Solar-assisted synthesis of ZnO nanoparticles using lime juice: a green approach
NASA Astrophysics Data System (ADS)
Hinge, Shruti P.; Pandit, Aniruddha B.
2017-12-01
Zinc oxide (ZnO) nanoparticles are those nanoparticles which have been synthesized in various morphologies and shapes. Their size and shape dependent properties and their applications in vivid sectors of science and technology make them interesting to synthesize. Present work reports a green method for ZnO nanoparticle synthesis using lime juice and sunlight. ZnO nanoparticles were also synthesized by conventionally used methods like heating, stirring or no heating and/or stirring. The nanoparticles were characterized using different techniques like UV-vis spectroscopy, scanning electron microscopy (SEM), x-ray diffraction (XRD) and dynamic light scattering (DLS). Thermo gravimetric analysis (TGA) was also carried out for the intermediate product to select the calcination temperature. Stoichiometric study reveals that the intermediate product formed is zinc citrate dihydrate. The synthesized calcined nanoparticles have good crystallinity, uniform shape, and high purity and were in the size range of 20-30 nm. These nanoparticles formed agglomerates of various shapes in the size range of 200-750 nm. This process is ecofriendly and is amiable for easy scale up.
7 CFR 51.1011 - Good green color.
Code of Federal Regulations, 2011 CFR
2011-01-01
... Standards for Persian (Tahiti) Limes Definitions § 51.1011 Good green color. Good green color means that the skin of the lime is of a good green color characteristic of the Persian variety. ... 7 Agriculture 2 2011-01-01 2011-01-01 false Good green color. 51.1011 Section 51.1011 Agriculture...
7 CFR 51.1011 - Good green color.
Code of Federal Regulations, 2012 CFR
2012-01-01
... Standards for Persian (Tahiti) Limes Definitions § 51.1011 Good green color. Good green color means that the skin of the lime is of a good green color characteristic of the Persian variety. ... 7 Agriculture 2 2012-01-01 2012-01-01 false Good green color. 51.1011 Section 51.1011 Agriculture...
7 CFR 51.1011 - Good green color.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Good green color. 51.1011 Section 51.1011 Agriculture... Standards for Persian (Tahiti) Limes Definitions § 51.1011 Good green color. Good green color means that the skin of the lime is of a good green color characteristic of the Persian variety. ...
Karakus, M.; Hagni, R.D.; Koenig, A.; Ciftc, E.
2008-01-01
Natural sphalerite associated with copper, silver, lead-zinc, tin and tungsten deposits from various world-famous mineral deposits have been studied by cathodoluminescence (CL), laser ablasion inductively coupled plasma mass spectrometry (LA-ICP-MS), electron probe microanalysis (EPMA) and electron paramagnetic resonance (EPR) to determine the relationship between trace element type and content and the CL properties of sphalerite. In general, sphalerite produces a spectrum of CL colour under electron bombardment that includes deep blue, turquoise, lime green, yellow-orange, orange-red and dull dark red depending on the type and concentration of trace quantities of activator ions. Sphalerite from most deposits shows a bright yellow-orange CL colour with ??max centred at 585 nm due to Mn2+ ion, and the intensity of CL is strongly dependent primarily on Fe2+ concentration. The blue emission band with ??max centred at 470-490 nm correlates with Ga and Ag at the Tsumeb, Horn Silver, Balmat and Kankoy mines. Colloform sphalerite from older well-known European lead-zinc deposits and late Cretaceous Kuroko-type VMS deposits of Turkey shows intense yellowish CL colour and their CL spectra are characterised by extremely broad emission bands ranging from 450 to 750 nm. These samples are characterised by low Mn (<10 ppm) and Ag (<1 ppm), and they are enriched in Tl (1-30 ppm) and Pb (80-1500 ppm). Strong green CL is produced by sphalerite from the Balmat-Edwards district. Amber, lime-green and red-orange sphalerite produced weak orange-red CL at room temperatures, with several emission bands centred at 490, 580, 630, 680, 745, with ??max at 630 nm being the strongest. These emission bands are well correlated with trace quantities of Sn, In, Cu and Mn activators. Sphalerite from the famous Ogdensburg and Franklin mines exhibited brilliant deep blue and orange CL colours and the blue CL may be related to Se. Cathodoluminescence behaviour of sphalerite serves to characterise ore types and help detect technologically important trace elements.
Thomas, Ann; Thakur, Sneha; Mhambrey, Sanjana
2015-01-01
A number of natural mouth rinse formulations are being proposed as an alternative to the widely used chemical mouth rinses. To evaluate and compare the antimicrobial efficacy of chlorhexidine (0.2%), sodium fluoride (0.05%), fluoride with essential oils (0.05%), alum (0.02 M), green tea, and garlic with lime mouth rinses against Streptococcus mutans, lactobacilli, and Candida albicans. The three microbes were isolated from the saliva samples collected from children with severe early childhood caries. The zone of minimum inhibition was assessed using agar diffusion method. The data were statistically analyzed using SPSS software. Against S. mutans and lactobacilli, chlorhexidine mouth rinse was found to be the most effective as compared to sodium fluoride (P < 0.001, P < 0.001), fluoride with essential oils (P < 0.001, P < 0.001), alum (P < 0.001, P < 0.001), green tea (P < 0.001, P < 0.001), and garlic with lime (P < 0.001, P < 0.001) mouth rinses, respectively. But against C. albicans, garlic with lime mouth rinse was found to be the most effective as compared to chlorhexidine (P < 0.001), sodium fluoride (P < 0.001), fluoride with essential oils (P < 0.001), alum (P < 0.001), and green tea (P < 0.001) mouth rinses. Against S. mutans and lactobacilli, after chlorhexidine mouth rinse, garlic with lime mouth rinse was found to be significantly more effective than sodium fluoride (P = 0.053, P = 0.001), fluoride with essential oils (P < 0.001, P < 0.001), alum (P < 0.001, P < 0.001), and green tea (P < 0.001, P < 0.001) mouth rinses. As a natural mouth rinse, garlic with lime mouth rinse was found to be the most promising. However, further studies are needed in this field.
Kaszowska, Zofia; Malek, Kamilla; Staniszewska-Slezak, Emilia; Niedzielska, Karina
2016-12-05
This work presents an in-depth study on Raman spectra excited with 1064 and 532nm lasers of lime binders employed in the past as building materials and revealed today as valuable conservation materials. We focus our interest on the bands of strong intensity, which are present in the spectra of all binders acquired with laser excitation at 1064nm, but absent in the corresponding spectra acquired with laser excitation at 532nm. We suggest, that the first group of spectra represents fluorescence phenomena of unknown origin and the second true Raman scattering. In our studies, we also include two other phases of lime cycle, i.e. calcium carbonate (a few samples of calcite of various origins) and calcium oxide (quicklime) to assess how structural and chemical transformations of lime phases affect the NIR-Raman spectral profile. Furthermore, we analyse a set of carbonated limewashes and lime binders derived from old plasters to give an insight into their spectral characteristics after excitation with the 1064nm laser line. NIR-Raman micro-mapping results are also presented to reveal the spatial distribution of building materials and fluorescent species in the cross-section of plaster samples taken from a 15th century chapel. Our study shows that the Raman analysis can help identify lime-based building and conservation materials, however, a caution is advised in the interpretation of the spectra acquired using 1064nm excitation. Copyright © 2016. Published by Elsevier B.V.
7 CFR 51.1011 - Good green color.
Code of Federal Regulations, 2014 CFR
2014-01-01
... green color. Good green color means that the skin of the lime is of a good green color characteristic of... 7 Agriculture 2 2014-01-01 2014-01-01 false Good green color. 51.1011 Section 51.1011 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing...
7 CFR 51.1011 - Good green color.
Code of Federal Regulations, 2013 CFR
2013-01-01
... green color. Good green color means that the skin of the lime is of a good green color characteristic of... 7 Agriculture 2 2013-01-01 2013-01-01 false Good green color. 51.1011 Section 51.1011 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shiota, Tadashi, E-mail: tshiota@ceram.titech.ac.jp; Sato, Yoshitaka; Yasuda, Kouichi
2014-03-10
Simultaneous time-resolved measurements of photon emission (PE) and fast crack propagation upon bending fracture were conducted in silica glass and soda lime glass. Observation of fracture surfaces revealed that macroscopic crack propagation behavior was similar between the silica glass and soda lime glass when fracture loads for these specimens were comparable and cracks propagated without branching. However, a large difference in the PE characteristics was found between the two glasses. In silica glass, PE (645–655 nm) was observed during the entire crack propagation process, whereas intense PE (430–490 nm and 500–600 nm) was observed during the initial stages of propagation. In contrast, onlymore » weak PE was detected in soda lime glass. These results show that there is a large difference in the atomic processes involved in fast crack propagation between these glasses, and that PE can be used to study brittle fracture on the atomic scale.« less
NASA Technical Reports Server (NTRS)
Nakamura-Messenger, K.; Messenger, Scott R.; Ito, M.; Keller, L. P.; Clemett, S. J.; Jones, J. H.; Tatsuoka, H.; Zolensky, M. E.; Tatsuoka, H.
2010-01-01
Brownleeite is a manganese silicide, ideally stoichiometric MnSi, not previously observed in nature until its discovery within an interplanetary dust particle (IDP) that likely originated from a comet [1]. Three discrete brownleeite grains in the IDP L2055 I3 (4 microns in size, hereafter IDP I3) were identified with maximum dimensions of 100, 250 and 600 nm and fully analyzed using scanning-transmission electron microscopy (STEM) [1]. One of the grains (100 nm in size) was poikilitically enclosed by low-Fe, Mn-enriched (LIME) olivine. LIME olivine is epitaxial to the brownleeite with the brownleeite (200) parallel to the olivine c* [1]. LIME olivine is an enigmatic phase first reported from chondritic porous IDPs and some unequilibrated ordinary chondrites [ 2], that is commonly observed in chondritic-porous IDPs. Recently, LIME olivine has been also found in comet Wild-2 (Stardust) samples [3], indicating that LIME olivine is a common mineral component of comets. LIME olivine has been proposed to form as a high temperature condensate in the protosolar nebula [2]. Brownleeite grains also likely formed as high-temperature condensates either in the early Solar System or in the outflow of an evolved star or supernova explosion [1]. The isotopic composition of the brownleeite grains may strongly constrain their ultimate source. To test this hypothesis, we performed isotopic analyses of the brownleeite and the associated LIME olivine, using the NASA/JSC NanoSIMS 50L ion microprobe.
Detecting aroma changes of local flavored green tea (Camellia sinensis) using electronic nose
NASA Astrophysics Data System (ADS)
Ralisnawati, D.; Sukartiko, A. C.; Suryandono, A.; Triyana, K.
2018-03-01
Indonesia is currently the sixth largest tea producer in the world. However, consumption of the product in the country was considered low. Besides tea, the country also has various local flavor ingredients that are potential to be developed. The addition of local flavored ingredients such as ginger, lemon grass, and lime leaves on green tea products is gaining acceptance from consumers and producers. The aroma of local flavored green tea was suspected to changes during storage, while its sensory testing has some limitations. Therefore, the study aimed to detect aroma changes of local flavors added in green tea using electronic nose (e-nose), an instrument developed to mimic the function of the human nose. The test was performed on a four-gram sample. The data was collected with 120 seconds of sensing time and 60 seconds of blowing time. Principal Component Analysis (PCA) was used to find out the aroma changes of local flavored green tea during storage. We observed that electronic nose could detect aroma changes of ginger flavored green tea from day 0 to day 6 with variance percentage 99.6%. Variance proportion of aroma changes of lemon grass flavored green tea from day 0 to day 6 was 99.3%. Variance proportion of aroma changes of lime leaves flavored green tea from day 0 to day 6 was 99.4%.
Lindsay, K R; Furlong, M J
2016-08-01
The banana-spotting bug, Amblypelta lutescens lutescens Distant (Hemiptera: Coreidae), is native to Australia and a major polyphagous pest of many tropical and subtropical horticultural crops in the east and north of the country. Different plant structures (flowers, vegetative flush, and different sized fruit) of avocado, lime, and papaya crops and green bean pods (a known suitable host) were evaluated for their suitability as hosts for A. l. lutescens Neonate to imago survivorship, the time taken to complete neonate to imago development, preovipositional period, and fecundity were assessed for each crop. Of all the different phenological stages of the plants investigated, A. l. lutescens could complete development to imago on vegetative flush of papaya and lime, papaya flowers, and green bean pods but on no other structures tested. There was higher survivorship to the second instar when neonates fed on green bean pods or flowers or vegetative flush of avocado, lime, or papaya crops than when neonates fed on small, medium, or large fruit of these crops. Insects that developed to the imago on green bean pods were significantly heavier than insects that developed on papaya flowers or papaya vegetative flush. The mean preoviposition period was shorter, and adult females more fecund, if they completed immature development and then fed as adults on papaya vegetative flush or green beans rather than papaya flowers. The data indicate that avocado is not a suitable host for A. l. lutescens, suggesting that adult populations that cause significant pest damage to the fruit of this crop originate elsewhere. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Selective Deposition of SiO2 on Ion Conductive Area of Soda-lime Glass Surface
Sakai, Daisuke; Harada, Kenji; Hara, Yuichiro; Ikeda, Hiroshi; Funatsu, Shiro; Uraji, Keiichiro; Suzuki, Toshio; Yamamoto, Yuichi; Yamamoto, Kiyoshi; Ikutame, Naoki; Kawaguchi, Keiga; Kaiju, Hideo; Nishii, Junji
2016-01-01
Selective deposition of SiO2 nanoparticles was demonstrated on a soda-lime glass surface with a periodic sodium deficient pattern formed using the electrical nanoimprint. Positively charged SiO2 particles generated using corona discharge in a cyclic siloxane vapor, were selectively deposited depending on the sodium pattern. For such phenomena to occur, the sodium ion migration to the cathode side was indispensable to the electrical charge compensation on the glass surface. Therefore, the deposition proceeded preferentially outside the alkali-deficient area. Periodic SiO2 structures with 424 nm and 180 nm heights were obtained using one-dimensional (6 μm period) and two-dimensional (500 nm period) imprinted patterns. PMID:27291796
NASA Astrophysics Data System (ADS)
Zamratul, M. I. M.; Zaidan, A. W.; Khamirul, A. M.; Nurzilla, M.; Halim, S. A.
New glass system of neodymium - doped zinc soda lime silica glass has been synthesized for the first time by melt-quenching of glass waste soda lime silica (SLS) with zinc oxide (ZnO) as precursor glass and Nd2O3 as dopant. In order to examine the effect of Nd3+ on the structural and optical properties, the prepared sample of structure [(ZnO)0.5(SLS)0.5](Nd2O3)x (x = 0, 1, 2, 3, 4 and 5 wt%) was characterized through X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy, UV-Vis spectroscopy (UV-Vis) and the photoluminescence (PL). XRD pattern justifies the amorphous nature of synthesized glasses. FTIR spectroscopy has been used to observe the structural evolution of ZnO4 and SiO4 groups. The UV-Vis-NIR absorption spectra reveals seven peaks centered at excitation of electron from ground state 4I9/2 to 4D3/2 + 4D5/2 (∼360 nm), 2G9/2 + 2D3/2 + 2P3/2(∼470 nm), 2K13/2 + 4G7/2 + 4G9/2 (∼523 nm), 4G5/2 + 2G7/2 (∼583 nm), 4F9/2 (∼678 nm), 4S3/2 + 4F7/2 (∼748 nm) and 4F5/2 + 2H9/2 (∼801 nm). PL spectra under the excitation of 800 nm display four emission bands centered at 531 nm, 598 nm, 637 nm and 671 nm corresponding to 4G7/2 → 4I9/2, (4G7/2 → 4I11/2, 4G5/2 → 4I9/2), (4G5/2 → 4I11/2) and (4G7/2 → 4I13/2, 4G5/2 → 4I11/2) respectively.
Thomas, Ann; Habib, Rishika
2017-01-01
Introduction With greater awareness worldwide, the use of herbs and herbal products has increased to a large extent. Objective To evaluate and compare the antimicrobial efficacy of green tea, garlic with lime, and 0.05% sodium fluoride (NaF) mouth rinses against Streptococcus mutans, Lactobacilli species, and Candida albicans. Materials and methods A total of 45 children aged 4 to 6 years with severe early childhood caries (S-ECC; based on decayed extracted filled [defs] score) were selected. Children were divided randomly into three equal groups and were asked to rinse with the prescribed mouth rinse once daily for 2 weeks after breakfast under supervision. A base-line and postrinsing nonstimulated whole salivary sample (2 mL) was collected and tested for the number of colony-forming units (CFUs). The data were statistically analyzed using Statistical Package for the Social Sciences (SPSS) version 16.0 software with one-way analysis of variance (ANOVA) and Tukey’s post hoc test. Results A statistically significant fall in colony count was found with the three mouth rinses in S. mutans (p < 0.001, p < 0.001) and Lactobacilli spp. (p < 0.001, p < 0.001), but not against C. albicans (p = 0.264, p = 0.264). On comparison, no statistically significant difference was found against S. mutans (p = 1, p = 0.554, p = 0.572), lactobacilli spp. (p = 0.884, p = 0.999, p = 0.819), and C. albicans (p = 0.999, p = 0.958, p = 0.983). Conclusion The findings of this study indicate that green tea and garlic with lime mouth rinse can be an economical alternative to NaF mouth rinse both for prevention and therapeutics. How to cite this article Thomas A, Thakur S, Habib R. Comparison of Antimicrobial Efficacy of Green Tea, Garlic with Lime, and Sodium Fluoride Mouth Rinses against Streptococcus mutans, Lactobacilli species, and Candida albicans in Children: A Randomized Double-blind Controlled Clinical Trial. Int J Clin Pediatr Dent 2017;10(3):234-239. PMID:29104381
Thomas, Ann; Thakur, Sneha; Habib, Rishika
2017-01-01
With greater awareness worldwide, the use of herbs and herbal products has increased to a large extent. To evaluate and compare the antimicrobial efficacy of green tea, garlic with lime, and 0.05% sodium fluoride (NaF) mouth rinses against Streptococcus mutans, Lactobacilli species, and Candida albicans. A total of 45 children aged 4 to 6 years with severe early childhood caries (S-ECC; based on decayed extracted filled [defs] score) were selected. Children were divided randomly into three equal groups and were asked to rinse with the prescribed mouth rinse once daily for 2 weeks after breakfast under supervision. A base-line and postrinsing nonstimulated whole salivary sample (2 mL) was collected and tested for the number of colony-forming units (CFUs). The data were statistically analyzed using Statistical Package for the Social Sciences (SPSS) version 16.0 software with one-way analysis of variance (ANOVA) and Tukey's post hoc test. A statistically significant fall in colony count was found with the three mouth rinses in S. mutans (p < 0.001, p < 0.001) and Lactobacilli spp. (p < 0.001, p < 0.001), but not against C. albicans (p = 0.264, p = 0.264). On comparison, no statistically significant difference was found against S. mutans (p = 1, p = 0.554, p = 0.572), lactobacilli spp. (p = 0.884, p = 0.999, p = 0.819), and C. albicans (p = 0.999, p = 0.958, p = 0.983). The findings of this study indicate that green tea and garlic with lime mouth rinse can be an economical alternative to NaF mouth rinse both for prevention and therapeutics. Thomas A, Thakur S, Habib R. Comparison of Antimicrobial Efficacy of Green Tea, Garlic with Lime, and Sodium Fluoride Mouth Rinses against Streptococcus mutans, Lactobacilli species, and Candida albicans in Children: A Randomized Double-blind Controlled Clinical Trial. Int J Clin Pediatr Dent 2017;10(3):234-239.
Val-Moraes, Silvana Pompeia; de Macedo, Helena Suleiman; Kishi, Luciano Takeshi; Pereira, Rodrigo Matheus; Navarrete, Acacio Aparecido; Mendes, Lucas William; de Figueiredo, Eduardo Barretto; La Scala, Newton; Tsai, Siu Mui; de Macedo Lemos, Eliana Gertrudes; Alves, Lúcia Maria Carareto
2016-12-01
Here we show that both liming the burnt sugarcane and the green harvest practice alter bacterial community structure, diversity and composition in sugarcane fields in northeastern São Paulo state, Brazil. Terminal restriction fragment length polymorphism fingerprinting and 16S rRNA gene cloning and sequencing were used to analyze changes in soil bacterial communities. The field experiment consisted of sugarcane-cultivated soils under different regimes: green sugarcane (GS), burnt sugarcane (BS), BS in soil amended with lime applied to increase soil pH (BSL), and native forest (NF) as control soil. The bacterial community structures revealed disparate patterns in sugarcane-cultivated soils and forest soil (R = 0.786, P = 0.002), and overlapping patterns were shown for the bacterial community structure among the different management regimes applied to sugarcane (R = 0.194, P = 0.002). The numbers of operational taxonomic units (OTUs) found in the libraries were 117, 185, 173 and 166 for NF, BS, BSL and GS, respectively. Sugarcane-cultivated soils revealed higher bacterial diversity than NF soil, with BS soil accounting for a higher richness of unique OTUs (101 unique OTUs) than NF soil (23 unique OTUs). Cluster analysis based on OTUs revealed similar bacterial communities in NF and GS soils, while the bacterial community from BS soil was most distinct from the others. Acidobacteria and Alphaproteobacteria were the most abundant bacterial phyla across the different soils with Acidobacteria Gp1 accounting for a higher abundance in NF and GS soils than burnt sugarcane-cultivated soils (BS and BSL). In turn, Acidobacteria Gp4 abundance was higher in BS soils than in other soils. These differential responses in soil bacterial community structure, diversity and composition can be associated with the agricultural management, mainly liming practices, and harvest methods in the sugarcane-cultivated soils, and they can be detected shortly after harvest.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deka, Angshuman; Nanda, Karuna Kar
2013-06-15
ZnO films have been grown via a vapour phase transport (VPT) on soda lime glass (SLG) and indium-tin oxide (ITO) coated glass. ZnO film on ITO had traces of Zn and C which gives them a dark appearance while that appears yellowish-white on SLG. X-ray photoelectron spectroscopy studies confirm the traces of C in the form of C-O. The photoluminescence studies reveal a prominent green luminescence band for ZnO film on ITO.
40 CFR 180.532 - Cyprodinil; tolerances for residues.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Kiwifruit 1.8 Leaf petioles subgroup 4B 30 Leafy greens subgroup 4A 50 Lemon 0.60 Lime 0.60 Longan 2.0 Lychee 2.0 Mango 1.2 Onion, bulb, subgroup 3-07A 0.6 Onion, green, subgroup 3-07B 4.0 Papaya 1.2 Parsley, dried leaves 170 Parsley, leaves 35 Pistachio 0.10 Pulasan 2.0 Rambutan 2.0 Sapodilla 1.2 Sapote, black...
40 CFR 180.532 - Cyprodinil; tolerances for residues.
Code of Federal Regulations, 2014 CFR
2014-07-01
... Kiwifruit 1.8 Leaf petioles subgroup 4B 30 Leafy greens subgroup 4A 50 Lemon 0.60 Lime 0.60 Longan 2.0 Lychee 2.0 Mango 1.2 Onion, bulb, subgroup 3-07A 0.6 Onion, green, subgroup 3-07B 4.0 Papaya 1.2 Parsley, dried leaves 170 Parsley, leaves 35 Pistachio 0.10 Pulasan 2.0 Rambutan 2.0 Sapodilla 1.2 Sapote, black...
Machining of glass and quartz using nanosecond and picosecond laser pulses
NASA Astrophysics Data System (ADS)
Ashkenasi, David; Kaszemeikat, Tristan; Mueller, Norbert; Lemke, Andreas; Eichler, Hans Joachim
2012-03-01
New laser processing strategies in micro processing of glass, quartz and other optically transparent materials are being developed with increasing effort. Utilizing diode-pumped solid-state laser generating nanosecond pulsed green (532 nm) laser light in conjunction with either scanners or special trepanning systems can provide for reliable glass machining at excellent efficiency. Micro ablation can be induced either from the front or rear side of the glass sample. Ablation rates of over 100 μm per pulse can be achieved in rear side processing. In comparison, picosecond laser processing of glass and quartz (at a wavelength of 1064 or 532 nm) yield smaller feed rates at however much better surface and bore wall quality. This is of great importance for small sized features, e.g. through-hole diameters smaller 50 μm in thin glass. Critical for applications with minimum micro cracks and maximum performance is an appropriate distribution of laser pulses over the work piece along with optimum laser parameters. Laser machining tasks are long aspect micro drilling, slanted through holes, internal contour cuts, micro pockets and more complex geometries in e.g. soda-lime glass, B33, B270, D236T, AF45 and BK7 glass, quartz, and Zerodur.
Orue, Nydia; García, Santos; Feng, Peter; Heredia, Norma
2013-02-01
Fresh cilantro, parsley, and spinach are products that are regularly consumed fresh, but are difficult to decontaminate, as a result, they are common vehicles of transmission of enteropathogenic bacteria. In this study, the efficacy of plant extracts as alternatives for disinfection of cilantro, parsley, and spinach that were artificially contaminated with Salmonella, Escherichia coli O157:H7, and Shigella sonnei was determined. Edible plant extracts obtained using ethanol as the extraction solvent were tested to determine the minimum bactericidal concentration (MBC) and those that exhibited the lowest MBC were selected for further studies. Leaves of fresh greens were washed with sterile water and dried. For seeding, leaves were submerged in suspensions of 2 different concentrations of bacteria (1.5 × 10(8) and 1 × 10(5) ), dried, and then stored at 4 °C until use. To determine the effects of the extracts, inoculated leafy greens were submerged in a container and subjected to treatments with chlorine, Citrol®, or selected plant extracts. Each treatment type was stored at 4 °C for 0, 1, 5, and 7 d, and the bacterial counts were determined. From the 41 plant extracts tested, the extracts from oregano leaves and from the peel and pulp of limes were found to be as effective as chlorine or Citrol® in reducing by > 2 logs, the population of pathogenic bacteria on leafy greens and therefore, may be a natural and edible alternative to chemicals to reduce the risk of Salmonella, E. coli O157:H7 and S. sonnei contamination on leafy vegetables. The antimicrobial efficacy of the extracts of Mexican lime and oregano was clearly demonstrated on cilantro, parsley, and spinach. The extracts of Mexican lime and oregano provide alternatives to chlorine to significantly reduce bacterial pathogens that have been associated with outbreaks from contaminated leafy green vegetables. A simple, low cost, and labor-saving extraction system for production of the extracts was used. © 2013 Institute of Food Technologists®
González-Alcaraz, María Nazaret; Conesa, Héctor Miguel; Álvarez-Rogel, José
2013-10-15
Wetlands are highly effective systems in removing large amounts of N from waters, preventing eutrophication processes. However, when wetlands are polluted by metal-mine wastes their capacity to act as green filters may be diminished. The objective of this study was to evaluate the effect of liming and plants (Sarcocornia fruticosa and Phragmites australis) on the removal of NO3(-) from eutrophic water in slightly acidic, wetland soils polluted by metal-mine wastes. Simulated soil profiles were constructed and six treatments were assayed: (1) no liming + no plant, (2) no liming + S. fruticosa, (3) no liming + P. australis, (4) liming + no plant, (5) liming + S. fruticosa and (6) liming + P. australis. Three horizons were differentiated: A (never under water), C1 (alternating flooding-drying conditions) and C2 (always under water). The eutrophic water used to flood the soil profiles was enriched in N and organic carbon (pH ~ 7.5, electrical conductivity ~ 11 dS m(-1), NO3(-) ~ 234 mg L(-1) and dissolved organic carbon ~ 106 mg L(-1)). The pH, Eh and concentrations of dissolved organic carbon (DOC), N-NO3(-) and N-NH4(+) were measured regularly for 18 weeks. Liming stimulated the growth of plants, especially for S. fruticosa (20-fold more plant biomass than without liming), increased the soil pH and favoured the decline of the Eh values, enhancing the removal of NO3(-) via denitrification. Of all the treatments assayed, liming + S. fruticosa was the only treatment that removed almost completely the high concentration of NO3(-) from the eutrophic flooding water, reaching ~1 mg L(-1) N-NO3(-) at the end of the experiment, at all depths. The higher content of DOC in the pore water of this treatment could explain this behaviour, since more labile carbon was available to the soil microorganisms in the rhizosphere, favouring NO3(-) removal through denitrification processes. However, the treatment liming + P. australis (2-fold more plant biomass that without liming) did not remove completely the high concentrations of NO3(-) from the eutrophic water, except in the C2 horizon - which was permanently under water. Hence, our results show that the effectiveness of liming, regarding the removal of NO3(-) from eutrophic flooding water in wetland soils polluted by metal-mine wastes, depends on the presence of plants, their growth and the production of organic compounds in the rhizospheric environment. Copyright © 2013 Elsevier Ltd. All rights reserved.
Mechanical-physical experimental tests on lime mortars and bricks reinforced with hemp
NASA Astrophysics Data System (ADS)
Formisano, Antonio; Dessı, Enzo; Landolfo, Raffaele
2017-11-01
Hemp is an agricultural product used for various applications. In the Civil Engineering field, only a limited use of this natural material, called the "green pig" since exploitation of all its constituent parts is allowed, has been done. For this reason, in the paper an experimental activity on lime mortars and bricks reinforced with hemp components has been performed. Compression and bending tests have been carried out on specimens manufactured with hemp shives and fibres, respectively. The achieved results have shown that hemp products change the failure modes from brittle to ductile, leaving basically unaltered the strength capacity of reinforced specimens with respect to unreinforced ones.
40 CFR 141.66 - Maximum contaminant levels for radionuclides.
Code of Federal Regulations, 2010 CFR
2010-07-01
... quality range andconsiderations. 1 1. Ion exchange (IE) (a) Intermediate All ground waters. 2. Point of.... Lime softening (d) Advanced All waters. 6. Green sand filtration (e) Basic. 7. Co-precipitation with Barium sulfate (f) Intermediate to Advanced Ground waters with suitable water quality. 8. Electrodialysis...
NASA Astrophysics Data System (ADS)
Heinz, M.; Dubiel, M.; Meinertz, J.; Ihlemann, J.; Hoell, A.
2017-02-01
In this study, plasmonic Au and Au/Ag nanostructures in soda-lime-silicate glasses have been generated by means of ArF-excimer laser irradiation (193 nm) below the ablation threshold of the glass. For this purpose pure and silver/sodium ion-exchanged float glasses have been coated by gold and then irradiated by the laser. The formation of Au and Au/Ag nanoparticles could be verified by the surface plasmon resonances between 420 and 620 nm, which were obtained by optical spectroscopy. Both, pure Au and Ag particles as well as bimetallic Au/Ag nanoparticles, could be observed by means of small angle X-ray scattering experiments. These results demonstrate that such procedures enable the spaceselected generation of plasmonic nanostructures in glass surfaces by excimer laser irradiation.
Physical properties of collagen fibrous networks derived from bovine hides
USDA-ARS?s Scientific Manuscript database
The hides and leather industry has been facing a serious challenge in the disposal of solid wastes such as trimmings and lime-splits. One strategy to solve this problem is to convert these wastes into useful fibrous products and green composites. Therefore research is needed to investigate the pre...
Heat transfer studies. Quarterly report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boehm, R.; Chen, Y.; Izzeldin, A.
The experiments on determination of the wavelength corresponding to the equality of the refractive indices and how this varies with temperature have been completed. This was accomplished using the calibration setup of a 2-inch-long test cell filled with 2 mm diameter soda-lime glass beads. Some good images result, but these are not very clear. Therefore, a 1-inch long test cell has now been built. The modified test cell is shown. A 30-gauge type K thermocouple is placed at the center inside the test cell. A model 450 AET Omega thermocouple thermometer is used to indicate the temperature from the thermocouple.more » A polyurethane foam insulator covered the test cell circular wall to approximate an adiabatic condition. The organic chemical liquid and glass beads are heated up by the mica band heater. A variable transformer is used to the control power to the heater and, thus, the temperature in the cell. The temperature is slowly increased from ambient to try to maintain a generally homogeneous temperature inside the cell. If the indices of refraction of the glass beads and the organic liquid are the same, the image of glass beads then can be found. Chlorobenzene (C{sub 6}H{sub 5}Cl) with a refractive index of about 1.52 at 25{degrees}C (boiling point of 131.6{degrees}C), has been used as the organic chemical liquid. A 5 W argon-ion laser has been used as the light source to visualize the image generated by the Christiansen effect. Two optical grade prisms are used to separate the three wavelengths (green, teal, and blue) of the beam. 80 {mu}m and 200 {mu}m apertures are used to select a single wavelength portion of the beam (either 488 nm blue or 514.5 nm green).« less
Zolotovskaya, S A; Tyrk, M A; Stalmashonak, A; Gillespie, W A; Abdolvand, A
2016-10-28
Spherical silver nanoparticles (NPs) of 30 nm diameter embedded in soda-lime glass were uniformly reshaped (elongated) after irradiation by a linearly polarised 250 fs pulsed laser operating within the NPs' surface plasmon resonance band. We observed second harmonic generation (SHG) and multiphoton-absorption-induced luminescence (MAIL) in the embedded laser-reshaped NPs upon picosecond (10 ps) pulsed laser excitation at 1064 nm. A complementary study of SHG and MAIL was conducted in soda-lime glass containing embedded, mechanically-reshaped silver NPs of a similar elongation ratio (aspect ratio) to the laser-reshaped NPs. This supports the notion that the observed difference in SHG and MAIL in the studied nanocomposite systems is due to the shape modification mechanism. The discrete dipole approximation method was used to assess the absorption and scattering cross-sections of the reshaped NPs with different elongation ratios.
Mubarak, Zaki; Soraya, Cut
2018-01-01
Background: The objective of the present study was to evaluate the acid tolerance response and pH adaptation when Enterococcus faecalis interacted with extract of lime ( Citrus aurant iifolia ). Methods : We used E. faecalis ATCC 29212 and lime extract from Aceh, Indonesia. The microbe was analyzed for its pH adaptation, acid tolerance response, and adhesion assay using a light microscope with a magnification of x1000. Further, statistical tests were performed to analyze both correlation and significance of the acid tolerance and pH adaptation as well as the interaction activity. Results : E. faecalis was able to adapt to a very acidic environment (pH 2.9), which was characterized by an increase in its pH (reaching 4.2) at all concentrations of the lime extract (p < 0.05). E. faecalis was also able to provide acid tolerance response to lime extract based on spectrophotometric data (595 nm) (p < 0.05). Also, the interaction activity of E. faecalis in different concentrations of lime extract was relatively stable within 6 up to 12 hours (p < 0.05), but it became unstable within 24-72 hours (p > 0.05) based on the mass profiles of its interaction activity. Conclusions : E. faecalis can adapt to acidic environments (pH 2.9-4.2); it is also able to tolerate acid generated by Citrus auranti ifolia extract, revealing a stable interaction in the first 6-12 hours.
40 CFR 142.65 - Variances and exemptions from the maximum contaminant levels for radionuclides.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Raw water quality range &considerations 1 1. Ion exchange (IE) (a) Intermediate All ground waters. 2...-filtration. 5. Lime softening (d) Advanced All waters. 6. Green sand filtration (e) Basic. 7. Co-precipitation with barium sulfate (f) Intermediate to Advanced Ground waters with suitable water quality. 8...
Quantification of Confocal Images Using LabVIEW for Tissue Engineering Applications
Sfakis, Lauren; Kamaldinov, Tim; Larsen, Melinda; Castracane, James
2016-01-01
Quantifying confocal images to enable location of specific proteins of interest in three-dimensional (3D) is important for many tissue engineering (TE) applications. Quantification of protein localization is essential for evaluation of specific scaffold constructs for cell growth and differentiation for application in TE and tissue regeneration strategies. Although obtaining information regarding protein expression levels is important, the location of proteins within cells grown on scaffolds is often the key to evaluating scaffold efficacy. Functional epithelial cell monolayers must be organized with apicobasal polarity with proteins specifically localized to the apical or basolateral regions of cells in many organs. In this work, a customized program was developed using the LabVIEW platform to quantify protein positions in Z-stacks of confocal images of epithelial cell monolayers. The program's functionality is demonstrated through salivary gland TE, since functional salivary epithelial cells must correctly orient many proteins on the apical and basolateral membranes. Bio-LabVIEW Image Matrix Evaluation (Bio-LIME) takes 3D information collected from confocal Z-stack images and processes the fluorescence at each pixel to determine cell heights, nuclei heights, nuclei widths, protein localization, and cell count. As a demonstration of its utility, Bio-LIME was used to quantify the 3D location of the Zonula occludens-1 protein contained within tight junctions and its change in 3D position in response to chemical modification of the scaffold with laminin. Additionally, Bio-LIME was used to demonstrate that there is no advantage of sub-100 nm poly lactic-co-glycolic acid nanofibers over 250 nm fibers for epithelial apicobasal polarization. Bio-LIME will be broadly applicable for quantification of proteins in 3D that are grown in many different contexts. PMID:27758134
Quantification of Confocal Images Using LabVIEW for Tissue Engineering Applications.
Sfakis, Lauren; Kamaldinov, Tim; Larsen, Melinda; Castracane, James; Khmaladze, Alexander
2016-11-01
Quantifying confocal images to enable location of specific proteins of interest in three-dimensional (3D) is important for many tissue engineering (TE) applications. Quantification of protein localization is essential for evaluation of specific scaffold constructs for cell growth and differentiation for application in TE and tissue regeneration strategies. Although obtaining information regarding protein expression levels is important, the location of proteins within cells grown on scaffolds is often the key to evaluating scaffold efficacy. Functional epithelial cell monolayers must be organized with apicobasal polarity with proteins specifically localized to the apical or basolateral regions of cells in many organs. In this work, a customized program was developed using the LabVIEW platform to quantify protein positions in Z-stacks of confocal images of epithelial cell monolayers. The program's functionality is demonstrated through salivary gland TE, since functional salivary epithelial cells must correctly orient many proteins on the apical and basolateral membranes. Bio-LabVIEW Image Matrix Evaluation (Bio-LIME) takes 3D information collected from confocal Z-stack images and processes the fluorescence at each pixel to determine cell heights, nuclei heights, nuclei widths, protein localization, and cell count. As a demonstration of its utility, Bio-LIME was used to quantify the 3D location of the Zonula occludens-1 protein contained within tight junctions and its change in 3D position in response to chemical modification of the scaffold with laminin. Additionally, Bio-LIME was used to demonstrate that there is no advantage of sub-100 nm poly lactic-co-glycolic acid nanofibers over 250 nm fibers for epithelial apicobasal polarization. Bio-LIME will be broadly applicable for quantification of proteins in 3D that are grown in many different contexts.
Failure mode analysis for lime/limestone FGD system. Volume III. Plant profiles. Part 1 of 3
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kenney, S.M.; Rosenberg, H.S.; Nilsson, L.I.O.
1984-08-01
This volume contains plant profiles for: Petersburg 3; Hawthorn 3, 4; La Cygne 1; Jeffry 1, 2; Lawrence 4, 5; Green River 1-3; Cane Run 4, 5; Mill Creek 1, 3; Paddy's Run 6; Clay Boswell 4; Milton R. Young 2; Pleasants 1, 2; and Colstrip 1, 2. (DLC)
Nair, U J; Nair, J; Friesen, M D; Bartsch, H; Ohshima, H
1995-05-01
The habit of betel quid chewing, common in South-East Asia and the South Pacific islands, is causally associated with an increased risk of oral cancer. Reactive oxygen species formed from polyphenolic betel quid ingredients and lime at alkaline pH have been implicated as the agents responsible for DNA and tissue damage. To determine whether hydroxyl radical (HO.) is generated in the human oral cavity during chewing of betel quid, the formation of o- and m-tyrosine from L-phenylalanine was measured. Both o- and m-tyrosine were formed in vitro in the presence of extracts of areca nut and/or catechu, transition metal ions such as Cu2+ and Fe2+ and lime or sodium carbonate (alkaline pH). Omission of any of these ingredients from the reaction mixture significantly reduced the yield of tyrosines. Hydroxyl radical scavengers such as ethanol, D-mannitol and dimethylsulfoxide inhibited the phenylalanine oxidation in a dose-dependent fashion. Five volunteers chewed betel quid consisting of betel leaf, areca nut, catechu and slaked lime (without tobacco). Their saliva, collected after chewing betel quid, contained high concentrations of p-tyrosine, but no appreciable amounts of o- or m-tyrosine. Saliva samples from the same subjects after chewing betel quid to which 20 mg phenylalanine had been added contained o- and m-tyrosine at concentrations ranging from 1010 to 3000 nM and from 1110 to 3140 nM respectively. These levels were significantly higher (P < 0.005) than those of subjects who kept phenylalanine in the oral cavity without betel quid, which ranged from 14 to 70 nM for o-tyrosine and from 10 to 35 nM for m-tyrosine. These studies clearly demonstrate that the HO. radical is formed in the human oral cavity during betel quid chewing and is probably implicated in the genetic damage that has been observed in oral epithelial cells of chewers.
Employing natural reagents from turmeric and lime for acetic acid determination in vinegar sample.
Supharoek, Sam-Ang; Ponhong, Kraingkrai; Siriangkhawut, Watsaka; Grudpan, Kate
2018-04-01
A simple, rapid and environmentally friendly sequential injection analysis system employing natural extract reagents was developed for the determination of acetic acid following an acid-base reaction in the presence of an indicator. Powdered lime and turmeric were utilized as the natural base and indicator, respectively. Mixing lime and turmeric produced an orange to reddish-brown color solution which absorbed the maximum wavelength at 455 nm, with absorbance decreasing with increasing acetic acid concentration. Influential parameters including lime and turmeric concentrations, reagent and sample aspirated volumes, mixing coil length and dispensing flow rate were investigated and optimized. A standard calibration graph was plotted for 0-5.0 mmol/L acetic acid with r 2 = 0.9925. Relative standard deviations (RSD) at 2.0 and 4.0 mmol/L acetic acid were less than 3% (n = 7), with limit of detection (LOD) and limit of quantification (LOQ) at 0.12 and 0.24 mmol/L, respectively. The method was successfully applied to assay acetic acid concentration in cooking vinegar samples. Results achieved were not significantly different from those obtained following a batchwise standard AOAC titration method. Copyright © 2017. Published by Elsevier B.V.
Wang, Yuguang; Huang, Ying-Ying; Wang, Yong; Lyu, Peijun; Hamblin, Michael R
2017-08-10
We previously showed that blue (415 nm) and green (540 nm) wavelengths were more effective in stimulating osteoblast differentiation of human adipose-derived stem cells (hASC), compared to red (660 nm) and near-infrared (NIR, 810 nm). Intracellular calcium was higher after blue/green, and could be inhibited by the ion channel blocker, capsazepine. In the present study we asked what was the effect of these four wavelengths on proliferation of the hASC? When cultured in proliferation medium there was a clear difference between blue/green which inhibited proliferation and red/NIR which stimulated proliferation, all at 3 J/cm 2 . Blue/green reduced cellular ATP, while red/NIR increased ATP in a biphasic manner. Blue/green produced a bigger increase in intracellular calcium and reactive oxygen species (ROS). Blue/green reduced mitochondrial membrane potential (MMP) and lowered intracellular pH, while red/NIR had the opposite effect. Transient receptor potential vanilloid 1 (TRPV1) ion channel was expressed in hADSC, and the TRPV1 ligand capsaicin (5uM) stimulated proliferation, which could be abrogated by capsazepine. The inhibition of proliferation caused by blue/green could also be abrogated by capsazepine, and by the antioxidant, N-acetylcysteine. The data suggest that blue/green light inhibits proliferation by activating TRPV1, and increasing calcium and ROS.
Kim, Sang Woo; Hui, Bang Jae; Bae, Dong-Sik
2008-02-01
Anomalous absorption of isolated silver nanoparticulate films with different morphological patterns prepared by the wet colloidal route and followed by thermal treatment were investigated. A polymer embedded silver nanoparticulate film thermally treated at 200 degrees C showed maximum absorbance at approximately 412 nm. The peak position of the surface plasmon band was slightly different but still consistent with theoretical prediction derived by the Mie theory. An isolated nanopariculate film thermally treated at 300 degrees C showed anomalous absorption. Its maximum absorption band was shifted to green regime of 506.9 nm and the bandwidth at half-maximum absorbance of the surface plasmon band was greatly broadened. The plasmon band and its bandwidth were much deviated compared to the theoretical prediction calculated for the silver nanoparticles in the surrounding medium of air and poly(vinyl pyrrolidone) or soda-lime-silica glass. Even though there was no significant growth of silver nanoparticles during thermal treatment at 300 degrees C, the anomalous absorption was observed. The anomalous absorption was not attributed to effects of particle shape and size but to effects of pores induced by development of a great number of pores in the nanoparticulate film. The anomalous absorption greatly decreased with increase in heating temperature from 400 degrees C to 500 degrees C. The extraordinary plasmon damping of the isolated film decreased and the plasmon absorption band was re-shifted to violet regime of 416 nm because of large decrease in size of particles with dramatic change of pore morphology from circular pores with rim to small continuous pores induced by spontaneous formation of new silver nanoparticles.
Structural quality of on Oxisol in recovery for 18 years
NASA Astrophysics Data System (ADS)
dos Santos Batista Bonini, C.; Alves, M. C.; Marchini, D. C.; Garcia de Arruda, O.; Nilce Souto Filho, S.
2012-04-01
Incorrect use of soil and large buildings construction in rural areas are causing changes to it, making them less productive and thus increasing the degraded areas. Techniques aimed at ecological restoration of degraded soils have been investigated. In this sense we investigated the positive changes in the structural quality of a soil that was beheaded in human intervention techniques for recovery for 18 years, having been used green manures, gypsum and pasture. The studied area is located in Mato Grosso do Sul, Brazil. The experimental design was a completely randomized with seven treatments and four replications. The treatments were: control (tilled soil without culture); Stizolobium aterrium; Cajanus cajan; lime+S. aterrimum; lime+C. cajan; lime+gypsum+S. aterrimum; lime+gypsum+C. cajan. In 1994, all treatments with C. cajan were replaced by Canavalia ensiformis and in 1999, Brachiaria decumbens was implanted in all treatments. Data from vegetated treatments were compared with the control bare soil and native vegetation (savannah). We evaluated the distribution and aggregate stability in water, soil samples were collected in 2010 in the depths: 0.00-0.10; 0.10-0.20 and 0,20-0.40 m. The results were analyzed by analysis of variance, following Scott-Knott test (5%) of probability to compare averages. Evaluating the results is noted that in the depth of 0.00-0.10 m, the control bare soil and savannah soil had lower and higher DMP, respectively. All recovery treatments were DMP greater than found for the bare soil control. Treatments: S. aterrimum, lime + gypsum + C. cajan and lime + gypsum + S. aterrimum and the savannah control were similar in the depth of 0.00-0.10 m. All of the recovery treatment in the depth from 0.00-0.10 m with values is close to the native vegetation of the savannah. Depths of 0.10-0.20 and 0.20-0.40 m results obtained for DMP treatments in recovery are similar to the bare soil, except for treatments with S. aterrimum and lime + gypsum + S. aterrimum that had values were similar to the savannah control. This behavior shows that the recovery of soil treatments were eficient only the superficial layer soil and other depths in the structure is still in recovery. It is concluded that the recovery treatment have positively influenced the structure quality in the 0.00-0.10 m depth : the recovery treatment with S. aterrimum and lime + gypsum + S. aterrimum were the most promising in the recovery structural quality.
NASA Astrophysics Data System (ADS)
Sugumaran, Sathish; Jamlos, Mohd Faizal; Ahmad, Mohd Noor; Bellan, Chandar Shekar; Sivaraj, Manoj
2016-08-01
Indium zinc oxide (InZnO) thin films with thicknesses of 100 nm and 200 nm were deposited on glass plate by thermal evaporation technique. Fourier transform infrared spectra showed a strong metal-oxide bond. X-ray diffraction patterns revealed amorphous nature for as-deposited film whereas polycrystalline structure for annealed films. Scanning electron microscope images showed a uniform distribution of spherical shape grains. Grain size was found to be higher for 200 nm film than 100 nm film. The presence of elements (In, Zn and O) was confirmed from energy dispersive X-ray analysis. Photoluminescence study of 200 nm film showed a blue, blue-green and blue-yellow emission whereas 100 nm film showed a broad green and green-yellow emissions. Both 100 nm and 200 nm films showed good oxygen sensitivity from room temperature to 400 °C. The observed optical and sensor results indicated that the prepared InZnO films are highly potential for room temperature gas sensor and blue, green and yellow emissive opto-electronic devices.
Code of Federal Regulations, 2013 CFR
2013-07-01
... Aerospace Challenge Sport Rocket Launch; Muskegon, MI—(i) Location. All waters of Muskegon Lake, near the...) Celebrate De Pere; De Pere, WI—(i) Location. All waters of the Fox River, near Voyageur Park, within the arc...) International Bayfest; Green Bay, WI—(i) Location. All waters of the Fox River, near the Western Lime Company 1...
Code of Federal Regulations, 2012 CFR
2012-07-01
... Aerospace Challenge Sport Rocket Launch; Muskegon, MI. (i) Location. All waters of Muskegon Lake, near the... Pere, WI. (i) Location. All waters of the Fox River, near Voyageur Park, within the arc of a circle... Bayfest; Green Bay, WI. (i) Location. All waters of the Fox River, near the Western Lime Company 1.13...
40 CFR 180.515 - Carfentrazone-ethyl; tolerances for residues.
Code of Federal Regulations, 2014 CFR
2014-07-01
..., green 0.10 Corn, field, forage 0.20 Corn, sweet, forage 0.20 Corn, sweet, kernel plus cob with husk... Shellfish 0.30 Sorghum, forage 0.20 Sorghum, grain 0.25 Sorghum, sweet 0.10 Soursop 0.10 Soybean, seed 0.10 Spanish lime 0.10 Star apple 0.10 Starfruit 0.10 Stevia 0.10 Strawberry 0.10 Strawberrypear 0.10 Sugar...
Federal Register 2010, 2011, 2012, 2013, 2014
2012-04-10
... 7 p.m. (2) Michigan Aerospace Challenge Sport Rocket Launch; Muskegon, MI. (i) Location. All waters... Saturday of May; 8 a.m. to 5 p.m. (5) Celebrate De Pere; De Pere, WI. (i) Location. All waters of the Fox...; Green Bay, WI. (i) Location. All waters of the Fox River, near the Western Lime Company 1.13 miles above...
Code of Federal Regulations, 2014 CFR
2014-07-01
... Challenge Sport Rocket Launch Muskegon, MI. All waters of Muskegon Lake, near the West Michigan Dock and... 5 p.m. (4) Celebrate De Pere De Pere, WI. All waters of the Fox River, near Voyageur Park, within...) International Bayfest Green Bay, WI. All waters of the Fox River, near the Western Lime Company 1.13 miles above...
NASA Astrophysics Data System (ADS)
Ahmad, Mohd Azmier; Afandi, Nur Syahidah; Bello, Olugbenga Solomon
2017-05-01
This study investigates the adsorptive removal of malachite green (MG) dye from aqueous solutions using chemically modified lime-peel-based activated carbon (LPAC). The adsorbent prepared was characterized using FTIR, SEM, Proximate analysis and BET techniques, respectively. Central composite design (CCD) in response surface methodology (RSM) was used to optimize the adsorption process. The effects of three variables: activation temperature, activation time and chemical impregnation ratio (IR) using KOH and their effects on percentage of dye removal and LPAC yield were investigated. Based on CCD design, quadratic models and two factor interactions (2FI) were developed correlating the adsorption variables to the two responses. Analysis of variance (ANOVA) was used to judge the adequacy of the model. The optimum conditions of MG dye removal using LPAC are: activation temperature (796 °C), activation time (1.0 h) and impregnation ratio (2.6), respectively. The percentage of MG dye removal obtained was 94.68 % resulting in 17.88 % LPAC yield. The percentage of error between predicted and experimental results for the removal of MG dye is 0.4 %. Model prediction was in good agreement with experimental results and LPAC was found to be effective in removing MG dye from aqueous solution.
Laser diode and pumped Cr:Yag passively Q-switched yellow-green laser at 543 nm
NASA Astrophysics Data System (ADS)
Yao, Y.; Ling, Zhao; Li, B.; Qu, D. P.; Zhou, K.; Zhang, Y. B.; Zhao, Y.; Zheng, Q.
2013-03-01
Efficient and compact yellow green pulsed laser output at 543 nm is generated by frequency doubling of a passively Q-switched end diode-pumped Nd:YVO4 laser at 1086 nm under the condition of sup-pressing the higher gain transition near 1064 nm. With 15 W of diode pump power and the frequency doubling crystal LBO, as high as 1.58 W output power at 543 nm is achieved. The optical to optical conversion efficiency from the corresponding Q-switched fundamental output to the yellow green output is 49%. The peak power of the Q-switched yellow green pulse laser is up to 30 kW with 5 ns pulse duration. The output power stability over 8 hours is better than 2.56% at the maximum output power. To the best of our knowledge, this is the highest watt-level laser at 543 nm generated by frequency doubling of a passively Q-switched end diode pumped Nd:YVO4 laser at 1086 nm.
Peculiarities of non-autoclaved lime wall materials production using clays
NASA Astrophysics Data System (ADS)
Volodchenko, A. A.; Lesovik, V. S.; Cherepanova, I. A.; Volodchenko, A. N.; Zagorodnjuk, L. H.; Elistratkin, M. Y.
2018-03-01
At present, the development and implementation of energy saving technologies for building materials production, which correspond to modern trends of «green» technologies, become ever more popular. One of the most widely spread wall materials today is a lime brick and stones. The primary raw goods used in production of such materials are quarziferous rocks. However, they have some disadvantages, including low strength index at the intermediate phase of their production, especially in case with a raw brick, which is an issue in the production of high-hollow goods due to low strength index of raw materials and the nonoptimal matrix structure. The conducted experiments confirmed the possibility to control structurization of building composites due to application of nonconventional argillous raw materials. Besides, the material and mineral composition of nonconventional clay rocks ensures the optimal microstructure thus providing for the production of efficient wall building materials via energy saving technology.
Characterization of the enhancement effect of Na2CO3 on the sulfur capture capacity of limestones.
Laursen, Karin; Kern, Arnt A; Grace, John R; Lim, C Jim
2003-08-15
It has been known for a long time that certain additives (e.g., NaCl, CaCl2, Na2CO3, Fe2O3) can increase the sulfur dioxide capture-capacity of limestones. In a recent study we demonstrated that very small amounts of Na2CO3 can be very beneficial for producing sorbents of very high sorption capacities. This paper explores what contributes to these significant increases. Mercury porosimetry measurements of calcined limestone samples reveal a change in the pore-size from 0.04-0.2 microm in untreated samples to 2-10 microm in samples treated with Na2CO3--a pore-size more favorable for penetration of sulfur into the particles. The change in pore-size facilitates reaction with lime grains throughout the whole particle without rapid plugging of pores, avoiding premature change from a fast chemical reaction to a slow solid-state diffusion controlled process, as seen for untreated samples. Calcination in a thermogravimetric reactor showed that Na2CO3 increased the rate of calcination of CaCO3 to CaO, an effect which was slightly larger at 825 degrees C than at 900 degrees C. Peak broadening analysis of powder X-ray diffraction data of the raw, calcined, and sulfated samples revealed an unaffected calcite size (approximately 125-170 nm) but a significant increase in the crystallite size for lime (approximately 60-90 nm to approximately 250-300 nm) and less for anhydrite (approximately 125-150 nm to approximately 225-250 nm). The increase in the crystallite and pore-size of the treated limestones is attributed to an increase in ionic mobility in the crystal lattice due to formation of vacancies in the crystals when Ca is partly replaced by Na.
Yu, Wenbo; Yang, Jiakuan; Shi, Yafei; Song, Jian; Shi, Yao; Xiao, Jun; Li, Chao; Xu, Xinyu; He, Shu; Liang, Sha; Wu, Xu; Hu, Jingping
2016-05-15
Conditioning sewage sludge with Fenton's reagent could effectively improve its dewaterability. However, drawbacks of conditioning with Fenton's reagent are requirement of acidic conditions to prevent iron precipitation and subsequent neutralization with alkaline additive to obtain the pH of the filtrate close to neutrality. In this study, roles of pH were thoroughly investigated in the acidification pretreatment, Fenton reaction, and the final filtrate after conditioning. Through the response surface methodology (RSM), the optimal dosages of H2SO4, Fe(2+), H2O2, and lime acted as a neutralizer were found to be 0 (no acidification), 47.9, 34.3 and 43.2 mg/g DS (dry solids). With those optimal doses, water content of the dewatered sludge cakes could be reduced to 55.8 ± 0.6 wt%, and pH of the final filtrate was 6.6 ± 0.2. Fenton conditioning without initial acidification can simplify the conditioning process and reduce the usage of lime. The Fe(3+) content in the sludge cakes showed a close correlation with the dewaterability of conditioned sludge, i.e., the water content of sludge cakes, SRF (specific resistance to filtration), CST (capillary suction time), bound water content, and specific surface area. It indicated that the coagulation by Fe(3+) species in Fenton reaction could play an important role, compared to traditional Fenton oxidation effect on sludge conditioning. Thus, a two-step mechanism of Fenton oxidation and Fe(III) coagulation was proposed in sewage sludge conditioning. The mechanisms include the following: (1) extracellular polymeric substances (EPS) were firstly degraded into dissolved organics by Fenton oxidation; (2) bound water was converted to free water due to degradation of EPS; (3) the sludge particles were disintegrated into small ones by oxidation; (4) Fe(3+) generated from Fenton reaction acted as a coagulant to agglomerate smaller sludge particles into larger dense particles with less bond water; (5) finally, the dewatered sludge cakes were obtained, with less small pores (1-10 nm) that contributed to water affinity, but with more large pores (>10 nm) that contributed to a permeable, rigid lattice structure. Morphology of the Fenton-conditioned sludge cake exhibited a porous structure. The estimated cost of the composite conditioner, Fenton's reagent and lime, is USD$ 43.8/t DS, which is less than that of ferric chloride and lime (USD$ 54/t DS). Furthermore, pH of the final filtrate using this composite conditioner is about 6.6. Comparatively, that using ferric chloride and lime is as high as 12.4. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wiltschko, Roswitha; Dehe, Lars; Gehring, Dennis; Thalau, Peter; Wiltschko, Wolfgang
2013-01-01
When magnetic compass orientation of migratory robins was tested, the birds proved well oriented under low intensity monochromatic light of shorter wavelengths up to 565 nm green; from 583 nm yellow onward, they were disoriented. In the present study, we tested robins under bichromatic lights composed (1) of 424 nm blue and 565 nm green and (2) of 565 nm green and 583 nm yellow at two intensities. Under dim blue-green light with a total quantal flux of ca. 8 × 10(15)quanta/sm(2), the birds were well oriented in their migratory direction by their inclination compass; under blue-green light of twice this intensity, their orientation became axial. In both cases, the magnetic directional information was mediated by the radical pair processes in the eye. When green and yellow light were combined, however, the nature of the behavior changed. Under green-yellow light of the higher intensity, the birds showed a 'fixed direction' response that was polar, no longer controlled by the normal inclination compass; under dim green-yellow light, the response became axial. Under these two light conditions, the respective directional information was mediated by the magnetite-based receptors in the skin of the upper beak. Apparently, yellow light leads to a change from one magnetoreception system to the other. How this change is effected is still unknown; it appears to reflect complex interactions between the visual and the two magnetoreception systems. Copyright © 2012 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tuchina, E S; Tuchin, Valerii V; Khlebtsov, B N
2011-04-30
The effect of IR laser radiation ({lambda} = 805 - 808 nm) on the bacteria of the strain Staphylococcus aureus 209 P, incubated in indocyanine green solutions, is studied, as well as that of colloid gold nanoshells, nanocages and their conjugates with indocyanine green. It is found that the S. aureus 209 P cells are equally subjected to the IR laser radiation ({lambda} = 805 nm) after preliminary sensitisation with indocyanine green and gold nanoparticles separately and with conjugates of nanoparticles and indocyanine green. The enhancement of photodynamic and photothermal effects by 5 % is observed after 30 min ofmore » laser illumination ({lambda} = 808 nm) of bacteria, treated with conjugates of indocyanine green and nanocages. (optical technologies in biophysics and medicine)« less
NASA Astrophysics Data System (ADS)
Lindstrom, Erik Vilhelm Mathias
Gasification of black liquor could drastically increase the flexibility and improve the profit potential of a mature industry. The completed work was focused on research around the economics and benefits of its implementation, utilizing laboratory pulping experiments and process simulation. The separation of sodium and sulfur achieved through gasification of recovered black liquor, can be utilized in processes like modified continuous cooking, split sulfidity and green liquor pretreatment pulping, and polysulfide-anthraquinone pulping, to improve pulp yield and properties. Laboratory pulping protocols have been developed for these modified pulping technologies and different process options evaluated. The process simulation work around BLG has led to the development of a WinGEMS module for the low temperature MTCI steam reforming process, and case studies comparing a simulated conventional kraft process to different process options built around the implementation of a BLG unit operation into the kraft recovery cycle. Pulp yield increases of 1-3% points with improved product quality, and the potential for capital and operating cost savings relative to the conventional kraft process have been demonstrated. Process simulation work has shown that the net variable operating cost for a pulping process using BLGCC is highly dependent on the cost of lime kiln fuel and the selling price of green power to the grid. Under the assumptions taken in the performed case study, the BLGCC process combined with split sulfidity or PSAQ pulping operations had net variable operating cost 2-4% greater than the kraft reference. The influence of the sales price of power to the grid is the most significant cost factor. If a sales price increase to 6 ¢/KWh for green power could be achieved, cost savings of about $40/ODtP could be realized in all investigated BLG processes. Other alternatives to improve the process economics around BLG would be to modify or eliminate the lime kiln unit operations, utilizing high sulfidity green liquor pretreatment, PSAQ with auto-causticization, or converting the process to mini-sulfide sulfite-AQ.
Gabhane, Jagdish; William, S P M Prince; Bidyadhar, Rajnikant; Bhilawe, Priya; Anand, Duraisamy; Vaidya, Atul N; Wate, Satish R
2012-06-01
The effect of various additives such as fly ash, phosphogypsum, jaggery, lime, and polyethylene glycol on green waste composting was investigated through assessing their influence on microbial growth, enzymatic activities, organic matter degradation, bulk density, quality of finished compost including gradation test, heavy metal analysis, etc. A perusal of results showed that addition of jaggery and polyethylene glycol were helpful to facilitate composting process as they significantly influenced the growth of microbes and cellulase activity. The quality of finished compost prepared from jaggery and polyethylene glycol added treatments were superior to other composts, wherein reduction in C/N ratio was more than 8% in jaggery treatment. All other parameters of compost quality including gradation test also favored jaggery and polyethylene glycol as the best additives for green waste composting. Copyright © 2012 Elsevier Ltd. All rights reserved.
Mudgil, A V; To, K W; Balachandran, R M; Janigian, R H; Tsiaras, W G
1999-01-01
To determine the optimal wavelength for subconjunctival laser suture lysis. 130 black monofilament 10-0 nylon sutures were sewn subconjunctivally into the bare sclera of enucleated rabbit globes. The lowest energy levels facilitating laser suture lysis were determined for the argon green (514.5 NM), argon blue-green (488.0 NM, 514.5 NM), and krypton red (647.1 NM) wavelengths. In addition, absorption spectroscopy was performed on the suture material and conjunctiva using the Perkin Elmer W/VIS Lambda 2 spectrometer. Krypton red produced the fewest buttonhole defects, and it was also the most efficient energy source for suture lysis (P = 0.0001) under nontenectomized conjunctiva. Absorbance spectra studies revealed peak absorbance at 628 NM for the 10-0 nylon suture material. Based on animal and absorption spectroscopy studies, krypton red may be a safer and more efficient wavelength for subconjunctival laser suture lysis.
Li, Dongyu; Tian, Linlin; Huang, Zhen; Shao, Lexi; Quan, Jun; Wang, Yuxiao
2016-04-01
Hexagonal phase NaLuF4:Yb3+/Er3+ nanorods were synthesized hydrothermally. An analysis of the intense green upconversion emissions at 525 nm and 550 nm in hexagonal phase NaLuF4:Yb3/+Er3+ nanorods under excitation power density of 4.2 W/cm2 available from a diode laser emitting at 976 nm, have been undertaken. Fluorescence intensity ratio (FIR) variation of temperature-sensitive green upconversion emissions at 525 nm and 550 nm in this material was recorded in the physiological range from 295 to 343 K. The maximum sensitivity derived from the FIR technique of the green upconversion emissions is approximately 0.0044 K-1. Experimental results implied that hexagonal phase NaLuF4:Yb3/+Er3+ nanorods was a potential candidate for optical temperature sensor.
Study on processing parameters of glass cutting by nanosecond 532 nm fiber laser
NASA Astrophysics Data System (ADS)
Wang, Jin; Gao, Fan; Xiong, Baoxing; Zhang, Xiang; Yuan, Xiao
2018-03-01
The processing parameters of soda-lime glass cutting with several nanosecond 532 nm pulsed fiber laser are studied in order to obtain sufficiently large ablation rate and better processing quality. The influences of laser processing parameters on effective cutting speed and cutting quality of 1 2 mm thick soda-lime glass are studied. The experimental results show that larger laser pulse energy will lead to higher effective cutting speed and larger maximum edge collapse of the front side of the glass samples. Compared with that of 1.1 mm thick glass samples, the 2.0 mm thick glass samples is more difficult to cut. With the pulse energy of 51.2 μJ, the maximum edge collapse is more than 200 μm for the 2.0 mm thick glass samples. In order to achieve the high effective cutting speed and good cutting quality at the same time, the dual energy overlapping method is used to obtain the better cutting performance for the 2.0 mm thick glass samples, and the cutting speed of 194 mm/s and the maximum edge collapse of less than 132 μm are realized.
Individual Differences in Chromatic Brightness Matching.
1984-10-03
very unreliable..." More recently, Boynton (15) has written, "Consider... a 555-nm green light on one side of a bi-partite field with a 4 6 5-nm blue...field immediately adjacent to it... We ask an observer to adjust the intensity of the blue field until it looks ’equally bright’ as the green one. This...clearly being blue, blue- green , green , yellow- green , yellow, and red. Their spectral transmittance curves are shown in Fig. 2. All were broad-band filters
Wezel, Felix; Wendt-Nordahl, Gunnar; Huck, Nina; Bach, Thorsten; Weiss, Christel; Michel, Maurice Stephan; Häcker, Axel
2010-04-01
Several diode laser systems were introduced in recent years for the minimal-invasive surgical therapy of benign prostate enlargement. We investigated the ablation capacities, hemostatic properties and extend of tissue necrosis of different diode lasers at wavelengths of 980, 1,318 and 1,470 nm and compared the results to the 120 W GreenLight HPS laser. The laser devices were evaluated in an ex vivo model using isolated porcine kidneys. The weight difference of the porcine kidneys after 10 min of laser vaporization defined the amount of ablated tissue. Blood loss was measured in blood-perfused kidneys following laser vaporization. Histological examination was performed to assess the tissue effects. The side-firing 980 and 1,470 nm diode lasers displayed similar ablative capacities compared to the GreenLight HPS laser (n.s.). The 1,318-nm laser, equipped with a bare-ended fiber, reached a higher ablation rate compared to the other laser devices (each P < 0.05). A calculated 'output power efficiency per watt' revealed that the 1,318-nm laser with a bare-ended fiber reached the highest rate compared to the side-firing devices (each P < 0.0001). All three diode lasers showed superior hemostatic properties compared to the GreenLight HPS laser (each P < 0.01). The extend of morphological tissue necrosis was 4.62 mm (1,318 nm), 1.30 mm (1,470 nm), 4.18 mm (980 nm) and 0.84 mm (GreenLight HPS laser), respectively. The diode lasers offered similar ablative capacities and improved hemostatic properties compared to the 120 W GreenLight HPS laser in this experimental ex vivo setting. The higher tissue penetration of the diode lasers compared to the GreenLight HPS laser may explain improved hemostasis.
Nonlinear refraction properties of nickel oxide thin films at 800 nm
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melo, Ronaldo P. Jr. de; Silva, Blenio J. P. da; Santos, Francisco Eroni P. dos
2009-11-01
Measurements of the nonlinear refractive index, n{sub 2}, of nickel oxide films prepared by controlled oxidation of nickel films deposited on substrates of soda-lime glass are reported. The structure and morphology of the samples were characterized by scanning electron microscopy, atomic force microscopy, and x-ray diffractometry. Samples of excellent optical quality were prepared. The nonlinear measurements were performed using the thermally managed eclipse Z-scan technique at 800 nm. A large value of n{sub 2}approx =10{sup -12} cm{sup 2}/W and negligible nonlinear absorption were obtained.
Miniature solid-state lasers for pointing, illumination, and warning devices
NASA Astrophysics Data System (ADS)
Brown, D. C.; Singley, J. M.; Yager, E.; Kowalewski, K.; Lotito, B.; Guelzow, J.; Hildreth, J.; Kuper, J. W.
2008-04-01
In this paper we review the current status of and progress towards higher power and more wavelength diverse diode-pumped solid-state miniature lasers. Snake Creek Lasers now offers unprecedented continuous wave (CW) output power from 9.0 mm and 5.6 mm TO type packages, including the smallest green laser in the world, the MicroGreen TM laser, and the highest density green laser in the world, the MiniGreen TM laser. In addition we offer an infrared laser, the MiniIR TM, operating at 1064 nm, and have just introduced a blue Mini laser operating at 473 nm in a 9.0 mm package. Recently we demonstrated over 1 W of output power at 1064 nm from a 12 mm TO type package, and green output power from 300-500 mW from the same 12 mm package. In addition, the company is developing a number of other innovative new miniature CW solid-state lasers operating at 750 nm, 820 nm, 458 nm, and an eye-safe Q-switched laser operating at 1550 nm. We also review recently demonstrated combining volume Bragg grating (VBG) technology has been combined with automatic power control (APC) to produce high power MiniGreen TM lasers whose output is constant to +/- 10 % over a wide temperature range, without the use of a thermoelectric cooler (TEC). This technology is expected to find widespread application in military and commercial applications where wide temperature operation is particularly important. It has immediate applications in laser pointers, illuminators, and laser flashlights, and displays.
Choi, Seung-Hwan; Seo, Jeong-Wan; Kim, Ki-Ho
2018-05-03
Acne vulgaris is one of the most common dermatological problems, and its therapeutic options include topical and systemic retinoids and antibiotics. However, increase in problems associated with acne treatment, such as side-effects from conventional agents and bacterial resistance to antibiotics, has led to greater use of photodynamic therapy. The purpose of this study was to compare the bactericidal effects of indocyanine green- and methyl aminolevulinate-based photodynamic therapy on Propionibacterium acnes. P. acnes were cultured under anaerobic conditions; then they were divided into three groups (control, treated with indocyanine green and treated with methyl aminolevulinate) and illuminated with different lights (630-nm light-emitting diode, 805-nm diode laser and 830-nm light-emitting diode). The bactericidal effects were evaluated by comparing each group's colony-forming units. The cultured P. acnes were killed with an 805-nm diode laser and 830-nm light-emitting diode in the indocyanine green group. No bactericidal effects of methyl aminolevulinate-based photodynamic therapy were identified. The clinical efficacy of indocyanine green-based photodynamic therapy in 21 patients was retrospectively analyzed. The Korean Acne Grading System was used to evaluate treatment efficacy, which was significantly decreased after treatment. The difference in the efficacy of the 805-nm diode laser and 830-nm light-emitting diode was not statistically significant. Although the methyl aminolevulinate-based photodynamic therapy showed no bactericidal effect, the indocyanine green-based photodynamic therapy has bactericidal effect and clinical efficacy. © 2018 Japanese Dermatological Association.
Green fiber lasers: An alternative to traditional DPSS green lasers for flow cytometry
Telford, William G.; Babin, Sergey A.; Khorev, Serge V.; Rowe, Stephen H.
2009-01-01
Green and yellow diode-pumped solid state (DPSS) lasers (532 and 561 nm) have become common fixtures on flow cytometers, due to their efficient excitation of phycoerythrin (PE) and its tandems, and their ability to excite an expanding array of expressible red fluorescent proteins. Nevertheless, they have some disadvantages. DPSS 532 nm lasers emit very close to the fluorescein bandwidth, necessitating optical modifications to permit detection of fluorescein and GFP. DPSS 561 nm lasers likewise emit very close to the PE detection bandwidth, and also cause unwanted excitation of APC and its tandems, requiring high levels of crossbeam compensation to reduce spectral overlap into the PE tandems. In this paper, we report the development of a new generation of green fiber lasers that can be engineered to emit in the range between 532 and 561 nm. A 550 nm green fiber laser was integrated into both a BD LSR II™ cuvette and FACSVantage DiVa™ jet-in-air cell sorter. This laser wavelength avoided both the fluorescein and PE bandwidths, and provided better excitation of PE and the red fluorescent proteins DsRed and dTomato than a power-matched 532 nm source. Excitation at 550 nm also caused less incidental excitation of APC and its tandems, reducing the need for crossbeam compensation. Excitation in the 550 nm range therefore proved to be a good compromise between 532 and 561 nm sources. Fiber laser technology is therefore providing the flexibility necessary for precisely matching laser wavelengths to our flow cytometry applications. PMID:19777600
Note: Making tens of centimeter long uniform microfluidic channels using commercial glass pipette
NASA Astrophysics Data System (ADS)
Ou, Neil; Lee, Huang-Ming; Wu, Jong-Ching
2018-03-01
Producing microchannels with diameters between 10 and 20 μm and with lengths in the tens of centimeters is reported. The method can be modified to obtain diameters as narrow as 350 nm. Length-to-diameter aspect ratios that surpass 104 can be produced for a fraction of current production costs. The controllable channel is produced by applying a flame to the narrow end of a commercial pipette that is made from a soda-lime silicate. In combination with a pulling mechanism, applying heat to the composite material lengthens the pipette in a highly uniform way. Given that the materials and methods in this research are cost-effective when compared to femtosecond laser micromachining on 2D silicon-based surfaces, further research into producing microchannels from soda-lime silicates may revolutionize access to 3D controllable microchannels.
Soda-lime-silica glass for radiation dosimetry.
Ezz-Eldin, F M; Abdel-Rehim, F; Abdel-Azim, A A; Ahmed, A A
1994-07-01
The color developed in a commercially available soda-lime-silica glass when subjected to gamma-irradiation and the stability of such radiation-induced color were studied to test its sensitivity to small doses of gamma-rays (0.0-27 kGy). After irradiation, two absorption bands developed at 400 and 620 nm. The former band exhibited a stronger absorption than the later one. The intensity of both bands showed a gradual increase with increasing irradiation dose and a gradual decrease with increasing fading time after irradiation. The development of these bands is associated with the generation of defects at nonbridging oxygen atoms in the glass lattice and hole centers. The results obtained suggest that this glass simulated the Z of compact bone in terms of gamma rays absorption properties over broad radiation spectra (0.1 to 10 MeV).
NASA Astrophysics Data System (ADS)
Shao, Yongni; Xie, Chuanqi; Jiang, Linjun; Shi, Jiahui; Zhu, Jiajin; He, Yong
2015-04-01
Visible/near infrared spectroscopy (Vis/NIR) based on sensitive wavelengths (SWs) and chemometrics was proposed to discriminate different tomatoes bred by spaceflight mutagenesis from their leafs or fruits (green or mature). The tomato breeds were mutant M1, M2 and their parent. Partial least squares (PLS) analysis and least squares-support vector machine (LS-SVM) were implemented for calibration models. PLS analysis was implemented for calibration models with different wavebands including the visible region (400-700 nm) and the near infrared region (700-1000 nm). The best PLS models were achieved in the visible region for the leaf and green fruit samples and in the near infrared region for the mature fruit samples. Furthermore, different latent variables (4-8 LVs for leafs, 5-9 LVs for green fruits, and 4-9 LVs for mature fruits) were used as inputs of LS-SVM to develop the LV-LS-SVM models with the grid search technique and radial basis function (RBF) kernel. The optimal LV-LS-SVM models were achieved with six LVs for the leaf samples, seven LVs for green fruits, and six LVs for mature fruits, respectively, and they outperformed the PLS models. Moreover, independent component analysis (ICA) was executed to select several SWs based on loading weights. The optimal LS-SVM model was achieved with SWs of 550-560 nm, 562-574 nm, 670-680 nm and 705-715 nm for the leaf samples; 548-556 nm, 559-564 nm, 678-685 nm and 962-974 nm for the green fruit samples; and 712-718 nm, 720-729 nm, 968-978 nm and 820-830 nm for the mature fruit samples. All of them had better performance than PLS and LV-LS-SVM, with the parameters of correlation coefficient (rp), root mean square error of prediction (RMSEP) and bias of 0.9792, 0.2632 and 0.0901 based on leaf discrimination, 0.9837, 0.2783 and 0.1758 based on green fruit discrimination, 0.9804, 0.2215 and -0.0035 based on mature fruit discrimination, respectively. The overall results indicated that ICA was an effective way for the selection of SWs, and the Vis/NIR combined with LS-SVM models had the capability to predict the different breeds (mutant M1, mutant M2 and their parent) of tomatoes from leafs and fruits.
Possible utilization of acrylic paint and copper phthalocyanine pigment sludge for vermiculture.
Majumdar, Deepanjan; Buch, Vaidehi; Macwan, Praisy; Patel, Jignesh
2010-05-01
Sludge generated from water treatment plants in two different paint and pigment manufacturing industries, one manufacturing CPC Green (copper phthalocyanine green) and the other acrylic (pure and styrene) washable distempers, synthetic enamels, fillers and putties, were used for culturing earthworms (Eisenia foetida Savigny). The possibility of getting a quality vermicompost was also explored. The sludges were used pure and mixed with month-old cow dung at 1:1, 1:2, 1:3, 2:1 and 3:1 ratios (sludge:cow dung). In pure sludges and in the 3:1 ratio, earthworms did not survive. Earthworms had very low survival in CPC Green sludge and its mixtures while acrylic paint sludge was very efficient in supporting worm growth and worm castings were generated quickly. Both sludges were alkaline, non-saline, but had appreciable Ca, Al, Pb, Zn, and Mn. CPC Green had high Cu (12,900 mg kg(-1)) and acrylic paint sludge had high total Cr (155 mg kg(-1)). High Ca and Al in both came from water treatment chemicals (lime and alum), while CPC Green itself is a copper-based pigment. The sludges were suitable for land application with regard to their metal contents, except for Cu in CPC Green. CPC Green did not support proper growth of plants (green gram, Vigna radiata (L). R. Wilcz.), while acrylic paint sludge supported growth in pure form and mixtures with soil.
Bahama Banks, Tongue of the Ocean, Bahamas
NASA Technical Reports Server (NTRS)
1992-01-01
Most of the Western Bahama Banks, the Tongue of the Ocean and Andros Island (24.0N, 77.0W) as well as north central Cuba with its fringing reefs can be seen in this one view. The green water over the banks is less than 30 ft. deep but the deep blue of the Tongue is 4000 to 6000 ft. deep. All the sediment on the banks, including the material that forms the islands, is calcium carbonate (lime) precipitated from sea water by animals and plants.
Bahama Banks, Tongue of the Ocean, Bahamas
NASA Technical Reports Server (NTRS)
1993-01-01
Most of the Western Bahama Banks, the Tongue of the Ocean and Andros Island (25.0N, 77.0W) as well as north central Cuba with its fringing reefs can be seen in this one view. The green water over the banks is less than 30 ft. deep but the deep blue of the Tongue is 4000 to 6000 ft. deep. All the sediment on the banks, including the material that forms the islands, is calcium carbonate (lime) precipitated from sea water by animals and plants.
Zhang, Hui; Fang, Congcong; Wu, Shijia; Duan, Nuo; Wang, Zhouping
2015-11-15
In this work, a biosensor based on luminescence resonance energy transfer (LRET) from NaYF4:Yb,Tm upconversion nanoparticles (UCNPs) to SYBR Green I has been developed. The aptamers are covalently linked to UCNPs and hybridized with their complementary strands. The subsequent addition of SYBR Green allows SYBR Green I to insert into the formed double-stranded DNA (dsDNA) duplex and brings the energy donor and acceptor into close proximity, leading to the fluorescence of UCNPs transferred to SYBR Green I. When excited at 980 nm, the UCNPs emit luminescence at 477 nm, and this energy is transferred to SYBR Green I, which emits luminescence at 530 nm. In the presence of oxytetracycline (OTC), the aptamers prefer to bind to its corresponding analyte and dehybridize with the complementary DNA. This dehybridization leads to the liberation of SYBR Green I, which distances SYBR Green I from the UCNPs and recovers the UCNPs' luminescence. Under optimal conditions, a linear calibration is obtained between the ratio of I530 to I477 nm (I530/I477) and the OTC concentration, which ranges from 0.1 to 10 ng/ml with a limit of detection (LOD) of 0.054 ng/ml. Copyright © 2015 Elsevier Inc. All rights reserved.
Continuous-wave Nd:YVO4/KTiOPO4 green laser at 542 nm under diode pumping into the emitting level
NASA Astrophysics Data System (ADS)
Liu, J. H.
2012-10-01
We report a green laser at 542 nm generation by intracavity frequency doubling of a continuous wave (CW) laser operation of a 1086 nm Nd:YVO4 laser under 880 nm diode pumping into the emitting level 4 F 3/2. A KTiOPO4 (KTP) crystal, cut for critical type I phase matching at room temperature is used for second harmonic generation of the laser. At an incident pump power of 14.5 W, as high as 1.33 W of CW output power at 542 nm is achieved. The optical-to-optical conversion efficiency is up to 9.2%, and the fluctuation of the green output power was better than 3.8% in the given 30 min.
Estimation of 557.7 nm Emission Altitude using Co-located Lidars and Photometers over Arecibo
NASA Astrophysics Data System (ADS)
Franco, E.; Raizada, S.; Lautenbach, J.; Brum, C. G. M.
2017-12-01
Airglow at 557.7 nm (green line emission) is generated through the Barth mechanism in the E-region altitude and is sometimes associated with red line (630.0 nm) originating at F-region altitudes. Photons at 557.7 nm are produced through the quenching of excited atomic oxygen atoms, O(1S), while 630.0 nm results through the de-excitation of O(1D) atoms. Even though, the contribution of the green line from F-region is negligible and the significant component comes from the mesosphere, this uncertainty gives rise to a question related to its precise altitude. Previous studies have shown that perturbations generated by atmospheric gravity Waves (GWs) alter the airglow intensity and can be used for studying dynamics of the region where it originates. The uncertainty in the emission altitude of green line can be resolved by using co-located lidars, which provide altitude resolved metal densities. At Arecibo, the resonance lidars tuned to Na and K resonance wavelengths at 589 nm and 770 nm can be used in conjunction with simultaneous measurements from green line photometer to resolve this issue. Both photometer and lidars have narrow field of view as compared to airglow imagers, and hence provide an added advantage that these instruments sample same GW spectrum. Hence, correlation between density perturbations inferred from lidars and airglow intensity perturbations can shed light on the exact altitude of green line emission.
Majumder, Santanu; Nath, Bibhash; Sarkar, Simita; Islam, Sk Mijanul; Bundschuh, Jochen; Chatterjee, Debashis; Hidalgo, Manuela
2013-11-15
Solar Oxidation and Removal of Arsenic (SORAS) is a low-cost non-hazardous technique for the removal of arsenic (As) from groundwater. In this study, we tested the efficiency of natural citric acid sources extracted from tomato, lemon and lime to promote SORAS for As removal at the household level. The experiment was conducted in the laboratory using both synthetic solutions and natural groundwater samples collected from As-polluted areas in West Bengal. The role of As/Fe molar ratios and citrate doses on As removal efficiency were checked in synthetic samples. The results demonstrate that tomato juice (as citric acid) was more efficient to remove As from both synthetic (percentage of removal: 78-98%) and natural groundwater (90-97%) samples compared to lemon (61-83% and 79-85%, respectively) and lime (39-69% and 63-70%, respectively) juices. The As/Fe molar ratio and the citrate dose showed an 'optimized central tendency' on As removal. Anti-oxidants, e.g. 'hydroxycinnamates', found in tomato, were shown to have a higher capacity to catalyze SORAS photochemical reactions compared to 'flavanones' found in lemon or lime. The application of this method has several advantages, such as eco- and user- friendliness and affordability at the household level compared to other low-cost techniques. Copyright © 2012 Elsevier B.V. All rights reserved.
Scharf, John Edward
1998-11-03
A reflectance pulse oximeter that determines oxygen saturation of hemoglobin using two sources of electromagnetic radiation in the green optical region, which provides the maximum reflectance pulsation spectrum. The use of green light allows placement of an oximetry probe at central body sites (e.g., wrist, thigh, abdomen, forehead, scalp, and back). Preferably, the two green light sources alternately emit light at 560 nm and 577 nm, respectively, which gives the biggest difference in hemoglobin extinction coefficients between deoxyhemoglobin, RHb, and oxyhemoglobin, HbO.sub.2.
Crook, Damon J; Francese, Joseph A; Zylstra, Kelley E; Fraser, Ivich; Sawyer, Alan J; Bartels, David W; Lance, David R; Mastro, Victor C
2009-12-01
Retinal sensitivity of Agrilus planipennis Fairmaire (Coleoptera: Buprestidae) was examined with an aim to improve trap efficacy for the beetle. Electroretinogram (ERG) recordings from dark-adapted compound eyes of male and female were measured at different wavelengths across the spectrum ranging from 300 to 700 nm. The spectral sensitivity curves revealed peaks in the UV (340 nm), the violet/purple (420-430 nm), blue (460 nm), and green (540-560 nm) regions of the spectrum. Females were sensitive to red regions of the spectrum (640-670 nm), whereas males were not. A spectrophotometer was used to measure the wavelength and reflectance for ash foliage, purple corrugated plastic traps, as well as the elytra and abdomen of adult A. planipennis. Traps were painted using colors based on ERG and spectrophotometer measurements and compared with purple corrugated plastic traps currently used by the USDA-APHIS-PPQ-EAB National Survey. In a field assay conducted along the edges of several A. planipennis-infested ash stands, there were no significant differences in trap catch among green, red, or purple treatments. Dark blue traps caught significantly fewer A. planipennis than red, light green, or dark purple traps. In a second assay where purple and green treatments were placed in the mid canopy of ash trees (approximately 13 m in height), trap catch was significantly higher on green treatments. We hypothesize that when placed in the mid-canopy, green traps constitute a foliage-type stimulus that elicits food-seeking and/or host seeking behavior by A. planipennis.
Hammer, Martin; Königsdörffer, Ekkehart; Liebermann, Christiane; Framme, Carsten; Schuch, Günter; Schweitzer, Dietrich; Strobel, Jürgen
2008-01-01
Post-translational protein modification by lipid peroxidation products or glycation is a feature of aging as well as pathologic processes in postmitotic cells at the ocular fundus exposed to an oxidative environment. The accumulation of modified proteins such as those found in lipofuscin and advanced glycation end products (AGEs) contribute greatly to the fundus auto-fluorescence. The distinct fluorescence spectra of lipofuscin and AGE enable their differentiation in multispectral fundus fluorescence imaging. A dual-centre consecutive case series of 78 pseudo-phacic patients is reported. Digital colour fundus photographs as well as auto-fluorescence images were taken from 33 patients with age related macular degeneration (AMD), 13 patients with diabetic retinopathy (RD), or from 32 cases without pathologic findings (controls). Fluorescence was excited at 475-515 nm or 476-604 nm and recorded in the emission bands 530-675 nm or 675-715 nm, respectively. Fluorescence images excited at 475-515 nm were taken by a colour CCD-camera (colour-fluorescence imaging) enabling the separate recording of green and red fluorescence. The ratio of green versus red fluorescence was calculated within a representative region of each image. The 530-675 nm auto-fluorescence in AMD patients was dominated by the red emission (green vs. red ratio, g/r = 0.861). In comparison, the fluorescence of the diabetics was green-shifted (g/r = 0.946; controls: g/r = 0.869). Atrophic areas (geographic atrophy, laser scars) showed massive hypo-fluorescence in both emission bands. Hyper-fluorescent drusen and exudates, unobtrusive in the colour fundus images as well as in the fluorescence images with emission >667 nm, showed an impressive green-shift in the colour-fluorescence image. Lipofuscin is the dominant fluorophore at long wavelengths (>675 nm or red channel of the colour fluorescence image). In the green spectral region, we found an additional emission of collagen and elastin (optic disc, sclera) as well as deposits in drusen and exudates. The green shift of the auto-fluorescence in RD may be a hint of increased AGE concentrations.
Green light emitting curcumin dye in organic solvents
NASA Astrophysics Data System (ADS)
Mubeen, Mohammad; Deshmukh, Abhay D.; Dhoble, S. J.
2018-05-01
In this modern world, the demand for the white light emission has increased because of its wide applications in various display and lighting devices, sensors etc. This white light can be produced by mixing red, green and blue lights. Thus this green light can be produced from the plant extract i.e., Turmeric. Curcumin is the essential element present in turmeric to generate the green light. The Photoluminescence (PL) emission is observed at 540 nm at 380nm excitation. This method of generating green light is very simple, cost effective and efficient when compared to other methods.
Tyrk, Mateusz A; Zolotovskaya, Svetlana A; Gillespie, W Allan; Abdolvand, Amin
2015-09-07
Radially and azimuthally polarized picosecond (~10 ps) pulsed laser irradiation at 532 nm wavelength led to the permanent reshaping of spherical silver nanoparticles (~30 - 40 nm in diameter) embedded in a thin layer of soda-lime glass. The observed peculiar shape modifications consist of a number of different orientations of nano-ellipsoids in the cross-section of each written line by laser. A Second Harmonic Generation cross-sectional scan method from silver nanoparticles in transmission geometry was adopted for characterization of the samples after laser modification. The presented approach may lead to sophisticated marking of information in metal-glass nanocomposites.
Green high-power tunable external-cavity GaN diode laser at 515 nm.
Chi, Mingjun; Jensen, Ole Bjarlin; Petersen, Paul Michael
2016-09-15
A 480 mW green tunable diode laser system is demonstrated for the first time to our knowledge. The laser system is based on a GaN broad-area diode laser and Littrow external-cavity feedback. The green laser system is operated in two modes by switching the polarization direction of the laser beam incident on the grating. When the laser beam is p-polarized, an output power of 50 mW with a tunable range of 9.2 nm is achieved. When the laser beam is s-polarized, an output power of 480 mW with a tunable range of 2.1 nm is obtained. This constitutes the highest output power from a tunable green diode laser system.
Over 0.5 MW green laser from sub-nanosecond giant pulsed microchip laser
NASA Astrophysics Data System (ADS)
Zheng, Lihe; Taira, Takunori
2016-03-01
A sub-nanosecond green laser with laser head sized 35 × 35 × 35 mm3 was developed from a giant pulsed microchip laser for laser processing on organic superconducting transistor with a flexible substrate. A composite monolithic Y3Al5O12 (YAG) /Nd:YAG/Cr4+:YAG/YAG crystal was designed for generating giant pulsed 1064 nm laser. A fibercoupled 30 W laser diode centered at 808 nm was used with pump pulse duration of 245 μs. The 532 nm green laser was obtained from a LiB3O5 (LBO) crystal with output energy of 150 μJ and pulse duration of 268 ps. The sub-nanosecond green laser is interesting for 2-D ablation patterns.
Shao, Yongni; Xie, Chuanqi; Jiang, Linjun; Shi, Jiahui; Zhu, Jiajin; He, Yong
2015-04-05
Visible/near infrared spectroscopy (Vis/NIR) based on sensitive wavelengths (SWs) and chemometrics was proposed to discriminate different tomatoes bred by spaceflight mutagenesis from their leafs or fruits (green or mature). The tomato breeds were mutant M1, M2 and their parent. Partial least squares (PLS) analysis and least squares-support vector machine (LS-SVM) were implemented for calibration models. PLS analysis was implemented for calibration models with different wavebands including the visible region (400-700 nm) and the near infrared region (700-1000 nm). The best PLS models were achieved in the visible region for the leaf and green fruit samples and in the near infrared region for the mature fruit samples. Furthermore, different latent variables (4-8 LVs for leafs, 5-9 LVs for green fruits, and 4-9 LVs for mature fruits) were used as inputs of LS-SVM to develop the LV-LS-SVM models with the grid search technique and radial basis function (RBF) kernel. The optimal LV-LS-SVM models were achieved with six LVs for the leaf samples, seven LVs for green fruits, and six LVs for mature fruits, respectively, and they outperformed the PLS models. Moreover, independent component analysis (ICA) was executed to select several SWs based on loading weights. The optimal LS-SVM model was achieved with SWs of 550-560 nm, 562-574 nm, 670-680 nm and 705-71 5 nm for the leaf samples; 548-556 nm, 559-564 nm, 678-685 nm and 962-974 nm for the green fruit samples; and 712-718 nm, 720-729 nm, 968-978 nm and 820-830 nm for the mature fruit samples. All of them had better performance than PLS and LV-LS-SVM, with the parameters of correlation coefficient (rp), root mean square error of prediction (RMSEP) and bias of 0.9792, 0.2632 and 0.0901 based on leaf discrimination, 0.9837, 0.2783 and 0.1758 based on green fruit discrimination, 0.9804, 0.2215 and -0.0035 based on mature fruit discrimination, respectively. The overall results indicated that ICA was an effective way for the selection of SWs, and the Vis/NIR combined with LS-SVM models had the capability to predict the different breeds (mutant M1, mutant M2 and their parent) of tomatoes from leafs and fruits. Copyright © 2015 Elsevier B.V. All rights reserved.
Yahuaca-Juárez, B; Martínez-Flores, H E; Huerta-Ruelas, J A; Pless, R C; Vázquez-Landaverde, P A; Tello Santillán, R
2013-03-01
The objective of this work was to evaluate the effect of alkaline cooking on the oxidative stability of oil in corn flour. A central composite design was used to study the combined effect of lime concentration (%) and steep time (h) on peroxide value (PV); specific extinction coefficients at 232 and 270 nm (K232 and K270); and FTIR absorbance at 3009 cm(-1), 3444 cm(-1), and 3530 cm(-1) in oils from corn flour obtained by alkaline cooking. The results indicate that lime concentration and steep time affected the PV, K232, and K270. A decrease of 2.56 % was observed in the IR absorption bands, corresponding to the polyunsaturated fatty acids. The FTIR spectra also showed absorption bands related to the secondary oil oxidation products.
Irradiation-induced Ag-colloid formation in ion-exchanged soda-lime glass
NASA Astrophysics Data System (ADS)
Caccavale, F.; De Marchi, G.; Gonella, F.; Mazzoldi, P.; Meneghini, C.; Quaranta, A.; Arnold, G. W.; Battaglin, G.; Mattei, G.
1995-03-01
Ion-exchanged glass samples were obtained by immersing soda-lime slides in molten salt baths of molar concentration in the range 1-20% AgNO 3 in NaNO 3, at temperatures varying from 320 to 350°C, and processing times of the order of a few minutes. Irradiations of exchanged samples were subsequently performed by using H +m, He +, N + ions at different energies in order to obtain comparable projected ranges. The fluence was varied between 5 × 10 15 and 2 × 10 17 ions/cm 2. Most of the samples were treated at current densities lower than 2 μA/cm 2, in order to avoid heating effects. Some samples were irradiated with 4 keV electrons, corresponding to a range of 250 nm. The formation of nanoclusters of radii in the range 1-10 nm has been observed after irradiation, depending on the treatment conditions. The precipitation process is governed by the electronic energy deposition of incident particles. The most desirable results are obtained for helium implants. The process was characterized by the use of Secondary Ion Mass Spectrometry (SIMS) and nuclear techniques (Rutherford Backscattering (RBS), Nuclear Reactions (NRA)), in order to determine concentration-depth profiles and by optical absorption and Transmission Electron Microscopy (TEM) measurements for the silver nanoclusters detection and size evaluation.
Color transitions in coral's fluorescent proteins by site-directed mutagenesis
Gurskaya, Nadya G; Savitsky, Alexander P; Yanushevich, Yurii G; Lukyanov, Sergey A; Lukyanov, Konstantin A
2001-01-01
Background Green Fluorescent Protein (GFP) cloned from jellyfish Aequorea victoria and its homologs from corals Anthozoa have a great practical significance as in vivo markers of gene expression. Also, they are an interesting puzzle of protein science due to an unusual mechanism of chromophore formation and diversity of fluorescent colors. Fluorescent proteins can be subdivided into cyan (~ 485 nm), green (~ 505 nm), yellow (~ 540 nm), and red (>580 nm) emitters. Results Here we applied site-directed mutagenesis in order to investigate the structural background of color variety and possibility of shifting between different types of fluorescence. First, a blue-shifted mutant of cyan amFP486 was generated. Second, it was established that cyan and green emitters can be modified so as to produce an intermediate spectrum of fluorescence. Third, the relationship between green and yellow fluorescence was inspected on closely homologous green zFP506 and yellow zFP538 proteins. The following transitions of colors were performed: yellow to green; yellow to dual color (green and yellow); and green to yellow. Fourth, we generated a mutant of cyan emitter dsFP483 that demonstrated dual color (cyan and red) fluorescence. Conclusions Several amino acid substitutions were found to strongly affect fluorescence maxima. Some positions primarily found by sequence comparison were proved to be crucial for fluorescence of particular color. These results are the first step towards predicting the color of natural GFP-like proteins corresponding to newly identified cDNAs from corals. PMID:11459517
Microbial lime-mud production and its relation to climate change
Yates, K.K.; Robbins, L.L.; Gerhard, L.C.; Harrison, W.E.; Hanson, B.M.B.
2001-01-01
Microbial calcification has been identified as a significant source of carbonate sediment production in modern marine and lacustrine environments around the globe. This process has been linked to the production of modern whitings and large, micritic carbonate deposits throughout the geologic record. Furthermore, carbonate deposits believed to be the result of cyanobacterial and microalgal calcification suggest that the potential exists for long-term preservation of microbial precipitates and storage of carbon dioxide (CO2). Recent research has advanced our understanding of the microbial-calcification mechanism as a photosynthetically driven process. However, little is known of the effects of this process on inorganic carbon cycling or of the effects of changing climate on microbial-calcification mechanisms.Laboratory experiments on microbial cellular physiology demonstrate that cyanobacteria and green algae can utilize different carbon species for metabolism and calcification. Cyanobacterial calcification relies on bicarbonate (HCO3–)utilization while green algae use primarily CO2. Therefore, depending on which carbonate species (HCO3– or CO2) dominates in the ocean or lacustrine environments (a condition ultimately linked to atmospheric partial pressure PCO2), the origin of lime-mud production by cyanobacteria and/or algae may fluctuate through geologic time. Trends of cyanobacteria versus algal dominance in the rock record corroborate this conclusion. These results suggest that relative species abundances of calcareous cyanobacteria and algae in the Phanerozoic may serve as potential proxies for assessing paleoclimatic conditions, including fluctuations in atmospheric PCO2.
Intense excitation source of blue-green laser
NASA Astrophysics Data System (ADS)
Han, Kwang S.
1986-10-01
An intense and efficient source for blue green laser useful for the space-based satellite laser applications, underwater strategic communication, and measurement of ocean bottom profile is being developed. The source in use, the hypocycloidal pinch plasma (HCP), and the dense plasma focus (DPF) can produce intense uv photons (200 to 400nm) which match the absorption spectra of both near UV and blue green dye lasers (300 to 400nm). As a result of optimization of the DPF light at 355nm, the blue green dye (LD490) laser output exceeding 4mJ was obtained at the best cavity tunning of the laser system. With the HCP pumped system a significant enhancement of the blue green laser outputs with dye LD490 and coumarin 503 has been achieved through the spectrum conversion of the pumping light by mixing a converter dye BBQ. The maximum increase of laser output with the dye mixture of LD490+BBQ and coumarin 503+BBQ was greater than 80%. In addition, the untunned near UV lasers were also obtained. The near UV laser output energy of P-terphenyl dye was 0.5mJ at lambda sub C=337nm with the bandwidth of 3n m for the pulse duration of 0.2us. Another near UV laser output energy obtained with BBQ dye was 25 mJ at lambda sub C=383nm with the bandwidth of 3nm for the pulse duration of 0.2us. Another near UV laser output energy obtained with BBQ dye was 25 mJ at lambda sub C=383nm with the bandwidth of 3nm for the pulse duration of 0.2microsec.
Uchida, Yumiko; Morimoto, Yukihiro; Uchiike, Takao; Kamamoto, Tomoyuki; Hayashi, Tamaki; Arai, Ikuyo; Nishikubo, Toshiya; Takahashi, Yukihiro
2015-07-01
Phototherapy using blue light-emitting diodes (LED) is effective against neonatal jaundice. However, green light phototherapy also reduces unconjugated jaundice. We aimed to determine whether mixed blue and green light can relieve jaundice with minimal oxidative stress as effectively as either blue or green light alone in a rat model. Gunn rats were exposed to phototherapy with blue (420-520 nm), filtered blue (FB; 440-520 nm without<440-nm wavelengths, FB50 (half the irradiance of filtered blue), mixed (filtered 50% blue and 50% green), and green (490-590 nm) LED irradiation for 24h. The effects of phototherapy are expressed as ratios of serum total (TB) and unbound (UB) bilirubin before and after exposure to each LED. Urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG) was measured by HPLC before and after exposure to each LED to determine photo-oxidative stress. Values < 1.00 indicate effective phototherapy. The ratios of TB and UB were decreased to 0.85, 0.89, 1.07, 0.90, and 1.04, and 0.85, 0.94, 0.93, 0.89, and 1.09 after exposure to blue, filtered blue, FB50, and filtered blue mixed with green LED, respectively. In contrast, urinary 8-OHdG increased to 2.03, 1.25, 0.96, 1.36, 1.31, and 1.23 after exposure to blue, filtered blue, FB50, mixed, green LED, and control, indicating side-effects (> 1.00), respectively. Blue plus green phototherapy is as effective as blue phototherapy and it attenuates irradiation-induced oxidative stress. Combined blue and green spectra might be effective against neonatal hyperbilirubinemia. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Kunuku, Srinivasu; Chen, Yen-Chun; Yeh, Chien-Jui; Chang, Wen-Hao; Manoharan, Divinah; Leou, Keh-Chyang; Lin, I.-Nan
2016-10-01
We report the synthesis of silicon-vacancy (SiV) incorporated spherical shaped ultrananocrystalline diamond (SiV-UNCD) particulates (size ∼1 μm) with bright luminescence at 738 nm. For this purpose, different granular structured polycrystalline diamond films and particulates were synthesized by using three different kinds of growth plasma conditions on the three types of substrate materials in the microwave plasma enhanced CVD process. The grain size dependent photoluminescence properties of nitrogen vacancy (NV) and SiV color centers have been investigated for different granular structured diamond samples. The luminescence of NV center and the associated phonon sidebands, which are usually observed in microcrystalline diamond and nanocrystalline diamond films, were effectively suppressed in UNCD films and UNCD particulates. Micron sized SiV-UNCD particulates with bright SiV emission has been attained by transfer of SiV-UNCD clusters on soda-lime glass fibers to inverted pyramidal cavities fabricated on Si substrates by the simple crushing of UNCD/soda-lime glass fibers in deionized water and ultrasonication. Such a plasma enhanced CVD process for synthesizing SiV-UNCD particulates with suppressed NV emission is simple and robust to attain the bright SiV-UNCD particulates to employ in practical applications.
NASA Astrophysics Data System (ADS)
Shi, Lihong; Li, Yanyan; Li, Xiaofeng; Wen, Xiangping; Zhang, Guomei; Yang, Jun; Dong, Chuan; Shuang, Shaomin
2015-04-01
We report a facile and eco-friendly strategy for the fabrication of green fluorescent carbon nanodots (CDs), and demonstrate their applications for bio-imaging, patterning, and staining. A one-pot hydrothermal method using various plant petals yields bright green-emitting CDs, providing an easy way for the production of green fluorescent CDs without the need for a tedious synthetic methodology or the use of toxic/expensive solvents and starting materials. The as-prepared CDs show small size distribution and excellent dispersibility. Their strong green fluorescence is observed when the excitation wavelength is between 430 nm and 490 nm. Moreover, they exhibit high tolerance to various external conditions, such as pH values, external cations, and continuous excitation. Due to minimum toxicity as well as good photoluminescence properties, these CDs can be applied to in vitro and in vivo imaging, patterning, and staining. According to confocal fluorescence imaging of human uterine cervical squamous cell carcinoma cells, CDs penetrate into the cell and enter the cytoplasm and the nucleus. More strikingly, carp is directly fed with CDs for in vivo imaging and shows bright green fluorescence at an excitation wavelength of 470 nm. In addition, the obtained CDs are used as fluorescent inks for drawing luminescence patterns. Finally, we also apply the CDs as a fluorescent dye. Interestingly, the absorbent filter paper with staining emits dramatic fluorescence under 470 nm excitation.We report a facile and eco-friendly strategy for the fabrication of green fluorescent carbon nanodots (CDs), and demonstrate their applications for bio-imaging, patterning, and staining. A one-pot hydrothermal method using various plant petals yields bright green-emitting CDs, providing an easy way for the production of green fluorescent CDs without the need for a tedious synthetic methodology or the use of toxic/expensive solvents and starting materials. The as-prepared CDs show small size distribution and excellent dispersibility. Their strong green fluorescence is observed when the excitation wavelength is between 430 nm and 490 nm. Moreover, they exhibit high tolerance to various external conditions, such as pH values, external cations, and continuous excitation. Due to minimum toxicity as well as good photoluminescence properties, these CDs can be applied to in vitro and in vivo imaging, patterning, and staining. According to confocal fluorescence imaging of human uterine cervical squamous cell carcinoma cells, CDs penetrate into the cell and enter the cytoplasm and the nucleus. More strikingly, carp is directly fed with CDs for in vivo imaging and shows bright green fluorescence at an excitation wavelength of 470 nm. In addition, the obtained CDs are used as fluorescent inks for drawing luminescence patterns. Finally, we also apply the CDs as a fluorescent dye. Interestingly, the absorbent filter paper with staining emits dramatic fluorescence under 470 nm excitation. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr00783f
Optoelectronic pH Meter: Further Details
NASA Technical Reports Server (NTRS)
Jeevarajan, Antony S.; Anderson, Mejody M.; Macatangay, Ariel V.
2009-01-01
A collection of documents provides further detailed information about an optoelectronic instrument that measures the pH of an aqueous cell-culture medium to within 0.1 unit in the range from 6.5 to 7.5. The instrument at an earlier stage of development was reported in Optoelectronic Instrument Monitors pH in a Culture Medium (MSC-23107), NASA Tech Briefs, Vol. 28, No. 9 (September 2004), page 4a. To recapitulate: The instrument includes a quartz cuvette through which the medium flows as it is circulated through a bioreactor. The medium contains some phenol red, which is an organic pH-indicator dye. The cuvette sits between a light source and a photodetector. [The light source in the earlier version comprised red (625 nm) and green (558 nm) light-emitting diodes (LEDs); the light source in the present version comprises a single green- (560 nm)-or-red (623 nm) LED.] The red and green are repeatedly flashed in alternation. The responses of the photodiode to the green and red are processed electronically to obtain the ratio between the amounts of green and red light transmitted through the medium. The optical absorbance of the phenol red in the green light varies as a known function of pH. Hence, the pH of the medium can be calculated from the aforesaid ratio.
Shibata, Yutaka; Katoh, Wataru; Tahara, Yukari
2013-04-01
Fluorescence microspectroscopy observations were used to study the processes of cell differentiation and assemblies of photosynthesis proteins in Zea mays leaves under the greening process. The observations were done at 78K by setting the sample in a cryostat to avoid any undesired progress of the greening process during the measurements. The lateral and axial spatial resolutions of the system were 0.64μm and 4.4μm, respectively. The study revealed the spatial distributions of protochlorophyllide (PChld) in both the 632-nm-emitting and 655-nm-emitting forms within etiolated Zea mays leaves. The sizes of the fluorescence spots attributed to the former were larger than those of the latter, validating the assignment of the former and latter to the prothylakoid and prolamellar bodies, respectively. In vivo microspectroscopy observations of mature Zea mays leaves confirmed the different photosystem II (PS I)/photosystem I (PS II) ratio between the bundle sheath (BS) and mesophyll (MS) cells, which is specific for C4-plants. The BS cells in Zea mays leaves 1h after the initiation of the greening process tended to show fluorescence spectra at shorter wavelength side (at around 679nm) than the MS cells (at around 682nm). The 679-nm-emitting chlorophyll-a form observed mainly in the BS cells was attributed to putative precursor complexes to PS I. The BS cells under 3-h greening showed higher relative intensities of the PS I fluorescence band at around 735nm, suggesting the reduced PS II amount in the BS cells in this greening stage. Copyright © 2013 Elsevier B.V. All rights reserved.
2011-02-18
environmental interferents selected for this study included dolomitic limestone (Lime, NIST Standard Reference Materials, Catalog No. SRM 88b) and ovalbumin...emission lines due solely to substrates or interferents can be ignored. As in previous studies by our group, the background-corrected peak ...calculated by adding the intensi- ties of the emission lines at 486 and 656 nm); the summed intensities were normalized to the total peak intensity of the
Enhanced frequency upconversion study in Er3+/Yb3+ doped/codoped TWTi glasses
NASA Astrophysics Data System (ADS)
Azam, Mohd; Rai, Vineet Kumar
2018-04-01
Er3+/Yb3+ doped/codoped TeO2-WO3-TiO2 (TWTi) glasses have been prepared by using the melt-quenching technique. The upconversion (UC) emission spectra of the developed glasses have been recorded upon 980 nm laser excitation. Three intense UC emission bands have been observed within the green and red region centered at ˜532 nm, ˜553 nm and ˜669 nm corresponding to the 2H11/2→4I15/2, 4S3/2→4I15/2 and 4F9/2→4I15/2 transitions respectively in the singly Er3+ doped glass. On introducing Yb3+ ions in the singly Er3+ doped glass, an enhancement of about ˜ 12 times and ˜50 times in the green and red bands respectively have been observed even at low pump power ˜ 364 mW followed by two photon absorption process. Colour tunability from yellowish green to pure green colour region has been observed on varying the pump power. The prepared glass can be used to produce NIR to green upconverter and colour tunable display devices.
Chu, Chang-Chi; Jackson, Charles G; Alexander, Patrick J; Karut, Kamil; Henneberry, Thomas J
2003-06-01
Equipping the standard plastic cup trap, also known as the CC trap, with lime-green light-emitting diodes (LED-plastic cup trap) increased its efficacy for catching Bemisia tabaci by 100%. Few Eretmocerus eremicus Rose and Zolnerowich and Encarsia formosa Gahan were caught in LED-plastic cup traps. The LED-plastic cup traps are less expensive than yellow sticky card traps for monitoring adult whiteflies in greenhouse crop production systems and are more compatible with whitefly parasitoids releases for Bemisia nymph control.
Wang, Fei; Zhou, Jiaqi; Lu, Yi; Chu, Renyuan
2011-02-01
To investigate (i) the effect of monochromatic light on inhibiting induction of light-induced melatonin and (ii) the roles of melanopsin and MT1 receptor in light-induced myopia in the guinea pig. Forty-eight guinea pigs were randomly distributed into three treatment groups: white-light (control), green-light (530 nm), and blue-light (480 nm) groups. Levels of pineal gland melatonin were measured twice daily--10:00 a.m. and 10:00 p.m.--10 days after initial light treatment. Thirty additional guinea pigs were also assigned to these groups and treated similarly. For these latter animals, refractive status, ocular length, and vitreous depth were measured before and after light treatment. Eight weeks after light treatment, retinal and sceral levels of melanopsin, melatonin receptor type (MT) 1, and mRNA protein were determined by Western blotting, real-time polymerase chain reaction (RT-PCR), and immunohistochemistry. The level of pineal gland melatonin in the green-light group was significantly higher than that in the blue-light group. Biometric measurements showed that guinea pigs in the green-light group had a somewhat myopic refractive status. Expressions of retinal melanopsin mRNA and protein were significantly higher in the blue-light group and lower in the green-light group when compared to controls. Conversely, expressions of MT1 receptor mRNA and protein in retina and sclera were significantly higher in the green-light group and lower in the blue-light group when compared to controls. Green light appears to suppress induction of melatonin production. In addition, 530 nm of green light is involved in the development of myopia. In the guinea pig, MT1 receptor and melanopsin appear to play roles in the development of myopia induced by 530 nm of light.
NASA Astrophysics Data System (ADS)
Morrill, Waldirene B. B.; Barnabé, Janice M. C.; da Silva, Tatiana P. N.; Pandorfi, Héliton; Gouveia-Neto, Artur S.; Souza, Wellington S.
2014-03-01
Growth performance, behavior, and development of broilers reared under red, green, and blue monochromatic and/or multicolor LED-based illuminants is investigated. The lighting treatments were performed on a 24h lighting basis during six weeks. Monochromatic red(630 nm), green(520 nm), and blue(460 nm), and simultaneous blue-green, and whitelight housing illumination was employed. Bodyweight, food consumption, and behavior were monitored and compared amongst light treatments. The behavioral data showed that broilers reared under green lighting presented the lowest respiratory rate (87 mov. min-1) while those under red lighting presented the highest (96 mov. min-1). Results also showed that broilers under blue and/or green monochromatic illumination exhibited up to 6%, and 8.9 % increase in final bodyweight when compared to those under red or white-light, respectively. The highest feed intake, and lowest body weight gain was observed in broilers reared under blue and red illumination, respectively.
Autophagy Signaling in Prostate Cancer: Identification of a Novel Phosphatase
2013-01-01
be attributed to, we measured the activity of wildtype or mutant PTPsigma using a phospho-tyrosine (pTyr) peptide and malachite green free... malachite green (Upstate) and absorbance measured at 650 nm. Background levels from enzyme-only and substrate-only (T yr-P or PtdIns3P) reactions were...peptide at the indicated concentrations for 15 minutes at 37°C and released phosphates measured by malachite green quenching and 650 nm absorbance. (B
Intense Excitation Source of Blue-Green Laser.
1985-10-15
plasma focus (DPF) can produce intense uv photons (200-300nm) which match the absorption spectra of both near uv and blue green dye lasers (300-400nm...existing blue green dye laser. On the other hand the dense- plasma focus (DPF) with new optical coupling has been designed and constructed. For the...optimization of the DPF device as the uv pumping light source, the velocity of current sheath and the formation of plasma focus have been measured as
Shi, Lihong; Li, Yanyan; Li, Xiaofeng; Wen, Xiangping; Zhang, Guomei; Yang, Jun; Dong, Chuan; Shuang, Shaomin
2015-04-28
We report a facile and eco-friendly strategy for the fabrication of green fluorescent carbon nanodots (CDs), and demonstrate their applications for bio-imaging, patterning, and staining. A one-pot hydrothermal method using various plant petals yields bright green-emitting CDs, providing an easy way for the production of green fluorescent CDs without the need for a tedious synthetic methodology or the use of toxic/expensive solvents and starting materials. The as-prepared CDs show small size distribution and excellent dispersibility. Their strong green fluorescence is observed when the excitation wavelength is between 430 nm and 490 nm. Moreover, they exhibit high tolerance to various external conditions, such as pH values, external cations, and continuous excitation. Due to minimum toxicity as well as good photoluminescence properties, these CDs can be applied to in vitro and in vivo imaging, patterning, and staining. According to confocal fluorescence imaging of human uterine cervical squamous cell carcinoma cells, CDs penetrate into the cell and enter the cytoplasm and the nucleus. More strikingly, carp is directly fed with CDs for in vivo imaging and shows bright green fluorescence at an excitation wavelength of 470 nm. In addition, the obtained CDs are used as fluorescent inks for drawing luminescence patterns. Finally, we also apply the CDs as a fluorescent dye. Interestingly, the absorbent filter paper with staining emits dramatic fluorescence under 470 nm excitation.
Diode-pumped Nd:GAGG-LBO laser at 531 nm
NASA Astrophysics Data System (ADS)
Zou, J.; Chu, H.; Wang, L. R.
2012-03-01
We report a green laser at 531 nm generation by intracavity frequency doubling of a continuous wave (cw) laser operation of a 1062 nm Nd:GAGG laser under in-band diode pumping at 808 nm. A LiB3O5 (LBO) crystal, cut for critical type I phase matching at room temperature is used for second harmonic generation of the laser. At an incident pump power of 18.5 W, as high as 933 mW of cw output power at 531 nm is achieved. The fluctuation of the green output power was better than 3.5% in the given 4 h.
Elemental detection of arabica and robusta green bean coffee using laser-induced plasma spectroscopy
NASA Astrophysics Data System (ADS)
Abdulmadjid, Syahrun Nur; Meilina, Hesti; Hedwig, Rinda; Kurniawan, Koo Hendrik
2017-01-01
The elemental detection of green bean of arabica and robusta coffee from Gayo Highland, Aceh-Indonesia, has been identified by using fundamental Nd-YAG Laser at 10 Torr of surrounding air gas pressure for distinguishing the characteristics of both coffees. As the preliminary study, we have detected the elements of K 766.49 nm, Na 588.9 nm, Ca 393.3 nm, CN band at 388.3 nm, N 337.13 nm and C 247.8 nm of both coffees. It is noticed that the order of elements concentration from highest to lowest are Ca>K>CN> Na>N> C for arabica and K>Ca>CN >Na>C>N for robusta. The emission intensity of K 766.49 nm is almost same for both of coffee. However, the emission intensity of Na 588.9 nm is lower in Arabica coffee. To distinguish the Arabica coffee and Robusta Coffee, we take the ratio intensity of K/C, Na/C, CN/C, and Ca/C. It is found that the ratio intensities of CN/C and Ca/C in arabica bean are significantly different with robusta bean. That ratio intensities can be used as a marker to discriminate kind of coffee. We also noted that the arabica green bean is 1.3 harder than robusta green bean. These findings prove that the technique of laser-induced plasma spectroscopy can be used to make rapid identification of elements in coffee and can potentially be applied to measure the concentration of blended coffee for the purpose of authentication.
Nguyen, D.C.; Faulkner, G.E.
1990-08-14
A blue-green laser (450--550 nm) uses a host crystal doped with Tm[sup 3+]. The Tm[sup 3+] is excited through upconversion by a red pumping laser and an IR pumping laser to a state which transitions to a relatively lower energy level through emissions in the blue-green band, e.g., 450.20 nm at 75 K. The exciting laser may be tunable dye lasers or may be solid-state semiconductor laser, e.g., GaAlAs and InGaAlP. 3 figs.
Nguyen, Dinh C.; Faulkner, George E.
1990-01-01
A blue-green laser (450-550 nm) uses a host crystal doped with Tm.sup.3+. The Tm.sup.+ is excited through upconversion by a red pumping laser and an IR pumping laser to a state which transitions to a relatively lower energy level through emissions in the blue-green band, e.g., 450.20 nm at 75 K. The exciting laser may be tunable dye lasers or may be solid-state semiconductor laser, e.g., GaAlAs and InGaAlP.
A potential green emitting citrate gel synthesized NaSrBO3:Tb3+ phosphor for display application
NASA Astrophysics Data System (ADS)
Bedyal, A. K.; Kumar, Vinay; Swart, H. C.
2018-04-01
A potential green emitting NaSrBO3:Tb3+ (1-9 mol%) phosphor was synthesized by a citrate gel combustion method. X-ray diffraction patterns confirmed the monoclinic phase of the phosphor. The phosphor emitted intense green emission under near-UV and electron excitation due to the characteristic transitions 5D4→7F6(488 nm),5D4→7F5(544 nm),5D4→7F4(586 nm) and 5D4→7F3(622 nm) of Tb3+ ions. The optimal molar concentration of Tb3+ ions was found to be 6 mol%, after that concentration quenching occurred. The dipole-dipole interaction was found to be accountable for energy transfer between the Tb3+ ions. X-ray photoelectron spectroscopy was carried out to analyze the chemical states of the elements and suggest that terbium was mostly presented in the (+3) valance state in the phosphor. The approximated Commission Internationale de l‧Eclairage coordinates for the PL (0.31, 0.61) and CL (0.33, 0.57) were found to be very close to the well-known green emitting phosphor. The obtained results suggest that the studied phosphor could be an ultimate choice for green emission in display applications.
Ostroverkhova, Oksana; Galindo, Gracie; Lande, Claire; Kirby, Julie; Scherr, Melissa; Hoffman, George; Rao, Sujaya
2018-06-05
Bees have a trichromatic vision with ultraviolet, blue, and green photoreceptors in their compound eyes. While the three photoreceptor types comprise the 'color space' at the perceptual level, preferential excitation of one or two of the photoreceptor types has been shown to play an important role in innate color preferences of bumble bees. Bees have been shown to exhibit strong attraction to fluorescence emission exclusively in the blue spectral region. It is not known if emission exclusively in the green spectral region produces similar attraction. Here, we examined responses of wild bees to traps designed to selectively stimulate either the blue or the green photoreceptor using sunlight-induced fluorescence in the 420-480 or 510-540 nm region, respectively. Additionally, we probed how subtle changes in the spectral characteristics of the traps affect the bee captures once a highly selective excitation of the blue photoreceptor is achieved. It was established that selective excitation of the green photoreceptor type was not attractive, in contrast to that of the blue photoreceptor type. However, once a highly selective excitation of the blue photoreceptor type (at ~ 400-480 nm) was achieved, the wild bees favored strong excitation at 430-480 nm over that in the 400-420 nm region.
Inhibited-coupling HC-PCF based beam-delivery-system for high power green industrial lasers
NASA Astrophysics Data System (ADS)
Chafer, M.; Gorse, A.; Beaudou, B.; Lekiefs, Q.; Maurel, M.; Debord, B.; Gérôme, F.; Benabid, F.
2018-02-01
We report on an ultra-low loss Hollow-Core Photonic Crystal Fiber (HC-PCF) beam delivery system (GLO-GreenBDS) for high power ultra-short pulse lasers operating in the green spectral range (including 515 nm and 532 nm). The GLOBDS- Green combines ease-of-use, high laser-coupling efficiency, robustness and industrial compatible cabling. It comprises a pre-aligned laser-injection head, a sheath-cable protected HC-PCF and a modular fiber-output head. It enables fiber-core gas loading and evacuation in a hermetic fashion. A 5 m long GLO-BDS were demonstrated for a green short pulse laser with a transmission coefficient larger than 80%, and a laser output profile close to single-mode (M2 <1.3).
Kawamura, Shoji; Kasagi, Satoshi; Kasai, Daisuke; Tezuka, Ayumi; Shoji, Ayako; Takahashi, Akiyoshi; Imai, Hiroo; Kawata, Masakado
2016-10-01
The guppy (Poecilia reticulata) shows remarkable variation of photoreceptor cells in the retina, especially those sensitive to middle-to-long wavelengths of light. Microspectrophotometry (MSP) has revealed varying "green", "green-yellow" and "yellow" cone cells among guppies in Trinidad and Venezuela (Cumana). In the guppy genome, there are four "long-wave" opsin loci (LWS-1, -2, -3 and -4). Two LWS-1 alleles have potentially differing spectral sensitivity (LWS-1/180Ser and LWS-1/180Ala). In addition, two "middle-wave" loci (RH2-1 and -2), two "short-wave" loci (SWS2-A and -B), and a single "ultraviolet" locus (SWS1) as well as a single "rhodopsin" locus (RH1) are present. However, the absorption spectra of these photopigments have not been measured directly and the association of cell types with these opsins remains speculative. In the present study, we reconstituted these opsin photopigments in vitro. The wavelengths of maximal absorbance (λmax) were 571nm (LWS-1/180Ser), 562nm (LWS-1/180Ala), 519nm (LWS-3), 516nm (LWS-2), 516nm (RH2-1), 476nm (RH2-2), 438nm (SWS2-A), 408nm (SWS2-B), 353nm (SWS1) and 503nm (RH1). The λmax of LWS-3 is much shorter than the value expected (560nm) from the "five-sites" rule. The two LWS-1 alleles could explain difference of the reported MSP λmax values for the yellow cone class between Trinidad and Cumana guppies. Absence of the short-wave-shifted LWS-3 and the green-yellow cone in the green swordtail supports the hypothesis that this cell class of the guppy co-expresses the LWS-1 and LWS-3. These results reveal the basis of variability in the guppy visual system and provide insight into the behavior and ecology of these tropical fishes. Copyright © 2016. Published by Elsevier Ltd.
Diameter Control and Photoluminescence of ZnO Nanorods from Trialkylamines
Andelman, Tamar; Gong, Yinyan; Neumark, Gertrude; ...
2007-01-01
A novel solution method to control the diameter of ZnO nanorods is reported. Small diameter (2-3 nm) nanorods were synthesized from trihexylamine, and large diameter (50–80 nm) nanorods were synthesized by increasing the alkyl chain length to tridodecylamine. The defect (green) emission of the photoluminescence (PL) spectra of the nanorods varies with diameter, and can thus be controlled by the diameter control. The small ZnO nanorods have strong green emission, while the large diameter nanorods exhibit a remarkably suppressed green band. We show that this observation supports surface oxygen vacancies as the defect that gives rise to the green emission.
Violet and blue light-induced green fluorescence emissions from dental caries.
Shakibaie, F; Walsh, L J
2016-12-01
The objective of this laboratory study was to compare violet and visible blue LED light-elicited green fluorescence emissions from enamel and dentine in healthy or carious states. Microscopic digital photography was undertaken using violet and blue LED illumination (405 nm and 455 nm wavelengths) of tooth surfaces, which were photographed through a custom-made stack of green compensating filters which removed the excitation light and allowed green fluorescence emissions to pass. Green channel pixel data were analysed. Dry sound enamel and sound root surfaces showed strong green fluorescence when excited by violet or blue lights. Regions of cavitated dental caries gave lower green fluorescence, and this was similar whether the dentine in the lesions was the same colour as normal dentine or was darkly coloured. The presence of saliva on the surface did not significantly change the green fluorescence, while the presence of blood diluted in saliva depressed green fluorescence. Using violet or blue illumination in combination with green compensating filters could potentially aid in the assessment of areas of mineral loss. © 2016 Australian Dental Association.
Barati, Ali; Shamsipur, Mojtaba; Arkan, Elham; Hosseinzadeh, Leila; Abdollahi, Hamid
2015-02-01
Herein, a facile hydrothermal treatment of lime juice to prepare biocompatible nitrogen-doped carbon quantum dots (N-CQDs) in the presence of ammonium bicarbonate as a nitrogen source has been presented. The resulting N-CQDs exhibited excitation and pH independent emission behavior; with the quantum yield (QY) up to 40%, which was several times greater than the corresponding value for CQDs with no added nitrogen source. The N-CQDs were applied as a fluorescent probe for the sensitive and selective detection of Hg(2+) ions with a detection limit of 14 nM. Moreover, the cellular uptake and cytotoxicity of N-CQDs at different concentration ranges from 0.0 to 0.8 mg/ml were investigated by using PC12 cells as a model system. Response surface methodology was used for optimization and systematic investigation of the main variables that influence the QY, including reaction time, reaction temperature, and ammonium bicarbonate weight. Copyright © 2014. Published by Elsevier B.V.
A CW green laser emission by self-sum-frequency-mixing in Nd:GdCOB crystal
NASA Astrophysics Data System (ADS)
Shao, Y.; Jin, H. J.; Lin, J.; Zhang, D.; Tao, Z. H.; Zhang, T. Y.; Li, Y. L.; Ruan, Q. R.
2011-10-01
A compact and efficient green laser light at 538 nm produced by self-sum-frequency-mixing of both fundamental infrared laser waves (1061 and 1091 nm) in Nd:GdCa4O(BO3)3 (Nd:GdCOB) crystal is demonstrated. With 18.2 W of diode pump power, a maximum output power of 1.73 W in the green spectral range at 538 nm has been achieved, corresponding to an optical-to-optical conversion efficiency of 9.5%; the output power stability over 30 min is better than 3%. To the best of our knowledge, this is first work on self-sum-frequency-mixing of a diode pumped Nd:GdCOB laser.
A multispectral sorting device for wheat kernels
USDA-ARS?s Scientific Manuscript database
A low-cost multispectral sorting device was constructed using three visible and three near-infrared light-emitting diodes (LED) with peak emission wavelengths of 470 nm (blue), 527 nm (green), 624 nm (red), 850 nm, 940 nm, and 1070 nm. The multispectral data were collected by rapidly (~12 kHz) blin...
Pore size distribution of a deeply excavated Oxisol after 19 years reclamation
NASA Astrophysics Data System (ADS)
dos Santos Batista Bonini, Carolina; de Cássia Marchini, Débora; Alves, Marlene Cristina; García de Arruda, Otton; Paz-Ferreiro, Jorge
2013-04-01
Digging of the local soil and using it as a raw material for construction purposes has been identified as a non-negligible source of land degradation. Techniques aimed at soil profile reconstruction and ecological restoration of soils truncated by mechanical excavation using heavy machinery have been investigated Both, total soil porosity and pore size distribution are important properties for soil management as well as for assessing the recovery of soil function after land degradation. In this way, macropores are responsible for aeration, whereas water storage depends on soil meso- and micropores in the soil and the optimal pore-size distribution is also an indicator of soil quality. We investigated the changes in the pore size distribution of a soil that was beheaded to extract raw materials after a 19 year period of reclamation, which involved the use of green manures, gypsum and pasture for the purpose of profile recovery. The studied area is located in Mato Grosso do Sul State, Brzil. A field trial was performed following a completely randomized experimental design with seven treatments and four replications. Starting 1992, the initial treatments were: 1) control (tilled bare soil), 2)Stizolobium aterrium, 3)Cajanus cajan, 4)lime+S. aterrimum, 5) lime+C. cajan, 6) lime + gypsum + S. aterrimum, 7) lime + gypsum+C. cajan. In 1994, all treatments with C. cajan were replaced by Canavalia ensiformis and in 1999, Brachiaria decumbens was implanted in all the experimental plots. Data from vegetated treatments were compared with bare soil (control) and native vegetation (Savannah). Soil samples were collected in 2011 at the 0.00-0.10, 0.10-0.20, and 0.20-0.40 m depths. Treatment differences were assessed by analysis of variance, following the Scott-Knott test (5%) of probability to compare averages. Macroporosity of the 0.00-0.10 m top layer was above the 0.10 m3m-3 threshold considered as critical for plant growth. On the 0.10-0.20 m layer only treatments with C. cajan later on followed by C. ensiformis reached macroporosities over the 0.10 m3m-3 threshold, and on the 0.20-0.40 m no treatment was above this critical value. In spite of the positive development of macroporosity in the restored soil profile, this physical attribute was far from the typical values corresponding to local soils under native Savannah vegetation.
Short-wavelength light beam in situ monitoring growth of InGaN/GaN green LEDs by MOCVD
2012-01-01
In this paper, five-period InGaN/GaN multiple quantum well green light-emitting diodes (LEDs) were grown by metal organic chemical vapor deposition with 405-nm light beam in situ monitoring system. Based on the signal of 405-nm in situ monitoring system, the related information of growth rate, indium composition and interfacial quality of each InGaN/GaN QW were obtained, and thus, the growth conditions and structural parameters were optimized to grow high-quality InGaN/GaN green LED structure. Finally, a green LED with a wavelength of 509 nm was fabricated under the optimal parameters, which was also proved by ex situ characterization such as high-resolution X-ray diffraction, photoluminescence, and electroluminescence. The results demonstrated that short-wavelength in situ monitoring system was a quick and non-destroyed tool to provide the growth information on InGaN/GaN, which would accelerate the research and development of GaN-based green LEDs. PMID:22650991
Ruoff, Kaspar; Luginbühl, Werner; Künzli, Raphael; Bogdanov, Stefan; Bosset, Jacques Olivier; von der Ohe, Katharina; von der Ohe, Werner; Amado, Renato
2006-09-06
Front-face fluorescence spectroscopy, directly applied on honey samples, was used for the authentication of 11 unifloral and polyfloral honey types (n = 371 samples) previously classified using traditional methods such as chemical, pollen, and sensory analysis. Excitation spectra (220-400 nm) were recorded with the emission measured at 420 nm. In addition, emission spectra were recorded between 290 and 500 nm (excitation at 270 nm) as well as between 330 and 550 nm (excitation at 310 nm). A total of four different spectral data sets were considered for data analysis. Chemometric evaluation of the spectra included principal component analysis and linear discriminant analysis; the error rates of the discriminant models were calculated by using Bayes' theorem. They ranged from <0.1% (polyfloral and chestnut honeys) to 9.9% (fir honeydew honey) by using single spectral data sets and from <0.1% (metcalfa honeydew, polyfloral, and chestnut honeys) to 7.5% (lime honey) by combining two data sets. This study indicates that front-face fluorescence spectroscopy is a promising technique for the authentication of the botanical origin of honey and may also be useful for the determination of the geographical origin within the same unifloral honey type.
Effect of Lime on Mechanical and Durability Properties of Blended Cement Based Concrete
NASA Astrophysics Data System (ADS)
Acharya, Prasanna Kumar; Patro, Sanjaya Kumar; Moharana, Narayana C.
2016-06-01
This work presents the results of experimental investigations performed to evaluate the effect of lime on mechanical and durability properties of concrete mixtures made with blended cement like Portland Slag Cement (PSC) and Portland Pozzolana Cement (PPC) with lime content of 0, 5, 7 and 10 %. Test result indicated that inclusion of hydraulic lime on replacement of cement up to 7 % increases compressive strength of concrete made with both PSC and PPC. Flexural strength increased with lime content. Highest flexural strength is reported at 7 % lime content for both PSC and PPC. Workability is observed to decrease with lime addition which could be compensated with introduction of super plasticizer. Acid and sulphate resistance increase slightly up to 7 % of lime addition and is found to decrease with further addition of lime. Lime addition up to 10 % does not affect the soundness of blended cements like PSC and PPC.
LED lighting and seasonality effects antioxidant properties of baby leaf lettuce.
Samuolienė, Giedrė; Sirtautas, Ramūnas; Brazaitytė, Aušra; Duchovskis, Pavelas
2012-10-01
We report on the application of supplementary light-emitting diode (LED) lighting within a greenhouse for cultivation of red, green and light green leaf baby lettuces (Lactuca sativa L.) grown under natural illumination and high-pressure sodium (HPS) lamps (16-h; PPFD-170 μmol m(-2)s(-1)) during different growing season. Supplementary lighting from blue 455/470 nm and green 505/530 nm LEDs was applied (16-h; PPFD-30 μmol m(-2)s(-1)). Our results showed that to achieve solely a positive effect is complicated, because metabolism of antioxidant properties in lettuce depended on multicomponent exposure of variety, light quality or seasonality. The general trend of a greater positive effect of supplemental LED components on the vitamin C and tocopherol contents was in order: 535>505>455>470 nm; on the total phenol content: 505>535=470>455 nm; on the DPPH free-radical scavenging capacity: 535=470>505>455 nm; on the total anthocyanins: 505>455>470>535 nm. Further investigations are needed for understanding the mechanism and interaction between antioxidants and light signal transduction pathways. Copyright © 2012 Elsevier Ltd. All rights reserved.
Excited-state absorption in Er: BaY2F8 and Cs3Er2Br9 and comparison with Er: LiYF4
NASA Astrophysics Data System (ADS)
Pollnau, M.; Lüthy, W.; Weber, H. P.; Krämer, K.; Güdel, H. U.; McFarlane, R. A.
1996-04-01
The influence of Excited-State Absorption (ESA) on the green laser transition and the overlap of Ground-State Absorption (GSA) and ESA for 970 nm upconversion pumping in erbium is investigated in Er3+ : BaY2F8 and Cs3Er2Br9. Results are compared to Er3+ : LiYF4. In Er3+: BaY2F8, a good overlap between GSA and ESA is found at 969 nm in one polarization direction. The emission cross section at 550 nm is a factor of two smaller than in LiYF4. In Cs3Er2Br9, the smaller Stark splitting of the levels shifts the wavelengths of the green emission and ESA from4 I 1 3/2 off resonance. It enhances, however, ground-state reabsorption. The emission cross section at 550 nm is comparable to LiYF4. Upconversion leads to significant green fluorescence from2 H 9/2. A significant population of the4 I 11/2 level and ESA at 970 nm are not present under 800 nm pumping.
Violet-green excitation for NIR luminescence of Yb3+ ions in Bi2O3-B2O3-SiO2-Ga2O3 glasses.
Li, Weiwei; Cheng, Jimeng; Zhao, Guoying; Chen, Wei; Hu, Lili; Guzik, Malgorzata; Boulon, Georges
2014-04-21
60Bi(2)O(3)-20B(2)O(3)-10SiO(2)-10Ga(2)O(3) glasses doped with 1-9 mol% Yb(2)O(3) were prepared and investigated mainly on their violet-green excitation for the typical NIR emission of Yb(3+), generally excited in the NIR. Two violet excitation bands at 365 nm and 405 nm are related to Yb(2+) and Bi(3+). 465 nm excitation band and 480 nm absorption band in the blue-green are assigned to Bi(0) metal nanoparticles/grains. Yb-content-dependence of the excitation and absorption means that Bi(0) is the reduced product of Bi(3+), but greatly competed by the redox reaction of Yb(2+) ↔ Yb(3+). It is proved that the violet-green excitations result in the NIR emission of Yb(3+). On the energy transfer, the virtual level of Yb(3+)-Yb(3+) as well as Bi(0) dimers probably plays an important role. An effective and controllable way is suggested to achieve nano-optical applications by Bi(0) metal nanoparticles/grains and Yb(3+).
Upconversion emission study of Er{sup 3+} doped CaMoO{sub 4} phosphor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sinha, Shriya, E-mail: Shriya.sinha6@gmail.com; Mahata, Manoj Kumar; Kumar, Kaushal
2016-05-06
The infrared to visible upconversion emission in Er{sup 3+} doped CaMoO{sub 4} phosphor has been investigated upon 980 nm diode laser excitation. The X-ray diffraction analysis reveals well crystalline nature and tetragonal phase structure of the prepared phosphor annealed at 800 °C. The Er{sup 3+} doped CaMoO{sub 4} phosphor has shown intense green upconversion emission upon 980 nm didode laser excitation. The green emission bands at 530 nm and 552 nm corresponds to the {sup 2}H{sub 11/2}→{sup 4}I{sub 15/2} and {sup 4}S{sub 3/2}→{sup 4}I{sub 15/2} electronic transitions, respectively of Er{sup 3+} ion. The very weak red emission band around 656more » nm is assigned to the {sup 4}F{sub 9/2}→{sup 4}I{sub 15/2} transition of Er{sup 3+} ion. The CIE color coordinate exhibits the emission color in intense green region, indicating the use of present phosphor in display device applications.« less
Efficient generation of 509 nm light by sum-frequency mixing between two tapered diode lasers
NASA Astrophysics Data System (ADS)
Tawfieq, Mahmoud; Jensen, Ole Bjarlin; Hansen, Anders Kragh; Sumpf, Bernd; Paschke, Katrin; Andersen, Peter E.
2015-03-01
We demonstrate a concept for visible laser sources based on sum-frequency generation of beam combined tapered diode lasers. In this specific case, a 1.7 W sum-frequency generated green laser at 509 nm is obtained, by frequency adding of 6.17 W from a 978 nm tapered diode laser with 8.06 W from a 1063 nm tapered diode laser, inside a periodically poled MgO doped lithium niobate crystal. This corresponds to an optical to optical conversion efficiency of 12.1%. As an example of potential applications, the generated nearly diffraction-limited green light is used for pumping a Ti:sapphire laser, thus demonstrating good beam quality and power stability. The maximum output powers achieved when pumping the Ti:sapphire laser are 226 mW (CW) and 185 mW (mode-locked) at 1.7 W green pump power. The optical spectrum emitted by the mode-locked Ti:sapphire laser shows a spectral width of about 54 nm (FWHM), indicating less than 20 fs pulse width.
Long term trends of fish after liming of Swedish streams and lakes
NASA Astrophysics Data System (ADS)
Holmgren, Kerstin; Degerman, Erik; Petersson, Erik; Bergquist, Björn
2016-12-01
Thousands of Swedish acidified lakes and streams have been regularly limed for about 30 years. Standard sampling of fish assemblages in lakes and streams was an important part of monitoring the trends after liming, i.e. sampling with multi-mesh gillnets in lakes (EN 14757) and electrofishing in streams (EN 14011). Monitoring data are nationally managed, in the National Register of Survey test-fishing and the Swedish Electrofishing Register. We evaluated long-term data from 1029 electrofishing sites in limed streams and gillnet sampling in 750 limed lakes, along with reference data from 195 stream sites and 101 lakes with no upstream liming in their catchments. The median year of first liming was 1986 for both streams and lakes. The proportion of limed stream sites with no fish clearly decreased with time, mean species richness and proportion of sites with brown trout (Salmo trutta) recruits increased. There were no consistent trends in fish occurrence or species richness at non-limed sites, but occurrence of brown trout recruits also increased in acid as well as neutral reference streams. Abundance of brown trout, perch (Perca fluviatilis) and roach (Rutilus rutilus) increased significantly more at limed sites than at non-limed reference sites sampled before and after 1986. The mean species richness did not change consistently in limed lakes, but decreased in low alkalinity reference lakes, and fish abundance decreased significantly in limed as well as in non-limed lakes.
NASA Astrophysics Data System (ADS)
Zampiva, Rúbia Young Sun; Acauan, Luiz Henrique; Venturini, Janio; Garcia, Jose Augusto Martins; da Silva, Diego Silverio; Han, Zhaohong; Kassab, Luciana Reyes Pires; Wetter, Niklaus Ursus; Agarwal, Anuradha; Alves, Annelise Kopp; Bergmann, Carlos Pérez
2018-02-01
Nanoparticles represent a promising platform for diagnostics and therapy of human diseases. For biomedical applications, these nanoparticles are usually coated with photosensitizers regularly activated in a spectral window of 530-700 nm. The emissions at 530 nm (green) and 660 nm (red) are of particular interest for imaging and photodynamic therapy, respectively. This work presents the Mg2SiO4:Er3+ system, produced by reverse strike co-precipitation, with up to 10% dopant and no secondary phase formation. These nanoparticles when excited at 985 nm show upconversion emission with peaks around 530 and 660 nm, although excitation at 808 nm leads to only a single emission peak at around 530 nm. The direct upconversion of this biomaterial without a co-dopant, and its tunability by the excitation source, renders Mg2SiO4:Er3+ nanoparticles a promising system for biomedical applications.
Liu, Li Li; Ling, Jiang Hua; Tie, Li; Wang, Jiao Yue; Bing, Long Fei; Xi, Feng Ming
2018-01-01
Under the background of "missing carbon sink" mystery and carbon capture and storage (CCS) technology development, this paper summarized the lime material flow process carbon sink from the lime carbonation principles, impact factors, and lime utilization categories in chemical industry, metallurgy industry, construction industry, and lime kiln ash treatment. The results showed that the lime carbonation rate coefficients were mainly impacted by materials and ambient conditions; the lime carbon sink was mainly in chemical, metallurgy, and construction industries; and current researches focused on the mechanisms and impact factors for carbonation, but their carbon sequestration calculation methods had not been proposed. Therefore, future research should focus on following aspects: to establish a complete system of lime carbon sequestration accounting method in view of material flow; to calculate lime carbon sequestration in both China and the world and explain their offset proportion of CO 2 emission from lime industrial process; to analyze the contribution of lime carbon sequestration to missing carbon sink for clarifying part of missing carbon sinks; to promote the development of carbon capture and storage technology and provide some scientific bases for China's international negotiations on climate change.
NASA Astrophysics Data System (ADS)
Tuchina, Elena S.; Tuchin, Valery V.
2009-02-01
In the present work we have investigated in vitro sensitivity of microorganisms P. acnes and S. epidermidis to action of red (625 nm and 405 nm) and infrared (805 nm) radiations in combination with photosensitizes Methylene Blue and Indocyanine Green.
USDA-ARS?s Scientific Manuscript database
A comparative investigation of adding milk of lime (MOL) versus lime saccharate (SACCH) in hot lime clarification of juice at a U.S. sugarcane factory was undertaken to quantify performance across the 2009 processing season after a preliminary factory study in 2008. SACCH was prepared by adding hyd...
In vitro energy transfer in Renilla bioluminescence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ward, W.W.; Cormier, M.J.
1976-09-23
A quantitative study of in vitro energy transfer in a natural biological system is reported. The in vitro bioluminescent oxidation of Renilla (sea pansy) luciferin by luciferase produces a broad, structureless emission, peaking in the blue at 490 nm. In contrast, the live animal produces a structured emission peaking in the green at 509 nm. This difference in emission characteristics is due to the presence, in Renilla, of a green fluorescent protein (GFP). Addition of GFP in vitro sensitizes the oxyluciferin product excited state, resulting in the narrow, structured green emission characteristic of GFP fluorescence (lambda/sub max/ 509 nm). Undermore » conditions of efficient in vitro energy transfer (2.7 x 10/sup -6/ M GFP) the radiative quantum yield (with respect to luciferin) increases 5.7-fold from 5.3% (blue pathway) to 30% (green pathway). The fluorescence quantum yield of the Renilla GFP has been measured as 30%; thus, within the precision of our measurements (15% coefficient of variation) the in vitro energy transfer efficiency is a surprising 100%.« less
NASA Astrophysics Data System (ADS)
Fu, S. C.; Wang, X.; Chu, H.
2013-02-01
We report the generation of a green laser at 543 nm by intracavity frequency doubling of the continuous-wave (cw) laser operation of a 1086 nm Nd:YVO4 laser under 888 nm diode pumping into the emitting level 4F3/2. An LiB3O5 (LBO) crystal, cut for critical type I phase matching at room temperature, is used for the laser second-harmonic generation. At an incident pump power of 17.8 W, as high as 4.53 W cw output power at 543 nm is achieved. The optical-to-optical conversion efficiency is up to 25.4%, and the fluctuation of the green output power is better than 2.3% in a 30 min period.
Code of Federal Regulations, 2010 CFR
2010-07-01
... PERFORMANCE FOR NEW STATIONARY SOURCES Standards of Performance for Lime Manufacturing Plants § 60.341... the Act and in the General Provisions. (a) Lime manufacturing plant means any plant which uses a rotary lime kiln to produce lime product from limestone by calcination. (b) Lime product means the...
The effect of liming on antibacterial and hormone levels in wastewater biosolids.
Olszewski, Jennifer M; Lozano, Nuria; Haines, Christine; Rice, Clifford P; Ramirez, Mark; Torrents, Alba
2013-01-01
This study analyzes the effect of liming on levels of triclocarban (TCC), triclosan (TCS), estrone (E1), and progesterone (P), two antimicrobial agents and two natural hormones, respectively. Factors studied include lime particle size, mixing time, and overall lime contact time. The study results suggest that coarse lime may be more active than fine lime due to less interaction with surrounding air. Both TCS and TCC concentrations were lower in coarse limed samples versus unlimed samples and the decrease was a function of time. A similar, but statistically insignificant trend in TCC and TCS levels was observed in fine lime samples with respect to unlimed samples. Liming was also found to decrease apparent E1 levels, with more notable decreases in samples amended with coarse lime. P-levels significantly increased after 1-day of contact time, stabilizing over the next 14 days of the study period. This increase and stabilization of P-levels was attributed to the pH and moisture-driven conversion of more chemically complex steroids into P.
[Study on Archaeological Lime Powders from Taosi and Yinxu Sites by FTIR].
Wei, Guo-feng; Zhang, Chen; Chen, Guo-liang; He, Yu-ling; Gao, Jiang-tao; Zhang, Bing-jian
2015-03-01
Archaeological lime powders samples from Taosi and Yinxu sites, natural limestone and experimentally prepared lime mortar were investigated by means of Fourier transform infrared spectrometry (FTIR) to identify the raw material of lime powders from Taosi and Yinxu sites. Results show that ν2/ν4 ratio of calcite resulted from carbonation reaction of man-made lime is around 6.31, which is higher than that of calcite in natural limestone and reflects the difference in the disorder of calcite crystal structure among the natural limestone and prepared lime mortar. With additional grinding, the values of v2 and ν4 in natural limestone and prepared lime mortar decrease. Meanwhile, the trend lines of ν2 versus ν4 for calcite in experimentally prepared lime mortar have a steeper slope when compared to calcite in natural limestone. These imply that ν2/ν4 ratio and the slope of the trend lines of ν2 versus ν4 can be used to determine the archaeological man-made lime. Based on the experiment results, it is possible that the archaeological lime powder from Taosi and Yinxu sites was prepared using man-made lime and the ancient Chinese have mastered the calcining technology of man-made lime in the late Neolithic period about 4 300 years ago.
9 CFR 73.10 - Permitted dips; substances allowed.
Code of Federal Regulations, 2010 CFR
2010-01-01
... follows: (1) Lime-sulphur dip, other than proprietary brands thereof, made in the proportion of 12 pounds of unslaked lime (or 16 pounds of commercial hydrated lime, not airslaked lime) and 24 pounds of... of lime-sulphur dip. (2) Dips made from specifically permitted proprietary brand emulsions of...
Lime utilization in the laboratory, field, and design of pavement layers : final report.
DOT National Transportation Integrated Search
2017-01-01
The objective of this study was to review and report the best practices of using lime (i.e., granulated lime, hydrated lime, and slurry lime) to dry soil, in working tables, and in pavement applications. The project also reviewed and documented the i...
NASA Astrophysics Data System (ADS)
Karunakaran, Gopalu; Jagathambal, Matheswaran; Van Minh, Nguyen; Kolesnikov, Evgeny; Kuznetsov, Denis
2018-05-01
Nickel ferrite (NiFe2O4) spinel-structured nanoparticles (NPs) were synthesized by a green synthesis approach using Hydrangea paniculata flower extract. Green synthesis of NPs was preliminary monitored by a color change. Further confirmation was carried out using different techniques. X-ray diffraction analysis confirmed the cubic crystalline system (fcc) of NiFe2O4. Energy-dispersive spectrum analysis showed the presence of iron, nickel, oxygen, and carbon. Scanning electron microscopy revealed the agglomerating nature of the NPs (30-50 nm). The specific surface area was found to be 46.73 m2/g, revealing the average size D of NPs to be 24 nm. Transmission electron microscopy confirmed the spherical, oval, and irregular shapes of the NPs with a size range between 10 nm and 45 nm, and an average size of 28 nm. The magnetization of the obtained NiFe2O4 NPs in a high magnetic field of 20 kOe was found to be 20 emu/g. The values of remanent magnetization (M r) and coercive field (H c) were found to be 1.1 emu/g and 28 Oe, respectively. In the process of magnetization reversal (with a small value of M r/M s, 0.055), NiFe2O4 NPs had a loop with low energy loss, showing that the obtained NiFe2O4 NPs were soft magnetic materials. The magnetization curve with a sigmoidal shape indicated that the obtained NiFe2O4 NPs are super-paramagnetic material. In addition, the comparison of green synthesis with the methods available in the literature proved that the green synthesis is the best method. Thus, it is clear that green synthesis is a novel eco-friendly approach for the synthesis of magnetic NiFe2O4 NPs.
Multicolor upconversion emission from Tm3++Ho3++Yb3+ codoped tellurite glass on NIR excitations
NASA Astrophysics Data System (ADS)
Giri, N. K.; Rai, D. K.; Rai, S. B.
2008-06-01
Multicolor emission has been produced using 798 nm and 980 nm laser excitation in a Tm3++Ho3++Yb3+ codoped tellurite based glass. This glass generates simultaneously red, green and blue (RGB) emission on 798 nm excitation. Multicolor emission thus obtained was tuned to white luminescence by adjusting the Ho3+ ion concentration. There is a close match between the calculated color coordinate for the white luminescence obtained here and the point of equal energy which represents white in the 1931 CIE chromaticity diagram. The 980 nm excitation of the same sample on the other hand gives intense green and red emission and the glass appears greenish.
Diode pumped Yb:CN laser at 1082 nm and intracavity doubling to the green spectral range
NASA Astrophysics Data System (ADS)
Liu, B.; Li, Y. L.; Jiang, H. L.
2011-08-01
A diode pumped Yb:CaNb2O6 (Yb:CN) laser at 1082 nm with a maximum output of 1.35 W at 13.3 W pump power has been demonstrated. The slope efficiency was 12.4%. Moreover, intracavity second-harmonic generation (SHG) has also been achieved with a maximum green power of 374 mW by using a LiB3O5 (LBO) nonlinear crystal. To the best of our knowledge, this is the first report on continuous wave (CW) green generation by intracavity frequency doubling Yb:CN laser.
Compact efficient microlasers (Invited Paper)
NASA Astrophysics Data System (ADS)
Brown, David C.; Kuper, Jerry W.
2005-04-01
In this paper we discuss the design and performance of high-density microlaser devices we have been developing, including a series of compact Nd:Vanadate lasers operating at 1064 and 532 nm, and miniature green lasers producing 1-100 mW single-transverse-mode output at 532 nm. In particular, our miniature green lasers have been designed and tested in both 9 mm and 5.6 mm industry standard modified TO cans. These packages pave the way for mass production of low cost yet reliable green lasers that may eventually substitute for red diode lasers in many consumer-oriented applications.
Influence of skin type and wavelength on light wave reflectance.
Fallow, Bennett A; Tarumi, Takashi; Tanaka, Hirofumi
2013-06-01
A new application of photoplethysmography (PPG) has emerged recently to provide the possibility of heart rate monitoring without a telemetric chest strap. The aim of this study was to determine if a new device could detect pulsation over a broad range of skin types, and what light wavelength would be most suitable for detecting the signals. A light emitting diode-based PPG system was used to detect changes in pulsatile blood flow on 23 apparently healthy individuals (11 male and 12 female, 20-59 years old) of varying skin types classified according to a questionnaire in combination with digital photographs with a skin type chart. Four different light wavelengths (470, 520, 630, and 880 nm) were tested. Normalized modulation level is calculated as the AC/DC component ratio and represents the change in flow over the underlying constant state of flow or perfusion. In the resting condition, green light wavelength (520 nm) displayed greater modulation (p < 0.001) than all the other wavelengths analyzed regardless of skin types. Type V (dark brown) skin type was significantly lower in modulation than all other skin types. In the exercise condition, both blue (470 nm) and green (520 nm) light wavelengths displayed greater signal-to-noise ratios than red (630 nm) or infrared (880 nm) light wavelengths (p < 0.001). We concluded that a PPG-based device can detect pulsation across all skin types and that a greater resolution was obtained using a green light wavelength at rest and a green or blue light wavelength during exercise.
Effect of skin coatings on prolonging shelf life of kagzi lime fruits (Citrus aurantifolia Swingle).
Bisen, Abhay; Pandey, Sailendra Kumar; Patel, Neha
2012-12-01
An experiment was conducted to assess the influence of chemical and oil coatings on storage life of kagzi lime fruits. Fruits were harvested at physiological light green mature stage and treated with different concentrations of chemicals viz., Cacl2 and KMnO4 and edible coatings viz., (coconut oil, mustard oil, sesamum oil, castor oil and liquid paraffin wax). After treatment, fruits were kept at ambient condition (25-30 °C, 60-70% RH) till 18 days and analyzed for various physical and chemical parameters like PLW, marketable fruits retained, TSS, acidity, ascorbic acid, juice content and also organoleptic values. The results revealed that edible oil emulsion coating particularly coconut oil had significantly (p ≤ 0.05) effect on reduction of the physiological loss in weight (9.67%) and maximum marketable fruits retained (70%), total soluble solids (8.43%), ascorbic acid (49.93 mg/100 ml juice), acidity (1.52%) and juice content (42.34%) of fruits. Similarly, application of this oil emulsion coating acceptable for sensory quality parameters such as appearance, flavour, taste, external colour and no incidence of moulds & their growth up to 18 days of storage.
Tanaka, Yasuo; Hasegawa, Teruaki; Sugimoto, Kiyomi; Miura, Keiichi; Aketo, Tsuyoshi; Minowa, Nobutaka; Toda, Masaya; Kinoshita, Katsumi; Yamashita, Takahiro; Ogino, Akifumi
2014-01-01
Advanced treatment using an agent synthesized from amorphous silica and hydrated lime (M-CSH-lime) was developed and applied to swine wastewater treatment. Biologically treated wastewater and M-CSH-lime (approximately 6 w/v% slurry) were fed continuously into a column-shaped reactor from its bottom. Accumulated M-CSH-lime gradually formed a bed layer. The influent permeated this layer and contacted the M-CSH-lime, and the treatment reaction progressed. Treated liquid overflowing from the top of the reactor was neutralized with CO₂gas bubbling. The colour removal rate approximately exceeded 50% with M-CSH-lime addition rates of > 0.15 w/v%. The removal rate of PO(3⁻)(4) exceeded 80% with the addition of>0.03 w/v% of M-CSH-lime. The removal rates of coliform bacteria and Escherichia coli exceeded 99.9% with > 0.1 w/v%. Accumulated M-CSH-lime in the reactor was periodically withdrawn from the upper part of the bed layer. The content of citric-acid-soluble P₂O₅ in the recovered matter was>15% when the weight ratio of influent PO(3⁻)(4) -P to added M-CSH-lime was > 0.15. This content was comparable with commercial phosphorus fertilizer. The inhibitory effect of recovered M-CSH-lime on germination and growth of leafy vegetable komatsuna (Brassica rapa var. perviridis) was evaluated by an experiment using the Neubauer's pot. The recovered M-CSH-lime had no negative effect on germination and growth. These results suggest that advanced water treatment with M-CSH-lime was effective for simultaneous removal of colour, [Formula: see text] and coliform bacteria at an addition rate of 0.03-0.15 w/v%, and that the recovered M-CSH-lime would be suitable as phosphorus fertilizer.
Yang, Yefeng; Pan, Chenhao; Zhong, Renhai; Pan, Jinming
2018-06-01
Although many experiments have been conducted to clarify the response of broiler chickens to light-emitting diode (LED) light, those published results do not provide a solid scientific basis for quantifying the response of broiler chickens. This study used a meta-analysis to establish light spectral models of broiler chickens. The results indicated that 455 to 495 nm blue LED light produced the greatest positive response in body weight by 10.66% (BW; P < 0.001) and 515 to 560 nm green LED light increased BW by 6.27% (P < 0.001) when compared with white light. Regression showed that the wavelength (455 to 660 nm) was negatively related to BW change of birds, with a decrease of about 4.9% BW for each 100 nm increase in wavelength (P = 0.002). Further analysis suggested that a combination of the two beneficial light sources caused a synergistic effect. BW was further increased in birds transferred either from green LED light to blue LED light (17.23%; P < 0.001) or from blue LED light to green LED light (17.52%; P < 0.001). Moreover, birds raised with a mixture of green and blue LED light showed a greater BW promotion (10.66%; P < 0.001) than those raised with green LED light (6.27%). A subgroup analysis indicated that BW response to monochromatic LED light was significant regardless of the genetic strain, sex, control light sources, light intensity and regime of LED light, environmental temperature, and dietary ME and CP (P > 0.05). However, there was an interaction between the FCR response to monochromatic LED light with those covariant factors (P < 0.05). Additionally, green and yellow LED light played a role in affecting the meat color, quality, and nutrition of broiler chickens. The results indicate that the optimal ratio of green × blue of mixed LED light or shift to green-blue of combined LED light may produce the optimized production performance, whereas the optimal ratio of green/yellow of mixed or combined LED light may result in the optimized meat quality.
40 CFR Table 5 to Subpart Aaaaa of... - Continuous Compliance With Operating Limits
Code of Federal Regulations, 2010 CFR
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutants for Lime Manufacturing Plants... . . . You must demonstrate continuous compliance by . . . 1. Each lime kiln controlled by a wet scrubber... within ±1%). 2. Each lime kiln or lime cooler equipped with a FF and using a BLDS, and each lime kiln...
Federal Register 2010, 2011, 2012, 2013, 2014
2010-01-20
..., Director of Operations, Lime Brokerage LLC, dated February 17, 2009 (``Lime I Letter''); Manisha Kimmel... Officer, Lime Brokerage LLC, dated June 30, 2009 (``Lime II Letter''); and letter to David S. Shillman... Letter, and Penson Letter. \\21\\ See Lime I Letter. [[Page 3266
NASA Astrophysics Data System (ADS)
Singh, Vijay; Kumar Rai, Vineet; Haase, Markus
2012-09-01
CaZrO3 phosphors co-doped with Er3+ and Yb3+ ions have been prepared by the urea combustion route. The formation of the orthorhombic phase of CaZrO3 was confirmed by powder x-ray diffraction. The absorption in the 280-1800 nm region and excitation spectrum corresponding to the emission at 545 nm for CaZrO3:Er3+/CaZrO3:Er3+,Yb3+ phosphors have been recorded. Upon excitation at 978 nm, the material displays strong energy transfer upconversion emission in the green and red spectral regions. The upconversion emission of the CaZrO3:Er3+,Yb3+ co-doped material shows an increased red-to-green ratio, indicating cross relaxation between Er3+ ions.
Kasturi, S; Sivakumar, V; Varadaraju, U V
2017-05-01
A series of Eu 2+ -activated barium orthosilicates (BaZnSiO 4 ) were synthesized using a high-temperature solid-state reaction. A photoluminescence excitation study of Eu 2 + shows a broad absorption band in the range of 270-450 nm, with multiple absorption peak maxima (310, 350 and 400 nm) due to 4f-5d electronic transition. The emission spectra of all the compositions show green color emission (in the spectral region 450-550 nm with a peak maximum at 502 nm and a shoulder at ~ 490 nm) with appropriate Comission Internationale de l'Eclairage (CIE) color coordinates. The two emission peaks are due to the presence of Eu 2 + in two different Ba sites in the BaZnSiO 4 host lattice. The energy transfers between the Eu 2 + ions in BaZnSiO 4 host are elucidated from the critical concentration quenching data based on the electronic multipolar interaction. All Eu 2 + -activated BaZnSiO 4 phosphor materials can be efficiently excited in the ultraviolet (UV) to near UV-region (270-420 nm), making them attractive candidate as a green phosphor for solid state lighting-white light-emitting diodes. Copyright © 2016 John Wiley & Sons, Ltd.
The antifungal efficiency of carbide lime slurry compared with the commercial lime efficiency
NASA Astrophysics Data System (ADS)
Strigac, J.; Mikusinec, J.; Strigacova, J.; Stevulova, N.
2017-10-01
The article deals with studying the antifungal efficiency of carbide lime slurry compared to industrially manufactured commercial lime. Antifungal efficiency expressed as mould proofness properties was tested on the fungi using the procedure given in standard CSN 72 4310. A mixture of fungi Aspergillus niger, Chaetomium globosum, Penicillium funiculosum, Paecilomyces variotii and Gliocladium virens was utilized for testing. The scale for evaluating mould proofness properties according to CSN 72 4310 is from 0 to 5 in degree of fungi growth, where 0 means that no fungi growth occurs and the building products and materials possess fungistatic properties. The study confirms the fungistatic propeties of carbide lime slurry as well as industrially manufactured commercial lime. However, carbide lime slurry and industrially manufactured commercial lime possess no fungicidal effect.
Generation of energetic femtosecond green pulses based on an OPCPA-SFG scheme.
Mero, M; Sipos, A; Kurdi, G; Osvay, K
2011-05-09
Femtosecond green pulses were generated from broadband pulses centered at 800 nm and quasi-monochromatic pulses centered at 532 nm using noncollinear optical parametric chirped pulse amplification (NOPCPA) followed by sum frequency mixing. In addition to amplifying the 800-nm pulses, the NOPCPA stage pumped by a Q-switched, injection seeded Nd:YAG laser also provided broadband idler pulses at 1590 nm. The signal and idler pulses were sum frequency mixed using achromatic and chirp assisted phase matching yielding pulses near 530 nm with a bandwidth of 12 nm and an energy in excess of 200 μJ. The generated pulses were recompressed with a grating compressor to a duration of 150 fs. The technique is scalable to high energies, broader bandwidths, and shorter pulse durations with compensation for higher order chirps and dedicated engineering of the interacting beams. © 2011 Optical Society of America
Tuning from green to red the upconversion emission of Y2O3:Er3+-Yb3+ nanophosphors
NASA Astrophysics Data System (ADS)
Diaz-Torres, L. A.; Salas, P.; Oliva, J.; Resendiz-L, E.; Rodriguez-Gonzalez, C.; Meza, O.
2017-01-01
In this work, the structural, morphological and luminescent properties of Y2O3 nanophosphors doped with Er3+ (1 mol%) and different Yb3+ concentrations (2-12 mol%) have been studied. Those nanophosphors were synthesized using a simple hydrothermal method. XRD analysis indicates that all the samples presented a pure cubic phase even for Yb concentrations as high as 12 mol%. In addition, SEM images show nanoparticles with quasi-spherical shapes with average sizes in the range of 300-340 nm. Photoluminescence measurements obtained after excitation at 967 nm revealed that our samples have strong green (563 nm) and red emissions (660 nm) corresponding to 2H11/2 + 4S3/2 → 4I15/2 and 4F9/2 → 4I15/2 transitions of Er3+ ions, respectively. We also observed that the green band is quenched and the red emission enhanced as the Yb concentration increases. In consequence, the CIE coordinates changed from (0.35, 0.64) in the green region to (0.59, 0.39) in the red region. Thus, the tuning properties of Y2O3 nanophosphors suggest that they are good candidates for applications in lighting.
Effect of the preparation of lime putties on their properties.
Navrátilová, Eva; Tihlaříková, Eva; Neděla, Vilém; Rovnaníková, Pavla; Pavlík, Jaroslav
2017-12-08
In the study of lime as the basic component of historical mortars and plasters, four lime putties prepared from various kinds of lime of various granulometry and by various ways of preparation were evaluated. The rheological properties and micro-morphologic changes, growing of calcite crystals, and rate of carbonation were monitored. The lime putty prepared from lump lime achieves the best rheological properties, yield stress 214.7 Pa and plastic viscosity 2.6 Pa·s. The suitability of this lime putty was checked by testing the development of calcium hydroxide and calcite crystals using scanning electron microscopy and environmental scanning electron microscopy. The disordered crystals of calcium hydroxide exhibit better carbonation resulting in the large crystals of calcite; therefore, the mortar prepared from the lump lime has the highest flexural strength and compressive strength 0.8/2.5 MPa, its carbonation is the fastest and exhibits the longest durability. Also, thanks to the micro-morphological characterization of samples in their native state by means of environmental scanning electron microscopy, the new way of lime putty preparation by mixing was proven. The preparation consists in the mechanical crash of the lime particles immediately after hydration. This enables the properties of putty prepared from lump lime to be nearly reached.
González-Alcaraz, María Nazaret; Conesa, Héctor Miguel; Álvarez-Rogel, José
2013-03-01
The aim of this study was to assess the effectiveness of combining liming and vegetation for the phytomanagement of strongly acidic, saline eutrophic wetlands polluted by mine wastes. Simulated soil profiles were constructed and four treatments were assayed: without liming+without plant, without liming+with plant, with liming+without plant and with liming+with plant. The plant species was the halophyte Sarcocornia fruticosa. Three horizons were differentiated: A (never under water), C1 (alternating flooding-drying conditions) and C2 (always under water). The soluble Cd, Cu, Mn, Pb and Zn concentrations were measured regularly for 18 weeks and a sequential extraction procedure was applied at the end of the experiment. Liming was effective (between ∼70% and ∼100%) in reducing the soluble Zn, Cu and Pb. In contrast, soluble Mn and Cd increased with liming, especially in the treatment with liming+with plant, where the concentrations were 2-fold higher than in the non-limed treatments. The amendment increased the contents of Zn, Mn and Cd bound to potentially-mobilisable soil fractions at the expense of the most-environmentally-inert fractions. Hence, the combined use of liming and vegetation may increase the long-term environmental risk of metals solubilisation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Compact 151 W green laser with U-type resonator for prostate surgery
NASA Astrophysics Data System (ADS)
Bazyar, Hossein; Aghaie, Mohammad; Daemi, Mohammad Hossein; Bagherzadeh, Seyed Morteza
2013-04-01
We analyzed, designed and fabricated a U-type resonator for intra-cavity frequency doubling of a diode-side-pumped Q-switched Nd:YAG rod laser with high power and high stability for surgery of prostatic tissue. The resonator stability conditions were analyzed graphically in the various configurations for a U-type resonator. We obtained green light at 532 nm using a single KTP crystal, with average output power of 151 W at 10 kHz repetition rate, and with 113 ns pulse duration at 810 W input pump power. We achieved 1064-532 nm conversion efficiency of 75.8%, and pump-to-green optical-optical efficiency of 18.6%. The green power fluctuation was ±1.0% and pointing stability was better than 4 μrad. The green laser output was coupled to a side-firing medical fiber to transfer the laser beam to the prostatic tissue.
40 CFR Table 4 to Subpart Aaaaa of... - Requirements for Performance Tests
Code of Federal Regulations, 2013 CFR
2013-07-01
... lime kiln and each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime cooler Select the location of the sampling port and the number of traverse ports Method 1 or... each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime...
40 CFR Table 4 to Subpart Aaaaa of... - Requirements for Performance Tests
Code of Federal Regulations, 2011 CFR
2011-07-01
... lime kiln and each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime cooler Select the location of the sampling port and the number of traverse ports Method 1 or... each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime...
40 CFR Table 4 to Subpart Aaaaa of... - Requirements for Performance Tests
Code of Federal Regulations, 2014 CFR
2014-07-01
... lime kiln and each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime cooler Select the location of the sampling port and the number of traverse ports Method 1 or... each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime...
40 CFR Table 4 to Subpart Aaaaa of... - Requirements for Performance Tests
Code of Federal Regulations, 2010 CFR
2010-07-01
... lime kiln and each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime cooler Select the location of the sampling port and the number of traverse ports Method 1 or... each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime...
40 CFR Table 4 to Subpart Aaaaa of... - Requirements for Performance Tests
Code of Federal Regulations, 2012 CFR
2012-07-01
... lime kiln and each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime cooler Select the location of the sampling port and the number of traverse ports Method 1 or... each associated lime cooler, if there is a separate exhaust to the atmosphere from the associated lime...
NASA Astrophysics Data System (ADS)
Francisco-Rodriguez, H. I.; Lira, A.; Soriano-Romero, O.; Meza-Rocha, A. N.; Bordignon, S.; Speghini, A.; Lozada-Morales, R.; Caldiño, U.
2018-05-01
A spectroscopic analysis of Tb3+ and Tb3+/Eu3+ doped lithium-aluminum-zinc phosphate glasses is performed through their absorbance and photoluminescence spectra, and decay time profiles. Laser parameter values (stimulated emission cross section, effective bandwidth, gain bandwidth and optical gain) were obtained for the terbium 5D4 → 7F5 green emission from the Tb3+ singly-doped glass (LAZT) excited at 350 nm to judge the suitability of the glass phosphor for fiber lasers. A quantum yield of (47.68 ± 0.49)% was measured for the 5D4 level luminescence. Upon 350 nm excitation the LAZT glass phosphor emits green light with a color purity of 65.6% and chromaticity coordinates (0.285, 0.585) very close to those (0.29, 0.60) of European Broadcasting Union illuminant green. The Tb3+/Eu3+codoped glass emission color can be tuned from reddish-orange of 1865 K upon 318 nm excitation to warm white of 3599 K and neutral white of 4049 K upon 359 and 340 nm excitations, respectively. Upon Tb3+ excitation at 340 nm Eu3+ is sensitized by Tb3+ through a non-radiative energy transfer with an efficiency of 0.23-0.26. An electric dipole-dipole interaction might be the dominant mechanism in the Tb3+ to Eu3+ energy transfer taking place into Tb3+ - Eu3+ clusters.
Organic Dye Degradation Under Solar Irradiation by Hydrothermally Synthesized ZnS Nanospheres
NASA Astrophysics Data System (ADS)
Samanta, Dhrubajyoti; Chanu, T. Inakhunbi; Basnet, Parita; Chatterjee, Somenath
2018-02-01
The green synthesis of ZnS nanospheres using Citrus limetta (sweet lime) juice as a capping agent through a conventional hydrothermal method was studied. The particle size, morphology, chemical composition, band gap, and optical properties of the synthesized ZnS nanospheres were characterized using x-ray diffraction spectroscopy, field emission scanning electron microscopy, high-resolution transmission electron microscopy, and ultraviolet-visible spectroscopy. The photocatalytic activity of the ZnS nanospheres was evaluated by degradation of rhodamine B (RhB) and methyl orange (MO) under solar irradiation. Upon 150 min of solar irradiation, the extent of degradation was 94% and 77% for RhB and MO, respectively.
Sharafi, Ata Allah; Abkenar, Asad Asadi; Sharafi, Ali; Masaeli, Mohammad
2016-01-01
Iran has a long history of acid lime cultivation and propagation. In this study, genetic variation in 28 acid lime accessions from five regions of south of Iran, and their relatedness with other 19 citrus cultivars were analyzed using Simple Sequence Repeat (SSR) and Inter-Simple Sequence Repeat (ISSR) molecular markers. Nine primers for SSR and nine ISSR primers were used for allele scoring. In total, 49 SSR and 131 ISSR polymorphic alleles were detected. Cluster analysis of SSR and ISSR data showed that most of the acid lime accessions (19 genotypes) have hybrid origin and genetically distance with nucellar of Mexican lime (9 genotypes). As nucellar of Mexican lime are susceptible to phytoplasma, these acid lime genotypes can be used to evaluate their tolerance against biotic constricts like lime "witches' broom disease".
Liming impacts on soils, crops and biodiversity in the UK: A review.
Holland, J E; Bennett, A E; Newton, A C; White, P J; McKenzie, B M; George, T S; Pakeman, R J; Bailey, J S; Fornara, D A; Hayes, R C
2018-01-01
Fertile soil is fundamental to our ability to achieve food security, but problems with soil degradation (such as acidification) are exacerbated by poor management. Consequently, there is a need to better understand management approaches that deliver multiple ecosystem services from agricultural land. There is global interest in sustainable soil management including the re-evaluation of existing management practices. Liming is a long established practice to ameliorate acidic soils and many liming-induced changes are well understood. For instance, short-term liming impacts are detected on soil biota and in soil biological processes (such as in N cycling where liming can increase N availability for plant uptake). The impacts of liming on soil carbon storage are variable and strongly relate to soil type, land use, climate and multiple management factors. Liming influences all elements in soils and as such there are numerous simultaneous changes to soil processes which in turn affect the plant nutrient uptake; two examples of positive impact for crops are increased P availability and decreased uptake of toxic heavy metals. Soil physical conditions are at least maintained or improved by liming, but the time taken to detect change varies significantly. Arable crops differ in their sensitivity to soil pH and for most crops there is a positive yield response. Liming also introduces implications for the development of different crop diseases and liming management is adjusted according to crop type within a given rotation. Repeated lime applications tend to improve grassland biomass production, although grassland response is variable and indirect as it relates to changes in nutrient availability. Other indicators of liming response in grassland are detected in mineral content and herbage quality which have implications for livestock-based production systems. Ecological studies have shown positive impacts of liming on biodiversity; such as increased earthworm abundance that provides habitat for wading birds in upland grasslands. Finally, understanding of liming impacts on soil and crop processes are explored together with functional aspects (in terms of ecosystems services) in a new qualitative framework that includes consideration of how liming impacts change with time. This holistic approach provides insights into the far-reaching impacts that liming has on ecosystems and the potential for liming to enhance the multiple benefits from agriculturally managed land. Recommendations are given for future research on the impact of liming and the implications for ecosystem services. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Jongaroontaprangsee, Saranya; Chiewchan, Naphaporn; Devahastin, Sakamon
2018-08-01
Water removal during drying of nanofibrillated cellulose (NFC) generally results in the formation of hydrogen bonds between fibers, leading to irreversible fiber agglomeration and hence their poor water redispersibility. The feasibility of using lime residues after juice extraction to produce dried NFC possessing superior redispersibility was here investigated. After autoclaving at 110-130 °C for 2 h, high-shear homogenization at 3800 × g for 15 min and high-pressure homogenization at 40 MPa for 5 passes, NFC having the diameters of 5-28 nm and crystallinity index of 44-46% could be obtained. After hot air drying at 60 °C, dried NFC could be well dispersed in water, with viscoelastic property similar to that of the originally prepared NFC suspension. Pectin associated with cellulose nanofibrils helped prevent fiber aggregation during drying and hence facilitating nanofiber redispersion in water. This observed trend was opposite to that belonging to fiber undergone chemical treatments to remove non-cellulosic constituents. Copyright © 2018 Elsevier Ltd. All rights reserved.
Formation and Properties of Laser-Induced Periodic Surface Structures on Different Glasses.
Gräf, Stephan; Kunz, Clemens; Müller, Frank A
2017-08-10
The formation and properties of laser-induced periodic surface structures (LIPSS) was investigated on different technically relevant glasses including fused silica, borosilicate glass, and soda-lime-silicate glass under irradiation of fs-laser pulses characterized by a pulse duration τ = 300 fs and a laser wavelength λ = 1025 nm. For this purpose, LIPSS were fabricated in an air environment at normal incidence with different laser peak fluence, pulse number, and repetition frequency. The generated structures were characterized by using optical microscopy, scanning electron microscopy, focused ion beam preparation and Fast-Fourier transformation. The results reveal the formation of LIPSS on all investigated glasses. LIPSS formation on soda-lime-silicate glass is determined by remarkable melt-formation as an intra-pulse effect. Differences between the different glasses concerning the appearing structures, their spatial period and their morphology were discussed based on the non-linear absorption behavior and the temperature-dependent viscosity. The findings facilitate the fabrication of tailored LIPSS-based surface structures on different technically relevant glasses that could be of particular interest for various applications.
Formation and Properties of Laser-Induced Periodic Surface Structures on Different Glasses
Kunz, Clemens; Müller, Frank A.
2017-01-01
The formation and properties of laser-induced periodic surface structures (LIPSS) was investigated on different technically relevant glasses including fused silica, borosilicate glass, and soda-lime-silicate glass under irradiation of fs-laser pulses characterized by a pulse duration τ = 300 fs and a laser wavelength λ = 1025 nm. For this purpose, LIPSS were fabricated in an air environment at normal incidence with different laser peak fluence, pulse number, and repetition frequency. The generated structures were characterized by using optical microscopy, scanning electron microscopy, focused ion beam preparation and Fast-Fourier transformation. The results reveal the formation of LIPSS on all investigated glasses. LIPSS formation on soda-lime-silicate glass is determined by remarkable melt-formation as an intra-pulse effect. Differences between the different glasses concerning the appearing structures, their spatial period and their morphology were discussed based on the non-linear absorption behavior and the temperature-dependent viscosity. The findings facilitate the fabrication of tailored LIPSS-based surface structures on different technically relevant glasses that could be of particular interest for various applications. PMID:28796180
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lai, C.-M.; Chang, K.-H.; Yang, Z.-Y.
Spectrally broad frequency comb generation over 510–555 nm range was reported on chirped quasi-phase-matching (QPM) χ{sup (2)} nonlinear photonic crystals of 12 mm length with periodicity stepwise increased from 5.9 μm to 7.1 μm. When pumped with nanosecond infrared (IR) frequency comb derived from a QPM optical parametric oscillator (OPO) and spanned over 1040 nm to 1090 nm wavelength range, the 520 nm to 545 nm up-converted green spectra were shown to consist of contributions from (a) second-harmonic generation among the signal or the idler modes, and (b) sum-frequency generation (SFG) from the neighboring pairs of the signal or the idler modes. These mechanisms led the up-converted greenmore » frequency comb to have the same mode spacing of 450 GHz as that in the IR-OPO pump comb. As the pump was further detuned from the aforementioned near-degeneracy point and moved toward the signal (1020–1040 nm) and the idler (1090–1110 nm) spectral range, the above QPM parametric processes were preserved in the chirped QPM devices to support up-converted green generation in the 510–520 nm and the 545–555 nm spectral regime. Additional 530–535 nm green spectral generation was also observed due to concurrence of multi-wavelength SFG processes between the (signal, idler) mode pairs. These mechanisms facilitate the chirped QPM device to support a single-pass up-conversion efficiency ∼10% when subject to an IR-OPO pump comb with 200 mW average power operated near- or off- the degeneracy point.« less
Teerman, S.C.; Crelling, J.C.; Glass, G.B.
1987-01-01
Flourescence spectral analysis indicates that resinite macerals from Tertiary Hanna Formation coals (Hanna Coal Field, southcentral Wyoming, U.S.A.) can be separated into five distinct groups. The first resinite group fluoresces a a medium green (in blue light); its average spectral maximum occurs at or below 440 mm with a red/green quotient of 0.22. The second resinite group fluoresces yellow-green with an average spectral maximum of 500 nm and a red/green quotient of 0.53. The third resinite group displays a yellow fluorescence having an average spectral maximum of 580 nm and a red/green quotient of 0.86. The fourth resinite group fluorescence orange-brown having an average spectral maximum of 610 nm and a red/green quotient of 1.20. These four groups mostly occur as primary globular resinites exhibiting scratches and fractures, indicating that they are brittle, solid substances. Primary cell-filling and secondary fracture-filling resinites also occur in these four groups. The fifth group only occurs as a secondary void-filling material and lacks evidence of br of brittle properties. It fluoresces a reddish-brown, has a spectral maximum at 690 nm, and a red/green quotient of 1.54. The fifth group has properties resembling exsudatinite. The five resinite groups can be separated on the basis of their nine spectral properties alone, without qualitative petrographic interpretation. The relative quantities of the five resinite groups vary among Hanna Formation coals. The origins of these five resinite groups are probably related to their botanical properties and pre- and post-depossitional conditions. Overall, Hanna Formation resinites have petrographic characteristics similar to other North American resinites; however, only four resinite groups have been distinguished in in certain coals from Utah and New Mexico (U.S.A.), and western Canada. ?? 1987.
NASA Astrophysics Data System (ADS)
Omri, K.; Alyamani, A.; Mir, L. El
2018-02-01
Mn2+-doped Zn2SiO4 (ZSM2+) was synthesized by a facile sol-gel technique. The obtained samples were characterized by X-ray diffraction (XRD), Raman spectroscopy, photoluminescence (PL) and cathodoluminescence (CL) techniques. Under UV excitation, spectra showed that the α-ZSM2+ phosphor exhibited a strong green emission around 525 nm and reached the highest luminescence intensity with the Mn doping concentration of 5 at.%. However, for the β-ZSM2+ phase, an interesting yellow emission band centered at 575 nm of Mn2+ at the Zn2+ tetrahedral sites was observed. In addition, an unusual red shift with increasing Mn2+ content was also found and attributed to an exchange interaction between Mn2+. Both PL and CL spectra exhibit an intense green and yellow emission centered at 525 and 573 nm, respectively, due to the 4T1 (4G)-6A1 (6S) transition of Mn2+. Furthermore, these results indicated that the Mn2+-doped zinc silicate phosphors may have potential applications in green and yellow emissions displays like field emission displays (FEDs).
Optical properties of P ion implanted ZnO
NASA Astrophysics Data System (ADS)
Pong, Bao-Jen; Chou, Bo-Wei; Pan, Ching-Jen; Tsao, Fu-Chun; Chi, Gou-Chung
2006-02-01
Red and green emissions are observed from P ion implanted ZnO. Red emission at ~680 nm (1.82 eV) is associated with the donor-acceptor pair (DAP) transition, where the corresponding donor and acceptor are interstitial zinc (Zn i) and interstitial oxygen (O i), respectively. Green emission at ~ 516 nm (2.40 eV) is associated with the transition between the conduction band and antisite oxygen (O Zn). Green emission at ~516nm (2.403 eV) was observed for ZnO annealed at 800 oC under ambient oxygen, whereas, it was not visible when it was annealed in ambient nitrogen. Hence, the green emission is most likely not related to oxygen vacancies on ZnO sample, which might be related to the cleanliness of ZnO surface, a detailed study is in progress. The observed micro-strain is larger for N ion implanted ZnO than that for P ion implanted ZnO. It is attributed to the larger straggle of N ion implanted ZnO than that of P ion implanted ZnO. Similar phenomenon is also observed in Be and Mg ion implanted GaN.
Highly efficient color filter array using resonant Si3N4 gratings.
Uddin, Mohammad Jalal; Magnusson, Robert
2013-05-20
We demonstrate the design and fabrication of a highly efficient guided-mode resonant color filter array. The device is designed using numerical methods based on rigorous coupled-wave analysis and is patterned using UV-laser interferometric lithography. It consists of a 60-nm-thick subwavelength silicon nitride grating along with a 105-nm-thick homogeneous silicon nitride waveguide on a glass substrate. The fabricated device exhibits blue, green, and red color response for grating periods of 274, 327, and 369 nm, respectively. The pixels have a spectral bandwidth of ~12 nm with efficiencies of 94%, 96%, and 99% at the center wavelength of blue, green, and red color filter, respectively. These are higher efficiencies than reported in the literature previously.
Schotsmans, Eline M J; Denton, John; Fletcher, Jonathan N; Janaway, Robert C; Wilson, Andrew S
2014-05-01
Contradictions and misconceptions regarding the effect of lime on the decay of human remains have demonstrated the need for more research into the effect of different types of lime on cadaver decomposition. This study follows previous research by the authors who have investigated the effect of lime on the decomposition of human remains in burial environments. A further three pig carcasses (Sus scrofa), used as human body analogues, were observed and monitored for 78 days without lime, with hydrated lime (Ca(OH)2) and with quicklime (CaO) in the taphonomy laboratory at the University of Bradford. The results showed that in the early stages of decay, the unlimed and hydrated lime cadavers follow a similar pattern of changes. In contrast, the application of quicklime instigated an initial acceleration of decay. Microbial investigation demonstrated that the presence of lime does not eliminate all aerobic bacteria. The experiment also suggested that lime functions as a sink, buffering the carbon dioxide evolution. This study complements the field observations. It has implications for the investigation of time since death of limed remains. Knowledge of the effects of lime on decomposition processes is of interest to forensic pathologists, archaeologists, humanitarian organisations and those concerned with disposal of animal carcasses or human remains in mass disasters. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Bluish-green color emitting Ba2Si3O8:Eu2+ ceramic phosphors for white light-emitting diodes.
Xiao, F; Xue, Y N; Zhang, Q Y
2009-10-15
This paper reports on the structural and optical properties of Eu(2+) activated Ba(2)Si(3)O(8) ceramic phosphors synthesized by a sol-gel method. The ceramic phosphors have been characterized by X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM) and fluorescence measurements. The structural characterization results suggest that the as-prepared phosphors are of single phase monoclinic Ba(2)Si(3)O(8) with rod-like morphology. A broad excitation band ranging from 300 to 410 nm matches well with the ultraviolet (UV) radiation of light-emitting diodes (LEDs). Upon 380 nm UV light excitation, these phosphors emit bluish-green emission centered at 500 nm with color coordination (x=0.25, y=0.40). All the obtained results indicate that the Ba(2)Si(3)O(8):Eu(2+) ceramic phosphors are promising bluish-green candidates for the phosphor-converted white LEDs.
High-power, continuous-wave, second-harmonic generation at 532 nm in periodically poled KTiOPO(4).
Samanta, G K; Kumar, S Chaitanya; Mathew, M; Canalias, C; Pasiskevicius, V; Laurell, F; Ebrahim-Zadeh, M
2008-12-15
We report efficient generation of high-power, cw, single-frequency radiation in the green in a simple, compact configuration based on single-pass, second-harmonic generation of a cw ytterbium fiber laser at 1064 nm in periodically poled KTiOPO(4). Using a crystal containing a 17 mm single grating with period of 9.01 microm, we generate 6.2 W of cw radiation at 532 nm for a fundamental power of 29.75 W at a single-pass conversion efficiency of 20.8%. Over the entire range of pump powers, the generated green output is single frequency with a linewidth of 8.5 MHz and has a TEM(00) spatial profile with M(2)<1.34. The demonstrated green power can be further improved by proper thermal management of crystal heating effects at higher pump powers and also by optimized design of the grating period to include thermal issues.
Mineral Resource of the Month: Lime
Corathers, Lisa A.
2015-01-01
Lime is the common term for several chemicals in three major categories: quicklime, hydrated lime and refractory dead-burned dolomite. Lime is almost never found naturally. It is primarily manufactured by burning limestone in kilns, followed by hydration when necessary.
Haag, Nicola Leonard; Nägele, Hans-Joachim; Fritz, Thomas; Oechsner, Hans
2015-02-01
A green biorefinery enables the material and energetic use of biomass via lactic acid and methane production. Different ensiling techniques were applied to maize and amaranth with the aim to increase the amount of lactic acid in the silage. In addition the methane formation potential of the ensiled samples and the remaining solid residues after separating the organic juice were assessed. Treating maize with homofermentative lactic acid bacteria in combination with carbonated lime increased the amount of lactic acid about 91.9%. For amaranth no additional lactic acid production was obtained by treating the raw material. Specific methane yields for the solid residues of amaranth were significantly lower in comparison to the corresponding silages. The most promising treatment resulted in a production of 127.9±4.1 g kg(-1) DM lactic acid and a specific methane yield for the solid residue of 349.5±6.6 lN kg(-1) ODM. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Lee, Dicky; Moulton, Peter F.
2001-03-01
In this paper we discuss our red, green, and blue (RGB) optical parametric oscillator (OPO) light source for projection display applications. Our source consists of a diode-pumped pump laser and a LBO-based OPO. Based on our Nd:YLF gain-module design, the pump laser is frequency doubled to serve as the pump source for the OPO. The unconverted pump power is recycled as the green light for projection. The singly resonant, non-critically phase- matched OPO has, to date, generated 13 W of 898-nm signal power and an estimated 9.3 W of intra-cavity idler power at 1256 nm. With approximately 76% of pump depletion, the power of the residual green light for projection is about 5.8 W. We have extra-cavity doubled the signal to produce approximately 3.5 W of 449-nm blue light and intra-cavity doubled the idler to produce approximately 6 W of 628-nm red light. The OPO-based RGB source generates about 4000 lumens of D65-balanced white light. The overall electrical power luminous efficiency (diodes only) is about 14.6 lumens/Watt.
Structural studies of a green-emitting terbium doped calcium zinc phosphate phosphor
NASA Astrophysics Data System (ADS)
Ramesh, B.; Dillip, G. R.; Rambabu, B.; Joo, S. W.; Raju, B. Deva Prasad
2018-03-01
In this study, a new green emitting CaZn2(PO4)2:Tb3+ phosphors were synthesized through solid-state reaction route. The phosphors were characterized structurally by X-ray diffraction, Fourier transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS). All the synthesized phosphors were crystallized in triclinic crystal structure with P 1 bar space group. The phosphate groups in the phosphors were confirmed by FTIR analysis. The surface elements O 1s, P 2p, Ca 2p, Zn 2p and Tb 3d were studied by high-resolution XPS spectra. Upon excitation at 378 nm, the dominant green emission of CaZn2(PO4)2:Tb3+ phosphors at 542 nm were noticed in the emission spectra. For various emission wavelengths (at 435 and 489 nm) and constant excitation wavelength (at 378 nm), the decay curves have shown two different decay dynamics of phosphors. The lighting properties such as Commission International de l'Eclairage (x = 0.319, y = 0.398) and color temperature (5995 K) were calculated.
NASA Astrophysics Data System (ADS)
Yang, Chun-Chieh; Kim, Moon S.; Chuang, Yung-Kun; Lee, Hoyoung
2013-05-01
This paper reports the development of a multispectral algorithm, using the line-scan hyperspectral imaging system, to detect fecal contamination on leafy greens. Fresh bovine feces were applied to the surfaces of washed loose baby spinach leaves. A hyperspectral line-scan imaging system was used to acquire hyperspectral fluorescence images of the contaminated leaves. Hyperspectral image analysis resulted in the selection of the 666 nm and 688 nm wavebands for a multispectral algorithm to rapidly detect feces on leafy greens, by use of the ratio of fluorescence intensities measured at those two wavebands (666 nm over 688 nm). The algorithm successfully distinguished most of the lowly diluted fecal spots (0.05 g feces/ml water and 0.025 g feces/ml water) and some of the highly diluted spots (0.0125 g feces/ml water and 0.00625 g feces/ml water) from the clean spinach leaves. The results showed the potential of the multispectral algorithm with line-scan imaging system for application to automated food processing lines for food safety inspection of leafy green vegetables.
NASA Astrophysics Data System (ADS)
Avram, Daniel; Florea, Mihaela; Tiseanu, Ion; Tiseanu, Carmen
2015-09-01
Herein, we report on the emission color tunability of Er doped BiOCl measured under up—conversion as well as x-ray excitation modes. The dependence of red (670 nm) to green emission (543 nm) ratio on Er concentration (1 and 5%), excitation wavelength into different (656.4, 802 and 976 nm) or across single Er absorption levels (965 ÷ 990 nm) and delay after the laser pulse (0.001 ÷ 1 ms) is discussed in terms of ground state absorption/excited state absorption and energy transfer up-conversion mechanisms. A first example of extended Er x-ray emission measured in the range of 500 to 1700 nm shows comparable emission intensities corresponding to 543 nm and 1500 nm based transitions. The present results together with our earlier report on the upconversion emission of Er doped BiOCl excited at 1500 nm, suggest that Er doped BiOCl may be considered an attractive system for optical and x-ray imaging applications.
Structural and optical investigation in Er3+ doped Y2MoO6 phosphors
NASA Astrophysics Data System (ADS)
Mondal, Manisha; Rai, Vineet Kumar
2018-05-01
The Er3+ doped Y2MoO6 phosphors have been structurally and optically characterized by X-ray Diffraction (XRD), Field emission scanning electron microscopy (FESEM), UV-Vis absorption spectroscopy and frequency upconversion (UC) emission studies. The crystal and the particles size are found to be ˜ 85 nm and ˜ 200 nm from XRD and FESEM analysis. The intense peak at ˜ 206 nm in the UV-Vis absorption spectroscopy is attributed due to the charge transfer transition between the Mo6+ and the O2- ions in the MoO4 group in the host molybdate. The frequency UC emission studies of the prepared phosphors under 980 nm diode laser excitation shows the intense UC emission in the 0.3 mol% concentrations for the Er3+ ions. In the UC emission spectra, the emission peaks at green (˜ 525 nm and ˜ 546 nm) and red (˜ 656 nm) bands are corresponding to the 2H11/2, 4S3/2 → 4I15/2 and 4F9/2 → 4I15/2 transitions of Er3+ ions. The mechanisms involved in the UC process have been explored with the help of energy level diagram. Moreover, the CIE point (0.31, 0.60) lie in the green colour region which indicates that the developed phosphor have suitable applications in NIR to visible upconverter and in making green light display devices.
Matan, N; Matan, N; Ketsa, S
2013-08-01
This study aimed to examine heat curing effect (30-100°C) on antifungal activities of lime oil and its components (limonene, p-cymene, β-pinene and α-pinene) at concentrations ranging from 100 to 300 μl ml(-1) against Aspergillus niger in microbiological medium and to optimize heat curing of lime oil for efficient mould control on sedge (Lepironia articulata). Broth dilution method was employed to determine lime oil minimum inhibitory concentration, which was at 90 μl ml(-1) with heat curing at 70°C. Limonene, a main component of lime oil, was an agent responsible for temperature dependencies of lime oil activities observed. Response surface methodology was used to construct the mathematical model describing a time period of zero mould growth on sedge as functions of heat curing temperature and lime oil concentration. Heat curing of 90 μl ml(-1) lime oil at 70°C extended a period of zero mould growth on sedge to 18 weeks under moist conditions. Heat curing at 70°C best enhanced antifungal activity of lime oil against A. niger both in medium and on sedge. Heat curing of lime oil has potential to be used to enhance the antifungal safety of sedge products. © 2013 The Society for Applied Microbiology.
Protanomaly without darkened red is deuteranopia with rods.
Shevell, Steven K; Sun, Yang; Neitz, Maureen
2008-11-01
The Rayleigh match, a color match between a mixture of 545+670 nm lights and 589 nm light in modern instruments, is the definitive measurement for the diagnosis of inherited red-green color defects. All trichromats, whether normal or anomalous, have a limited range of 545+670 nm mixtures they perceive to match 589 nm: a typical color-normal match range is about 50-55% of 670 nm in the mixture (deutan mode), while deuteranomals have a range that includes mixtures with less 670 nm than normal and protanomals a range that includes mixtures with more 670 nm than normal. Further, the matching luminance of the 589 nm light for deuteranomals is the same as for normals but for protanomals is below normal. An example of an unexpected Rayleigh match, therefore, is a match range above normal (typical of protanomaly) and a normal luminance setting for 589 nm (typical of deuteranomaly), a match called protanomaly "when the red end of the spectrum is not darkened" [Pickford, R.W. (1950). Three pedigrees for color blindness. Nature, 165, 182.]. In this case, Rayleigh matching does not yield a clear diagnosis. Aside from Pickford, we are aware of only one other report of a similar observer [Pokorny, J., & Smith, V. C. (1981). A variant of red-green color defect. Vision Research, 21, 311-317]; this study predated modern genetic techniques that can reveal the cone photopigment(s) in the red-green range. We recently had the opportunity to conduct genetic and psychophysical tests on such an observer. Genetic results predict he is a deuteranope. His Rayleigh match is consistent with L cones and a contribution from rods. Further, with a rod-suppressing background, his Rayleigh match is characteristic of a single L-cone photopigment (deuteranopia).
Zhu, Qi; Song, Caiyun; Li, Xiaodong; Sun, Xudong; Li, Ji-Guang
2018-04-09
Submicron sized, monodispersed spheres of Mn2+, Yb3+/Er3+ and Mn2+/Yb3+/Er3+ doped α-NaYF4 were easily autoclaved from mixed solutions of the component nitrates and ammonium fluoride (NH4F), in the presence of EDTA-2Na. Detailed characterizations of the resultant phosphors were obtained using XRD, Raman spectroscopy, FE-SEM, HR-TEM, STEM, PLE/PL spectroscopy, and fluorescence decay analysis. Finer structure and better crystal perfection was observed at a higher calcination temperature, and the spherical shape and excellent dispersion of the original particles was retained at temperatures up to 600 °C. Under the 980 nm infrared excitation, the Yb3+/Er3+-doped sample (calcined at 400 °C) exhibits a stronger green emission centered at ∼524 nm (2H11/2 → 4I15/2 transition of Er3+) and a weaker red emission centered at ∼657 nm (4F9/2 → 4I15/2 transition of Er3+). A 200 °C increase in the temperature from 400 °C to 600 °C resulted in the dominant red emission originating from the 4F9/2 → 4I15/2 transition of Er3+, instead of the previously dominant green one. Mn2+ doping induced a remarkable more enhanced intensity at ∼657 nm and ∼667 nm (red emission area) than that at ∼524 nm and ∼546 nm (green emission area), because of the non-radiative energy transfer between Mn2+ and Er3+. However, a poor thermal stability was induced by Mn2+ doping. The observed upconversion luminescence of the samples calcined at 400 °C and 600 °C followed the two photon process and the four photon process, respectively.
Beneficial Utilization of Lime Sludge for Subgrade Stabilization : a Pilot Investigation
DOT National Transportation Integrated Search
2010-06-30
Water plants annually produce thousands of tons of lime sludge from the water treatment procedures. The lime sludge : is then discharged into a retention pond. When the storage limit is reached, lime sludge is usually disposed into : landfills, where...
Beneficial utilization of lime sludge for subgrade stabilization : a pilot investigation.
DOT National Transportation Integrated Search
2010-06-01
Water plants annually produce thousands of tons of lime sludge from the water treatment procedures. The lime sludge : is then discharged into a retention pond. When the storage limit is reached, lime sludge is usually disposed into : landfills, where...
Green Synthesis of Ag-Cu Nanoalloys Using Opuntia ficus- indica
NASA Astrophysics Data System (ADS)
Rocha-Rocha, O.; Cortez-Valadez, M.; Hernández-Martínez, A. R.; Gámez-Corrales, R.; Alvarez, Ramón A. B.; Britto-Hurtado, R.; Delgado-Beleño, Y.; Martinez-Nuñez, C. E.; Pérez-Rodríguez, A.; Arizpe-Chávez, H.; Flores-Acosta, M.
2017-02-01
Bimetallic Ag/Cu nanoparticles have been obtained by green synthesis using Opuntia ficus- indica plant extract. Two synthesis methods were applied to obtain nanoparticles with core-shell and Janus morphologies by reversing the order of precursors. Transmission electronic microscopy revealed size of 10 nm and 20 nm for the core-shell and Janus nanoparticles, respectively. Other small particles with size of up to 2 nm were also observed. Absorption bands attributed to surface plasmon resonance were detected at 440 nm and 500 nm for the core-shell and Janus nanoparticles, respectively. Density functional theory predicted a breathing mode type (BMT) located at low wavenumber due to small, low-energy clusters of (AgCu) n with n = 2 to 9, showing a certain correlation with the experimental one (at 220 cm-1). The dependence of the BMT on the number of atoms constituting the cluster is also studied.
Hydrothermal synthesis infrared to visible upconversion luminescence of SrMoO4: Er3+/Yb3+ phosphor
NASA Astrophysics Data System (ADS)
Sinha, Shriya; Kumar, Kaushal
2018-04-01
The upconversion emission properties in Er3+/Yb3+ doped SrMoO4 phosphor synthesized via hydrothermal method is investigated upon 980 nm laser light excitation. The crystal structure and morphology of the synthesized phosphor are characterized by X-ray diffraction and field emission scanning electron microscopy. The X-ray diffraction pattern suggests that SrMoO4 phosphor has tetragonal phase structure. The phosphor emits strong green (525 and 552 nm) and red (665 nm) UC emissions along with weak blue (410 and 488 nm) and near infrared (798 nm) emission bands. The color emitted from the phosphor is shifted from yellow to green region with increasing the power density from 15 to 65 W/cm2. The result indicates that the present material is suitable for making infrared to visible up-converts and display devices.
Mineral resource of the month: lime
,
2009-01-01
The article presents facts about lime, which is said to be a caustic chemical manufactured from limestone or other calcium carbonates in a kiln at temperatures ranging from 935 to 1,350 degrees Celsius. It states that lime is widely used in industries such as steelmaking, paper production and chemical manufacturing. It also mentions that global lime production amounts up to 280 million metric tons annually. However, it notes that international trade in lime is limited.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klein, T., E-mail: tklein@ifp.uni-bremen.de; Klembt, S.; Institut Néel, Université Grenoble Alpes and CNRS, B.P. 166, 38042 Grenoble
2015-03-21
ZnSe-based electron-beam pumped vertical-cavity surface-emitting lasers for the green (λ = 530 nm) and blue (λ = 462 nm) spectral region have been realized. Structures with and without epitaxial bottom distributed Bragg reflector have been fabricated and characterized. The samples consist of an active region containing 20 quantum wells with a cavity length varying between an optical thickness of 10 λ to 20 λ. The active material is ZnCdSSe in case of the green devices and ZnSe for the blue ones. Room temperature single mode lasing for structures with and without epitaxial bottom mirror with a maximum output power up to 5.9 W (green) and 3.3 W (blue)more » is achieved, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Panlai, E-mail: li_panlai@126.com; Wang, Zhijun, E-mail: wangzj1998@126.com; Yang, Zhiping
2014-12-15
A novel green phosphor SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} is synthesized by a high temperature solid-state method, and its luminescent property is investigated. X-ray diffraction patterns of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} indicate a similarity crystalline phase to SrZn{sub 2}(PO{sub 4}){sub 2}. SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} shows green emission under 369 nm excitation, and the prominent luminescence in green (544 nm) due to {sup 5}D{sub 4}–{sup 7}F{sub 5} transition of Tb{sup 3+}. For the 544 nm emission, excitation spectrum has several excitation band from 200 nm to 400 nm. Emission intensity of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} is influencedmore » by Tb{sup 3+} concentration, and concentration quenching effect of Tb{sup 3+} in SrZn{sub 2}(PO{sub 4}){sub 2} is also observed. With incorporating A{sup +} (A=Li, Na, and K) as compensator charge, the emission intensity of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} can be obviously enhanced. CIE color coordinates of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} locate in the green region. The results indicate this phosphor may be a potential application in white LEDs. - Graphical abstract: SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} can produce green emission under near-UV excitation, and its luminescent properties can be improved by incorporating A{sup +} (A=Li, Na, and K). - Highlights: • SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} can produce green emission under near-UV excitation. • Concentration quenching effect of Tb{sup 3+} in SrZn{sub 2}(PO{sub 4}){sub 2} is observed. • Emission intensities of SrZn{sub 2}(PO{sub 4}){sub 2}:Tb{sup 3+} are enhanced by codoped A{sup +} (A=Li, Na, K)« less
40 CFR 98.190 - Definition of the source category.
Code of Federal Regulations, 2010 CFR
2010-07-01
... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Lime Manufacturing § 98.190 Definition of the source category. (a) Lime manufacturing plants (LMPs) engage in the manufacture of a lime product (e.g., calcium oxide, high-calcium quicklime, calcium hydroxide, hydrated lime, dolomitic quicklime, dolomitic hydrate, or...
[Effects of Lime on Seedling Growth,Yield and Volatile Constituents of Atractylodes lancea].
Zhang, Yan; Miki, Sakurai; Chen, Mei-lan; Takeda, Xiuji; Zhao, Dong-yue; Kang, Li-ping; Guo, Lan-ping
2015-03-01
To investigate the effects of different amounts of lime on yield and quality of Atractylodes lancea, and to provide reference for the herb growing site soil improvement and self-poisoning ease. Add different gradients of lime, and then measure their growth targets, yield and four kinds of volatile constituents content(hinesol, atractylone, β-eudesmol and atractylodin). Volatile constituents yield per plant was calculated. Adding 160 g/m2 lime had a significant role in promoting the growth and yield of herb; Adding 80 g/m2 lime was conducive to the volatile constituents production, and adding lime decreased the atractylone and atractylodin content, while increased the hinesol and β-eudesmol content; Adding 160 g/m2 lime promoted the volatile constituents yield per plant. Adding lime plays a role of neutralize soil pH, antibacteria and prevention incognita, and has a certain degree of ease autotoxicity and obstacle,and then promotes the yield and volatile constituents production of Atractylodes lancea.
Effect of lime concentration on gelatinized maize starch dispersions properties.
Lobato-Calleros, C; Hernandez-Jaimes, C; Chavez-Esquivel, G; Meraz, M; Sosa, E; Lara, V H; Alvarez-Ramirez, J; Vernon-Carter, E J
2015-04-01
Maize starch was lime-cooked at 92 °C with 0.0-0.40% w/w Ca(OH)2. Optical micrographs showed that lime disrupted the integrity of insoluble remnants (ghosts) and increased the degree of syneresis of the gelatinized starch dispersions (GSD). The particle size distribution was monomodal, shifting to smaller sizes and narrower distributions with increasing lime concentration. X-ray patterns and FTIR spectra showed that crystallinity decreased to a minimum at lime concentration of 0.20% w/w. Lime-treated GSD exhibited thixotropic and viscoelastic behaviour. In the linear viscoelastic region the storage modulus was higher than the loss modulus, but a crossover between these moduli occurred in the non-linear viscoelastic region. The viscoelastic properties decreased with increased lime concentration. The electrochemical properties suggested that the amylopectin-rich remnants and the released amylose contained in the continuous matrix was firstly attacked by calcium ions at low lime levels (<0.20% w/w), disrupting the starch gel microstructure. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bartoshesky, J.; Price, R.; DeMuro, J.
In recent years acid deposition has become a serious concern internationally. Scientific literature has documented the acidification of numerous lakes and streams in North America and Scandinavia resulting in the depletion or total loss of fisheries and other aquatic biota. Liming represents the only common corrective practice aimed specifically at remediating an affected acid receptor. This report reviews a range of liming technologies and liming materials, as well as the effect of surface-water liming on water quality and aquatic biota. As background to the liming discussion, the hydrologic cycle and the factors that make surface waters sensitive to acid depositionmore » are also discussed. Finally, a brief review of some of the liming projects that have been conducted, or are currently in operation is presented, giving special emphasis to mitigation efforts in Maryland. Liming has been effectively used to counteract surface-water acidification in parts of Scandinavia, Canada, and the U.S. To date, liming has generally been shown to improve physical and chemical conditions and enhance the biological recovery of aquatic ecosystems affected by acidification.« less
Efficient Green Emission from Wurtzite Al xIn1- xP Nanowires.
Gagliano, L; Kruijsse, M; Schefold, J D D; Belabbes, A; Verheijen, M A; Meuret, S; Koelling, S; Polman, A; Bechstedt, F; Haverkort, J E M; Bakkers, E P A M
2018-06-13
Direct band gap III-V semiconductors, emitting efficiently in the amber-green region of the visible spectrum, are still missing, causing loss in efficiency in light emitting diodes operating in this region, a phenomenon known as the "green gap". Novel geometries and crystal symmetries however show strong promise in overcoming this limit. Here we develop a novel material system, consisting of wurtzite Al x In 1- x P nanowires, which is predicted to have a direct band gap in the green region. The nanowires are grown with selective area metalorganic vapor phase epitaxy and show wurtzite crystal purity from transmission electron microscopy. We show strong light emission at room temperature between the near-infrared 875 nm (1.42 eV) and the "pure green" 555 nm (2.23 eV). We investigate the band structure of wurtzite Al x In 1- x P using time-resolved and temperature-dependent photoluminescence measurements and compare the experimental results with density functional theory simulations, obtaining excellent agreement. Our work paves the way for high-efficiency green light emitting diodes based on wurtzite III-phosphide nanowires.
Green rusts synthesis by coprecipitation of Fe II-Fe III ions and mass-balance diagram
NASA Astrophysics Data System (ADS)
Ruby, Christian; Aïssa, Rabha; Géhin, Antoine; Cortot, Jérôme; Abdelmoula, Mustapha; Génin, Jean-Marie
2006-06-01
A basic solution is progressively added to various mixed Fe II-Fe III solutions. The nature and the relative quantities of the compounds that form can be visualised in a mass-balance diagram. The formation of hydroxysulphate green rust {GR( SO42-)} is preceded by the precipitation of a sulphated ferric basic salt that transforms in a badly ordered ferric oxyhydroxide. Then octahedrally coordinated Fe II species and SO42- anions are adsorbed on the FeOOH surface and GR( SO42-) is formed at the solid/solution interface. By using the same method of preparation, other types of green rust were synthesised, e.g. hydroxycarbonate green rust {GR( CO32-)}. Like other layered double hydroxides, green rusts obey the general chemical formula [ṡ[ṡmHO]x+ with x⩽1/3. Al-substituted hydroxysulphate green rust consists of small hexagonal crystals with a lateral size ˜50 nm, which is significantly smaller than the size of the GR( SO42-) crystals (˜500 nm). To cite this article: C. Ruby et al., C. R. Geoscience 338 (2006).
NASA Astrophysics Data System (ADS)
Lintang, H. O.; Ghazalli, N. F.; Yuliati, L.
2018-04-01
We report on systematic study on vapochromic sensing of ethanol by using phosphorescent trinuclear metal pyrazolate complexes with supramolecular assembly of weak intermolecular metal-metal interactions using 4-(3,5-dimethoxybenzyl)-3,5-dimethyl pyrazole ligand (1) and group 11 metal ions (Cu(I), Ag(I), Au(I)). Upon excitation at 284, the resulting complexes showed emission bands with a peak centered at 616, 473 and 612 nm for 2(Cu), 2(Ag) and 2(Au), respectively. Chemosensor 2(Cu) showed positive response to ethanol vapors in 5 mins by blue-shifting its emission band from 616 to 555 nm and emitting bright orange to green. Otherwise 2(Au) gave shifting from its emission band centered at 612 to 587 nm with Δλ of 25 nm (41%) and color changes from red-orange to light green-orange while 2(Ag) showed quenching in its original emission intensity at 473 nm in 40% with color changes from dark green to less emissive. These results demonstrate that sensing capability of chemosensor 2(Cu) with suitable molecular design of ligand and metal ion in the complex is due to the formation of a weak intermolecular hydrogen bonding interaction of O atom at the methoxy of the benzyl ring with the OH of the vapors at the outside of the molecules.
[Immobilization impact of different fixatives on heavy metals contaminated soil].
Wu, Lie-shan; Zeng, Dong-mei; Mo, Xiao-rong; Lu, Hong-hong; Su, Cui-cui; Kong, De-chao
2015-01-01
Four kinds of amendments including humus, ammonium sulfate, lime, superphosphate and their complex combination were added to rapid immobilize the heavy metals in contaminated soils. The best material was chosen according to the heavy metals' immobilization efficiency and the Capacity Values of the fixative in stabilizing soil heavy metals. The redistributions of heavy metals were determined by the European Communities Bureau of Referent(BCR) fraction distribution experiment before and after treatment. The results were as follows: (1) In the single material treatment, lime worked best with the dosage of 2% compared to the control group. In the compound amendment treatments, 2% humus combined with 2% lime worked best, and the immobilization efficiency of Pb, Cu, Cd, Zn reached 98.49%, 99.40%, 95.86%, 99.21%, respectively. (2) The order of Capacity Values was lime > humus + lime > ammonium sulfate + lime > superphosphate > ammonium sulfate + superphosphate > humus + superphosphate > humus > superphosphate. (3) BCR sequential extraction procedure results indicated that 2% humus combined with 2% lime treatment were very effective in immobilizing heavy metals, better than 2% lime treatment alone. Besides, Cd was activated firstly by 2% humus treatment then it could be easily changed into the organic fraction and residual fraction after the subsequent addition of 2% lime.
DOT National Transportation Integrated Search
2005-08-31
This study investigated the effectiveness of hydrated lime as an antistrip additive for mixes : containing excess baghouse fines. Wet process of lime addition was used without marination. One percent : lime was added to asphalt mixes containing 5.5% ...
George, Scott D.; Baldigo, Barry P.; Lawrence, Gregory B.; Fuller, Randall L.
2018-01-01
Liming techniques are being explored as a means to accelerate the recovery of aquatic biota from decades of acid deposition in many regions. The preservation or restoration of native sportfish populations has typically been the impetus for liming programs, and as such, less attention has been given to its effects on other biological assemblages such as macroinvertebrates. Furthermore, the differing effects of various lime application strategies such as in-stream and watershed applications are not well understood. In 2012, a program was initiated using in-stream and aerial (whole-watershed) liming to improve water quality and Brook Trout (Salvelinus fontinalis) recruitment in three acidified tributaries of a high-elevation Adirondack lake in New York State. Concurrently, macroinvertebrates were sampled annually between 2013 and 2016 at 3 treated sites and 3 untreated reference sites to assess the effects of each liming technique on this community. Despite improvements in water chemistry in all three limed streams, our results generally suggest that neither liming technique succeeded in improving the condition of macroinvertebrate communities. The watershed application caused an immediate and unsustained decrease in the density of macroinvertebrates and increase in the proportion of sensitive taxa. These changes were driven primarily by a one-year 71 percent reduction of the acid-tolerant Leuctra stoneflies and likely represent an initial chemistry shock from the lime application rather than a recovery response. The in-stream applications appeared to reduce the density of macroinvertebrates, particularly in one stream where undissolved lime covered the natural substrate. The close proximity of our study sites to the in-stream application points (50 and 1230 m) may partly explain these negative effects. Our results are consistent with prior studies of in-stream liming which indicate that this technique often fails to restore macroinvertebrate communities to a pre-acidification condition, especially at distances <1.5 km downstream of the lime application point. The inability of either liming technique to improve the condition of macroinvertebrate communities may be partly explained by the persistence of acidic episodes in all three streams. This suggests that in order to be effective, liming programs should attempt to eliminate even temporary episodes of unsuitable water chemistry rather than just meeting minimal criteria the majority of the time. Because watershed liming produced a more stable water chemistry regime than in-stream liming, this technique may have greater future potential to eliminate toxic episodes and accelerate the recovery of acid-impacted macroinvertebrate communities.
Lime sulfur toxicity to broad mite, to its host plants and to natural enemies.
Venzon, Madelaine; Oliveira, Rafael M; Perez, André L; Rodríguez-Cruz, Fredy A; Martins Filho, Sebastião
2013-06-01
An acaricidal effect of lime sulfur has not been demonstrated for Polyphagotarsonemus latus. However, lime sulfur can cause toxicity to natural enemies and to host plants. In this study, the toxicity of different concentrations of lime sulfur to P. latus, to the predatory mite Amblyseius herbicolus and to the predatory insect Chrysoperla externa was evaluated. Additionally, the phytotoxicity of lime sulfur to two P. latus hosts, chili pepper and physic nut plants, was determined. Lime sulfur at a concentration of 9.5 mL L(-1) restrained P. latus population growth. However, this concentration was deleterious to natural enemies. The predatory mite A. herbicolus showed a negative value of instantaneous growth rate, and only 50% of the tested larvae of C. externa reached adulthood when exposed to 10 mL L(-1) . Physic nut had severe injury symptoms when sprayed with all tested lime sulfur concentrations. For chili pepper plants, no phytoxicity was observed at any tested concentration. Lime sulfur might be used for P. latus control on chili pepper but not on physic nut owing to phytotoxicity. Care should be taken when using lime sulfur in view of negative effects on natural enemies. Selective lime sulfur concentration integrated with other management tactics may provide an effective and sustainable P. latus control on chili pepper. © 2012 Society of Chemical Industry.
Removal of phosphate from greenhouse wastewater using hydrated lime.
Dunets, C Siobhan; Zheng, Youbin
2014-01-01
Phosphate (P) contamination in nutrient-laden wastewater is currently a major topic of discussion in the North American greenhouse industry. Precipitation of P as calcium phosphate minerals using hydrated lime could provide a simple, inexpensive method for retrieval. A combination of batch experiments and chemical equilibrium modelling was used to confirm the viability of this P removal method and determine lime addition rates and pH requirements for greenhouse wastewater of varying nutrient compositions. Lime: P ratio (molar ratio of CaMg(OH)₄: PO₄‒P) provided a consistent parameter for estimating lime addition requirements regardless of initial P concentration, with a ratio of 1.5 providing around 99% removal of dissolved P. Optimal P removal occurred when lime addition increased the pH from 8.6 to 9.0, suggesting that pH monitoring during the P removal process could provide a simple method for ensuring consistent adherence to P removal standards. A Visual MINTEQ model, validated using experimental data, provided a means of predicting lime addition and pH requirements as influenced by changes in other parameters of the lime-wastewater system (e.g. calcium concentration, temperature, and initial wastewater pH). Hydrated lime addition did not contribute to the removal of macronutrient elements such as nitrate and ammonium, but did decrease the concentration of some micronutrients. This study provides basic guidance for greenhouse operators to use hydrated lime for phosphate removal from greenhouse wastewater.
Yang, Yongjie; Chen, Jiangmin; Huang, Qina; Tang, Shaoqing; Wang, Jianlong; Hu, Peisong; Shao, Guosheng
2018-02-01
Cadmium (Cd) accumulation in rice is strongly controlled by liming, but information on the use of liming to control Cd accumulation in rice grown in slightly acidic soils is inconsistent. Here, pot experiments were carried out to investigate the mechanisms of liming on Cd accumulation in two rice varieties focusing on two aspects: available/exchangeable Cd content in soils that were highly responsive to liming, and Cd uptake and transport capacity in the roots of rice in terms of Cd accumulation-relative gene expression. The results showed that soil availability and exchangeable iron, manganese, zinc and Cd contents decreased with increased liming, and that genes related to Cd uptake (OsNramp5 and OsIRT1) were sharply up-regulated in the roots of the two rice varieties. Thus, iron, manganese, zinc and Cd contents in rice plants increased under low liming applications but decreased in response to high liming applications. However, yield and rice quantities were only slightly affected. These results indicated that Cd accumulation in rice grown in slightly acidic soils presents a contradictory dynamic equilibrium between Cd uptake capacity by roots and soil Cd immobilisation in response to liming. The enhanced Cd uptake capacity under low liming dosages increases risks to human health. Copyright © 2017 Elsevier Ltd. All rights reserved.
Evidence for carbon sequestration by agricultural liming
NASA Astrophysics Data System (ADS)
Hamilton, Stephen K.; Kurzman, Amanda L.; Arango, Clay; Jin, Lixin; Robertson, G. Philip
2007-06-01
Agricultural lime can be a source or a sink for CO2, depending on whether reaction occurs with strong acids or carbonic acid. Here we examine the impact of liming on global warming potential by comparing the sum of Ca2+ and Mg2+ to carbonate alkalinity in soil solutions beneath unmanaged vegetation versus limed row crops, and of streams and rivers in agricultural versus forested watersheds, mainly in southern Michigan. Soil solutions sampled by tension indicated that lime can act as either a source or a sink for CO2. However, infiltrating waters tended to indicate net CO2 uptake, as did tile drainage waters and streams draining agricultural watersheds. As nitrate concentrations increased in infiltrating waters, lime switched from a net CO2 sink to a source, implying nitrification as a major acidifying process. Dissolution of lime may sequester CO2 equal to roughly 25-50% of its C content, in contrast to the prevailing assumption that all of the carbon in lime becomes CO2. The ˜30 Tg/yr of agricultural lime applied in the United States could thus sequester up to 1.9 Tg C/yr, about 15% of the annual change in the U.S. CO2 emissions (12 Tg C/yr for 2002-2003). The implications of liming for atmospheric CO2 stabilization should be considered in strategies to mitigate global climate change.
[Study on the traditional lime mortar from the memorial archway in the southern Anhui province].
Wei, Guo-Feng; Sun, Sheng; Wang, Cheng-Xing; Zhang, Bing-Jian; Chen, Xi-Min
2013-07-01
The traditional lime mortar was investigated by means of scanning electron microscope (SEM), X-ray diffractometry and Fourier transform infrared spectrometry (FTIR). The results show that the mortar from the memorial archway in the southern Anhui province was the organic-inorganic composite materials composed of lime with tung oil or sticky rice. It was found that the excellent performance of the tung oil-lime mortar can be explained by the compact lamellar organic-inorganic composite structure that was produced by carbonization reaction of lime, cross-linking reactions of tung oil and oxygen and complexing reaction of Ca2+ and -COO-. The compact micro-structure of sticky rice-lime mortar, which was produced due to carbonation process of lime controlled by amylopectin, should be the cause of the good performance of this kind of organic-inorganic mortar.
Discipline in Organizations: A Field Study.
1982-09-01
with the job and supervisor? In this study we will also investigate discipline from an attributional perspective. Mitchell, Green , & Wood (I%1) hove...representing two major d mr nm stability and locus of control. Mitchell, Green , & Wood (1980 and Green & Mitchell (I0) preent a discussion of the kinds...Attributions to external causes prompt the leader to focus on changing the situation. In addition, Mitchell, Green , & Wood (1981) indicate that if the
46 CFR 148.230 - Calcium oxide (lime, unslaked).
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 5 2011-10-01 2011-10-01 false Calcium oxide (lime, unslaked). 148.230 Section 148.230... MATERIALS THAT REQUIRE SPECIAL HANDLING Special Requirements for Certain Materials § 148.230 Calcium oxide (lime, unslaked). (a) When transported by barge, unslaked lime (calcium oxide) must be carried in an...
46 CFR 148.230 - Calcium oxide (lime, unslaked).
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 5 2014-10-01 2014-10-01 false Calcium oxide (lime, unslaked). 148.230 Section 148.230... MATERIALS THAT REQUIRE SPECIAL HANDLING Special Requirements for Certain Materials § 148.230 Calcium oxide (lime, unslaked). (a) When transported by barge, unslaked lime (calcium oxide) must be carried in an...
46 CFR 148.230 - Calcium oxide (lime, unslaked).
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 5 2012-10-01 2012-10-01 false Calcium oxide (lime, unslaked). 148.230 Section 148.230... MATERIALS THAT REQUIRE SPECIAL HANDLING Special Requirements for Certain Materials § 148.230 Calcium oxide (lime, unslaked). (a) When transported by barge, unslaked lime (calcium oxide) must be carried in an...
46 CFR 148.230 - Calcium oxide (lime, unslaked).
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 5 2013-10-01 2013-10-01 false Calcium oxide (lime, unslaked). 148.230 Section 148.230... MATERIALS THAT REQUIRE SPECIAL HANDLING Special Requirements for Certain Materials § 148.230 Calcium oxide (lime, unslaked). (a) When transported by barge, unslaked lime (calcium oxide) must be carried in an...
Angiographic Method Using Green Porphyrinew In Primmate Eyes
Miller, Joan W.; Young, Lucy H.Y.; Gragoudas, Evangelos S.
1998-01-13
An angiographic method to observe the condition of blood vessels, including neovasculature in the eyes of living primates using green porphyrins and light at a wavelength of 550-700 nm to effect fluorescence is disclosed.
Synthesis of brushite particles in reverse microemulsions of the biosurfactant surfactin.
Maity, Jyoti Prakash; Lin, Tz-Jiun; Cheng, Henry Pai-Heng; Chen, Chien-Yen; Reddy, A Satyanarayana; Atla, Shashi B; Chang, Young-Fo; Chen, Hau-Ren; Chen, Chien-Cheng
2011-01-01
In this study the "green chemistry" use of the biosurfactant surfactin for the synthesis of calcium phosphate using the reverse microemulsion technique was demonstrated. Calcium phosphates are bioactive materials that are a major constituent of human teeth and bone tissue. A reverse microemulsion technique with surfactin was used to produce nanocrystalline brushite particles. Structural diversity (analyzed by SEM and TEM) resulted from different water to surfactin ratios (W/S; 250, 500, 1000 and 40,000). The particle sizes were found to be in the 16-200 nm range. Morphological variety was observed in the as-synthesized microemulsions, which consisted of nanospheres (~16 nm in diameter) and needle-like (8-14 nm in diameter and 80-100 nm in length) noncalcinated particles. However, the calcinated products included nanospheres (50-200 nm in diameter), oval (~300 nm in diameter) and nanorod (200-400 nm in length) particles. FTIR and XRD analysis confirmed the formation of brushite nanoparticles in the as-synthesized products, while calcium pyrophosphate was produced after calcination. These results indicate that the reverse microemulsion technique using surfactin is a green process suitable for the synthesis of nanoparticles.
Effect of LED irradiation on the ripening and nutritional quality of postharvest banana fruit.
Huang, Jen-Yi; Xu, Fengying; Zhou, Weibiao
2018-04-24
With the ability to tailor wavelengths necessary to the photosynthetically active radiation spectrum of plant pigments, light-emitting diodes (LEDs) offer vast possibilities in horticultural lighting. The influence of LED light irradiation on major postharvest features of banana was investigated. Mature green bananas were treated daily with selected blue (464-474 nm), green (515-525 nm) and red (617-627 nm) LED lights for 8 days, and compared with non-illuminated control. The positive effect of LED lighting on the acceleration of ripening in bananas was greatest for blue, followed by red and green. Under the irradiation of LED lights, faster peel de-greening and flesh softening, and increased ethylene production and respiration rate in bananas were observed during storage. Furthermore, the accumulations of ascorbic acid, total phenols, and total sugars in banana fruit were enhanced by LED light exposure. LED light treatment can induce the ripening of bananas and improve their quality and nutrition potential. These findings might provide new chemical-free strategies to shorten the time to ripen banana after harvest by using LED light source. This article is protected by copyright. All rights reserved.
Choi, Cheol Young; Shin, Hyun Suk; Choi, Young Jae; Kim, Na Na; Lee, Jehee; Kil, Gyung-Suk
2012-11-01
The present study aimed to test starvation-induced oxidative stress in the cinnamon clownfish Amphiprion melanopus illuminated by light-emitting diodes (LEDs): red (peak at 630 nm), green (peak at 530 nm), and blue (peak at 450 nm) within a visible light. We investigated the oxidative stress induced by starvation for 12 days during illumination with 3 LED light spectra through measuring antioxidant enzyme (superoxide dismutase [SOD] and catalase [CAT]) mRNA expression and activity; CAT western blotting; and measuring lipid peroxidation [LPO]), plasma H(2)O(2), lysozyme, glucose, alanine aminotransferase (AlaAT), aspartate aminotransferase (AspAT), and melatonin levels. In green and blue lights, expression and activity of antioxidant enzyme mRNA were significantly lower than those of other light spectra, results that are in agreement with CAT protein expression level by western blot analysis. Also, in green and blue lights, plasma H(2)O(2), lysozyme, glucose, AlaAT, AspAT, and melatonin levels were significantly lower than those in other light spectra. These results indicate that green and blue LEDs inhibit oxidative stress and enhance immune function in starved cinnamon clownfish. Copyright © 2012 Elsevier Inc. All rights reserved.
The Isolation and Characterization of Human Prostate Cancer Stem Cells
2015-05-01
GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance
The economic pre-treatment of coal mine drainage water with caustic and ozone.
Boyden, B H; Nador, L; Addleman, S; Jeston, L
2017-09-01
Coal mine drainage waters are low in pH with varying amounts of iron and manganese and are generally brackish. The Austar Coal Mine in NSW, Australia, sought alternatives to their current lime dosing as the pre-treatment before the downstream reverse osmosis plant. Undesirable operating aspects of the current system include manganese and gypsum scaling/fouling, the need for anti-scalants and reduced water recovery. Thirteen processes for acid mine drainage were initially considered. The preferred process of caustic and ozone for Mn(II) oxidation was pilot tested at up to 0.74 kL/hr at the mine site. Under proper conditions and no aeration, about 81 per cent of the Fe could be removed (initially at 156 mg/L) as green rust. Supplemental aeration followed first-order kinetics and allowed 99.9 per cent Fe(II) oxidation and removal but only with a hydraulic residence time of about 47 minutes. The addition of supplemental Cu catalyst improved Fe removal. Ozone applied after caustic was effective in stoichiometrically oxidising recalcitrant Mn(II) and any remaining Fe(II). Control of the ozonation was achieved using the oxidation reduction potential during oxidation of the Mn(II) species. The use of caustic, followed by ozone, proved economically comparable to the current lime pre-treatment.
Effects of corn cob ash on lime stabilized lateritic soil
NASA Astrophysics Data System (ADS)
Nnochiri, Emeka Segun
2018-03-01
This study assesses the effects of Corn Cob Ash (CCA) on lime-stabilized lateritic soil. Preliminary tests were carried out on the natural soil sample for purpose of identification and classification. Lime being the main stabilizing material was thoroughly mixed with the soil sample to determine the optimum lime requirement of the sample as a basis for evaluating the effects of the CCA. The optimum lime requirement was 10%. The CCA was thereafter added to the lime stabilized soil in varying proportions of 2, 4, 6, 8 and 10%. Unsoaked CBR increased from 83% at 0% CCA to highest value of 94% at 4% CCA. Unconfined Compressive Strength (UCS) values increased from 1123kN/m2 at 0% CCA to highest value of 1180kN/m2 at 4% CCA. It was therefore concluded that CCA can serve as a good complement for lime stabilization in lateritic soil.
Characteristic Asphalt Concrete Wearing Course (ACWC) Using Variation Lime Filler
NASA Astrophysics Data System (ADS)
Permana, R. A.; Pramesti, F. P.; Setyawan, A.
2018-03-01
This research use of lime filler Sukaraja expected add durability layers of concrete pavement is asphalt damage caused by the weather and load traffic. This study attempts to know how much value characteristic Marshall on a mixture of concrete asphalt using lime filler. This research uses experimental methods that is with a pilot to get results, thus will look filler utilization lime on construction concrete asphalt variation in filler levels 2 %, 3 %, 4 %.The results showed that the use of lime filler will affect characteristic a mixture of concrete asphalt. The more filler chalk used to increase the value of stability. On the cretaceous filler 2 % value of stability is 1067,04 kg. When lime filler levels added to the levels of filler 4 %, the value of stability increased to 1213,92 kg. The flexibility increased the number of filler as levels lime 2 % to 4 % suggests that are conducted more stiff mix.
NASA Astrophysics Data System (ADS)
Tiecheng, Yan; Xingyuan, Zhang; Hongping, Yang
2018-03-01
This study describes an analytical comparison of the engineering characteristics of two-lime waste tire particle soil and soil with lime/loess ratio of 3:7 using density measurements, results of indoor consolidation tests, and direct shear tests to examine the strength and deformation characteristics. It investigates the engineering performance of collapsible loess treated with waste tire particles and lime. The results indicate that (1) the shear strength of the two-lime waste tire particle soils increases continuously with soil age; and (2) the two-lime waste tire particle soils are light-weight, strong, and low-deformation soils, and can be applied primarily to improve the foundation soil conditions in areas with collapsible loess soils. This could address the problem of used tire disposal, while providing a new method to consider and manage collapsible loess soils.
46 CFR 148.04-23 - Unslaked lime in bulk.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 5 2010-10-01 2010-10-01 false Unslaked lime in bulk. 148.04-23 Section 148.04-23... HAZARDOUS MATERIALS IN BULK Special Additional Requirements for Certain Material § 148.04-23 Unslaked lime in bulk. (a) Unslaked lime in bulk must be transported in unmanned, all steel, double-hulled barges...
27 CFR 9.27 - Lime Kiln Valley.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Lime Kiln Valley. 9.27... OF THE TREASURY LIQUORS AMERICAN VITICULTURAL AREAS Approved American Viticultural Areas § 9.27 Lime Kiln Valley. (a) Name. The name of the viticultural area described in this section is “Lime Kiln Valley...
77 FR 48541 - Notice of Lodging of Consent Decree Under the Clean Air Act
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-14
... given that on July 20, 2012, a proposed Consent Decree in United States v. Carmeuse Lime, Inc., Civil... 40 CFR 52.21; the New Source Performance Standards for Lime Manufacturing Plants (``Lime NSPS....344; the National Emission Standards for Hazardous Air Pollutants for Lime Manufacturing Plants...
40 CFR 60.340 - Applicability and designation of affected facility.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Performance for Lime Manufacturing Plants § 60.340 Applicability and designation of affected facility. (a) The provisions of this subpart are applicable to each rotary lime kiln used in the manufacture of lime. (b) The provisions of this subpart are not applicable to facilities used in the manufacture of lime at kraft pulp...
40 CFR 180.1231 - Lime; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Lime; exemption from the requirement... From Tolerances § 180.1231 Lime; exemption from the requirement of a tolerance. An exemption from the requirement of a tolerance is established for residues of lime. [70 FR 33363, June 8, 2005] ...
Moon, Young Hwan; Madsen, Lee; Chung, Chang-Ho; Kim, Doman; Day, Donal F
2015-02-01
We have previously demonstrated the production of glucooligosaccharides via a fermentation of sucrose with Leuconostoc mesenteroides NRRL B-742 using sodium hydroxide (NaOH) to control the pH. Because NaOH is expensive, we sought to minimize the cost of our process by substituting hydrated lime and saccharate of lime (lime sucrate) in its place. The yield of glucooligosaccharides using either 5 % lime (41.4 ± 0.5 g/100 g) or 5 % lime sucrate (40.0 ± 1.4 g/100 g) were both similar to the NaOH control (42.4 ± 1.5 g/100 g). Based on this, it appears that the cost associated with pH control in our process can be reduced by a factor of approximately 2.4 using lime instead of NaOH. Because our chromatographic stage is based on a Ca(2+)-form resin to separate glucooligosaccharides, the use of lime not only negates the need for costly de-salting via ion-exchange (elimination of two ion-exchange sections) prior to separation, but also greatly reduces the resin regeneration cost.
Yamashita, Takahiro; Aketo, Tsuyoshi; Minowa, Nobutaka; Sugimoto, Kiyomi; Yokoyama, Hiroshi; Ogino, Akifumi; Tanaka, Yasuo
2013-01-01
An agent synthesized from amorphous silica and hydrated lime (CSH-lime) was investigated for its ability to simultaneously remove the colour, phosphorus and disinfection from the effluents from wastewater treatment plants on swine farms. CSH-lime removed the colour and phosphate from the effluents, with the colour-removal effects especially high at pH 12, and phosphorous removal was more effective in strongly alkaline conditions (pH > 10). Colour decreased from 432 +/-111 (mean +/- SD) to 107 +/- 41 colour units and PO4(3-)P was reduced from 45 +/- 39 mg/L to undetectable levels at the CSH-lime dose of 2.0% w/v. Moreover, CSH-lime reduced the total organic carbon from 99.0 to 37.9 mg/L at the dose of 2.0% w/v and was effective at inactivating total heterotrophic and coliform bacteria. However, CSH-lime did not remove nitrogen compounds such as nitrite, nitrate and ammonium. Colour was also removed from dye solutions by CSH-lime, at the same dose.
Phytochemical fingerprints of lime honey collected in serbia.
Gašić, Uroš; Šikoparija, Branko; Tosti, Tomislav; Trifković, Jelena; Milojković-Opsenica, Dušanka; Natić, Maja; Tešić, Živoslav
2014-01-01
Composition of phenolic compounds and the sugar content were determined as the basis for characterization of lime honey from Serbia. Particular attention was given to differences in phytochemical profiles of ripe and unripe lime honey and lime tree nectar. Melissopalynological analysis confirmed domination of Tilia nectar in all analyzed samples. Phenolic acids, abscisic acid, flavonoids, and flavonoid glycosides were determined by means of ultra-HPLC coupled with a hybrid mass spectrometer (UHPLC-OrbiTrap). Sugar content was determined using high-performance anion-exchange chromatography with amperometric detection. Similar phenolic compounds characterized unripe and ripe honeys, while the lime tree nectar profile showed notable differences. Compared to lime tree nectar, a high amount of chrysin, pinocembrin, and galangin were detected in both ripe and unripe lime honey. Fructose and glucose were the major constituents of all investigated samples, and amounts were within the limits established by European Union legislation. Sucrose content in the nectar sample was up to two-fold higher when compared to all honey samples. Isomaltose and gentiobiose with turanose content were different in analyzed production stages of lime honey.
NASA Astrophysics Data System (ADS)
Estabragh, A. R.; Bordbar, A. T.; Parsaee, B.; Eskandari, Gh.
2009-04-01
Using Lime as an additive material to clayey soil is one of the best effective technique in building the soil structures to get some purposes such as soil stabilization, soil reinforcement and decreasing soil swelling. In this research the effect of Lime on geotechnical characteristics of a clayey soil was investigated. Soil specimen types used in this study were consisted of clayey soil as the control treatment and clay mixed with different weight fractions of lime, 4, 6, 8 & 10 percent. Some experiments such as CBR, atterburg limits, compaction, consolidation and swelling was conducted on specimens. Results revealed that adding lime to soil would change its physical and mechanical properties. Adding lime increase the compression strength and consolidation coefficient and decrease swelling potential and maximum dry density. According to the results, Atterburg experiments show that presence of lime in soil increase the liquid limit of low plasticity soil and decrease the liquid limit of high plasticity soil, but totally it decreases the plasticity index of soils. Key words: soil stabilization, lime, compression strength, swelling, atterburg limits, compaction
Effects of Palm Kernel Shell Ash on Lime-Stabilized Lateritic Soil
NASA Astrophysics Data System (ADS)
Nnochiri, Emeka Segun; Ogundipe, Olumide M.; Oluwatuyi, Opeyemi E.
2017-09-01
The research investigated the effects of palm kernel shell ash (PKSA) on lime-stabilized lateritic soil. Preliminary tests were performed on three soil samples, i.e., L1, L2 and L3 for identification; the results showed that L1 was A-7-6, L2 was A-7-6, and L3 was A-7-6. The optimum amount of lime for each of the soil samples was achieved. The optimum amount for L1 was 10%, for L2, 8% and for L3, 10%; at these values they recorded the lowest plasticity indexes. The further addition of PKSA was performed by varying the amount of PKSA and lime added to each of the soil samples. The addition of 4% PKSA+ 6% lime, the addition of 4% PKSA + 4% lime, and the addition of 4% PKSA + 6% lime increased the California Bearing Ratio (CBR) to the highest values for L1, L2 and L3 from 8.20%. It was concluded that PKSA can be a suitable complement for lime stabilization in lateritic soil.
Schotsmans, Eline M J; Fletcher, Jonathan N; Denton, John; Janaway, Robert C; Wilson, Andrew S
2014-05-01
An increased number of police enquiries involving human remains buried with lime have demonstrated the need for more research into the effect of different types of lime on cadaver decomposition and its micro-environment. This study follows previous studies by the authors who have investigated the effects of lime on the decay of human remains in laboratory conditions and 6 months of field experiments. Six pig carcasses (Sus scrofa), used as human body analogues, were buried without lime with hydrated lime (Ca(OH)2) and quicklime (CaO) in shallow graves in sandy-loam soil in Belgium and recovered after 17 and 42 months of burial. Analysis of the soil, lime and carcasses included entomology, pH, moisture content, microbial activity, histology and lime carbonation. The results of this study demonstrate that despite conflicting evidence in the literature, the extent of decomposition is slowed down by burial with both hydrated lime and quicklime. The more advanced the decay process, the more similar the degree of liquefaction between the limed and unlimed remains. The end result for each mode of burial will ultimately result in skeletonisation. This study has implications for the investigation of clandestine burials, for a better understanding of archaeological plaster burials and potentially for the interpretation of mass graves and management of mass disasters by humanitarian organisation and DVI teams. Copyright © 2014. Published by Elsevier Ireland Ltd.
Photoluminescence and afterglow luminescence properties of a green-emitting Na2BeGeO4:Mn2+ phosphor
NASA Astrophysics Data System (ADS)
Lu, Jie; Shen, Linjiang
2018-07-01
Recently, developing free rare-earth (RE) doped afterglow phosphors has received great attentions in the lighting field. In this work, we prepare and report a RE-free phosphor, Na2BeGeO4:Mn2+, which can simultaneously emit the green fluorescence and afterglow luminescence upon excitation at UV light. Our results reveal that the as-prepared samples crystallize in orthorhombic type with the space group of Pmn21 (31). The green emission is a broad band centered at 525 nm, corresponds to the 4T1(4G)-6A1(6S) transition of Mn2+ ions. After exposing to a 254 nm UV lamp for 10 min, the green afterglow luminescence seen with naked eyes can last more than 5 h. Together with the structural analysis and thermoluminescence (TL) spectra, the afterglow luminescence mechanism is also discussed in this work.
Rothwell, Shane A.; Elphinstone, E. David; Dodd, Ian C.
2015-01-01
To meet future requirements for food production, sustainable intensive agricultural systems need to optimize nutrient availability to maximize yield, traditionally achieved by maintaining soil pH within an optimal range (6–6.5) by applying lime (calcium carbonate). However, a field trial that applied recommended liming rates to a sandy loam soil (increasing soil pH from 5.5 to 6.2) decreased pod yield of field bean (Vicia faba L. cv. Fuego) by ~30%. Subsequent pot trials, with liming that raised soil pH to 6.3–6.7, reduced stomatal conductance (g s) by 63, 26, and 59% in V. faba, bean (Phaseolus vulgaris), and pea (Pisum sativum), respectively. Furthermore, liming reduced shoot dry biomass by 16–24% in these species. Ionomic analysis of root xylem sap and leaf tissue revealed a decrease in phosphorus concentration that was correlated with decreased g s: both reductions were partially reversed by adding superphosphate fertilizer. Further analysis of pea suggests that leaf gas exchange was reduced by a systemic increase (roots, xylem sap, and leaves) in the phytohormone abscisic acid (ABA) in response to lime-induced suboptimal plant phosphorus concentrations. Supplying synthetic ABA via the transpiration stream to detached pea leaves, at the same xylem sap concentrations induced by liming, decreased transpiration. Furthermore, the g s of the ABA-deficient mutant pea wilty was unresponsive to liming, apparently confirming that ABA mediates some responses to low phosphorus availability caused by liming. This research provides a detailed mechanistic understanding of the physiological processes by which lime application can limit crop yields, and questions the suitability of current liming recommendations. PMID:25740925
Similar resilience attributes in lakes with different management practices
Baho, Didier L.; Drakare, Stina; Johnson, Richard K.; Allen, Craig R.; Angeler, David G.
2014-01-01
Liming has been used extensively in Scandinavia and elsewhere since the 1970s to counteract the negative effects of acidification. Communities in limed lakes usually return to acidified conditions once liming is discontinued, suggesting that liming is unlikely to shift acidified lakes to a state equivalent to pre-acidification conditions that requires no further management intervention. While this suggests a low resilience of limed lakes, attributes that confer resilience have not been assessed, limiting our understanding of the efficiency of costly management programs. In this study, we assessed community metrics (diversity, richness, evenness, biovolume), multivariate community structure and the relative resilience of phytoplankton in limed, acidified and circum-neutral lakes from 1997 to 2009, using multivariate time series modeling. We identified dominant temporal frequencies in the data, allowing us to track community change at distinct temporal scales. We assessed two attributes of relative resilience (cross-scale and within-scale structure) of the phytoplankton communities, based on the fluctuation frequency patterns identified. We also assessed species with stochastic temporal dynamics. Liming increased phytoplankton diversity and richness; however, multivariate community structure differed in limed relative to acidified and circum-neutral lakes. Cross-scale and within-scale attributes of resilience were similar across all lakes studied but the contribution of those species exhibiting stochastic dynamics was higher in the acidified and limed compared to circum-neutral lakes. From a resilience perspective, our results suggest that limed lakes comprise a particular condition of an acidified lake state. This explains why liming does not move acidified lakes out of a “degraded” basin of attraction. In addition, our study demonstrates the potential of time series modeling to assess the efficiency of restoration and management outcomes through quantification of the attributes contributing to resilience in ecosystems.
NASA Astrophysics Data System (ADS)
dos Santos, J. F. M.; Terra, I. A. A.; Astrath, N. G. C.; Guimarães, F. B.; Baesso, M. L.; Nunes, L. A. O.; Catunda, T.
2015-02-01
Trivalent Tb-doped materials exhibit strong emission in the green and weak emission in the UV-blue levels. Usually, this behavior is attributed to the cross relaxation (CR) process. In this paper, the luminescence properties of Tb3+-doped low silica calcium aluminosilicate glasses are analyzed for UV (λexc = 325 nm) and visible (488 nm) excitations. Under 325 nm excitation, the intensity of green luminescence increases proportionally to Tb3+ concentration. However, the blue luminescence intensity is strongly reduced with the increase of concentration from 0.5-15.0 wt. %. In the case of 488 nm excitation, a saturation behavior of the green emission is observed at intensities two orders of magnitude smaller than expected for bleaching of the ground state population. Using a rate equation model, we showed that this behavior can be explained by an excited state absorption cross section two orders of magnitude larger than the ground state absorption. The blue emission is much weaker than expected from our rate equations (325 nm and 488 nm excitation). We concluded that only the CR process cannot explain the overall feature of measured luminescence quenching in the wide range of Tb3+ concentrations. Cooperative upconversion from a pair of excited ions (5D3:5D3 or 5D3:5D4) and other mechanisms involving upper lying states (4f5d, charge transfer, host matrix, defects, etc.) may play a significant role.
SrMoO4:Er3+-Yb3+ upconverting phosphor for photonic and forensic applications
NASA Astrophysics Data System (ADS)
Soni, Abhishek Kumar; Rai, Vineet Kumar
2016-08-01
The Er3+-Yb3+ codoped strontium molybdate (SrMoO4) phosphors have been synthesized via chemical co-precipitation method by adding ammonium hydroxide as a base reagent. The phase, crystal structure and formation of spindle-like particles present in the prepared phosphors have been recognized by using the X-ray powder diffraction (XRPD) and Field emission scanning electron microscopy (FE-SEM) techniques. The Fourier transform infrared (FTIR) spectroscopy of the developed phosphors has been analyzed to mark the different functional groups present in synthesized phosphors. The multicolour upconversion emissions observed upon excitation with 980 nm and 808 nm laser diode have been explained on the basis of dopants ions concentration, pump power dependence, energy level structure and decay curve analysis. The colour co-ordinate study confirmed that the codoped phosphor emits non-tunable green colour when excited with the 980 nm laser diode, whereas it shows the colour tunability from yellow to green region upon excitation with the 808 nm laser diode. The applicability of non-tunable green colour emission has been demonstrated in the security ink and latent finger print detection. This shows the utility of the developed phosphors in the photonic and forensic applications.
NASA Astrophysics Data System (ADS)
Wang, Yu; Akiyama, Hidefumi; Terakado, Kanako; Nakatsu, Toru
2013-08-01
Firefly bioluminescence has attracted great interest because of its high quantum yield and intriguing modifiable colours. Modifications to the structure of the enzyme luciferase can change the emission colour of firefly bioluminescence, and the mechanism of the colour change has been intensively studied by biochemists, structural biologists, optical physicists, and quantum-chemistry theorists. Here, we report on the quantitative spectra of firefly bioluminescence catalysed by wild-type and four site-directed mutant luciferases. While the mutation caused different emission spectra, the spectra differed only in the intensity of the green component (λmax ~ 560 nm). In contrast, the orange (λmax ~ 610 nm) and red (λmax ~ 650 nm) components present in all the spectra were almost unaffected by the modifications to the luciferases and changes in pH. Our results reveal that the intensity of the green component is the unique factor that is influenced by the luciferase structure and other reaction conditions.
Yang, T T; Kain, S R; Kitts, P; Kondepudi, A; Yang, M M; Youvan, D C
1996-01-01
The green fluorescent protein (GFP) from the jellyfish, Aequorea victoria, has become a versatile reporter for monitoring gene expression and protein localization in a variety of cells and organisms. GFP emits bright green light (lambda max = 510 nm) when excited with ultraviolet (UV) or blue light (lambda max = 395 nm, minor peak at 470 nm). The chromophore in GFP is intrinsic to the primary structure of the protein, and fluorescence from GFP does not require additional gene products, substrates or other factors. GFP fluorescence is stable, species-independent and can be monitored noninvasively using the techniques of fluorescence microscopy and flow cytometry [Chalfie et al., Science 263 (1994) 802-805; Stearns, Curr. Biol. 5 (1995) 262-264]. The protein appears to undergo an autocatalytic reaction to create the fluorophore [Heim et al., Proc. Natl. Acad. Sci. USA 91 (1994) 12501-12504] in a process involving cyclization of a Tyr66 aa residue. Recently [Delagrave et al., Bio/Technology 13 (1995) 151-154], a combinatorial mutagenic strategy was targeted at aa 64 through 69, which spans the chromophore of A. victoria GFP, yielding a number of different mutants with red-shifted fluorescence excitation spectra. One of these, RSGFP4, retains the characteristic green emission spectra (lambda max = 505 nm), but has a single excitation peak (lambda max = 490 nm). The fluorescence properties of RSGFP4 are similar to those of another naturally occurring GFP from the sea pansy, Renilla reniformis [Ward and Cormier, Photobiochem. Photobiol. 27 (1978) 389-396]. In the present study, we demonstrate by fluorescence microscopy that selective excitation of A. victoria GFP and RSGFP4 allows for spectral separation of each fluorescent signal, and provides the means to image these signals independently in a mixed population of bacteria or mammalian cells.
40 CFR 63.7082 - What parts of my plant does this subpart cover?
Code of Federal Regulations, 2010 CFR
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Hazardous Air Pollutants for Lime Manufacturing Plants... applies to each existing or new lime kiln(s) and their associated cooler(s), and processed stone handling (PSH) operations system(s) located at an LMP that is a major source. (b) A new lime kiln is a lime kiln...
40 CFR 98.192 - GHGs to report.
Code of Federal Regulations, 2010 CFR
2010-07-01
... GREENHOUSE GAS REPORTING Lime Manufacturing § 98.192 GHGs to report. You must report: (a) CO2 process emissions from lime kilns. (b) CO2 emissions from fuel combustion at lime kilns. (c) N2O and CH4 emissions from fuel combustion at each lime kiln. You must report these emissions under 40 CFR part 98, subpart C...
40 CFR 180.1232 - Lime-sulfur; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Lime-sulfur; exemption from the... Exemptions From Tolerances § 180.1232 Lime-sulfur; exemption from the requirement of a tolerance. An exemption from the requirement of a tolerance is established for residues of lime-sulfur. [70 FR 33363, June...
40 CFR 180.1232 - Lime-sulfur; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Lime-sulfur; exemption from the... Exemptions From Tolerances § 180.1232 Lime-sulfur; exemption from the requirement of a tolerance. An exemption from the requirement of a tolerance is established for residues of lime-sulfur. [70 FR 33363, June...
40 CFR 180.1232 - Lime-sulfur; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Lime-sulfur; exemption from the... Exemptions From Tolerances § 180.1232 Lime-sulfur; exemption from the requirement of a tolerance. An exemption from the requirement of a tolerance is established for residues of lime-sulfur. [70 FR 33363, June...
40 CFR 180.1232 - Lime-sulfur; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Lime-sulfur; exemption from the... Exemptions From Tolerances § 180.1232 Lime-sulfur; exemption from the requirement of a tolerance. An exemption from the requirement of a tolerance is established for residues of lime-sulfur. [70 FR 33363, June...
40 CFR 180.1232 - Lime-sulfur; exemption from the requirement of a tolerance.
Code of Federal Regulations, 2013 CFR
2013-07-01
... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Lime-sulfur; exemption from the... Exemptions From Tolerances § 180.1232 Lime-sulfur; exemption from the requirement of a tolerance. An exemption from the requirement of a tolerance is established for residues of lime-sulfur. [70 FR 33363, June...
1981-01-01
exchange and diffusion systems have been studied. The approaches we have tried at HRL include: (1) Li2SO2-K2so4 eutectic salt melt/soda lime glass (2...LiC1-KCL eutectic salt melt/soda lime glass (3) Ag metal field-assisted diffusion (solid phase)/soda lime glass (4) AgNO3 melt/soda lime glass (with...measurements were made of the throughput of guides formed by the ion exchange of soda lime glass in Li2SO4-K2S04 eutectic salt baths. The results of the
1980-12-01
thousand tons by the year 2040. Much of this increased consumption will be lime used in flue gas desulfurization . A. Market Areas In addition to local...increased consumption will result from lime consumed in lime and limestone flue gas desulfur - ization (FGD) installation processes. During the period 2000...is the use of lime and limestone in flue gas desulfu- rization processes. Lime scrubbers for power plants and other industrial plants have also
The modern Japanese color lexicon.
Kuriki, Ichiro; Lange, Ryan; Muto, Yumiko; Brown, Angela M; Fukuda, Kazuho; Tokunaga, Rumi; Lindsey, Delwin T; Uchikawa, Keiji; Shioiri, Satoshi
2017-03-01
Despite numerous prior studies, important questions about the Japanese color lexicon persist, particularly about the number of Japanese basic color terms and their deployment across color space. Here, 57 native Japanese speakers provided monolexemic terms for 320 chromatic and 10 achromatic Munsell color samples. Through k-means cluster analysis we revealed 16 statistically distinct Japanese chromatic categories. These included eight chromatic basic color terms (aka/red, ki/yellow, midori/green, ao/blue, pink, orange, cha/brown, and murasaki/purple) plus eight additional terms: mizu ("water")/light blue, hada ("skin tone")/peach, kon ("indigo")/dark blue, matcha ("green tea")/yellow-green, enji/maroon, oudo ("sand or mud")/mustard, yamabuki ("globeflower")/gold, and cream. Of these additional terms, mizu was used by 98% of informants, and emerged as a strong candidate for a 12th Japanese basic color term. Japanese and American English color-naming systems were broadly similar, except for color categories in one language (mizu, kon, teal, lavender, magenta, lime) that had no equivalent in the other. Our analysis revealed two statistically distinct Japanese motifs (or color-naming systems), which differed mainly in the extension of mizu across our color palette. Comparison of the present data with an earlier study by Uchikawa & Boynton (1987) suggests that some changes in the Japanese color lexicon have occurred over the last 30 years.
Response of adult mosquitoes to light-emitting diodes placed in resting boxes and in the field.
Bentley, Michael T; Kaufman, Phillip E; Kline, Daniel L; Hogsette, Jerome A
2009-09-01
The response of adult mosquitoes to 4 light-emitting diode (LED) wavelengths was evaluated using diode-equipped sticky cards (DESCs) and diode-equipped resting boxes at 2 sites in north central Florida. Wavelengths evaluated were blue (470 nm), green (502 nm), red (660 nm), and infrared (IR) (860 nm). When trapping with DESCs, 15 mosquito species from 7 genera (Aedes, Anopheles, Coquillettidia, Culex, Mansonia, Psorophora, and Uranotaenia) were captured. Overall, approximately 43.8% of all mosquitoes were trapped on DESCs fitted with green LEDs. Significantly more females of Aedes infirmatus, Aedes vexans, and Culex nigripalpus were captured on DESCs fitted with blue LEDs compared with red or IR LEDs. DESCs with blue LEDs captured significantly more Culex erraticus females than those with IR LEDs. Using resting boxes, 12 species from 5 genera (Anopheles, Coquillettidia, Culex, Mansonia, and Uranotaenia) were collected. Resting boxes without LEDs captured 1,585 mosquitoes (22.2% of total). The fewest number of mosquitoes (16.7%) were collected from boxes affixed with the blue LEDs. Significantly more Anopheles quadrimaculatus females were aspirated from resting boxes fitted with red and IR LEDs than from those with blue or green LEDs, or from the unlit control. Blood-fed mosquitoes were recovered in highest numbers from unlit resting boxes, followed by resting boxes fitted with green, IR, and blue LEDs. Culex erraticus accounted for the majority of blood-fed mosquitoes followed by Coquillettidia perturbans. No blood-fed mosquitoes were recovered from resting boxes fitted with red LEDs.
Eu/Tb codoped spindle-shaped fluorinated hydroxyapatite nanoparticles for dual-color cell imaging
NASA Astrophysics Data System (ADS)
Ma, Baojin; Zhang, Shan; Qiu, Jichuan; Li, Jianhua; Sang, Yuanhua; Xia, Haibing; Jiang, Huaidong; Claverie, Jerome; Liu, Hong
2016-06-01
Lanthanide doped fluorinated hydroxyapatite (FAp) nanoparticles are promising cell imaging nanomaterials but they are excited at wavelengths which do not match the light sources usually found in a commercial confocal laser scanning microscope (CLSM). In this work, we have successfully prepared spindle-shaped Eu/Tb codoped FAp nanoparticles by a hydrothermal method. Compared with single Eu doped FAp, Eu/Tb codoped FAp can be excited by a 488 nm laser, and exhibit both green and red light emission. By changing the amounts of Eu and Tb peaks, the emission in the green region (500-580 nm) can be decreased to the benefit of the emission in the red region (580-720 nm), thus reaching a balanced dual color emission. Using MC3T3-E1 cells co-cultured with Eu/Tb codoped FAp nanoparticles, it is observed that the nanoparticles are cytocompatible even at a concentration as high as 800 μg ml-1. The Eu/Tb codoped FAp nanoparticles are located in the cytoplasm and can be monitored by dual color--green and red imaging with a single excitation light at 488 nm. At a concentration of 200 μg ml-1, the cytoplasm is saturated in 8 hours, and Eu/Tb codoped FAp nanoparticles retain their fluorescence for at least 3 days. The cytocompatible Eu/Tb codoped FAp nanoparticles with unique dual color emission will be of great use for cell and tissue imaging.Lanthanide doped fluorinated hydroxyapatite (FAp) nanoparticles are promising cell imaging nanomaterials but they are excited at wavelengths which do not match the light sources usually found in a commercial confocal laser scanning microscope (CLSM). In this work, we have successfully prepared spindle-shaped Eu/Tb codoped FAp nanoparticles by a hydrothermal method. Compared with single Eu doped FAp, Eu/Tb codoped FAp can be excited by a 488 nm laser, and exhibit both green and red light emission. By changing the amounts of Eu and Tb peaks, the emission in the green region (500-580 nm) can be decreased to the benefit of the emission in the red region (580-720 nm), thus reaching a balanced dual color emission. Using MC3T3-E1 cells co-cultured with Eu/Tb codoped FAp nanoparticles, it is observed that the nanoparticles are cytocompatible even at a concentration as high as 800 μg ml-1. The Eu/Tb codoped FAp nanoparticles are located in the cytoplasm and can be monitored by dual color--green and red imaging with a single excitation light at 488 nm. At a concentration of 200 μg ml-1, the cytoplasm is saturated in 8 hours, and Eu/Tb codoped FAp nanoparticles retain their fluorescence for at least 3 days. The cytocompatible Eu/Tb codoped FAp nanoparticles with unique dual color emission will be of great use for cell and tissue imaging. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02137a
ATOTA-a very promising green fluorophore
NASA Astrophysics Data System (ADS)
Doan, Hung The
Despite the fact that fluorescence community nowadays has invested in developing near-infrared probes, green fluorescence dyes like fluorescein and substitutes are still among the most widely used fluorophores for labeling in cellular imaging and biomedical research. Trioxatriangulenium dye ATOTA + is a very promising green fluorophore with high extinction coefficient and outstanding fluorescence quantum yield. This study focuses on characterizing ATOTA+'s fundamental spectroscopic properties, including fluorescence and orientation of the transition moments. ATOTA's aggregation in aqueous solution and lipid bilayer membrane are also investigated. ATOTA+ has absorption maxima between 470 nm and 476 nm and emission maxima between 496 nm and 511 nm depending on the solvent. The molar extinction coefficient varies from 135,000 mol-1cm-1 in nonpolar dichloromethane to above 90,000 mol-1cm-1 in polar solvents such as methanol. The quantum yield of ATOTA+ is close to 1 in nonpolar DCM and decreases to 0.44 in polar DMF. ATOTA+'s fluorescence lifetimes vary between 3.25 ns in aprotic low polarity triacetin to 1.66 ns in polar DMF. Furthermore, both radiative and non-radiative rates are affected by solvent polarity. ATOTA+ has very low water solubility due to the presence of 6 diethyl substitutions, and forms H-aggregates with a blue-shifted absorption maxima around 450 nm and red-shifted emission maxima of 580 nm respectively with fluorescence lifetime above 20 ns. The excitation anisotropy approaches 0.35 at red edge of the absorption spectrum and shape of polarization spectrum suggests the presence of overlapping transition moments in a S0-S1 band which is confirmed by linear dichroism in stretched PVA film. In DMPC lipid vesicles, ATOTA + forms a tight ion pair with a counter anion and localizes in the hydrocarbon interior. Overall we conclude that ATOTA+ will be a highly useful and superior member of the green fluorophore family.
Viviani, V R; Amaral, D T; Neves, D R; Simões, A; Arnoldi, F G C
2013-01-08
Beetle luciferases emit different bioluminescence colors from green to red; however, no clear relationship between the identity of the luciferin binding site residues and bioluminescence colors was found in different luciferases, and it is unclear whether critical interactions affecting emission spectra occur on the thiazolyl or on the benzothiazolyl sides of the luciferin binding site. Through homology modeling and site-directed mutagenesis using our multicolor set of beetle luciferases (Pyrearinus termitilluminans larval click beetle, Pte, λ(max) = 534 nm; Phrixothrix hirtus railroad worm red emitting, PxRE, λ(max) = 623 nm; and Macrolampis sp2 firefly, Mac, λ(max) = 564 nm), we show that the residues C/T311 (S314) play an important role in bioluminescence color determination. Modeling studies indicate that the main-chain carbonyls of these residues are close to both oxyluciferin phenolate and AMP, whereas the side chains pack against second-shell residues. The C311(S314)A mutation considerably red shifts the spectra of the green-yellow-emitting luciferases (Pte λ(max) = 534 to 590 nm; Mac λ(max) = 564 to 583/613 nm) and affects the K(M) values for luciferin and ATP, but not the spectrum of the red-emitting luciferase. On the other hand, whereas the exchange between C/T311 (S314) caused smaller effects on the emission spectra of green-yellow-emitting luciferases, the C311T substitution (naturally found in green-emitting railroad worm luciferases) resulted in the largest reported blue shift in P. hirtus red-emitting luciferase (λ(max) = 623 to 606 nm). Altogether, these results indicate that the stability of residues C/T311 (S314) and the size of the cavity around oxyluciferin phenolate affect bioluminescence colors and suggest, for the first time, the occurrence of a critical interaction between main-chain carbonyls of position 311 (314) residues and oxyluciferin phenolate.
Glassblowers' ocular health and safety: optical radiation hazards and eye protection assessment.
Oriowo, O M; Chou, B R; Cullen, A P
1997-05-01
The aims of this study were to investigate the levels of optical radiation exposure in glassblowing and to determine type(s) of protective eyewear commonly used. Radiometric measurements of radiant emissions from different molten glass materials and heating systems were carried out in six installations. Spectral transmittance curves of available protective lenses used at the locations were obtained. Significant variation (P = 0.0001) in ocular irradiation was obtained. All operations produced irradiances higher than the threshold limit values (TLVs) for the visible spectrum (400 to 700 nm). In craft glassblowing which employs furnace systems, irradiance levels exceeding the TLVs for near infrared (760 1o 1100 nm) were obtained. Molten soda-lime and quartz glasses emitted substantial subthreshold near UV radiation. This study shows that variation exists in glassblowing ocular radiation exposure due to different glass materials and heating systems, therefore selection of appropriate eye protector should be on an individual basis.
Samad, Mst Fateha; Kouzani, Abbas Z
2014-01-01
This paper presents a low actuation voltage microvalve with optimized insulating layers that manipulates a conducting ferro-fluid droplet by the principle of electrowetting-on-dielectric (EWOD). The proposed EWOD microvalve contains an array of chromium (Cr) electrodes on the soda-lime glass substrate, covered by both dielectric and hydrophobic layers. Various dielectric layers including Su-8 2002, Polyvinylidenefluoride (PVDF) and Cyanoethyl pullulan (CEP), and thin (50 nm) hydrophobic Teflon and Cytonix are used to analyze the EWOD microvalves at different voltages. The Finite Element Method (FEM) based software, Coventorware is used to carry out the simulation analysis. It is observed that the EWOD microvalve having a CEP dielectric layer with dielectric constant of about 20 and thickness of 1 μm, and a Cytonix hydrophobic layer with thickness of 50 nm operated the conducting ferro-fluid droplet at the actuation voltage as low as 7.8 V.
Romani, E C; Vitoreti, Douglas; Gouvêa, Paula M P; Caldas, P G; Prioli, R; Paciornik, S; Fokine, Michael; Braga, Arthur M B; Gomes, Anderson S L; Carvalho, Isabel C S
2012-02-27
Materials presenting high optical nonlinearity, such as materials containing metal nanoparticles (NPs), can be used in various applications in photonics. This motivated the research presented in this paper, where morphological, linear and nonlinear optical characteristics of gold NPs on the surface of bulk soda-lime glass substrates were investigated as a function of nanoparticle height. The NPs were obtained by annealing gold (Au) thin films previously deposited on the substrates. Pixel intensity histogram fitting on Atomic Force Microscopy (AFM) images was performed to obtain the thickness of the deposited film. Image analysis was employed to obtain the statistical distribution of the average height of the NPs. In addition, absorbance spectra of the samples before and after annealing were measured. Finally, the nonlinear refractive index (n2) and the nonlinear absorption index (α2) at 800 nm were obtained before and after annealing by using the thermally managed eclipse Z-scan (TM-EZ) technique with a Ti:Sapphire laser (150 fs pulses). Results show that both n2 and α2 at this wavelength change signs after the annealing and that the samples presented a high nonlinear refractive index.
Long-term field-scale experiment on using lime filters in an agricultural catchment.
Kirkkala, Teija; Ventelä, Anne-Mari; Tarvainen, Marjo
2012-01-01
The River Yläneenjoki catchment in southwest Finland is an area with a high agricultural nutrient load. We report here on the nutrient removal performance of three on-site lime-sand filters (F1, F2, and F3), established within or on the edge of the buffer zones. The filters contain burnt lime (CaO) or spent lime [CaO, Ca(OH), and CaCO]. Easily soluble lime results in a high pH level (>11) and leads to an efficient precipitation of soluble phosphorus (P) from the runoff. Water samples were taken from the inflow and outflow of each site in different hydrological situations. The length of the monitoring period was 4 yr for F1, 6 yr for F2, and 1.5 yr for F3. F1 and F2 significantly reduced the suspended solids (SS), total P (PTOT), and dissolved reactive P (DRP) in the treated water. The proportional reduction (%) varied but was usually clearly positive. Filter F3 was divided into two equal parts, one containing burnt lime and the other spent lime. Both filter parts removed PTOT and SS efficiently from the water; the burnt-lime part also removed DRP. The mixed-lime part removed DRP for a year, but then the efficiency decreased. The effect of filters on nitrogen compounds varied. We conclude that sand filters incorporating lime can be used together with buffer zones to reduce both P and SS load to watercourses. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.
Chen, Yanhui; Xie, Tuanhui; Liang, Qiaofeng; Liu, Mengjiao; Zhao, Mingliu; Wang, Mingkuang; Wang, Guo
2016-04-01
In paddy soils, amendments and moisture play important role in the immobilization of cadmium (Cd). The effects of applying lime, peat, and a combination of both on soil Eh, pH, and Cd availability in contaminated soils were investigated under wetted (80 ± 5 % of water holding capacity) and flooded (completely submerged) conditions. In wetted soils, there was little change in Eh, compared to flooded soils where Eh reduced rapidly. Amendments of lime only or in a mixture with peat increased soil pH to different degrees, depending on the lime application rate. However, peat addition only slightly affected soil pH. The decreased Cd availability in flooded soils was related to submergence duration and was significantly lower than that in wetted soils after 14 days. Liming wetted and flooded soils decreased exchangeable Cd and increased carbonates or Fe-Mn oxides bound fractions, while peat addition transformed Cd from carbonates to organic matter bound fractions. The combined application of peat and lime generally showed better inhibitory effects on the availability of Cd than separately application of lime or peat. Higher application rates of lime, peat, or their mixture were more effective at reducing Cd contamination in flooded soil. This indicates that application of peat and lime mixture under flooded conditions was most effective for in situ remediation of Cd-contaminated soils. Further studies are required to assess the long-term effectiveness of the peat and lime mixture on Cd availability in paddy soils.
Cytotoxic and antibacterial activity of the mixture of olive oil and lime cream in vitro conditions.
Sumer, Zeynep; Yildirim, Gulay; Sumer, Haldun; Yildirim, Sahin
2013-01-01
The mixture of olive oil and lime cream has been traditionally used to treat external burns in the region of Hatay/Antakya and middle Anatolia. Olive oil and lime cream have been employed by many physicians to treat many ailments in the past. A limited number of studies have shown the antibacterial effect of olive oil and that it does not have any toxic effect on the skin. But we did not find any reported studies on the mixture of olive oil and lime cream. The aim of this paper is to investigate the cytotoxic and antibacterial activity of olive oil and lime cream individually or/and in combination in vitro conditions, by using disk-diffusion method and in cell culture. The main purpose in using this mixture is usually to clear burns without a trace. Agar overlay, MTT (Cytotoxicity assay) and antibacterial susceptibility tests were used to investigate the cytotoxic and antibacterial activity of olive oil and lime cream. We found that lime cream has an antibacterial activity but also cytotoxic on the fibroblasts. On the other hand olive oil has limited or no antibacterial effect and it has little or no cytotoxic on the fibroblasts. When we combined lime cream and olive oil, olive oil reduced its cytotoxic impact. These results suggest that mixture of olive oil and lime cream is not cytotoxic and has antimicrobial activity.
40 CFR Table 1 to Subpart Aaaaa of... - Emission Limits
Code of Federal Regulations, 2011 CFR
2011-07-01
... following emission limit 1. Existing lime kilns and their associated lime coolers that did not have a wet... of stone feed (lb/tsf). 2. Existing lime kilns and their associated lime coolers that have a wet... not exceed 0.60 lb/tsf. If at any time after January 5, 2004 the kiln changes to a dry control system...
40 CFR Table 1 to Subpart Aaaaa of... - Emission Limits
Code of Federal Regulations, 2013 CFR
2013-07-01
... emission limit 1. Existing lime kilns and their associated lime coolers that did not have a wet scrubber... feed (lb/tsf). 2. Existing lime kilns and their associated lime coolers that have a wet scrubber, where... 0.60 lb/tsf. If at any time after January 5, 2004 the kiln changes to a dry control system, then the...
40 CFR Table 1 to Subpart Aaaaa of... - Emission Limits
Code of Federal Regulations, 2014 CFR
2014-07-01
... emission limit 1. Existing lime kilns and their associated lime coolers that did not have a wet scrubber... feed (lb/tsf). 2. Existing lime kilns and their associated lime coolers that have a wet scrubber, where... 0.60 lb/tsf. If at any time after January 5, 2004 the kiln changes to a dry control system, then the...
40 CFR Table 1 to Subpart Aaaaa of... - Emission Limits
Code of Federal Regulations, 2010 CFR
2010-07-01
... following emission limit 1. Existing lime kilns and their associated lime coolers that did not have a wet... of stone feed (lb/tsf). 2. Existing lime kilns and their associated lime coolers that have a wet... not exceed 0.60 lb/tsf. If at any time after January 5, 2004 the kiln changes to a dry control system...
40 CFR Table 1 to Subpart Aaaaa of... - Emission Limits
Code of Federal Regulations, 2012 CFR
2012-07-01
... following emission limit 1. Existing lime kilns and their associated lime coolers that did not have a wet... of stone feed (lb/tsf). 2. Existing lime kilns and their associated lime coolers that have a wet... not exceed 0.60 lb/tsf. If at any time after January 5, 2004 the kiln changes to a dry control system...
Six-day randomized safety trial of intravaginal lime juice.
Mauck, Christine K; Ballagh, Susan A; Creinin, Mitchell D; Weiner, Debra H; Doncel, Gustavo F; Fichorova, Raina N; Schwartz, Jill L; Chandra, Neelima; Callahan, Marianne M
2008-11-01
Nigerian women reportedly apply lime juice intravaginally to protect themselves against HIV. In vitro data suggest that lime juice is virucidal, but only at cytotoxic concentrations. This is the first controlled, randomized safety trial of lime juice applied to the human vagina. Forty-seven women were randomized to apply water or lime juice (25%, 50%, or undiluted) intravaginally twice daily for two 6-day intervals, separated by a 3-week washout period. Product application also was randomized: during 1 interval, product was applied using a saturated tampon and in the other by douche. Vaginal pH, symptoms, signs of irritation observed via naked eye examination and colposcopy, microflora, and markers of inflammation in cervicovaginal lavages were evaluated after 1 hour and on days 3 and 7. The largest reduction in pH was about one-half a pH unit, seen 1 hour after douching with 100% lime juice. We observed a dose-dependent pattern of symptoms and clinical and laboratory findings that were consistent with a compromised vaginal barrier function. The brief reduction in pH after vaginal lime juice application is unlikely to be virucidal in the presence of semen. Lime juice is unlikely to protect against HIV and may actually be harmful.
Han, Pei-pei; Sun, Ying; Jia, Shi-ru; Zhong, Cheng; Tan, Zhi-lei
2014-05-25
The influences of different wavelengths of light (red 660nm, yellow 590nm, green 520nm, blue 460nm, purple 400nm) and white light on extracellular polysaccharide (EPS) and capsular polysaccharide (CPS) production by Nostoc flagelliforme in liquid culture were demonstrated in this study. The results showed that, compared with white light, red and blue lights significantly increased both EPS and CPS production while yellow light reduced their production; purple and green lights stimulated EPS production but inhibited CPS formation. Nine constituent monosaccharides and one uronic acid were detected in both EPS and CPS, and their ratios showed significant differences among treatment with different light wavelengths. However, the advanced structure of EPS and CPS from various light conditions did not present obvious difference through Fourier transform infrared spectroscopy and X-ray diffraction characterization. These findings establish a basis for development of high-yielding polysaccharide production process and understanding their regulation. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
C, Rajkumar; Srivastava, Rajneesh K.
2018-05-01
Zinc oxide (ZnO) nanoparticle has been synthesized by cost effective Co-precipitation method and studied its photo-response activity. The synthesized ZnO nanomaterial was characterized by using various analytical techniques such as x-ray diffraction (XRD), UV–visible spectroscopy, FTIR spectroscopy, photoluminescence (PL) spectroscopy, and Scanning Electron Microscopy (SEM). From the XRD results, it is confirmed that synthesized ZnO nanomaterial possess hexagonal wurtzite phase structure with an average crystallite size of ∼16–17 nm. The UV-Visible absorption spectrum shows that it has blue shift compared to their bulk counterparts. Photoluminescence spectra of ZnO nanoparticles have a strong violet band at 423 nm and three weak bands at 485 nm (blue), 506 nm (green), and 529 nm (green). The presence of hydroxyl group was confirmed by FTIR. The photo-response analysis was studied by the time-dependent rise and decay photocurrent of ZnO nanoparticle was tested in the air as well as vacuum medium.
A novel eco-friendly technique for efficient control of lime water softening process.
Ostovar, Mohamad; Amiri, Mohamad
2013-12-01
Lime softening is an established type of water treatment used for water softening. The performance of this process is highly dependent on lime dosage. Currently, lime dosage is adjusted manually based on chemical tests, aimed at maintaining the phenolphthalein (P) and total (M) alkalinities within a certain range (2 P - M > or = 5). In this paper, a critical study of the softening process has been presented. It has been shown that the current method is frequently incorrect. Furthermore, electrical conductivity (EC) has been introduced as a novel indicator for effectively characterizing the lime softening process.This novel technique has several advantages over the current alkalinities method. Because no chemical reagents are needed for titration, which is a simple test, there is a considerable reduction in test costs. Additionally, there is a reduction in the treated water hardness and generated sludge during the lime softening process. Therefore, it is highly eco-friendly, and is a very cost effective alternative technique for efficient control of the lime softening process.
Models for predicting the mass of lime fruits by some engineering properties.
Miraei Ashtiani, Seyed-Hassan; Baradaran Motie, Jalal; Emadi, Bagher; Aghkhani, Mohammad-Hosein
2014-11-01
Grading fruits based on mass is important in packaging and reduces the waste, also increases the marketing value of agricultural produce. The aim of this study was mass modeling of two major cultivars of Iranian limes based on engineering attributes. Models were classified into three: 1-Single and multiple variable regressions of lime mass and dimensional characteristics. 2-Single and multiple variable regressions of lime mass and projected areas. 3-Single regression of lime mass based on its actual volume and calculated volume assumed as ellipsoid and prolate spheroid shapes. All properties considered in the current study were found to be statistically significant (ρ < 0.01). The results indicated that mass modeling of lime based on minor diameter and first projected area are the most appropriate models in the first and the second classifications, respectively. In third classification, the best model was obtained on the basis of the prolate spheroid volume. It was finally concluded that the suitable grading system of lime mass is based on prolate spheroid volume.
González-Alcaraz, María Nazaret; Conesa, Héctor Miguel; Tercero, María del Carmen; Schulin, Rainer; Alvarez-Rogel, José; Egea, Consuelo
2011-02-15
The aim of this study was to evaluate the combined effects of liming and behaviour of Sarcocornia fruticosa as a strategy of phytomanagement of metal polluted salt marsh soils. Soils were taken from two polluted salt marshes (one with fine texture and pH∼6.4 and the other one with sandy texture and pH∼3.1). A lime amendment derived from the marble industry was added to each soil at a rate of 20 g kg(-1), giving four treatments: neutral soil with/without liming and acidic soil with/without liming. Cuttings of S. fruticosa were planted in pots filled with these substrates and grown for 10 months. The pots were irrigated with eutrophicated water. As expected, lime amendment decreased the soluble metal concentrations. In both soils, liming favoured the growth of S. fruticosa and enhanced the capacity of the plants to phytostabilise metals in roots. Copyright © 2010 Elsevier B.V. All rights reserved.
Rabelo, Sarita C; Filho, Rubens Maciel; Costa, Aline C
2008-01-01
Pretreatment procedures of sugarcane bagasse with lime (calcium hydroxide) or alkaline hydrogen peroxide were evaluated and compared. Analyses were performed using 2(3) factorial designs, with pretreatment time, temperature, and lime loading and hydrogen peroxide concentration as factors. The responses evaluated were the yield of total reducing sugars (TRS) and glucose released from pretreated bagasse after enzymatic hydrolysis. Experiments were performed using the bagasse, as it comes from an alcohol/sugar factory and bagasse, in the size, range from 0.248 to 1.397 mm (12-60 mesh). The results show that, when hexoses and pentoses are of interest, lime should be the pretreatment agent chosen, as high TRS yields are obtained for non-screened bagasse using 0.40 g lime/g dry biomass at 70 degrees C for 36 h. When the product of interest is glucose, the best results were obtained with lime pretreatment of screened bagasse. However, the results for alkaline peroxide and lime pretreatments of non-screened bagasse are not very different.
NASA Astrophysics Data System (ADS)
Rabelo, Sarita C.; Filho, Rubens Maciel; Costa, Aline C.
Pretreatment procedures of sugarcane bagasse with lime (calcium hydroxide) or alkaline hydrogen peroxide were evaluated and compared. Analyses were performed using 2 × 2 × 2 factorial designs, with pretreatment time, temperature, and lime loading and hydrogen peroxide concentration as factors. The responses evaluated were the yield of total reducing sugars (TRS) and glucose released from pretreated bagasse after enzymatic hydrolysis. Experiments were performed using the bagasse as it comes from an alcohol/ sugar factory and bagasse in the size range of 0.248 to 1.397 mm (12-60 mesh). The results show that when hexoses and pentoses are of interest, lime should be the pretreatment agent chosen, as high TRS yields are obtained for nonscreened bagasse using 0.40 g lime/g dry biomass at 70 °C for 36 h. When the product of interest is glucose, the best results were obtained with lime pretreatment of screened bagasse. However, the results for alkaline peroxide and lime pretreatments of nonscreened bagasse are not very different.
Rabelo, Sarita C; Maciel Filho, Rubens; Costa, Aline C
2008-03-01
Pretreatment procedures of sugarcane bagasse with lime (calcium hydroxide) or alkaline hydrogen peroxide were evaluated and compared. Analyses were performed using 2 x 2 x 2 factorial designs, with pretreatment time, temperature, and lime loading and hydrogen peroxide concentration as factors. The responses evaluated were the yield of total reducing sugars (TRS) and glucose released from pretreated bagasse after enzymatic hydrolysis. Experiments were performed using the bagasse as it comes from an alcohol/sugar factory and bagasse in the size range of 0.248 to 1.397 mm (12-60 mesh). The results show that when hexoses and pentoses are of interest, lime should be the pretreatment agent chosen, as high TRS yields are obtained for nonscreened bagasse using 0.40 g lime/g dry biomass at 70 degrees C for 36 h. When the product of interest is glucose, the best results were obtained with lime pretreatment of screened bagasse. However, the results for alkaline peroxide and lime pretreatments of nonscreened bagasse are not very different.
Harding, Alexander S.; Schwab, Kellogg J.
2012-01-01
We investigated the use of psoralens and limes to enhance solar disinfection of water (SODIS) using an UV lamp and natural sunlight experiments. SODIS conditions were replicated using sunlight, 2 L polyethylene terephthalate (PET) bottles, and tap water with Escherichia coli, MS2 bacteriophage, and murine norovirus (MNV). Psoralens and lime acidity both interact synergistically with UV radiation to accelerate inactivation of microbes. Escherichia coli was ablated > 6.1 logs by SODIS + Lime Slurry and 5.6 logs by SODIS + Lime Juice in 30-minute solar exposures, compared with a 1.5 log reduction with SODIS alone (N = 3; P < 0.001). MS2 was inactivated > 3.9 logs by SODIS + Lime Slurry, 1.9 logs by SODIS + Lime Juice, and 1.4 logs by SODIS in 2.5-hour solar exposures (N = 3; P < 0.05). MNV was resistant to SODIS, with < 2 log reductions after 6 hours. Efficacy of SODIS against human norovirus should be investigated further. PMID:22492137
Yokoyama, Shozo; Takenaka, Naomi
2005-04-01
Red-green color vision is strongly suspected to enhance the survival of its possessors. Despite being red-green color blind, however, many species have successfully competed in nature, which brings into question the evolutionary advantage of achieving red-green color vision. Here, we propose a new method of identifying positive selection at individual amino acid sites with the premise that if positive Darwinian selection has driven the evolution of the protein under consideration, then it should be found mostly at the branches in the phylogenetic tree where its function had changed. The statistical and molecular methods have been applied to 29 visual pigments with the wavelengths of maximal absorption at approximately 510-540 nm (green- or middle wavelength-sensitive [MWS] pigments) and at approximately 560 nm (red- or long wavelength-sensitive [LWS] pigments), which are sampled from a diverse range of vertebrate species. The results show that the MWS pigments are positively selected through amino acid replacements S180A, Y277F, and T285A and that the LWS pigments have been subjected to strong evolutionary conservation. The fact that these positively selected M/LWS pigments are found not only in animals with red-green color vision but also in those with red-green color blindness strongly suggests that both red-green color vision and color blindness have undergone adaptive evolution independently in different species.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Jin Ah; Kim, Na Na; Choi, Young Jae
We investigated the effect of light spectra on retinal damage and stress in goldfish using green (530 nm) and red (620 nm) light emitting diodes (LEDs) at three intensities each (0.5, 1.0, and 1.5 W/m{sup 2}). We measured the change in the levels of plasma cortisol and H{sub 2}O{sub 2} and expression and levels of caspase-3. The apoptotic response of green and red LED spectra was assessed using the terminal transferase dUTP nick end labeling (TUNEL) assay. Stress indicator (cortisol and H{sub 2}O{sub 2}) and apoptosis-related genes (caspase-3) decreased in green light, but increased in red light with higher light intensities over time.more » The TUNEL assay revealed that more apoptotic cells were detected in outer nuclear layers after exposure to red LED over time with the increase in light intensity, than the other spectra. These results indicate that green light efficiently reduces retinal damage and stress, whereas red light induces it. Therefore, red light-induced retina damage may induce apoptosis in goldfish retina. -- Highlights: •Green light efficiently reduces retinal damage and stress. •Green spectra reduce caspase production and apoptosis. •Red light-induced retina damage may induce apoptosis in goldfish retina. •The retina of goldfish recognizes green spectra as a stable environment.« less
Time evolution of pore system in lime - Pozzolana composites
NASA Astrophysics Data System (ADS)
Doleželová, Magdaléna; Čáchová, Monika; Scheinherrová, Lenka; Keppert, Martin
2017-11-01
The lime - pozzolana mortars and plasters are used in restoration works on building cultural heritage but these materials are also following the trend of energy - efficient solutions in civil engineering. Porosity and pore size distribution is one of crucial parameters influencing engineering properties of porous materials. The pore size distribution of lime based system is changing in time due to chemical processes occurring in the material. The present paper describes time evolution of pore system in lime - pozzolana composites; the obtained results are useful in prediction of performance of lime - pozzolana systems in building structures.
Phylogenetic origin of limes and lemons revealed by cytoplasmic and nuclear markers.
Curk, Franck; Ollitrault, Frédérique; Garcia-Lor, Andres; Luro, François; Navarro, Luis; Ollitrault, Patrick
2016-04-01
The origin of limes and lemons has been a source of conflicting taxonomic opinions. Biochemical studies, numerical taxonomy and recent molecular studies suggested that cultivated Citrus species result from interspecific hybridization between four basic taxa (C. reticulata,C. maxima,C. medica and C. micrantha). However, the origin of most lemons and limes remains controversial or unknown. The aim of this study was to perform extended analyses of the diversity, genetic structure and origin of limes and lemons. The study was based on 133 Citrus accessions. It combined maternal phylogeny studies based on mitochondrial and chloroplastic markers, and nuclear structure analysis based on the evaluation of ploidy level and the use of 123 markers, including 73 basic taxa diagnostic single nucleotide polymorphism (SNP) and indel markers. The lime and lemon horticultural group appears to be highly polymorphic, with diploid, triploid and tetraploid varieties, and to result from many independent reticulation events which defined the sub-groups. Maternal phylogeny involves four cytoplasmic types out of the six encountered in the Citrus genus. All lime and lemon accessions were highly heterozygous, with interspecific admixture of two, three and even the four ancestral taxa genomes. Molecular polymorphism between varieties of the same sub-group was very low. Citrus medica contributed to all limes and lemons and was the direct male parent for the main sub-groups in combination with C. micrantha or close papeda species (for C. aurata, C. excelsa, C. macrophylla and C. aurantifolia--'Mexican' lime types of Tanaka's taxa), C. reticulata(for C. limonia, C. karna and C. jambhiri varieties of Tanaka's taxa, including popular citrus rootstocks such as 'Rangpur' lime, 'Volkamer' and 'Rough' lemons), C. aurantium (for C. limetta and C. limon--yellow lemon types--varieties of Tanaka's taxa) or the C. maxima × C. reticulate hybrid (for C. limettioides--'Palestine sweet' lime types--and C. meyeri). Among triploid limes, C. latifolia accessions ('Tahiti' and 'Persian' lime types) result from the fertilization of a haploid ovule of C. limon by a diploid gamete of C. aurantifolia, while C. aurantifolia triploid accessions ('Tanepao' lime types and 'Madagascar' lemon) probably result from an interspecific backcross (a diploid ovule of C. aurantifolia fertilized by C. medica). As limes and lemons were vegetatively propagated (apomixis, horticultural practices) the intra-sub-group phenotypic diversity results from asexual variations. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Phylogenetic origin of limes and lemons revealed by cytoplasmic and nuclear markers
Curk, Franck; Ollitrault, Frédérique; Garcia-Lor, Andres; Luro, François; Navarro, Luis; Ollitrault, Patrick
2016-01-01
Background and Aims The origin of limes and lemons has been a source of conflicting taxonomic opinions. Biochemical studies, numerical taxonomy and recent molecular studies suggested that cultivated Citrus species result from interspecific hybridization between four basic taxa (C. reticulata, C. maxima, C. medica and C. micrantha). However, the origin of most lemons and limes remains controversial or unknown. The aim of this study was to perform extended analyses of the diversity, genetic structure and origin of limes and lemons. Methods The study was based on 133 Citrus accessions. It combined maternal phylogeny studies based on mitochondrial and chloroplastic markers, and nuclear structure analysis based on the evaluation of ploidy level and the use of 123 markers, including 73 basic taxa diagnostic single nucleotide polymorphism (SNP) and indel markers. Key Results The lime and lemon horticultural group appears to be highly polymorphic, with diploid, triploid and tetraploid varieties, and to result from many independent reticulation events which defined the sub-groups. Maternal phylogeny involves four cytoplasmic types out of the six encountered in the Citrus genus. All lime and lemon accessions were highly heterozygous, with interspecific admixture of two, three and even the four ancestral taxa genomes. Molecular polymorphism between varieties of the same sub-group was very low. Conclusions Citrus medica contributed to all limes and lemons and was the direct male parent for the main sub-groups in combination with C. micrantha or close papeda species (for C. aurata, C. excelsa, C. macrophylla and C. aurantifolia – ‘Mexican’ lime types of Tanaka’s taxa), C. reticulata (for C. limonia, C. karna and C. jambhiri varieties of Tanaka’s taxa, including popular citrus rootstocks such as ‘Rangpur’ lime, ‘Volkamer’ and ‘Rough’ lemons), C. aurantium (for C. limetta and C. limon – yellow lemon types – varieties of Tanaka’s taxa) or the C. maxima × C. reticulata hybrid (for C. limettioides – ‘Palestine sweet’ lime types – and C. meyeri). Among triploid limes, C. latifolia accessions (‘Tahiti’ and ‘Persian’ lime types) result from the fertilization of a haploid ovule of C. limon by a diploid gamete of C. aurantifolia, while C. aurantifolia triploid accessions (‘Tanepao’ lime types and ‘Madagascar’ lemon) probably result from an interspecific backcross (a diploid ovule of C. aurantifolia fertilized by C. medica). As limes and lemons were vegetatively propagated (apomixis, horticultural practices) the intra-sub-group phenotypic diversity results from asexual variations. PMID:26944784
Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J
2008-05-01
We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.
[Identification of green tea brand based on hyperspectra imaging technology].
Zhang, Hai-Liang; Liu, Xiao-Li; Zhu, Feng-Le; He, Yong
2014-05-01
Hyperspectral imaging technology was developed to identify different brand famous green tea based on PCA information and image information fusion. First 512 spectral images of six brands of famous green tea in the 380 approximately 1 023 nm wavelength range were collected and principal component analysis (PCA) was performed with the goal of selecting two characteristic bands (545 and 611 nm) that could potentially be used for classification system. Then, 12 gray level co-occurrence matrix (GLCM) features (i. e., mean, covariance, homogeneity, energy, contrast, correlation, entropy, inverse gap, contrast, difference from the second-order and autocorrelation) based on the statistical moment were extracted from each characteristic band image. Finally, integration of the 12 texture features and three PCA spectral characteristics for each green tea sample were extracted as the input of LS-SVM. Experimental results showed that discriminating rate was 100% in the prediction set. The receiver operating characteristic curve (ROC) assessment methods were used to evaluate the LS-SVM classification algorithm. Overall results sufficiently demonstrate that hyperspectral imaging technology can be used to perform classification of green tea.
NASA Astrophysics Data System (ADS)
Komori, Yuichi; Ishii, Yukihiro
2010-08-01
A doubly-doped LiNbO3 (LN) crystal has been well used as a nonvolatile two-wavelength recording material. By using two levels of the crystal, two-kind holograms can be recorded on one crystal; a hologram is recorded with a 405-nm blue laser diode (LD) for a deep Mn level, and another hologram is with a 532-nm green laser for a shallow Fe level. The recording capacity doubles. A 780-nm LD is non-volatile reconstructing source since the LD line is insensitive to both levels. Multiplexed reconstructed images are demonstrated by using a sharp angular selectivity of a volume LN crystal keeping Bragg condition with spherical reconstructions.
Human-Friendly Light-Emitting Diode Source Stimulates Broiler Growth.
Pan, Jinming; Yang, Yefeng; Yang, Bo; Dai, Wenhua; Yu, Yonghua
2015-01-01
Previous study and our laboratory have reported that short-wavelength (blue and green) light and combination stimulate broiler growth. However, short-wavelength stimuli could have negative effects on poultry husbandry workers. The present study was conducted to evaluate the effects of human-friendly yellow LED light, which is acceptable to humans and close to green light, on broiler growth. We also aimed to investigate the potential quantitative relationship between the wavelengths of light used for artificial illumination and growth parameters in broilers. After hatching, 360 female chicks ("Meihuang" were evenly divided into six lighting treatment groups: white LED strips (400-700 nm, WL); red LED strips (620 nm, RL); yellow LED strips (580 nm, YL); green LED strips (514 nm, GL); blue LED strips (455 nm, BL); and fluorescent strips (400-700 nm, FL). From 30 to 72 days of age, broilers reared under YL and GL were heavier than broilers treated with FL (P < 0.05). Broilers reared under YL obtained the similar growth parameters with the broilers reared under GL and BL (P > 0.05). Moreover, YL significantly improved feeding efficiency when compared with GL and BL at 45 and 60 days of age (P < 0.05). In addition, we found an age-dependent effect of light spectra on broiler growth and a quantitative relationship between LED light spectra (455 to 620 nm) and the live body weights of broilers. The wavelength of light (455 to 620 nm) was found to be negatively related (R2 = 0.876) to live body weight at an early stage of development, whereas the wavelength of light (455 to 620 nm) was found to be positively correlated with live body weight (R2 = 0.925) in older chickens. Our results demonstrated that human-friendly yellow LED light (YL), which is friendly to the human, can be applied to the broilers production.
Human-Friendly Light-Emitting Diode Source Stimulates Broiler Growth
Yang, Bo; Dai, Wenhua; Yu, Yonghua
2015-01-01
Previous study and our laboratory have reported that short-wavelength (blue and green) light and combination stimulate broiler growth. However, short-wavelength stimuli could have negative effects on poultry husbandry workers. The present study was conducted to evaluate the effects of human-friendly yellow LED light, which is acceptable to humans and close to green light, on broiler growth. We also aimed to investigate the potential quantitative relationship between the wavelengths of light used for artificial illumination and growth parameters in broilers. After hatching, 360 female chicks (“Meihuang” were evenly divided into six lighting treatment groups: white LED strips (400–700 nm, WL); red LED strips (620 nm, RL); yellow LED strips (580 nm, YL); green LED strips (514 nm, GL); blue LED strips (455 nm, BL); and fluorescent strips (400–700 nm, FL). From 30 to 72 days of age, broilers reared under YL and GL were heavier than broilers treated with FL (P < 0.05). Broilers reared under YL obtained the similar growth parameters with the broilers reared under GL and BL (P > 0.05). Moreover, YL significantly improved feeding efficiency when compared with GL and BL at 45 and 60 days of age (P < 0.05). In addition, we found an age-dependent effect of light spectra on broiler growth and a quantitative relationship between LED light spectra (455 to 620 nm) and the live body weights of broilers. The wavelength of light (455 to 620 nm) was found to be negatively related (R 2 = 0.876) to live body weight at an early stage of development, whereas the wavelength of light (455 to 620 nm) was found to be positively correlated with live body weight (R 2 = 0.925) in older chickens. Our results demonstrated that human-friendly yellow LED light (YL), which is friendly to the human, can be applied to the broilers production. PMID:26270988
NASA Astrophysics Data System (ADS)
Ansari, Ghizal F.; Mahajan, S. K.
2012-02-01
The bright white upconversion emission ( tri-colour UC) is generated in Er/Tm/Yb tri -doped oxy-fluoride lithium tungsten tellurite (TWLOF)glass ceramics containing crystalline phase LiYbF4 under the excitation of 980nm laser diode. The most appropriate combination of rare-earth ions (2mol% YbF3 1mol% ErF3 and 1mol%TmF3 )of glass ceramic sample has been determined to tune the primary colour (RGB and generate white light emission. By varying the pump power, intense and weak blue (487nm, 437nm), green (525nm and 545nm) and red (662nm) emission are simultaneously observed at room temperature. The dependence of upconversion emission intensity suggest that a theephoton process is responsible for the blue emission of Tm3+ ions and red emission due to both Tm3+ and Er3+ ions , while green emission originated from two photon processes in Er3+ ions. Also tri colour upconvesion and energy transfer in this glass ceramics sample were studied under 808nm laser diode excitation. The Upconversion mechanisms and Tm3+ ions plays role of both emitter and activator (transfer energy to Er) were discussed.
Synthesis of Brushite Particles in Reverse Microemulsions of the Biosurfactant Surfactin
Maity, Jyoti Prakash; Lin, Tz-Jiun; Cheng, Henry Pai-Heng; Chen, Chien-Yen; Reddy, A. Satyanarayana; Atla, Shashi B.; Chang, Young-Fo; Chen, Hau-Ren; Chen, Chien-Cheng
2011-01-01
In this study the “green chemistry” use of the biosurfactant surfactin for the synthesis of calcium phosphate using the reverse microemulsion technique was demonstrated. Calcium phosphates are bioactive materials that are a major constituent of human teeth and bone tissue. A reverse microemulsion technique with surfactin was used to produce nanocrystalline brushite particles. Structural diversity (analyzed by SEM and TEM) resulted from different water to surfactin ratios (W/S; 250, 500, 1000 and 40,000). The particle sizes were found to be in the 16–200 nm range. Morphological variety was observed in the as-synthesized microemulsions, which consisted of nanospheres (~16 nm in diameter) and needle-like (8–14 nm in diameter and 80–100 nm in length) noncalcinated particles. However, the calcinated products included nanospheres (50–200 nm in diameter), oval (~300 nm in diameter) and nanorod (200–400 nm in length) particles. FTIR and XRD analysis confirmed the formation of brushite nanoparticles in the as-synthesized products, while calcium pyrophosphate was produced after calcination. These results indicate that the reverse microemulsion technique using surfactin is a green process suitable for the synthesis of nanoparticles. PMID:21747709
Synthesis, energy transfer and tunable emission properties of SrSb2O6:Eu3 +, Bi3 + phosphor
NASA Astrophysics Data System (ADS)
Cao, Renping; Fu, Ting; Peng, Dedong; Cao, Chunyan; Ruan, Wen; Yu, Xiaoguang
2016-12-01
Host SrSb2O6, SrSb2O6:Bi3 +, SrSb2O6:Eu3 +, and SrSb2O6:Eu3 +, Bi3 + phosphors are synthesized by solid state reaction method in air. Host SrSb2O6 with excitation 254 nm shows weak green-yellow emission in the range of 320-780 nm due to Sb5 + → O2- transition. SrSb2O6:Bi3 + phosphor with excitation 365 nm emits green light within the range 400-650 nm owing to the 3P1 → 1S0 transition of Bi3 + ion. SrSb2O6:Eu3 + phosphor with excitation 254 nm exhibits a systematically varied hue from green to orange-red light by increasing Eu3 + concentration from 0 to 7 mol%, and that with excitation 394 nm only shows orange-red light. The optimal Eu3 + concentration is 4 mol% in SrSb2O6:Eu3 + phosphor. SrSb2O6:Eu3 +, Bi3 + phosphor with excitation 254 and 394 nm emits orange-red light. Emission intensity of SrSb2O6:Eu3 + phosphor may be enhanced > 2 times by co-doping Bi3 + ion because of the fluxing agent and energy transfer roles of Bi3 + ion in SrSb2O6:Eu3 +, Bi3 + phosphor. The luminous mechanism of SrSb2O6:Eu3 +, Bi3 + phosphor is analyzed and explained by the simplified energy level diagrams of Sb2O62 - group, Bi3 + and Eu3 + ions, and energy transfer processes between them.
NASA Astrophysics Data System (ADS)
Yao, Yuhong; Knox, Wayne H.
2015-03-01
We report the optical system design of a novel speckle-free ultrafast Red-Green-Blue (RGB) source based on angularly multiplexed simultaneous second harmonic generation from the efficiently generated Stokes and anti-Stokes pulses from a commercially available photonic crystal fiber (PCF) with two zero dispersion wavelengths (TZDW). We describe the optimized configuration of the TZDW fiber source which supports excitations of dual narrow-band pulses with peak wavelengths at 850 nm, 1260 nm and spectral bandwidths of 23 nm, 26 nm, respectively within 12 cm of commercially available TZDW PCF. The conversion efficiencies are as high as 44% and 33% from the pump source (a custom-built Yb:fiber master-oscillator-power-amplifier). As a result of the nonlinear dynamics of propagation, the dual pulses preserve their ultrashort pulse width (with measured autocorrelation traces of 200 fs and 227 fs,) which eliminates the need for dispersion compensation before harmonic generation. With proper optical design of the free-space harmonic generation system, we achieve milli-Watt power level red, green and blue pulses at 630 nm, 517 nm and 425 nm. Having much broader spectral bandwidths compared to picosecond RGB laser sources, the source is inherently speckle-free due to the ultra-short coherence length (<37 μm) while still maintaining an excellent color rendering capability with >99.4% excitation purities of the three primaries, leading to the coverage of 192% NTSC color gamut (CIE 1976). The reported RGB source features a very simple system geometry, its potential for power scaling is discussed with currently available technologies.
A compact frequency stabilized telecom laser diode for space applications
NASA Astrophysics Data System (ADS)
Philippe, C.; Holleville, D.; Le Targat, R.; Wolf, P.; Leveque, T.; Le Goff, R.; Martaud, E.; Acef, O.
2017-09-01
We report on a Telecom laser diode (LD) frequency stabilization to a narrow iodine hyperfine line in the green range, after frequency tripling process using fibered nonlinear waveguide PPLN crystals. We have generated up to 300 mW optical power in the green range ( 514 nm) from 800 mW of infrared power ( 1542 nm), corresponding to a nonlinear conversion efficiency h = P3?/P? 36%. Less than 10 mW of the generated green power are used for Doppler-free spectroscopy of 127I2 molecular iodine, and -therefore- for the frequency stabilization purpose. The frequency tripling optical setup is very compact (< 5 l), fully fibered, and could operate over the full C-band of the Telecom range (1530 nm - 1565 nm). Several thousands of hyperfine iodine lines may thus be interrogated in the 510 nm - 521 nm range. We build up an optical bench used at first in free space configuration, using the well-known modulation transfer spectroscopy technique (MTS), in order to test the potential of this new frequency standard based on the couple "1.5 ?m laser / iodine molecule". We have already demonstrated a preliminary frequency stability of 4.8 x 10-14 ? -1/2 with a minimum value of 6 x 10-15 reached after 50 s of integration time, conferred to a laser diode operating at 1542.1 nm. We focus now our efforts to expand the frequency stability to a longer integration time in order to meet requirements of many space experiments, such earth gravity missions, inters satellites links or space to ground communications. Furthermore, we investigate the potential of a new approach based on frequency modulation technique (FM), associated to a 3rd harmonic detection of iodine lines to increase the compactness of the optical setup.
Philip M. Wargo; Rakesh Minocha; Betty Wong; Robert P. Long; Stephen B. Horsley; Thomas J. Hall
2002-01-01
A study established in 1985 in north-central Pennsylvania to determine effects of lime fertilization on declining sugar maple (Acer saccharum Marsh.) was evaluated in 1993 and showed that liming positively affected growth and crown vitality in sugar maple. This effect of lime on sugar maple offered an opportunity to assess other indicators of tree...
Robert P. Long; Scott W. Bailey; Stephen B. Horsley; Thomas J. Hall; Bryan R. Swistock; David R. DeWalle
2015-01-01
Sugar maple (Acer saccharum Marsh.) decline disease, decreased growth, and regeneration failure have been related to a low supply of Ca and Mg. There is increased interest in augmenting cation availability via liming, but there is little information on the amounts of lime required and the longevity of the lime treatment. A single application of 22.4...
Rouiss, H; Bakry, F; Froelicher, Y; Navarro, L; Aleza, P; Ollitrault, P
2018-03-05
Two main types of triploid limes are produced worldwide. The 'Tahiti' lime type (Citrus latifolia) is predominant, while the 'Tanepao' type (C. aurantiifolia) is produced to a lesser extent. Both types result from natural interspecific hybridization involving a diploid gamete of C. aurantiifolia 'Mexican' lime type (itself a direct interspecific C. micrantha × C. medica hybrid). The meiotic behaviour of a doubled-diploid 'Mexican' lime, the interspecific micrantha/medica recombination and the resulting diploid gamete structures were analysed to investigate the possibility that 'Tahiti' and 'Tanepao' varieties are derived from natural interploid hybridization. A population of 85 tetraploid hybrids was established between a doubled-diploid clementine and a doubled-diploid 'Mexican' lime and used to infer the genotypes of 'Mexican' lime diploid gametes. Meiotic behaviour was studied through combined segregation analysis of 35 simple sequenbce repeat (SSR) and single nucleotide polymorphismn (SNP) markers covering the nine citrus chromosomes and cytogenetic studies. It was supplemented by pollen viability assessment. Pollen viability of the doubled-diploid Mexican lime (64 %) was much higher than that of the diploid. On average, 65 % of the chromosomes paired as bivalents and 31.4 % as tetravalents. Parental heterozygosity restitution ranged from 83 to 99 %. Disomic inheritance with high preferential pairing values was deduced for three chromosomes. Intermediate inheritances, with disomic trend, were found for five chromosomes, and an intermediate inheritance was observed for one chromosome. The average effective interspecific recombination rate was low (1.2 cM Mb-1). The doubled-diploid 'Mexican' lime had predominantly disomic segregation, producing interspecific diploid gamete structures with high C. medica/C. micrantha heterozygosity, compatible with the phylogenomic structures of triploid C. latifolia and C. aurantiifolia varieties. This disomic trend limits effective interspecific recombination and diversity of the diploid gamete population. Interploid reconstruction breeding using doubled-diploid lime as one parent is a promising approach for triploid lime diversification. © The Author(s) 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Modification of Lime Mortars with Synthesized Aluminosilicates
NASA Astrophysics Data System (ADS)
Loganina, Valentina I.; Sadovnikova, Marija E.; Jezierski, Walery; Małaszkiewicz, Dorota
2017-10-01
The increasing attention for restoration of buildings of historical and architectural importance has increased the interest for lime-based binders, which could be applied for manufacturing repair mortars and plasters compatible with historical heritage. Different additives, admixtures or fibers may be incorporated to improve mechanical and thermal features of such materials. In this study synthesized aluminosilicates (SA) were applied as an additive for lime mortar. The technology of synthesis consisted in the deposition of aluminosilicates from a sodium liquid glass by the aluminum sulphate Al2(SO4)3. The goal of this investigation was developing a new method of aluminosilicates synthesis from a sodium liquid glass and using this new material as a component for a lime mortar. Aluminosilicates were precipitated from the solution of aluminum sulphate Al2(SO)3 and sodium silicate. SA were then used as an additive to calcareous compositions and their influence was tested. Mortars were prepared with commercial air lime and siliceous river sand. Air lime binder was replaced by 5 and 10 wt.% of SA. Calcareous composition specimens were formed at water/lime ratio 1.0. The following analyses were made: grain size distribution of SA, X-ray diffraction analysis (XRD), sorption properties, plastic strength and compressive strength of lime mortars. XRD pattern of the SA shows the presence of thenardite, gibbsite and amorphous phase represented by aggregate of nano-size cristobalite-like crystallites. Application of SA leads to increase of compressive strength after 90 days of hardening by 28% and 53% at SA content 5 and 10% respectively comparing to specimens without this additive. Contents of chemically bound lime in the reference specimens after 28 days of hardening in air-dry conditions was 46.5%, while in specimens modified with SA contained 50.0-55.3% of bound lime depending on filtrate pH. This testifies to high activity of calcareous composition. The new blended lime mortar was developed based on SA. SA in lime composites turned out to be effective as structure-forming additive, both plastic and compressive strength increased after addition of SA.
Pan, Yuexiao; Li, Li; Lu, Jing; Pang, Ran; Wan, Li; Huang, Shaoming
2016-06-21
A green long-lasting phosphorescence (LLP) phosphor Zn2GeO4:Mn(2+) (ZGOM) has been synthesized by a solid-state method at 1100 °C in air. The luminescence intensity has been improved up to 9 and 6 times through mixing GeO2 and MgF2 into the composition, respectively. The phosphorescence duration of the sample has been prolonged to 5 h. The phosphor, composed of a mixture of Zn2GeO4 (ZGO), GeO2, and MgGeO3 phases, emits enhanced green luminescence with a broad excitation band between 250 nm to 400 nm. Under identical measurement conditions, the optimized phosphor ZGOM has a higher emission intensity and shows longer wavelength emission than those of the commercial green LLP phosphor SrAl2O4:Eu,Dy (SAOED) under an excitation at 336 nm. The quantum yield of the sample modified by GeO2 and MgF2 is as high as 95.0%. Understanding of the formation mechanism for enhancement of emission intensity and prolonging of phosphorescence duration of ZGOM is fundamentally important, which might be extended to other identified solid-state inorganic phosphor materials for advanced properties.
Luminescence in microcrystalline green emitting Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor
NASA Astrophysics Data System (ADS)
Panse, V. R.; Kokode, N. S.; Shinde, K. N.; Dhoble, S. J.
2018-03-01
Green emitting Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor powders were synthesized via the wet chemical synthesis and the luminescent proprieties were studied when excited at 380 nm and present a dominant and strong green luminescence peak at 543 nm, due to D-F transition. The preparation of Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor powders were confirmed by X-ray diffraction (XRD) results without any secondary or impurity phases. The size and morphology of the Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor powders were further examined by scanning electron microscopy (SEM). Photoluminescence (PL) results have shown strongest green emission at 543 nm, which is originated due to 5D4-7F5 transition of Tb3+ ion, for the Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor. The addition of concentration Tb3+ was greatly improved the photoluminescence properties of present phosphors. The present study suggests that the Li2Mg1-xZrO4:xTb3+ (0.1 ≤ x ≤ 2.0) phosphor is a strong candidate as a green component for phosphor-converted white light-emitting diodes (LEDs).
Near-infrared lasers and self-frequency-doubling in Nd:YCOB cladding waveguides.
Ren, Yingying; Chen, Feng; Vázquez de Aldana, Javier R
2013-05-06
A design of cladding waveguides in Nd:YCOB nonlinear crystals is demonstrated in this work. Compact Fabry-Perot oscillation cavities are employed for waveguide laser generation at 1062 nm and self-frequency-doubling at 531 nm, under optical pump at 810 nm. The waveguide laser shows slope efficiency as high as 55% at 1062 nm. The SFD green waveguide laser emits at 531 nm with a maximum power of 100 μW.
Sato, Yuka; Seimiya, Masanori; Yoshida, Toshihiko; Sawabe, Yuji; Hokazono, Eisaku; Osawa, Susumu; Matsushita, Kazuyuki
2017-01-01
Background The indocyanine green retention rate is important for assessing the severity of liver disorders. In the conventional method, blood needs to be collected twice. In the present study, we developed an automated indocyanine green method that does not require blood sampling before intravenous indocyanine green injections and is applicable to an automated biochemical analyser. Methods The serum samples of 471 patients collected before and after intravenous indocyanine green injections and submitted to the clinical laboratory of our hospital were used as samples. The standard procedure established by the Japan Society of Hepatology was used as the standard method. In the automated indocyanine green method, serum collected after an intravenous indocyanine green injection was mixed with the saline reagent containing a surfactant, and the indocyanine green concentration was measured at a dominant wavelength of 805 nm and a complementary wavelength of 884 nm. Results The coefficient of variations of the within- and between-run reproducibilities of this method were 2% or lower, and dilution linearity passing the origin was noted up to 10 mg/L indocyanine green. The reagent was stable for four weeks or longer. Haemoglobin, bilirubin and chyle had no impact on the results obtained. The correlation coefficient between the standard method (x) and this method (y) was r=0.995; however, slight divergence was noted in turbid samples. Conclusion Divergence in turbid samples may have corresponded to false negativity with the standard procedure. Our method may be highly practical because blood sampling before indocyanine green loading is unnecessary and measurements are simple.
Penjor, Tshering; Mimura, Takashi; Matsumoto, Ryoji; Yamamoto, Masashi; Nagano, Yukio
2014-01-01
Lime [Citrus aurantifolia (Cristm.) Swingle] is a Citrus species that is a popular ingredient in many cuisines. Some citrus plants are known to originate in the area ranging from northeastern India to southwestern China. In the current study, we characterized and compared limes grown in Bhutan (n = 5 accessions) and Indonesia (n = 3 accessions). The limes were separated into two groups based on their morphology. Restriction site-associated DNA sequencing (RAD-seq) separated the eight accessions into two clusters. One cluster contained four accessions from Bhutan, whereas the other cluster contained one accession from Bhutan and the three accessions from Indonesia. This genetic classification supported the morphological classification of limes. The analysis suggests that the properties associated with asexual reproduction, and somatic homologous recombination, have contributed to the genetic diversification of limes. PMID:24781859
Effects of Liming on Forage Availability and Nutrient Content in a Forest Impacted by Acid Rain
Pabian, Sarah E.; Ermer, Nathan M.; Tzilkowski, Walter M.; Brittingham, Margaret C.
2012-01-01
Acidic deposition and subsequent forest soil acidification and nutrient depletion can affect negatively the growth, health and nutrient content of vegetation, potentially limiting the availability and nutrient content of forage for white-tailed deer (Odocoileus virginianus) and other forest herbivores. Liming is a mitigation technique that can be used to restore forest health in acidified areas, but little is known about how it affects the growth or nutrient content of deer forage. We examined the effects of dolomitic limestone application on the growth and chemical composition of understory plants in an acidified forest in central Pennsylvania, with a focus on vegetative groups included as white-tailed deer forage. We used a Before-After-Control-Impact study design with observations 1 year before liming and up to 5 years post-liming on 2 treated and 2 untreated 100-ha sites. Before liming, forage availability and several nutrients were below levels considered optimal for white-tailed deer, and many vegetative characteristics were related to soil chemistry. We observed a positive effect of liming on forb biomass, with a 2.7 fold increase on limed sites, but no biomass response in other vegetation groups. We observed positive effects of liming on calcium and magnesium content and negative effects on aluminum and manganese content of several plant groups. Responses to liming by forbs and plant nutrients show promise for improving vegetation health and forage quality and quantity for deer. PMID:22761890
Effects of liming on forage availability and nutrient content in a forest impacted by acid rain.
Pabian, Sarah E; Ermer, Nathan M; Tzilkowski, Walter M; Brittingham, Margaret C
2012-01-01
Acidic deposition and subsequent forest soil acidification and nutrient depletion can affect negatively the growth, health and nutrient content of vegetation, potentially limiting the availability and nutrient content of forage for white-tailed deer (Odocoileus virginianus) and other forest herbivores. Liming is a mitigation technique that can be used to restore forest health in acidified areas, but little is known about how it affects the growth or nutrient content of deer forage. We examined the effects of dolomitic limestone application on the growth and chemical composition of understory plants in an acidified forest in central Pennsylvania, with a focus on vegetative groups included as white-tailed deer forage. We used a Before-After-Control-Impact study design with observations 1 year before liming and up to 5 years post-liming on 2 treated and 2 untreated 100-ha sites. Before liming, forage availability and several nutrients were below levels considered optimal for white-tailed deer, and many vegetative characteristics were related to soil chemistry. We observed a positive effect of liming on forb biomass, with a 2.7 fold increase on limed sites, but no biomass response in other vegetation groups. We observed positive effects of liming on calcium and magnesium content and negative effects on aluminum and manganese content of several plant groups. Responses to liming by forbs and plant nutrients show promise for improving vegetation health and forage quality and quantity for deer.
Green binary and phase shifting mask
NASA Astrophysics Data System (ADS)
Shy, S. L.; Hong, Chao-Sin; Wu, Cheng-San; Chen, S. J.; Wu, Hung-Yu; Ting, Yung-Chiang
2009-12-01
SixNy/Ni thin film green mask blanks were developed , and are now going to be used to replace general chromium film used for binary mask as well as to replace molydium silicide embedded material for AttPSM for I-line (365 nm), KrF (248 nm), ArF (193 nm) and Contact/Proximity lithography. A bilayer structure of a 1 nm thick opaque, conductive nickel layer and a SixNy layer is proposed for binary and phase-shifting mask. With the good controlling of plasma CVD of SixNy under silane (50 sccm), ammonia (5 sccm) and nitrogen (100 sccm), the pressure is 250 mTorr. and RF frequency 13.56 MHz and power 50 W. SixNy has enough deposition latitude to meet the requirements as an embedded layer for required phase shift 180 degree, and the T% in 193, 248 and 365 nm can be adjusted between 2% to 20% for binary and phase shifting mask usage. Ni can be deposited by E-gun, its sheet resistance Rs is less than 1.435 kΩ/square. Jeol e-beam system and I-line stepper are used to evaluate these thin film green mask blanks, feature size less than 200 nm half pitch pattern and 0.558 μm pitch contact hole can be printed. Transmission spectrums of various thickness of SixNy film are inspected by using UV spectrometer and FTIR. Optical constants of the SixNy film are measured by n & k meter and surface roughness is inspected by using Atomic Force Microscope (AFM).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Santos, J. F. M. dos; Terra, I. A. A.; Nunes, L. A. O.
Trivalent Tb-doped materials exhibit strong emission in the green and weak emission in the UV-blue levels. Usually, this behavior is attributed to the cross relaxation (CR) process. In this paper, the luminescence properties of Tb{sup 3+}-doped low silica calcium aluminosilicate glasses are analyzed for UV (λ{sub exc} = 325 nm) and visible (488 nm) excitations. Under 325 nm excitation, the intensity of green luminescence increases proportionally to Tb{sup 3+} concentration. However, the blue luminescence intensity is strongly reduced with the increase of concentration from 0.5–15.0 wt. %. In the case of 488 nm excitation, a saturation behavior of the green emission is observed at intensities two ordersmore » of magnitude smaller than expected for bleaching of the ground state population. Using a rate equation model, we showed that this behavior can be explained by an excited state absorption cross section two orders of magnitude larger than the ground state absorption. The blue emission is much weaker than expected from our rate equations (325 nm and 488 nm excitation). We concluded that only the CR process cannot explain the overall feature of measured luminescence quenching in the wide range of Tb{sup 3+} concentrations. Cooperative upconversion from a pair of excited ions ({sup 5}D{sub 3}:{sup 5}D{sub 3} or {sup 5}D{sub 3}:{sup 5}D{sub 4}) and other mechanisms involving upper lying states (4f5d, charge transfer, host matrix, defects, etc.) may play a significant role.« less
Chaitanya Kumar, S; Parsa, S; Ebrahim-Zadeh, M
2016-01-01
We report a stable, Yb-fiber-laser-based, green-pumped, picosecond optical parametric oscillator (OPO) for the near-infrared based on periodically poled potassium titanyl phosphate (PPKTP) nonlinear crystal, using fan-out grating design and operating near room temperature. The OPO is continuously tunable across 726-955 nm in the signal and 1201-1998 nm in the idler, resulting in a total signal plus idler wavelength coverage of 1026 nm by grating tuning at a fixed temperature. The device generates up to 580 mW of average power in the signal at 765 nm and 300 mW in the idler at 1338 nm, with an overall extraction efficiency of up to 52% and a pump depletion >76%. The extracted signal at 765 nm and idler at 1746 nm exhibit excellent passive power stability better than 0.5% and 0.8% rms, respectively, over 1 h with good beam quality in TEM00 mode profile. The output signal pulses have a Gaussian temporal duration of 13.2 ps, with a FWHM spectral bandwidth of 3.4 nm at 79.5 MHz repetition rate. Power scaling limitations of the OPO due to the material properties of PPKTP are studied.
Lime retention in anthracite coal-breaker refuse
Miroslaw M. Czapowskyj; Edward A. Sowa
1973-01-01
Hydrated lime was applied to extremely acid anthracite coal-breaker refuse at rates of 2.5 and 5.0 tons per acre. The lime raised the pH to neutral range, and this range was still in evidence 7 years after treatment. The pH readings decreased with the depth of the refuse profile, and below 9 inches they approximated those of the control plots. The 2.5-tons-of-lime-per-...
Dudley J. Raynal
1998-01-01
Forests in the northeastern US have been limed to mitigate soil acidification and the acidity of surface waters and to improve soil base cation status. Much of the area considered for liming is within the range of sugar maple (Acer saccharum), but there is a poor understanding of how liming influences growth and nutrient balance of this species on...
First demonstration of green and amber LED-pumped Nd:YAG laser
NASA Astrophysics Data System (ADS)
Tarkashvand, M.; Farahbod, A. H.; Hashemizadeh, S. A.
2018-05-01
For the first time, to the best of our knowledge, a green (520 nm) and amber (592 nm) light emitting diode-pumped Nd:YAG laser is reported. The laser oscillator is a stable semi-planar resonator with a total length of 140 mm. The green (amber) light emitting diode-pumped laser produced a 107 (52) µJ laser energy, at 2.6 (0.7) J electrical pump energy. The oscillator operated at a low repetition rate (about 0.1 Hz) in free-running mode, where the laser spikes were initiated about 210–280 µs after the leading edge of the pump pulse. Moreover, the transverse mode profiles of the resonator, pump absorption efficiency, and optical gain have been studied in some detail.
NASA Astrophysics Data System (ADS)
Qi, Yaoyao; Yu, Haijuan; Zhang, Jingyuan; Zhang, Ling; He, Chaojian; Lin, Xuechun
2018-05-01
We demonstrated a high efficiency and high average power picosecond green light source based on SHG (second harmonic generation) of an unpolarized ytterbium-doped fiber amplifier chain. Using single-pass frequency doubling in two temperature-tuned type-I phase-matching LBO crystals, we were able to generate 46 W, >70 ps pulses at 532 nm from a fundamental beam at 1064 nm, whose output is 96 W, 4.8 μJ, with a repetition frequency of 20 MHz and nearly diffraction limited. The optical conversion efficiency was ∼48% in a highly compact design. To the best of our knowledge, this is the first reported on ps green source through SHG of an unpolarized fiber laser with such a high output and high efficiency.
The effect of red, green and blue lasers on healing of oral wounds in diabetic rats.
Fekrazad, Reza; Mirmoezzi, Amir; Kalhori, Katayoun Am; Arany, Praveen
2015-07-01
Many studies have demonstrated that low-level laser therapy (LLLT) can improve wound healing in non-diabetic and diabetic animals. We compared the effects of red, green, and blue lasers in terms of accelerating oral wound healing in diabetic rats. Diabetes was successfully induced in 32 male Wistar rats using intraperitoneal injection of Streptozotocin (150 mg/kg). After intraperitoneal injection of the anesthetic agent, a full-thickness oral wound (10 mm × 2 mm) was created aseptically with a scalpel on hard palate of the diabetic rats. The study was performed using red (630 nm), green (532 nm), and blue (425 nm) lasers and a control group. We used an energy density of 2J/cm2 and a treatment schedule of 3 times/week for 10 days. The area of wounds was measured and recorded on a chart for all rats. On the 10th day, the samples were then sacrificed and a full-thickness sample of wound area was prepared for pathological study. We observed a significant difference (p<0.001) in the mean slope values of wound healing between treatment and control groups. Moreover, the mean slope of wound healing differed significantly between red laser and two other lasers - blue and green (p<0.001). The mean slopes of wound healing were not significantly different between blue laser and green laser (p=0.777). The results of the present study provide evidence that wound healing is slower in control rats compared to the treatment groups. Moreover, the findings suggest that wound healing occurs faster with red laser compared to blue and green lasers. Copyright © 2015 Elsevier B.V. All rights reserved.
Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.
Khadhair, A H; Evans, I R; Choban, B
2002-01-01
In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.
Jellies, John
2014-11-01
Medicinal leeches are predatory annelids that exhibit countershading and reside in aquatic environments where light levels might be variable. They also leave the water and must contend with terrestrial environments. Yet, leeches generally maintain a dorsal upward position despite lacking statocysts. Leeches respond visually to both green and near-ultraviolet (UV) light. I used LEDs to test the hypothesis that ventral, but not dorsal UV would evoke compensatory movements to orient the body. Untethered leeches were tested using LEDs emitting at red (632 nm), green (513 nm), blue (455 nm) and UV (372 nm). UV light evoked responses in 100 % of trials and the leeches often rotated the ventral surface away from it. Visible light evoked no or modest responses (12-15 % of trials) and no body rotation. Electrophysiological recordings showed that ventral sensilla responded best to UV, dorsal sensilla to green. Additionally, a higher order interneuron that is engaged in a variety of parallel networks responded vigorously to UV presented ventrally, and both the visible and UV responses exhibited pronounced light adaptation. These results strongly support the suggestion that a dorsal light reflex in the leech uses spectral comparisons across the dorsal-ventral axis rather than, or in addition to, luminance.
Jaffri, Shaan Bibi; Ahmad, Khuram Shahzad
2018-06-13
Present study has for the first time reported Prunus cerasifera leaf extract mediated zinc oxide nanoparticles in a green and one pot synthetic mode without utilization of any chemical reducing agents. Synthesized nanoparticles were analyzed by ultraviolet-visible (UV-Vis) spectroscopy, X-ray diffraction (XRD), fourier transmission infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). UV-Vis peak was detected at 380 nm due to surface plasmon resonance (SPR). Variety of biomolecules were revealed by FTIR involved in reduction cum stabilization of zinc oxide nanoparticles. Wurtzite hexagonal geometry with an average crystallite size of 12 nm was obtained from XRD diffraction pattern. SEM exhibited size ranges of 80-100 nm and 60- 100 nm for 200 ℃ and 600 ℃ calcination temperatures. Synthesized nanoparticles were used as bio-cleaning photocatalysts against organic pollutants i.e. bromocresol green, bromophenol blue, methyl red and methyl blue, which yielded pseudo first order reaction kinetics (R 2 = 0.98, 0.92, 0.92, 0.90 respectively). Pollutants expressed higher degradation percentages in less than 14 min in direct solar irradiance. Moreover, synthesized nanoparticles were tested against resistant microbes i.e. Aspergillus niger, Aspergillus flavus, Aspergillus fumigatus, Aspergillus terreus, Penicillium chrysogenum, Fusarium solani, Lasiodiplodia theobromae, Xanthomonas axonopodis pv. citri and Psuedomonas syringae for development of new generation of antimicrobial agents.
Awasthi, Mukesh Kumar; Wang, Quan; Huang, Hui; Ren, Xiuna; Lahori, Altaf Hussain; Mahar, Amanullah; Ali, Amjad; Shen, Feng; Li, Ronghua; Zhang, Zengqiang
2016-09-01
This study aimed to evaluate the role of different amount of zeolite with low dosage of lime amendment on the greenhouse gas (GHGs) emission and maturity during the dewatered fresh sewage sludge (DFSS) composting. The evolution of CO2, CH4, NH3 and N2O and maturity indexes were monitored in five composting mixtures prepared from DFSS mixed with wheat straw, while 10%, 15% and 30% zeolite+1% lime were supplemented (dry weight basis of DFSS) into the composting mass and compared with treatment only 1% lime amended and control without any amendment. The results showed that addition of higher dosage of zeolite+1% lime drastically reduce the GHGs emissions and NH3 loss. Comparison of GHGs emissions and compost quality showed that zeolite amended treatments were superior than control and 1% lime amended treatments. Therefore, DFSS composting with 30% zeolite+1% lime as consortium of additives were found to emit very less amount of GHGs and gave the highest maturity than other treatments. Copyright © 2016 Elsevier Ltd. All rights reserved.
Recycled sand in lime-based mortars.
Stefanidou, M; Anastasiou, E; Georgiadis Filikas, K
2014-12-01
The increasing awareness of the society about safe guarding heritage buildings and at the same time protecting the environment promotes strategies of combining principles of restoration with environmentally friendly materials and techniques. Along these lines, an experimental program was carried out in order to investigate the possibility of producing repair, lime-based mortars used in historic buildings incorporating secondary materials. The alternative material tested was recycled fine aggregates originating from mixed construction and demolition waste. Extensive tests on the raw materials have been performed and mortar mixtures were produced using different binding systems with natural, standard and recycled sand in order to compare their mechanical, physical and microstructure properties. The study reveals the improved behavior of lime mortars, even at early ages, due to the reaction of lime with the Al and Si constituents of the fine recycled sand. The role of the recycled sand was more beneficial in lime mortars rather than the lime-pozzolan or lime-pozzolan-cement mortars as a decrease in their performance was recorded in the latter cases due to the mortars' structure. Copyright © 2014 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Kawiji; Utami, R.; Ulum, S.; Khasanah, L. U.; Manuhara, G. J.; Atmaka, W.
2018-03-01
Oleoresin of kaffir lime leaves distillation residue still contains some active compounds such as Citronellal, β-Citronellol, and Linalool which potential to incorporated on the active paper packaging. The purposes of this study were to determine the effect of kaffir lime leaves distillation residue oleoresin concentration on the physical characteristics, sensory characteristics, and antimicrobial activity of the active paper packaging incorporated with kaffir lime leaves distillation residue oleoresin and to determine the functional groups of active paper packaging. The concentration of kaffir lime leaves distillation residue oleoresin were varied at 0%, 2%, 4% and 6%. The result showed that the addition of kaffir lime leaves distillation residue oleoresin increased the thickness and moisture content of the paper and decreased the tensile strengths and folding endurances of active paper packaging. The microbial inhibition tends to increase along with the higher oleoresin concentration addition. Aromatic CH group were found at a wavelength of 897.90 cm-1 of on paper packaging with 2% oleoresin indicated as functional aromatic functional group allegedly obtained from the kaffir lime leaves oleoresin.
Rechner, Ole; Neugart, Susanne; Schreiner, Monika; Wu, Sasa; Poehling, Hans-Michael
2017-01-01
Light of different wavelengths is essential for plant growth and development. Short-wavelength radiation such as UV can shift the composition of flavonoids, glucosinolates, and other plant metabolites responsible for enhanced defense against certain herbivorous insects. The intensity of light-induced, metabolite-based resistance is plant- and insect species-specific and depends on herbivore feeding guild and specialization. The increasing use of light-emitting diodes (LEDs) in horticultural plant production systems in protected environments enables the creation of tailor-made light scenarios for improved plant cultivation and induced defense against herbivorous insects. In this study, broccoli (Brassica oleracea var. italica) plants were grown in a climate chamber under broad spectra photosynthetic active radiation (PAR) and were additionally treated with the following narrow-bandwidth light generated with LEDs: UV-A (365 nm), violet (420 nm), blue (470 nm), or green (515 nm). We determined the influence of narrow-bandwidth light on broccoli plant growth, secondary plant metabolism (flavonol glycosides and glucosinolates), and plant-mediated light effects on the performance and behavior of the specialized cabbage aphid Brevicoryne brassicae. Green light increased plant height more than UV-A, violet, or blue LED treatments. Among flavonol glycosides, specific quercetin and kaempferol glycosides were increased under violet light. The concentration of 3-indolylmethyl glucosinolate in plants was increased by UV-A treatment. B. brassicae performance was not influenced by the different light qualities, but in host-choice tests, B. brassicae preferred previously blue-illuminated plants (but not UV-A-, violet-, or green-illuminated plants) over control plants.
Spectral inputs and ocellar contributions to a pitch-sensitive descending neuron in the honeybee.
Hung, Y-S; van Kleef, J P; Stange, G; Ibbotson, M R
2013-02-01
By measuring insect compensatory optomotor reflexes to visual motion, researchers have examined the computational mechanisms of the motion processing system. However, establishing the spectral sensitivity of the neural pathways that underlie this motion behavior has been difficult, and the contribution of the simple eyes (ocelli) has been rarely examined. In this study we investigate the spectral response properties and ocellar inputs of an anatomically identified descending neuron (DNII(2)) in the honeybee optomotor pathway. Using a panoramic stimulus, we show that it responds selectively to optic flow associated with pitch rotations. The neuron is also stimulated with a custom-built light-emitting diode array that presented moving bars that were either all-green (spectrum 500-600 nm, peak 530 nm) or all-short wavelength (spectrum 350-430 nm, peak 380 nm). Although the optomotor response is thought to be dominated by green-sensitive inputs, we show that DNII(2) is equally responsive to, and direction selective to, both green- and short-wavelength stimuli. The color of the background image also influences the spontaneous spiking behavior of the cell: a green background produces significantly higher spontaneous spiking rates. Stimulating the ocelli produces strong modulatory effects on DNII(2), significantly increasing the amplitude of its responses in the preferred motion direction and decreasing the response latency by adding a directional, short-latency response component. Our results suggest that the spectral sensitivity of the optomotor response in honeybees may be more complicated than previously thought and that ocelli play a significant role in shaping the timing of motion signals.
Neugart, Susanne; Schreiner, Monika; Wu, Sasa; Poehling, Hans-Michael
2017-01-01
Light of different wavelengths is essential for plant growth and development. Short-wavelength radiation such as UV can shift the composition of flavonoids, glucosinolates, and other plant metabolites responsible for enhanced defense against certain herbivorous insects. The intensity of light-induced, metabolite-based resistance is plant- and insect species-specific and depends on herbivore feeding guild and specialization. The increasing use of light-emitting diodes (LEDs) in horticultural plant production systems in protected environments enables the creation of tailor-made light scenarios for improved plant cultivation and induced defense against herbivorous insects. In this study, broccoli (Brassica oleracea var. italica) plants were grown in a climate chamber under broad spectra photosynthetic active radiation (PAR) and were additionally treated with the following narrow-bandwidth light generated with LEDs: UV-A (365 nm), violet (420 nm), blue (470 nm), or green (515 nm). We determined the influence of narrow-bandwidth light on broccoli plant growth, secondary plant metabolism (flavonol glycosides and glucosinolates), and plant-mediated light effects on the performance and behavior of the specialized cabbage aphid Brevicoryne brassicae. Green light increased plant height more than UV-A, violet, or blue LED treatments. Among flavonol glycosides, specific quercetin and kaempferol glycosides were increased under violet light. The concentration of 3-indolylmethyl glucosinolate in plants was increased by UV-A treatment. B. brassicae performance was not influenced by the different light qualities, but in host-choice tests, B. brassicae preferred previously blue-illuminated plants (but not UV-A-, violet-, or green-illuminated plants) over control plants. PMID:29190278
Nutrients Limiting Soybean (glycine max l) Growth in Acrisols and Ferralsols of Western Kenya
Keino, Ludy; Baijukya, Frederick; Ng’etich, Wilson; Otinga, Abigael N.; Okalebo, John R.; Njoroge, Ruth; Mukalama, John
2015-01-01
Low soybean yields in western Kenya have been attributed to low soil fertility despite much work done on nitrogen (N) and phosphorus (P) nutrition leading to suspicion of other nutrient limitations. To investigate this, a nutrient omission trial was set up in the greenhouse at the University of Eldoret-Kenya to diagnose the nutrients limiting soybean production in Acrisols from Masaba central and Butere sub-Counties, and Ferralsols from Kakamega (Shikhulu and Khwisero sub-locations) and Butula sub-Counties and to assess the effect of liming on soil pH and soybean growth. The experiment was laid out in a completely randomized design with ten treatments viz; positive control (complete), negative control (distilled water), complete with lime, complete with N, minus macronutrients P, potassium (K), calcium (Ca), magnesium (Mg) and sulphur (S) and with, micro-nutrients boron (B), molybdenum (Mo), manganese (Mn), copper (Cu) and zinc (Zn) omitted. Visual deficiency symptoms observed included interveinal leaf yellowing in Mg omission and N addition and dark green leaves in P omission. Nutrients omission resulted in their significantly low concentration in plant tissues than the complete treatment. Significantly (P≤ 0.05) lower shoot dry weights (SDWs) than the complete treatment were obtained in different treatments; omission of K and Mg in Masaba and Shikhulu, Mg in Khwisero, K in Butere and, P, Mg and K in Butula. Nitrogen significantly improved SDWs in soils from Kakamega and Butula. Liming significantly raised soil pH by 9, 13 and 11% from 4.65, 4.91 and 4.99 in soils from Masaba, Butere and Butula respectively and soybean SDWs in soils from Butere. The results show that, poor soybean growth was due to K, Mg and P limitation and low pH in some soils. The results also signify necessity of application of small quantities of N for initial soybean use. PMID:26716825
The Design and the Implementation of the Machinery for Whitewashing the Trunks
NASA Astrophysics Data System (ADS)
Chen, Xuehui; Yuan, Genfu; Huang, Lei; Wang, Riguang; Lei, Jingfa; Chen, Congsheng
Whitewashing the trunks is an important part in the management of tree greening in winter, which can prevent the pests and the livestock grazing the trunks, strengthen the winter-proofing ability of trees and enhance the esthetic effect of amenity. In this paper, an innovative mechanical design idea that the trees are brushed by the lime water with the insect repellant has been introduced. Meanwhile, the numerical simulation technology has been also employed to analyze the important components of this machine, which can improve the reliability and the economy of the design. The practice shows that this product can significantly improve the work efficiency and reduce the labor intensity through comparing with the traditional working ways.
NASA Astrophysics Data System (ADS)
Selvakumari, J. Celina; Ahila, M.; Malligavathy, M.; Padiyan, D. Pathinettam
2017-09-01
Tin oxide (SnO2) nanoparticles were cost-effectively synthesized using nontoxic chemicals and green tea ( Camellia sinensis) extract via a green synthesis method. The structural properties of the obtained nanoparticles were studied using X-ray diffraction, which indicated that the crystallite size was less than 20 nm. The particle size and morphology of the nanoparticles were analyzed using scanning electron microscopy and transmission electron microscopy. The morphological analysis revealed agglomerated spherical nanoparticles with sizes varying from 5 to 30 nm. The optical properties of the nanoparticles' band gap were characterized using diffuse reflectance spectroscopy. The band gap was found to decrease with increasing annealing temperature. The O vacancy defects were analyzed using photoluminescence spectroscopy. The increase in the crystallite size, decreasing band gap, and the increasing intensities of the UV and visible emission peaks indicated that the green-synthesized SnO2 may play future important roles in catalysis and optoelectronic devices.
Evaluation of superpave mixtures containing hydrated lime.
DOT National Transportation Integrated Search
2013-07-01
The use of hydrated lime in Hot-Mix Asphalt (HMA) mixtures can reduce permanent deformation, long-term aging, and moisture : susceptibility of mixtures. In addition, hydrated lime increases the stiffness and fatigue resistance of mixtures. This study...
NASA Astrophysics Data System (ADS)
Rajendran, Kalimuthu; Rajendiran, Nagappan
2018-02-01
A simple, economical, and green method for the preparation of water soluble, high fluorescent carbon quantum dots (CQDs) has been prepared via hydrothermal process using jackfruit (Artocarpus heterophyllus) as a carbon source. The optical properties of synthesized CQDs were characterized by UV- visible and fluorescence spectroscopy. Fourier transform infrared spectroscopy (FT-IR), x-ray Diffraction (XRD) and high resolution transmission electron microscopy (HR-TEM) techniques were used to study the composition and size of the CQDs. The prepared CQDs were spherical in shape with an average size of 2.5 nm along with uniform distribution and showed bright bluish green emission properties, without any further surface modification. The prepared CQDs were exhibit high stability at neutral pH and showed high photo-stability under UV light irradiation at 365 nm. The obtained CQDs were effectively utilized as fluorescent probe for highly selective and sensitive detection of Hg2+ and Cr6+ ions in environmental samples with a limit of detection of about 8 and 10 nM respectively.
One-pot green synthesis of luminescent gold nanoparticles using imidazole derivative of chitosan.
Nazirov, Alexander; Pestov, Alexander; Privar, Yuliya; Ustinov, Alexander; Modin, Evgeny; Bratskaya, Svetlana
2016-10-20
Water soluble luminescent gold nanoparticles with average size 2.3nm were for the first time synthesized by completely green method of Au(III) reduction using chitosan derivative-biocompatible nontoxic N-(4-imidazolyl)methylchitosan (IMC) as both reducing and stabilizing agent. Reduction of Au(III) to gold nanoparticles in IMC solution is a slow process, in which coordination power of biopolymer controls both reducing species concentration and gold crystal growth rate. Gold nanoparticles formed in IMC solution do not manifest surface plasmon resonance, but exhibit luminescence at 375nm under UV light excitation at 230nm. Due to biological activity of imidazolyl-containing polymers and their ability to bind proteins and drugs, the obtained ultra-small gold nanoparticles can find an application for biomolecules detection, bio-imaging, drug delivery, and catalysis. Very high catalytic activity (as compared to gold nanoparticles obtained by other green methods) was found for Au/IMC nanoparticles in the model reaction of p-nitrophenol reduction providing complete conversion of p-nitrophenol to p-aminophenol within 180-190s under mild conditions. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Bing; Shen, Chao; Zhang, Mengya
Green synthesis of CdSe quantum dots for application in the quantum-dots-sensitized solar cells (QDSCs) is investigated in this work. The CdSe QDs were prepared with glycerol as the solvent, with sharp emission peak, full width at half maximum around 30 nm, and absorption peak from 475 nm to 510 nm. The reaction is environmental friendly and energy saving. What's more, the green synthesized CdSe QDs are coherence to the maximum remittance region of the solar spectrum and suitable as sensitizers to assemble onto TiO{sub 2} electrodes for cell devices application. What's more, the dynamic procedure of the carriers' excitation, transportation, and recombination inmore » the QDSCs are discussed. Because the recombination of the electrons from the conduction band of TiO{sub 2}'s to the electrolyte affects the efficiency of the solar cells greatly, 3-Mercaptopropionic acid capped water-dispersible QDs were used to cover the surface of TiO{sub 2}. The resulting green synthesized CdSe QDSCs with Cu{sub 2}S as the electrode show a photovoltaic performance with a conversion efficiency of 3.39%.« less
NASA Astrophysics Data System (ADS)
Maeno, Akihiro; Kato, Yuko; Jimbo, Mitsuru; Amada, Kei; Mita, Hajime; Akasaka, Kazuyuki
2017-04-01
We have investigated conformational fluctuations in a new green fluorescent protein(GFP)-like protein rb-Akane found in a red-brown-colored octocoral, Scleronephthya gracillima (Kuekenthal)), with high pressure fluorescence spectroscopy at 0.1-700 MPa. Besides the green fluorescence at 510 nm, two red fluorescence peaks are observed at 590 and 629 nm, the relative intensity of which varies reversibly with pressure. The phenomenon is interpreted as representing the cis-trans isomerization of the chromophore accompanied by the conformational transition between two sub-states of the red fluorescence form of rb-Akane. The two sub-states are separated only marginally in free energy (ΔG0 = 1.9 ± 0.4 kJ mol-1), but significantly in partial molar volume (ΔV0 = -19.8 ± 1.4 ml mol-1) at 0.1 MPa (pH 7.5, 25°C). Above 500 MPa, the fluorescence at λmax 629 nm undergoes another reversible change with pressure, showing the onset of unfolding.
A new solid-state, frequency-doubled neodymium-YAG photocoagulation system.
Jalkh, A E; Pflibsen, K; Pomerantzeff, O; Trempe, C L; Schepens, C L
1988-06-01
We have developed a solid-state laser system that produces a continuous green monochromatic laser beam of 532 nm by doubling the frequency of a neodymium-YAG laser wavelength of 1064 nm with a potassium-titamyl-phosphate crystal. Photocoagulation burns of equal size and intensity were placed in two rabbit eyes with the solid-state laser system and the regular green argon laser system, respectively, using the same slit-lamp mode of delivery. Histologic findings of lesion sections revealed no important differences between the two systems. In theory, the longer wavelength of the solid-state laser offers the advantages of less scattering in ocular media, higher absorption by oxyhemoglobin, and less absorption by macular xanthophyll than the 514-nm wavelength of the regular green argon laser. The solid-state laser has impressive technical advantages: it contains no argon-ion gas tube that wears out and is expensive to replace; it is much more power efficient, and thus considerably smaller and compact; it is sturdier and easily movable; it does not require external cooling; it uses a 220-V monophasic alternating current; and it requires little maintenance.
Huang, Jingfeng; Wei, Chen; Zhang, Yao; Blackburn, George Alan; Wang, Xiuzhen; Wei, Chuanwen; Wang, Jing
2015-01-01
Passive optical hyperspectral remote sensing of plant pigments offers potential for understanding plant ecophysiological processes across a range of spatial scales. Following a number of decades of research in this field, this paper undertakes a systematic meta-analysis of 85 articles to determine whether passive optical hyperspectral remote sensing techniques are sufficiently well developed to quantify individual plant pigments, which operational solutions are available for wider plant science and the areas which now require greater focus. The findings indicate that predictive relationships are strong for all pigments at the leaf scale but these decrease and become more variable across pigment types at the canopy and landscape scales. At leaf scale it is clear that specific sets of optimal wavelengths can be recommended for operational methodologies: total chlorophyll and chlorophyll a quantification is based on reflectance in the green (550–560nm) and red edge (680–750nm) regions; chlorophyll b on the red, (630–660nm), red edge (670–710nm) and the near-infrared (800–810nm); carotenoids on the 500–580nm region; and anthocyanins on the green (550–560nm), red edge (700–710nm) and near-infrared (780–790nm). For total chlorophyll the optimal wavelengths are valid across canopy and landscape scales and there is some evidence that the same applies for chlorophyll a. PMID:26356842
NASA Astrophysics Data System (ADS)
Binal, Adil
2017-10-01
In the historic masonry structures, hard and large rock fragments were used as the construction materials. The hydraulic binder material prepared to keep this used material in its entirety is a different material than the cement used today. Khorasan mortar made by using aggregate and lime exhibits a more flexible structure than the concrete. This feature allows the historic building to be more durable. There is also a significant industrial value because of the use of Khorasan mortar in the restoration of historic masonry structures. Therefore, the calculation of the ideal mixture of Khorasan mortar and the determination of its mechanical and physical properties are of great importance regarding preserving historic buildings. In this study, the mixtures of different lime and brick fractions were prepared. It was determined that Khorasan mortar shows the highest compressive strength in mixtures with water/lime ratio of 0.55 and lime/aggregate ratio of 0.66. By keeping the mixing ratio constant, it was observed that the strengths of the samples kept in the humidity chamber for different curing times increased day by day. The early strength values of samples with the high lime/aggregate ratio (l/a: 0.83) were higher than those with the low lime/aggregate ratio (l/a: 0.5). For the samples with low lime/aggregate ratio, there was an increase in the strength values depending on the curing period. As the cure duration increases, a chemical reaction takes place between the lime and the brick fracture, and as a result of this reaction, the strength values are increased.
Yang, Jun; Zhang, Cuimiao; Peng, Chong; Li, Chunxia; Wang, Lili; Chai, Ruitao; Lin, Jun
2009-01-01
Light fantastic! Lu(2)O(3):Yb(3+)/Er(3+)/Tm(3+) nanocrystals with controllable red, green, blue (RGB) and bright white upconversion luminescence by a single laser excitation of 980 nm have been successfully synthesized (see picture). Due to abundant UC PL colors, it can potentially be used as fluorophores in the field of color displays, back light, UC lasers, photonics, and biomedicine.Lu(2)O(3):Yb(3+)/Er(3+)/Tm(3+) nanocrystals have been successfully synthesized by a solvothermal process followed by a subsequent heat treatment at 800 degrees C. Powder X-ray diffraction, transmission electron microscopy, upconversion photoluminescence spectra, and kinetic decay were used to characterize the samples. Under single-wavelength diode laser excitation of 980 nm, the bright blue emissions of Lu(2)O(3):Yb(3+), Tm(3+) nanocrystals near 477 and 490 nm were observed due to the (1)G(4)-->(3)H(6) transition of Tm(3+). The bright green UC emissions of Lu(2)O(3):Er(3+) nanocrystals appeared near 540 and 565 nm were observed and assigned to the (2)H(11/2)-->(4)I(15/2) and (4)S(3/2)-->(4)I(15/2) transitions, respectively, of Er(3+). The ratio of the intensity of green luminescence to that of red luminescence decreases with an increase of concentration of Yb(3+) in Lu(2)O(3):Er(3+) nanocrystals. In sufficient quantities of Yb(3+) with resprct to Er(3+), the bright red UC emission of Lu(2)O(3):Yb(3+)/Er(3+) centered at 662 nm was predominant, due to the (4)F(9/2)-->(4)I(15/2) transition of Er(3+). Based on the generation of red, green, and blue emissions in the different doped Lu(2)O(3):RE(3+) nanocrystals, it is possible to produce the luminescence with a wide spectrum of colors, including white, by the appropriate doping of Yb(3+), Tm(3+), and Er(3+) in the present Lu(2)O(3) nanocrystals. Namely, Lu(2)O(3):3 %Yb(3+)/0.2 %Tm(3+)/0.4 %Er(3+) nanocrystals show suitable intensities of blue, green, and red (RGB) emission, resulting in the production of perfect and bright white light with CIE-x=0.3456 and CIE-y=0.3179, which is very close to the standard equal energy white light illuminate (x=0.33, y=0.33). Because of abundant luminescent colors from RGB to white in Lu(2)O(3):Yb(3+)/Er(3+)/Tm(3+) nanocrystals under 980 nm laser diode (LD) excitation, they can potentially be used as fluorophores in the field of color displays, back light, UC lasers, photonics, and biomedicine.
A resonance-free nano-film airborne ultrasound emitter
NASA Astrophysics Data System (ADS)
Daschewski, Maxim; Harrer, Andrea; Prager, Jens; Kreutzbruck, Marc; Beck, Uwe; Lange, Thorid; Weise, Matthias
2013-01-01
In this contribution we present a novel thermo-acoustic approach for the generation of broad band airborne ultrasound and investigate the applicability of resonance-free thermo-acoustic emitters for very short high pressure airborne ultrasound pulses. We report on measurements of thermo-acoustic emitter consisting of a 30 nm thin metallic film on a usual soda-lime glass substrate, generating sound pressure values of more than 140 dB at 60 mm distance from the transducer and compare the results with conventional piezoelectric airborne ultrasound transducers. Our experimental investigations show that such thermo-acoustic devices can be used as broad band emitters using pulse excitation.
62. INTERIOR VIEW OF THE LIME KILN BUILDING, LOOKING AT ...
62. INTERIOR VIEW OF THE LIME KILN BUILDING, LOOKING AT THE LIME KILNS AND MOTOR DRIVES FOR THE KILNS. (DATE UNKNOWN). - United States Nitrate Plant No. 2, Reservation Road, Muscle Shoals, Muscle Shoals, Colbert County, AL
Autophagy Signaling in Prostate Cancer: Identification of a Novel Phosphatase
2011-08-01
the transmembrane and cytosolic residues). We measured PTPRS activity using a phospho-tyrosine (pTyr) peptide with malachite green free phosphate...vitro using a 100 uM phosphotyrosine peptide substrate and malachite green detection of released free phosphates. Activity is expressed as picomoles...Upstate) at 37°C for 15 minutes. Released phosphates were detected with malachite green (Upstate) and absorbance measured at 650 nm. Background levels
Effect of Physicochemical Anomalies of Soda-Lime Silicate Slides on Biomolecule Immobilization
2009-01-01
roughness. EXPERIMENTAL SECTION Materials. Standard soda - lime glass microscope slides were obtained from several sources (Table 1). Rabbit anti-lipid A...had changed, confir- mation was obtained from the manufacturers that slides in set A1 were the same soda - lime glass slides as those in set A2 and...manufacture of soda - lime glass slides. X-ray Photoelectron Spectroscopy (XPS). To identify el- emental disparities in the glass surface, relative atomic
Maas, Ronald H. W.; Bakker, Robert R.; Jansen, Mickel L. A.; Visser, Diana; de Jong, Ed; Eggink, Gerrit
2008-01-01
Conventional processes for lignocellulose-to-organic acid conversion requires pretreatment, enzymatic hydrolysis, and microbial fermentation. In this study, lime-treated wheat straw was hydrolyzed and fermented simultaneously to lactic acid by an enzyme preparation and Bacillus coagulans DSM 2314. Decrease in pH because of lactic acid formation was partially adjusted by automatic addition of the alkaline substrate. After 55 h of incubation, the polymeric glucan, xylan, and arabinan present in the lime-treated straw were hydrolyzed for 55%, 75%, and 80%, respectively. Lactic acid (40.7 g/l) indicated a fermentation efficiency of 81% and a chiral l(+)-lactic acid purity of 97.2%. In total, 711 g lactic acid was produced out of 2,706 g lime-treated straw, representing 43% of the overall theoretical maximum yield. Approximately half of the lactic acid produced was neutralized by fed-batch feeding of lime-treated straw, whereas the remaining half was neutralized during the batch phase with a Ca(OH)2 suspension. Of the lime added during the pretreatment of straw, 61% was used for the neutralization of lactic acid. This is the first demonstration of a process having a combined alkaline pretreatment of lignocellulosic biomass and pH control in fermentation resulting in a significant saving of lime consumption and avoiding the necessity to recycle lime. PMID:18247027
Influence of lime juice on the severity of sickle cell anemia.
Adegoke, Samuel Ademola; Shehu, Umar Abdullahi; Mohammed, Lasisi Oluwafemi; Sanusi, Yunusa; Oyelami, Oyeku Akibu
2013-06-01
The pain in sickle cell anemia (SCA) is often triggered by dehydration, acidosis, and fever that are usually due to malaria. Intake of lime juice was recently demonstrated to facilitate clearance of the malaria parasite. It was therefore sought to determine whether regular intake of lime juice will ameliorate crisis, especially recurrent bone pain. In this preliminary, open-labeled, randomized study, the effects of lime juice on the clinical and some laboratory characteristics of children with SCA were tested. Among the 113 children with SCA studied in two hospitals, the 58 receiving lime treatment had lower rates of significant painful episodes than the 55 without lime (37 versus 83 crises in 6 months, and 0.64±0.11 versus 1.51±0.34 average rates per child, p<0.001). Also, fewer subjects than the controls had significant painful episodes (50.0% versus 92.7%); febrile illness (46.6% versus 87.3%) and admission rate (3.4% versus 34.5%) (p<0.001). The mean hematocrit of the subjects (26.23±2.03%) at the end of the study was also higher, p<0.001. However, transfusion rate, presence of hepatomegaly, splenomegaly, and jaundice was similar. Treatment with lime did not cause any significant side-effect. Regular intake of lime juice may be of great therapeutic and nutritional relevance in children with SCA.
Improving primary treatment of urban wastewater with lime-induced coagulation.
Marani, Dario; Ramadori, Roberto; Braguglia, Camilla Maria
2004-01-01
The enhancement of primary treatment efficiency through the coagulation process may yield several advantages, including lower aeration energy in the subsequent biological unit and higher recovery of biogas from sludge digestion. In this work sewage coagulation with lime was studied at pilot plant level, using degritted sewage from the city of Rome. The work aimed at optimising the operating conditions (coagulant dosage or treatment pH, and mixing conditions in the coagulation and flocculation tanks), in order to maximise the efficiency of suspended Chemical Oxygen Demand (COD) removal and to minimise sludge production. Lime dosage optimisation resulted in an optimal treatment pH of 9. Lime addition up to pH 9 may increase COD removal rate in the primary treatment from typical 30-35% of plain sedimentation up to 55-70%. Within the velocity gradients experimented in this work (314-795 s(-1) for the coagulation tank and 13-46 s(-1) for the flocculation tank), mixing conditions did not significantly affect the lime-enhanced process, which seems to be controlled by slow lime dissolution. Sludge produced in the lime-enhanced process settled and compacted easily, inducing an average 36% decrease in sludge volume with respect to plain settling. However excess sludge was produced, which was not accounted for by the amount of suspended solids removed. This is probably due to incomplete dissolution of lime, which may be partially incorporated in the sludge.
2007-05-25
of-the-art optical filters. Specifically, a FF01 -510/84 Semrock green band-pass filter (transmission >95% with 1% standard deviation between 467nm...used to reject the UV laser light (-390nm) exciting the CH radicals, and a NF0I-532U Semrock notch filter (transmission ə 04 % at 527nm, and >95
Green synthesis, structure and fluorescence spectra of new azacyanine dyes
NASA Astrophysics Data System (ADS)
Enchev, Venelin; Gadjev, Nikolai; Angelov, Ivan; Minkovska, Stela; Kurutos, Atanas; Markova, Nadezhda; Deligeorgiev, Todor
2017-11-01
A series of symmetric and unsymmetric monomethine azacyanine dyes (monomethine azacyanine and merocyanine sulfobetaines) were synthesized with moderate to high yields via a novel method using microwave irradiation. The compounds are derived from a condensation reaction between 2-thiomethylbenzotiazolium salts and 2-imino-3-methylbenzothiazolines proceeded under microwave irradiation. The synthetic approach involves the use of green solvent and absence of basic reagent. TD-DFT calculations were performed to simulate absorption and fluorescent spectra of synthesized dyes. Absorption maxima, λmax, of the studied dyes were found in the range 364-394 nm. Molar absorbtivities were evaluated in between 40300 and 59200 mol-1 dm3 cm-1. Fluorescence maxima, λfl, were registered around 418-448 nm upon excitation at 350 nm. A slight displacements of theoretically estimated absorption maxima according to experimental ones is observed. The differences are most probably due to the fact that the DFT calculations were carried out without taking into account the solvent effect. In addition, the merocyanine sulfobetaines also fluorescence in blue optical range (420-480 nm) at excitation in red range (630-650 nm).
Anomalous pH Effect of Blue Proteorhodopsin.
Yamada, Keisuke; Kawanabe, Akira; Yoshizawa, Susumu; Inoue, Kentaro; Kogure, Kazuhiro; Kandori, Hideki
2012-04-05
Proteorhodopsin (PR) is a light-driven proton pump found in marine bacteria, and thousands of PRs are classified into blue-absorbing PR (B-PR; λmax ≈ 490 nm) and green-absorbing PR (G-PR; λmax ≈ 525 nm). In this report, we present conversion of B-PR into G-PR using anomalous pH effect. B-PR in LC1-200, marine γ-proteobacteria, absorbs 497 and 513 nm maximally at pH 7 and 4, respectively, whose pH titration was reversible (pKa = 4.8). When pH was lowered from 4, the λmax was further red-shifted (528 nm at pH 2). This is unusual because blue shift occurs by chloride binding in the case of bacteriorhodopsin. Surprisingly, when pH was increased from 2 to 7, the λmax of this B-PR was further red-shifted to 540 nm, indicating that green-absorbing PR (PR540) is created only by changing pH. The present study reports the conformational flexibility of microbial rhodopsins, leading to the switch of absorbing color by a simple pH change.
Plasmon-Induced Selective Enhancement of Green Emission in Lanthanide-Doped Nanoparticles.
Zhang, Weina; Li, Juan; Lei, Hongxiang; Li, Baojun
2017-12-13
By introducing an 18 nm thick Au nanofilm, selective enhancement of green emission from lanthanide-doped (β-NaYF 4 :Yb 3+ /Er 3+ ) upconversion nanoparticles (UCNPs) is demonstrated. The Au nanofilm is deposited on a microfiber surface by the sputtering method and then covered with the UCNPs. The plasma on the surface of the Au nanofilm can be excited by launching a 980 nm wavelength laser beam into the microfiber, resulting in an enhancement of the local electric field and a strong thermal effect. A 36-fold luminescence intensity enhancement of the UCNPs at 523 nm is observed, with no obvious reduction in the photostability of the UCNPs. Further, the intensity ratios of the emissions at 523-545 nm and at 523-655 nm are enhanced with increasing pump power, which is attributed to the increasing plasmon-induced thermal effect. Therefore, the fabricated device is further demonstrated to exhibit an excellent ability in temperature sensing. By controlling the pump power and the UCNP concentration, a wide temperature range (325-811 K) and a high temperature resolution (0.035-0.046 K) are achieved in the fabricated device.
[Research of spectrum characteristics for light conversion agricultural films].
Zhang, Song-pei; Li, Jian-yu; Chen, Juan; Xiao, Yang; Sun, Yu-e
2004-10-01
The solar spectrum and the function spectrum in chrysanthemum and tomato were determined in this paper. The research for a relation plant growth to solar spectrum showed that the efficiency of plant making use of ultraviolet light of 280-380 nm and yellow-green light of 500-600 nm and near IR spectra over 720 nm are lower, that the blue-purple light of 430-480 nm and red light of 630-690 nm are beneficial to enhancing photosynthesis and promoting plant growth. According to plant photosynthesis and solar spectrum characteristic, the author developed CaS:Cu+, Cl- blue light film, and red light film added with CaS:Eu2+, Mn2+, Cl- to convert green light into red light, and discussed the spectrum characteristic of red-blue double peak in agricultural film and rare earth organic complex which could convert ultraviolet light into red light. Just now, the study on light conversion regents in farm films is going to face new breakthrough and the technology of anti-stocks displacement to study red film which can convert near infrared light are worth to attention.
Narendrula-Kotha, Ramya; Nkongolo, Kabwe K.
2017-01-01
Aims To assess the effects of dolomitic limestone applications on soil microbial communities’ dynamics and bacterial and fungal biomass, relative abundance, and diversity in metal reclaimed regions. Methods and Results The study was conducted in reclaimed mining sites and metal uncontaminated areas. The limestone applications were performed over 35 years ago. Total microbial biomass was determined by Phospholipid fatty acids. Bacterial and fungal relative abundance and diversity were assessed using 454 pyrosequencing. There was a significant increase of total microbial biomass in limed sites (342 ng/g) compared to unlimed areas (149 ng/g). Chao1 estimates followed the same trend. But the total number of OTUs (Operational Taxonomic Units) in limed (463 OTUs) and unlimed (473 OTUs) soil samples for bacteria were similar. For fungi, OTUs were 96 and 81 for limed and unlimed soil samples, respectively. Likewise, Simpson and Shannon diversity indices revealed no significant differences between limed and unlimed sites. Bacterial and fungal groups specific to either limed or unlimed sites were identified. Five major bacterial phyla including Actinobacteria, Acidobacteria, Chloroflexi, Firmicutes, and Proteobacteria were found. The latter was the most prevalent phylum in all the samples with a relative abundance of 50%. Bradyrhizobiaceae family with 12 genera including the nitrogen fixing Bradirhizobium genus was more abundant in limed sites compared to unlimed areas. For fungi, Ascomycota was the most predominant phylum in unlimed soils (46%) while Basidiomycota phylum represented 86% of all fungi in the limed areas. Conclusion Detailed analysis of the data revealed that although soil liming increases significantly the amount of microbial biomass, the level of species diversity remain statistically unchanged even though the microbial compositions of the damaged and restored sites are different. Significance and Impact of the study Soil liming still have a significant beneficial effects on soil microbial abundance and composition > 35 years after dolomitic limestone applications. PMID:28052072
Shiroma, Riki; Park, Jeung-yil; Al-Haq, Muhammad Imran; Arakane, Mitsuhiro; Ike, Masakazu; Tokuyasu, Ken
2011-02-01
We improved the CaCCO process for rice straw by its incorporation with a step of lime pretreatment at room temperature (RT). We firstly optimized the RT-lime pretreatment for the lignocellulosic part. When the ratio of lime/dry-biomass was 0.2 (w/w), the RT lime-pretreatment for 7-d resulted in an effect on the enzymatic saccharification of cellulose and xylan equivalent to that of the pretreatment at 120°C for 1h. Sucrose, starch and β-1,3-1,4-glucan, which could be often detected in rice straw, were mostly stable under the RT-lime pretreatment condition. Then, the pretreatment condition in the conventional CaCCO process was modified by the adaptation of the optimized RT lime-pretreatment, resulting in significantly better carbohydrate recoveries via enzymatic saccharification than those of the CaCCO process (120°C for 1 h). Thus, the improved CaCCO process (the RT-CaCCO process) could preserve/pretreat the feedstock at RT in a wet form with minimum loss of carbohydrates. Copyright © 2010 Elsevier Ltd. All rights reserved.
Schotsmans, Eline M J; Denton, John; Dekeirsschieter, Jessica; Ivaneanu, Tatiana; Leentjes, Sarah; Janaway, Rob C; Wilson, Andrew S
2012-04-10
Recent casework in Belgium involving the search for human remains buried with lime, demonstrated the need for more detailed understanding of the effect of different types of lime on cadaver decomposition and its micro-environment. Six pigs (Sus scrofa) were used as body analogues in field experiments. They were buried without lime, with hydrated lime (Ca(OH)(2)) and with quicklime (CaO) in shallow graves in sandy loam soil in Belgium and recovered after 6 months of burial. Observations from these field recoveries informed additional laboratory experiments that were undertaken at the University of Bradford, UK. The combined results of these studies demonstrate that despite conflicting evidence in the literature, hydrated lime and quicklime both delay the decay of the carcass during the first 6 months. This study has implications for the investigation of clandestine burials and for a better understanding of archaeological plaster burials. Knowledge of the effects of lime on decomposition processes also has bearing on practices involving burial of animal carcasses and potentially the management of mass graves and mass disasters by humanitarian organisations and DVI teams. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Effect of Cr2O3 Pickup on Dissolution of Lime in Converter Slag
NASA Astrophysics Data System (ADS)
Yan, Wei; Chen, Weiqing; Zhao, Xiaobo; Yang, Yindong; McLean, Alex
2017-09-01
Application of low-nickel laterite ore containing chromium as charging material for ironmaking can reduce raw material costs, but result in an increase of chromium content in the hot metal and hence, Cr2O3 content in the steelmaking slag, which subsequently causes many problems related to lime dissolution for the steelmaking operation. In this work, a rotating cylinder method was employed to study the effect of Cr2O3 on lime dissolution in steelmaking slag. The lime dissolution mechanism, rate control step and affecting factors, including slag basicity, FeOx and B2O3 content, and the formation of phases at reacted layer, were discussed. It was found that mass transfer was the rate control step in slag phase, increase of Cr2O3 and slag basicity delayed lime dissolution due to the formation of high-melting temperature phases of FeO · Cr2O3 spinel and 2CaO · SiO2 at the slag/lime reacted interface. Addition of B2O3 promoted lime dissolution and suppressed formation of FeO · Cr2O3 spinel.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benninger-Truax, M.; Taylor, D.H.
1993-10-01
Mechanisms of ecosystem recovery following 11 years of sewage sludge disposal were addressed by examining the effects of tilling and/or liming on soil chemistry and the heavy metal (Cd, Cu, Pb, and Zn) concentrations in soil, earthworms, vegetation, spiders, and crickets. In 1989 and 1990, subplots in each of three former 0.1-ha, long-term treatments (sludge, fertilizer, and control) were either unmanipulated or manipulated via tilling and/or liming. Liming significantly increased the pH of soil from the long-term sludge and fertilizer plots, and the combination of tilling and liming affected the heavy metal concentrations in earthworms, as lower concentrations of Cd,more » Cu, Pb, and Zn were found in earthworms collected from subplots that had been both tilled and limed. However, most observed significant differences in heavy metal concentrations reflected the long-term treatments, as heavy metal concentrations tended to be greater in the soil and biota collected from sludge-treated plots. Thus, heavy metals remained in the soil in forms available to the biota, regardless of the cessation of sludge application or subplot manipulations (liming and/or tilling) for two years following cessation of sludge application.« less
Terminalia chebula mediated green and rapid synthesis of gold nanoparticles
NASA Astrophysics Data System (ADS)
Mohan Kumar, Kesarla; Mandal, Badal Kumar; Sinha, Madhulika; Krishnakumar, Varadhan
2012-02-01
Biologically inspired experimental process in synthesising nanoparticles is of great interest in present scenario. Biosynthesis of nanoparticles is considered to be one of the best green techniques in synthesising metal nanoparticles. Here, an in situ green biogenic synthesis of gold nanoparticles using aqueous extracts of Terminalia chebula as reducing and stabilizing agent is reported. Gold nanoparticles were confirmed by surface plasmon resonance in the range of 535 nm using UV-visible spectrometry. TEM analysis revealed that the morphology of the particles thus formed contains anisotropic gold nanoparticles with size ranging from 6 to 60 nm. Hydrolysable tannins present in the extract of T. chebula are responsible for reductions and stabilization of gold nanoparticles. Antimicrobial activity of gold nanoparticles showed better activity towards gram positive S. aureus compared to gram negative E. coli using standard well diffusion method.
NASA Astrophysics Data System (ADS)
Dubey, Vikas; Tiwari, Ratnesh; Tamrakar, Raunak Kumar; Rathore, Gajendra Singh; Sharma, Chitrakant; Tiwari, Neha
2014-11-01
The paper reports upconversion luminescence behaviour and infra-red spectroscopic pattern of erbium doped yttrium (III) oxide phosphor. Sample was synthesized by solid state reaction method with variable concentration or erbium (0.5-2.5 mol%). The conventional solid state method is suitable for large scale production and eco-friendly method. The prepared sample was characterized by X-ray diffraction (XRD) technique. From structural analysis by XRD technique shows cubic structure of prepared sample with variable concentration of erbium and no impurity phase were found when increase the concentration of Er3+. Particle size was calculated by Scherer's formula and it varies from 67 nm to 120 nm. The surface morphology of prepared phosphor was determined by field emission gun scanning electron microscopy (FEGSEM) technique. The surface morphology of the sample shows good connectivity with grains as well as some agglomerates formation occurs in sample. The functional group analysis was done by Fourier transform infra-red technique (FTIR) analysis which confirm the formation of Y2O3:Er3+ phosphor was prepared. The results indicated that the Y2O3:Er3+ phosphors might have high upconversion efficiency because of their low vibrational energy. Under 980 nm laser excitation sample shows intense green emission at 555 nm and orange emission at 590 nm wavelength. For green emission transition occurs 2H11/2 → 4I15/2, 4S3/2 → 4I15/2 for upconversion emissions. Excited state absorption and energy transfer process were discussed as possible upconversion mechanisms. The near infrared luminescence spectra was recorded. The upconversion luminescence intensity increase with increasing the concentration or erbium up to 2 mol% after that luminescence intensity decreases due to concentration quenching occurs. Spectrophotometric determinations of peaks are evaluated by Commission Internationale de I'Eclairage (CIE) technique. From CIE technique the dominant peak of from PL spectra shows intense green emission so the prepared phosphor is may be useful for green light emitting diode (GLED) application.
REMOVAL OF BERYLLIUM FROM DRINKING WATER BY CHEMICAL COAGULATION AND LIME SOFTENING
The effectiveness of conventional drinking water treatment and lime softening was evaluated for beryllium removal from two drinking water sources. ar test studies were conducted to determine how common coagulants (aluminum sulfate and ferric chloride and lime softening performed ...
Code of Federal Regulations, 2010 CFR
2010-01-01
... STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE STANDARDS FOR BARRELS BARRELS AND OTHER CONTAINERS FOR LIME... U.S.C. 237-242), entitled “An Act to standardize lime barrels,” shall be known and referred to as the “Standard Lime-Barrel Act.” ...
Efficacy of road bond and condor as soil stabilizers : final report.
DOT National Transportation Integrated Search
2013-08-01
The Oklahoma Department of Transportation (ODOT) uses lime-based stabilizers including quick lime, hydrated lime, Class C fly ash (CFA) and cement kiln dust (CKD) to increase bearing capacity of fine-grained subgrade soils within the state of Oklahom...
DOT National Transportation Integrated Search
1977-04-01
This study showed that lime treatment removes polar, viscosity-building components and reduces the susceptibility of the asphalt to laboratory oxidative hardening. The beneficial effects of lime treatment in reducing asphalt oxidative hardening were ...
Applications for reuse of lime sludge from water softening.
DOT National Transportation Integrated Search
2005-07-15
Lime sludge, an inert material mostly composed of calcium carbonate, is the result of : softening hard water for distribution as drinking water. A large city such as Des Moines, : Iowa, produces about 30,700 tons of lime sludge (dry weight basis) ann...
INTERIOR VIEW, MLT'S STONE AND WATER MIXED HERE TO MAKE ...
INTERIOR VIEW, MLT'S STONE AND WATER MIXED HERE TO MAKE MILK OF LIME (CALCIUM HYDROXIDE). MLT BUILDING IS ATTACHED TO AND WEST OF LIME KILNS. - Solvay Process Company, Milk of Lime Towers Building, Between Willis & Milton Avenues, Solvay, Onondaga County, NY
Use of hydrated lime as an antistripping additive : installation report.
DOT National Transportation Integrated Search
1983-01-01
The purpose of this investigation is to evaluate the effectiveness of hydrated lime as an antistripping additive in several test sections. The two sections installed in 1982 contain S-5 surface mixes with (1) hydrated lime, (2) a chemical additive, a...
N J, Shivaramu; B N, Lakshminarasappa; K R, Nagabhushana; H C, Swart; Fouran, Singh
2018-01-15
Nanocrystalline Er 3+ doped Y 2 O 3 crystals were prepared by a sol gel technique. X-ray diffraction (XRD) patterns showed the cubic structure of Y 2 O 3 and the crystallite size was found to be ~25nm. Optical absorption showed absorption peaks at 454, 495 and 521nm. These peaks are attributed to the 4 F 3/2 + 4 F 5/2 , 4 F 7/2 and 2 H 11/2 + 4 S 3/2 transitions of Er 3+ . Under excitation at 378nm, the appearance of strong green (520-565nm) down conversion emission assigned to the ( 2 H 11/2, 4 S 3/2 )→ 4 I 15/2 transition and the feeble red (650-665nm) emission is assigned to the 4 F 9/2 → 4 I 15/2 transition. The color chromaticity coordinates showed emission in the green region. The strong green emission of Y 2 O 3 :Er 3+ nanophosphor may be useful for applications in solid compact laser devices. Thermoluminescence (TL) studies of γ-irradiated Y 2 O 3 :Er 3+ showed a prominent TL glow peak maximum at 383K along with a less intense shoulder peak at ~425K and a weak glow at 598K. TL emission peaks with maxima at 545, 490, 588 and 622nm for the doped sample were observed at a temperature of 383K and these emissions were due to defect related to the host material. TL kinetic parameters were calculated by a glow curve deconvolution (GCD) method and the obtained results are discussed in detail for their possible usage in high dose dosimetry. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
N. J., Shivaramu; B. N., Lakshminarasappa; K. R., Nagabhushana; H. C., Swart; Fouran, Singh
2018-01-01
Nanocrystalline Er3 + doped Y2O3crystals were prepared by a sol gel technique. X-ray diffraction (XRD) patterns showed the cubic structure of Y2O3 and the crystallite size was found to be 25 nm. Optical absorption showed absorption peaks at 454, 495 and 521 nm. These peaks are attributed to the 4F3/2 + 4F5/2, 4F7/2 and 2H11/2 + 4S3/2 transitions of Er3 +. Under excitation at 378 nm, the appearance of strong green (520-565 nm) down conversion emission assigned to the (2H11/2,4S3/2) → 4I15/2 transition and the feeble red (650-665 nm) emission is assigned to the 4F9/2 → 4I15/2 transition. The color chromaticity coordinates showed emission in the green region. The strong green emission of Y2O3:Er3 + nanophosphor may be useful for applications in solid compact laser devices. Thermoluminescence (TL) studies of γ-irradiated Y2O3:Er3 + showed a prominent TL glow peak maximum at 383 K along with a less intense shoulder peak at 425 K and a weak glow at 598 K. TL emission peaks with maxima at 545, 490, 588 and 622 nm for the doped sample were observed at a temperature of 383 K and these emissions were due to defect related to the host material. TL kinetic parameters were calculated by a glow curve deconvolution (GCD) method and the obtained results are discussed in detail for their possible usage in high dose dosimetry.
Arsenic removal in conjunction with lime softening
Khandaker, Nadim R.; Brady, Patrick V.; Teter, David M.; Krumhansl, James L.
2004-10-12
A method for removing dissolved arsenic from an aqueous medium comprising adding lime to the aqueous medium, and adding one or more sources of divalent metal ions other than calcium and magnesium to the aqueous medium, whereby dissolved arsenic in the aqueous medium is reduced to a lower level than possible if only the step of adding lime were performed. Also a composition of matter for removing dissolved arsenic from an aqueous medium comprising lime and one or more sources of divalent copper and/or zinc metal ions.
2011-06-17
based glasses like fused silica and soda - lime glass , the polyhedral central cation is silicon. In this case, each silicon is surrounded by four oxygen...to two network forming cations) oxygen atoms per network polyhedron. The equilibrium values for this parameter in fused silica and soda - lime glass ...Molecular-level analysis of shock-wave physics and derivation of the Hugoniot relations for soda - lime glass M. Grujicic • B. Pandurangan • W. C. Bell
Regeneration of lime from sulfates for fluidized-bed combustion
Yang, Ralph T.; Steinberg, Meyer
1980-01-01
In a fluidized-bed combustor the evolving sulfur oxides are reacted with CaO to form calcium sulfate which is then decomposed in the presence of carbonaceous material, such as the fly ash recovered from the combustion, at temperatures of about 900.degree. to 1000.degree. C., to regenerate lime. The regenerated lime is then recycled to the fluidized bed combustor to further react with the evolving sulfur oxides. The lime regenerated in this manner is quite effective in removing the sulfur oxides.
Song, Jin Ah; Kim, Na Na; Choi, Young Jae; Choi, Cheol Young
2016-07-22
We investigated the effect of light spectra on retinal damage and stress in goldfish using green (530 nm) and red (620 nm) light emitting diodes (LEDs) at three intensities each (0.5, 1.0, and 1.5 W/m(2)). We measured the change in the levels of plasma cortisol and H2O2 and expression and levels of caspase-3. The apoptotic response of green and red LED spectra was assessed using the terminal transferase dUTP nick end labeling (TUNEL) assay. Stress indicator (cortisol and H2O2) and apoptosis-related genes (caspase-3) decreased in green light, but increased in red light with higher light intensities over time. The TUNEL assay revealed that more apoptotic cells were detected in outer nuclear layers after exposure to red LED over time with the increase in light intensity, than the other spectra. These results indicate that green light efficiently reduces retinal damage and stress, whereas red light induces it. Therefore, red light-induced retina damage may induce apoptosis in goldfish retina. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Choi, Yoonho; Kang, Sehyeon; Cha, Song-Hyun; Kim, Hyun-Seok; Song, Kwangho; Lee, You Jeong; Kim, Kyeongsoon; Kim, Yeong Shik; Cho, Seonho; Park, Youmie
2018-01-01
A green synthesis of gold and silver nanoparticles is described in the present report using platycodon saponins from Platycodi Radix ( Platycodon grandiflorum) as reducing agents. Platycodin D (PD), a major triterpenoidal platycodon saponin, was enriched by an enzymatic transformation of an aqueous extract of Platycodi Radix. This PD-enriched fraction was utilized for processing reduction reactions of gold and silver salts to synthesize gold nanoparticles (PD-AuNPs) and silver nanoparticles (PD-AgNPs), respectively. No other chemicals were introduced during the reduction reactions, providing an entirely green, eco-friendly, and sustainable method. UV-visible spectra showed the surface plasmon resonance bands of PD-AuNPs at 536 nm and PD-AgNPs at 427 nm. Spherically shaped nanoparticles were observed from high-resolution transmission electron microscopy with average diameters of 14.94 ± 2.14 nm for PD-AuNPs and 18.40 ± 3.20 nm for PD-AgNPs. Minor triangular and other polygonal shapes were also observed for PD-AuNPs along with spherical ones. Atomic force microscopy (AFM) images also demonstrated that both nanoparticles were mostly spherical in shape. Curvature-dependent evolution was employed to enhance the AFM images and precisely measure the sizes of the nanoparticles. The sizes were measured as 19.14 nm for PD-AuNPs and 29.93 nm for PD-AgNPs from the enhanced AFM images. Face-centered cubic structures for both nanoparticles were confirmed by strong diffraction patterns from high-resolution X-ray diffraction analyses. Fourier transform infrared spectra revealed the contribution of -OH, aromatic C=C, C-O, and C-H functional groups to the synthesis. Furthermore, the catalytic activity of PD-AuNPs was assessed with a reduction reaction of 4-nitrophenol to 4-aminophenol in the presence of sodium borohydride. The catalytic activity results suggest the potential application of these gold nanoparticles as catalysts in the future. The green strategy reported in this study using saponins as reducing agents will pave new roads to develop novel nanomaterials with versatile applications.
Viviani, Vadim R; Neves, Deimison Rodrigues; Amaral, Danilo Trabuco; Prado, Rogilene A; Matsuhashi, Takuto; Hirano, Takashi
2014-08-19
Beetle luciferases produce different bioluminescence colors from green to red using the same d-luciferin substrate. Despite many studies of the mechanisms and structural determinants of bioluminescence colors with firefly luciferases, the identity of the emitters and the specific active site interactions responsible for bioluminescence color modulation remain elusive. To address these questions, we analyzed the bioluminescence spectra with 6'-amino-D-luciferin (aminoluciferin) and its 5,5-dimethyl analogue using a set of recombinant beetle luciferases that naturally elicit different colors and different pH sensitivities (pH-sensitive, Amydetes vivianii λmax=538 nm, Macrolampis sp2 λmax=564 nm; pH-insensitive, Phrixotrix hirtus λmax=623 nm, Phrixotrix vivianii λmax=546 nm, and Pyrearinus termitilluminans λmax=534 nm), a luciferase-like enzyme (Tenebrionidae, Zophobas morio λmax=613 nm), and mutants of C311 (S314). The green-yellow-emitting luciferases display red-shifted bioluminescence spectra with aminoluciferin in relation to those with D-luciferin, whereas the red-emitting luciferases displayed blue-shifted spectra. Bioluminescence spectra with 5,5-dimethylaminoluciferin, in which enolization is blocked, were almost identical to those of aminoluciferin. Fluorescence probing using 2-(4-toluidino)naphthalene-6-sulfonate and inference with aminoluciferin confirm that the luciferin binding site of the red-shifted luciferases is more polar than in the case of the green-yellow-emitting luciferases. Altogether, the results show that the keto form of excited oxyluciferin is the emitter in beetle bioluminescence and that bioluminescence colors are essentially modulated by interactions of the 6'-hydroxy group of oxyluciferin and basic moieties under the influence of the microenvironment polarity of the active site: a strong interaction between a base moiety and oxyluciferin phenol in a hydrophobic microenvironment promotes green-yellow emission, whereas a more polar environment weakens such interaction promoting red shifts. In pH-sensitive luciferases, a pH-mediated switch from a closed hydrophobic conformation to a more open polar conformation promotes the typical red shift.
Chicken manure enhanced yield and quality of field-grown kale and collard greens.
Antonious, George F; Turley, Eric T; Hill, Regina R; Snyder, John C
2014-01-01
Organic matter and nutrients in municipal sewage sludge (SS) and chicken manure (CM) could be recycled and used for land farming to enhance fertility and physical properties of soils. Three soil management practices were used at Kentucky State University Research Farm, Franklin County, to study the impact of soil amendments on kale (Brassica oleracea cv. Winterbar) and collard (Brassica oleracea cv. Top Bunch) yields and quality. The three soil management practices were: (i) SS mixed with native soil at 15 t acre(-1), (ii) CM mixed with native soil at 15 t acre(-1), and (iii) no-mulch (NM) native soil for comparison purposes. At harvest, collard and kale green plants were graded according to USDA standards. Plants grown in CM and SS amended soil produced the greatest number of U.S. No. 1 grade of collard and kale greens compared to NM native soil. Across all treatments, concentrations of ascorbic acid and phenols were generally greater in kale than in collards. Overall, CM and SS enhanced total phenols and ascorbic acid contents of kale and collard compared to NM native soil. We investigated the chemical and physical properties of each of the three soil treatments that might explain variability among treatments and the impact of soil amendments on yield, phenols, and ascorbic acid contents of kale and collard green grown under this practice.
Chlorophyll as a biomarker for early disease diagnosis
NASA Astrophysics Data System (ADS)
Manzoor Atta, Babar; Saleem, M.; Ali, Hina; Arshad, Hafiz Muhammad Imran; Ahmed, M.
2018-06-01
The current study was designed to identify the stage for the diagnosis of disease before visible symptoms appeared. Fluorescence spectroscopy has been employed to identify disease signatures for its early diagnosis in rice plant leaves. Bacterial leaf blight (BLB) diseased and healthy leaf samples were collected from the rice fields in September, 2017 which were then used to record spectra using an excitation wavelength at 410 nm. The spectral range of emission was set from 420 to 800 nm which covers the blue–green and the chlorophyll bands. It was found that diseased leaves have a narrower ‘chlorophyll a’ band than healthy ones, and furthermore, that the emission band at 730 nm was either declined or depleted in the sample with high infection symptoms. In contrast, the blue–green region was observed to increase due to the emergence of disease. As the band intensity of chlorophyll decreases during infection, this decrease in chlorophyll content and increase in the blue–green spectral region could provide a new approach for predicting BLB at an early stage. The important finding was that the chlorophyll degradation and rise in the blue–green region take place in leaves with BLB or during BLB infection. Principal component analysis has been applied to spectral data which successfully separated diseased samples from healthy ones even with very small spectral variations.
Synthesis and Crystal Structure of Highly Strained [4]Cyclofluorene: Green-Emitting Fluorophore.
Liu, Yu-Yu; Lin, Jin-Yi; Bo, Yi-Fan; Xie, Ling-Hai; Yi, Ming-Dong; Zhang, Xin-Wen; Zhang, Hong-Mei; Loh, Teck-Peng; Huang, Wei
2016-01-15
[4]Cyclo-9,9-dipropyl-2,7-fluorene ([4]CF) with the strain energy of 79.8 kcal/mol is synthesized in high quantum yield. Impressively, hoop-shaped [4]CF exhibits a green fluorescence emission around 512 nm offering a new explanation for the green band (g-band) in polyfluorenes. The solution-processed [4]CF-based organic light emitting diode (OLED) has also been fabricated with the a stronger green band emission. Strained semiconductors offer a promising approach to fabricating multifunctional optoelectronic materials in organic electronics and biomedicine.
Effects of Comprehensive Technologies on the Improvement of Acidified Vineyard Soils
NASA Astrophysics Data System (ADS)
Jiang, Hongguo; Wang, Qiunan; Xu, Feng; Jin, Jun; Wang, Guoyu; Liu, Jianguo
2018-01-01
Soil acidification is an important factor that restricts the yield and quality of fruits. In this study, the comprehensive improving technologies were applied on the vineyards in which the soil pH is below 5.5. The technologies include application of soil conditioner, organic fertilizer and bacterial manure, and growth of green manure and natural grass. The results show that the comprehensive improving technologies can raise the pH of 0-15 cm soil layer by 0.5-0.8 unit and the pH of 15-30 cm soil layer by 0.3-0.6 unit. The soil bulk densities are decreased by 0.77-10.42%. The contents of organic matter, total N, available P and K in the soils are all increased. Therefore, the soil fertilities are improved. The yields of grape fruits are increased by 12.77-14.94%, and the contents of soluble solid in the grapes are raised by 7.01-9.55%, by the comprehensive measure of seaweed liquid silicon plus sheep manure plus growth of green manure. The comprehensive measure of soil conditioner Naduoli No. 1 plus bacterial manure plus natural grass increases the yields of grape by 7.67%, raises the content of soluble solid in the grape by 8.6%. But the effect of the comprehensive measure of unslaked lime plus sheep manure plus growth of green manure is not clear.
Investigation of copper sorption by sugar beet processing lime waste.
Ippolito, J A; Strawn, D G; Scheckel, K G
2013-01-01
In the western United States, sugar beet processing for sugar recovery generates a lime-based waste product (∼250,000 Mg yr) that has little liming value in the region's calcareous soils. This area has recently experienced an increase in dairy production, with dairies using copper (Cu)-based hoof baths to prevent hoof diseases. A concern exists regarding soil Cu accumulation because spent hoof baths may be disposed of in waste ponds, with pond waters being used for irrigation. The objective of this preliminary study was to evaluate the ability of lime waste to sorb Cu. Lime waste was mixed with increasing Cu-containing solutions (up to 100,000 mg Cu kg lime waste) at various buffered pH values (pH 6, 7, 8, and 9) and shaken over various time periods (up to 30 d). Copper sorption phenomenon was quantified using sorption maximum fitting, and the sorption mechanism was investigated using X-ray absorption spectroscopy. Results showed that sorption onto lime waste increased with decreasing pH and that the maximum Cu sorption of ∼45,000 mg kg occurred at pH 6. X-ray absorption spectroscopy indicated that Cu(OH) was the probable species present, although the precipitate existed as small multinuclear precipitates on the surface of the lime waste. Such structures may be precursors for larger surface precipitates that develop over longer incubation times. Findings suggest that sugar beet processing lime waste can viably sorb Cu from liquid waste streams, and thus it may have the ability to remove Cu from spent hoof baths. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.
Rodriguez-Navarro, Carlos; Ruiz-Agudo, Encarnacion; Burgos-Cara, Alejandro; Elert, Kerstin; Hansen, Eric F
2017-10-17
Hydrated lime (Ca(OH) 2 ) is a vernacular art and building material produced following slaking of CaO in water. If excess water is used, a slurry, called lime putty, forms, which has been the preferred craftsman selection for formulating lime mortars since Roman times. A variety of natural additives were traditionally added to the lime putty to improve its quality. The mucilaginous juice extracted from nopal cladodes has been and still is used as additive incorporated in the slaking water for formulation of lime mortars and plasters, both in ancient Mesoamerica and in the USA Southwest. Little is known on the ultimate effects of this additive on the crystallization and microstructure of hydrated lime. Here, we show that significant changes in habit and size of portlandite crystals occur following slaking in the presence of nopal juice as well as compositionally similar citrus pectin. Both additives contain polysaccharides made up of galacturonic acid and neutral sugar residues. The carboxyl (and hydroxyl) functional groups present in these residues and in their alkaline degradation byproducts, which are deprotonated at the high pH (12.4) produced during lime slaking, strongly interact with newly formed Ca(OH) 2 crystals acting in two ways: (a) as nucleation inhibitors, promoting the formation of nanosized crystals, and (b) as habit modifiers, favoring the development of planar habit following their adsorption onto positively charged (0001) Ca(OH) 2 faces. Adsorption of polysaccharides on Ca(OH) 2 crystals prevents the development of large particles, resulting in a very reactive, nanosized portlandite slurry. It also promotes steric stabilization, which limits aggregation, thus enhancing the colloidal nature of the lime putty. Overall, these effects are very favorable for the preparation of highly plastic lime mortars with enhanced properties.
Homan, Caitlin; Beirer, Colin M; McCay, Timothy S; Lawrence, Gregory B.
2016-01-01
The application of lime (calcium carbonate) may be a cost-effective strategy to promote forest ecosystem recovery from acid impairment, under contemporary low levels of acidic deposition. However, liming acidified soils may create more suitable habitat for invasive earthworms that cause significant damage to forest floor communities and may disrupt ecosystem processes. We investigated the potential effects of liming in acidified soils where earthworms are rare in conjunction with a whole-ecosystem liming experiment in the chronically acidified forests of the western Adirondacks (USA). Using a microcosm experiment that replicated the whole-ecosystem treatment, we evaluated effects of soil liming on Lumbricus terrestris survivorship and biomass growth. We found that a moderate lime application (raising pH from 3.1 to 3.7) dramatically increased survival and biomass of L. terrestris, likely via increases in soil pH and associated reductions in inorganic aluminum, a known toxin. Very few L. terrestris individuals survived in unlimed soils, whereas earthworms in limed soils survived, grew, and rapidly consumed leaf litter. We supplemented this experiment with field surveys of extant earthworm communities along a gradient of soil pH in Adirondack hardwood forests, ranging from severely acidified (pH < 3) to well-buffered (pH > 5). In the field, no earthworms were observed where soil pH < 3.6. Abundance and species richness of earthworms was greatest in areas where soil pH > 4.4 and human dispersal vectors, including proximity to roads and public fishing access, were most prevalent. Overall our results suggest that moderate lime additions can be sufficient to increase earthworm invasion risk where dispersal vectors are present.
Gypsum treated fly ash as a liner for waste disposal facilities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sivapullaiah, Puvvadi V., E-mail: siva@civil.iisc.ernet.in; Baig, M. Arif Ali, E-mail: reach2arif@gmail.com
2011-02-15
Fly ash has potential application in the construction of base liners for waste containment facilities. While most of the fly ashes improve in the strength with curing, the ranges of permeabilities they attain may often not meet the basic requirement of a liner material. An attempt has been made in the present context to reduce the hydraulic conductivity by adding lime content up to 10% to two selected samples of class F fly ashes. The use of gypsum, which is known to accelerate the unconfined compressive strength by increasing the lime reactivity, has been investigated in further improving the hydraulicmore » conductivity. Hydraulic conductivities of the compacted specimens have been determined in the laboratory using the falling head method. It has been observed that the addition of gypsum reduces the hydraulic conductivity of the lime treated fly ashes. The reduction in the hydraulic conductivity of the samples containing gypsum is significantly more for samples with high amounts of lime contents (as high as 1000 times) than those fly ashes with lower amounts of lime. However there is a relatively more increase in the strengths of the samples with the inclusion of gypsum to the fly ashes at lower lime contents. This is due to the fact that excess lime added to fly ash is not effectively converted into pozzolanic compounds. Even the presence of gypsum is observed not to activate these reactions with excess lime. On the other hand the higher amount of lime in the presence of sulphate is observed to produce more cementitious compounds which block the pores in the fly ash. The consequent reduction in the hydraulic conductivity of fly ash would be beneficial in reducing the leachability of trace elements present in the fly ash when used as a base liner.« less
Molecular Iodine Fluorescence Using a Green Helium-Neon Laser
ERIC Educational Resources Information Center
Williamson, J. Charles
2011-01-01
Excitation of molecular iodine vapor with a green (543.4 nm) helium-neon laser produces a fluorescence spectrum that is well suited for the upper-level undergraduate physical chemistry laboratory. Application of standard evaluation techniques to the spectrum yields ground electronic-state molecular parameters in good agreement with literature…
Wei, Guo-feng; Fang, Shi-qiang; Zhang, Bing-jian; Wang, Xiao-qi; Li, Zu-guang
2012-08-01
Liesegang patterns in traditional sticky rice-lime mortar undergoing carbonation were investigated by means of FTIR, XRD and SEM. Results indicate that well-developed Liesegang patterns only occur in the mortar prepared with aged lime and sticky rice. The smaller Ca(OH)2 particle size in aged lime and the control of the sticky rice for the crystallization of calcium carbonate lead to the small pores in this mortar. These small pores can make Ca2+ and CO3(2-) highly supersaturated, which explains the reason why Liesegang pattern developed in the sticky rice-aged lime mortar. The formed metastable aragonite proves that Liesegang pattern could be explained based on the post-nucleation theory.
Textile Fingerprinting for Dismount Analysis in the Visible, Near, and Shortwave Infrared Domain
2014-03-01
Laboratory setup of reflectance data collection. The green, 100% cotton shirt sample, contact probe, and black calibration panel used are labeled...32 3.2 100 Instances of Cotton Reflectance from ASD FieldSpec ® 3 Hi-Res Spectroradiometer using a contact probe, with a black reflectance panel as...eight a-class colors. The solid vertical black line represents the wavelength selected as a feature (430nm, 481nm, 530nm, 588nm
Lee, Jihyoung; Matsumura, Kenta; Yamakoshi, Ken-ichi; Rolfe, Peter; Tanaka, Shinobu; Yamakoshi, Takehiro
2013-01-01
Reflection photoplethysmography (PPG) using 530 nm (green) wavelength light has the potential to be a superior method for monitoring heart rate (HR) during normal daily life due to its relative freedom from artifacts. However, little is known about the accuracy of pulse rate (PR) measured by 530 nm light PPG during motion. Therefore, we compared the HR measured by electrocadiography (ECG) as a reference with PR measured by 530, 645 (red), and 470 nm (blue) wavelength light PPG during baseline and while performing hand waving in 12 participants. In addition, we examined the change of signal-to-noise ratio (SNR) by motion for each of the three wavelengths used for the PPG. The results showed that the limit of agreement in Bland-Altman plots between the HR measured by ECG and PR measured by 530 nm light PPG (±0.61 bpm) was smaller than that achieved when using 645 and 470 nm light PPG (±3.20 bpm and ±2.23 bpm, respectively). The ΔSNR (the difference between baseline and task values) of 530 and 470nm light PPG was significantly smaller than ΔSNR for red light PPG. In conclusion, 530 nm light PPG could be a more suitable method than 645 and 470nm light PPG for monitoring HR in normal daily life.
Lime treatment has been used in contaminated sediment management activities for many purposes such as dewatering, improvement of physical properties, and reducing contaminant mobility. Exothermic volatilization of volatile organic compounds from lime-treated sediment is well kno...
Influence sample sizing of citrus hystrix essential oil from hydrodistillation extraction
NASA Astrophysics Data System (ADS)
Yahya, A.; Amadi, I.; Hashib, S. A.; Mustapha, F. A.
2018-03-01
Essential oil extracted from kaffir lime leaves through hydrodistillation. The objective of this study is to quantify the oil production rate by identify the significant influence of particle size on kaffir lime leaves. Kaffir lime leaves were ground and separated by using siever into 90, 150, 300 μm and other kaffir lime leaves. The mean essential oil yield of 0.87, 0.52, 0.41 and 0.3% was obtained. 90 μm of ground gives the highest yield compared to other sizes. Thus, it can be concluded that in quantifying oil production rate, the relevance of different size of particle is clearly affects the amount of oil yield. In analysing the composition of kaffir lime essential oil using GC-MS, there were 38 compounds found in the essential oil. Some of the major compounds of the kaffir lime leave oils were detected while some are not, may due to oil experience thermal degradation which consequently losing some significant compounds in controlled temperature.
Broadband, Achromatic Twyman-Green Interferometer
NASA Technical Reports Server (NTRS)
Steimle, Lawrence J.
1991-01-01
Improved Twyman-Green interferometer used in wave-front testing optical components at wavelengths from 200 to 1,100 nm, without having to readjust focus when changing wavelength. Built to measure aberrations of light passing through optical filters. Collimating and imaging lenses of classical Twyman-Green configuration replaced by single spherical mirror. Field lens replaced by field mirror. Mirrors exhibit no axial chromatic aberration and made to reflect light efficiently over desired broad range of wavelengths.
A photoswitchable orange-to-far-red fluorescent protein, PSmOrange.
Subach, Oksana M; Patterson, George H; Ting, Li-Min; Wang, Yarong; Condeelis, John S; Verkhusha, Vladislav V
2011-07-31
We report a photoswitchable monomeric Orange (PSmOrange) protein that is initially orange (excitation, 548 nm; emission, 565 nm) but becomes far-red (excitation, 636 nm; emission, 662 nm) after irradiation with blue-green light. Compared to its parental orange proteins, PSmOrange has greater brightness, faster maturation, higher photoconversion contrast and better photostability. The red-shifted spectra of both forms of PSmOrange enable its simultaneous use with cyan-to-green photoswitchable proteins to study four intracellular populations. Photoconverted PSmOrange has, to our knowledge, the most far-red excitation peak of all GFP-like fluorescent proteins, provides diffraction-limited and super-resolution imaging in the far-red light range, is optimally excited with common red lasers, and can be photoconverted subcutaneously in a mouse. PSmOrange photoswitching occurs via a two-step photo-oxidation process, which causes cleavage of the polypeptide backbone. The far-red fluorescence of photoconverted PSmOrange results from a new chromophore containing N-acylimine with a co-planar carbon-oxygen double bond.
A green chemical approach for synthesis of shape anisotropic gold nanoparticles
NASA Astrophysics Data System (ADS)
Kalyan Kamal, S. S.; Vimala, J.; Sahoo, P. K.; Ghosal, P.; Ram, S.; Durai, L.
2014-06-01
A complete green chemical reaction between aurochloric acid and tea polyphenols resulted in the reduction of Au3+ → Au0. The reaction was carried out in a Teflon-coated bomb digestion vessel at 200 °C. It was observed that with increasing the reaction time from 1 to 5 h, the shape of the nanoparticles changed from spherical- to rod-like structures. The reaction was followed with the help of UV-vis spectrometer, which showed a single absorption peak at 548 nm for 1-h reaction product and two peaks for a 5-h reaction product at 533 and 745 nm corresponding to the transverse and longitudinal surface plasmon resonance bands. Microstructures obtained from transmission electron microscope revealed that the samples obtained after 1-h reaction are predominantly spherical in shape with an average size of 15 nm. Whereas samples obtained after 5 h of reaction exhibited rod-like structures with an average size of 45 nm.
Class B Alkaline Stabilization to Achieve Pathogen Inactivation
Bean, Christine L.; Hansen, Jacqueline J.; Margolin, Aaron B.; Balkin, Helene; Batzer, Glenda; Widmer, Giovanni
2007-01-01
Liming is a cost-effective treatment currently employed in many Class B biosolids production plants in the United States. A bench scale model of lime stabilization was designed to evaluate the persistence of viral, bacterial and parasitic pathogens. The survival of fecal coliforms, Salmonella, adenovirus type 5, rotavirus Wa, bacteriophage MS-2, Cryptosporidium parvum oocysts, Giardia lamblia cysts, and Ascaris lumbricoides ova was evaluated under lime stabilization conditions in a water matrix. Fecal coliforms and Salmonella were undetectable following 2 hours of lime stabilization, demonstrating a 7-log reduction. Adenovirus, MS-2 and rotavirus were below detectable levels following 2 h of liming, demonstrating a 4-log reduction. G. lamblia cysts were also inactivated. A. lumbricoides ova remained viable following 72 hours of liming as did C. parvum oocysts. While this study confirmed that Ascaris ova are resistant to liming, their scarcity in sludge and low recovery efficiencies limit their use as indicator. The persistence of C. parvum oocysts after exposure to lime, suggests that this parasite would be a better choice as indicator for evaluating biosolids intended for land application. The studies done with adenovirus Type 5, rotavirus Wa and male specific bacteriophage provided preliminary data demonstrating similar inactivation rates. Monitoring anthropogenic viruses is a time consuming, labor intensive and expensive process. If further studies could demonstrate that phage could be used as an indicator of other enteric viruses, enhanced monitoring could result in greater acceptance of land application of biosolids while demonstrating no increased public health threat. PMID:17431316
Kaffir lime leaves extract inhibits biofilm formation by Streptococcus mutans.
Kooltheat, Nateelak; Kamuthachad, Ludthawun; Anthapanya, Methinee; Samakchan, Natthapon; Sranujit, Rungnapa Pankla; Potup, Pachuen; Ferrante, Antonio; Usuwanthim, Kanchana
2016-04-01
Although kaffir lime has been reported to exhibit antioxidant and antileukemic activity, little is known about the antimicrobial effect of kaffir lime extract. Because Streptococcus mutans has been known to cause biofilm formation, it has been considered the most important causative pathogen of dental caries. Thus, the effective control of its effects on the oral biofilm is the key to the prevention of dental caries. The aims of the present study were to investigate the effect of kaffir lime leaves extract on biofilm formation and its antibacterial activity on S. mutans. We examined the effect of kaffir lime leaves extract on growth and biofilm formation of S. mutans. For the investigation we used a kaffir lime extract with high phenolic content. The minimum inhibitory concentration of the extract was determined by broth microdilution assay. The inhibitory effect of the test substances on biofilm formation was also investigated by biofilm formation assay and qRT-PCR of biofilm formation-associated genes. Kaffir lime leaves extract inhibits the growth of S. mutans, corresponding to the activity of an antibiotic, ampicillin. Formation of biofilm by S. mutans was also inhibited by the extract. These results were confirmed by the down-regulation of genes associated with the biofilm formation. The findings highlight the ability of kaffir lime leaves extract to inhibit S. mutans activity, which may be beneficial in the prevention of biofilm formation on dental surface, reducing dental plaque and decreasing the chance of dental carries. Copyright © 2016 Elsevier Inc. All rights reserved.
77 FR 45715 - Application of Key Lime Air Corporation for Commuter Authority
Federal Register 2010, 2011, 2012, 2013, 2014
2012-08-01
... DEPARTMENT OF TRANSPORTATION Office of the Secretary [Docket DOT-OST-2009-0116] Application of Key Lime Air Corporation for Commuter Authority AGENCY: Department of Transportation. ACTION: Notice of... Lime Air Corporation fit, willing, and able, and awarding it a Commuter Air Carrier Authorization...
Code of Federal Regulations, 2010 CFR
2010-01-01
... STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE STANDARDS FOR BARRELS BARRELS AND OTHER CONTAINERS FOR LIME... to lime in barrels, or other containers packed, sold, or offered for sale for shipment from any State...; and to lime in containers of less capacity than the standard small barrel sold in interstate or...
Study of lime vs. no lime in cold in-place recycled asphalt concrete pavements : final report.
DOT National Transportation Integrated Search
1991-09-01
The resilient characteristics of cold in-place recycled asphalt concrete with and without lime were examined. Six core samples were obtained from a site two months after construction; six months later, six additional core samples were obtained from t...
de Azevedo, Lyvia Vidinho; de Barros, Henrique Lins; Keim, Carolina Neumann; Acosta-Avalos, Daniel
2013-09-01
'Candidatus Magnetoglobus multicellularis' is a magnetotactic microorganism composed of several bacterial cells. Presently, it is the best known multicellular magnetotactic prokaryote (MMP). Recently, it has been observed that MMPs present a negative photoresponse to high intensity ultraviolet and violet-blue light. In this work, we studied the movement of 'Candidatus Magnetoglobus multicellularis' under low intensity light of different wavelengths, measuring the average velocity and the time to reorient its trajectory when the external magnetic field changes its direction (U-turn time). Our results show that the mean average velocity is higher for red light (628 nm) and lower for green light (517 nm) as compared to yellow (596 nm) and blue (469 nm) light, and the U-turn time decreased for green light illumination. The light wavelength velocity dependence can be understood as variation in flagella rotation speed, being increased by the red light and decreased by the green light relative to yellow and blue light. It is suggested that the dependence of the U-turn time on light wavelength can be considered a form of light-dependent magnetotaxis, because this time represents the magnetic sensibility of the magnetotactic microorganisms. The cellular and molecular mechanisms for this light-dependent velocity and magnetotaxis are unknown and deserve further studies to understand the biochemical interactions and the ecological roles of the different mechanisms of taxis in MMPs.
Nanostructures of Indium Gallium Nitride Crystals Grown on Carbon Nanotubes.
Park, Ji-Yeon; Man Song, Keun; Min, Yo-Sep; Choi, Chel-Jong; Seok Kim, Yoon; Lee, Sung-Nam
2015-11-16
Nanostructure (NS) InGaN crystals were grown on carbon nanotubes (CNTs) using metalorganic chemical vapor deposition. The NS-InGaN crystals, grown on a ~5-μm-long CNT/Si template, were estimated to be ~100-270 nm in size. Transmission electron microscope examinations revealed that single-crystalline InGaN NSs were formed with different crystal facets. The observed green (~500 nm) cathodoluminescence (CL) emission was consistent with the surface image of the NS-InGaN crystallites, indicating excellent optical properties of the InGaN NSs on CNTs. Moreover, the CL spectrum of InGaN NSs showed a broad emission band from 490 to 600 nm. Based on these results, we believe that InGaN NSs grown on CNTs could aid in overcoming the green gap in LED technologies.
Electro-holographic display using a ZBLAN glass as the image space.
Son, Jung-Young; Lee, Hyoung; Byeon, Jina; Zhao, Jiangbo; Ebendorff-Heidepriem, Heike
2017-04-01
An Er3+-doped ZBLAN glass is used to display a 360° viewable reconstructed image from a hologram on a DMD. The reconstructed image, when the hologram is illuminated by a 852 nm wavelength laser beam, is situated at the inside of the glass, and then a 1530 nm wavelength laser beam is crossed through the image to light it with an upconversion green light, which is viewable at all surrounding directions. This enables us to eliminate the limitation of the viewing zone angle imposed by the finite size of pixels in electro-holographic displays based on digital display chips/panels. The amount of the green light is much higher than that known previously. This is partly caused by the upconversion luminescence induced by 852 and 1530 nm laser beams.
Gong, Deyan; Han, Shi-Chong; Iqbal, Anam; Qian, Jing; Cao, Ting; Liu, Wei; Liu, Weisheng; Qin, Wenwu; Guo, Huichen
2017-12-19
Two fluorescent, m-nitrophenol-substituted difluoroboron dipyrromethene dyes have been designed by nucleophilic substitution reaction of 3,5-dichloro-4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY). Nonsymmetric and symmetric probes, that is. BODIPY 1 (with one nitrophenol group at the position 3) and BODIPY 2 (with two nitrophenol groups at the positions 3 and 5) were applied to ratiometric fluorescent glutathione detection. The detection is based on the two-step nucleophilic aromatic substitution of the nitrophenol groups of the probes by glutathione in buffer solution containing CTAB. In the first stage, probe 1 showed ratiometric fluorescent color change from green (λ em = 530 nm) to yellow (λ em = 561 nm) because of monosubstitution with glutathione (I 561nm /I 530nm ). Addition of excess glutathione caused the second stage of ratiometric fluorescent color change from yellow to reddish orange (λ em = 596 nm, I 596nm /I 561nm ) due to disubstitution with glutathione. Therefore, different concentration ranges of glutathione (from less to excess) could be rapidly detected by the two-stage ratiometric fluorescent probe 1 in 5 min. While, probe 2 shows single-stage ratiometric fluorescent detection to GSH (from green to reddish orange, I 596nm /I 535nm ). Probes 1 and 2 exhibit excellent properties with sensitive, specific colorimetric response and ratiometric fluorescent response to glutathione over other sulfur nucleophiles. Application to cellular ratiometric fluorescence imaging indicated that the probes were highly responsive to intracellular glutathione.
The advantages of wearable green reflected photoplethysmography.
Maeda, Yuka; Sekine, Masaki; Tamura, Toshiyo
2011-10-01
This report evaluates the efficacy of reflected-type green light photoplethysmography (green light PPG). Transmitted infrared light was used for PPG and the arterial pulse was monitored transcutaneously. The reflected PPG signal contains AC components based on the heartbeat-related signal from the arterial blood flow and DC components, which include reflectance and scattering from tissue. Generally, changes in AC components are monitored, but the DC components play an important role during heat stress. In this study, we compared the signal of green light PPG to infrared PPG and ECG during heat stress. The wavelengths of the green and infrared light were 525 nm and 880 nm, respectively. Experiments were performed on young healthy subjects in cold (10°C), hot (45°C), and normal environments. The pulse rates were compared among three measurement devices and the AC and DC components of the PPG signal were evaluated during heat stress. The pulse rates obtained from green light PPG were strongly correlated with the R-R interval of an electrocardiogram in all environments, but those obtained from infrared light PPG displayed a weaker correlation with cold exposure. The AC components were of similar signal output for both wavelengths during heat stress. Also, the DC components for green light PPG were similar during heat stress, but showed less signal output for infrared light PPG during hot exposure. The main reason for the reduced DC components was speculated to be the increased blood flow at the vascular bed. Therefore, reflected green light PPG can be useful for pulse rate monitoring because it is less influenced by the tissue and vein region.
Ohad, Itzakh; Clayton, Roderick K.; Bogorad, Lawrence
1979-01-01
Preparations of allophycocyanin isolated from the alga Fremyella diplosiphon show light-induced optical absorbance changes that suggest the presence of a photoconvertible component [Formula: see text] similar to the algal pigments described by J. Scheibe [(1972) Science 176, 1037-1039]. At pH < 4 the allophycocyanin has an absorption maximum at 620 nm. Red illumination causes a loss of absorbance in the red, centered at 620 nm, and subsequent green illumination restores the lost absorbance. We have studied this photoconversion at temperatures between 200 K and 307 K, analyzing the results in terms of photostationary states established under red (640 nm) and green (550 nm) light. As the temperature was lowered to 260 K, the state Pr became progressively favored; the reaction Pr → Pg induced by red light was attenuated but the reaction Pg → Pr induced by green light was not. Decreasing the temperature from 260 K to 200 K had no further effect. Two distinct and simple models can account for this curious temperature dependence. By analyzing the kinetic and steady-state data, with reasonable estimates of the molar extinction coefficients of Pr and Pg, we computed quantum efficiencies greater than 15% for the photoconversion at 300 K. We deduced that a conversion of “all Pr” to “all Pg” should produce a fractional absorbance change ΔA/A at 620 nm equal to 0.1. If the chromatic adaptation response of intact F. diplosiphon shows the unusual temperature dependence reported here, the system Pr ⇌ Pg will be implicated in mediating this response. PMID:16592721
Code of Federal Regulations, 2010 CFR
2010-01-01
... STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE STANDARDS FOR BARRELS BARRELS AND OTHER CONTAINERS FOR LIME § 240.6 Tolerances. (a) When lime is packed in barrels the tolerance to be allowed on the large barrel or the small barrel of lime shall be 5 pounds in excess or in deficiency on any individual barrel...
15 CFR 240.5 - Required marking.
Code of Federal Regulations, 2010 CFR
2010-01-01
... STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE STANDARDS FOR BARRELS BARRELS AND OTHER CONTAINERS FOR LIME § 240.5 Required marking. (a) The lettering required upon barrels of lime by section 2 of the law shall... lime and where manufactured, and, if imported, the name of the country from which it is imported, shall...
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-11
... Request Submitted to OMB for Review and Approval; Comment Request; NESHAP for Lime Manufacturing (Renewal... Agency has submitted an information collection request (ICR), ``NESHAP for Lime Manufacturing (40 CFR... required semiannually. Form Numbers: None. Respondents/affected entities: Lime manufacturing plants...
40 CFR 98.193 - Calculating GHG emissions.
Code of Federal Regulations, 2010 CFR
2010-07-01
... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Lime Manufacturing § 98.193 Calculating GHG emissions. You must calculate and report the annual process CO2 emissions from all lime kilns combined using the procedure in paragraphs (a) and (b) of this section. (a) If all lime kilns meet the conditions specified in...
Miller, M.
2006-01-01
In 2005, US lime production was 20 Mt with a value of $1.5 billion. Production was unchanged compared with 2004. Captive production was 1.4 Mt. US consumption was 20.2 Mt. Most of the US lime trade was with Canada and Mexico. Despite some disruptions due to hurricanes Katrina and Rita, normal sales activities remained healthy.
USDA-ARS?s Scientific Manuscript database
Several distorted Mexican lime [Citrus aurantiifolia (Christm). Swingle] fruit, leaf, and twig samples with lime anthracnose symptoms were collected from three trees in residential areas of Brownsville, Texas. The causal fungal organism, Colletotrichum acutatum J. H. Simmonds was isolated from leave...
40 CFR 98.193 - Calculating GHG emissions.
Code of Federal Regulations, 2014 CFR
2014-07-01
... (General Stationary Fuel Combustion Sources) the combustion CO2 emissions from each lime kiln according to... must calculate and report the annual process CO2 emissions from all lime kilns combined using the... combustion CO2 emissions from all lime kilns by operating and maintaining a CEMS to measure CO2 emissions...
Simple Analysis of Historical Lime Mortars
ERIC Educational Resources Information Center
Pires, Joa~o
2015-01-01
A laboratory experiment is described in which a simple characterization of a historical lime mortar is made by the determination of its approximate composition by a gravimetric method. Fourier transform infrared (FTIR) spectroscopy and X-ray diffraction (XRD) are also used for the qualitative characterization of the lime mortar components. These…
Investigation of Copper Sorption by Sugar Beet Processing Lime Waste
In the western United States, sugar beet processing for sugar recovery generates a lime-based waste product (~250,000 Mg yr-1) that has little liming value in the region’s calcareous soils. This area has recently experienced an increase in dairy production, with dairi...
Treatment of cotton textile wastewater using lime and ferrous sulfate.
Georgiou, D; Aivazidis, A; Hatiras, J; Gimouhopoulos, K
2003-05-01
This technical note summarizes the results of a textile wastewater treatment process aiming at the destruction of the wastewater's color by means of coagulation/flocculation techniques using ferrous sulfate and/or lime. All the experiments were run in a pilot plant that simulated an actual industrial wastewater treatment plant. Treatment with lime alone proved to be very effective in removing the color (70-90%) and part of the COD (50-60%) from the textile wastewater. Moreover, the treatment with ferrous sulfate regulating the pH in the range 9.0+/-0.5 using lime was equally effective. Finally, the treatment with lime in the presence of increasing doses of ferrous sulfate was tested successfully, however; it proved to be very costly mainly due to the massive production of solids that precipitated.
Vouk, D; Nakic, D; Štirmer, N; Baricevic, A
2017-02-01
Final disposal of sewage sludge is important not only in terms of satisfying the regulations, but the aspect of choosing the optimal wastewater treatment technology, including the sludge treatment. In most EU countries, significant amounts of stabilized and dewatered sludge are incinerated, and sewage sludge ash (SSA) is generated as a by product. At the same time, lime is one of the commonly used additives in the sewage sludge treatment primarily to stabilize the sludge. In doing so, the question arose how desirable is such addition of lime if the sludge is subsequently incinerated, and the generated ash is further used in the production of cementitious materials. A series of mortars were prepared where 10-20% of the cement fraction was replaced by SSA. Since all three types of analyzed SSA (without lime, with lime added during sludge stabilization and with extra lime added during sludge incineration) yielded nearly same results, it can be concluded that if sludge incineration is accepted solution, lime addition during sludge treatment is unnecessary even from the standpoint of preserving the pozzolanic properties of the resulting SSA. Results of the research carried out on cement mortars point to the great possibilities of using SSA in concrete industry.
Preliminary Study of the Potential Extracts from Selected Plants to Improve Surface Cleaning
Vong, Ai Ting
2018-01-01
Environment hygiene is important for preventing infection and promoting a healthier environment in which to live or work. The goal of this study was to examine the antimicrobial effects of Citrus aurantifolia (key lime) juice and aqueous extracts of Cinnamomum iners (cinnamon) bark and Citrus hystrix (kaffir lime) leaves on the kinetic growth of Pseudomonas aeruginosa and methicillin resistance Staphylococcus aureus (MRSA). Antimicrobial activity was quantitatively evaluated using spectrophotometry and viable cell counts versus bacterial growth time. The fomite surface samples that were used in the second experiment were chosen randomly from the laboratories. They were assessed both before and after intervention using a mixture of commercial disinfectant detergent and lime juice. In the kinetic growth study, the lime juice effectively eliminated P. aeruginosa and MRSA. The cinnamon bark extract was more effective at inhibiting P. aeruginosa than MRSA. The kaffir lime leaf extract demonstrated bacteriostatic activity for the first 60 min, which then weakened after 90 min for both bacteria. The lime juice extract and commercial disinfectant mixture effectively disinfected the fomites. Further studies of the use of key lime juice as a disinfectant in the hospital environment should be conducted, as C. aurantifolia exhibits antibacterial activities against endemic microbes. PMID:29509658
Water Utility Lime Sludge Reuse – An Environmental Sorbent ...
Lime sludge can be used as an environmental sorbent to remove sulfur dioxide (SO2) and acid gases, by the ultra-fine CaCO3 particles, and to sequester mercury and other heavy metals, by the Natural Organic Matter and residual activated carbon. The laboratory experimental set up included a simulated flue gas preparation unit, a lab-scale wet scrubber, and a mercury analyzer system. The influent mercury concentration was based on a range from 22 surveyed power plants. The reactivity of the lime sludge sample for acid neutralization was determined using a method similar to method ASTM C1318-95. Similar experiments were conducted using reagent calcium carbonate and calcium sulfate to obtain baseline data for comparing with the lime sludge test results. The project also evaluated the techno-economic feasibility and sustainable benefits of reusing lime softening sludge. If implemented on a large scale, this transformative approach for recycling waste materials from water treatment utilities at power generation utilities for environmental cleanup can save both water and power utilities millions of dollars. Huge amounts of lime sludge waste, generated from hundreds of water treatment utilities across the U.S., is currently disposed in landfills. This project evaluated a sustainable and economically-attractive approach to the use of lime sludge waste as a valuable resource for power generation utilities.
González-Alcaraz, María Nazaret; Conesa, Héctor Miguel; Alvarez-Rogel, José
2013-02-15
The aim of this study was to identify the effectiveness of liming in combination with vegetation for the recovery of slightly acidic, saline soils of eutrophic wetlands affected by mine wastes, under fluctuating flooding conditions. Simulated soil profiles were constructed and four treatments were assayed under greenhouse conditions: control, only plant, only liming, and liming and plant. The plant species was the halophyte Sarcocornia fruticosa. Three horizons were differentiated: A (never under water), C1 (alternating flooding-drying conditions), and C2 (always under water). The pH, Eh, salinity, and the concentrations of dissolved organic carbon and soluble metals were measured regularly for 18 weeks. Liming favoured the growth of S. fruticosa, an increase in pH and a fall in Eh. The amendment was effective for reducing Mn, Zn, and Cd in pore water of bare soils, but not Cu and Pb. In the treatment with liming and plant, the growth of S. fruticosa counteracted the effect of the amendment, strongly increasing the concentrations of metals in pore water and distributing them along the soil profile. Hence, the combined use of liming and plants may increase the risk of metals mobilisation. Copyright © 2012 Elsevier Ltd. All rights reserved.
Effect of Lime Stabilization on Vertical Deformation of Laterite Halmahera Soil
NASA Astrophysics Data System (ADS)
Saing, Zubair; Djainal, Herry
2018-04-01
In this paper, the study was conducted to determine the lime effect on vertical deformation of road base physical model of laterite Halmahera soil. The samples of laterite soil were obtained from Halmahera Island, North Maluku Province, Indonesia. Soil characteristics were obtained from laboratory testing, according to American Standard for Testing and Materials (ASTM), consists of physical, mechanical, minerals, and chemical. The base layer of physical model testing with the dimension; 2m of length, 2m of width, and 1.5m of height. The addition of lime with variations of 3, 5, 7, an 10%, based on maximum dry density of standard Proctor test results and cured for 28 days. The model of lime treated laterite Halmahera soil with 0,1m thickness placed on subgrade layer with 1,5m thickness. Furthermore, the physical model was given static vertical loading. Some dial gauge is placed on the lime treated soil surface with distance interval 20cm, to read the vertical deformation that occurs during loading. The experimentals data was analyzed and validated with numerical analysis using finite element method. The results showed that the vertical deformation reduced significantly on 10% lime content (three times less than untreated soil), and qualify for maximum deflection (standard requirement L/240) on 7-10% lime content.
Intense excitation source of blue-green laser
NASA Astrophysics Data System (ADS)
Han, K. S.
1985-10-01
An intense and efficient excitation source for blue-green lasers useful for the space-based satellite laser applications, underwater strategic communication, and measurement of ocean bottom profile is being developed. The source in use, hypocycloidal pinch plasma (HCP), and a newly designed dense-plasma focus (DPF) can produce intense UV photons (200 to 300 nm) which match the absorption spectra of both near UV and blue green dye lasers (300 to 400 nm). During the current project period, the successful enhancement of blue-green laser output of both Coumarin 503 and LD490 dye through the spectral conversion of the HCP pumping light has been achieved with a converter dye BBQ. The factor of enhancement in the blue-green laser output energy of both Coumarin 503 and LD490 is almost 73%. This enhancement will definitely be helpful in achieving the direct high power blue-green laser (> 1 MW) with the existing blue green dye laser. On the other hand the dense-plasma focus (DPF) with new optical coupling has been designed and constructed. For the optimization of the DPF device as the UV pumping light source, the velocity of current sheath and the formation of plasma focus have been measured as function of argon or argon-deuterium fill gas pressure. Finally, the blue-green dye laser (LD490) has been pumped with the DPF device for preliminary tests. Experimental results with the DPF device show that the velocity of the current sheath follows the inverse relation of sq st. of pressure as expected. The blue-green dye (LD490) laser output exceeded 3.1 m at the best cavity tuning of laser system. This corresponds to 3J/1 cu cm laser energy extraction.
NASA Astrophysics Data System (ADS)
Britz, Steven; Caldwell, Charles; Mirecki, Roman; Slusser, James; Gao, Wei
2005-08-01
Eight cultivars each of red and green leaf lettuce were raised in a greenhouse with supplemental UV radiation, either UV-A (wavelengths greater than ca. 315 nm) or UV-A+UV-B (wavelengths greater than ca. 290 nm; 6.4 kJ m-2 daily biologically effective UV-B), or no supplemental UV (controls). Several phytonutrients were analyzed in leaf flours to identify lines with large differences in composition and response to UV-B. Red leaf lettuce had higher levels of phenolic acid esters, flavonols and anthocyanins than green lines. Both green and red lines exposed to UV-B for 9 days showed 2-3-fold increases in flavonoids compared to controls, but only 45% increases in phenolic acid esters, suggesting these compounds may be regulated by different mechanisms. There were large differences between cultivars in levels of phenolic compounds under control conditions and also large differences in UV-B effects. Among red varieties, cv. Galactic was notable for high levels of phenolics and a large response to UV-B. Among green varieties, cvs. Black-Seeded Simpson and Simpson Elite had large increases in phenolics with UV-B exposure. Photosynthetic pigments were also analyzed. Green leaf lettuce had high levels of pheophytin, a chlorophyll degradation product. Total chlorophylls (including pheophytin) were much lower in green compared to red varieties. Lutein, a carotenoid, was similar for green and red lines. Total chlorophylls and lutein increased 2-fold under supplemental UV-B in green lines but decreased slightly under UV-B in red lines. Lettuce appears to be a valuable crop to use to study phytochemical-environment interactions.
High-Temperature Spintronic Devices and Circuits in Absence of Magnetic Field
2012-04-23
non-equilibrium Green’s function (NEGF) formalism. • Molecular beam epitaxy (MBE) growth of ferromagnetic metals (Fe, MnAs) and...measured for two diode injection currents in the Faraday geometry. The quantum dot microcavity device was grown by molecular beam epitaxy with a low...channel (10 nm, lxlOl9j Mn-doped) / undoped-AlAs (1 nm) tunnel barrier / undoped-GaAs (0.5 nm) / MnAs (25 nm) were grown by molecular beam epitaxy (MBE
NASA Astrophysics Data System (ADS)
Everard, Colm D.; Kim, Moon S.; Lee, Hoyoung
2014-05-01
The production of contaminant free fresh fruit and vegetables is needed to reduce foodborne illnesses and related costs. Leafy greens grown in the field can be susceptible to fecal matter contamination from uncontrolled livestock and wild animals entering the field. Pathogenic bacteria can be transferred via fecal matter and several outbreaks of E.coli O157:H7 have been associated with the consumption of leafy greens. This study examines the use of hyperspectral fluorescence imaging coupled with multivariate image analysis to detect fecal contamination on Spinach leaves (Spinacia oleracea). Hyperspectral fluorescence images from 464 to 800 nm were captured; ultraviolet excitation was supplied by two LED-based line light sources at 370 nm. Key wavelengths and algorithms useful for a contaminant screening optical imaging device were identified and developed, respectively. A non-invasive screening device has the potential to reduce the harmful consequences of foodborne illnesses.
A water marker monitored by satellites to predict seasonal endemic cholera.
Jutla, Antarpreet; Akanda, Ali Shafqat; Huq, Anwar; Faruque, Abu Syed Golam; Colwell, Rita; Islam, Shafiqul
2013-01-01
The ability to predict an occurrence of cholera, a water-related disease, offers a significant public health advantage. Satellite based estimates of chlorophyll, a surrogate for plankton abundance, have been linked to cholera incidence. However, cholera bacteria can survive under a variety of coastal ecological conditions, thus constraining the predictive ability of the chlorophyll, since it provides only an estimate of greenness of seawater. Here, a new remote sensing based index is proposed: Satellite Water Marker (SWM), which estimates condition of coastal water, based on observed variability in the difference between blue (412 nm) and green (555 nm) wavelengths that can be related to seasonal cholera incidence. The index is bounded between physically separable wavelengths for relatively clear (blue) and turbid (green) water. Using SWM, prediction of cholera with reasonable accuracy, with at least two month in advance, can potentially be achieved in the endemic coastal regions.
Stavenga, Doekele G.; Wilts, Bodo D.; Leertouwer, Hein L.; Hariyama, Takahiko
2011-01-01
The elytra of the Japanese jewel beetle Chrysochroa fulgidissima are metallic green with purple stripes. Scanning electron microscopy and atomic force microscopy demonstrated that the elytral surface is approximately flat. The accordingly specular green and purple areas have, with normal illumination, 100–150 nm broad reflectance bands, peaking at about 530 and 700 nm. The bands shift progressively towards shorter wavelengths with increasing oblique illumination, and the reflection then becomes highly polarized. Transmission electron microscopy revealed that the epicuticle of the green and purple areas consists of stacks of 16 and 12 layers, respectively. Assuming gradient refractive index values of the layers between 1.6 and 1.7 and applying the classical multilayer theory allowed modelling of the measured polarization- and angle-dependent reflectance spectra. The extreme polarized iridescence exhibited by the elytra of the jewel beetle may have a function in intraspecific recognition. PMID:21282175
Green fluorescent protein as a reporter of gene expression and protein localization.
Kain, S R; Adams, M; Kondepudi, A; Yang, T T; Ward, W W; Kitts, P
1995-10-01
The green fluorescent protein (GFP) from the jellyfish Aequorea victoria is rapidly becoming an important reporter molecule for monitoring gene expression and protein localization in vivo, in situ and in real time. GFP emits bright green light (lambda max = 509 nm) when excited with UV or blue light (lambda max = 395 nm, minor peak at 470 nm). The fluorescence excitation and emission spectra of GFP are similar to those of fluorescein, and the conditions used to visualize this fluorophore are also suitable for GFP. Unlike other bioluminescent reporters, the chromophore in GFP is intrinsic to the primary structure of the protein, and GFP fluorescence does not require a substrate or cofactor. GFP fluorescence is stable, species-independent and can be monitored non-invasively in living cells and, in the case of transparent organisms, whole animals. Here we demonstrate GFP fluorescence in bacterial and mammalian cells and introduce our Living Colors line of GFP reporter vectors, GFP protein and anti-GFP antiserum. The reporter vectors for GFP include a promoterless GFP vector for monitoring the expression of cloned promoters/enhancers in mammalian cells and a series of six vectors for creating fusion protein to either the N or C terminus of GFP.
NASA Astrophysics Data System (ADS)
Wang, Bin; Zhao, Jinsheng; Cui, Chuansheng; Wang, Min; Wang, Zhong; He, Qingpeng
2012-05-01
Electrochemical copolymerization of 1,4-bis(2-thienyl)naphthalene (BTN) with pyrene is carried out in acetonitrile (ACN) solution containing sodium perchlorate (NaClO4) as a supporting electrolyte. Characterizations of the resulting copolymer P(BTN-co-pyrene) are performed by cyclic voltammetry (CV), UV-vis spectroscopy, Fourier transform infrared spectroscopy (FT-IR) and scanning electron microscopy (SEM). The P(BTN-co-pyrene) film has distinct electrochromic properties and exhibits three different colors (yellowish green, green and blue) under various potentials. Maximum contrast (ΔT%) and response time of the copolymer film are measured as 37.8% and 1.71 s at 687 nm. An electrochromic device (ECD) based on P(BTN-co-pyrene) and poly(3,4-ethylenedioxythiophene) (PEDOT) is constructed and characterized. Neutral state of device shows green color while oxidized state reveals blue color. This ECD shows a maximum optical contrast (ΔT%) of 24.4% with a response time of 0.43 s at 635 nm. The coloration efficiency (CE) of the device is calculated to be 349 cm2 C-1 at 635 nm. In addition, the ECD also has satisfactory optical memories and redox stability.
USDA-ARS?s Scientific Manuscript database
The use of "green" processes for the synthesis of nanoparticles is a new branch of nanotechnology. However, knowledge of the bioactivity of nanoparticles against mosquitoes and malaria parasites is limited. We tested silver nanoparticles (average size 450 nm) bio-reduced in 5% Cassia occidentalis ...
Interfering with DNA Damage Signals: Radiosensitizing Prostate Cancer Using Small Peptides
2009-05-01
25-l sample of the supernatant was analyzed for free phosphate in the malachite green assay by dilution with 100 l of a developing solution... malachite green). After incubation for 15 min, the release of phosphate was quantified by measuring the absorbance at 650 nm in a microtiter plate reader
Interfering with DNA Damage Signals: Radiosensitizing Prostate Cancer using Small Peptides
2007-11-01
were pelleted, and a 25-l sample of the supernatant was analyzed for free phosphate in the malachite green assay by dilution with 100 l of a...developing solution ( malachite green). After incubation for 15 min, the release of phosphate was quantified by measuring the absorbance at 650 nm in a
Do visually salient stimuli reduce children's risky decisions?
Schwebel, David C; Lucas, Elizabeth K; Pearson, Alana
2009-09-01
Children tend to overestimate their physical abilities, and that tendency is related to risk for unintentional injury. This study tested whether or not children estimate their physical ability differently when exposed to stimuli that were highly visually salient due to fluorescent coloring. Sixty-nine 6-year-olds judged physical ability to complete laboratory-based physical tasks. Half judged ability using tasks that were painted black; the other half judged the same tasks, but the stimuli were striped black and fluorescent lime-green. Results suggest the two groups judged similarly, but children took longer to judge perceptually ambiguous tasks when those tasks were visually salient. In other words, visual salience increased decision-making time but not accuracy of judgment. These findings held true after controlling for demographic and temperament characteristics.
The First Mutant of the Aequorea victoria Green Fluorescent Protein That Forms a Red Chromophore†
Mishin, Alexander S.; Subach, Fedor V.; Yampolsky, Ilia V.; King, William; Lukyanov, Konstantin A.; Verkhusha, Vladislav V.
2010-01-01
Green fluorescent protein (GFP) from a jellyfish, Aequorea victoria, and its mutants are widely used in biomedical studies as fluorescent markers. In spite of the enormous efforts of academia and industry toward generating its red fluorescent mutants, no GFP variants with emission maximum at more than 529 nm have been developed during the 15 years since its cloning. Here, we used a new strategy of molecular evolution aimed at generating a red-emitting mutant of GFP. As a result, we have succeeded in producing the first GFP mutant that substantially matures to the red-emitting state with excitation and emission maxima at 555 and 585 nm, respectively. A novel, nonoxidative mechanism for formation of the red chromophore in this mutant that includes a dehydration of the Ser65 side chain has been proposed. Model experiments showed that the novel dual-color GFP mutant with green and red emission is suitable for multicolor flow cytometry as an additional color since it is clearly separable from both green and red fluorescent tags. PMID:18366185
Green synthesis of carbon quantum dots from lignite coal and the application in Fe3+ detection
NASA Astrophysics Data System (ADS)
Liu, Xuexia; Hao, Juanyuan; Liu, Jianhui; Tao, Hongcai
2018-02-01
Carbon quantum dots (CQDs) had attracted much attention due to their unique structures and excellent properties. Their green preparation was one of the research frontiers. However, most of the CQDs were prepared by strong acid oxidation, the way of which was not friendly to the environment. In this study, CQDs were prepared by green ozone oxidation of lignite coal, which is abundant and inexpensive. The CQDs were well dispersed, the size distribution of the obtained CQDs centralized from 2 to 4 nm with the average diameter of about 2.8 nm. In addition, the as-prepared CQDs containing rich oxygen functional groups exhibited good water-solubility and optical properties with yield reached 35%. The CQDs showed a highly sensitive and selective quenching effect to Fe3+ with desirable anti-interference performance. Moreover, the fluorescence intensity of CQDs had a good linear response to the Fe3+ concentration ranging from 10 to 150 µmol/L with the detection limit of 0.26 µmol/L. This green and facile synthesis method had the prospect of large-scale preparation of CQDs.
Increasing Soil Calcium Availability Alters Forest Soil Carbon Stocks
NASA Astrophysics Data System (ADS)
Melvin, A.; Goodale, C. L.
2011-12-01
Acid deposition in the Northeastern U.S. has been linked to a loss of soil base cations, especially calcium (Ca). While much research has addressed the effects of Ca depletion on soil and stream acidification, few studies have investigated its effects on ecosystem carbon (C) balance. We studied the long-term effects of increased Ca availability on C cycling in a northern hardwood forest in the Adirondack Park, NY. In 1989, calcium carbonate (lime) was added to ~ 100 ha of the Woods Lake Watershed to ameliorate the effects of soil Ca depletion. An additional 100 ha were maintained as controls. We hypothesized that the lime addition would improve forest health and that this improvement would be evident in increased tree biomass, leaf litter, and fine root production. Within the forest floor, we anticipated that the increased pH associated with liming would stimulate microbial activity resulting in increased decomposition and basal soil respiration, and reduced C stocks. Additionally, we hypothesized that increased Ca availability could enhance Ca-OM complexation in the upper mineral soils, leading to increased C stocks in these horizons. Eighteen years after liming, soil pH and exchangeable Ca pools remained elevated in the forest floor and upper mineral soil of the limed plots. Forest floor C stocks were significantly larger in limed plots (68 vs. 31 t C ha-1), and were driven primarily by greater C accumulation in the forest floor Oa horizon. Mineral soil C stocks did not differ between limed and control soils. Liming did not affect tree growth, however a net decline in biomass was observed across the entire watershed. There was a trend for larger fine root and foliar litter inputs in limed plots relative to controls, but the observed forest floor accumulation appears to be driven primarily by a suppression of decomposition. Liming reduced basal soil respiration rates by 17 and 43 % in the Oe and Oa horizons, respectively. This research suggests that Ca may stabilize soil organic matter and that long-term Ca depletion caused by acid deposition could have large, unexpected effects on ecosystem C dynamics.
Lime pretreatment of lignocellulosic biomass
NASA Astrophysics Data System (ADS)
Chang, Shushien
Lignocellulose is a valuable alternative energy source. The susceptibility of lignocellulosic biomass to enzymatic hydrolysis is constrained due to its structural features, so pretreatment is essential to enhance enzymatic digestibility. Of the chemicals used as pretreatment agents, it has been reported that alkalis improve biomass digestibility significantly. In comparison with other alkalis such as NaOH and ammonia, lime (calcium hydroxide) has many advantages; it is very inexpensive, is safe, and can be recovered by carbonating wash water. The effects of lime pretreatment were explored on switchgrass and poplar wood, representing herbaceous and woody biomass, respectively. The effects of pretreatment conditions (time, temperature, lime loading, water loading, particle size, and oxygen pressure) have been systematically studies. Lime alone enhances the digestibility of switchgrass significantly; under the recommended conditions, the 3-d total sugar (glucose + xylose) yields of lime-treated switchgrass were 7 times that of untreated sample. When treating poplar wood, lime must be combined with oxygen to achieve high digestibility; oxidative lime pretreatment increased the 3-d total sugar yield of poplar wood to 12 times that of untreated sample. In a fundamental study, to determine why lime pretreatment is effective, the effects of three structural features on enzymatic digestibility were studied: lignin content, acetyl content, and crystallinity index (CrI). Poplar wood was treated with peracetic acid, potassium hydroxide, and ball milling to produce model lignocelluloses with a broad spectrum of lignin contents, acetyl contents, and CrI, respectively. Enzymatic hydrolysis was performed on the model lignocelluloses to determine the digestibility. Correlations between lignin/carbohydrate ratio, acetyl/carbohydrate ratio, CrI and digestibility were developed. The 95% prediction intervals show that the correlations predict the 1-h and 3-d total sugar conversions of a biomass sample within a precision of 5% and 20%, respectively. The digestibility of a variety of lime-treated biomass and ball-milled alpha-cellulose was compared to the correlations determined from the model compounds. The agreement between the measured and predicted values shows that the correlations are satisfactory and the three structural features---lignin content, acetyl content, and CrI---are the major factors that determine enzymatic digestibility.
Alvarenga, P; Ferreira, C; Mourinha, C; Palma, P; de Varennes, A
2018-06-07
The aim of this study was to evaluate the use of drinking-water treatment residuals (DWTR) in the amendment of a soil affected by mining activities (Aljustrel mine, Portuguese sector of the Iberian Pyrite Belt), considering the effects on its chemical, biochemical and ecotoxicological characteristics. The DWTR had neutral characteristics (pH 6.7) and an organic matter (OM) content of 575 g kg -1 dry matter (DM), which makes them a potential amendment for the remediation of mine degraded soils, as they may correct soil acidity and reduce the extractable metal fraction. An incubation assay, with soil and DWTR, with or without lime, was carried out to test the doses to be used in the assisted-phytostabilization experiment. Based on the results obtained, the doses of DWTR used were the equivalent to 48, 96, and 144 t DM ha -1 , with and without lime application (CaCO 3 11 t DM ha -1 ). Agrostis tenuis Sibth was used as the test plant. Some amendments doses were able to improve soil characteristics (pH and OM content), to decrease metal extractability by 0.01 M CaCl 2 (especially for Cu and Zn), and to allow plant growth, that did not occur in the non-amended soil. Copper, Pb and Zn concentrations in the plant material were lower than the maximum tolerable level for cattle feed, used as an indicator of risk of entry of those metals into the human food chain. The simultaneous application of DWTR (96 and 144 t ha -1 ), with lime, allowed a reduction in the mine soil ecotoxicity, as evaluated by some lethal and sub-lethal bioassays, including luminescence inhibition of Vibrio fischeri, Daphnia magna acute immobilization test, mortality of Thamnocephalus platyurus, and 72-h growth inhibition of the green microalgae Pseudokirchneriella subcapitata. However, DWTR were unable to increase soil microbial activity, evaluated by dehydrogenase activity, an important soil-health indicator. Also, OM content and N Kjeldahl , concentrations increased slightly but remained low or very low (P and K extractable concentrations were not affected). In general, the bioassays highlighted a decrease in soil ecotoxicity with the presence of lime and DWTR (144 t DM ha -1 ). In conclusion, DWTR are recommended to amend acidic soils, with high concentrations of trace elements, but an additional application of organic or mineral fertilizers should be considered. Copyright © 2018 Elsevier Inc. All rights reserved.
A new look at liming as an approach to accelerate recovery from acidic deposition effects
Lawrence, Gregory B.; Burns, Douglas A.; Murray, Karen
2016-01-01
Acidic deposition caused by fossil fuel combustion has degraded aquatic and terrestrial ecosystems in North America for over four decades. The only management option other than emissions reductions for combating the effects of acidic deposition has been the application of lime to neutralize acidity after it has been deposited on the landscape. For this reason, liming has been a part of acid rain science from the beginning. However, continued declines in acidic deposition have led to partial recovery of surface water chemistry, and the start of soil recovery. Liming is therefore no longer needed to prevent further damage, so the question becomes whether liming would be useful for accelerating recovery of systems where improvement has lagged. As more is learned about recovering ecosystems, it has become clear that recovery rates vary with watershed characteristics and among ecosystem components. Lakes appear to show the strongest recovery, but recovery in streams is sluggish and recovery of soils appears to be in the early stages. The method in which lime is applied is therefore critical in achieving the goal of accelerated recovery. Application of lime to a watershed provides the advantage of increasing Ca availability and reducing or preventing mobilization of toxic Al, an outcome that is beneficial to both terrestrial and aquatic ecosystems. However, the goal should not be complete neutralization of soil acidity, which is naturally produced. Liming of naturally acidic areas such as wetlands should also be avoided to prevent damage to indigenous species that rely on an acidic environment.
Alvarenga, Emilio; Øgaard, Anne Falk; Vråle, Lasse
2017-04-01
More efficient plant utilisation of the phosphorus (P) in sewage sludge is required because rock phosphate is a limited resource. To meet environmental legislation thresholds for P removal from wastewater (WW), primary treatment with iron (Fe) or aluminium (Al) coagulants is effective. There is also a growing trend for WW treatment plants (WWTPs) to be coupled to a biogas process, in order to co-generate energy. The sludge produced, when stabilised, is used as a soil amendment in many countries. This study examined the effects of anaerobic digestion (AD), with or without liming as a post-treatment, on P release from Fe- and Al-precipitated sludges originating from primary WWTPs. Plant uptake of P from Fe- and Al-precipitated sludge after lime treatment but without AD was also compared. Chemical characterisation with sequential extraction of P and a greenhouse experiment with barley (Hordeum vulgare) were performed to assess the treatment effects on plant-available P. Liming increased the P-labile fraction in all cases. Plant P uptake increased from 18.5 mg pot -1 to 53 mg P pot -1 with liming of Fe-precipitated sludge and to 35 mg P pot -1 with liming of the digestate, while it increased from 18.7 mg pot -1 to 39 and 29 mg P pot -1 for the Al-precipitated substrate and digestate, respectively. Thus, liming of untreated Fe-precipitated sludge and its digestate resulted in higher P uptake than liming its Al-precipitated counterparts. AD had a negative impact on P mobility for both sludges.
A new look at liming as an approach to accelerate recovery from acidic deposition effects.
Lawrence, Gregory B; Burns, Douglas A; Riva-Murray, Karen
2016-08-15
Acidic deposition caused by fossil fuel combustion has degraded aquatic and terrestrial ecosystems in North America for over four decades. The only management option other than emissions reductions for combating the effects of acidic deposition has been the application of lime to neutralize acidity after it has been deposited on the landscape. For this reason, liming has been a part of acid rain science from the beginning. However, continued declines in acidic deposition have led to partial recovery of surface water chemistry, and the start of soil recovery. Liming is therefore no longer needed to prevent further damage, so the question becomes whether liming would be useful for accelerating recovery of systems where improvement has lagged. As more is learned about recovering ecosystems, it has become clear that recovery rates vary with watershed characteristics and among ecosystem components. Lakes appear to show the strongest recovery, but recovery in streams is sluggish and recovery of soils appears to be in the early stages. The method in which lime is applied is therefore critical in achieving the goal of accelerated recovery. Application of lime to a watershed provides the advantage of increasing Ca availability and reducing or preventing mobilization of toxic Al, an outcome that is beneficial to both terrestrial and aquatic ecosystems. However, the goal should not be complete neutralization of soil acidity, which is naturally produced. Liming of naturally acidic areas such as wetlands should also be avoided to prevent damage to indigenous species that rely on an acidic environment. Published by Elsevier B.V.
NaK (DX) stimulated emission in the visible
NASA Astrophysics Data System (ADS)
Dinev, S. G.; Hadjichristov, G. B.
1990-12-01
Using optical pumping in the blue 450-470 nm and green 510.6 nm, we have observed molecular laser action in the D→X electronic transition of the heteronuclear NaK molecule. Pumping, emission and competing mechanisms are discussed together with the energy balance of the system.
Code of Federal Regulations, 2010 CFR
2010-01-01
... STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE STANDARDS FOR BARRELS BARRELS AND OTHER CONTAINERS FOR LIME... container not in barrel form containing therein a net weight of lime of less than 180 pounds. (b) The term... matter upon the surface of a barrel or other container of lime subject to the provisions of this act, or...
76 FR 82295 - Central Power & Lime LLC; Notice of Filing
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-30
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket Nos. EL12-18-000; QF82-207-007] Central Power & Lime LLC; Notice of Filing December 23, 2011. Take notice that on December 22, 2011, Central Power & Lime LLC, pursuant to sections 18 CFR 292.205(c) and 385.207 of the Federal Energy...
40 CFR 63.7081 - Am I subject to this subpart?
Code of Federal Regulations, 2010 CFR
2010-07-01
...) National Emission Standards for Hazardous Air Pollutants for Lime Manufacturing Plants What This Subpart... a lime manufacturing plant (LMP) that is a major source, or that is located at, or is part of, a... manufacture of lime product (calcium oxide, calcium oxide with magnesium oxide, or dead burned dolomite) by...
Lime-amended growing medium causes seedling growth distortions
R. Kasten Dumroese; Gale Thompson; David L. Wenny
1990-01-01
Although a commercial growing medium with incorporated agricultural lime had been successfully used for years, it caused growth distortion of coniferous and deciduous seedlings during 1988. Seedlings grown in the amended medium were stunted and chlorotic, often with disfigured needles and multiple tops. Seedlings grown in the same medium without incorporated lime grew...
Code of Federal Regulations, 2011 CFR
2011-07-01
... there any special provision regarding my individual filter turbidity monitoring? 141.564 Section 141.564... People Individual Filter Turbidity Requirements § 141.564 My system practices lime softening—is there any special provision regarding my individual filter turbidity monitoring? If your system utilizes lime...
Code of Federal Regulations, 2014 CFR
2014-07-01
... there any special provision regarding my individual filter turbidity monitoring? 141.564 Section 141.564... People Individual Filter Turbidity Requirements § 141.564 My system practices lime softening—is there any special provision regarding my individual filter turbidity monitoring? If your system utilizes lime...
Code of Federal Regulations, 2010 CFR
2010-07-01
... there any special provision regarding my individual filter turbidity monitoring? 141.564 Section 141.564... People Individual Filter Turbidity Requirements § 141.564 My system practices lime softening—is there any special provision regarding my individual filter turbidity monitoring? If your system utilizes lime...
Code of Federal Regulations, 2013 CFR
2013-07-01
... there any special provision regarding my individual filter turbidity monitoring? 141.564 Section 141.564... People Individual Filter Turbidity Requirements § 141.564 My system practices lime softening—is there any special provision regarding my individual filter turbidity monitoring? If your system utilizes lime...
Code of Federal Regulations, 2012 CFR
2012-07-01
... there any special provision regarding my individual filter turbidity monitoring? 141.564 Section 141.564... People Individual Filter Turbidity Requirements § 141.564 My system practices lime softening—is there any special provision regarding my individual filter turbidity monitoring? If your system utilizes lime...
Substrate pH and butterfly bush response to dolomitic lime or steel slag amendment
USDA-ARS?s Scientific Manuscript database
Steel slag is a fertilizer amendment with a high concentration of calcium oxide, and thus capable of raising substrate pH similar to dolomitic lime. Steel slag, however, contains higher concentrations of some nutrients, such as iron, manganese, and silicon, compared to dolomitic lime. The objectiv...
Experimental investigation and constitutive model for lime mudstone.
Wang, Junbao; Liu, Xinrong; Zhao, Baoyun; Song, Zhanping; Lai, Jinxing
2016-01-01
In order to investigate the mechanical properties of lime mudstone, conventional triaxial compression tests under different confining pressures (0, 5, 15 and 20 MPa) are performed on lime mudstone samples. The test results show that, from the overall perspective of variation law, the axial peak stress, axial peak strain and elastic modulus of lime mudstone tend to gradually increase with increasing confining pressure. In the range of tested confining pressure, the variations in axial peak stress and elastic modulus with confining pressure can be described with linear functions; while the variation in axial peak strain with confining pressure can be reflected with a power function. To describe the axial stress-strain behavior in failure process of lime mudstone, a new constitutive model is proposed, with the model characteristics analyzed and the parameter determination method put forward. Compared with Wang' model, only one parameter n is added to the new model. The comparison of predicted curves from the model and test data indicates that the new model can preferably simulate the strain softening property of lime mudstone and the axial stress-strain response in rock failure process.
Wong, Jonathan W-C; Fung, Shun On; Selvam, Ammaiyappan
2009-07-01
To evaluate the use of coal fly ash (CFA) on the decomposition efficiency of food waste, synthetic food waste was mixed with lime at 1.5% and 3% (equivalent to 0.94% and 1.88% CaCO(3), respectively), CFA at 5%, 10% and 15% with lime so as to achieve CaCO(3) equivalent of 1.88% and composted for 42 days in a thermophilic 20 l composter with two replicates each. Alkaline materials at 1.88% CaCO(3) equivalent successfully buffered the pH during the composting and enhanced the decomposition efficiency. When these buffering was achieved with CFA+lime, the composting period could be shortened to approximately 28 days compared with approximately 42 days in 3% lime. Organic decomposition in terms of CO(2) loss, carbon turnover and nitrogen transformation were significantly higher for treatments with 1.88% CaCO(3) equivalent. Nutrient transformations and compost maturity parameters indicated that addition of CFA (5-10%) with lime at 1.88% CaCO(3) equivalent enhances the decomposition efficiency and shortens the composting period by 35%.
Jung, Hyunchul; Chung, Wonkeun; Lee, Chang Hun; Kim, Sung Hyun
2012-07-01
White light-emitting diodes (LEDs) were fabricated using GaN-based 380-nm UV LEDs precoated with the composite of blue-emitting polymer (poly[(9,9-dihexylfluorenyl-2,7-diyl)-alt-co-(2-methoxy-5-{2-ethylhexyloxy)-1 ,4-phenylene)]), yellow green-emitting polymer (poly[(9,9-dioctylfluorenyl-2,7-diyl)-co-(1,4-benzo-{2,1',3}-thiadiazole)]), and 605-nm red-emitting quantum dots (QDs). CdSe cores were obtained by solvothermal route using CdO, Se precursors and ZnS shells were synthesized by using diethylzinc, and hexamethyldisilathiane precursors. The optical properties of CdSe/ZnS QDs were characterized by UV-visible and photoluminescence (PL) spectra. The structural data and composition of the QDs were transmission electron microscopy (TEM), and EDX technique. The quantum yield and size of the QDs were 58.7% and about 6.7 nm, respectively. Three-band white light was generated by hybridizing blue (430 nm), green (535 nm), and red (605 nm) emission. The color-rendering index (CRI) of the device was extremely improved by introducing the QDs. The CIE-1931 chromaticity coordinate, color temperature, and CRI of a white LED at 20 mA were (0.379, 0.368), 3969 K, and 90, respectively.
Growth Chambers on the International Space Station for Large Plants
NASA Technical Reports Server (NTRS)
Massa, G. D.; Wheeler, R. M.; Morrow, R. C.; Levine, H. G.
2016-01-01
The International Space Station (ISS) now has platforms for conducting research on horticultural plant species under LED lighting, and those capabilities continue to expand. The 'Veggie' vegetable production system was deployed to the ISS as an applied research platform for food production in space. Veggie is capable of growing a wide array of horticultural crops. It was designed for low power usage, low launch mass and stowage volume, and minimal crew time requirements. The Veggie flight hardware consists of a light cap containing red (630 nm), blue, (455 nm) and green (530 nm) LEDs. Interfacing with the light cap is an extendable bellows/baseplate for enclosing the plant canopy. A second large plant growth chamber, the Advanced Plant Habitat (APH), is will fly to the ISS in 2017. APH will be a fully controllable environment for high-quality plant physiological research. APH will control light (quality, level, and timing), temperature, CO2, relative humidity, and irrigation, while scrubbing any cabin or plant-derived ethylene and other volatile organic compounds. Additional capabilities include sensing of leaf temperature and root zone moisture, root zone temperature, and oxygen concentration. The light cap will have red (630 nm), blue (450 nm), green (525 nm), far red (730 nm) and broad spectrum white LEDs (4100K). There will be several internal cameras (visible and IR) to monitor and record plant growth and operations. Veggie and APH are available for research proposals.
NASA Astrophysics Data System (ADS)
Gillespie, Jonathan B.; Maclean, Michelle; Wilson, Mark P.; Given, Martin J.; MacGregor, Scott J.
2017-03-01
This study details the design, build and testing of a prototype antimicrobial blended white light unit containing pulsed red, yellow, green and 405nm LEDs. With a push for alternative methods of disinfection, optical methods have become a topic of interest. Ultra-violet (UV) light is widely known for its antimicrobial properties however; 405nm light has demonstrated significant antimicrobial properties against many common hospital acquired pathogens. In this study, a pulsed, blended, white-light prototype with a high content of 405 nm antimicrobial light, was designed, built and tested. Antimicrobial efficacy testing of the prototype was conducted using Staphylococcus aureus and Pseudomonas. aeruginosa, two bacteria which are common causes of hospital acquired infections. These were exposure to 3 different light outputs from the prototype and the surviving bacteria enumerated. Results showed that the mixed light output provided a much better CRI and light output under which to work. Also, the light output containing 405 nm light provided an antimicrobial effect, with decontamination of 103 CFUml-1 populations of both bacterial species. The other light content (red, yellow, green) had no beneficial or adverse effects on the antimicrobial properties of the 405nm light. The results suggest that with further development, it could be possible to produce an antimicrobial blended white light containing pulsed 405nm light that could supplement or even replace standard white lighting in certain environments.
Grimaldi, Maira Prearo; Marques, Marina Paganini; Laluce, Cecília; Cilli, Eduardo Maffud; Sponchiado, Sandra Regina Pombeiro
2015-01-01
Ethanol production from sugarcane bagasse requires a pretreatment step to disrupt the cellulose-hemicellulose-lignin complex and to increase biomass digestibility, thus allowing the obtaining of high yields of fermentable sugars for the subsequent fermentation. Hydrothermal and lime pretreatments have emerged as effective methods in preparing the lignocellulosic biomass for bioconversion. These pretreatments are advantageous because they can be performed under mild temperature and pressure conditions, resulting in less sugar degradation compared with other pretreatments, and also are cost-effective and environmentally sustainable. In this study, we evaluated the effect of these pretreatments on the efficiency of enzymatic hydrolysis of raw sugarcane bagasse obtained directly from mill without prior screening. In addition, we evaluated the structure and composition modifications of this bagasse after lime and hydrothermal pretreatments. The highest cellulose hydrolysis rate (70 % digestion) was obtained for raw sugarcane bagasse pretreated with lime [0.1 g Ca(OH)2/g raw] for 60 min at 120 °C compared with hydrothermally pretreated bagasse (21 % digestion) under the same time and temperature conditions. Chemical composition analyses showed that the lime pretreatment of bagasse promoted high solubilization of lignin (30 %) and hemicellulose (5 %) accompanied by a cellulose accumulation (11 %). Analysis of pretreated bagasse structure revealed that lime pretreatment caused considerable damage to the bagasse fibers, including rupture of the cell wall, exposing the cellulose-rich areas to enzymatic action. We showed that lime pretreatment is effective in improving enzymatic digestibility of raw sugarcane bagasse, even at low lime loading and over a short pretreatment period. It was also demonstrated that this pretreatment caused alterations in the structure and composition of raw bagasse, which had a pronounced effect on the enzymes accessibility to the substrate, resulting in an increase of cellulose hydrolysis rate. These results indicate that the use of raw sugarcane bagasse (without prior screening) pretreated with lime (cheaper and environmentally friendly reagent) may represent a cost reduction in the cellulosic ethanol production.
Mitigation of acidified salmon rivers - effects of liming on young brown trout Salmo trutta.
Hesthagen, T; Larsen, B M; Bolstad, G; Fiske, P; Jonsson, B
2017-11-01
In southern Norway, 22 acidified rivers supporting anadromous salmonids were mitigated with lime to improve water quality and restore fish populations. In 13 of these rivers, effects on Salmo trutta and Salmo salar densities were monitored over 10-12 years, grouped into age 0 and age ≥ 1 year fish. These rivers had a mean annual discharge of between 4·9 and 85·5 m 3 s -1 , and six of them were regulated for hydro-power production. Salmo salar were lost in six of these rivers prior to liming, and highly reduced in the remaining seven rivers. Post-liming, S. salar became re-established in all six rivers with lost populations, and recovered in the seven other rivers. Salmo trutta occurred in all 13 study rivers prior to liming. Despite the improved water quality, both age 0 and age ≥ 1 year S. trutta densities decreased as S. salar density increased, with an average reduction of >50% after 10 years of liming. For age 0 year S. trutta this effect was less strong in rivers where S. salar were present prior to liming. In contrast, densities of S. trutta increased in unlimed streams above the anadromous stretches in two of the rivers following improved water quality due to natural recovery. Density increases of both age 0 and age ≥ 1 year S. salar showed a positive effect of river discharge. The results suggest that the decline in S. trutta density after liming is related to interspecific resource competition due to the recovery of S. salar. Thus, improved water quality through liming may not only sustain susceptible species, but can have a negative effect on species that are more tolerant prior to the treatment, such as S. trutta. © 2017 The Fisheries Society of the British Isles.
NASA Astrophysics Data System (ADS)
Ledemi, Yannick; Manzani, Danilo; Ribeiro, Sidney J. L.; Messaddeq, Younes
2011-10-01
Multicolor and white light emissions have been achieved in Yb 3+, Tm 3+ and Ho 3+ triply doped heavy metal oxide glasses upon laser excitation at 980 nm. The red (660 nm), green (547 nm) and blue (478 nm) up conversion emissions of the rare earth (RE) ions triply doped TeO 2-GeO 2-Bi 2O 3-K 2O glass (TGBK) have been investigated as a function of the RE concentration and excitation power of the 980 nm laser diode. The most appropriate combination of RE in the TGBK glass host (1.6 wt% Yb 2O 3, 0.6 wt% Tm 2O 3 and 0.1 wt% Ho 2O 3) has been determined with the purpose to tune the primary colors (RGB) respective emissions and generate white light emission by varying the pump power. The involved infrared to visible up conversion mechanisms mainly consist in a three-photon blue up conversion of Tm 3+ ions and a two-photon green and red up conversions of Ho 3+ ions. The resulting multicolor emissions have been described according to the CIE-1931 standards.
Long, Dan-Dan; Zhang, Qing-Xia; Wang, Yu; Zhang, Fan; Wang, Yan-Fei; Zhou, Xin; Qi, Xiao-Hua; Zhang, Heng; Yan, Jing-Hui; Zou, Ming-Qiang
2013-08-01
NaYF4 : Yb3+, Er3+, Tm3+ nanoparticles were prepared by microemulsion-hydrothermal method. Crystal phase, morphology and structure of the samples were characterized by X-ray diffraction (XRD) and scanning electron microscopy (SEM). The luminescence properties were studied by up-conversional fluorescence spectroscopy. The XRD patterns of as-prepared samples were in agreement with the PDF # 77-2042 of cubic NaYF4. SEM images of the particles showed that the samples were cotton-like spherical in shape and which were assembled by smaller nano-particles. The average size was 120 nm, while the shape was regular and the particle size was homogeneous. Under the excitation of 980 nm, the as-prepared particles could emit blue (438 and 486 nm), green (523 and 539 nm) and red (650 nm) light simultaneously. It can be seen from the color coordinates figure (CIE) that when doping concentration ratio of Tm3+ and E3+ increased from 0 to 2, the whole emitting light color of samples movedto green region. While the ratio was 1 : 1, pseudo white light was obtained. As the ratio changed from 2 to 7, the luminous color was moved to red region.
Ultra-small (r<2 nm), stable (>1 year) copper oxide quantum dots with wide band gap
NASA Astrophysics Data System (ADS)
Talluri, Bhusankar; Prasad, Edamana; Thomas, Tiju
2018-01-01
Practical use of quantum dots (QDs) will rely on processes that enable (i) monodispersity, (ii) scalability, (iii) green approaches to manufacturing them. We demonstrate, a green, rapid, soft chemical, and industrial viable approach for obtaining quasi-spherical, ultra-small (size ∼2.4 ± 0.5 nm), stable (>1 yr), and monodispersed copper oxide QDs (r < 2 nm) based on digestive ripening (DR). These QDs show wide band gap (Eg∼5.3 eV), this substantial band gap increase is currently inexplicable using Brus' equation, and is likely due to surface chemistry of these strongly confined QDs. Capping with triethanolamine (TEA) results in reduction in the average particle diameter from 9 ± 4 nm to 2.4 ± 0.5 nm and an increase of zeta potential (ξ) from +12 ± 2 mV to +31 ± 2 mV. XPS and electron diffraction studies indicate that capped copper oxide QDs which have TEA chemisorbed on its surface are expected to partly stabilize Cu (I) resulting in mixed phase in these QDs. This result is likely to inform efforts that involve achieving monodisperse microstructures and nano-structures, of oxides with a tendency for multivalency.
NASA Astrophysics Data System (ADS)
Yang, Victor X.; Yeow, Jenny; Lilge, Lothar D.; Kost, James; Mang, Thomas S.; Wilson, Brian C.
1999-07-01
A system for in vivo, fluorescence image-guided, non-contact point fluorescence spectroscopy is presented. A 442 nm HeCd laser is used as the fluorescence excitation source. An intensified CCD serves as the detector for both imaging and spectroscopy, on which two regions of 300 X 300 pixels were used for green (500 +/- 18 nm) and red (630 +/- 18 nm) imaging channels, and a strip of 600 X 120 pixels are used for emission spectroscopy (450 - 750 nm). At a working distance of 40 mm, the system has a spatial resolution of 0.16 mm and a spectral resolution of 5 nm. System performance is demonstrated in a carcinogenesis model in hamsters, where tumors were induced by painting DMBA in the cheek pouch. Autofluorescence and Photofrin-induced fluorescence measurements were performed every 2 weeks during the 18 weeks of tumor induction. Punch biopsies on selected animals were taken for histological staging. The results show that autofluorescence fluorescence can distinguish dysplasia from normal mucosal tissue model, utilizing the peak red intensity (or the red-to-green intensity ratio). Photofrin-induced fluorescence was superior to autofluorescence for differentiating high grade dysplasia from invasive cancer.
NASA Astrophysics Data System (ADS)
Reddy Prasad, V.; Damodaraiah, S.; Ratnakaram, Y. C.
2018-04-01
Ho3+ doped zinc fluorophosphate (ZFP) glasses with molar chemical compositions, (60-x) NH4H2PO4+20ZnO+10BaF2+10NaF+xHo2O3 (where x = 0.1, 0.3, 0.5, 1.0 and 1.5 mol%) were prepared by melt quenching technique. These glasses were characterized through physical, structural, optical, excitation, luminescence and decay curve analysis. From the absorption spectra, spectral intensities (fexp and fcal), Judd-Ofelt intensity parameters (Ω2, Ω4 and Ω6), radiative transition probabilities (AT), radiative lifetimes (τR) and branching ratios (βR) were evaluated for all Ho3+ doped ZFP glass matrices. From the photoluminescence spectra, peak stimulated emission cross-sections (σP) were calculated for all Ho3+ doped ZFP glasses. The Ho3+ doped ZFP glasses show strong green emission at 545 nm and red emission at 656 nm under excitation, 450 nm. The measured lifetimes (τmeas) of (5S2)5F4 level of Ho3+ doped ZFP glasses were obtained from decay profiles. The CIE color coordinates of Ho3+ doped ZFP glasses were calculated from emission spectra and 1.0 mol% of Ho3+ doped ZFP glass matrix gives green emission. Hence, these results confirm that the Ho3+ doped ZFP glasses could be considered as a promising candidate for visible green laser applications.
Near-infrared fluorescence imaging with a mobile phone (Conference Presentation)
NASA Astrophysics Data System (ADS)
Ghassemi, Pejhman; Wang, Bohan; Wang, Jianting; Wang, Quanzeng; Chen, Yu; Pfefer, T. Joshua
2017-03-01
Mobile phone cameras employ sensors with near-infrared (NIR) sensitivity, yet this capability has not been exploited for biomedical purposes. Removing the IR-blocking filter from a phone-based camera opens the door to a wide range of techniques and applications for inexpensive, point-of-care biophotonic imaging and sensing. This study provides proof of principle for one of these modalities - phone-based NIR fluorescence imaging. An imaging system was assembled using a 780 nm light source along with excitation and emission filters with 800 nm and 825 nm cut-off wavelengths, respectively. Indocyanine green (ICG) was used as an NIR fluorescence contrast agent in an ex vivo rodent model, a resolution test target and a 3D-printed, tissue-simulating vascular phantom. Raw and processed images for red, green and blue pixel channels were analyzed for quantitative evaluation of fundamental performance characteristics including spectral sensitivity, detection linearity and spatial resolution. Mobile phone results were compared with a scientific CCD. The spatial resolution of CCD system was consistently superior to the phone, and green phone camera pixels showed better resolution than blue or green channels. The CCD exhibited similar sensitivity as processed red and blue pixels channels, yet a greater degree of detection linearity. Raw phone pixel data showed lower sensitivity but greater linearity than processed data. Overall, both qualitative and quantitative results provided strong evidence of the potential of phone-based NIR imaging, which may lead to a wide range of applications from cancer detection to glucose sensing.
Taghizadeh, Mohsen; Memarzadeh, Mohammad Reza; Abedi, Fatemeh; Sharifi, Nasrin; Karamali, Fatemeh; Fakhrieh Kashan, Zohreh; Asemi, Zatollah
2016-08-01
Limited data are available regarding the effects of combined administration of Cumin cyminum L. and lime on weight loss and metabolic profiles among subjects with overweight subjects. The current study aimed to assess the effects of combined administration of Cumin cyminum L. and lime on weight loss and metabolic profiles among subjects with overweight. This randomized double-blind placebo-controlled clinical trial was conducted on 72 subjects with overweight, aged 18 - 50 years old. Participants were randomly divided into three groups: Group A received high-dose Cumin cyminum L. and lime capsules (75 mg each, n = 24), group B low-dose Cumin cyminum L. and lime capsules (25 mg each, n = 24) and group C placebos (n = 24) twice daily for eight weeks. After eight weeks of intervention, compared with low-dose C. cyminum L. plus lime and placebo, taking high-dose C. cyminum L. plus lime resulted in significant weight loss (in the high-dose group: -2.1 ± 1.7 vs. in the low-dose group: -1.2 ± 1.5 and in the placebo group: + 0.2 ± 1.3 kg, respectively; P < 0.001) and body mass index (-0.8 ± 0.6 vs. -0.5 ± 0.5 and +0.1 ± 0.5 kg/m 2 , respectively; P < 0.001). In addition, administration of high-dose C. cyminum L. plus lime compared with low-dose C. cyminum L. plus lime and placebo, led to a significant reduction in fasting plasma glucose (FPG) (P < 0.001) and a significant rise in quantitative insulin sensitivity check index (QUICKI) (+ 0.02 ± 0.02 vs. + 0.01 ± 0.02 and 0.01 ± 0.01, respectively; P = 0.01). Moreover, a significant decrease in serum triglycerides (-14.1 ± 56.2 vs. +13.9 ± 36.8 and + 10.6 ± 25.1 mg/dL; respectively; P = 0.03), total-cholesterol (-18.4 ± 28.6 vs. +8.6 ± 28.5 and -1.0 ± 24.8 mg/dL; respectively; P = 0.004) and low density lipoproteins- (LDL)-cholesterol levels (-11.8 ± 20.7 vs. +6.5 ± 23.2 and -2.9 ± 20.4 mg/dL, respectively; P = 0.01) was observed following the consumption of high-dose C. cyminum L. plus lime compared with low-dose C. cyminum L. plus lime and placebo. Results of the current study indicated that taking high-dose C. cyminum L. plus lime for eight weeks among subjects with overweight had beneficial effects on weight, BMI, FPG, QUICKI, triglycerides, total-cholesterol and LDL-cholesterol levels.
Taghizadeh, Mohsen; Memarzadeh, Mohammad Reza; Abedi, Fatemeh; Sharifi, Nasrin; Karamali, Fatemeh; Fakhrieh Kashan, Zohreh; Asemi, Zatollah
2016-01-01
Background Limited data are available regarding the effects of combined administration of Cumin cyminum L. and lime on weight loss and metabolic profiles among subjects with overweight subjects. Objectives The current study aimed to assess the effects of combined administration of Cumin cyminum L. and lime on weight loss and metabolic profiles among subjects with overweight. Patients and Methods This randomized double-blind placebo-controlled clinical trial was conducted on 72 subjects with overweight, aged 18 - 50 years old. Participants were randomly divided into three groups: Group A received high-dose Cumin cyminum L. and lime capsules (75 mg each, n = 24), group B low-dose Cumin cyminum L. and lime capsules (25 mg each, n = 24) and group C placebos (n = 24) twice daily for eight weeks. Results After eight weeks of intervention, compared with low-dose C. cyminum L. plus lime and placebo, taking high-dose C. cyminum L. plus lime resulted in significant weight loss (in the high-dose group: -2.1 ± 1.7 vs. in the low-dose group: -1.2 ± 1.5 and in the placebo group: + 0.2 ± 1.3 kg, respectively; P < 0.001) and body mass index (-0.8 ± 0.6 vs. -0.5 ± 0.5 and +0.1 ± 0.5 kg/m2, respectively; P < 0.001). In addition, administration of high-dose C. cyminum L. plus lime compared with low-dose C. cyminum L. plus lime and placebo, led to a significant reduction in fasting plasma glucose (FPG) (P < 0.001) and a significant rise in quantitative insulin sensitivity check index (QUICKI) (+ 0.02 ± 0.02 vs. + 0.01 ± 0.02 and 0.01 ± 0.01, respectively; P = 0.01). Moreover, a significant decrease in serum triglycerides (-14.1 ± 56.2 vs. +13.9 ± 36.8 and + 10.6 ± 25.1 mg/dL; respectively; P = 0.03), total-cholesterol (-18.4 ± 28.6 vs. +8.6 ± 28.5 and -1.0 ± 24.8 mg/dL; respectively; P = 0.004) and low density lipoproteins- (LDL)-cholesterol levels (-11.8 ± 20.7 vs. +6.5 ± 23.2 and -2.9 ± 20.4 mg/dL, respectively; P = 0.01) was observed following the consumption of high-dose C. cyminum L. plus lime compared with low-dose C. cyminum L. plus lime and placebo. Conclusions Results of the current study indicated that taking high-dose C. cyminum L. plus lime for eight weeks among subjects with overweight had beneficial effects on weight, BMI, FPG, QUICKI, triglycerides, total-cholesterol and LDL-cholesterol levels. PMID:27781121
Innate colour preference, individual learning and memory retention in the ant Camponotus blandus.
Yilmaz, Ayse; Dyer, Adrian G; Rössler, Wolfgang; Spaethe, Johannes
2017-09-15
Ants are a well-characterized insect model for the study of visual learning and orientation, but the extent to which colour vision is involved in these tasks remains unknown. We investigated the colour preference, learning and memory retention of Camponotus blandus foragers under controlled laboratory conditions. Our results show that C. blandus foragers exhibit a strong innate preference for ultraviolet (UV, 365 nm) over blue (450 nm) and green (528 nm) wavelengths. The ants can learn to discriminate 365 nm from either 528 nm or 450 nm, independent of intensity changes. However, they fail to discriminate between 450 nm and 528 nm. Modelling of putative colour spaces involving different numbers of photoreceptor types revealed that colour discrimination performance of individual ants is best explained by dichromacy, comprising a short-wavelength (UV) receptor with peak sensitivity at about 360 nm, and a long-wavelength receptor with peak sensitivity between 470 nm and 560 nm. Foragers trained to discriminate blue or green from UV light are able to retain the learned colour information in an early mid-term (e-MTM), late mid-term (l-MTM), early long-term (e-LTM) and late long-term (l-LTM) memory from where it can be retrieved after 1 h, 12 h, 24 h, 3 days and 7 days after training, indicating that colour learning may induce different memory phases in ants. Overall, our results show that ants can use chromatic information in a way that should promote efficient foraging in complex natural environments. © 2017. Published by The Company of Biologists Ltd.
Cone pigments in human deutan colour vision defects.
Alpern, M; Wake, T
1977-01-01
1. The Nagel anomaloscope, neutral points and dichromatic matches to a spectral green light identified a population of seventy red-green dichromats. 2. The anomaloscope settings allow the calculation of the relative action spectrum of the match at the wave-length of the red (645 nm) and green (535 nm) primaries. The distribution of this ratio is bimodal; there are two clusters with a gap of about 0-75 long units between. Among the thirty-eight deuteranopes there are wide differences in anomaloscope matches; similar differences appear among the thirty-two protanopes. 3. Retinal densitometry of the foveas of fifteen of the deuteranopes is compared and contrasted with measurements on trichromats. In the former, only one photolabile pigment is found in the red-green region of the spectrum; normals always have two. The view of Rushton (1965a) that deuteranopes have erythrolabe but no measurable chlorolabe is confirmed for each member of this group. 4. Simple deuteranomalous show two red-green cone pigments. The difference spectra of extreme deuteranomalous are very similar to those found in deuteranopia. 5. Individual differnce in kinetics (photosensitivity, time constant of regeneration) and in the density and lambdamax of the difference spectrum of erythrolabe in deuteranopia are appreciable; the reasons for these differences are not clear. PMID:301185
Luminescent properties of Tb3+- doped TeO2-WO3-GeO2 glasses for green laser applications
NASA Astrophysics Data System (ADS)
Subrahmanyam, T.; Rama Gopal, K.; Padma Suvarna, R.; Jamalaiah, B. C.; Vijaya Kumar, M. V.
2018-06-01
Different concentrations of Tb3+ -doped oxyfluoro tellurite (TWGTb) glasses were prepared by conventional melt quenching technique and characterized for green laser applications. The Judd-Ofelt theory was applied to evaluate various spectroscopic and radiative parameters. The TWGTb glasses exhibit 5D3 → 7F5-3 and 5D4 → 7F6-0 transitions when excited at 316 nm radiation. The variation of intensity of 5D4 → 7F5 (Green) and 5D3 → 7F4 (Blue) transitions and the green to blue (IG/IB) intensity ratios were studied as a function of Tb3+ ions concentration. The laser characteristic parameters such as effective bandwidth (Δλeff), stimulated emission cross-section (σe), gain bandwidth (σe × Δλeff) and optical gain (σe × τR) were determined using the three phenomenological Judd-Ofelt intensity parameters. The fluorescence decay profiles of 5D4 metastable level exhibit single-exponential nature for all the samples. Based on the experimental results we suggest that the 1.0 mol% of Tb3+ -doped TWGTb glass could be a suitable laser host material to emit intense green luminescence at 545 nm.
Jiang, Shengxiang; Feng, Yulong; Chen, Zhizhong; Zhang, Lisheng; Jiang, Xianzhe; Jiao, Qianqian; Li, Junze; Chen, Yifan; Li, Dongsan; Liu, Lijian; Yu, Tongjun; Shen, Bo; Zhang, Guoyi
2016-01-01
An anodic aluminum oxide (AAO) patterned sapphire substrate, with the lattice constant of 520 ± 40 nm, pore dimension of 375 ± 50 nm, and height of 450 ± 25 nm was firstly used as a nanoimprint lithography (NIL) stamp and imprinted onto the surface of the green light-emitting diode (LED). A significant light extraction efficiency (LEE) was improved by 116% in comparison to that of the planar LED. A uniform broad protrusion in the central area and some sharp lobes were also obtained in the angular resolution photoluminescence (ARPL) for the AAO patterned LED. The mechanism of the enhancement was correlated to the fluctuations of the lattice constant and domain orientation of the AAO-pattern, which enabled the extraction of more guided modes from the LED device. PMID:26902178
NASA Astrophysics Data System (ADS)
Saghafi, S.; Penjweini, R.; Becker, K.; Kratky, K. W.; Dodt, H.-U.
2010-09-01
When moulds are illuminated by visible electromagnetic-EM radiations, several effects on nucleus materials and nucleotides can be detected. These effects have a significant influence on mould generation or destruction. This paper presents the effects and implications of a red diode laser beam (660 nm), a second-harmonics of a Nd:YAG laser emitting green beam (532 nm), or the combination of both, on the eradication of Pistachio mould fungus. Incident doses (ID) of both beams are kept identical throughout the experiment. The absorption spectrums of irradiated mouldy samples and the bright-greenish-yellow-fluorescence (BGYF) of fungus occurring in mould texture due to electronic excitation are investigated. We found that a combination of a green and a red laser beam with an ID of 0.5 J/cm2 provides the optimal effects on Pistachio mould fungus eradication.
Effects of hydrated lime on radionuclides stabilization of Hanford tank residual waste.
Wang, Guohui; Um, Wooyong; Cantrell, Kirk J; Snyder, Michelle M V; Bowden, Mark E; Triplett, Mark B; Buck, Edgar C
2017-10-01
Chemical stabilization of tank residual waste is part of a Hanford Site tank closure strategy to reduce overall risk levels to human health and the environment. In this study, a set of column leaching experiments using tank C-104 residual waste were conducted to evaluate the leachability of uranium (U) and technetium (Tc) where grout and hydrated lime were applied as chemical stabilizing agents. The experiments were designed to simulate future scenarios where meteoric water infiltrates through the vadose zones into the interior of the tank filled with layers of grout or hydrated lime, and then contacts the residual waste. Effluent concentrations of U and Tc were monitored and compared among three different packing columns (waste only, waste + grout, and waste + grout + hydrated lime). Geochemical modeling of the effluent compositions was conducted to determine saturation indices of uranium solid phases that could control the solubility of uranium. The results indicate that addition of hydrated lime strongly stabilized the uranium through transforming uranium to a highly insoluble calcium uranate (CaUO 4 ) or similar phase, whereas no significant stabilization effect of grout or hydrated lime was observed on Tc leachability. The result implies that hydrated lime could be a great candidate for stabilizing Hanford tank residual wastes where uranium is one of the main concerns. Published by Elsevier Ltd.
Huang, Gaoxiang; Ding, Changfeng; Guo, Fuyu; Li, Xiaogang; Zhang, Taolin; Wang, Xingxiang
2017-08-01
A pot experiment was conducted to investigate the effects of selenium (Se) and hydrated lime (Lime), applied alone or simultaneously (Se+Lime), on growth and cadmium (Cd) uptake and translocation in rice seedlings grown in an acid soil with three levels of Cd (slight, mild, and moderate contamination). In the soil with 0.41 mg kg -1 Cd (slight Cd contamination), Se addition alone significantly decreased Cd accumulation in the root and shoot by 35.3 and 40.1%, respectively, but this tendency weakened when Cd level in the soil increased. However, Se+Lime treatment effectively reduced Cd accumulation in rice seedlings in the soil with higher Cd levels. The results also showed that Se application alone strongly increased Cd concentration in the iron plaque under slight Cd contamination, which was suggested as the main reason underlying the inhibition of Cd accumulation in rice seedlings. Se+Lime treatment also increased the ability of the iron plaques to restrict Cd uptake by rice seedlings across all Cd levels and dramatically decreased the available Cd concentration in the soil. These results suggest that Se application alone would be useful in the soil with low levels of Cd, and the effect would be enhanced when Se application is combined with hydrated lime at higher Cd levels.
75 FR 32455 - Combined Notice of Filings #1
Federal Register 2010, 2011, 2012, 2013, 2014
2010-06-08
... Funding IV, L.L.C., Utility Contract Funding, L.L.C., Vineland Energy LLC, Central Power & Lime LLC, Cedar... Brakes I, L.L.C., Utility Contract Funding, L.L.C., Vineland Energy LLC, Central Power & Lime LLC, Cedar..., L.L.C., Vineland Energy LLC, Central Power & Lime LLC, Cedar Brakes II, L.L.C., J.P. Morgan...
21 CFR 184.1210 - Calcium oxide.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Calcium oxide. 184.1210 Section 184.1210 Food and... Substances Affirmed as GRAS § 184.1210 Calcium oxide. (a) Calcium oxide (CaO, CAS Reg. No. 1305-78-8) is also known as lime, quick lime, burnt lime, or calx. It is produced from calcium carbonate, limestone, or...
21 CFR 184.1210 - Calcium oxide.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Calcium oxide. 184.1210 Section 184.1210 Food and... Substances Affirmed as GRAS § 184.1210 Calcium oxide. (a) Calcium oxide (CaO, CAS Reg. No. 1305-78-8) is also known as lime, quick lime, burnt lime, or calx. It is produced from calcium carbonate, limestone, or...
Predicting Calcite (CaCO3) Requirements of Sphagnum Peat Moss from pH Titration Curves
USDA-ARS?s Scientific Manuscript database
Liming materials are required to neutralize acidity in peat moss to make it a suitable substrate for growing container crops. A series of time-consuming incubations of peat:lime mixtures are typically used to determine the liming rate to achieve a desired pH. Our objective was to evaluate the util...
Code of Federal Regulations, 2014 CFR
2014-07-01
... there any special provision regarding my combined filter effluent? 141.553 Section 141.553 Protection of... Filter Effluent Requirements § 141.553 My system practices lime softening—is there any special provision regarding my combined filter effluent? If your system practices lime softening, you may acidify...
Code of Federal Regulations, 2013 CFR
2013-07-01
... there any special provision regarding my combined filter effluent? 141.553 Section 141.553 Protection of... Filter Effluent Requirements § 141.553 My system practices lime softening—is there any special provision regarding my combined filter effluent? If your system practices lime softening, you may acidify...
Code of Federal Regulations, 2012 CFR
2012-07-01
... there any special provision regarding my combined filter effluent? 141.553 Section 141.553 Protection of... Filter Effluent Requirements § 141.553 My system practices lime softening—is there any special provision regarding my combined filter effluent? If your system practices lime softening, you may acidify...
Code of Federal Regulations, 2010 CFR
2010-07-01
... there any special provision regarding my combined filter effluent? 141.553 Section 141.553 Protection of... Filter Effluent Requirements § 141.553 My system practices lime softening—is there any special provision regarding my combined filter effluent? If your system practices lime softening, you may acidify...
Code of Federal Regulations, 2011 CFR
2011-07-01
... there any special provision regarding my combined filter effluent? 141.553 Section 141.553 Protection of... Filter Effluent Requirements § 141.553 My system practices lime softening—is there any special provision regarding my combined filter effluent? If your system practices lime softening, you may acidify...
Rapid Stabilization/Polymerization of Wet Clay Soils; Literature Review
2009-01-15
known as lime, and potassium hydroxide (KOH) were found to increase shear strength, and decrease expansive properties of Diablo clay. The lime...Publication Date: 1991 Purpose of Stabilizer: Control High Swell Potential Stabilizers Tested: Lime, potassium phosphate, potassium chloride...Date: 1988 Purpose of Stabilizer: Stabilizer Stabilizers Tested: Hydroxy-aluminum, hydroxy-aluminum and potassium chloride, hydroxy-aluminum
DOT National Transportation Integrated Search
2001-09-01
This document presents an example of mechanistic design and analysis using a mix design and : testing protocol. More specifically, it addresses the structural properties of lime-treated subgrade, : subbase, and base layers through mechanistic design ...
40 CFR 98.193 - Calculating GHG emissions.
Code of Federal Regulations, 2011 CFR
2011-07-01
.... Calcium oxide and magnesium oxide content must be analyzed monthly for each lime product type that is...). MgOi,n = Magnesium oxide content for lime type i, for month n, determined according to § 98.194(c... type i sold, for month n (metric tons CaO/metric ton lime). MgOLKD,i,n = Magnesium oxide content for...
21 CFR 184.1210 - Calcium oxide.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Calcium oxide. 184.1210 Section 184.1210 Food and....1210 Calcium oxide. (a) Calcium oxide (CaO, CAS Reg. No. 1305-78-8) is also known as lime, quick lime, burnt lime, or calx. It is produced from calcium carbonate, limestone, or oyster shells by calcination...
USDA-ARS?s Scientific Manuscript database
Preliminary analyses by HPLC-MS of methanolic extracts of two sets of orange leaves that are symptomatic of the Greening Disease (HLB) have shown several consistent differences. The main flavonoids in symptomatic and nonsymptomatic leaves were monitored in the HPLC chromatograms at 330 nm, and signi...
Bringing Catalysis with Gold Nanoparticles in Green Solvents to Graduate Level Students
ERIC Educational Resources Information Center
Raghuwanshi, Vikram Singh; Wendt, Robert; O'Neill, Maeve; Ochmann, Miguel; Som, Tirtha; Fenger, Robert; Mohrmann, Marie; Hoell, Armin; Rademann, Klaus
2017-01-01
We demonstrate here a novel laboratory experiment for the synthesis of gold nanoparticles (AuNPs) by using a low energy gold-sputtering method together with a modern, green, and biofriendly deep eutectic solvent (DES). The strategy is straightforward, economical, ecofriendly, rapid, and clean. It yields uniform AuNPs of 5 nm in diameter with high…
In situ measurement of airway surface liquid [K+] using a ratioable K+-sensitive fluorescent dye.
Namkung, Wan; Song, Yuanlin; Mills, Aaron D; Padmawar, Prashant; Finkbeiner, Walter E; Verkman, A S
2009-06-05
The airway surface liquid (ASL) is the thin fluid layer lining airway surface epithelial cells, whose volume and composition are tightly regulated and may be abnormal in cystic fibrosis (CF). We synthesized a two-color fluorescent dextran to measure ASL [K(+)], TAC-Lime-dextran-TMR, consisting of a green-fluorescing triazacryptand K(+) ionophore-Bodipy conjugate, coupled to dextran, together with a red fluorescing tetramethylrhodamine reference chromophore. TAC-Lime-dextran-TMR fluorescence was K(+)-selective, increasing >4-fold with increasing [K(+)] from 0 to 40 mm. In well differentiated human airway epithelial cells, ASL [K(+)] was 20.8 +/- 0.3 mm and decreased by inhibition of the Na(+)/K(+) pump (ouabain), ENaC (amiloride), CF transmembrane conductance regulator (CFTR(inh)-172), or K(+) channels (TEA or XE991). ASL [K(+)] was increased by forskolin but not affected by Na(+)/K(+)/2Cl(-) cotransporter inhibition (bumetanide). Functional and expression studies indicated the involvement of [K(+)] channels KCNQ1, KCNQ3, and KCNQ5 as determinants of ASL [K(+)]. [K(+)] in CF cultures was similar to that in non-CF cultures, suggesting that abnormal ASL [K(+)] is not a factor in CF lung disease. In intact airways, ASL [K(+)] was also well above extracellular [K(+)]: 22 +/- 1 mm in pig trachea ex vivo and 16 +/- 1 mm in mouse trachea in vivo. Our results provide the first noninvasive measurements of [K(+)] in the ASL and indicate the involvement of apical and basolateral membrane ion transporters in maintaining a high ASL [K(+)].
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Jijian; Liu, Ni; Xu, Ling, E-mail: xuling@snnu.edu.cn
Graphical abstract: The doping ions tune the UC luminescence of the T- AgGd(W,Mo){sub 2}O{sub 8}:Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} material. - Highlights: • AgGd(W,Mo){sub 2}O{sub 8}:Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} phosphors show color-tunable blue, green, and red UC emissions. • The samples’ UC emission color can be switched with the concentrations of doped ions. • The blue, green and red UC mechanisms are interpreted reasonably as three- and two- photon process. - Abstract: Tetragonal Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} tri-doped AgGd(W,Mo){sub 2}O{sub 8} phosphors were prepared by the high-temperature solid-state method. When the phosphors were excited at 980 nm, the UC emission ofmore » blue at 475 nm, green at 525 and 550 nm, and red at 656 nm were corresponding to the {sup 1}G{sub 4} → {sup 3}H{sub 6} transition of Tm{sup 3+} ions, the {sup 2}H{sub 11/2},{sup 4}S{sub 3/2} → {sup 4}I{sub 15/2} transitions of Er{sup 3+} ions, and the {sup 4}F{sub 9/2} → {sup 4}I{sub 15/2} transition of Er{sup 3+} ions, respectively. The blue UC emissions originate from a three-photon mechanism, while the green and red ones of Er{sup 3+} from two-photon process. The UC emission color of the Yb{sup 3+}/Er{sup 3+}/Tm{sup 3+} tri-doped AgGdW{sub 2}O{sub 8} samples switched from green to white, and then to red depending on the concentrations of Er{sup 3+} and Tm{sup 3+}. After doping with Mo(VI), tetragonal AgGdW{sub 2}O{sub 8} was transformed into tetragonal AgGdMo{sub 2}O{sub 8}, resulting in a slightly enhanced UC luminescence intensity with the favor of the red emission of Er{sup 3+} ion.« less
Pappa, María Renée; de Palomo, Patricia Palacios; Bressani, Ricardo
2010-06-01
The objective of the study was to obtain information on the chemical composition, functional properties, sensory quality and protein value of tortillas made from the nixtamalization of maize using either lime or wood ashes. The Ca, K, Mg, Fe, and Zn content of lime and wood ashes showed lime to be high in Ca content while wood ash contained more K and about 71% of the Ca content of lime. Both contained relatively high levels of Mg, Fe and Zn, but more so in the wood ashes. The level of reagent for nixtamalization was set at 0.8% of the maize weight. All other processing conditions were kept constant. The pH of the cooking solution was 12.0 for lime and 10.9 for wood ash. The moisture content of maize at 60 min of cooking was 45.8% for both treatments, however after 12 h of soaking, moisture level was 51.0% for the lime treatment and only 46.8% for the ash treatment. Solids (2.4%) in the lime cooking liquor were higher than in the wood ash liquor (1.0%). Chemical composition changes were similar between treatments in masa and tortilla; however, both masa and tortillas absorbed relatively high levels of all minerals including Fe and Zn from the wood ash treatment. The different treatment influenced functional properties particularly hardness and color. Tortilla characteristics were also similar. Protein quality of both alkali cooked products was lower than that of raw corn, more so the product from the wood ash treatment. Although some differences were observed in the sensory studies, human subjects did not dislike the wood ash made tortillas.
Hansen, Jacqueline J.; Warden, Paul S.; Margolin, Aaron B.
2007-01-01
The use of lime to reduce or eliminate pathogen content is a cost-effective treatment currently employed in many Class B biosolids production plants in the United States. A bench scale model of lime stabilization was designed to evaluate the survival of adenovirus type 5, rotavirus Wa, and the male specific bacteriophage, MS2, in various matrices. Each virus was initially evaluated independently in a reverse osmosis treated water matrix limed with an aqueous solution of calcium hydroxide for 24-hr at 22 ± 5°C. In all R/O water trials, adenovirus type 5, rotavirus Wa and MS2 were below detectable levels (<100.5 TCID50/mL and <1 PFU/mL respectively) following 0.1-hr of liming. Adenovirus type 5, rotavirus Wa, and MS2, were inoculated into composted, raw and previously limed matrices, representative of sludge and biosolids, to achieve a final concentration of approximately 104 PFU or TCID50/mL. Each matrix was limed for 24-hr at 22 ± 5°C and 4 ± 2°C. In all trials virus was below detectable levels following a 24-hr incubation. The time required for viral inactivation varied depending on the temperature and sample matrix. This research demonstrates reduction of adenovirus type 5, rotavirus Wa, and male-specific bacteriophage, in water, sludge and biosolids matrices following addition of an 8% calcium hydroxide slurry to achieve a pH of 12 for 2-hr reduced to 11.5 for 22-hr by addition of 0.1 N HCl. In these trials, MS2 was a conservative indicator of the efficacy of lime stabilization of adenovirus Type 5 and rotavirus Wa and therefore is proposed as a useful indicator organism. PMID:17431317
NASA Astrophysics Data System (ADS)
Sterling, S. M.; Angelidis, C.; Armstrong, M.; Biagi, K. M.; Clair, T. A.; Jackson, N.; Breen, A.
2014-09-01
Populations of Atlantic salmon (Salmo salar) in Southwest Nova Scotia (SWNS) have plummeted since the 1980s. Acidification is considered a main threat to this population. The lakes and streams of SWNS were among the most heavily acidified in North America during the last century and calcium levels are predicted to continue to fall in coming decades. One of the most promising mitigation options to reduce the risk of extirpation of the SWNS Salmo salar is terrestrial liming; however, both the chemistry of SWNS rivers, and effective strategies for terrestrial liming in SWNS are poorly understood. Here we have launched the first terrestrial liming study in Nova Scotia, employing a test hydrologic source area liming strategy in a 5 ha experimental catchment in SWNS, Maria Brook; we apply an average local application rate of 13 t ha-1 to 10% of the 47 ha catchment. We employ high frequency stream monitoring to complement grab sampling to identify which constituents pose a threat to Salmo salar and to identify strategies for larger scale terrestrial liming that would fit the local conditions. Results indicate that the water chemistry conditions are currently at toxic levels for Salmo salar throughout the year, with levels of ionic aluminium exceeding toxic thresholds almost 100% of the time. The stream chemistry in Maria Brook is remarkably similar to pre-recovery conditions in other heavily acidified watersheds, such as Birkenes in Norway. Our results support the hypothesis that there has been no recovery from acidification in SWNS. Results from the first year of post-liming do not show an improvement in stream chemistry levels, and further lime application is needed to improve the water chemistry conditions to needed levels for the recovery of Salmo salar.
NASA Astrophysics Data System (ADS)
Karolina, Rahmi; Panatap Simanjuntak, Murydrischy
2018-03-01
Self Compacting Concrete (SCC) is a technology which is developing today in which concrete solidifies by itself without using vibrator. Casting conventional concrete which has a lot of reinforcement bars sometimes finds difficulty in achieving optimal solidity. The method used to solve this problem is by using SCC technology. SCC was made by using filler, volcanic ash, and lime ash as the filling materials so that the concrete became more solid and hollow space could be filled up. The variation of using these two materials was 10%, 15%, 20%, and 25% of the cementitious mass and using 1% of superplasticizer from cementitious material. The supporting testing was done by using the test when the concrete was still fluid and when it was solid. Malleable concrete was tested by using EFNARC 2002 standard in slump flow test, v-funnel test, l-shaped box test, and j-ring test to obtain filling ability and passing ability. In this malleable lime concrete test, there was the decrease, compared with normal SCC concrete without adding volcanic ash and lime ash. Testing was also done in solid concrete in compressive strength, tensile strength, and concrete absorption. The result of the testing showed that the optimum tensile strength in Variation 1, without volcanic ash and lime ash – with 1% of superplasticizer was 39.556 MPa, the optimum tensile strength in Variation 1, without volcanic ash and lime ash- with 1% of super-plasticizer was 3.563 MPa, while the value of optimum absorption which occurred in Variation 5 (25% of volcanic ash + 25% of lime ash + 50% of cement + 1% of superplasticizer) was 1.313%. This was caused by the addition of volcanic ash and lime ash which had high water absorption.
Amelioration of an Ultisol profile acidity using crop straws combined with alkaline slag.
Li, Jiu-yu; Masud, M M; Li, Zhong-yi; Xu, Ren-kou
2015-07-01
The acidity of Ultisols (pH <5) is detrimental to crop production. Technologies should be explored to promote base saturation and liming effect for amelioration of Ultisol pH. Column leaching experiments were conducted to investigate the amelioration effects of canola straw (CS) and peanut straw (PS) in single treatment and in combination whether with alkaline slag (AS) or with lime on Ultisol profile acidity. The treatment without liming materials was set as control, and the AS and lime in single treatment are set for comparison. Results indicated that all the liming materials increase soil profile pH and soil exchangeable base cations at the 0-40-cm depth, except that the lime had amelioration effect just on 0 to 15-cm profile. The amelioration effect of the liming materials on surface soil acidity was mainly dependent on the ash alkalinity in organic materials or acid neutralization capacity of inorganic materials. Specific adsorption of sulfate (SO4(2-)) or organic anions, decarboxylation of organic acids/anions, and the association of H(+) with organic anions induced a "liming effect" of crop residues and AS on subsoil acidity. Moreover, SO4(2-) and chloride (Cl(-)) in PS, CS, and AS primarily induced base cations to move downward to subsoil and exchange with exchangeable aluminum (Al(3+)) and protons (H(+)). These anions also promoted the exchangeable Al to leach out of the soil profile. The CS was more effective than PS in decreasing soil acidity in the subsoil, which mainly resulted from higher sulfur (S) and Cl content in CS compared to PS. The CS combined with AS was the better amendment choice in practical agricultural systems.
Liming of acidified waters: issues and research - a report of the International Liming Workshop
Schreiber, R. Kent
1982-01-01
Acidic deposition is a problem of significant national and international concern. It is strongly suspected that acidic deposition has adversely affected aquatic resources in Scandinavia and North America. While substantial resources are being devoted to understanding the causative factors associated with surface water acidification, much less research is being conducted on mitigative strategies. Mitigative techniques involving liming may be useful for short-term protection of specific component of aquatic communities or for renovation of seriously impacted aquatic ecosystems. The selection of effective liming strategies is based on an integrated understanding of the following key factors: biological systems, water chemistry, sediment chemistry, hydrology, and watershed characteristics, effectiveness of neutralizing materials, and application techniques. Research in Scandinavia, Canada, and the U.S. has led to a partial understanding of some of the key factors for successful neutralization of surface waters (Bengtsson, 1982; Fraser and Britt, 1982). However, conflicting results of liming operations and experiments have been reported. (Fraser et al., 1982; Fraser and Britt, 1982; Sverdrup and Bjerle, 1982). Additional research is required to improve the ability of scientists and resource managers to select effective liming strategies. An International Liming workshop was convened during 19-25 September 1982 at the University of Washington's Friday Harbor Laboratories. The major objective of this workshop were: - To identify the most critical deficiencies in the scientific understanding of liming techniques and their long-term consequences. - To develop and document a research strategy to address information deficiencies that are pertinent to the protection or renovation of acidic surface waters in the United States. The participants who contributed to this workshop are listed in Table 1.
Aigner, Siegfried; Remias, Daniel; Karsten, Ulf; Holzinger, Andreas
2013-01-01
The filamentous green alga Zygogonium ericetorum (Zygnematophyceae, Streptophyta) was collected in a high-alpine rivulet in Tyrol, Austria. Two different morphotypes of this alga were found: a purple morph with a visible purple vacuolar content and a green morph lacking this coloration. These morphotypes were compared with respect to their secondary metabolites, ultrastructure, and ecophysiological properties. Colorimetric tests with aqueous extracts of the purple morph indicated the presence of soluble compounds such as phenolics and hydrolyzable tannins. High-performance liquid chromatography-screening showed that Z. ericetorum contained several large phenolic peaks with absorption maxima at ∼280 nm and sometimes with minor maxima at ∼380 nm. Such compounds are uncommon for freshwater green microalgae, and could contribute to protect the organism against increased UV and visible (VIS) irradiation. The purple Z. ericetorum contained larger amounts (per dry weight) of the putative phenolic substances than the green morph; exposure to irradiation may be a key factor for accumulation of these phenolic compounds. Transmission electron microscopy of the purple morph showed massive vacuolization with homogenous medium electron-dense content in the cell periphery, which possibly contains the secondary compounds. In contrast, the green morph had smaller, electron-translucent vacuoles. The ecophysiological data on photosynthesis and desiccation tolerance indicated that increasing photon fluence densities led to much higher relative electron transport rates (rETR) in the purple than in the green morph. These data suggest that the secondary metabolites in the purple morph are important for light acclimation in high-alpine habitats. However, the green morph recovered better after 4 d of rehydration following desiccation stress. PMID:25810559
NASA Astrophysics Data System (ADS)
Cheng, Jun; Gong, Yadong; Wang, Jinsheng
2013-11-01
The current research of micro-grinding mainly focuses on the optimal processing technology for different materials. However, the material removal mechanism in micro-grinding is the base of achieving high quality processing surface. Therefore, a novel method for predicting surface roughness in micro-grinding of hard brittle materials considering micro-grinding tool grains protrusion topography is proposed in this paper. The differences of material removal mechanism between convention grinding process and micro-grinding process are analyzed. Topography characterization has been done on micro-grinding tools which are fabricated by electroplating. Models of grain density generation and grain interval are built, and new predicting model of micro-grinding surface roughness is developed. In order to verify the precision and application effect of the surface roughness prediction model proposed, a micro-grinding orthogonally experiment on soda-lime glass is designed and conducted. A series of micro-machining surfaces which are 78 nm to 0.98 μm roughness of brittle material is achieved. It is found that experimental roughness results and the predicting roughness data have an evident coincidence, and the component variable of describing the size effects in predicting model is calculated to be 1.5×107 by reverse method based on the experimental results. The proposed model builds a set of distribution to consider grains distribution densities in different protrusion heights. Finally, the characterization of micro-grinding tools which are used in the experiment has been done based on the distribution set. It is concluded that there is a significant coincidence between surface prediction data from the proposed model and measurements from experiment results. Therefore, the effectiveness of the model is demonstrated. This paper proposes a novel method for predicting surface roughness in micro-grinding of hard brittle materials considering micro-grinding tool grains protrusion topography, which would provide significant research theory and experimental reference of material removal mechanism in micro-grinding of soda-lime glass.
Huang, Shunhong; Yang, Yi; Li, Qian; Su, Zhen; Yuan, Cuiyu; Ouyang, Kun
2017-03-01
The effects of amendments, such as lime, bassanite, sodium phosphate, steel slag and charcoal, and their compounds on the immobilization of cadmium (Cd) are investigated. The lime-bassanite-charcoal compound shows the best remediation performance compared to other agents in conducted experiments. The optimum condition for lime-bassanite-charcoal application in contaminated soil is lime-bassanite-charcoal with a mass ratio of 1:1/3:2/3, a dose of 2% of the soil weight, and a liquid-to-solid ratio of 35%-40%; additionally, the agents should be added before water addition. The highest Cd removal rate was 58.94% (±1.19%) with a ∆pH of 0.23, which is much higher than the rates reported in previous studies. The compound amendment was used in a field experiment, demonstrating a Cd removal efficiency of 48.78% (±4.23), further confirming its effectiveness.
Wang, Xiaojun; Zhuang, Jingshun; Fu, Yingjuan; Tian, Guoyu; Wang, Zhaojiang; Qin, Menghua
2016-04-01
A combined process of lime treatment and mixed bed ion exchange was proposed to separate hemicellulose-derived saccharides (HDS) from prehydrolysis liquor (PHL) of lignocellulose as value added products. The optimization of lime treatment achieved up to 44.2% removal of non-saccharide organic compounds (NSOC), mainly colloidal substances, with negligible HDS degradation at 0.5% lime level and subsequent neutralization by phosphoric acid. The residual NSOC and calcium ions in lime-treated PHL were eliminated by mixed bed ion exchange. The breakthrough curves of HDS and NSOC showed selective retention toward NSOC, leading to 75% HDS recovery with 95% purity at 17 bed volumes of exchange capacity. In addition, macroporous resin showed higher exchange capacity than gel resin as indicated by the triple processing volume. The remarkable selectivity of the combined process suggested the feasibility for HDS separation from PHL. Copyright © 2016 Elsevier Ltd. All rights reserved.
Influence of lime on struvite formation and nitrogen conservation during food waste composting.
Wang, Xuan; Selvam, Ammaiyappan; Wong, Jonathan W C
2016-10-01
This study aimed at investigating the feasibility of supplementing lime with struvite salts to reduce ammonia emission and salinity consequently to accelerate the compost maturity. Composting was performed in 20-L bench-scale reactors for 35days using artificial food waste mixed with sawdust at 1.2:1 (w/w dry basis), and Mg and P salts (MgO and K2HPO4, respectively). Nitrogen loss was significantly reduced from 44.3% to 27.4% during composting through struvite formation even with the addition of lime. Lime addition significantly reduced the salinity to less than 4mS/cm with a positive effect on improving compost maturity. Thus addition of both lime and struvite salts synergistically provide advantages to buffer the pH, reduce ammonia emission and salinity, and accelerate food waste composting. Copyright © 2016 Elsevier Ltd. All rights reserved.
California Bearing Ratio (CBR) test on stabilization of clay with lime addition
NASA Astrophysics Data System (ADS)
Hastuty, I. P.; Roesyanto; Limbong, M. N.; Oberlyn, S. J.
2018-02-01
Clay is a type of soil with particles of certain minerals giving plastic properties when mixed with water. Soil has an important role in a construction, besides as a building material in a wide variety of civil engineering works, soil is also used as supporting foundation of the building. Basic properties of clay are rock-solid in dry and plastic with medium water content. In high water content, clay becomes sticky like (cohesive) and soften. Therefore, clay stabilization is necessary to repair soil’s mechanical properties. In this research, lime is use as a stabilizer that contains the Ca+ element to bond bigger particles. Lime used is slaked lime Ca(OH)2. Clay used has liquid limitation (LL) value of 47.33%, plasticity index of 29.88% and CBR value 6.29. The results explain about 10% lime mixture variation gives the optimum stabilized clay with CBR value of 8.75%.
Expansive soil stabilization with coir waste and lime for flexible pavement subgrade
NASA Astrophysics Data System (ADS)
Narendra Goud, G.; Hyma, A.; Shiva Chandra, V.; Sandhya Rani, R.
2018-03-01
Expansive soil properties can be improved by various methods to make it suitable for construction of flexible pavement. The coir pith is the by-product (bio-waste) generated from coir industry during extraction of coir fiber from coconut husk. Openly disposed coir pith can make the surrounding areas unhygienic. This bio-waste can be one of the potential materials to stabilize the expansive soils. In the present study coir pith and lime are used as stabilizers. Different combinations of coir pith contents (1%, 2% and 3%) and lime contents (2%, 3% and 4%)are used to study the behavior of expansive soil. Unconfined compressive strength (UCS) of unstabilized and stabilized soils was determined. Optimum content of coir pith and lime are determined based on UCS of the soil. California bearing ratio of soil determined at optimum contents of coir pith and lime. Flexible pavement layer compositions for two levels of traffic using stabilized soil subgrade.
OPO-based compact laser projection display
NASA Astrophysics Data System (ADS)
Lee, Dicky; Moulton, Peter F.; Bergstedt, Robert; Flint, Graham W.
2001-09-01
In this paper we discuss our red, green, and blue (RGB) optical parametric oscillator (OPO) based laser projection display. The complete project display consists of two subsystems, the RGB-OPO laser head and the light modulation unit. The RGB lights from rack-mounted laser head are fibers coupled to the projection unit for independent placement. The light source consists of a diode-pumped pump laser and a LBO-based OPO. Based on our Nd:YLF gain module design, the pump laser is frequency doubled to serve as the pump source for the OPO. The unconverted pump power is recycled as the green light for projection. The singly resonant, non- critically phase-matched (NCPM) OPO has, to date, generated 13 W of 898-nm signal power and an estimated 9.3 W of intra- cavity idler power at 1256 nm. With approximately 76% of pump depletion, the power of the residual green light for projection is about 5.8 W. We have extra-cavity doubled the signal to produce approximately 3.5 W of 449-nm blue light and intra-cavity doubled the idler to produce approximately 6 W of 628-nm red light. The OPO-based RGB source generates about 4000 lumens of D65-balanced white light. The overall electrical power on a commercially available JVC's three- panel D-ILA (reflective LCD) projector with the arc-lamp removed and extensive modifications. The projector has a native resolution of 1365 x 1024 and the expected on screen lumens from our laser display is about 1200 lumens.
NASA Astrophysics Data System (ADS)
Park, Jungho; Park, Youngjun; Hwang, Young M.
1997-10-01
Cut-off filters reject all the radiation below and transmit all the above a certain wavelength and vice versa. In this paper, we will study the design and fabrication of a short wave pass or a long wave pass dichroic mirrors for color separation and recombination from the R.G.B. color beam source. In the laser display system, color separation and recombination is very important. We designed the coating layers so that the best performance may be obtained from a 45 degree incident s-polarized light. The following fabrication specification is satisfied in our color separation/recombination of the Kr-Ar laser source. The first dichroic mirror for the blue color separation, maximized on reflectance and transmittance as R > 99% in the blue regions (400 approximately 490 nm) and T > 90% in the green and red region (510 approximately 700 nm). The second dichroic mirror for the color recombination maximized the reflectance and transmittance as R > 99% in the range of 510 approximately 700 nm and T > 90% in the blue color region. In the third dichroic mirror for which it used the color separation and recombination of the green and red simultaneously, maximized the reflectance and transmittance as R > 99% in the green region (510 approximately 560 nm) and T > 90% in the red region. These fabricated mirrors were applied in our laser display projection system. We obtained an excellent result.
Ulloa, G; Collao, B; Araneda, M; Escobar, B; Álvarez, S; Bravo, D; Pérez-Donoso, J M
2016-12-01
The use of bacterial cells to produce fluorescent semiconductor nanoparticles (quantum dots, QDs) represents a green alternative with promising economic potential. In the present work, we report for the first time the biosynthesis of CdS QDs by acidophilic bacteria of the Acidithiobacillus genus. CdS QDs were obtained by exposing A. ferrooxidans, A. thiooxidans and A. caldus cells to sublethal Cd 2+ concentrations in the presence of cysteine and glutathione. The fluorescence of cadmium-exposed cells moves from green to red with incubation time, a characteristic property of QDs associated with nanocrystals growth. Biosynthesized nanoparticles (NPs) display an absorption peak at 360nm and a broad emission spectra between 450 and 650nm when excited at 370nm, both characteristic of CdS QDs. Average sizes of 6 and 10nm were determined for green and red NPs, respectively. The importance of cysteine and glutathione on QDs biosynthesis in Acidithiobacillus was related with the generation of H 2 S. Interestingly, QDs produced by acidophilic bacteria display high tolerance to acidic pH. Absorbance and fluorescence properties of QDs was not affected at pH 2.0, a condition that totally inhibits the fluorescence of QDs produced chemically or biosynthesized by mesophilic bacteria (stable until pH 4.5-5.0). Results presented here constitute the first report of the generation of QDs with improved properties by using extremophile microorganisms. Copyright © 2016 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Malleshappa, J.; Nagabhushana, H.; Kavyashree, D.; Prashantha, S. C.; Sharma, S. C.; Premkumar, H. B.; Shivakumara, C.
2015-06-01
CeO2:Ho3+ (1-9 mol%) nanopowders have been prepared by efficient and environmental friendly green combustion method using Aloe vera gel as fuel for the first time. The final products are well characterized by powder X-ray diffraction (PXRD), scanning electron microscopy (SEM), fourier transform infrared (FTIR). Bell, urchin, core shell and flower like morphologies are observed with different concentrations of the A. vera gel. It is apparent that by adjusting the concentration of the gel, considerable changes in the formation of CeO2:Ho3+ nano structures can be achieved. Photoluminescence (PL) studies show green (543, 548 nm) and red (645, 732 nm) emissions upon excited at 400 nm wavelength. The emission peaks at ∼526, 548, 655 and 732 nm are associated with the transitions of 5F3 → 5I8, 5S2 → 5I8, 5F5 → 5I8 and 5S2 → 5I7, respectively. Three TL glow peaks are observed at 118, 267 and 204 °C for all the γ irradiated samples which specify the surface and deeper traps. Linear TL response in the range 0.1-2 kGy shows that phosphor is fairly useful as γ radiation dosimeter. Kinetic parameters associated with the glow peaks are estimated using Chen's half width method. The CIE coordinate values show that phosphor is quite useful for the possible applications in WLEDs as orange red phosphor.
Large laser projection displays utilizing all-solid-state RGB lasers
NASA Astrophysics Data System (ADS)
Xu, Zuyan; Bi, Yong
2005-01-01
RGB lasers projection displays have the advantages of producing large color triangle, high color saturation and high image resolution. In this report, with more than 4W white light synthesized by red (671nm), green (532nm) and blue (473nm) lasers, a RGB laser projection display system based on diode pumped solid-state lasers is developed and the performance of brilliant and vivid DVD dynamitic pictures on 60 inch screen is demonstrated.
A Clementine Collection: Moonglow
1994-06-01
View of the Sun and Moon 54 West of Apollo 17 56 Tycho Crater 58 Copernicus Crater Mosaic 60 Limb of Gagarin 62 Night and Day 64 Lake Victoria 66 Sunrise...Color composite Red = 1000 nm Green = 900 nm Blue = 415 nm 56 57 57 Sopernicus Crater Mosaic Mosaic of the lunar crater Copernicus produced using...half of Copernicus . This color mosaic was prepared using images obtained through filters of three different coiors chosen to allow small lunar color
Growth and laser properties of Yb : Ca 4YO(BO 3) 3 crystal
NASA Astrophysics Data System (ADS)
Zhang, Huaijin; Meng, Xianlin; Zhu, Li; Wang, Pu; Liu, Xuesong; Cheng, Ruiping; Dawes, Judith; Dekker, Peter; Zhang, Shaojun; Sun, Lianke
1999-04-01
Yb : Ca 4YO(BO 3) 3 (Yb : YCOB) crystal has been grown by the Czochralski method. The absorption and fluorescence spectra have been measured. The green luminescence is also observed. The output laser at 1032 nm has been demonstrated pumped by laser diode (LD) at 976.4 nm.
Zheng, Mingda; Wang, Chenge; Wang, Yingying; Wei, Wei; Ma, Shuang; Sun, Xiaohan; He, Jiang
2018-08-01
In this work, Lycii Fructus as raw materials for green synthesis of fluorescent carbon dots (CDs) reduce AgNO 3 . The CDs-AgNPs were synthesized by one-step method. CDs were applied to stabilize AgNPs due to abundant functional groups on the surface of CDs. In presence of phoxim, the dispersed CDs-AgNPs get aggregated and the absorption peak with red shift from 400 nm to 525 nm, resulting in the color changed from yellow to red. Under optimized conditions, the absorbance ratio at A 525 nm /A 400 nm was related linearly to the concentrations of phoxim in the range of 0.1-100 μM. The detection limit was calculated to 0.04 μM, which is lower than maximum residue limits of phoxim in samples in China. The colorimetric sensor was successfully utilized to monitoring phoxim in environmental and fruit samples with good recoveries ranges from 87% to 110.0%. These results showed the sensor had a promising application prospect in real samples. Copyright © 2018 Elsevier B.V. All rights reserved.
MOCVD growth of vertically aligned InGaN nanowires
NASA Astrophysics Data System (ADS)
Kuo, H. C.; Su Oh, Tae; Ku, P.-C.
2013-05-01
In this work, we report the growth of vertically aligned bulk InGaN nanowires (NWs) on r-plane sapphire substrate by metal organic chemical vapor deposition (MOCVD). Through the optimization process of growth conditions, such as growth temperature and pressure, we obtained high density InGaN NWs consisting of one (0001) polar- and two equivalent {1101} semi-polar planes. We have shown the highest InGaN NWs wire density of 8×108 cm-2,with an average diameter of 300 nm and a length of 2 μm. From results of photoluminescence (PL) at 30 K and 300 K, we observed the intense and broad emission peak from InGaN NWs at around 595 nm, and confirmed that the luminescence could be tuned from 580 nm to 660 nm by controlling the indium flow (TMIn) rate. Our results indicate that MOCVD-grown InGaN NWs can be effective absorbers of the blue-green range of solar spectrum and may be one of the good candidates for high efficiency photovoltaic devices targeting at blue-green photons.
Lu, Zhijuan; Mao, Zhiyong; Chen, Jingjing; Wang, Dajian
2015-09-21
In this work, tunable emission from green to red and the inverse tuning from red to green in α-(Ca, Sr)2SiO4:Eu(2+) phosphors were demonstrated magically by varying the incorporation content of Eu(2+) and Sr(2+) ions, respectively. The tunable emission properties and the tuning mechanism of red-shift resulting from the Eu(2+) content as well as that of blue-shift induced by the Sr(2+) content were investigated in detail. As a result of fine-controlling the incorporation content of Eu(2+), the emission peak red-shifts from 541 nm to 640 nm. On the other hand, the emission peak inversely blue-shifts from 640 nm to 546 nm through fine-adjusting the incorporation content of Sr(2+). The excellent tuning characteristics for α-(Ca, Sr)2SiO4:Eu(2+) phosphors presented in this work exhibited their various application prospects in solid-state lighting combining with a blue chip or a near-UV chip.
Peripheral visual response time to colored stimuli imaged on the horizontal meridian
NASA Technical Reports Server (NTRS)
Haines, R. F.; Gross, M. M.; Nylen, D.; Dawson, L. M.
1974-01-01
Two male observers were administered a binocular visual response time task to small (45 min arc), flashed, photopic stimuli at four dominant wavelengths (632 nm red; 583 nm yellow; 526 nm green; 464 nm blue) imaged across the horizontal retinal meridian. The stimuli were imaged at 10 deg arc intervals from 80 deg left to 90 deg right of fixation. Testing followed either prior light adaptation or prior dark adaptation. Results indicated that mean response time (RT) varies with stimulus color. RT is faster to yellow than to blue and green and slowest to red. In general, mean RT was found to increase from fovea to periphery for all four colors, with the curve for red stimuli exhibiting the most rapid positive acceleration with increasing angular eccentricity from the fovea. The shape of the RT distribution across the retina was also found to depend upon the state of light or dark adaptation. The findings are related to previous RT research and are discussed in terms of optimizing the color and position of colored displays on instrument panels.
Oxycarbonitride phosphors and light emitting devices using the same
Li, Yuanqiang; Romanelli, Michael Dennis; Tian, Yongchi
2013-10-08
Disclosed herein is a novel family of oxycarbidonitride phosphor compositions and light emitting devices incorporating the same. Within the sextant system of M--Al--Si--O--N--C--Ln and quintuplet system of M--Si--O--N--C--Ln (M=alkaline earth element, Ln=rare earth element), the phosphors are composed of either one single crystalline phase or two crystalline phases with high chemical and thermal stability. In certain embodiments, the disclosed phosphor of silicon oxycarbidonitrides emits green light at wavelength between 530-550 nm. In further embodiments, the disclosed phosphor compositions emit blue-green to yellow light in a wavelength range of 450-650 nm under near-UV and blue light excitation.
Oxycarbonitride phosphors and light emitting devices using the same
Li, Yuanqiang; Romanelli, Michael Dennis; Tian, Yongchi
2014-07-08
Disclosed herein is a novel family of oxycarbonitride phosphor compositions and light emitting devices incorporating the same. Within the sextant system of M--Al--Si--O--N--C--Ln and quintuplet system of M--Si--O--N--C--Ln (M=alkaline earth element, Ln=rare earth element), the phosphors are composed of either one single crystalline phase or two crystalline phases with high chemical and thermal stability. In certain embodiments, the disclosed phosphor of silicon oxycarbonitrides emits green light at wavelength between 530-550 nm. In further embodiments, the disclosed phosphor compositions emit blue-green to yellow light in a wavelength range of 450-650 nm under near-UV and blue light excitation.
NASA Astrophysics Data System (ADS)
Chen, Chen; He, Ruiyun; Tan, Yang; Wang, Biao; Akhmadaliev, Shavkat; Zhou, Shengqiang; de Aldana, Javier R. Vázquez; Hu, Lili; Chen, Feng
2016-01-01
This work reports on the fabrication of ridge waveguides in Er3+/Yb3+ co-doped phosphate glass by the combination of femtosecond laser ablation and following swift carbon ion irradiation. The guiding properties of waveguides have been investigated at 633 and 1064 nm through end face coupling arrangement. The refractive index profile on the cross section of the waveguide has been constructed. The propagation losses can be reduced considerably after annealing treatment. Under the optical pump laser at 980 nm, the upconversion emission of both green and red fluorescence has been realized through the ridge waveguide structures.