
This work reports on the fabrication of ridge waveguides in Er3+/Yb3+ co-doped phosphate glass by the combination of femtosecond laser ablation and following swift carbon ion irradiation. The guiding properties of waveguides have been investigated at 633 and 1064 nm through end face coupling arrangement. The refractive index profile on the cross section of the waveguide has been constructed. The propagation losses can be reduced considerably after annealing treatment. Under the optical pump laser at 980 nm, the upconversion emission of both green and red fluorescence has been realized through the ridge waveguide structures.
Henze, Miriam J; Dannenhauer, Kara; Kohler, Martin; Labhart, Thomas; Gesemann, Matthias
2012-08-30
Opsins are key proteins in animal photoreception. Together with a light-sensitive group, the chromophore, they form visual pigments which initiate the visual transduction cascade when photoactivated. The spectral absorption properties of visual pigments are mainly determined by their opsins, and thus opsins are crucial for understanding the adaptations of animal eyes. Studies on the phylogeny and expression pattern of opsins have received considerable attention, but our knowledge about insect visual opsins is still limited. Up to now, researchers have focused on holometabolous insects, while general conclusions require sampling from a broader range of taxa. We have therefore investigated visual opsins in the ocelli and compound eyes of the two-spotted cricket Gryllus bimaculatus, a hemimetabolous insect. Phylogenetic analyses place all identified cricket sequences within the three main visual opsin clades of insects. We assign three of these opsins to visual pigments found in the compound eyes with peak absorbances in the green (515 nm), blue (445 nm) and UV (332 nm) spectral range. Their expression pattern divides the retina into distinct regions: (1) the polarization-sensitive dorsal rim area with blue- and UV-opsin, (2) a newly-discovered ventral band of ommatidia with blue- and green-opsin and (3) the remainder of the compound eye with UV- and green-opsin. In addition, we provide evidence for two ocellar photopigments with peak absorbances in the green (511 nm) and UV (350 nm) spectral range, and with opsins that differ from those expressed in the compound eyes. Our data show that cricket eyes are spectrally more specialized than has previously been assumed, suggesting that similar adaptations in other insect species might have been overlooked. The arrangement of spectral receptor types within some ommatidia of the cricket compound eyes differs from the generally accepted pattern found in holometabolous insect taxa and awaits a functional explanation. From the opsin phylogeny, we conclude that gene duplications, which permitted differential opsin expression in insect ocelli and compound eyes, occurred independently in several insect lineages and are recent compared to the origin of the eyes themselves.
2012-01-01
Background Opsins are key proteins in animal photoreception. Together with a light-sensitive group, the chromophore, they form visual pigments which initiate the visual transduction cascade when photoactivated. The spectral absorption properties of visual pigments are mainly determined by their opsins, and thus opsins are crucial for understanding the adaptations of animal eyes. Studies on the phylogeny and expression pattern of opsins have received considerable attention, but our knowledge about insect visual opsins is still limited. Up to now, researchers have focused on holometabolous insects, while general conclusions require sampling from a broader range of taxa. We have therefore investigated visual opsins in the ocelli and compound eyes of the two-spotted cricket Gryllus bimaculatus, a hemimetabolous insect. Results Phylogenetic analyses place all identified cricket sequences within the three main visual opsin clades of insects. We assign three of these opsins to visual pigments found in the compound eyes with peak absorbances in the green (515 nm), blue (445 nm) and UV (332 nm) spectral range. Their expression pattern divides the retina into distinct regions: (1) the polarization-sensitive dorsal rim area with blue- and UV-opsin, (2) a newly-discovered ventral band of ommatidia with blue- and green-opsin and (3) the remainder of the compound eye with UV- and green-opsin. In addition, we provide evidence for two ocellar photopigments with peak absorbances in the green (511 nm) and UV (350 nm) spectral range, and with opsins that differ from those expressed in the compound eyes. Conclusions Our data show that cricket eyes are spectrally more specialized than has previously been assumed, suggesting that similar adaptations in other insect species might have been overlooked. The arrangement of spectral receptor types within some ommatidia of the cricket compound eyes differs from the generally accepted pattern found in holometabolous insect taxa and awaits a functional explanation. From the opsin phylogeny, we conclude that gene duplications, which permitted differential opsin expression in insect ocelli and compound eyes, occurred independently in several insect lineages and are recent compared to the origin of the eyes themselves. PMID:22935102
NASA Astrophysics Data System (ADS)
Inceoglu, F.; Knudsen, M. F.; Olsen, J.; Karoff, C.; Herren, P.-A.; Schwikowski, M.; Aldahan, A.; Possnert, G.
2016-05-01
The authors regret that figure panels 2d and 4a (green lines), showing the 10Be concentrations from Dome Fuji, were plotted erroneously in the original version. The correct versions of the figures (green lines) appear below for the reader's convenience.
NASA Astrophysics Data System (ADS)
Liu, Eric; Ko, Akiteru; O'Meara, David; Mohanty, Nihar; Franke, Elliott; Pillai, Karthik; Biolsi, Peter
2017-05-01
Dimension shrinkage has been a major driving force in the development of integrated circuit processing over a number of decades. The Self-Aligned Quadruple Patterning (SAQP) technique is widely adapted for sub-10nm node in order to achieve the desired feature dimensions. This technique provides theoretical feasibility of multiple pitch-halving from 193nm immersion lithography by using various pattern transferring steps. The major concept of this approach is to a create spacer defined self-aligned pattern by using single lithography print. By repeating the process steps, double, quadruple, or octuple are possible to be achieved theoretically. In these small architectures, line roughness control becomes extremely important since it may contribute to a significant portion of process and device performance variations. In addition, the complexity of SAQP in terms of processing flow makes the roughness improvement indirective and ineffective. It is necessary to discover a new approach in order to improve the roughness in the current SAQP technique. In this presentation, we demonstrate a novel method to improve line roughness performances on 30nm pitch SAQP flow. We discover that the line roughness performance is strongly related to stress management. By selecting different stress level of film to be deposited onto the substrate, we can manipulate the roughness performance in line and space patterns. In addition, the impact of curvature change by applied film stress to SAQP line roughness performance is also studied. No significant correlation is found between wafer curvature and line roughness performance. We will discuss in details the step-by-step physical performances for each processing step in terms of critical dimension (CD)/ critical dimension uniformity (CDU)/line width roughness (LWR)/line edge roughness (LER). Finally, we summarize the process needed to reach the full wafer performance targets of LWR/LER in 1.07nm/1.13nm on 30nm pitch line and space pattern.
Large eddy simulation of the tidal power plant deep green using the actuator line method
NASA Astrophysics Data System (ADS)
Fredriksson, S. T.; Broström, G.; Jansson, M.; Nilsson, H.; Bergqvist, B.
2017-12-01
Tidal energy has the potential to provide a substantial part of the sustainable electric power generation. The tidal power plant developed by Minesto, called Deep Green, is a novel technology using a ‘flying’ kite with an attached turbine, moving at a speed several times higher than the mean flow. Multiple Deep Green power plants will eventually form arrays, which require knowledge of both flow interactions between individual devices and how the array influences the surrounding environment. The present study uses large eddy simulations (LES) and an actuator line model (ALM) to analyze the oscillating turbulent boundary layer flow in tidal currents without and with a Deep Green power plant. We present the modeling technique and preliminary results so far.
Lipoprotein processing is essential for resistance of Mycobacterium tuberculosis to malachite green.
Banaei, Niaz; Kincaid, Eleanor Z; Lin, S-Y Grace; Desmond, Edward; Jacobs, William R; Ernst, Joel D
2009-09-01
Malachite green, a synthetic antimicrobial dye, has been used for over 50 years in mycobacterial culture medium to inhibit the growth of contaminants. The molecular basis of mycobacterial resistance to malachite green is unknown, although the presence of malachite green-reducing enzymes in the cell envelope has been suggested. The objective of this study was to investigate the role of lipoproteins in resistance of Mycobacterium tuberculosis to malachite green. The replication of an M. tuberculosis lipoprotein signal peptidase II (lspA) mutant (DeltalspA::lspAmut) on Middlebrook agar with and without 1 mg/liter malachite green was investigated. The lspA mutant was also compared with wild-type M. tuberculosis in the decolorization rate of malachite green and sensitivity to sodium dodecyl sulfate (SDS) detergent and first-line antituberculosis drugs. The lspA mutant has a 10(4)-fold reduction in CFU-forming efficiency on Middlebrook agar with malachite green. Malachite green is decolorized faster in the presence of the lspA mutant than wild-type bacteria. The lspA mutant is hypersensitive to SDS detergent and shows increased sensitivity to first-line antituberculosis drugs. In summary, lipoprotein processing by LspA is essential for resistance of M. tuberculosis to malachite green. A cell wall permeability defect is likely responsible for the hypersensitivity of lspA mutant to malachite green.
Diagnosis and Treatment of Neurological Disorders by Millimeter-Wave Stimulation
NASA Technical Reports Server (NTRS)
Siegel, Peter H.; Pikov, Victor
2011-01-01
Increasingly, millimeter waves are being employed for telecomm, radar, and imaging applications. To date in the U.S, however, very few investigations on the impact of this radiation on biological systems at the cellular level have been undertaken. In the beginning, to examine the impact of millimeter waves on cellular processes, researchers discovered that cell membrane depolarization may be triggered by low levels of integrated power at these high frequencies. Such a situation could be used to advantage in the direct stimulation of neuronal cells for applications in neuroprosthetics and diagnosing or treating neurological disorders. An experimental system was set up to directly monitor cell response on exposure to continuous-wave, fixed-frequency, millimeter-wave radiation at low and modest power levels (0.1 to 100 safe exposure standards) between 50 and 100 GHz. Two immortalized cell lines derived from lung and neuronal tissue were transfected with green fluorescent protein (GFP) that locates on the inside of the cell membrane lipid bi-layer. Oxonol dye was added to the cell medium. When membrane depolarization occurs, the oxonal bound to the outer wall of the lipid bi-layer can penetrate close to the inner wall where the GFP resides. Under fluorescent excitation (488 nm), the normally green GFP (520 nm) optical signal quenches and gives rise to a red output when the oxonol comes close enough to the GFP to excite a fluorescence resonance energy transfer (FRET) with an output at 620 nm. The presence of a strong FRET signature upon exposures of 30 seconds to 2 minutes at 5-10 milliwatts per square centimeter RF power at 50 GHz, followed by a return to the normal 520-nm GFP signal after a few minutes indicating repolarization of the membrane, indicates that low levels of RF energy may be able to trigger non-destructive membrane depolarization without direct cell contact. Such a mechanism could be used to stimulate neuronal cells in the cortex without the need for invasive electrodes as millimeter waves penetrate skin and bone on the order of 15 mm in depth. Although 50 GHz could not readily penetrate from the outer skull to the center of the cortex, implants on the outer skull or even on the scalp could reach the outer layer of the cerebral cortex where substantial benefit could be realized from such non-contact type excitation.
A New Green Titania with Enhanced NIR Absorption for Mitochondria-Targeted Cancer Therapy.
Mou, Juan; Lin, Tianquan; Huang, Fuqiang; Shi, Jianlin; Chen, Hangrong
2017-01-01
A new kind of green titania ( G -TiO 2- x ) with obvious green color was facilely synthesized from black titania ( B -TiO 2- x ) through subsequently strong ultrasonication. Comparatively, this stable G -TiO 2- x shows much enhanced near infrared (NIR) absorption, especially around 920 nm, which can be ascribed to the obvious change of TiO 2- x lattice order owing to the effect of ultrasonication. This feature enables G -TiO 2- x to be stimulated with 980 nm laser in the combined photodynamic therapy (PDT) and photothermal therapy (PTT), which is greatly beneficial for improving tissue penetration depth. Furthermore, since mitochondria are preferred subcellular organelles for PDT/PTT, G -TiO 2- x was further designed to conjugate with triphenylphosphonium (TPP) ligand for mitochondria-targeted PDT/PTT to obtain precise cancer treatment. Attributing to the high mitochondria-targeting efficiency and simultaneously synergistic PDT/PTT, high phototherapeutic efficacy and safety with a much lower laser power density (980 nm, 0.72 W cm -2 ) and low materials dosage were achieved both in vitro and in vivo . In addition, negligible toxicity was found, indicating high biocompatibility. This novel G -TiO 2- x could provide new strategies for future precise minimal/non-invasive tumor treatment.
Crystal structure and luminescent properties of Sr2SiO4:Eu2+ phosphor prepared by sol-gel method.
Pan, Heng; Li, Xu; Zhang, Jinping; Guan, Li; Su, Hongxin; Yang, Zhiping; Teng, Feng
2016-07-04
A series of Eu2+ (0.0025≤ × ≤0.025) activated Sr2SiO4:xEu2+ (SSO:xEu2+) phosphors were synthesized via a sol-gel method. The phosphors were characterized by x-ray diffraction (XRD), scanning electron microscopy (SEM) and photoluminescence (PL) spectroscopy. The differences between α' and β phase of SSO in the density of states and energy band gap were investigated. The energy gap of α'-SSO and β-SSO are 4.489 and 4.106 eV, respectively. While, two samples showed similar total and partial densities of states. Under the excitation by the ultra violet (UV) light (365 nm), the SSO:xEu2+ phosphor exhibited a green emission band from 400 to 700 nm, which was corresponding to the transition of 5d → 4f of Eu2+ ions. Two emission peaks at 464 and 532 nm could be obtained through Gauss fitting curves. The ratio of the blue to green emission peak decreased with the Eu2+ concentration and the peaks shifted regularly with it. The thermal quenching property was investigated and its activation energy was calculated. The results indicated that this phosphor could be a candidate of green phosphor for UV-based light-emitting diodes (LEDs).
NASA Astrophysics Data System (ADS)
Muthu, Karuppiah; Priya, Sethuraman
2017-05-01
Cassia auriculata L., the flower aqueous extract was fractionated by separating funnel using n-hexane (A1), chloroform (A2), ethyl acetate (A3) and triple distilled water (A4). The A4 fraction was concentrated and determined the presence of preliminary phytochemicals such as tannins, flavonoids, glycosides, carbohydrates and polyphenolic compounds. These phytochemical compounds acted as reducing as well as a stabilizing agent in the green synthesis of Ag NPs from aqueous silver ions. Initially, the colour change and UV-vis absorbance surface Plasmon resonance strong, wide band located at 435 nm has confirmed the synthesis of Ag NPs. The X-ray diffraction (XRD) pattern of Ag NPs shows a face-centered cubic crystal structure. The observed values were calculated by Debye-Scherrer equation to theoretical confirms the particle size of 18 nm. The surface morphology of Ag NPs was viewed by HRTEM, the particles are spherical and triangle shapes with sizes from 10 to 35 nm. Further, the Ag NPs was effective catalytic activity in the reduction of highly environmental polluted organic compounds of 4-nitrophenol and methyl orange. The green synthesis of Ag NPs seems to eco-friendly, cost-effective, conventional one spot synthesis and greater performance of catalytic degradation of environmentally polluted organic dyes.
A New Green Titania with Enhanced NIR Absorption for Mitochondria-Targeted Cancer Therapy
Mou, Juan; Lin, Tianquan; Huang, Fuqiang; Shi, Jianlin; Chen, Hangrong
2017-01-01
A new kind of green titania (G-TiO2-x) with obvious green color was facilely synthesized from black titania (B-TiO2-x) through subsequently strong ultrasonication. Comparatively, this stable G-TiO2-x shows much enhanced near infrared (NIR) absorption, especially around 920 nm, which can be ascribed to the obvious change of TiO2-x lattice order owing to the effect of ultrasonication. This feature enables G-TiO2-x to be stimulated with 980 nm laser in the combined photodynamic therapy (PDT) and photothermal therapy (PTT), which is greatly beneficial for improving tissue penetration depth. Furthermore, since mitochondria are preferred subcellular organelles for PDT/PTT, G-TiO2-x was further designed to conjugate with triphenylphosphonium (TPP) ligand for mitochondria-targeted PDT/PTT to obtain precise cancer treatment. Attributing to the high mitochondria-targeting efficiency and simultaneously synergistic PDT/PTT, high phototherapeutic efficacy and safety with a much lower laser power density (980 nm, 0.72 W cm-2) and low materials dosage were achieved both in vitro and in vivo. In addition, negligible toxicity was found, indicating high biocompatibility. This novel G-TiO2-x could provide new strategies for future precise minimal/non-invasive tumor treatment. PMID:28529636
Hyperspectral imaging of snow algae and green algae from aeroterrestrial habitats
Holzinger, Andreas; Allen, Michael C.; Deheyn, Dimitri D.
2016-01-01
Snow algae and green algae living in aeroterrestrial habitats are ideal obbjects to study adaptation to high light irradiation. Here, we used a detailed description of the spectral properties as a proxy for photo-acclimation/protection in snow algae (Chlamydomonas nivalis, Chlainomonas sp. and Chloromonas sp.) and charopyhte green algae (Zygnema sp., Zygogonium ericetorum and Klebsormidium crenulatum). The hyperspectral microscopic mapping and imaging technique allowed us to acquire total absorbance spectra of these microalgae in the waveband of 400-900 nm. Particularly in Chlamydomonas nivalis and Chlainomonas sp., a high absorbance in the wave band of 400-550 nm was observed, due to naturally occurring secondary carotenoids; in Chloromonas sp. and in the charopyhte algae this was missing, the latter being close relatives to land plants. To investigate if cellular water loss has an influence on the spectral properties, the cells were plasmolysed in sorbitol or desiccated at ambient air. While in snow algae, these treatments did not change the spectral properties, in the charopyhte algae the condensation of the cytoplasm and plastids increased the absorbance in the lower waveband of 400 – 500 nm. These changes might be ecologically relevant and photoprotective, as aeroterrestrial algae are naturally exposed to occasional water limitation, leading to desiccation, which are conditions usually occurring together with higher irradiation. PMID:27442511
Jungwirth, Nicholas R; Calderon, Brian; Ji, Yanxin; Spencer, Michael G; Flatté, Michael E; Fuchs, Gregory D
2016-10-12
We investigate the distribution and temperature-dependent optical properties of sharp, zero-phonon emission from defect-based single photon sources in multilayer hexagonal boron nitride (h-BN) flakes. We observe sharp emission lines from optically active defects distributed across an energy range that exceeds 500 meV. Spectrally resolved photon-correlation measurements verify single photon emission, even when multiple emission lines are simultaneously excited within the same h-BN flake. We also present a detailed study of the temperature-dependent line width, spectral energy shift, and intensity for two different zero-phonon lines centered at 575 and 682 nm, which reveals a nearly identical temperature dependence despite a large difference in transition energy. Our temperature-dependent results are well described by a lattice vibration model that considers piezoelectric coupling to in-plane phonons. Finally, polarization spectroscopy measurements suggest that whereas the 575 nm emission line is directly excited by 532 nm excitation, the 682 nm line is excited indirectly.
Solar polarimetry through the K I lines at 770 nm
NASA Astrophysics Data System (ADS)
Quintero Noda, C.; Uitenbroek, H.; Katsukawa, Y.; Shimizu, T.; Oba, T.; Carlsson, M.; Orozco Suárez, D.; Ruiz Cobo, B.; Kubo, M.; Anan, T.; Ichimoto, K.; Suematsu, Y.
2017-09-01
We characterize the K I D1 & D2 lines in order to determine whether they could complement the 850 nm window, containing the Ca II infrared triplet lines and several Zeeman sensitive photospheric lines, that was studied previously. We investigate the effect of partial redistribution on the intensity profiles, their sensitivity to changes in different atmospheric parameters, and the spatial distribution of Zeeman polarization signals employing a realistic magnetohydrodynamic simulation. The results show that these lines form in the upper photosphere at around 500 km, and that they are sensitive to the line-of-sight velocity and magnetic field strength at heights where neither the photospheric lines nor the Ca II infrared lines are. However, at the same time, we found that their sensitivity to the temperature essentially comes from the photosphere. Then, we conclude that the K I lines provide a complement to the lines in the 850 nm window for the determination of atmospheric parameters in the upper photosphere, especially for the line-of-sight velocity and the magnetic field.
Ren, Yongxiong; Li, Long; Wang, Zhe; ...
2016-09-12
To increase system capacity of underwater optical communications, we employ the spatial domain to simultaneously transmit multiple orthogonal spatial beams, each carrying an independent data channel. In this paper, we show up to a 40-Gbit/s link by multiplexing and transmitting four green orbital angular momentum (OAM) beams through a single aperture. Moreover, we investigate the degrading effects of scattering/turbidity, water current, and thermal gradient-induced turbulence, and we find that thermal gradients cause the most distortions and turbidity causes the most loss. We show systems results using two different data generation techniques, one at 1064 nm for 10-Gbit/s/beam and one atmore » 520 nm for 1-Gbit/s/beam; we use both techniques since present data-modulation technologies are faster for infrared (IR) than for green. For the 40-Gbit/s link, data is modulated in the IR, and OAM imprinting is performed in the green using a specially-designed metasurface phase mask. For the 4-Gbit/s link, a green laser diode is directly modulated. Lastly, we show that inter-channel crosstalk induced by thermal gradients can be mitigated using multi-channel equalisation processing.« less
Rakhman, A.; Hafez, Mohamed A.; Nanda, Sirish K.; ...
2016-03-31
Here, a high-finesse Fabry-Perot cavity with a frequency-doubled continuous wave green laser (532 nm) has been built and installed in Hall A of Jefferson Lab for high precision Compton polarimetry. The infrared (1064 nm) beam from a ytterbium-doped fiber amplifier seeded by a Nd:YAG nonplanar ring oscillator laser is frequency doubled in a single-pass periodically poled MgO:LiNbO 3 crystal. The maximum achieved green power at 5 W infrared pump power is 1.74 W with a total conversion efficiency of 34.8%. The green beam is injected into the optical resonant cavity and enhanced up to 3.7 kW with a corresponding enhancementmore » of 3800. The polarization transfer function has been measured in order to determine the intra-cavity circular laser polarization within a measurement uncertainty of 0.7%. The PREx experiment at Jefferson Lab used this system for the first time and achieved 1.0% precision in polarization measurements of an electron beam with energy and current of 1.0 GeV and 50 μA.« less
Sung, Min Jae; Yoon, Seongwon; Kwon, Soon-Ki; Kim, Yun-Hi; Chung, Dae Sung
2016-11-16
A push-pull-type donor copolymer, named PP-TPD, was synthesized with the Suzuki coupling reaction using 6H-phenanthro[1,10,9,8-cdefg]carbazole (PCZ) as the donor unit and 1,3-bis(5-bromothiophen-2-yl)-5-octyl-4H-thieno[3,4-c]pyrrole-4,6(5H)-dione (TPD) as the acceptor unit. The synthesized PP-TPD was systematically investigated in terms of crystallinity and thermal, electrical, electrochemical, and optical properties. PP-TPD revealed green-selective absorption with a narrow full width at half-maximum of 138 nm. Green-selective organic photodiodes (OPDs) were constructed using PP-TPD as the green-absorbing donor and ZnO as the nonabsorbing acceptor material. The fabricated OPDs exhibited an extremely low dark current of 0.68 nA/cm 2 at -5 V and a high detectivity above 10 12 Jones at 550 nm. Moreover, they showed a sufficiently high 3-dB frequency and a linear dynamic range, similar to those of ideal-operating OPDs. The origin and physics background of the observed low dark current and high detectivity are discussed in detail.
Ren, Yongxiong; Li, Long; Wang, Zhe; Kamali, Seyedeh Mahsa; Arbabi, Ehsan; Arbabi, Amir; Zhao, Zhe; Xie, Guodong; Cao, Yinwen; Ahmed, Nisar; Yan, Yan; Liu, Cong; Willner, Asher J.; Ashrafi, Solyman; Tur, Moshe; Faraon, Andrei; Willner, Alan E.
2016-01-01
To increase system capacity of underwater optical communications, we employ the spatial domain to simultaneously transmit multiple orthogonal spatial beams, each carrying an independent data channel. In this paper, we show up to a 40-Gbit/s link by multiplexing and transmitting four green orbital angular momentum (OAM) beams through a single aperture. Moreover, we investigate the degrading effects of scattering/turbidity, water current, and thermal gradient-induced turbulence, and we find that thermal gradients cause the most distortions and turbidity causes the most loss. We show systems results using two different data generation techniques, one at 1064 nm for 10-Gbit/s/beam and one at 520 nm for 1-Gbit/s/beam; we use both techniques since present data-modulation technologies are faster for infrared (IR) than for green. For the 40-Gbit/s link, data is modulated in the IR, and OAM imprinting is performed in the green using a specially-designed metasurface phase mask. For the 4-Gbit/s link, a green laser diode is directly modulated. Finally, we show that inter-channel crosstalk induced by thermal gradients can be mitigated using multi-channel equalisation processing. PMID:27615808
NASA Astrophysics Data System (ADS)
Ren, Yongxiong; Li, Long; Wang, Zhe; Kamali, Seyedeh Mahsa; Arbabi, Ehsan; Arbabi, Amir; Zhao, Zhe; Xie, Guodong; Cao, Yinwen; Ahmed, Nisar; Yan, Yan; Liu, Cong; Willner, Asher J.; Ashrafi, Solyman; Tur, Moshe; Faraon, Andrei; Willner, Alan E.
2016-09-01
To increase system capacity of underwater optical communications, we employ the spatial domain to simultaneously transmit multiple orthogonal spatial beams, each carrying an independent data channel. In this paper, we show up to a 40-Gbit/s link by multiplexing and transmitting four green orbital angular momentum (OAM) beams through a single aperture. Moreover, we investigate the degrading effects of scattering/turbidity, water current, and thermal gradient-induced turbulence, and we find that thermal gradients cause the most distortions and turbidity causes the most loss. We show systems results using two different data generation techniques, one at 1064 nm for 10-Gbit/s/beam and one at 520 nm for 1-Gbit/s/beam; we use both techniques since present data-modulation technologies are faster for infrared (IR) than for green. For the 40-Gbit/s link, data is modulated in the IR, and OAM imprinting is performed in the green using a specially-designed metasurface phase mask. For the 4-Gbit/s link, a green laser diode is directly modulated. Finally, we show that inter-channel crosstalk induced by thermal gradients can be mitigated using multi-channel equalisation processing.
Intense green emission from Tb3+- doped Teo2-Wo3-Geo2 glasses
NASA Astrophysics Data System (ADS)
Subrahmanyam, Tallam; Gopal, Kotalo Rama; Suvarna, Reniguntla Padma; Jamalaiah, Bungala Chinna
2018-04-01
Tb3+ -doped oxyfluoro tellurite (TWGTb) glasses were prepared by conventional melt quenching technique. The Judd-Ofelt theory has been applied to evaluate the Ωλ (λ=2,4,6) intensity parameters. The TWGTb glasses exhibit 5D3 → 7F5-3 and 5D4 → 7F6-0 transitions when excited at 316 nm wavelength. The variation of intensity of 5D4 → 7F5 (Green) and 5D3 → 7F4 (Blue) transitions and the green to blue (IG/IB) intensity ratios were studied as a function of Tb3+ ions concentration. The laser characteristic parameters such as effective bandwidth (Δλeff), stimulated emission cross-section (σe), gain bandwidth (σe×Δλeff) and optical gain (σe×τR) were determined using the emission spectra and radiative parameters. The luminescence decay profiles exhibit single-exponential nature for all the samples. Based on the experimental results we suggest that the 1.0 mol% of Tb3+-doped TWGTb glass could be the suitable laser host materials to emit intense green luminescence at 545 nm.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ren, Yongxiong; Li, Long; Wang, Zhe
To increase system capacity of underwater optical communications, we employ the spatial domain to simultaneously transmit multiple orthogonal spatial beams, each carrying an independent data channel. In this paper, we show up to a 40-Gbit/s link by multiplexing and transmitting four green orbital angular momentum (OAM) beams through a single aperture. Moreover, we investigate the degrading effects of scattering/turbidity, water current, and thermal gradient-induced turbulence, and we find that thermal gradients cause the most distortions and turbidity causes the most loss. We show systems results using two different data generation techniques, one at 1064 nm for 10-Gbit/s/beam and one atmore » 520 nm for 1-Gbit/s/beam; we use both techniques since present data-modulation technologies are faster for infrared (IR) than for green. For the 40-Gbit/s link, data is modulated in the IR, and OAM imprinting is performed in the green using a specially-designed metasurface phase mask. For the 4-Gbit/s link, a green laser diode is directly modulated. Lastly, we show that inter-channel crosstalk induced by thermal gradients can be mitigated using multi-channel equalisation processing.« less
NASA Astrophysics Data System (ADS)
Kwon, Yiseul; Sunesh, Chozhidakath Damodharan; Choe, Youngson
2015-01-01
We report here two new cationic iridium(III) complexes with phenanthroline-based ancillary ligands, [Ir(dfppy)2(dibutyl-phen)]PF6 (Complex 1) and [Ir(ppz)2(dibutyl-phen)]PF6 (Complex 2) and their uses in light-emitting electrochemical cells (LECs). The design is based on 2-(2,4-difluorophenyl)pyridine (dfppy) and 1-phenylpyrazole (ppz) as the cyclometalating ligands and 2,9-dibutyl-1,10-phenanthroline (dibutyl-phen) as the ancillary ligand. The photophysical and electrochemical properties of the complexes were studied and the results obtained were corroborated with theoretical density functional theory (DFT) calculations. LECs were fabricated incorporating each complexes which resulted in blue-green light emission (502 nm) with Commission Internationale de l'Eclairage (CIE) coordinates of (0.26, 0.49) for Complex 1 and green (530 nm) electroluminescence with CIE coordinates of (0.33, 0.54) for Complex 2. The luminance and the current efficiency of the LECs based on Complex 1 are 947 cd m-2 and 0.25 cd A-1, respectively, which are relatively higher than that of Complex 2 with a maximum luminance of 773 cd m-2 and an efficiency of 0.16 cd A-1.
Ren, Yongxiong; Li, Long; Wang, Zhe; Kamali, Seyedeh Mahsa; Arbabi, Ehsan; Arbabi, Amir; Zhao, Zhe; Xie, Guodong; Cao, Yinwen; Ahmed, Nisar; Yan, Yan; Liu, Cong; Willner, Asher J; Ashrafi, Solyman; Tur, Moshe; Faraon, Andrei; Willner, Alan E
2016-09-12
To increase system capacity of underwater optical communications, we employ the spatial domain to simultaneously transmit multiple orthogonal spatial beams, each carrying an independent data channel. In this paper, we show up to a 40-Gbit/s link by multiplexing and transmitting four green orbital angular momentum (OAM) beams through a single aperture. Moreover, we investigate the degrading effects of scattering/turbidity, water current, and thermal gradient-induced turbulence, and we find that thermal gradients cause the most distortions and turbidity causes the most loss. We show systems results using two different data generation techniques, one at 1064 nm for 10-Gbit/s/beam and one at 520 nm for 1-Gbit/s/beam; we use both techniques since present data-modulation technologies are faster for infrared (IR) than for green. For the 40-Gbit/s link, data is modulated in the IR, and OAM imprinting is performed in the green using a specially-designed metasurface phase mask. For the 4-Gbit/s link, a green laser diode is directly modulated. Finally, we show that inter-channel crosstalk induced by thermal gradients can be mitigated using multi-channel equalisation processing.
Advances in process overlay on 300-mm wafers
NASA Astrophysics Data System (ADS)
Staecker, Jens; Arendt, Stefanie; Schumacher, Karl; Mos, Evert C.; van Haren, Richard J. F.; van der Schaar, Maurits; Edart, Remi; Demmerle, Wolfgang; Tolsma, Hoite
2002-07-01
Overlay budgets are getting tighter within 300 mm volume production and as a consequence the process effects on alignment and off-line metrology becomes more important. In a short loop experiment, with cleared reference marks in each image field, the isolated effect of processing was measured with a sub-nanometer accuracy. The examined processes are Shallow Trench Isolation (STI), Tungsten-Chemical Mechanical Processing (W-CMP) and resist spinning. The alignment measurements were done on an ASML TWINSCANT scanner and the off-line metrology measurements on a KLA Tencor. Mark type and mark position dependency of the process effects are analyzed. The mean plus 3 (sigma) of the maximum overlay after correcting batch average wafer parameters is used as an overlay performance indicator (OPI). 3 (sigma) residuals to the wafer-model are used as an indicator of the noise that is added by the process. The results are in agreement with existing knowledge of process effects on 200 mm wafers. The W-CMP process introduces an additional wafer rotation and scaling that is similar for alignment marks and metrology targets. The effects depend on the mark type; in general they get less severe for higher spatial frequencies. For a 7th order alignment mark, the OPI measured about 12 nm and the added noise about 12 nm. For the examined metrology targets the OPI is about 20 nm with an added noise of about 90 nm. Two different types of alignment marks were tested in the STI process, i.e., zero layer marks and marks that were exposed together with the STI product. The overlay contribution due to processing on both types of alignment marks is very low (smaller than 5 nm OPI) and independent on mark type. Some flyers are observed fot the zero layer marks. The flyers can be explained by the residues of oxide and nitride that is left behind in the spaces of the alignment marks. Resist spinning is examined on single layer resist and resist with an organic Bottom Anti-Reflective Coating (BARC) underneath. Single layer resist showed scaling on unsegmented marks that disappears using higher diffraction orders and/or mark segmentation. Resist with a planarizing BARC caused additional effects on the wafer edge for measurements with the red laser signal. The effects disappear using the green laser of ATHENAT.
NASA Astrophysics Data System (ADS)
Venkatachalaiah, KN; Venkataravanappa, M.; Nagabhushana, H.; Basavaraj, R. B.
2016-09-01
For the first time green route method was used to synthesize pure and Mg2+(1-11 mol %) doped Y2O3 nanophosphors by using Mimosa pudica leaves extract as a fuel. The final product was well characterized by powder x-ray diffraction (PXRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), diffuse reflectance spectroscopy (DRS) and photoluminescence (PL).The PXRD result shows the formation of single phase, cubic structure of Y2O3 with crystallite sizes ∼25 nm. The SEM results showed porous and agglomerated structures, TEM images showed the crystallite size of the material and was found to be around ∼ 25 nm. PL emission spectra show the blue light emission under the excitation wavelength of 315 nm. The emission peaks of Mg2+were observed at 428 nm, 515 nm and 600 nm corresponding to the transitions of 4F9/2 → 6Hi7/2 (violet), 4F9/2 → 6Hi5/2 (blue), 4F9/2 → 6HJ3/2 (yellow) respectively. The estimated CIE chromaticity co-ordinate was very close to the national television standard committee value of blue emission. CCT was found to be ∼ 6891 K as a result the present phosphor was potential to be used for warm white light emitting display applications.
Classification of fecal contamination on leafy greens by hyperspectral imaging
NASA Astrophysics Data System (ADS)
Yang, Chun-Chieh; Jun, Won; Kim, Moon S.; Chao, Kaunglin; Kang, Sukwon; Chan, Diane E.; Lefcourt, Alan
2010-04-01
This paper reported the development of hyperspectral fluorescence imaging system using ultraviolet-A excitation (320-400 nm) for detection of bovine fecal contaminants on the abaxial and adaxial surfaces of romaine lettuce and baby spinach leaves. Six spots of fecal contamination were applied to each of 40 lettuce and 40 spinach leaves. In this study, the wavebands at 666 nm and 680 nm were selected by the correlation analysis. The two-band ratio, 666 nm / 680 nm, of fluorescence intensity was used to differentiate the contaminated spots from uncontaminated leaf area. The proposed method could accurately detect all of the contaminated spots.
Fingerprint recognition of alien invasive weeds based on the texture character and machine learning
NASA Astrophysics Data System (ADS)
Yu, Jia-Jia; Li, Xiao-Li; He, Yong; Xu, Zheng-Hao
2008-11-01
Multi-spectral imaging technique based on texture analysis and machine learning was proposed to discriminate alien invasive weeds with similar outline but different categories. The objectives of this study were to investigate the feasibility of using Multi-spectral imaging, especially the near-infrared (NIR) channel (800 nm+/-10 nm) to find the weeds' fingerprints, and validate the performance with specific eigenvalues by co-occurrence matrix. Veronica polita Pries, Veronica persica Poir, longtube ground ivy, Laminum amplexicaule Linn. were selected in this study, which perform different effect in field, and are alien invasive species in China. 307 weed leaves' images were randomly selected for the calibration set, while the remaining 207 samples for the prediction set. All images were pretreated by Wallis filter to adjust the noise by uneven lighting. Gray level co-occurrence matrix was applied to extract the texture character, which shows density, randomness correlation, contrast and homogeneity of texture with different algorithms. Three channels (green channel by 550 nm+/-10 nm, red channel by 650 nm+/-10 nm and NIR channel by 800 nm+/-10 nm) were respectively calculated to get the eigenvalues.Least-squares support vector machines (LS-SVM) was applied to discriminate the categories of weeds by the eigenvalues from co-occurrence matrix. Finally, recognition ratio of 83.35% by NIR channel was obtained, better than the results by green channel (76.67%) and red channel (69.46%). The prediction results of 81.35% indicated that the selected eigenvalues reflected the main characteristics of weeds' fingerprint based on multi-spectral (especially by NIR channel) and LS-SVM model.
Dual line CW fiber laser module based on FBG combination
NASA Astrophysics Data System (ADS)
Dobashi, Kazuma; Hoshi, Masayuki; Hirohashi, Junji; Makio, Satoshi
2018-02-01
We developed the dual line fiber laser module based on FBG combination. The proposed configuration has several advantages such as compact, simple, and inexpensive. The laser was composed pump LD (40W), two HR FBGs for 1053 nm and 1058 nm, Yb-doped fiber, two OC FBGs for 1053 nm and 1058 nm, and delivery fiber. All single mode fibers were polarization maintained with approximately 6 micron core. All FBGs were mounted on holders with TECs and their temperatures were controlled independently. The center wavelengths of HR and OC FBGs were temperature dependent and their shifts are approximately 7 nm/degree-C for all integrated FBG. By adjusting the temperature, it is possible to realize the resonant condition for only 1053 nm or only for 1058 nm. Based on this configuration, we demonstrated dual line CW fiber laser module. This module was compact with the size of 200 mm X 150 mm X 23 mm. By adjusting the FBG temperatures, we obtained the output power of more than 10 W at 1053 nm and 1058 nm with linear polarization.
Visible light emission induced by Krq+ (4 ≤ q ≤ 9) ions colliding with the Cu surface
NASA Astrophysics Data System (ADS)
Guo, Yipan; Yang, Zhihu; Xu, Qiumei; Ren, Jieru; Zhao, Hongyun; Zhao, Yongtao
2017-09-01
In this paper, we report visible light emission from 320 keV Krq+ (4 ≤ q ≤ 9) ions on the Cu target. The wavelength range measured is from 300 nm to 656 nm. Two Cu I spectra deriving from different initial states and one Kr I line are detected. Specifically, the two Cu I lines belong to transitions 3d104p(2P03/2) - 3d104s (2S1/2) at 324.78 nm (A) and 3d104p(2P01/2) - 3d104s(2S1/2) at 327.42 nm (B), respectively, and the photon yield ratio of spectra lines (A) and (B) are about 2:1. The Kr I line belongs to transition 4s24p5(2P03/2)11d 2[3/2]0 - 4s24p5(2P03/2)5p 2[1/2] at 486.12 nm (C). In addition, the experimental results show that the photon yields of all lines are increasing with the charge state increase.
NASA Astrophysics Data System (ADS)
Patterson, Steven G.; Guiney, Tina; Stapleton, Dean; Braker, Joseph; Alegria, Kim; Irwin, David A.; Ebert, Christopher
2017-02-01
DILAS has leveraged its industry-leading work in manufacturing low SWaP fiber-coupled modules extending the wavelength range to 793nm for Tm fiber laser pumping. Ideal for medical, industrial and military applications, modules spanning from single emitter-based 9W to TBar-based 200W of 793nm pump power will be discussed. The highlight is a lightweight module capable of <200W of 793nm pump power out of a package weighing < 400 grams. In addition, other modules spanning from single emitter-based 9W to TBar-based 200W of 793nm pump power will be presented. In addition, advances in DPAL modules, emitting at the technologically important wavelengths near 766nm and 780nm, will be detailed. Highlights include a fully microprocessor controlled fiber-coupled module that produces greater than 400W from a 600 micron core fiber and a line width of only 56.3pm. The micro-processor permits the automated center wavelength and line width tuning of the output over a range of output powers while retaining excellent line center and line width stability over time.
Allen, J.L.; Meinertz, J.R.
1991-01-01
The chromatic and leuco forms of malachite green and crystal violet were readily separated and detected by a sensitive and selective high-performance liquid chromatographic procedure. The chromatic and leuco forms of the dyes were separated within 11 min on a C18 column with a mobile phase of 0.05 M sodium acetate and 0.05 M acetic acid in water (19%) and methanol (81%). A reaction chamber, containing 10% PbO2 in Celite 545, was placed between the column and the spectrophotometric detector to oxidize the leuco forms of the dyes to their chromatic forms. Chromatic and leuco malachite green were quantified by their absorbance at 618 nm; and chromatic and leuco Crystal Violet by their absorbance at 588 nm. Detection limits for chromatic and leuco forms of both dyes ranged from 0.12 to 0.28 ng. A linear range of 1 to 100 ng was established for both forms of the dyes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rakhman, A.; Hafez, Mohamed A.; Nanda, Sirish K.
Here, a high-finesse Fabry-Perot cavity with a frequency-doubled continuous wave green laser (532 nm) has been built and installed in Hall A of Jefferson Lab for high precision Compton polarimetry. The infrared (1064 nm) beam from a ytterbium-doped fiber amplifier seeded by a Nd:YAG nonplanar ring oscillator laser is frequency doubled in a single-pass periodically poled MgO:LiNbO 3 crystal. The maximum achieved green power at 5 W infrared pump power is 1.74 W with a total conversion efficiency of 34.8%. The green beam is injected into the optical resonant cavity and enhanced up to 3.7 kW with a corresponding enhancementmore » of 3800. The polarization transfer function has been measured in order to determine the intra-cavity circular laser polarization within a measurement uncertainty of 0.7%. The PREx experiment at Jefferson Lab used this system for the first time and achieved 1.0% precision in polarization measurements of an electron beam with energy and current of 1.0 GeV and 50 μA.« less
Fluorescent Properties of Manganese Halide Benzothiazole Inorganic-Organic Hybrids.
Yu, Hui; Mei, YingXuan; Wei, ZhenHong; Mei, GuangQuan; Cai, Hu
2016-11-01
The reaction of manganese (II) halides MnX 2 and benzothiazole (btz) in the concentrated acids HX (X = Cl, Br) at 80 °C resulted in the formation of two inorganic-organic hybrid complexes: [(btz) 2 (MnX 4 )]·2H 2 O (X = Cl, 1; X = Br, 2). Both compounds showed green luminescence and exhibited moderate quantum yields of 43.17 % for 1 and 26.18 % for 2, which were directly originated from the tetrahedral coordination of Mn 2+ ion. Two organic - inorganic hybrids [(btz) 2 (MnX 4 )]·2H 2 O based on MnCl 2 , benzothiazole and halide acids emitted green light with the moderate quantum efficiencies when excited by 365 nm light. Graphical abstract Two organic-inorganic hybrids [(btz) 2 (MnX 4 )]·2H 2 O based on MnCl 2 , benzothiazole and halide acids emitted green light with the moderate quantum efficiencies when excited by 365 nm light.
Line roughness improvements on self-aligned quadruple patterning by wafer stress engineering
NASA Astrophysics Data System (ADS)
Liu, Eric; Ko, Akiteru; Biolsi, Peter; Chae, Soo Doo; Hsieh, Chia-Yun; Kagaya, Munehito; Lee, Choongman; Moriya, Tsuyoshi; Tsujikawa, Shimpei; Suzuki, Yusuke; Okubo, Kazuya; Imai, Kiyotaka
2018-04-01
In integrated circuit and memory devices, size shrinkage has been the most effective method to reduce production cost and enable the steady increment of the number of transistors per unit area over the past few decades. In order to reduce the die size and feature size, it is necessary to minimize pattern formation in the advance node development. In the node of sub-10nm, extreme ultra violet lithography (EUV) and multi-patterning solutions based on 193nm immersionlithography are the two most common options to achieve the size requirement. In such small features of line and space pattern, line width roughness (LWR) and line edge roughness (LER) contribute significant amount of process variation that impacts both physical and electrical performances. In this paper, we focus on optimizing the line roughness performance by using wafer stress engineering on 30nm pitch line and space pattern. This pattern is generated by a self-aligned quadruple patterning (SAQP) technique for the potential application of fin formation. Our investigation starts by comparing film materials and stress levels in various processing steps and material selection on SAQP integration scheme. From the cross-matrix comparison, we are able to determine the best stack of film selection and stress combination in order to achieve the lowest line roughness performance while obtaining pattern validity after fin etch. This stack is also used to study the step-by-step line roughness performance from SAQP to fin etch. Finally, we will show a successful patterning of 30nm pitch line and space pattern SAQP scheme with 1nm line roughness performance.
ERIC Educational Resources Information Center
Badarna, Laila Khaled; abu Ashour, Muhammad Ali
2016-01-01
The present study aimed to identify the role of the school administration in solving the students' problems and differences according to gender, scientific qualification, years of experience and job title. The sample consisted of (300) staff from those who are working in the Bedouin schools within the Green Line of Palestine. The author used a…
Storrie-Lombardi, Michael C; Muller, Jan-Peter; Fisk, Martin R; Cousins, Claire; Sattler, Birgit; Griffiths, Andrew D; Coates, Andrew J
2009-12-01
The European Space Agency will launch the ExoMars mission in 2016 with a primary goal of surveying the martian subsurface for evidence of organic material. We have recently investigated the utility of including either a 365 nm light-emitting diode or a 375 nm laser light source in the ExoMars rover panoramic camera (PanCam). Such a modification would make it feasible to monitor rover drill cuttings optically for the fluorescence signatures of aromatic organic molecules and map the distribution of polycyclic aromatic hydrocarbons (PAHs) as a function of depth to the 2 m limit of the ExoMars drill. The technique described requires no sample preparation, does not consume irreplaceable resources, and would allow mission control to prioritize deployment of organic detection experiments that require sample destruction, expenditure of non-replaceable consumables, or both. We report here for the first time laser-induced fluorescence emission (L.I.F.E.) imaging detection limits for anthracene, pyrene, and perylene targets doped onto a Mars analog granular peridotite with a 375 nm Nichia laser diode in optically uncorrected wide-angle mode. Data were collected via the Beagle 2 PanCam backup filter wheel fitted with original blue (440 nm), green (530 nm), and red (670 nm) filters. All three PAH species can be detected with the PanCam green (530 nm) filter. Detection limits in the green band for signal-to-noise ratios (S/N) > 10 are 49 parts per million (ppm) for anthracene, 145 ppm for pyrene, and 20 ppm for perylene. The anthracene detection limit improves to 7 ppm with use of the PanCam blue filter. We discuss soil-dependent detection limit constraints; use of UV excitation with other rover cameras, which provides higher spatial resolution; and the advantages of focused and wide-angle laser modes. Finally, we discuss application of L.I.F.E. techniques at multiple wavelengths for exploration of Mars analog extreme environments on Earth, including Icelandic hydrothermally altered basalts and the ice-covered lakes and glaciers of Dronning Maud Land, Antarctica.
Age-corrected reference values for the Heidelberg multi-color anomaloscope.
Rüfer, Florian; Sauter, Benno; Klettner, Alexa; Göbel, Katja; Flammer, Josef; Erb, Carl
2012-09-01
To determine reference values for the HMC anomaloscope (Heidelberg multi-color anomaloscope) of healthy subjects. One hundred and thirteen healthy subjects were divided into four age groups: <20 years of age (ten female, five male), 20-39 years of age (23 female, 15 male), 40-59 years of age (23 female, ten male) and >60 years of age (nine female, 18 male). Match midpoint, matching range (MR) and anomaly quotient (AQ), according to the Moreland equation [blue (436 nm) + blue-green (490 nm) = cyan (480 nm) + yellow (589 nm)] and according to the Rayleigh equation [green (546 nm) + red (671 nm) = yellow (589 nm)] were determined. The neutral adaptation was done showing white light every 5 seconds in absolute mode and every 15 seconds in relative mode. The mean match midpoint according to the Rayleigh equation was 43.9 ± 2.6 scale units in absolute mode. It was highest between 20-39 years (45.2 ± 2.2) and lowest in subjects >60 years of age (42.2 ± 2.2). The mean MR in absolute mode was 3.1 ± 3.5 scale units with a maximum >60 years (4.4 ± 4.4). The MR in relative mode was between 1.6 ± 1.9 (20-39 years) and 4.4 ± 3.8 (>60 years). The resulting mean AQ was 1.01 ± 0.15 in both modes. The mean match midpoint of the Moreland equation was 51.0 ± 5.2 scale units in absolute mode. It was highest between 20-39 years (52.5 ± 5.7), and lowest in subjects >60 years of age (48.7 ± 3.6). The mean MR according to the Moreland equation was lower in absolute mode (13.4 ± 15.6) than in relative mode (16.2 ± 15.2). The mean resulting AQ was 1.02 ± 0.21 in both modes. The values of this study can be used as references for the diagnosis of red-green and blue perception impairment with the HMC anomaloscope.
Green chemistry synthesis of nano-cuprous oxide.
Ceja-Romero, L R; Ortega-Arroyo, L; Ortega Rueda de León, J M; López-Andrade, X; Narayanan, J; Aguilar-Méndez, M A; Castaño, V M
2016-04-01
Green chemistry and a central composite design, to evaluate the effect of reducing agent, temperature and pH of the reaction, were employed to produce controlled cuprous oxide (Cu2O) nanoparticles. Response surface method of the ultraviolet-visible spectroscopy is allowed to determine the most relevant factors for the size distribution of the nanoCu2O. X-ray diffraction reflections correspond to a cubic structure, with sizes from 31.9 to 104.3 nm. High-resolution transmission electron microscopy reveals that the different shapes depend strongly on the conditions of the green synthesis.
Colorimetric determination of DNase I activity with a DNA-methyl green substrate.
Sinicropi, D; Baker, D L; Prince, W S; Shiffer, K; Shak, S
1994-11-01
A simple, high throughput, and precise assay was developed for quantification of deoxyribonuclease I (DNase; IUB 3.1.21.1) activity. The method was adapted from the procedure devised by Kurnick which employs a substrate comprised of highly polymerized native DNA complexed with methyl green. Hydrolysis of the DNA produced unbound methyl green and a decrease in the absorbance of the solution at 620 nm. By adjusting the time and temperature of the reaction, the assay permits quantification of DNase activity over a wide concentration range (0.4 to 8900 ng/ml). Samples and standards were added to the substrate in microtiter plates and were incubated for 1-24 h at 25-37 degrees C to achieve the desired assay range. The DNase activity of the samples was interpolated from a standard curve generated with Pulmozyme recombinant human deoxyribonuclease I (rhDNase). Interassay precision was less than 12% CV and recovery was within 100 +/- 11%. Activity determination by the DNA-methyl green method correlated well with that determined by the widely used "hyperchromicity" method originated by Kunitz, which is based on the increase in absorbance at 260 nm upon hydrolysis of DNA. The DNA-methyl green assay was simpler and more versatile than the hyperchromicity method and was used to characterize the activity of rhDNase and DNase isolated from human urine.
Protanomaly-without-darkened-red is deuteranopia with rods
Shevell, Steven K.; Sun, Yang; Neitz, Maureen
2008-01-01
The Rayleigh match, a color match between a mixture of 545+670 nm lights and 589 nm light in modern instruments, is the definitive measurement for the diagnosis of inherited red/green color defects. All trichromats, whether normal or anomalous, have a limited range of 545+670 nm mixtures they perceive to match 589 nm: a typical color-normal match-range is about 50–55% of 670 nm in the mixture (deutan mode), while deuteranomals have a range that includes mixtures with less 670 nm than normal and protanomals a range that includes mixtures with more 670 nm than normal. Further, the matching luminance of the 589 nm light for deuteranomals is the same as for normals but for protanomals is below normal. An example of an unexpected Rayleigh match, therefore, is a match range above normal (typical of protanomaly) and a normal luminance setting for 589 nm (typical of deuteranomaly), a match that Pickford (1950) called protanomaly “when the red end of the spectrum is not darkened”. In this case, Rayleigh matching does not yield a clear diagnosis. Aside from Pickford, we are aware of only one other report of a similar observer (Pokorny and Smith, 1981); this study predated modern genetic techniques that can reveal the cone photopigment(s) in the red/green range. We recently had the opportunity to conduct genetic and psychophysical tests on such an observer. Genetic results predict he is a deuteranope. His Rayleigh match is consistent with L cones and a contribution from rods. Further, with a rod-suppressing background, his Rayleigh match is characteristic of a single L-cone photopigment (deuteranopia). PMID:18423511
Lipoprotein Processing Is Essential for Resistance of Mycobacterium tuberculosis to Malachite Green▿
Banaei, Niaz; Kincaid, Eleanor Z.; Lin, S.-Y. Grace; Desmond, Edward; Jacobs, William R.; Ernst, Joel D.
2009-01-01
Malachite green, a synthetic antimicrobial dye, has been used for over 50 years in mycobacterial culture medium to inhibit the growth of contaminants. The molecular basis of mycobacterial resistance to malachite green is unknown, although the presence of malachite green-reducing enzymes in the cell envelope has been suggested. The objective of this study was to investigate the role of lipoproteins in resistance of Mycobacterium tuberculosis to malachite green. The replication of an M. tuberculosis lipoprotein signal peptidase II (lspA) mutant (ΔlspA::lspAmut) on Middlebrook agar with and without 1 mg/liter malachite green was investigated. The lspA mutant was also compared with wild-type M. tuberculosis in the decolorization rate of malachite green and sensitivity to sodium dodecyl sulfate (SDS) detergent and first-line antituberculosis drugs. The lspA mutant has a 104-fold reduction in CFU-forming efficiency on Middlebrook agar with malachite green. Malachite green is decolorized faster in the presence of the lspA mutant than wild-type bacteria. The lspA mutant is hypersensitive to SDS detergent and shows increased sensitivity to first-line antituberculosis drugs. In summary, lipoprotein processing by LspA is essential for resistance of M. tuberculosis to malachite green. A cell wall permeability defect is likely responsible for the hypersensitivity of lspA mutant to malachite green. PMID:19596883
[Study on spectral detection of green plant target].
Deng, Wei; Zhao, Chun-jiang; He, Xiong-kui; Chen, Li-ping; Zhang, Lu-da; Wu, Guang-wei; Mueller, J; Zhai, Chang-yuan
2010-08-01
Weeds grow scatteredly in fields, where many insentient objects exist, for example, withered grasses, dry twig and barriers. In order to improve the precision level of spraying, it is important to study green plant detecting technology. The present paper discussed detecting method of green plant by using spectral recognizing technology, because of the real-time feature of spectral recognition. By analyzing the reflectivity difference between each of the two sides of the "red edge" of the spectrum from plants and surrounding environment, green plant discriminat index (GPDI) is defined as the value which equals the reflectivity ratio at the wavelength of 850 nm divided by the reflectivity ratio at the wavelength of 650 nm. The original spectral data of green plants and the background were measured by using the handhold FieldSpec 3 Spectroradiometer manufactured by ASD Inc. in USA. The spectral data were processed to get the reflectivity of each measured objects and to work out the GPDI thereof as well. The classification model of green plant and its background was built up using decision tree method in order to obtain the threshold of GPDI to distinguish green plants and the background. The threshold of GPDI was chosen as 5.54. The detected object was recognized as green plant when it is GPDI>GPDITH, and vice versa. Through another test, the accuracy rate was verified which was 100% by using the threshold. The authors designed and developed the green plant detector based on single chip microcomputer (SCM) "AT89S51" and photodiode "OPT101" to realize detecting green plants from the background. After passing through two optical filters, the center wavelengths of which are 650 and 850 nm respectively, the reflected light from measured targets was detected by two photodiodes and converted into electrical signals. These analog signals were then converted to digital signals via an analog-to-digital converter (ADS7813) after being amplified by a signal amplifier (OP400). The converted digital signal of reflected light was eventually sent to the SCM (AT89S51) and was calculated and processed there. The processing results and the control signals were given out to actuate executive device to open or close the solenoid valve. The test results show that the level of detectivity of the designed detector was affected by the species, size, and density of weeds. The detectivity of broad-leaf species is higher than that of narrow-leaf species. Broad-leaf species are more easily detected than those narrow-leaf ones; the bigger the plants and the denser the leaves are, the higher the level of detectivity is.
Lyα Profile, Dust, and Prediction of Lyα Escape Fraction in Green Pea Galaxies
NASA Astrophysics Data System (ADS)
Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Leitherer, Claus; Wofford, Aida; Jiang, Tianxing; Dijkstra, Mark; Tilvi, V.; Wang, Junxian
2017-08-01
We studied Lyman-α (Lyα) escape in a statistical sample of 43 Green Peas with HST/COS Lyα spectra. Green Peas are nearby star-forming galaxies with strong [O III]λ5007 emission lines. Our sample is four times larger than the previous sample and covers a much more complete range of Green Pea properties. We found that about two-thirds of Green Peas are strong Lyα line emitters with rest-frame Lyα equivalent width > 20 \\mathringA . The Lyα profiles of Green Peas are diverse. The Lyα escape fraction, defined as the ratio of observed Lyα flux to intrinsic Lyα flux, shows anti-correlations with a few Lyα kinematic features—both the blue peak and red peak velocities, the peak separations, and the FWHM of the red portion of the Lyα profile. Using properties measured from Sloan Digital Sky Survey optical spectra, we found many correlations—the Lyα escape fraction generally increases at lower dust reddening, lower metallicity, lower stellar mass, and higher [O III]/[O II] ratio. We fit their Lyα profiles with the H I shell radiative transfer model and found that the Lyα escape fraction is anti-correlated with the best-fit N H I . Finally, we fit an empirical linear relation to predict {f}{esc}{Lyα } from the dust extinction and Lyα red peak velocity. The standard deviation of this relation is about 0.3 dex. This relation can be used to isolate the effect of intergalactic medium (IGM) scatterings from Lyα escape and to probe the IGM optical depth along the line of sight of each z> 7 Lyα emission-line galaxy in the James Webb Space Telescope era.
Ghate, T; Deshpande, S; Bhargava, S
2017-05-01
Near isogenic lines (NILs) of sweet sorghum genotype S35 into which individual stay green loci were introgressed, were used to understand the contribution of Stay green loci to stem sugar accumulation and its remobilization under drought stress exposure. Sugar and starch content, activities of sugar metabolism enzymes and levels of their expression were studied in the 3rd (source) leaf from panicle and the 5th (sugar storing) internode of the three lines, in irrigated plants and in plants exposed to a brief drought exposure at the panicle emergence stage. Annotation of genes in the respective Stay green loci introgressed in the NILs was carried out using bioinformatics tools. The leaves of NILs accumulated more photoassimilates and the internodes accumulated more sugar, as compared to the parent S35 line. Drought stress exposure led to a decrease in the starch and sugar levels in leaves of all three lines, while an increase in sugar levels was observed in internodes of the NILs. Sugar fluxes were accompanied by alterations in the activities of sugar metabolizing enzymes as well as the expression of genes related to sugar metabolism and transport. Remobilization of sugars from the stem internodes was apparent in the NILs when subjected to drought stress, since the peduncle, which supports the panicle, showed an increase in the sugar content, even when photoassimation in source leaves was reduced. Several genes related to carbohydrate metabolism were located in the Stay green loci, which probably contributed to variation in the parameters studied. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.
Ocean acoustic interferometry.
Brooks, Laura A; Gerstoft, Peter
2007-06-01
Ocean acoustic interferometry refers to an approach whereby signals recorded from a line of sources are used to infer the Green's function between two receivers. An approximation of the time domain Green's function is obtained by summing, over all source positions (stacking), the cross-correlations between the receivers. Within this paper a stationary phase argument is used to describe the relationship between the stacked cross-correlations from a line of vertical sources, located in the same vertical plane as two receivers, and the Green's function between the receivers. Theory and simulations demonstrate the approach and are in agreement with those of a modal based approach presented by others. Results indicate that the stacked cross-correlations can be directly related to the shaded Green's function, so long as the modal continuum of any sediment layers is negligible.
Multiwavelength spectropolarimetric observations of an Ellerman bomb
NASA Astrophysics Data System (ADS)
Rezaei, R.; Beck, C.
2015-10-01
Context. Ellerman bombs (EBs) are enhanced emission in the wings of the Hα line in the solar spectrum. Aims: We study the structure of an EB in the photosphere and chromosphere. Methods: We analyze simultaneous observations of four chromospheric lines (Hα, Ca ii H, Ca ii IR 854 nm, and He i 1083 nm) as well as two photospheric lines (Fe i 630 and Si i 1082.7 nm) along with high-cadence 160 and 170 nm ultraviolet (UV) continuum filtergrams. Full Stokes data from the Helioseismic and Magnetic Imager (HMI) are used to trace the temporal evolution of the magnetic structure. Results: We identify the EB by excess emission in the wings of the Hα line, a brightening in the UV continuum, and large emission peaks in the core of the two Ca ii lines. The EB shows a blueshift in all chromospheric lines, while no shifts are observed in the photospheric lines. The blueshift in the chromospheric layer causes very asymmetric emission peaks in the Ca ii H line. The photospheric Si i spectral line shows a shallower line depth at the location of the EB. The UV continuum maps show that the EB was substantially brighter than its surroundings for about 30 min. The continuum contrast of the EB from 170 nm to 1080 nm shows a power-law dependency on the wavelength. The temperature enhancement amounts to 130 K in the low photosphere and 400 K at the temperature minimum level. This temperature excess is also seen in an LTE inversion of the Ca ii spectra. The total thermal and radiative energy content of the EB is about 1020 J and 1018 J in the photosphere and chromosphere, respectively. The HMI data hints at a photospheric magnetic flux cancellation as the driver of the EB. Conclusions: Ellerman bombs release the energy in a height range of several pressure scale heights around the temperature minimum such that they affect both the photosphere and the lower chromosphere.
Lin, Liangwu; Sun, Xinyuan; Jiang, Yao; He, Yuehui
2013-12-21
Novel near-UV and blue excited Eu(3+), Tb(3+)-codoped one dimensional strontium germanate full-color nano-phosphors have been successfully synthesized by a simple sol-hydrothermal method. The morphologies, internal structures, chemical constitution and optical properties of the resulting samples were characterized using FE-SEM, TEM, HRTEM, EDS, XRD, FTIR, XPS, PL and PLE spectroscopy and luminescence decay curves. The results suggested that the obtained Eu(3+), Tb(3+)-codoped strontium germanate nanowires are single crystal nanowires with a diameter ranging from 10 to 80 nm, average diameter of around 30 nm and the length ranging from tens to hundreds micrometers. The results of PL and PLE spectra indicated that the Eu(3+), Tb(3+)-codoped single crystal strontium germanate nanowires showed an intensive blue, blue-green, green, orange and red or green, orange and red light emission under excitation at 350-380 nm and 485 nm, respectively, which may attributed to the coexistent Eu(3+), Eu(2+) and Tb(3+) ions, and the defects located in the strontium germanate nanowires. A possible mechanism of energy transfer among the host, Eu(3+) and Tb(3+) ions was proposed. White-emission can be realized in a single-phase strontium germanate nanowire host by codoping with Tb(3+) and Eu(3+) ions. The Eu(3+), Tb(3+)-codoped one-dimensional strontium germanate full-color nano-phosphors have superior stability under electron bombardment. Because of their strong PL intensity, good CIE chromaticity and stability, the novel 1D strontium germanate full-color nano-phosphors have potential applications in W-LEDs.
Advances in Fluorescence Sensing Systems for the Remote Assessment of Nitrogen Supply in Field Corn
NASA Technical Reports Server (NTRS)
Corp, L. A.; Chappelle, E. W.; McMurtrey, J. E.; Daughtry, C. S. T.; Kim, M. S.
2000-01-01
The studies described herein were conducted to better define changes in fluorescence properties of leaves from field grown corn (Zea mays L.) as they relate to varying levels of nitrogen (N) fertilization. This research was directed toward: 1) providing a remote non-destructive sensing technique to aid in the determination of optimal rates of N fertilization in corn crops and, 2) defining parameters for further development of fluorescence instrumentation to be operated remotely at field canopy levels. Fluorescence imaging bands centered in the blue (450 nm), green (525 nm), red (680 nm), and far-red (740 nm) and ratios of these bands were compared with the following plant parameters: rates of photosynthesis, N:C ratio, pigment concentrations, and grain yields. Both the fluorescence and physiological measures exhibited similar curvilinear responses to N fertilization level while significant linear correlations were obtained among fluorescence bands and band ratios to certain physiological measures of plant productivity. The red / blue, red / green, far-red / blue, far-red /green fluorescence ratios are well suited for remote observation and provided high correlations to grain yield, LAI, N:C, and chlorophyll contents. The results from this investigation indicate that fluorescence technology could aid in the determination of N fertilization requirements for corn. This discussion will also address design concepts and preliminary field trials of a mobile field-based Laser Induced Fluorescence Imaging System (LIFIS) capable of simultaneously acquiring images of four fluorescence emission bands from areas of plant canopies equaling 1 sq m and greater without interference of ambient solar radiation.
Modified InGaN/GaN quantum wells with dual-wavelength green-yellow emission
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fang, Z. L., E-mail: zhilaifang@hotmail.com; Li, Q. F.; Shen, X. Y.
2014-01-28
Energy band engineering by indium pretreatment of the bottom GaN barriers and control of the growth temperature profile for the InGaN active layers were employed to improve the green-yellow emitting InGaN/GaN quantum well (QW). The modified InGaN/GaN QWs were investigated by various characterization techniques and demonstrated to be of good interface abruptness and well-defined indium concentration profile, composed of 0.52 nm In{sub 0.35}Ga{sub 0.65}N “wetting layer,” 1.56 nm In{sub 0.35-0.22}Ga{sub 0.65-0.78}N graded layers, and 1.56 nm In{sub 0.22}Ga{sub 0.78}N layer along the growth direction. Broad-band dual-wavelength green-yellow emission at about 497 and 568 nm was observed and attributed to the major contribution of enhancedmore » interband transitions from the first and second quantized electron states “e1” and “e2” to the first quantized hole state “h1.” With the modified QW structure, electron overflow loss would be suppressed by filling of the excited electron state with electrons at high carrier injection density and reduction in polarization-induced band bending. APSYS simulation shows efficiency and droop improvements due to the enhanced overlapping of electron and hole wave functions inside the modified InGaN active layers, and the enhanced interband transitions involving the excited electron state.« less
Interpretation of the fluorescence signatures from vegetation
NASA Astrophysics Data System (ADS)
Buschmann, C.
Vegetation emits fluorescence as part of the energy taken up by absorption %of solar radiation from UV to the visible. This fluorescence consists of light with low intensity (only few percents of the reflected light) emitted from the leaves. The fluorescence emission of a green leaf is characterized by four bands with maxima in the blue (440 nm), green (520 nm), red (690 nm) and far red (740 nm) spectral region. The intensity of fluorescence in the maxima of the emission spectrum varies depending on the following six basic parameters which must be taken into account for the interpretation of fluorescence signatures from vegetation: (a) content of the fluorophores (ferulic acid, chlorophyll a), (b) temperature of the leaf, (c) penetration of excitation light into the leaf, (d) emission of fluorescence from the leaf (re-absorption inside the leaf tissue), (e) photosynthetic activity of the leaf, (f) non-radiative decay (heat production) parallel to the fluorescence The ratios between the intensities of the maxima (F440/F690, F440/F520, F690/F740) are used as characteristic fluorescence parameter. The wide range of changes of these ratios caused by differences in the leaf tissue (aerial interspaces, variegated/homogeneous green leaves), various types of stress (UV, photoinhibition, sun exposure, heat, water deficiency, N-deficiency) and chemicals (inhibitors, fertilizers) can be explained by changes of the six basic parameters. It will be shown that the interpretation of the fluorescence signatures, in most cases, must be based on a complex consideration of more than one of the basic parameters.
Zhang, Bingbo; Yang, Weitao; Yu, Jiani; Guo, Weisheng; Wang, Jun; Liu, Shiyuan; Xiao, Yi; Shi, Donglu
2017-02-01
Gadolinium (Gd)-based nanoparticles are known for their high potential in magnetic resonance imaging (MRI). However, further MRI applications of these nanoparticles are hampered by their relatively large sizes resulting in poor organ/tumor targeting. In this study, ultrafine sub-10 nm and biocompatible Gd-based nanoparticles are synthesized in a bioinspired, environmentally benign, and straightforward fashion. This novel green synthetic strategy is developed for growing dextran-coated Gd-based nanoparticles (GdNPs@Dex). The as-prepared GdNPs@Dex is not only biocompatible but also stable with a sub-10 nm size. It exhibits higher longitudinal and transverse relaxivities in water (r 1 and r 2 values of 5.43 and 7.502 s -1 × 10 -3 m -1 of Gd 3+ , respectively) than those measured for Gd-DTPA solution (r 1 and r 2 values of 3.42 and 3.86 s -1 × 10 -3 m -1 of Gd 3+ , respectively). In vivo dynamic T 1 -weighted MRI in tumor-bearing mice shows GdNPs@Dex can selectively target kidneys and tumor, in addition to liver and spleen. GdNPs@Dex is found particularly capable for determining the tumor boundary with clearly enhanced tumor angiogenesis. GdNPs@Dex is also found cleared from body gradually mainly via hepatobiliary and renal processing with no obvious systemic toxicity. With this green synthesis strategy, the sub-10 nm GdNPs@Dex presents promising potentials for translational biomedical imaging applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kanamori, Yoshiaki; Ozaki, Toshikazu; Hane, Kazuhiro
2014-10-20
We fabricated reflection color filters of the three primary colors with wide viewing angles using silicon two-dimensional subwavelength gratings on the same quartz substrate. The grating periods were 400, 340, and 300 nm for red, green, and blue filters, respectively. All of the color filters had the same grating thickness of 100 nm, which enabled simple fabrication of a color filter array. Reflected colors from the red, green, and blue filters under s-polarized white-light irradiation appeared in the respective colors at incident angles from 0 to 50°. By rigorous coupled-wave analysis, the dimensions of each color filter were designed, and the calculated reflectivity was compared with the measured reflectivity.
Yao, Wenming; Gao, Jing; Zhang, Long; Li, Jiang; Tian, Yubing; Ma, Yufei; Wu, Xiaodong; Ma, Gangfei; Yang, Jianming; Pan, Yubai; Dai, Xianjin
2015-06-20
We present what is, to the best of our knowledge, the first report on yellow-green laser generation based on the frequency doubling of the 1.1 μm transitions in Nd:YAG ceramics. By employing an 885 nm diode laser as the end-pumping source and a lithium triborate crystal as the frequency doubler, the highest continuous wave output powers of 1.4, 0.5, and 1.1 W at 556, 558, and 561 nm are achieved, respectively. These result in optical-to-optical efficiencies of 6.9%, 2.5%, and 5.4% with respect to the absorbed pump power, respectively.
NASA Technical Reports Server (NTRS)
Onate, Bryan
2016-01-01
The International Space Station (ISS) will soon have a platform for conducting fundamental research of Large Plants. Plant Habitat (PH) is designed to be a fully controllable environment for high-quality plant physiological research. PH will control light quality, level, and timing, temperature, CO2, relative humidity, and irrigation, while scrubbing ethylene. Additional capabilities include leaf temperature and root zone moisture and oxygen sensing. The light cap will have red (630 nm), blue (450 nm), green (525 nm), far red (730 nm) and broad spectrum white LEDs. There will be several internal cameras (visible and IR) to monitor and record plant growth and operations.
Azizi, Susan; Mahdavi Shahri, Mahnaz; Rahman, Heshu Sulaiman; Rahim, Raha Abdul; Rasedee, Abdullah; Mohamad, Rosfarizan
2017-01-01
Among nanoparticles used for medical applications, palladium nanoparticles (PdNPs) are among the least investigated. This study was undertaken to develop PdNPs by green synthesis using white tea (W.tea; Camellia sinensis ) extract to produce the Pd@W.tea NPs. The Pd@W.tea NPs were characterized by UV-vis spectroscopy and X-ray diffractometry, and evaluated with transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The Pd@W.tea NPs were spherical (size 6-18 nm) and contained phenols and flavonoids acquired from the W.tea extract. Pd@W.tea NPs has good 1-diphenyl-2-picrylhydrazyl (DPPH), OH, and NO-scavenging properties as well as antibacterial effects toward Staphylococcus epidermidis and Escherichia coli . MTT assay showed that Pd@W.tea NPs (IC 50 =0.006 μM) were more antiproliferative toward the human leukemia (MOLT-4) cells than the W.tea extract (IC 50 =0.894 μM), doxorubicin (IC 50 =2.133 μM), or cisplatin (IC 50 =0.013 μM), whereas they were relatively innocuous for normal human fibroblast (HDF-a) cells. The anticancer cell effects of Pd@W.tea NPs are mediated through the induction of apoptosis and G2/M cell-cycle arrest.
NASA Astrophysics Data System (ADS)
Xu, Wei; Fan, Yapei; Liu, Xinfang; Luo, Denglin; Liu, Huan; Yang, Ningning
2018-04-01
Silver nanoparticles (Ag NPs) were green fabricated using soluble green tea powder (SGTP) as stabilizer and reducing agent. The properties and morphology of Ag NPs were investigated through UV–visible spectroscopy, field emission transmission electron microscope (FE-TEM) and fourier transform infrared (FT-IR). The spectroscopy showed surface plasmon resonance around at 420 nm revealing the synthesis of Ag NPs. FE-TEM results confirmed that the Ag NPs are spherical and face-centered cubic structure. FT-IR spectroscopy identified the role of various functional groups in the nanoparticle synthesis. The one spot biosynthesized Ag NPs showed favourable antibacterial properties on Escherichia coli and Staphyloccocus aureus, and excellent catalytic reduction of 4-nitrophenol. This work provided a feasible, green method to fabricate Ag NPs with promising photocatalytic and antimicrobial activities.
Red Fluorescent Carbon Nanoparticle-Based Cell Imaging Probe.
Ali, Haydar; Bhunia, Susanta Kumar; Dalal, Chumki; Jana, Nikhil R
2016-04-13
Fluorescent carbon nanoparticle-based probes with tunable visible emission are biocompatible, environment friendly and most suitable for various biomedical applications. However, synthesis of red fluorescent carbon nanoparticles and their transformation into functional nanoparticles are very challenging. Here we report red fluorescent carbon nanoparticle-based nanobioconjugates of <25 nm hydrodynamic size and their application as fluorescent cell labels. Hydrophobic carbon nanoparticles are synthesized via high temperature colloid-chemical approach and transformed into water-soluble functional nanoparticles via coating with amphiphilic polymer followed by covalent linking with desired biomolecules. Following this approach, carbon nanoparticles are functionalized with polyethylene glycol, primary amine, glucose, arginine, histidine, biotin and folic acid. These functional nanoparticles can be excited with blue/green light (i.e., 400-550 nm) to capture their emission spanning from 550 to 750 nm. Arginine and folic acid functionalized nanoparticles have been demonstrated as fluorescent cell labels where blue and green excitation has been used for imaging of labeled cells. The presented method can be extended for the development of carbon nanoparticle-based other bioimaging probes.
The Research of Correlation of Water Surface Spectral and Sediment Parameters
NASA Astrophysics Data System (ADS)
Li, J.; Gong, G.; Fang, W.; Sun, W.
2018-04-01
In the method of survey underwater topography using remote sensing, and the water surface spectral reflectance R, which remote sensing inversion results were closely related to affects by the water and underwater sediment and other aspects, especially in shallow nearshore coastal waters, different sediment types significantly affected the reflectance changes. Therefore, it was of great significance of improving retrieval accuracy to explore the relation of sediment and water surface spectral reflectance. In this study, in order to explore relationship, we used intertidal sediment sand samples in Sheyang estuary, and in the laboratory measured and calculated the chroma indicators, and the water surface spectral reflectance. We found that water surface spectral reflectance had a high correlation with the chroma indicators; research result stated that the color of the sediment had an very important impact on the water surface spectral, especially in Red-Green chroma a*. Also, the research determined the sensitive spectrum bands of the Red-Green chroma a*, which were 636-617 nm, 716-747 nm and 770-792 nm.
Upconversion luminescence of CsScF4 crystals doped with erbium and ytterbium
NASA Astrophysics Data System (ADS)
Ikonnikov, D. A.; Voronov, V. N.; Molokeev, M. S.; Aleksandrovsky, A. S.
2016-10-01
Tetragonal CsScF4 crystals doped with (5 at.%) Er and Er/Yb (0.5 at.%/5 at.%) are grown and their crystal structure is determined to belong to Pmmn space group. Er and Yb ions are shown to occupy distorted octahedral Sc sites with the center of inversion. Bright visible upconversion luminescence was observed under 970-980 nm pumping with red (4F9/2), yellow (4S3/2) and green (2H11/2) bands of comparable intensity. UCL tuning curves maximize at 972 nm (CSF:Er) and at 969.7 nm (CSF:Er,Yb) pumping wavelengths. Different ratios between yellow-green and red luminescence intensities in CSF:Er and CSF:Er, Yb are explained by contribution of cross-relaxation in CSF:Er UCL. UC in CSF:Er is a three stage process while UC in CSF:Er, Yb is a two stage process. The peculiarities of power dependences are explained by the power-dependent repopulation between starting levels of UC.
Dey, Riya; Kumar Rai, Vineet
2017-03-22
Optical temperature sensing in Er 3+ -Tm 3+ -Yb 3+ codoped CaMoO 4 phosphor prepared by chemical co-precipitation route based on the near infrared (NIR) to green upconversion emission from Er 3+ ion is reported. The variation with respect to external temperature in emission intensity ratio of the green emissions around 530 nm and 552 nm, corresponding to the 2 H 11/2 → 4 I 15/2 and 4 S 3/2 → 4 I 15/2 transitions respectively, under 980 nm excitation has been studied in detail, to report the sensing property of the prepared material; the maximum sensor sensitivity ∼0.0182 K -1 was attained at 413 K. The laser induced optical heating within the prepared phosphor has been explored and the heat generation caused by the laser effect has been verified by comparison of experimental and calculated data.
Certification procedures for sirius red F3B (CI 35780, Direct red 80).
Dapson, R W; Fagan, C; Kiernan, J A; Wickersham, T W
2011-06-01
Sirius red F3B (CI 35780, Direct red 80) is a polyazo dye used principally in staining methods for collagen and amyloid. For certification by the Biological Stain Commission, a sample of the dye must exhibit an absorption spectrum of characteristic shape with a maximum at 528-529 nm, a small shoulder near 500 nm and narrow peaks at 372, 281-282 and 230-235 nm. Spot tests (color changes with addition of concentrated H(2)SO(4) or HCl and subsequent dilution or neutralization) also are applied. The dye must perform satisfactorily in the picro-sirius red method for collagen by providing red staining of all types of collagen with yellow and green birefringence of fibers. Llewellyn's alkaline sirius red method applied to tissue known to contain amyloid must show red coloration of the products with green birefringence. Dye content, which does not influence significantly the staining properties of sirius red F3B, is not assayed.
Blueish green photoluminescence from nitrided GaAs(100) surfaces
NASA Astrophysics Data System (ADS)
Shimaoka, Goro; Udagawa, Takashi
1999-04-01
Optical and structural studies were made on the Si-doped (100)GaAs surfaces nitrided at a temperature between 650° and 750°C for 15 min in the flowing NH 3 gas. The wavelength of photoluminescence (PL) spectra were observed to be shortened from 820 nm of the GaAs nitrided at 650°C with increasing nitridation temperature. Blueish green PL with wavelengths of approx. 490 nm and 470 nm were emitted from the nitrided surfaces at 700° and 750°C, respectively. Results of AES and SIMS indicated that the surfaces are nitrided as GaAs 1- xN x, (0< x≤1) alloy layer, and the nitrided region also tended to increase as the temperature raised. High-resolution transmission electron microscopic (HRTEM), transmission electron diffraction (TED) and energy dispersive X-ray (EDX) results showed that films peeled off from the nitrided surfaces consisted mainly of hexagonal, wurtzite-type gallium nitride (GaN) with stacking faults and microtwins.
NASA Astrophysics Data System (ADS)
Kowalewska, Zofia; Laskowska, Hanna; Gzylewski, Michał
2017-06-01
High-resolution continuum source and line source flame atomic absorption spectrometry (HR-CS FAAS and LS FAAS, respectively) were applied for Pb determination in unleaded aviation or automotive gasoline that was dissolved in methyl-isobutyl ketone. When using HR-CS FAAS, a structured background (BG) was registered in the vicinity of both the 217.001 nm and 283.306 nm Pb lines. In the first case, the BG, which could be attributed to absorption by the OH molecule, directly overlaps with the 217 nm line, but it is of relatively low intensity. For the 283 nm line, the structured BG occurs due to uncompensated absorption by OH molecules present in the flame. BG lines of relatively high intensity are situated at a large distance from the 283 nm line, which enables accurate analysis, not only when using simple variants of HR-CS FAAS but also for LS FAAS with a bandpass of 0.1 nm. The lines of the structured spectrum at 283 nm can have ;absorption; (maxima) or ;emission; (minima) character. The intensity of the OH spectra can significantly depend on the flame character and composition of the investigated organic solution. The best detection limit for the analytical procedure, which was 0.01 mg L- 1 for Pb in the investigated solution, could be achieved using HR-CS FAAS with the 283 nm Pb line, 5 pixels for the analyte line measurement and iterative background correction (IBC). In this case, least squares background correction (LSBC) is not recommended. However, LSBC (available as the ;permanent structures; option) would be recommended when using the 217 nm Pb line. In LS FAAS, an additional phenomenon related to the nature of the organic matrix (for example, isooctane or toluene) can play an important role. The effect is of continuous character and probably due to the simultaneous efficient correction of the continuous background (IBC) it is not observed in HR-CS FAAS. The fact that the effect does not depend on the flame character indicates that it is not radiation scattering. For LS FAAS, the determination of Pb using the 283 nm line, a 0.1 nm bandpass and a fuel lean flame is strongly recommended. The analysis of certified reference materials, recovery studies and the analysis of real samples with low Pb content supported the satisfactory accuracy of Pb determination in automotive or aviation gasoline when the recommended analytical variants are applied. The studies in this work shed new light on spectral phenomena in air-acetylene flames. The structured background due to absorption by the OH molecules must be taken into account during Pb determination in other materials as well as in some other elemental determinations, especially at low absorbance levels. The usefulness of HR-CS FAAS for revealing and investigating a structured background was demonstrated. HR-CS FAAS does not reveal fully corrected spectral effects with a continuous character, which can be found in LS FAAS.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pletneva, Nadya V.; Pletnev, Vladimir Z.; Lukyanov, Konstantin A.
2010-11-03
The acGFPL is the first-identified member of a novel, colorless and non-fluorescent group of green fluorescent protein (GFP)-like proteins. Its mutant aceGFP, with Gly replacing the invariant catalytic Glu-222, demonstrates a relatively fast maturation rate and bright green fluorescence ({lambda}{sub ex} = 480 nm, {lambda}{sub em} = 505 nm). The reverse G222E single mutation in aceGFP results in the immature, colorless variant aceGFP-G222E, which undergoes irreversible photoconversion to a green fluorescent state under UV light exposure. Here we present a high resolution crystallographic study of aceGFP and aceGFP-G222E in the immature and UV-photoconverted states. A unique and striking feature ofmore » the colorless aceGFP-G222E structure is the chromophore in the trapped intermediate state, where cyclization of the protein backbone has occurred, but Tyr-66 still stays in the native, non-oxidized form, with C{sup {alpha}} and C{sup {beta}} atoms in the sp{sup 3} hybridization. This experimentally observed immature aceGFP-G222E structure, characterized by the non-coplanar arrangement of the imidazolone and phenolic rings, has been attributed to one of the intermediate states in the GFP chromophore biosynthesis. The UV irradiation ({lambda} = 250-300 nm) of aceGFP-G222E drives the chromophore maturation further to a green fluorescent state, characterized by the conventional coplanar bicyclic structure with the oxidized double Tyr-66 C{sup {alpha}} = C{sup {beta}} bond and the conjugated system of {pi}-electrons. Structure-based site-directed mutagenesis has revealed a critical role of the proximal Tyr-220 in the observed effects. In particular, an alternative reaction pathway via Tyr-220 rather than conventional wild type Glu-222 has been proposed for aceGFP maturation.« less
Evanescent-wave Infrared Optical Fiber Gas Sensor
NASA Astrophysics Data System (ADS)
Wang, Yiding; Wang, Di; Zhong, Hong-Jie; Zhang, Zhiguo
2000-03-01
We propose the treatment of amblyopia using yellow-green laser diodes.There are amblyopia children in excess of fifty million in the world.Because the causative agent of amblyopia hasn't been well understood,only roughly considered to be concerned with visual sense cell,optic nerve network and function of nerve center,no appropriate treatment is found up to date.The vision of person is determined by the center hollow region of retina,where there are three kinds of cone cell.The corresponding peak wavelength in absorption spectrum locates 447nm(blue light),532nm (green light)and 565nm(yellow light), respectively.When stimulated by white light, excited degree of three kinds of cone cell are identical,or yellow-green light,to which person eye is most sensitive, will significantly takes effects.Therefore the yellow-green laser diode is suitable for treating amblyopia. The weak laser,namely laser power less than mW order of magnitude,shows curative by stimulating bion tissue.When stimulating light power density is less than 0.001W/cm,the compounding speed of nucleic acid DNA is significantly increased.The growth rate of cell,activity of enzyme,content of hemoglobin and the growth of blood vessel,are all increased.However,it's key to control the dose of light.When the dose transcend some value,a inhibition will occur.The little dose of weak laser treatment can be accumulated with a parabolic characteristics,that is the weak laser generate bion response stengthening gradually versus time.Then it will weaken gradually after the peak.When the treatment duration is longer than a certain time,a inhibition also takes place.A suggested theraphy is characterized by little dose and short treatment course. In a conclusion, the yellow-green laser diode should be used for the treatment of amblyopia.The little dose and short treatment couse are to be adopted.
A Treatment of Amblyopia Using Laser Diodes
NASA Astrophysics Data System (ADS)
Wang, Di; Wang, Yi-Ding; Liu, Bing-Chun
2000-04-01
We propose the treatment of amblyopia using yellow-green laser diodes. There are amblyopia children in excess of fifty million in the world. Because the causative agent of amblyopia hasn't been well understood,only roughly considered to be concerned with visual sense cell, optic nerve network and function of nerve center, no appropriate treatment is found up to date. The vision of person is determined by the center hollow region of retina, where there are three kinds of cone cell. The corresponding peak wavelength in absorption spectrum locates 447nm (blue light), 532nm (green light) and 565nm (yellow light), respectively. When stimulated by white light, excited degree of three kinds of cone cell are identical,or yellow-green light, to which person eye is most sensitive, will significantly takes effects. Therefore the yellow-green laser diode is suitable for treating amblyopia. The weak laser, namely laser power less than mW order of magnitude, shows curative by stimulating bion tissue. When stimulating light power density is less than 0.001W/cm, the compounding speed of nucleic acid DNA is significantly increased. The growth rate of cell, activity of enzyme, content of hemoglobin and the growth of blood vessel, are all increased. However, it's key to control the dose of light. When the dose transcend some value, a inhibition will occur. The little dose of weak laser treatment can be accumulated with a parabolic characteristics, that is the weak laser generate bion response stengthening gradually versus time. Then it will weaken gradually after the peak. When the treatment duration is longer than a certain time, a inhibition also takes place. A suggested theraphy is characterized by little dose and short treatment course. In a conclusion, the yellow-green laser diode should be used for the treatment of amblyopia. The little dose and short treatment couse are to be adopted. Key words:treatment amblyopia laser diode
Jiang, Xiao-jun; Lu, Xu-liang; Pan, Jia-liang; Zhang, Shuan-qin
2015-07-01
Due to the life characteristics such as physiological structure and transpiration, plants have unique optical and infrared features. In the optical band, because of the common effects of chlorophyll and water, plant leafs show spectral reflectance characteristics change in 550, 680, 1400 and 1900 nm significantly. In the infrared wave band, driven by transpiration, plants could regulate temperature on their own initiative, which make the infrared characteristics of plants different from artificial materials. So palnt bionic materials were proposed to simulate optical and infrared characteristics of plants. By analyzing formation mechanism of optical and infrared features about green plants, the component design and heat-transfer process of plants bionic materials were studied, above these the heat-transfer control formulation was established. Based on water adsorption/release compound, optical pigments and other man-made materials, plant bionic materials preparation methods were designed which could simulate the optical and infrared features of green plants. By chemical casting methods plant bionic material films were prepared, which use polyvinyl alcohol as film forming and water adsorption/release compound, and use optical pigments like chrome green and macromolecule yellow as colouring materials. The research conclusions achieved by testings figured out: water adsorption/release testing showed that the plant bionic materials with a certain thickness could absorb 1.3 kg water per square meter, which could satisfy the water usage of transpiration simulation one day; the optical and infrared simulated effect tests indicated that the plant bionic materials could preferably simulate the spectral reflective performance of green plants in optical wave band (380-2500 nm, expecially in 1400 and 1900 nm which were water absorption wave band of plants), and also it had similar daily infrared radiation variations with green plants, daily average radiation temperature difference was 0.37 degrees C, maximum radiation temperature difference was 0.9 degrees C; so according to the testing results, the materials behave well plant bionic performance.
Cheng, C-F; Sun, Y R; Pan, H; Lu, Y; Li, X-F; Wang, J; Liu, A-W; Hu, S-M
2012-04-23
A continuous-wave cavity ring-down spectrometer has been built for precise determination of absolute frequencies of Doppler-broadened absorption lines. Using a thermo-stabilized Fabry-Pérot interferometer and Rb frequency references at the 780 nm and 795 nm, 0.1 - 0.6 MHz absolute frequency accuracy has been achieved in the 775-800 nm region. A water absorption line at 12579 cm(-1) is studied to test the performance of the spectrometer. The line position at zero-pressure limit is determined with an uncertainty of 0.3 MHz (relative accuracy of 0.8 × 10(-9)). © 2012 Optical Society of America
Classification of Korla fragrant pears using NIR hyperspectral imaging analysis
NASA Astrophysics Data System (ADS)
Rao, Xiuqin; Yang, Chun-Chieh; Ying, Yibin; Kim, Moon S.; Chao, Kuanglin
2012-05-01
Korla fragrant pears are small oval pears characterized by light green skin, crisp texture, and a pleasant perfume for which they are named. Anatomically, the calyx of a fragrant pear may be either persistent or deciduous; the deciduouscalyx fruits are considered more desirable due to taste and texture attributes. Chinese packaging standards require that packed cases of fragrant pears contain 5% or less of the persistent-calyx type. Near-infrared hyperspectral imaging was investigated as a potential means for automated sorting of pears according to calyx type. Hyperspectral images spanning the 992-1681 nm region were acquired using an EMCCD-based laboratory line-scan imaging system. Analysis of the hyperspectral images was performed to select wavebands useful for identifying persistent-calyx fruits and for identifying deciduous-calyx fruits. Based on the selected wavebands, an image-processing algorithm was developed that targets automated classification of Korla fragrant pears into the two categories for packaging purposes.
Reexamination of the coronal index of solar activity
NASA Astrophysics Data System (ADS)
Rybanský, M.; Rušin, V.; Minarovjech, M.; Klocok, L.; Cliver, E. W.
2005-08-01
The coronal index (CI) of solar activity is the irradiance of the Sun as a star in the coronal green line (Fe XIV, 530.3 nm or 5303 Å). It is derived from ground-based observations of the green corona made by the network of coronal stations (currently Kislovodsk, Lomnický Štít, Norikura, and Sacramento Peak). The CI was introduced by Rybanský (1975) to facilitate comparison of ground-based green line measurements with satellite-based extreme ultraviolet and soft X-ray observations. The CI since 1965 is based on the Lomnický Štít photometric scale; the CI was extended to earlier years by Rybanský et al. (1994) based on cross-calibrations of Lomnický Štít data with measurements made at Pic du Midi and Arosa. The resultant 1939-1992 CI had the interesting property that its value at the peak of the 11-year cycle increased more or less monotonically from cycle 18 through cycle 22 even though the peak sunspot number of cycle 20 exhibited a significant local minimum between that of cycles 19 and 21. Rušin and Rybanský (2002) recently showed that the green line intensity and photospheric magnetic field strength were highly correlated from 1976 to 1999. Since the photospheric magnetic field strength is highly correlated with sunspot number, the lack of close correspondence between the sunspot number and the CI from 1939 to 2002 is puzzling. Here we show that the CI and sunspot number are highly correlated only after 1965, calling the previously-computed coronal index for earlier years (1939-1965) into question. We can use the correlation between the CI and sunspot number (also the 2800 MHz radio flux and the cosmic ray intensity) to recompute daily values of the CI for years before 1966. In fact, this method can be used to obtain CI values as far back as we have reliable sunspot observations (˜1850). The net result of this exercise is a CI that closely tracks the sunspot number at all times. We can use the sunspot-CI relationship (for 1966-2002) to identify which coronal stations can be used as a basis for the homogeneous coronal data set (HDS) before 1966. Thus we adopt the photometric scale of the following observatories for the indicated times: Norikura (1951-1954; the Norikura photometric scale was also used from 1939 to 1954); Pic du Midi (1955-1959); Kislovodsk (1960-1965). Finally, we revised the post-1965 HDS and made several small corrections and now include data from Kislovodsk, Norikura, and Sacramento Peak to fill gaps at Lomnický Štít.
NASA Astrophysics Data System (ADS)
Ashokraja, C.; Sakar, M.; Balakumar, S.
2017-10-01
We report the hemolysis properties of silver and silver oxide nanoparticles (NPs) prepared by chemical and green-synthesis methods. The prepared silver and silver oxide NPs were analyzed using UV-vis spectroscopy to confirm their formation by characterizing their surface plasmon resonance (SPR) and absorption band peaks respectively. The Fourier transmission infrared (FTIR) spectra of the materials showed the characteristic functional groups corresponding to the molecules present in leaf extracts, which is proposed to be acted as reducing and capping agents that are also found on the surface of silver and silver oxide nanoparticles that synthesized via green-synthesis method. Zeta potential analysis revealed the surface charge and stability of the prepared NPs. HRTEM images showed almost spherical shape nanoparticles with an average size of 15.2 and 31.5 nm for wet chemical synthesized silver and silver oxide nanoparticles respectively. In the case of green synthesized silver and silver oxide nanoparticles, it was observed to be 19.4 and 30.4 nm respectively. The order of hemolysis efficacy of the materials is found to be as follows: chemically synthesized Ag2O> chemically synthesized Ag NPs followed by green-synthesized Ag2O and green-synthesized Ag NPs which showed almost similar hemolysis with respect to concentration. The relatively stable nature of the silver NPs could be attributed to their lower hemolysis efficacy, while the increased lysis properties of silver oxide could be attributed due to reductive/oxidative processes that give rise to the hemolysis through interfacial charge interactions with RBCs.
Amplification of spontaneous emission on sodium D-lines using nonresonance broadband optical pumping
NASA Astrophysics Data System (ADS)
Petukhov, T. D.; Evtushenko, G. S.; Tel'minov, E. N.
2018-04-01
This work describes an experimental study of obtaining the amplified spontaneous emission (ASE) on sodium D-lines using nonresonance broadband optical pumping. ASE is observed at transitions D2 and D1 line: 589 nm (32 P3/2 - 32 S1/2) and 589.6 nm (32 P1/2 - 32 S1/2). The active medium was pumped by the dye laser with FWHM of 5 nm, maximum radiation in the range 584.5-586.5 nm, and pulse energy above 2 mJ. The working temperature of the active medium was 260 °C, initial pressure of buffer gas-helium was 300 torr (operating pressure - 500 torr). A change in the absorption spectra at D lines at different temperatures of the active medium and buffer gas pressures was observed
Dong, Jin-yang; Zhang, Gui-xin; Wang, Chang-quan
2012-01-01
As a kind of new electric light source, electrodeless discharge lamps are of long life, low mercury and non-stroboscopic light. The lighting effect of electrodeless discharge lamps depends on the radiation efficiency of 253.7 nm resonance spectra line to a large extent. The influence of cold temperature on 253.7 nm resonance spectra line has been studied experimentally by atomic emission spectral analysis. It was found that the radiation efficiency of 253.7 nm resonance spectra line is distributed in a nearly normal fashion with the variation of cold spot temperature, in other words, there is an optimum cold spot temperature for an electrodeless discharge lamp. At last, the results of experiments were analyzed through gas discharge theory, which offers guidance to the improvement of lighting effect for electrodeless discharge lamps.
NASA Astrophysics Data System (ADS)
Seibel, Eric J.
2008-02-01
Flexible endoscopes use one sensor element per display pixel. When diameter is reduced to the size of a catheter, there is a significant reduction in the number of pixels within the image. By placing a sub-millimeter microscanner at the tip of a catheter, image quality can be significantly improved. The microscanner consists of a 0.4 mm diameter piezoelectric tube with quadrant electrodes, surrounding a cantilevered singlemode optical fiber. At the distal end, the fiber microscanner is sealed with a 0.9 mm diameter lens assembly, creating a rigid length less than 10 mm at the tip of a highly flexible shaft. The cantilevered fiber is vibrated at the first mode of resonance for bending to generate a circular scan pattern. A spiral scan pattern is generated that constitutes an image frame by modulating the piezoelectric drive signals. By using a custom optical fiber at 80 microns cladding diameter, >10 KHz resonant scanning is achieved, resulting in a 30 Hz frame rate. Red (635 nm), green (532 nm), and blue (442 nm) laser light is scanned by coupling to the fiber scanner. The scanned illumination is detected in a non-confocal arrangement by having one or more optical fibers collecting the backscattered light at MHz pixel rates. Current 1-mm diameter catheterscopes generate 500-line images at maximum fields of view of 100 degrees and spatial resolutions of <20 microns with image zooming. Shaft length of four meters have been fabricated with flexibility of <10 mm bending radius to image previously inaccessible regions of the body.
Measurement of aerosol optical properties by cw cavity enhanced spectroscopy
NASA Astrophysics Data System (ADS)
Jie, Guo; Ye, Shan-Shan; Yang, Xiao; Han, Ye-Xing; Tang, Huai-Wu; Yu, Zhi-Wei
2016-10-01
The CAPS (Cavity Attenuated Phase shift Spectroscopy) system, which detects the extinction coefficients within a 10 nm bandpass centered at 532 nm, comprises a green LED with center wavelength in 532nm, a resonant optical cavity (36 cm length), a Photo Multiplier Tube detector, and a lock in amplifier. The square wave modulated light from the LED passes through the optical cavity and is detected as a distorted waveform which is characterized by a phase shift with respect to the initial modulation. Extinction coefficients are determined from changes in the phase shift of the distorted waveform of the square wave modulated LED light that is transmitted through the optical cavity. The performance of the CAPS system was evaluated by using measurements of the stability and response of the system. The minima ( 0.1 Mm-1) in the Allan plots show the optimum average time ( 100s) for optimum detection performance of the CAPS system. In the paper, it illustrates that extinction coefficient was correlated with PM2.5 mass (0.91). These figures indicate that this method has the potential to become one of the most sensitive on-line analytical techniques for extinction coefficient detection. This work aims to provide an initial validation of the CAPS extinction monitor in laboratory and field environments. Our initial results presented in this paper show that the CAPS extinction monitor is capable of providing state-of-the-art performance while dramatically reducing the complexity of optical instrumentation for directly measuring the extinction coefficients.
Variation of the Mn I 539.4 nm line with the solar cycle
NASA Astrophysics Data System (ADS)
Danilovic, S.; Solanki, S. K.; Livingston, W.; Krivova, N.; Vince, I.
2016-03-01
Context. As a part of the long-term program at Kitt Peak National Observatory (KPNO), the Mn I 539.4 nm line has been observed for nearly three solar cycles using the McMath telescope and the 13.5 m spectrograph in double-pass mode. These full-disk spectrophotometric observations revealed an unusually strong change of this line's parameters over the solar cycle. Aims: Optical pumping by the Mg II k line was originally proposed to explain these variations. More recent studies have proposed that this is not required and that the magnetic variability (I.e., the changes in solar atmospheric structure due to faculae) might explain these changes. Magnetic variability is also the mechanism that drives the changes in total solar irradiance variations (TSI). With this work we investigate this proposition quantitatively by using the same model that was earlier successfully employed to reconstruct the irradiance. Methods: We reconstructed the changes in the line parameters using the model SATIRE-S, which takes only variations of the daily surface distribution of the magnetic field into account. We applied exactly the same model atmospheres and value of the free parameter as were used in previous solar irradiance reconstructions to now model the variation in the Mn I 539.4 nm line profile and in neighboring Fe I lines. We compared the results of the theoretical model with KPNO observations. Results: The changes in the Mn I 539.4 nm line and a neighbouring Fe I 539.52 nm line over approximately three solar cycles are reproduced well by the model without additionally tweaking the model parameters, if changes made to the instrument setup are taken into account. The model slightly overestimates the change for the strong Fe I 539.32 nm line. Conclusions: Our result confirms that optical pumping of the Mn II 539.4 nm line by Mg II k is not the main cause of its solar cycle change. It also provides independent confirmation of solar irradiance models which are based on the assumption that irradiance variations are caused by the evolution of the solar surface magnetic flux. The result obtained here also supports the spectral irradiance variations computed by these models.
NASA Astrophysics Data System (ADS)
Sarkar, Sonia; Kotteeswaran, Venkatesan
2018-06-01
Plants contain different important phytochemicals that can be used as a potential treatment for various ailments including cancer. The green synthesis of silver nanoparticles from the extract of different plant parts has gained a wide range of engrossment among the researchers due to its unique optical and structural property. The aim of this study is green synthesis of silver nanoparticles from the aqueous leaf extract of pomegranate (Punica granatum) and to investigate its anticancer activity on human cervical cancer cells (HeLa). The synthesis of silver nanoparticle was depicted by the colour change from golden yellowish to dark brownish, UV-visible spectral analysis gave a characteristic surface plasmon absorption peak at . Further morphological characterization was done by Zeta potential where the size analysis was depicted to be 46.1 nm and zeta potential as . Fourier transform infrared spectroscopy (FTIR) inferred 3 intense sharp peaks at , , , confirmed the presence of flavonoids and polyphenols. The scanning electron microscopy (SEM) analysis with energy diffraction spectroscopy (EDS) confirmed the presence of silver nanoparticles with size ranged from to . X-ray diffraction (XRD) confirmed the crystallographic nature of silver. The cell proliferation activity of nanoparticles was tested by 3, ‑4, 5 dimethylthiazol-2,5 diphenyl tetrazolium bromide (MTT) assay where the inhibitory concentration () was found at inhibiting of HeLa cell line. The anticancer activity of nanoparticles was determined by lactate dehydrogenase (LDH) assay where showed of cytotoxicity. Furthermore, the anticancer property of nanoparticles was confirmed by the DNA fragmentation assay.
Laser at 532 nm by intracavity frequency-doubling in BBO
NASA Astrophysics Data System (ADS)
Yuan, Xiandan; Wang, Jinsong; Chen, Yongqi; Wu, Yulong; Qi, Yunfei; Sun, Meijiao; Wang, Qi
2017-06-01
A simple and compact linear resonator green laser at 532 nm is generated by intracavity frequency-doubling of a diode-side-pumped acousto-optically (AO) Q-switched Nd:YAG laser at 1064 nm. Two acousto-optic Q-switches were placed orthogonally with each other to improve the hold-off capacity. As high as 214 W of continuous-wave (CW) and 154 W of quasi-continuous-wave (QCW) output power at 1064 nm were obtained when the pumping power was 1598 W. The type I phase-matched BBO crystal was used as the nonlinear medium in the second harmonic generation. A green laser with an average output power of 37 W was obtained at a repetition rate of 20 kHz and a pulse width of 54 ns, which corresponds to pulse energy of 1.85 mJ per pulse and a peak power 34.26 kW, respectively. Project supported by the Beijing Engineering Technology Research Center of All-Solid-State Lasers Advanced Manufacturing, the National High Technology Research and Development Program of China (No. 2014AA032607), and the National Natural Science Foundation of China (Nos. 61404135, 61405186, 61308032, 61308033).
Mo, Changyeun; Kim, Giyoung; Lee, Kangjin; Kim, Moon S.; Cho, Byoung-Kwan; Lim, Jongguk; Kang, Sukwon
2014-01-01
In this study, we developed a viability evaluation method for pepper (Capsicum annuum L.) seeds based on hyperspectral reflectance imaging. The reflectance spectra of pepper seeds in the 400–700 nm range are collected from hyperspectral reflectance images obtained using blue, green, and red LED illumination. A partial least squares–discriminant analysis (PLS-DA) model is developed to classify viable and non-viable seeds. Four spectral ranges generated with four types of LEDs (blue, green, red, and RGB), which were pretreated using various methods, are investigated to develop the classification models. The optimal PLS-DA model based on the standard normal variate for RGB LED illumination (400–700 nm) yields discrimination accuracies of 96.7% and 99.4% for viable seeds and nonviable seeds, respectively. The use of images based on the PLS-DA model with the first-order derivative of a 31.5-nm gap for red LED illumination (600–700 nm) yields 100% discrimination accuracy for both viable and nonviable seeds. The results indicate that a hyperspectral imaging technique based on LED light can be potentially applied to high-quality pepper seed sorting. PMID:24763251
NASA Astrophysics Data System (ADS)
Martínez-Bernett, D.; Silva-Granados, A.; Correa-Torres, S. N.; Herrera, A.
2016-02-01
It was studied the green synthesis of silver nanoparticles (AgNPs) from the reduction of a silver nitrate solution (1 and 10mM) in the presence of an extract of mangifera indica leaves. Phytochemicals components present in extracts of mango leaves were determined using a GC-MS chromatograph. The results showed the presence of the phenolic compound pyrogallol (26.9% wt/5mL of extract) and oleic acid (29.1% wt/5mL of extract), which are useful for the reduction of the metallic salt AgNO3 and the stabilization of silver nanoparticles. The synthesized nanoparticles were characterized by UV visible spectroscopy (UV-vis), evidencing absorbances at wavelengths of 417nm (AgNPs-1) and 414nm (AgNPs- 10), which are characteristic peaks of this metallic nanoparticles. Scanning Electron Microscopy (SEM) was used to determine the size of the synthesized nanoparticles. A particle size of about 28±7nm was observed for the AgNPs-1 sample and 26±5nm for the AgNPs-10. This suggests the advantages of green chemistry to obtain silver nanoparticles with a narrow size distribution.
Polarimetric, Two-Color, Photon-Counting Laser Altimeter Measurements of Forest Canopy Structure
NASA Technical Reports Server (NTRS)
Harding, David J.; Dabney, Philip W.; Valett, Susan
2011-01-01
Laser altimeter measurements of forest stands with distinct structures and compositions have been acquired at 532 nm (green) and 1064 nm (near-infrared) wavelengths and parallel and perpendicular polarization states using the Slope Imaging Multi-polarization Photon Counting Lidar (SIMPL). The micropulse, single photon ranging measurement approach employed by SIMPL provides canopy structure measurements with high vertical and spatial resolution. Using a height distribution analysis method adapted from conventional, 1064 nm, full-waveform lidar remote sensing, the sensitivity of two parameters commonly used for above-ground biomass estimation are compared as a function of wavelength. The results for the height of median energy (HOME) and canopy cover are for the most part very similar, indicating biomass estimations using lidars operating at green and near-infrared wavelengths will yield comparable estimates. The expected detection of increasing depolarization with depth into the canopies due to volume multiple-scattering was not observed, possibly due to the small laser footprint and the small detector field of view used in the SIMPL instrument. The results of this work provide pathfinder information for NASA's ICESat-2 mission that will employ a 532 nm, micropulse, photon counting laser altimeter.
Mo, Changyeun; Kim, Giyoung; Lee, Kangjin; Kim, Moon S; Cho, Byoung-Kwan; Lim, Jongguk; Kang, Sukwon
2014-04-24
In this study, we developed a viability evaluation method for pepper (Capsicum annuum L.) seeds based on hyperspectral reflectance imaging. The reflectance spectra of pepper seeds in the 400-700 nm range are collected from hyperspectral reflectance images obtained using blue, green, and red LED illumination. A partial least squares-discriminant analysis (PLS-DA) model is developed to classify viable and non-viable seeds. Four spectral ranges generated with four types of LEDs (blue, green, red, and RGB), which were pretreated using various methods, are investigated to develop the classification models. The optimal PLS-DA model based on the standard normal variate for RGB LED illumination (400-700 nm) yields discrimination accuracies of 96.7% and 99.4% for viable seeds and nonviable seeds, respectively. The use of images based on the PLS-DA model with the first-order derivative of a 31.5-nm gap for red LED illumination (600-700 nm) yields 100% discrimination accuracy for both viable and nonviable seeds. The results indicate that a hyperspectral imaging technique based on LED light can be potentially applied to high-quality pepper seed sorting.
Spectrum of Transient ASASSN-13at
NASA Astrophysics Data System (ADS)
Garnavich, Peter; Deal, Shanel
2013-06-01
We observed the transient ASASSN-13at (ATEL 5168) on June 28.3 (UT) with the Vatican Advanced Technology Telescope (VATT) and VATTSPEC instrument. The resulting spectrum covers the wavelength range between 365 nm and 750 nm with a resolution of 1100. The spectrum of ASASSN-13at shows a blue continuum with strong Balmer absorption lines. Helium absorption at 447 nm and 588 nm is also seen. Blue-shifted emission lines are visible within the Halpha and Hbeta absorption features.
NASA Technical Reports Server (NTRS)
Habbal, Shadia Rifai; Druckmueller, Miloslav; Morgan, Huw; Ding, Adalbert; Johnson, Judd; Druckmuellerova, Hana; Daw, Adrian; Arndt, Martina B.; Dietzel, Martin; Saken, Jon
2011-01-01
We report on multi-wavelength observations of the corona taken simultaneously in broadband white light, and in seven spectral lines, H-alpha 656.3 nm, Fe IX 435.9 nm, Fe X 637.4 nm, Fe XI 789.2 nm, Fe XIII 1074.7 nm, Fe XIV 530.3 nm and Ni XV 670.2 nm. The observations were made during the total solar eclipse of 11 July 2010 from the atoll of Tatakoto in French Polynesia. Simultaneous imaging with narrow bandpass filters in each of these spectral lines and in their corresponding underlying continua maximized the observing time during less than ideal observing conditions and yielded outstanding quality data. The application of two complementary image processing techniques revealed the finest details of coronal structures at 1" resolution in white light, and 6.5" in each of the spectral lines. This comprehensive wavelength coverage confirmed earlier eclipse findings that the solar corona has a clear two-temperature structure: The open field lines, expanding outwards from the solar surface, are characterized by electron temperatures near 1 X 10(exp 6) K, while the hottest plasma around 2X 10(exp 6) K resides in loop-like structures forming the bulges of streamers. The first images of the corona in the forbidden lines of Fe IX and Ni XV, showed that there was very little coronal plasma at temperatures below 5 X 10(exp 5) K and above 2.5X 10(exp 6) K. The data also enabled temperature differentiations as low as 0:2 X 10(exp 6) K in different density structures. These observations showed how the passage of CMEs through the corona, prior to totality, produced large scale ripples and very sharp streaks, which could be identified with distinct temperatures for the first time. The ripples were most prominent in emission from spectral lines associated with temperatures around 10(exp 6) K. The most prominent streak was associated with a conical-shaped void in the emission from the coolest line of Fe IX and from the hottest line of Ni XV. A prominence, which erupted prior to totality, appeared in the shape of a hook in the cooler lines of Fe X and Fe XI, spanning 0.5 R(solar) in extent starting at a heliocentric distance of 1.3 R(solar), with a complex trail of hot and cool twisted structures connecting it to the solar surface. Simultaneous Fe X 17.4 nm observations from space by Proba2/SWAP provided an ideal opportunity for comparing emission from a coronal forbidden line, namely Fe X 637.4 nm, with a space-based EUV allowed line. Comparison of the Fe X 17.4 nm and 637.4 nm emission provided the first textbook example of the role of radiative excitation in extending the detectability of coronal emission to much larger heliocentric distances than its collisionally excited component. These eclipse observations demonstrate the unique capabilities of coronal forbidden lines for exploring the evolution of the coronal magnetic field in the heliocentric distance range of 1 - 3 R(solar), which is currently inaccessible to any space-borne or ground-based observatory.
Lau, Susanna K. P.; Martelli, Paolo; Hui, Suk-Wai; Lau, Candy C. Y.; Fan, Rachel Y. Y.; Groff, Joseph M.; Tam, Emily W. T.; Chan, Kwok-Hung
2014-01-01
Beginning in July 2011, 31 green anaconda (Eunectes murinus) juveniles from an oceanarium in Hong Kong died over a 12-month period. Necropsy revealed at least two of the following features in 23 necropsies: dermatitis, severe pan-nephritis, and/or severe systemic multiorgan necrotizing inflammation. Histopathological examination revealed severe necrotizing inflammation in various organs, most prominently the kidneys. Electron microscopic examination of primary tissues revealed intralesional accumulations of viral nucleocapsids with diameters of 10 to 14 nm, typical of paramyxoviruses. Reverse transcription (RT)-PCR results were positive for paramyxovirus (viral loads of 2.33 × 104 to 1.05 × 108 copies/mg tissue) in specimens from anaconda juveniles that died but negative in specimens from the two anaconda juveniles and anaconda mother that survived. None of the other snakes in the park was moribund, and RT-PCR results for surveillance samples collected from other snakes were negative. The virus was isolated from BHK21 cells, causing cytopathic effects with syncytial formation. The virus could also replicate in 25 of 27 cell lines of various origins, in line with its capability for infecting various organs. Electron microscopy with cell culture material revealed enveloped virus with the typical “herringbone” appearance of helical nucleocapsids in paramyxoviruses. Complete genome sequencing of five isolates confirmed that the infections originated from the same clone. Comparative genomic and phylogenetic analyses and mRNA editing experiments revealed a novel paramyxovirus in the genus Ferlavirus, named anaconda paramyxovirus, with a typical Ferlavirus genomic organization of 3′-N-U-P/V/I-M-F-HN-L-5′. Epidemiological and genomic analyses suggested that the anaconda juveniles acquired the virus perinatally from the anaconda mother rather than from other reptiles in the park, with subsequent interanaconda juvenile transmission. PMID:25078906
NASA Astrophysics Data System (ADS)
Lee, Young-Sook; Kwak, Young-Sil; Kim, Kyung-Chan; Solheim, Brian; Lee, Regina; Lee, Jaejin
2017-01-01
The auroral green-line emission at 557.7 nm wavelength as arising from the atomic oxygen O(1S → 1D) transition typically peaks at an altitude of 100 km specifically in the nightside oval, induced by auroral electrons within an energy range of 100 eV-30 keV. Intense aurora is known as being suppressed by sunlight in summer daytime but usually occurs in low electrical background conductivity. However, in the present study in summer (July) sunlit condition, enhancements of O(1S) emission rates observed by using the Wind Imaging Interferometer/UARS were frequently observed at low altitudes below 90 km, where ice particles are created initially as subvisible and detected as polar mesosphere summer echoes, emerging to be an optical phenomenon of polar mesospheric clouds. The intense O(1S) emission occurring in summer exceeds those occurring in the daytime in other seasons both in occurrence and in intensity, frequently accompanied by occurrences of supersonic neutral velocity (300-1500 m s-1). In the mesosphere, ion motion is controlled by electric field and the momentum is transferred to neutrals. The intense O(1S) emission is well associated with high-energy electron precipitation as observed during an event of high-speed solar wind streams. Meanwhile, since the minimum occurrences of O(1S) emission and supersonic velocity are maintained even in the low precipitation flux, the mechanism responsible is not only related to high-energy electron precipitation but also presumably to the local conditions, including the composition of meteoric-charged ice particles and charge separation expected in extremely low temperatures (<150 K).
1D design style implications for mask making and CEBL
NASA Astrophysics Data System (ADS)
Smayling, Michael C.
2013-09-01
At advanced nodes, CMOS logic is being designed in a highly regular design style because of the resolution limitations of optical lithography equipment. Logic and memory layouts using 1D Gridded Design Rules (GDR) have been demonstrated to nodes beyond 12nm.[1-4] Smaller nodes will require the same regular layout style but with multiple patterning for critical layers. One of the significant advantages of 1D GDR is the ease of splitting layouts into lines and cuts. A lines and cuts approach has been used to achieve good pattern fidelity and process margin to below 12nm.[4] Line scaling with excellent line-edge roughness (LER) has been demonstrated with self-aligned spacer processing.[5] This change in design style has important implications for mask making: • The complexity of the masks will be greatly reduced from what would be required for 2D designs with very complex OPC or inverse lithography corrections. • The number of masks will initially increase, as for conventional multiple patterning. But in the case of 1D design, there are future options for mask count reduction. • The line masks will remain simple, with little or no OPC, at pitches (1x) above 80nm. This provides an excellent opportunity for continual improvement of line CD and LER. The line pattern will be processed through a self-aligned pitch division sequence to divide pitch by 2 or by 4. • The cut masks can be done with "simple OPC" as demonstrated to beyond 12nm.[6] Multiple simple cut masks may be required at advanced nodes. "Coloring" has been demonstrated to below 12nm for two colors and to 8nm for three colors. • Cut/hole masks will eventually be replaced by e-beam direct write using complementary e-beam lithography (CEBL).[7-11] This transition is gated by the availability of multiple column e-beam systems with throughput adequate for high- volume manufacturing. A brief description of 1D and 2D design styles will be presented, followed by examples of 1D layouts. Mask complexity for 1D layouts patterned directly will be compared to mask complexity for lines and cuts at nodes larger than 20nm. No such comparison is possible below 20nm since single-patterning does not work below ~80nm pitch using optical exposure tools. Also discussed will be recently published wafer results for line patterns with pitch division by-2 and by-4 at sub-12nm nodes, plus examples of post-etch results for 1D patterns done with cut masks and compared to cuts exposed by a single-column e-beam direct write system.
Interatomic potentials for Cd, Zn, and Hg from absorption spectra
NASA Astrophysics Data System (ADS)
Su, Ching-Hua; Liao, Pok-Kai; Huang, Yu; Liou, Shian-Shyang; Brebrick, R. F.
1984-07-01
The absorption coefficient has been measured over a 65 nm range in the red wing of the 213.8 nm line for Zn vapor at 1000 °C. It has also been measured in the blue wing and over a 60 nm range in the red wing of the 228.7 nm line for Cd vapor at five temperatures between 642 and 955 °C and over a 75 nm range in the red wing of the 253.7 nm line for Hg vapor at five temperatures between 460 and 860 °C. These data are analyzed in terms of the statistical theory of broadening. Oscillator strengths of 1.42±0.01 and 1.61±0.06 are obtained for, respectively, the Cd line and the Zn line. Pair potentials for both the ground and lowest excited state are also obtained in all three cases. For Cd this is done assuming no functional form and then assuming Lennard-Jones potentials. Both methods agree and give a ground state minimum of -47.5 meV at 0.482 nm separation and an excited state minimum of -1.06 eV at 0.410 nm. A functional form is required for the less extensive Zn data and the Lennard-Jones form leads to a range of possibilities including ground and excited state minima of -56 meV at 0.400 nm and -1.30 eV at 0.330 nm, respectively, which are in fair agreement with the theoretical calculations. For Hg the experiments indicate a single excited state and a ground state with a minimum of -55 meV. Assuming no functional form for the pair potentials, taking the excited state as doubly degenerate, and assuming the transition probability from the ground to excited state is one-sixth of the free atom value gives points along the ground and excited state potentials that join smoothly with other experimental results and agree well with the calculation of Baylis for the ground state.
Influence of ablation wavelength and time on optical properties of laser ablated carbon dots
NASA Astrophysics Data System (ADS)
Isnaeni, Hanna, M. Yusrul; Pambudi, A. A.; Murdaka, F. H.
2017-01-01
Carbon dots, which are unique and applicable materials, have been produced using many techniques. In this work, we have fabricated carbon dots made of coconut fiber using laser ablation technique. The purpose of this work is to evaluate two ablation parameters, which are ablation wavelength and ablation time. We used pulsed laser from Nd:YAG laser with emit wavelength at 355 nm, 532 nm and 1064 nm. We varied ablation time one hour and two hours. Photoluminescence and time-resolved photoluminescence setup were used to study the optical properties of fabricated carbon dots. In general, fabricated carbon dots emit bluish green color emission upon excitation by blue laser. We found that carbon dots fabricated using 1064 nm laser produced the highest carbon dots emission among other samples. The peak wavelength of carbon dots emission is between 495 nm until 505 nm, which gives bluish green color emission. Two hours fabricated carbon dots gave four times higher emission than one hour fabricated carbon dot. More emission intensity of carbon dots means more carbon dots nanoparticles were fabricated during laser ablation process. In addition, we also measured electron dynamics of carbon dots using time-resolved photoluminescence. We found that sample with higher emission has longer electron decay time. Our finding gives optimum condition of carbon dots fabrication from coconut fiber using laser ablation technique. Moreover, fabricated carbon dots are non-toxic nanoparticles that can be applied for health, bio-tagging and medical applications.
Smirnova, Daria V; Samsonova, Jeanne V; Ugarova, Natalia N
2016-01-01
The sensitive BRET system for the homogeneous immunoassay of a low-molecular weight antigen was developed using progesterone as an example. Two thermostable mutants of the Luciola mingrelica firefly luciferase (Luc)-the "red" mutant with λmax.em = 590 nm (RedLuc) and the "green" mutant with λmax.em = 550 nm (GreenLuc)-were tested as the donors. The water-soluble Alexa Fluor 610× (AF) dye was selected as the acceptor because its two absorption maxima, located at 550 and 610 nm, are close to the bioluminescence maxima of the GreenLuc and RedLuc, respectively. The methods for the synthesis of the luciferase-progesterone (Luc-Pg) conjugate and the conjugate of the dye and the polyclonal antiprogesterone antibody (AF-Ab) were developed. Both conjugates retained their functional properties, had high antigen-antibody binding activity, and demonstrated a high BRET signal. The homogeneous immunoassay system based on the BRET from the firefly luciferase to the synthetic dye was established to assay progesterone as a model antigen. Optimization of the assay conditions, the composition of the reaction mixture, and the concentrations of the donor and the acceptor made it possible to reach the minimum detectable progesterone concentration of 0.5 ng mL(-1) . © 2015 The American Society of Photobiology.
Hyperspectral imaging of snow algae and green algae from aeroterrestrial habitats.
Holzinger, Andreas; Allen, Michael C; Deheyn, Dimitri D
2016-09-01
Snow algae and green algae living in aeroterrestrial habitats are ideal objects to study adaptation to high light irradiation. Here, we used a detailed description of the spectral properties as a proxy for photo-acclimation/protection in snow algae (Chlamydomonas nivalis, Chlainomonas sp. and Chloromonas sp.) and charophyte green algae (Zygnema sp., Zygogonium ericetorum and Klebsormidium crenulatum). The hyperspectral microscopic mapping and imaging technique allowed us to acquire total absorption spectra of these microalgae in the waveband of 400-900nm. Particularly in Chlamydomonas nivalis and Chlainomonas sp., a high absorbance between 400-550nm was observed, due to naturally occurring secondary carotenoids; in Chloromonas sp. and in the charopyhte algae this high absorbance was missing, the latter being close relatives to land plants. To investigate if cellular water loss has an influence on the spectral properties, the cells were plasmolysed in sorbitol or desiccated at ambient air. While in snow algae, these treatments did hardly change the spectral properties, in the charopyhte algae the condensation of the cytoplasm and plastids increased the absorbance in the lower waveband of 400-500nm. These changes might be ecologically relevant and photoprotective, as aeroterrestrial algae are naturally exposed to occasional water limitation, leading to desiccation, which are conditions usually occurring together with higher irradiation. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romero, V.H.; De la Rosa, E., E-mail: elder@cio.mx; Salas, P.
In this paper, we report the obtained strong broadband blue photoluminescence (PL) emission centered at 427 nm for undoped BaZrO{sub 3} observed after 266 nm excitation of submicron crystals prepared by hydrothermal/calcinations method. This emission is enhanced with the introduction of Tm{sup 3+} ions and is stronger than the characteristic PL blue emission of such lanthanide. The proposed mechanism of relaxation for host lattice emission is based on the presence of oxygen vacancies produced during the synthesis process and the charge compensation due to the difference in the electron valence between dopant and substituted ion in the host. Brilliant whitemore » light emission with a color coordinate of (x=0.29, y=0.32) was observed by combining the blue PL emission from the host with the green and red PL emission from Tb{sup 3+} and Eu{sup 3+} ions, respectively. The color coordinate can be tuned by changing the ratio between blue, green and red band by changing the concentration of lanthanides. - Graphical abstract: Strong blue emission from undoped BaZrO{sub 3} phosphor and white light emission by doping with Tb{sup 3+} (green) and Eu{sup 3+} (red) after 266 nm excitation. Highlights: Black-Right-Pointing-Pointer Blue emission from BaZrO{sub 3} phosphor. Black-Right-Pointing-Pointer Blue emission enhanced with Tm{sup 3+}. Black-Right-Pointing-Pointer White light from BaZrO{sup 3+} phosphor.« less
Upconverting Nanoparticles as Optical Sensors of Nano- to Micro-Newton Forces.
Lay, Alice; Wang, Derek S; Wisser, Michael D; Mehlenbacher, Randy D; Lin, Yu; Goodman, Miriam B; Mao, Wendy L; Dionne, Jennifer A
2017-07-12
Mechanical forces affect a myriad of processes, from bone growth to material fracture to touch-responsive robotics. While nano- to micro-Newton forces are prevalent at the microscopic scale, few methods have the nanoscopic size and signal stability to measure them in vivo or in situ. Here, we develop an optical force-sensing platform based on sub-25 nm NaYF 4 nanoparticles (NPs) doped with Yb 3+ , Er 3+ , and Mn 2+ . The lanthanides Yb 3+ and Er 3+ enable both photoluminescence and upconversion, while the energetically coupled d-metal Mn 2+ adds force tunability through its crystal field sensitivity. Using a diamond anvil cell to exert up to 3.5 GPa pressure or ∼10 μN force per particle, we track stress-induced spectral responses. The red (660 nm) to green (520, 540 nm) emission ratio varies linearly with pressure, yielding an observed color change from orange to red for α-NaYF 4 and from yellow-green to green for d-metal optimized β-NaYF 4 when illuminated in the near infrared. Consistent readouts are recorded over multiple pressure cycles and hours of illumination. With the nanoscopic size, a dynamic range of 100 nN to 10 μN, and photostability, these nanoparticles lay the foundation for visualizing dynamic mechanical processes, such as stress propagation in materials and force signaling in organisms.
Upconverting Nanoparticles as Optical Sensors of Nano- to Micro-Newton Forces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lay, Alice; Wang, Derek S.; Wisser, Michael D.
Mechanical forces affect a myriad of processes, from bone growth to material fracture to touch-responsive robotics. While nano- to micro-Newton forces are prevalent at the microscopic scale, few methods have the nanoscopic size and signal stability to measure them in vivo or in situ. Here, we develop an optical force-sensing platform based on sub-25 nm NaYF4 nanoparticles (NPs) doped with Yb3+, Er3+, and Mn2+. The lanthanides Yb3+ and Er3+ enable both photoluminescence and upconversion, while the energetically coupled d-metal Mn2+ adds force tunability through its crystal field sensitivity. Using a diamond anvil cell to exert up to 3.5 GPa pressuremore » or ~10 μN force per particle, we track stress-induced spectral responses. The red (660 nm) to green (520, 540 nm) emission ratio varies linearly with pressure, yielding an observed color change from orange to red for α-NaYF4 and from yellow–green to green for d-metal optimized β-NaYF4 when illuminated in the near infrared. Consistent readouts are recorded over multiple pressure cycles and hours of illumination. With the nanoscopic size, a dynamic range of 100 nN to 10 μN, and photostability, these nanoparticles lay the foundation for visualizing dynamic mechanical processes, such as stress propagation in materials and force signaling in organisms.« less
Upconverting Nanoparticles as Optical Sensors of Nano- to Micro-Newton Forces
Lay, Alice; Wang, Derek S.; Wisser, Michael D.; ...
2017-06-13
Mechanical forces affect a myriad of processes, from bone growth to material fracture to touch-responsive robotics. While nano- to micro-Newton forces are prevalent at the microscopic scale, few methods have the nanoscopic size and signal stability to measure them in vivo or in situ. Here, we develop an optical force-sensing platform based on sub-25 nm NaYF 4 nanoparticles (NPs) doped with Yb 3+, Er 3+, and Mn 2+. The lanthanides Yb 3+ and Er 3+ enable both photoluminescence and upconversion, while the energetically coupled d-metal Mn 2+ adds force tunability through its crystal field sensitivity. IN using a diamond anvilmore » cell to exert up to 3.5 GPa pressure or ~10 μN force per particle, we track stress-induced spectral responses. The red (660 nm) to green (520, 540 nm) emission ratio varies linearly with pressure, yielding an observed color change from orange to red for α-NaYF 4 and from yellow–green to green for d-metal optimized β-NaYF 4 when illuminated in the near infrared. We record consistent readouts over multiple pressure cycles and hours of illumination. With the nanoscopic size, a dynamic range of 100 nN to 10 μN, and photostability, these nanoparticles lay the foundation for visualizing dynamic mechanical processes, such as stress propagation in materials and force signaling in organisms.« less
Upconverting Nanoparticles as Optical Sensors of Nano- to Micro-Newton Forces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lay, Alice; Wang, Derek S.; Wisser, Michael D.
Mechanical forces affect a myriad of processes, from bone growth to material fracture to touch-responsive robotics. While nano- to micro-Newton forces are prevalent at the microscopic scale, few methods have the nanoscopic size and signal stability to measure them in vivo or in situ. Here, we develop an optical force-sensing platform based on sub-25 nm NaYF 4 nanoparticles (NPs) doped with Yb 3+, Er 3+, and Mn 2+. The lanthanides Yb 3+ and Er 3+ enable both photoluminescence and upconversion, while the energetically coupled d-metal Mn 2+ adds force tunability through its crystal field sensitivity. IN using a diamond anvilmore » cell to exert up to 3.5 GPa pressure or ~10 μN force per particle, we track stress-induced spectral responses. The red (660 nm) to green (520, 540 nm) emission ratio varies linearly with pressure, yielding an observed color change from orange to red for α-NaYF 4 and from yellow–green to green for d-metal optimized β-NaYF 4 when illuminated in the near infrared. We record consistent readouts over multiple pressure cycles and hours of illumination. With the nanoscopic size, a dynamic range of 100 nN to 10 μN, and photostability, these nanoparticles lay the foundation for visualizing dynamic mechanical processes, such as stress propagation in materials and force signaling in organisms.« less
Murugan, Nirosha J; Karbowski, Lukasz M; Persinger, Michael A
2017-01-01
Synergisms between a physiologically patterned magnetic field that is known to enhance planarian growth and suppress proliferation of malignant cells in culture and three light emitting diode (LED) generated visible wavelengths (blue, green, red) upon planarian regeneration and melanoma cell numbers were discerned. Five days of hourly exposures to either a physiologically patterned (2.5-5.0 μT) magnetic field, one of three wavelengths (3 kLux) or both treatments simultaneously indicated that red light (680 nm), blue light (470 nm) or the magnetic field significantly facilitated regeneration of planarian compared to sham field exposed planarian. Presentation of both light and magnetic field conditions enhanced the effect. Whereas the blue and red light diminished the growth of malignant (melanoma) cells, the effect was not as large as that produced by the magnetic field. Only the paired presentation of the blue light and magnetic field enhanced the suppression. On the other hand, the changes following green light (540 nm) exposure did not differ from the control condition and green light presented with the magnetic field eliminated its effects for both the planarian and melanoma cells. These results indicate specific colors affect positive adaptation that is similar to weak, physiologically patterned frequency modulated (8-24 Hz) magnetic fields and that the two forms of energy can synergistically summate or cancel.
Sensitivity Differences in Fish Offer Near-Infrared Vision as an Adaptable Evolutionary Trait
Shcherbakov, Denis; Knörzer, Alexandra; Espenhahn, Svenja; Hilbig, Reinhard; Haas, Ulrich; Blum, Martin
2013-01-01
Near-infrared (NIR) light constitutes an integrated part of solar radiation. The principal ability to sense NIR under laboratory conditions has previously been demonstrated in fish. The availability of NIR in aquatic habitats, and thus its potential use as a cue for distinct behaviors such as orientation and detection of prey, however, depends on physical and environmental parameters. In clear water, blue and green light represents the dominating part of the illumination. In turbid waters, in contrast, the relative content of red and NIR radiation is enhanced, due to increased scattering and absorption of short and middle range wavelengths by suspended particles and dissolved colored materials. We have studied NIR detection thresholds using a phototactic swimming assay in five fish species, which are exposed to different NIR conditions in their natural habitats. Nile and Mozambique tilapia, which inhabit waters with increased turbidity, displayed the highest spectral sensitivity, with thresholds at wavelengths above 930 nm. Zebrafish, guppy and green swordtail, which prefer clearer waters, revealed significantly lower thresholds of spectral sensitivity with 825–845 nm for green swordtail and 845–910 nm for zebrafish and guppy. The present study revealed a clear correlation between NIR sensation thresholds and availability of NIR in the natural habitats, suggesting that NIR vision, as an integral part of the whole spectrum of visual abilities, can serve as an evolutionarily adaptable trait in fish. PMID:23691215
A study of the interaction between malachite green and lysozyme by steady-state fluorescence.
Ding, Fei; Liu, Wei; Liu, Feng; Li, Zhi-Yuan; Sun, Ying
2009-09-01
The interaction of a N-methylated diaminotriphenylmethane dye, malachite green, with lysozyme was investigated by fluorescence spectroscopic techniques under physiological conditions. The binding parameters have been evaluated by fluorescence quenching methods. The results revealed that malachite green caused the fluorescence quenching of lysozyme through a static quenching procedure. The thermodynamic parameters like DeltaH and DeltaS were calculated to be -15.33 kJ mol(-1) and 19.47 J mol(-1) K(-1) according to van't Hoff equation, respectively, which proves main interaction between malachite green and lysozyme is hydrophobic forces and hydrogen bond contact. The distance r between donor (lysozyme) and acceptor (malachite green) was obtained to be 3.82 nm according to Frster's theory. The results of synchronous fluorescence, UV/vis and three-dimensional fluorescence spectra showed that binding of malachite green with lysozyme can induce conformational changes in lysozyme. In addition, the effects of common ions on the constants of lysozyme-malachite green complex were also discussed.
Nanostructured polymer brushes.
Schmelmer, Ursula; Paul, Anne; Küller, Alexander; Steenackers, Marin; Ulman, Abraham; Grunze, Michael; Gölzhäuser, Armin; Jordan, Rainer
2007-03-01
Nanopatterned polymer brushes with sub-50-nm resolution were prepared by a combination of electron-beam chemical lithography (EBCL) of self-assembled monolayers (SAMs) and surface-initiated photopolymerization (SIPP). As a further development of our previous work, selective EBCL was performed with a highly focused electron beam and not via a mask, to region-selectively convert a SAM of 4'-nitro-1,1'-biphenyl-4-thiol to defined areas of crosslinked 4'-amino-1,1'-biphenyl-4-thiol. These "written" structures were then used to prepare surface-bonded, asymmetric, azo initiator sites of 4'-azomethylmalonodinitrile-1,1'-biphenyl-4-thiol. In the presence of bulk styrene, SIPP amplified the primary structures of line widths from 500 to 10 nm to polystyrene structures of line widths 530 nm down to approximately 45 nm at a brush height of 10 or 7 nm, respectively, as measured by scanning electron microscopy and atomic force microscopy (AFM). The relative position of individual structures was within a tolerance of a few nanometers, as verified by AFM. At line-to-line spacings down to 50-70 nm, individual polymer brush structures are still observable. Below this threshold, neighboring structures merge due to chain overlap.
Chhabra, Kanika; Kaur, Prempal; Singh, Karamjit; Aggarwal, Anand; Chalia, Dharamvir
2018-02-01
The purpose of this study was to analyse the outcome of solid-state green laser in high-risk retinopathy of prematurity (ROP) at a tertiary centre in India. Fifty-nine eyes of 30 infants with high-risk ROP were recruited in this prospective, interventional study. High-risk ROP included prethreshold type 1 ROP and APROP. Laser photocoagulation was performed with 532 nm solid-state green laser (Novus Spectra, Lumenis, GmbH, Germany). Of the 30 infants, 18 were males (60%) and 12 were females (40%). The mean birth weight was 1102.83 ± 196.27 g. The mean gestational age was 29.5 ± 1.47 weeks. Zone 1 disease was present in 10 eyes (16.95%) and zone 2 disease in 49 (83.05%) eyes. Out of 57 eyes with prethreshold type 1 ROP, 39 eyes (68.42%) had stage 2 and 18 eyes (31.58%) had stage 3. The postconceptional age at the time of treatment was 36.03 ± 2.32 weeks. The infants received mean 2710.24 ± 747.97 laser spots. Fifty (84.8%) eyes underwent laser in a single sitting and 9 eyes (15.2%) required 2 laser sittings. Mean time for regression of ROP was 5.8 ± 3.8 weeks (range 3-11 weeks). Total ROP regression was seen in 55 eyes (93.22%). Despite laser treatment, 4 (6.78%) eyes of three infants had unfavourable outcome. One infant developed intra-procedural bradycardia. Vitreous haemorrhage was seen in five eyes (8.4%). Solid-state 532 nm green laser is a safe and effective treatment for high-risk retinopathy of prematurity.
Enhancement of luminescence properties in Er3+ doped TeO2-Na2O-PbX (X=O and F) ternary glasses.
Kumar, Kaushal; Rai, S B; Rai, D K
2007-04-01
An enhancement of luminescence properties in Er3+ doped ternary glasses is observed on the addition of PbO/PbF2. The infrared to visible upconversion emission bands are observed at 410, 525, 550 and 658 nm, due to the 2H9/2-->4I15/2, 2H11/2-->4I15/2, 4S3/2-->4I15/2, 4F9/2-->4I15/2 transitions respectively, on excitation with 797 nm laser line. A detailed study reveals that the 2H9/2-->4I15/2 transition arises due to three step upconversion process while other transitions arise due to two step absorption. On excitation with 532 nm radiation, ultraviolet and violet upconversion bands centered at 380, 404, 410 and 475 nm wavelengths are observed along with one photon luminescence bands at 525, 550, 658 and 843 nm wavelengths. These bands are found due to the 4G11/2-->4I15/2, 2P3/2-->4I13/2, 2H9/2-->4I15/2, 2P3/2-->4I11/2, 2H11/2-->4I15/2, 4S3/2-->4I15/2, 4F9/2-->4I15/2 and 4S3/2-->4I13/2 transitions, respectively. Though incorporation of PbO and PbF2 both enhances fluorescence intensities however, PbF2 content has an important influence on upconversion luminescence emission. The incorporation of PbF2 enhances the red emission (658 nm) intensity by 1.5 times and the violet emission (410 nm) intensity by 2.0 times. A concentration dependence study of fluorescence reveals the rapid increase in the red (4F9/2-->4I15/2) emission intensity relative to the green (4S3/2-->4I15/2) emission with increase in the Er3+ ion concentration. This behaviour has been explained in terms of an energy transfer by relaxation between excited ions.
Lightning Step Leader and Return Stroke Spectra at 100,000 fps
NASA Astrophysics Data System (ADS)
Harley, J.; McHarg, M.; Stenbaek-Nielsen, H. C.; Haaland, R. K.; Sonnenfeld, R.; Edens, H. E.; Cummer, S.; Lapierre, J. L.; Maddocks, S.
2017-12-01
A fundamental understanding of lightning can be inferred from the spectral emissions resulting from the leader and return stroke channels. We examine events recorded at 00:58:07 on 19 July 2015 and 06:44:24 on 23 July 2017, both at Langmuir Laboratory. Analysis of both events is supplemented by data from the Lightning Mapping Array at Langmuir. The 00:58:07 event spectra was recorded using a 100 line per mm grating in front of a Phantom V2010 camera with an 85mm (9o FOV) Nikon lens recording at 100,000 frames per second. Coarse resolution spectra (approximately 5 nm resolution) are produced from approximately 400 nm to 800 nm for each frame. We analyze several nitrogen and oxygen lines to understand step leader temperature behavior between cloud and ground. The 06:44:24 event spectra was recorded using a 300 line per mm grating (approximately 1.5 nm resolution) in front of a Phantom V2010 camera with an 50mm (32o FOV) Nikon lens also recording at 100,000 frames per second. Two ionized atomic nitrogen lines at 502 nm and 569 nm appear upon attachment and disappear as the return stroke travels from ground to cloud in approximately 5 frames. We analyze these lines to understand initial return stroke temperature and species behavior.
Polarizers tuned at key far-UV spectral lines for space instrumentation
NASA Astrophysics Data System (ADS)
Larruquert, Juan I.; Malvezzi, A. Marco; Rodríguez-de Marcos, Luis; Giglia, Angelo; Gutiérrez-Luna, Nuria; Espinosa-Yáñez, Lucía.; Honrado-Benítez, Carlos; Aznárez, José A.; Massone, Giuseppe; Capobianco, Gerardo; Fineschi, Silvano; Nannarone, Stefano
2017-05-01
Polarimetry is a valuable technique to help us understand the role played by the magnetic field of the coronal plasma in the energy transfer processes from the inner parts of the Sun to the outer space. Polarimetry in the far ultraviolet (FUV: 100-200 nm), which must be performed from space due to absorption in terrestrial atmosphere, supplies fundamental data of processes that are governed by the Doppler and Hanle effects on resonantly scattered line-emission. To observe these processes there are various key spectral lines in the FUV, from which H I Lyman α (121.6 nm) is the strongest one. Hence some solar physics missions that have been proposed or are under development plan to perform polarimetry at 121.6 nm, like the suborbital missions CLASP I (2015) and CLASP II (2018), and the proposed solar missions SolmeX and COMPASS and stellar mission Arago. Therefore, the development of efficient FUV linear polarizers may benefit these and other possible future missions. C IV (155 nm) and Mg II (280 nm) are other spectral lines relevant for studies of solar and stellar magnetized atmospheres. High performance polarizers can be obtained with optimized coatings. Interference coatings can tune polarizers at the spectral line(s) of interest for solar and stellar physics. Polarizing beamsplitters consist in polarizers that separate one polarization component by reflection and the other by transmission, which enables observing the two polarization components simultaneously with a single polarizer. They involve the benefit of a higher efficiency in collection of polarization data due to the use of a single polarizer for the two polarization components and they may also facilitate a simplified design for a space polarimeter. We present results on polarizing beamsplitters tuned either at 121.6 nm or at the pair of 155 and 280 nm spectral lines.
Huang, Wen; Deng, Yun; Dong, Wei; Yuan, Wuzhou; Wan, Yongqi; Mo, Xiaoyan; Li, Yongqing; Wang, Zequn; Wang, Yuequn; Ocorr, Karen; Zhang, Bo; Lin, Shuo; Wu, Xiushan
2011-02-01
In order to study the impalpable effect of GFP in homozygous heart-specific GFP-positive zebrafish during the early stage, the researchers analyzed the heart function of morphology and physiology at the first 3 days after fertilization. This zebrafish line was produced by a large-scale Tol2 transposon mediated enhancer trap screen that generated a transgenic zebrafish with a heart-specific expression of green fluorescent protein (GFP)-tagged under control of the nppa enhancer. In situ hybridization experiments showed that the nppa:GFP line faithfully recapitulated both the spatial and temporal expressions of the endogenous nppa. Green fluorescence was intensively and specifically expressed in the myocardial cells located both in the heart chambers and in the atrioventricular canal. The embryonic heart of nppa:GFP line developed normally compared with those in the wild type. There was no difference between the nappa:GFP and wild type lines with respect to heart rate, overall size, ejection volume, and fractional shortening. Thus the excess expression of GFP in this transgenic line seemed to exert no detrimental effects on zebrafish hearts during the early stages.
Syafiuddin, Achmad; Salmiati; Hadibarata, Tony; Salim, Mohd Razman; Kueh, Ahmad Beng Hong; Sari, Ajeng Arum
2017-09-01
Green procedure for synthesizing silver nanoparticles (AgNPs) is currently considered due to its economy and toxic-free effects. Several existing works on synthesizing AgNPs using leaves extract still involve the use of physical or mechanical treatment such as heating or stirring, which consume a lot of energy. To extend and explore the green extraction philosophy, we report here the synthesis and antibacterial evaluations of a purely green procedure to synthesize AgNPs using Carica papaya, Manihot esculenta, and Morinda citrifolia leaves extract without the aforementioned additional treatment. The produced AgNPs were characterized using the ultraviolet-visible spectroscopy, field emission scanning electron microscopy, energy-dispersive X-ray spectroscopy, Fourier transform infrared spectroscopy, and antibacterial investigations. For antibacterial tests, two bacteria namely Escherichia coli and Bacillus cereus were selected. The presently employed method has successfully produced spherical AgNPs having sizes ranging from 9 to 69 nm, with plasmonic characteristics ranging from 356 to 485 nm, and energy-dispersive X-ray peak at approximately 3 keV. In addition, the smallest particles can be produced when Manihot esculenta leaves extract was applied. Moreover, this study also confirmed that both the leaves and synthesized AgNPs exhibit the antibacterial capability, depending on their concentration and the bacteria type.
Maxwell, Eric J; Tong, William G
2016-05-01
An ultrasensitive label-free antibody-free detection method for malachite green and crystal violet is presented using nonlinear laser wave-mixing spectroscopy and capillary zone electrophoresis. Wave-mixing spectroscopy provides a sensitive absorption-based detection method for trace analytes. This is accomplished by forming dynamic gratings within a sample cell, which diffracts light to create a coherent laser-like signal beam with high optical efficiency and high signal-to-noise ratio. A cubic dependence on laser power and square dependence on analyte concentration make wave mixing sensitive enough to detect molecules in their native form without the use of fluorescent labels for signal enhancement. A 532 nm laser and a 635 nm laser were used for malachite green and crystal violet sample excitation. The use of two lasers of different wavelengths allows the method to simultaneously detect both analytes. Selectivity is obtained through the capillary zone electrophoresis separation, which results in characteristic migration times. Measurement in capillary zone electrophoresis resulted in a limit of detection of 6.9 × 10(-10)M (2.5 × 10(-19) mol) for crystal violet and 8.3 × 10(-11)M (3.0 × 10(-20) mol) for malachite green at S/N of 2. Copyright © 2016. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Göker, Ü. D.; Gigolashvili, M. Sh.; Kapanadze, N.
2017-06-01
A study of variations of solar spectral irradiance (SSI) in the wavelength ranges 121.5 nm-300.5 nm for the period 1981-2009 is presented. We used various data for ultraviolet (UV) spectral lines and international sunspot number (ISSN) from interactive data centers such as SME (NSSDC), UARS (GDAAC), SORCE (LISIRD) and SIDC, respectively. We reduced these data by using the MATLAB software package. In this respect, we revealed negative correlations of intensities of UV (289.5 nm-300.5 nm) spectral lines originating in the solar chromosphere with the ISSN index during the unusually prolonged minimum between the solar activity cycles (SACs) 23 and 24. We also compared our results with the variations of solar activity indices obtained by the ground-based telescopes. Therefore, we found that plage regions decrease while facular areas are increasing in SAC 23. However, the decrease in plage regions is seen in small sunspot groups (SGs), contrary to this, these regions in large SGs are comparable to previous SACs or even larger as is also seen in facular areas. Nevertheless, negative correlations between ISSN and SSI data indicate that these variations are in close connection with the classes of sunspots/SGs, faculae and plage regions. Finally, we applied the time series analysis of spectral lines corresponding to the wavelengths 121.5 nm-300.5 nm and made comparisons with the ISSN data. We found an unexpected increase in the 298.5 nm line for the Fe II ion. The variability of Fe II ion 298.5 nm line is in close connection with the facular areas and plage regions, and the sizes of these solar surface indices play an important role for the SSI variability, as well. So, we compared the connection between the sizes of faculae and plage regions, sunspots/SGs, chemical elements and SSI variability. Our future work will be the theoretical study of this connection and developing of a corresponding model.
Green Chemical Treatments for Heating and Cooling Systems
2006-09-01
Legionella pneumophila bacterium, which causes Legion- naire’s Disease. 2.3 Steam Line Treatment The third and final product in the Green Chemistry...ER D C/ CE R L TR -0 6 -2 9 Green Chemical Treatments for Heating and Cooling Systems Susan A. Drozdz and Vincent F. Hock September...CERL TR-06-29 September 2006 Green Chemical Treatments for Heating and Cooling Systems Susan A. Drozdz and Vincent F. Hock Construction
Ashok, Vipin; Agrawal, Nitasha; Durgbanshi, Abhilasha; Esteve-Romero, Josep; Bose, Devasish
2014-01-01
A simple, fast, and robust micellar LC method was developed for the separation and identification of the nonpermitted color malachite green in green pea and some ready-to-eat foodstuffs. Malachite green (4-[(4-dimethylaminophenyl) phenyl-methyl]-N,N-dimethylaniline) is a hazardous dye that is used to treat fungal and protozoan infections in fish and is a common adulterant (coloring agent) in green pea and other green vegetables because of its green color. In the present work, malachite green was determined in various foodstuffs using a direct injection technique on an RP C18 column with isocratic elution. The optimum mobile phase consisted of 0.15 M sodium dodecyl sulfate (SDS), 6% pentanol buffered at pH 5. Detection was carried out at 620 nm. Malachite green was eluted in 9.2 min without any interference caused by endogenous compounds. Linearities (r > 0.9999), intraday and interday precision (RSD less than 1.00%) in micellar media, and robustness were studied for method validation. LOD and LOQ were 0.10 and 0.25 ppm, respectively. The simplicity of the developed method makes it useful for routine analysis in the area of food QC.
Greening the Bottom Line: The Trend toward Green Revolving Funds on Campus
ERIC Educational Resources Information Center
Weisbord, Dano
2011-01-01
Facing steep budget cuts and rising energy costs, many colleges are grappling with how to finance urgently needed, but capital intensive, energy efficiency upgrades on campus. One innovative approach, using return-oriented green revolving funds (GRFs), is a rapidly growing trend at colleges and universities. GRFs can invest in a variety of…
Rao, Ying-Li; Schoenmakers, Dylan; Chang, Yi-Lu; Lu, Jia-Sheng; Lu, Zheng-Hong; Kang, Youngjin; Wang, Suning
2012-09-03
New phosphorescent Pt(II) compounds based on dimesitylboron (BMes(2))-functionalized 2-phenylpyridyl (ppy) N,C-chelate ligands and an acetylacetonato ancillary ligand have been achieved. We have found that BMes(2) substitution at the 4'-position of the phenyl ring can blue-shift the phosphorescent emission energy of the Pt(II) compound by approximately 50 nm, compared to the 5'-BMes(2) substituted analogue, without substantial loss of luminescent quantum efficiencies. The emission color of the 4'-BMes(2) substituted Pt(II) compound, Pt(Bppy)(acac) (1) can be further tuned by the introduction of a substituent group at the 3'-position of the phenyl ring. A methyl substituent red-shifts the emission energy of 1 by approximately 10 nm whereas a fluoro substituent blue-shifts the emission energy by about 6 nm. Using this strategy, three bright blue-green phosphorescent Pt(II) compounds 1, 2 and 3 with emission energy at 481, 492, and 475 nm and Φ(PL)=0.43, 0.26 and 0.25, respectively, have been achieved. In addition, we have examined the impact of BMes(2) substitution on 3,5-dipyridylbenzene (dpb) N,C,N-chelate Pt(II) compounds by synthesizing compound 4, Pt(Bdpb)Cl, which has a BMes(2) group at the 4'-position of the benzene ring. Compound 4 has a phosphorescent emission band at 485 nm and Φ(PL)=0.70. Highly efficient blue-green electroluminescent (EL) devices with a double-layer structure and compounds 1, 3 or 4 as the phosphorescent dopant have been fabricated. At 100 cd m(-2) luminance, EL devices based on 1, 3 and 4 with an external quantum efficiency of 4.7, 6.5 and 13.4%, respectively, have been achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
ESCAPE : a first step to high resolution solar coronagraphy in Antarctica
NASA Astrophysics Data System (ADS)
Damé, L.; Abe, L.; Faurobert, M.; Fineschi, S.; Kuzin, S.; Lamy, P.; Meftah, M.; Vives, S.
2012-06-01
The Dome C high plateau is unique for coronagraphic observations: sky brightness is reduced, water vapour is low, seeing is excellent and continuity of observations on several weeks is possible. ESCAPE (the Extreme Solar Coronagraphy Antarctic Program Experiment) will perform 2-dimensional spectroscopy of the forbidden line of FeXIV at 530.285 nm: precise line profile analysis will allow the diagnostic of the nature of waves by simultaneous measurements of velocities and intensities in the corona. ESCAPE is proposed to Institut Paul-Emile Victor (IPEV) for a campaign in 2012-2013 at Dome C/Concordia since all subsystems are available in particular thanks to an ESA STARTIGER 2010 R&D "Toward a New Generation of Formation Flying Coronagraph". Using state-of-the-art technologies developed for Space missions (a Three Mirrors Anastigmat telescope, the TMA, a 4 stages Liquid Crystal Tunable-filter Polarimeter, the LCTP) allows us to propose an automated Coronal Green Line full-field Polarimeter for unique observations (waves nature and intensity to address coronal heating) with the best possible performances on Earth and for preparing and testing the technologies for the next steps in Space. No other site would allow such coronagraphic performances (the sky brightness is a factor 2 to 4 better than in Hawaï) and with high spatial resolution (better than an arcsec is possible).
Upconversion luminescence and blackbody radiation in tetragonal YSZ co-doped with Tm(3+) and Yb(3+).
Soares, M R N; Ferro, M; Costa, F M; Monteiro, T
2015-12-21
Lanthanide doped inorganic nanoparticles with upconversion luminescence are of utmost importance for biomedical applications, solid state lighting and photovoltaics. In this work we studied the downshifted luminescence, upconversion luminescence (UCL) and blackbody radiation of tetragonal yttrium stabilized zirconia co-doped with Tm(3+) and Yb(3+) single crystals and nanoparticles produced by laser floating zone and laser ablation in liquids, respectively. The photoluminescence (PL) and PL excitation (PLE) were investigated at room temperature (RT). PL spectra exhibit the characteristic lines in UV, blue/green, red and NIR regions of the Tm(3+) (4f(12)) under resonant excitation into the high energy (2S+1)LJ multiplets. Under NIR excitation (980 nm), the samples placed in air display an intense NIR at ∼800 nm due to the (1)G4→(3)H5/(3)H4→(3)H6 transitions. Additionally, red, blue/green and ultraviolet UCL is observed arising from higher excited (1)G4 and (1)D2 multiplets. The power excitation dependence of the UCL intensity indicated that 2-3 low energy absorbed photons are involved in the UCL for low power levels, while for high powers, the identified saturation is dependent on the material size with a enhanced effect on the NPs. The temperature dependence of the UCL was investigated for single crystals and targets used in the ablation. An overall increase of the integrated intensity was found to occur between 12 K and the RT. The thermally activated process is described by activation energies of 10 meV and 30 meV for single crystals and targets, respectively. For the NPs, the UCL was found to be strongly sensitive to pressure conditions. Under vacuum conditions, instead of the narrow lines of the Tm(3+), a wide blackbody radiation was detected, responsible for the change in the emission colour from blue to orange. This phenomenon is totally reversible when the NPs are placed at ambient pressure. The UCL/blackbody radiation in the nanosized material exhibits non-contact pressure colour-based sensor characteristics. Moreover, tuning the color of the blackbody radiation in the nanoparticles by harvesting the low energy photons into the visible spectral region was found to be possible by adjusting the excitation power, paving the way for further developments of these nanoparticles for lighting and photovoltaic applications.
NASA Astrophysics Data System (ADS)
Li, B.; Zhao, L.; Zhang, Y. B.; Zheng, Q.; Zhao, Y.; Yao, Y.
2013-03-01
Efficient and compact green-yellow laser output at 543 nm is generated by intracavity frequency doubling of a CW diode-pumped Nd:LuVO4 laser at 1086 nm under the condition of suppressing the higher gain transition near 1064 nm. With 16 W of diode pump power and the frequency-doubling crystal LBO, as high as 2.17 W of CW output power at 543 nm is achieved, corresponding to an optical-to-optical conversion efficiency of 13.6% and the output power stability over 8 hours is better than 2.86%. To the best of our knowledge, this is the highest watt-level laser at 543 nm generated by intracavity frequency doubling of a diode pumped Nd:LuVO4 laser at 1086 nm.
78 FR 5821 - Final Flood Hazard Determinations
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-28
... Greene County Courthouse, 306 West Court Street, Paragould, AR 72450. Curry County, New Mexico, and..., Clovis, NM 88101. Unincorporated Areas of Curry County. Curry County Administrative Office, 700 North...
Evaluation of chromatic cues for trapping Bactrocera tau.
Li, Lei; Ma, Huabo; Niu, Liming; Han, Dongyin; Zhang, Fangping; Chen, Junyu; Fu, Yueguan
2017-01-01
Trapping technology based on chromatic cues is an important strategy in controlling Tephritidae (fruit flies). The objectives of this present study were to evaluate the preference of Bactrocera tau for different chromatic cues, and to explore an easy method to print and reproduce coloured paper. Chromatic cues significantly affected the preference of adult B. tau. Wavelengths in the 515-604 nm range were the suitable wavelengths for trapping B. tau. Different-day-old B. tau had different colour preferences. Virtual wavelengths of 595 nm (yellow) and 568 nm (yellowish green) were the optimum wavelengths for trapping 5-7-day-old B. tau and 30-32-day-old B. tau respectively. The trap type and height significantly influenced B. tau attraction efficiency. The number of B. tau on coloured traps hung perpendicular to plant rows was not significantly higher than the number on traps hung parallel to plant rows. The quantisation of colour on the basis of Bruton's wavelength to RGB function can serve as an alternative method for printing and reproducing coloured paper, but a corrected equation should be established between the theoretical wavelength and actual wavelength of coloured paper. Results show that a compound paper coloured yellow (595 nm) and yellowish green (568 nm) installed at 60 and 90 cm above the ground shows the maximum effect for trapping B. tau. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Blue light emission from ZnO-graphene hybrid quantum dot (Conference Presentation)
NASA Astrophysics Data System (ADS)
Choi, Won Kook; Kim, Hong Hee; Park, Cheolmin; Hwang, Do Kyung; Lee, Yeonju
2017-03-01
One of a wide-bandgap semiconductor, Zinc oxide (ZnO) has a near ultraviolet bandgap (3.37 eV) and an exciton binding energy of 60 meV at room temperature (RT), and has several favorable properties, such as high electron mobility, high oscillator strength, and good transparency. In the photoluminescence (PL) spectra of ZnO nanoparticles, the near band edge ultraviolet (UV) emission at 378 nm relevant to direct bandgap of ZnO, and blue light emissions centered at 410, 435, and 465 nm corresponding to Zn interstitial (Zni) to valence band maximum (VBM), and to Zn vacancies (VZn) and green light emission at 540 nm corresponding to conduction band maximum (CBM) to oxygen vacancy (Vo). Ultra-small size quasi consolidated ZnO-graphene nanoparticles was synthesized in which graphene outer layer was chemically attached with ZnO inner core. After attaching graphene to ZnO, green emission completely disappeared whereas the intensity of blue emission was greatly increased. Enhanced blue emission could be well described by both fast electron transfer from CBM of ZnO to graphene having similar molecular energy level with Zni and transition to VBM and Vzn. Glass/ITO/PEDOT:PSS/poly-TPD/ZnO-graphene/Cs2CO3/Al were fabricated and showed the blue emission centered at 435 nm with FWHM of about 90 nm.
Mahamat, Adoum H; Narducci, Frank A; Schwiegerling, James
2016-03-01
Volume-phase holographic (VPH) gratings have been designed for use in many areas of science and technology, such as optical communication, optical imaging, and astronomy. In this paper, the design of a volume-phase holographic grating, simultaneously optimized to operate in the red, green, and blue wavelengths, is presented along with a study of its fabrication tolerances. The grating is optimized to produce 98% efficiency at λ=532 nm and at least 75% efficiency in the region between 400 and 700 nm, when the incident light is unpolarized. The optimization is done for recording in dichromated gelatin with a thickness of 12 μm, an average refractive index of 1.5, and a refractive index modulation of 0.022.
Fedorova, Ksenia A; Sokolovskii, Grigorii S; Khomylev, Maksim; Livshits, Daniil A; Rafailov, Edik U
2014-12-01
A compact high-power yellow-green continuous wave (CW) laser source based on second-harmonic generation (SHG) in a 5% MgO doped periodically poled congruent lithium niobate (PPLN) waveguide crystal pumped by a quantum-dot fiber Bragg grating (QD-FBG) laser diode is demonstrated. A frequency-doubled power of 90.11 mW at the wavelength of 560.68 nm with a conversion efficiency of 52.4% is reported. To the best of our knowledge, this represents the highest output power and conversion efficiency achieved to date in this spectral region from a diode-pumped PPLN waveguide crystal, which could prove extremely valuable for the deployment of such a source in a wide range of biomedical applications.
Study of white light emission from ZnS/PS composite system
NASA Astrophysics Data System (ADS)
Wang, Caifeng; Li, Qingshan; Lu, Lei; Zhang, Lichun; Qi, Hongxia
2007-09-01
ZnS films were deposited by pulsed laser deposition (PLD) on porous silicon (PS) substrates formed by electrochemical anodization of p-type (100) silicon wafer. The photoluminescence (PL) spectra of ZnS/PS composites were measured at room temperature. Under different excitation wavelengths, the relative integrated intensities of the red light emission from PS layers and the blue-green emission from ZnS films had different values. After samples were annealed in vacuum at different temperatures (200, 300, and 400 Celsius degree) for 30 min respectively, a new green emission located at around 550 nm appeared in the PL spectra of all ZnS/PS samples, and all of the ZnS/PS composites had a broad PL band (450-700 nm) in the visible region, exhibiting intensively white light emission.
Amendola, R; Martinez, R; Negroni, A; Venturelli, D; Tanno, B; Calabretta, B; Raschellà, G
2001-01-01
Nm23 gene family has been associated with metastasis suppression and differentiation. We studied DR-nm23 during neuroblastoma cells differentiation. DR-nm23 expression increased after retinoic acid induction of differentiation in human cell lines SK-N-SH and LAN-5. In several cell lines, overexpression of DR-nm23 was associated with more differentiated phenotypes. SK-N-SH cells increased vimentin expression, increased deposition of collagen type IV, modulated integrin expression, and underwent growth arrest; the murine neuroblastoma cell line N1E-115 showed neurite outgrowth and a striking enhancement of beta1 integrin expression. Up-regulation of beta1 integrin was specifically responsible for the increase in the adhesion to collagen type I-coated plates. Finally, cells overexpressing DR-nm23 were unable to growth in soft agar. In conclusion, DR-nm23 expression is directly involved in differentiation of neuroblastoma cells, and its ability to affects the adhesion to extracellular substrates and to inhibit growth in soft agar suggests an involvement in the metastatic potential of neuroblastoma.
Lin, Xiaorong; Gao, Xiong; Chen, Zhongzheng; Zhang, Yuanyuan; Luo, Wei; Li, Xiaofei; Li, Bin
2017-05-10
Tea nano-aggregates spontaneously assembled in clear tea infusions are considered as the precursors of tea cream, although their molecular basis remains obscure. Here, we characterized nano-aggregates in green tea infusions from Camellia ptilophylla, a peculiar tea variety with 6.0% of theobromine, and Camellia sinensis as the control for comparative purpose. Numerous negatively charged spherical colloidal particles of 50-100 nm in diameter were primarily found in both green tea infusions. Catechins, proteins, and carbohydrates were confirmed as the dominant components in green tea nano-aggregates. In addition, iron, copper, nickel, proteins, and gallated catechins exhibited higher aggregating affinity than other components, whereas methylxanthines and calcium contributed to the transformation of nano-aggregates into tea cream. Green tea nano-aggregates were partly destroyed by simulated gastrointestinal digestion, and removing theses peculiar particles dramatically attenuated the bioaccessibility of methylxanthines, theanine, and some catechin monomers in green tea infusions. This study enhanced our knowledge of molecular interactions in the formation of green tea cream and provided insight into physicochemical profiles, phytochemical nature, and functional effects of green tea nano-aggregates.
Method for predicting dry mechanical properties from wet wood and standing trees
Meglen, Robert R.; Kelley, Stephen S.
2003-08-12
A method for determining the dry mechanical strength for a green wood comprising: illuminating a surface of the wood to be determined with light between 350-2,500 nm, the wood having a green moisture content; analyzing the surface using a spectrometric method, the method generating a first spectral data, and using a multivariate analysis to predict the dry mechanical strength of green wood when dry by comparing the first spectral data with a calibration model, the calibration model comprising a second spectrometric method of spectral data obtained from a reference wood having a green moisture content, the second spectral data correlated with a known mechanical strength analytical result obtained from a reference wood when dried and having a dry moisture content.
Effect of marine derived deoxyribonucleic acid on nonlinear optical properties of PicoGreen dye
NASA Astrophysics Data System (ADS)
Pradeep, C.; Mathew, S.; Nithyaja, B.; Radhakrishnan, P.; Nampoori, V. P. N.
2013-06-01
We have investigated the effect of DNA on nonlinear absorption of PicoGreen dye using single beam open aperture Z-scan technique in nanosecond regime. We observed reverse saturable absorption at 532 nm for PicoGreen without DNA. In the presence of DNA, the sample begins to behave like saturable absorbers and this effect increased as the concentration of DNA was increased. The dye-intercalated DNA showed SA characteristics near the focus but exhibited RSA characteristics at the focus. Theoretical analysis has been performed using a two-photon absorption model based on nonlinear absorption coefficient and saturation intensity. Such tailoring of optical nonlinear absorption in PicoGreen makes it a potential candidate for photonic application.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Minghui; University of Chinese Academy of Sciences, Beijing 100039; Yu, Jianding
2013-11-15
Graphical abstract: - Highlights: • Novel BaTi{sub 2}O{sub 5}–Gd{sub 2}O{sub 3} based glasses have been prepared by aerodynamic levitation. • The obtained glasses show high thermal stability with T{sub g} = 763.3 °C. • Er{sup 3+}/Yb{sup 3+} co-doped glasses show strong upconversion based on a two-photon process. • Red emission is stronger than green emissions for EBT by high Yb{sup 3+} concentration. • Magnetic ions are paramagnetic and the distribution is homogeneous in the glasses. - Abstract: Novel Er{sup 3+}/Yb{sup 3+} co-doped BaTi{sub 2}O{sub 5}–Gd{sub 2}O{sub 3} spherical glasses have been fabricated by aerodynamic levitation method. The thermal stability, upconversionmore » luminescence, and magnetic properties of the present glass have been studied. The glasses show high thermal stability with 763.3 °C of the onset temperature of the glass transition. Red and green emissions centered at 671 nm, 548 nm and 535 nm are obtained at 980 nm excitation. The upconversion is based on a two-photon process by energy transfer, excited-state absorption, and energy back transfer. Yb{sup 3+} ions are more than Er{sup 3+} ions in the glass, resulting in efficient energy back transfer from Er{sup 3+} to Yb{sup 3+}. So the red emission is stronger than the green emissions. Magnetization curves indicate that magnetic rare earth ions are paramagnetic and the distribution is homogeneous and random in the glass matrix. Aerodynamic levitation method is an efficient way to prepare glasses with homogeneous rare earth ions.« less