Sample records for non-mhc immune genes

  1. Extensive shared polymorphism at non-MHC immune genes in recently diverged North American prairie grouse

    USGS Publications Warehouse

    Minias, Piotr; Bateson, Zachary W; Whittingham, Linda A; Johnson, Jeff A; Oyler-McCance, Sara J.; Dunn, Peter O


    Gene polymorphisms shared between recently diverged species are thought to be widespread and most commonly reflect introgression from hybridization or retention of ancestral polymorphism through incomplete lineage sorting. Shared genetic diversity resulting from incomplete lineage sorting is usually maintained for a relatively short period of time, but under strong balancing selection it may persist for millions of years beyond species divergence (balanced trans-species polymorphism), as in the case of the major histocompatibility complex (MHC) genes. However, balancing selection is much less likely to act on non-MHC immune genes. The aim of this study was to investigate the patterns of shared polymorphism and selection at non-MHC immune genes in five grouse species from Centrocercus and Tympanuchus genera. For this purpose, we genotyped five non-MHC immune genes that do not interact directly with pathogens, but are involved in signaling and regulate immune cell growth. In contrast to previous studies with MHC, we found no evidence for balancing selection or balanced trans-species polymorphism among the non-MHC immune genes. No haplotypes were shared between genera and in most cases more similar allelic variants sorted by genus. Between species within genera, however, we found extensive shared polymorphism, which was most likely attributable to introgression or incomplete lineage sorting following recent divergence and large ancestral effective population size (i.e., weak genetic drift). Our study suggests that North American prairie grouse may have attained relatively low degree of reciprocal monophyly at nuclear loci and reinforces the rarity of balancing selection in non-MHC immune genes.

  2. Regulation of experimental autoimmune uveitis in rats--separation of MHC and non-MHC gene effects.

    PubMed Central

    Hirose, S; Ogasawara, K; Natori, T; Sasamoto, Y; Ohno, S; Matsuda, H; Onoé, K


    Experimental autoimmune uveitis (EAU) is an organ-specific autoimmune disease and has served as a model of certain ocular inflammatory conditions in man. The present study was aimed at separating the effects of MHC and non-MHC genes on the development of EAU in the rat. EAU-susceptible LEW (RT1l), EAU-resistant WKAH (RT1k), and WKAH.1L (RT1l) MHC congenic strain of WKAH background rats were immunized with retinal soluble antigen (S-Ag) in Freund's complete adjuvant (FCA). LEW rats showed typical EAU, while neither WKAH nor WKAH.1L congenic rats developed EAU. However, when an additional i.v. injection of Bordetella pertussis was given, all rat strains developed EAU. Furthermore, when immunized with peptide M, an 18-mer synthetic peptide, which corresponds to amino acid positions 303-320 of bovine S-Ag, and given an additional i.v. injection of B. pertussis, LEW and WKAH.1L rats developed EAU, whereas WKAH did not. When ACI (RT1avl), BUF (RT1b), LEJ (RT1j), W (RT1k), F344 (RT1lvl), BN (RT1n), NIG-III (RT1q), TO (RT1t), and SDJ (RT1u) rats were immunized with peptide M or S-Ag and then B. pertussis, all strains developed EAU by immunization with S-Ag plus B. pertussis, but only F344 and NIG-III developed EAU by immunization with peptide M. These findings suggest that susceptibility to EAU in rats is controlled by both MHC and non-MHC genes; and that in the absence of B. pertussis adjuvant, the form of disease induced by native S-Ag in FCA is governed by non-MHC gene(s). However, this effect of non-MHC gene(s) could no longer be observed when the rats were also injected with B. pertussis adjuvant at sensitization. Images Fig. 1 PMID:1747950

  3. Cloning and characterization of the 2B4 gene encoding a molecule associated with non-MHC-restricted killing mediated by activated natural killer cells and T cells

    SciTech Connect

    Mathew, P.A.; Garni-Wagner, B.A.; Land, K.; Takashima, A.; Stoneman, E.; Bennett, M.; Kumar, V. )


    The authors have recently described a signal transducing molecule, 2B4, expressed on all NK and T cells that mediate non-MHC-restricted killing. The gene encoding this molecule was cloned and its nucleotide sequence determined. The encoded protein of 398 amino acids has a leader peptide of 18 amino acids and a transmembrane region of 24 amino acids. The predicted protein has eight N-linked glycosylation sites, suggesting that it is highly glycosylated. Comparison of 2B4 with sequences in the databanks indicates that 2B4 is a member of the Ig supergene family, and it shows homology to murine and rat CD48 and human LFA-3. Northern blot analysis has shown at least three transcripts for 2B4 in adherent lymphokine-activated killer cells of several mouse strains and TCR-[gamma]/[delta] dendritic epidermal T cell lines but not in allospecific T cell clones. These three mRNA are the products of differential splicing of heterogeneous nuclear RNA. Southern blot analysis of genomic DNA from several mouse strains revealed that 2B4 belongs to a family of closely related genes. The 2B4 gene has been mapped to mouse chromosome 1 by analysis of 2B4 expression in recombinant inbred mouse strains. 48 refs., 6 figs., 2 tabs.

  4. Development of Anti-donor Antibody Directed Toward Non-MHC Antigens in Tolerant Animals

    PubMed Central

    Scalea, Joseph R.; Villani, Vincenzo; Gillon, Bradford C.; Weiner, Joshua; Gianello, Pierre; Turcotte, Nicole; Arn, J. Scott; Yamada, Kazuhiko; Sachs, David H.


    Background The clinical significance of antibodies directed against antigens other than MHC antigens is poorly understood and there are few large animal models in which such antibodies can be examined. We studied, both retrospectively and prospectively, the development of antibodies to non-MHC antigens in tolerant miniature swine. Methods Our database was assessed for cases of anti-donor antibody formation in tolerant animals over the last 20 years. Flow cytometry, absorption assays and familial analyses for inheritance pattern of the gene(s) potentially responsible for the antibody reactivities were carried out and an animal determined to be negative for this reactivity was immunized by a skin graft and subcutaneous injections of PBMCs from an antigen-positive donor. Results Sixteen of 469 tolerant animals tested were found to have developed anti-donor antibodies. These antibodies were found to be specific for the same, presumably single, non-MHC antigen. Familial analyses indicated that the gene encoding this antigen was expressed in an autosomal dominant manner in approximately 95% of the herd. In a prospective study, anti-donor antibodies with the same specificity as those observed retrospectively were successfully induced in an antigen-negative animal after immunization with PBMCs. Conclusions To our knowledge, this is the first report of the development of antibodies to a highly prevalent, non-MHC antigen present on peripheral blood mononuclear cells and developing in tolerant animals without signs of graft dysfunction. Considering the concern often raised by the appearance of anti-donor antibodies in transplant recipients, these data could have important implications for clinical transplantation. PMID:24933456

  5. HLA Immune Function Genes in Autism

    PubMed Central

    Torres, Anthony R.; Westover, Jonna B.; Rosenspire, Allen J.


    The human leukocyte antigen (HLA) genes on chromosome 6 are instrumental in many innate and adaptive immune responses. The HLA genes/haplotypes can also be involved in immune dysfunction and autoimmune diseases. It is now becoming apparent that many of the non-antigen-presenting HLA genes make significant contributions to autoimmune diseases. Interestingly, it has been reported that autism subjects often have associations with HLA genes/haplotypes, suggesting an underlying dysregulation of the immune system mediated by HLA genes. Genetic studies have only succeeded in identifying autism-causing genes in a small number of subjects suggesting that the genome has not been adequately interrogated. Close examination of the HLA region in autism has been relatively ignored, largely due to extraordinary genetic complexity. It is our proposition that genetic polymorphisms in the HLA region, especially in the non-antigen-presenting regions, may be important in the etiology of autism in certain subjects. PMID:22928105

  6. [Immune response genes products in human physiology].


    Khaitov, R M; Alekseev, L P


    Current data on physiological role of human immune response genes' proteomic products (antigens) are discussed. The antigens are specified by a very high level of diversity that mediates a wide specter ofphysiological functions. They actually provide integrity and biological stability of human as species. These data reveal new ideas on many pathological processes as well as drafts new approaches for prophylaxis and treatment.

  7. The X chromosome and immune associated genes.


    Bianchi, Ilaria; Lleo, Ana; Gershwin, M Eric; Invernizzi, Pietro


    The X chromosome is known to contain the largest number of immune-related genes of the whole human genome. For this reason, X chromosome has recently become subject of great interest and attention and numerous studies have been aimed at understanding the role of genes on the X chromosome in triggering and maintaining the autoimmune aggression. Autoimmune diseases are indeed a growing heath burden affecting cumulatively up to 10% of the general population. It is intriguing that most X-linked primary immune deficiencies carry significant autoimmune manifestations, thus illustrating the critical role played by products of single gene located on the X chromosome in the onset, function and homeostasis of the immune system. Again, the plethora of autoimmune stigmata observed in patients with Turner syndrome, a disease due to the lack of one X chromosome or the presence of major X chromosome deletions, indicate that X-linked genes play a unique and major role in autoimmunity. There have been several reports on a role of X chromosome gene dosage through inactivation or duplication in women with autoimmune diseases, for example through a higher rate of circulating cells with a single X chromosome (i.e. with X monosomy). Finally, a challenge for researchers in the coming years will be to dissect the role for the large number of X-linked microRNAs from the perspective of autoimmune disease development. Taken together, X chromosome might well constitute the common trait of the susceptibility to autoimmune diseases, other than to explain the female preponderance of these conditions. This review will focus on the available evidence on X chromosome changes and discuss their potential implications and limitations. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Gene gun immunization to combat malaria.


    Bergmann-Leitner, Elke S; Leitner, Wolfgang W


    DNA immunization by gene gun against a variety of infectious diseases has yielded promising results in animal models. Skin-based DNA vaccination against these diseases is not only an attractive option for the clinic but can aid in the discovery and optimization of vaccine candidates. Vaccination against the protozoan parasite Plasmodium presents unique challenges: (a) most parasite-associated antigens are stage-specific; (b) antibodies capable of neutralizing the parasite during the probing of the mosquitoes have to be available at high titers in order to prevent infection of the liver; (c) immunity to liver-stage infection needs to be absolute in order to prevent subsequent blood-stage parasitemia. Gene gun vaccination has successfully been used to prevent the infection of mice with the rodent malaria strain P. berghei and has been employed in a macaque model of human P. falciparum. DNA plasmid delivery by gene gun offers the opportunity to economically and efficiently test novel malaria vaccine candidates and vaccination strategies, which include the evaluation of novel molecular adjuvant strategies. Here we describe the procedures involved in making and delivering a pre-clinical malaria DNA vaccine by gene gun as well as the correct approach for the in vivo evaluation of the vaccine. Furthermore, we discuss various approaches that either have already been tested or could be employed to improve DNA vaccines against malaria.

  9. Expression of immune genes in skin of channel catfish immunized with live theronts of Ichthyophthirius multifiliis

    USDA-ARS?s Scientific Manuscript database

    There is limited information on innate and adaptive immune gene expression in the skin of channel catfish, Ictalurus punctatus immunized with Ichthyophthirius multifiliis (Ich). The objective of this study was to evaluate differential expression of innate and adaptive immune genes, including immunog...

  10. Innate Immune Gene Polymorphisms in Tuberculosis

    PubMed Central

    Sadee, Wolfgang


    Tuberculosis (TB) is a leading cause worldwide of human mortality attributable to a single infectious agent. Recent studies targeting candidate genes and “case-control” association have revealed numerous polymorphisms implicated in host susceptibility to TB. Here, we review current progress in the understanding of causative polymorphisms in host innate immune genes associated with TB pathogenesis. We discuss genes encoding several types of proteins: macrophage receptors, such as the mannose receptor (MR, CD206), dendritic cell-specific ICAM-3-grabbing nonintegrin (DC-SIGN, CD209), Dectin-1, Toll-like receptors (TLRs), complement receptor 3 (CR3, CD11b/CD18), nucleotide oligomerization domain 1 (NOD1) and NOD2, CD14, P2X7, and the vitamin D nuclear receptor (VDR); soluble C-type lectins, such as surfactant protein-A (SP-A), SP-D, and mannose-binding lectin (MBL); phagocyte cytokines, such as tumor necrosis factor (TNF), interleukin-1β (IL-1β), IL-6, IL-10, IL-12, and IL-18; chemokines, such as IL-8, monocyte chemoattractant protein 1 (MCP-1), RANTES, and CXCL10; and other important innate immune molecules, such as inducible nitric oxide synthase (iNOS) and solute carrier protein 11A1 (SLC11A1). Polymorphisms in these genes have been variably associated with susceptibility to TB among different populations. This apparent variability is probably accounted for by evolutionary selection pressure as a result of long-term host-pathogen interactions in certain regions or populations and, in part, by lack of proper study design and limited knowledge of molecular and functional effects of the implicated genetic variants. Finally, we discuss genomic technologies that hold promise for resolving questions regarding the evolutionary paths of the human genome, functional effects of polymorphisms, and corollary impacts of adaptation on human health, ultimately leading to novel approaches to controlling TB. PMID:22825450

  11. Molecular structure of the immunity gene and immunity protein of the bacteriocinogenic plasmid Clo DF13.

    PubMed Central

    van den Elzen, P J; Gaastra, W; Spelt, C E; de Graaf, F K; Veltkamp, E; Nijkamp, H J


    The nucleotide sequence of the Clo DF13 DNA region comprising the immunity gene has been determined. We also elucidated the aminoacid sequence of the 40 N-terminal and 7 C-terminal aminoacids of the purified immunity protein. From analysis of the data obtained we were able to locate the immunity gene between 11.7 and 14.5% on the Clo DF13 map, and to determine the complete aminoacid sequence of the immunity protein. It was observed that the Clo DF13 immunity gene encodes an 85 aminoacid protein and is transcribed in the same direction as the cloacin gene. These experimental data support our model, presented elsewhere, which implicates that the cloacin and immunity genes of Clo DF13 are coordinately transcribed from the cloacin promoter. We also present DNA sequence data indicating that an extra ribosome binding site precedes the immunity gene on the polycistronic mRNA. This ribosome binding site might explain the fact that in cloacinogenic cells more immunity protein than cloacin is synthesized. The comparison of the complete aminoacid sequence of the Clo DF13 immunity protein, with the aminoacid sequence data of the purified, comparable Col E3 immunity protein revealed that both proteins have extensive homologies in primary and secondary structure, although they are exchangeable only to a low extent in vivo and in vitro. It was also observed that a lysine residue was modified in immunity protein isolated from excreted bacteriocin complexes. Images PMID:6253914

  12. Immune function genes, genetics, and the neurobiology of addiction.


    Crews, Fulton T


    The neuroimmune system (i.e., the immune system and those components of the nervous system that help regulate immune responses), and in particular the innate immune system, play a role in the development of addictions, including alcoholism, particularly in the context of stressful situations. Certain cells of the neuroimmune system are activated both by stress and by environmental factors such as alcohol, resulting in the induction of genes involved in innate immunity. One of the molecules mediating this gene induction is a regulatory protein called nuclear factor-κB, which activates many innate immune genes. Innate immune gene induction in certain brain regions (e.g., the frontal cortex), in turn, can disrupt decision making, which is a characteristic of addiction to alcohol and other drugs. Likewise, altered neuroimmune signaling processes are linked to alcohol-induced negative affect and depression-like behaviors and also regulate alcohol-drinking behavior. Moreover, the expression of several genes and proteins involved in innate immunity is enhanced in addicted people. Finally, specific variants of multiple innate immune genes are associated with the genetic risk for alcoholism in humans, further strengthening the connection between increased brain innate immune gene expression and alcohol addiction.

  13. Cervical Carcinogenesis and Immune Response Gene Polymorphisms: A Review

    PubMed Central

    Mooij, Merel


    The local immune response is considered a key determinant in cervical carcinogenesis after persistent infection with oncogenic, high-risk human papillomavirus (HPV) infections. Genetic variation in various immune response genes has been shown to influence risk of developing cervical cancer, as well as progression and survival among cervical cancer patients. We reviewed the literature on associations of immunogenetic single nucleotide polymorphism, allele, genotype, and haplotype distributions with risk and progression of cervical cancer. Studies on HLA and KIR gene polymorphisms were excluded due to the abundance on literature on that subject. We show that multiple genes and loci are associated with variation in risk of cervical cancer. Rather than one single gene being responsible for cervical carcinogenesis, we postulate that variations in the different immune response genes lead to subtle differences in the effectiveness of the antiviral and antitumour immune responses, ultimately leading to differences in risk of developing cervical cancer and progressive disease after HPV infection. PMID:28280748

  14. Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci

    PubMed Central

    Reveille, John D; Sims, Anne-Marie; Danoy, Patrick; Evans, David M; Leo, Paul; Pointon, Jennifer J; Jin, Rui; Zhou, Xiaodong; Bradbury, Linda A; Appleton, Louise H; Davis, John C; Diekman, Laura; Doan, Tracey; Dowling, Alison; Duan, Ran; Duncan, Emma L; Farrar, Claire; Hadler, Johanna; Harvey, David; Karaderi, Tugce; Mogg, Rebecca; Pomeroy, Emma; Pryce, Karena; Taylor, Jacqueline; Savage, Laurie; Deloukas, Panos; Kumanduri, Vasudev; Peltonen, Leena; Ring, Sue M; Whittaker, Pamela; Glazov, Evgeny; Thomas, Gethin P; Maksymowych, Walter P; Inman, Robert D; Ward, Michael M; Stone, Millicent A; Weisman, Michael H; Wordsworth, B Paul; Brown, Matthew A


    To identify susceptibility loci for ankylosing spondylitis, we undertook a genome-wide association study in 2,053 unrelated ankylosing spondylitis cases among people of European descent and 5,140 ethnically matched controls, with replication in an independent cohort of 898 ankylosing spondylitis cases and 1,518 controls. Cases were genotyped with Illumina HumHap370 genotyping chips. In addition to strong association with the major histocompatibility complex (MHC; P < 10−800), we found association with SNPs in two gene deserts at 2p15 (rs10865331; combined P = 1.9 × 10−19) and 21q22 (rs2242944; P = 8.3 × 10−20), as well as in the genes ANTXR2 (rs4333130; P = 9.3 × 10−8) and IL1R2 (rs2310173; P = 4.8 × 10−7). We also replicated previously reported associations at IL23R (rs11209026; P = 9.1 × 10−14) and ERAP1 (rs27434; P = 5.3 × 10−12). This study reports four genetic loci associated with ankylosing spondylitis risk and identifies a major role for the interleukin (IL)-23 and IL-1 cytokine pathways in disease susceptibility. PMID:20062062

  15. Advances in Overcoming Immune Responses following Hemophilia Gene Therapy

    PubMed Central

    Miao, Carol H.


    Both Clinical trials and pre-clinical experiments for hemophilia gene therapy showed that it is important to overcome potential immune responses against gene transfer vectors and/or transgene products to ensure the success of gene therapy. Recently various approaches have been investigated to prevent or modulate such responses. Gene transfer vectors have been specifically engineered and immunosuppressive regimens have been administered to avoid or manipulate the immune responses against the vectors. In order to prevent cytotoxic lymphocyte or antibody formation induced by transgene expression, novel approaches have been developed, including methods to manipulate antigen presentation, development of variant genes encoding less immunogenic proteins or gene transfer protocols to evade immune responses, as well as immunosuppressive strategies to target either T and/or B cell responses. Most of these successful protocols involve the induction of activated regulatory T cells to create a regulatory immune environment during tolerance induction. Recent development of these strategies to evade vector-specific immune responses and induce long-term immune tolerance specific to the transgene product will be discussed. PMID:22737594

  16. Immune gene mining by pyrosequencing in the rockshell, Thais clavigera.


    Rhee, Jae-Sung; Kim, Bo-Mi; Jeong, Chang-Bum; Horiguchi, Toshihiro; Lee, Young-Mi; Kim, Il-Chan; Lee, Jae-Seong


    The rockshell, Thais clavigera (Gastropoda: Muricidae) has been shown to be a useful species as a potential indicator for diverse pollution in the marine environment. However, their genetic information is still not widely available. Here, we performed an extensive transcriptome analysis of T. clavigera using the pyrosequencing method, and selected innate immune-related genes. Among the unigenes obtained in this species, we annotated a number of immune system-related genes (e.g. adhesive protein, antimicrobial protein, apoptosis- and cell cycle-related protein, cellular defense effector, immune regulator, pattern recognition protein, protease, protease inhibitor, reduction/oxidation-related protein, signal transduction-related protein and stress protein), which are potentially useful for immunity research in this species. To confirm the usefulness of potential immune-biomarker genes, we checked the transcript level of specific immune genes in both different tissues and LPS-exposed rockshells within the T. clavigera transcript database. This study would be helpful to extend our knowledge on the immune system of rockshell in comparative aspects. Also it would be useful to develop the rockshell as a potential test organism for monitoring of marine environment quality. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. The Innate Immune-Related Genes in Catfish

    PubMed Central

    Gao, Lei; He, Chongbo; Liu, Xueguang; Su, Hao; Gao, Xianggang; Li, Yunfeng; Liu, Weidong


    Catfish is one of the most important aquaculture species in America (as well as in Asia and Africa). In recent years, the production of catfish has suffered massive financial losses due to pathogen spread and breakouts. Innate immunity plays a crucial role in increasing resistance to pathogenic organisms and has generated increasing interest in the past few years. This review summarizes the current understanding of innate immune-related genes in catfish, including pattern recognition receptors, antimicrobial peptides, complements, lectins, cytokines, transferrin and gene expression profiling using microarrays and next generation sequencing technologies. This review will benefit the understanding of innate immune system in catfish and further efforts in studying the innate immune-related genes in fish. PMID:23203058

  18. Population Genetics of Anopheles coluzzii Immune Pathways and Genes

    PubMed Central

    Rottschaefer, Susan M.; Crawford, Jacob E.; Riehle, Michelle M.; Guelbeogo, Wamdaogo M.; Gneme, Awa; Sagnon, N’Fale; Vernick, Kenneth D.; Lazzaro, Brian P.


    Natural selection is expected to drive adaptive evolution in genes involved in host–pathogen interactions. In this study, we use molecular population genetic analyses to understand how natural selection operates on the immune system of Anopheles coluzzii (formerly A. gambiae “M form”). We analyzed patterns of intraspecific and interspecific genetic variation in 20 immune-related genes and 17 nonimmune genes from a wild population of A. coluzzii and asked if patterns of genetic variation in the immune genes are consistent with pathogen-driven selection shaping the evolution of defense. We found evidence of a balanced polymorphism in CTLMA2, which encodes a C-type lectin involved in regulation of the melanization response. The two CTLMA2 haplotypes, which are distinguished by fixed amino acid differences near the predicted peptide cleavage site, are also segregating in the sister species A. gambiae (“S form”) and A. arabiensis. Comparison of the two haplotypes between species indicates that they were not shared among the species through introgression, but rather that they arose before the species divergence and have been adaptively maintained as a balanced polymorphism in all three species. We additionally found that STAT-B, a retroduplicate of STAT-A, shows strong evidence of adaptive evolution that is consistent with neofunctionalization after duplication. In contrast to the striking patterns of adaptive evolution observed in these Anopheles-specific immune genes, we found no evidence of adaptive evolution in the Toll and Imd innate immune pathways that are orthologously conserved throughout insects. Genes encoding the Imd pathway exhibit high rates of amino acid divergence between Anopheles species but also display elevated amino acid diversity that is consistent with relaxed purifying selection. These results indicate that adaptive coevolution between A. coluzzii and its pathogens is more likely to involve novel or lineage-specific molecular mechanisms

  19. big bang gene modulates gut immune tolerance in Drosophila.


    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc


    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  20. Regulation of cytokine gene transcription in the immune system.


    Holloway, A F; Rao, S; Shannon, M F


    The controlled expression of cytokine genes is an essential component of an immune response. The specific types of cytokines as well as the time and place of their production is important in generating an appropriate immune response to an infectious agent. Aberrant expression is associated with pathological conditions of the immune system such as autoimmunity, atopy and chronic inflammation. Cytokine gene transcription is generally induced in a cell-specific manner. Over the last 15 years, a large amount of information has been generated describing the transcriptional controls that are exerted on cytokine genes. Recently, efforts have been directed at understanding how these genes are transcribed in a chromatin context. This review will discuss the mechanisms by which cytokine genes become available for transcription in a cell-restricted manner as well as the mechanisms by which these genes sense their environment and activate high level transcription in a transient manner. Particular attention will be paid to the role of chromatin in allowing transcription factor access to appropriate genes.

  1. Gene therapy for primary adaptive immune deficiencies.


    Fischer, Alain; Hacein-Bey-Abina, Salima; Cavazzana-Calvo, Marina


    Gene therapy has become an option for the treatment of 2 forms of severe combined immunodeficiency (SCID): X-linked SCID and adenosine deaminase deficiency. The results of clinical trials initiated more than 10 years ago testify to sustained and reproducible correction of the underlying T-cell immunodeficiency. Successful treatment is based on the selective advantage conferred on T-cell precursors through their expression of the therapeutic transgene. However, "first-generation" retroviral vectors also caused leukemia in some patients with X-linked SCID because of the constructs' tendency to insert into active genes (eg, proto-oncogenes) in progenitor cells and transactivate an oncogene through a viral element in the long terminal repeat. These elements have been deleted from the vectors now in use. Together with the use of lentiviral vectors (which are more potent for transducing stem cells), these advances should provide a basis for the safe and effective extension of gene therapy's indications in the field of primary immunodeficiencies. Nevertheless, this extension will have to be proved by examining the results of the ongoing clinical trials.

  2. The evolution of secondary organization in immune system gene libraries

    SciTech Connect

    Hightower, R.; Forrest, S.; Perelson, A.S.


    A binary model of the immune system is used to study the effects of evolution on the genetic encoding for antibody molecules. We report experiments which show that the evolution of immune system genes, simulated by the genetic algorithm, can induce a high degree of genetic organization even though that organization is not explicitly required by the fitness function. This secondary organization is related to the true fitness of an individual, in contrast to the sampled fitness which is the explicit fitness measure used to drive the process of evolution.

  3. Importance of immune response genes in hemophilia A

    PubMed Central

    de Alencar, Josiane Bazzo; Macedo, Luciana Conci; de Barros, Morgana Ferreira; Rodrigues, Camila; Cadide, Renata Campos; Sell, Ana Maria; Visentainer, Jeane Eliete Laguila


    Hemophilia A is a disease caused by a deficiency of coagulation factor VIII resulting from genetic inheritance linked to chromosome X. One treatment option is the administration of plasma or recombinant FVIII. However, some patients develop inhibitors or antibodies against this factor. Inhibitors are alloantibodies that bind to the epitope of factor VIII causing it to be recognized by the immune system as a foreign peptide. This is the most serious complication in hemophilia patients in respect to replacement therapy. Some studies have suggested that genetic factors influence the development of factor VIII inhibitors such as ethnicity, family history, mutations in the factor VIII gene and in genes of the immune system. The aim of this study was to conduct a literature review to assess the influence of genetic factors of immune response genes, especially genes of the major histocompatibility complex and cytokines, which may be related to the development of factor VIII inhibitors in hemophilia A patients. Understanding these risk factors will help to determine future differential treatment in the control and prevention of the development of inhibitors. PMID:24106448

  4. Expression of immune genes in systemic and mucosal immune tissues of channel catfish vaccinated with live theronts of Ichthyophthirius multifiliis.


    Xu, De-Hai; Moreira, Gabriel S A; Shoemaker, Craig A; Zhang, Dunhua; Beck, Benjamin H


    Ichthyophthiriasis caused by Ichthyophthirius multifiliis (Ich) has a worldwide distribution and affects most freshwater fishes. Fish surviving natural infection and/or immunized with Ich develop strong innate and adaptive immune responses. However, there is a lack of the knowledge regarding immune gene expression patterns in systemic and mucosal immune tissues, and how immune genes interact and lead to innate and adaptive immune protection against Ich infection in fish. The objective of this study was to investigate the expression of innate and adaptive immune-related genes in systemic (liver, spleen) and mucosal (gill, intestine) tissues of channel catfish over time following vaccination with live Ich theronts. The vaccinated fish showed significantly higher antibody titers and survival (95%) than those of mock immunized fish. Expression of IgM and IgD heavy chain genes exhibited a rapid increase from 4 h (h4) to 2 days (d2) post-vaccination in systemic immune tissues. Immune cell receptor genes (CD4, CD8-α, MHC I, MHC II β, TcR-α, and TcR-β) were more highly upregulated and remained upregulated for longer duration in systemic tissues than in mucosal tissues of the vaccinated fish. The cytokine genes IL-1βa and IFN-γ were rapidly upregulated in both systemic and mucosal tissues of vaccinated fish, with peak expression from h4 to d1 post-vaccination. Toll-like receptor genes TLR-1 and TLR-9 showed relatively stable upregulation in the gill of immunized fish following vaccination. Results of this study revealed the molecular immune responses in mucosal and systemic tissues of vaccinated fish and demonstrated that Ich vaccination resulted in innate and adaptive immune responses against Ich infection. Published by Elsevier Ltd.

  5. B lymphocyte immune response gene phenotype is genetically determined

    SciTech Connect

    Tse, H.Y.; Mond, J.J.; Longo, D.L.


    We examined the effects of the developmental milieu on the capacity of B cells to undergo immune response gene-controlled, T cell-dependent polyclonal proliferation. Although I-Aq poly(Glu60 Ala30 Tyr10)n (GAT)-nonresponder T cells developing in a responder environment become phenotypic GAT-responders, I-Aq B cells remain unresponsive to GAT, even after maturation in a GAT-responder animal. Conversely, (B10.A x B10.Q)F1 ((GAT responder x GAT nonresponder)F1) T cells developing in a B10.Q GAT nonresponder host fail to respond to GAT, but F1 B cells from the same F1 leads to parent chimeras make excellent proliferative responses in the presence of GAT and responder T cells. Thus, by this assay, B cell immune response gene function is genetically determined and is not affected by the developmental milieu.

  6. Passive immunization against HIV/AIDS by antibody gene transfer.


    Yang, Lili; Wang, Pin


    Despite tremendous efforts over the course of many years, the quest for an effective HIV vaccine by the classical method of active immunization remains largely elusive. However, two recent studies in mice and macaques have now demonstrated a new strategy designated as Vectored ImmunoProphylaxis (VIP), which involves passive immunization by viral vector-mediated delivery of genes encoding broadly neutralizing antibodies (bnAbs) for in vivo expression. Robust protection against virus infection was observed in preclinical settings when animals were given VIP to express monoclonal neutralizing antibodies. This unorthodox approach raises new promise for combating the ongoing global HIV pandemic. In this article, we survey the status of antibody gene transfer, review the revolutionary progress on isolation of extremely bnAbs, detail VIP experiments against HIV and its related virus conduced in humanized mice and macaque monkeys, and discuss the pros and cons of VIP and its opportunities and challenges towards clinical applications to control HIV/AIDS endemics.

  7. Identifying genes that mediate anthracyline toxicity in immune cells

    PubMed Central

    Frick, Amber; Suzuki, Oscar T.; Benton, Cristina; Parks, Bethany; Fedoriw, Yuri; Richards, Kristy L.; Thomas, Russell S.; Wiltshire, Tim


    The role of the immune system in response to chemotherapeutic agents remains elusive. The interpatient variability observed in immune and chemotherapeutic cytotoxic responses is likely, at least in part, due to complex genetic differences. Through the use of a panel of genetically diverse mouse inbred strains, we developed a drug screening platform aimed at identifying genes underlying these chemotherapeutic cytotoxic effects on immune cells. Using genome-wide association studies (GWAS), we identified four genome-wide significant quantitative trait loci (QTL) that contributed to the sensitivity of doxorubicin and idarubicin in immune cells. Of particular interest, a locus on chromosome 16 was significantly associated with cell viability following idarubicin administration (p = 5.01 × 10−8). Within this QTL lies App, which encodes amyloid beta precursor protein. Comparison of dose-response curves verified that T-cells in App knockout mice were more sensitive to idarubicin than those of C57BL/6J control mice (p < 0.05). In conclusion, the cellular screening approach coupled with GWAS led to the identification and subsequent validation of a gene involved in T-cell viability after idarubicin treatment. Previous studies have suggested a role for App in in vitro and in vivo cytotoxicity to anticancer agents; the overexpression of App enhances resistance, while the knockdown of this gene is deleterious to cell viability. Further investigations should include performing mechanistic studies, validating additional genes from the GWAS, including Ppfia1 and Ppfibp1, and ultimately translating the findings to in vivo and human studies. PMID:25926793

  8. Transferred interbacterial antagonism genes augment eukaryotic innate immune function.


    Chou, Seemay; Daugherty, Matthew D; Peterson, S Brook; Biboy, Jacob; Yang, Youyun; Jutras, Brandon L; Fritz-Laylin, Lillian K; Ferrin, Michael A; Harding, Brittany N; Jacobs-Wagner, Christine; Yang, X Frank; Vollmer, Waldemar; Malik, Harmit S; Mougous, Joseph D


    Horizontal gene transfer allows organisms to rapidly acquire adaptive traits. Although documented instances of horizontal gene transfer from bacteria to eukaryotes remain rare, bacteria represent a rich source of new functions potentially available for co-option. One benefit that genes of bacterial origin could provide to eukaryotes is the capacity to produce antibacterials, which have evolved in prokaryotes as the result of eons of interbacterial competition. The type VI secretion amidase effector (Tae) proteins are potent bacteriocidal enzymes that degrade the cell wall when delivered into competing bacterial cells by the type VI secretion system. Here we show that tae genes have been transferred to eukaryotes on at least six occasions, and that the resulting domesticated amidase effector (dae) genes have been preserved for hundreds of millions of years through purifying selection. We show that the dae genes acquired eukaryotic secretion signals, are expressed within recipient organisms, and encode active antibacterial toxins that possess substrate specificity matching extant Tae proteins of the same lineage. Finally, we show that a dae gene in the deer tick Ixodes scapularis limits proliferation of Borrelia burgdorferi, the aetiologic agent of Lyme disease. Our work demonstrates that a family of horizontally acquired toxins honed to mediate interbacterial antagonism confers previously undescribed antibacterial capacity to eukaryotes. We speculate that the selective pressure imposed by competition between bacteria has produced a reservoir of genes encoding diverse antimicrobial functions that are tailored for co-option by eukaryotic innate immune systems.

  9. Epigenetic regulation of inducible gene expression in the immune system.


    Lim, Pek Siew; Li, Jasmine; Holloway, Adele F; Rao, Sudha


    T cells are exquisitely poised to respond rapidly to pathogens and have proved an instructive model for exploring the regulation of inducible genes. Individual genes respond to antigenic stimulation in different ways, and it has become clear that the interplay between transcription factors and the chromatin platform of individual genes governs these responses. Our understanding of the complexity of the chromatin platform and the epigenetic mechanisms that contribute to transcriptional control has expanded dramatically in recent years. These mechanisms include the presence/absence of histone modification marks, which form an epigenetic signature to mark active or inactive genes. These signatures are dynamically added or removed by epigenetic enzymes, comprising an array of histone-modifying enzymes, including the more recently recognized chromatin-associated signalling kinases. In addition, chromatin-remodelling complexes physically alter the chromatin structure to regulate chromatin accessibility to transcriptional regulatory factors. The advent of genome-wide technologies has enabled characterization of the chromatin landscape of T cells in terms of histone occupancy, histone modification patterns and transcription factor association with specific genomic regulatory regions, generating a picture of the T-cell epigenome. Here, we discuss the multi-layered regulation of inducible gene expression in the immune system, focusing on the interplay between transcription factors, and the T-cell epigenome, including the role played by chromatin remodellers and epigenetic enzymes. We will also use IL2, a key inducible cytokine gene in T cells, as an example of how the different layers of epigenetic mechanisms regulate immune responsive genes during T-cell activation.

  10. Origins of immunity: transcription factors and homologues of effector genes of the vertebrate immune system expressed in sea urchin coelomocytes.


    Pancer, Z; Rast, J P; Davidson, E H


    Echinoderms share common ancestry with the chordates within the deuterostome clade. Molecular features that are shared between their immune systems and that of mammals thus illuminate the basal genetic framework on which these immune systems have been constructed during evolution. The immune effector cells of sea urchins are the coelomocytes, whose primary function is protection against invasive marine pathogens; here we identify six genes expressed in coelomocytes, homologues of which are also expressed in cells of the mammalian immune system. Three coelomocyte genes reported here encode transcription factors. These are an NFKB homologue (SpNFKB); a GATA-2/3 homologue (SpGATAc); and a runt domain factor (SpRunt-1). All three of these coelomocyte genes respond sharply to bacterial challenge: SpNFKB and SpRunt-1 genes are rapidly up-regulated, while transcripts of SpGATAc factor disappear within hours of injection of bacteria. Sham injection also activates SpNFKB and SpRunt, though with slower kinetics, but does not affect SpGATAc levels. Another gene, SpHS, encodes a protein related to the signal transduction intermediate HS1 of lymphoid cells. Two other newly discovered genes, SpSRCR1 and SpSRCR5, encode proteins featuring SRCR repeats. These genes are members of a complex family of SRCR genes all expressed specifically in coelomocytes. The SRCR repeats most closely resemble those of mammalian macrophage scavenger receptors. Remarkably, each individual sea urchin expresses a specific pattern of SRCR genes. Our results imply some shared immune functions and more generally, a shared regulatory architecture which underlies immune system gene expression in all deuterostomes. We conclude that the vertebrate immune system has evolved by inserting new genes into old gene regulatory networks dedicated to immunity.

  11. Ten years of gene therapy for primary immune deficiencies.


    Aiuti, Alessandro; Roncarolo, Maria Grazia


    Gene therapy with hematopoietic stem cells (HSC) is an attractive therapeutic strategy for several forms of primary immunodeficiencies. Current approaches are based on ex vivo gene transfer of the therapeutic gene into autologous HSC by vector-mediated gene transfer. In the past decade, substantial progress has been achieved in the treatment of severe combined immundeficiencies (SCID)-X1, adenosine deaminase (ADA)-deficient SCID, and chronic granulomatous disease (CGD). Results of the SCID gene therapy trials have shown long-term restoration of immune competence and clinical benefit in over 30 patients. The inclusion of reduced-dose conditioning in the ADA-SCID has allowed the engraftment of multipotent gene-corrected HSC at substantial level. In the CGD trial significant engraftment and transgene expression were observed, but the therapeutic effect was transient. The occurrence of adverse events related to insertional mutagenesis in the SCID-X1 and CGD trial has highlighted the limitations of current retroviral vector technology. For future applications the risk-benefit evaluation should include the type of vector employed, the disease background and the nature of the transgene. The use of self-inactivating lentiviral vectors will provide significant advantages in terms of natural gene regulation and reduction in the potential for adverse mutagenic events. Following recent advances in preclinical studies, lentiviral vectors are now being translated into new clinical approaches, such as Wiskott-Aldrich Syndrome.

  12. Calcitonin Gene-Related Peptide: Key Regulator of Cutaneous Immunity

    PubMed Central

    Granstein, Richard D.; Wagner, John A.; Stohl, Lori L.; Ding, Wanhong


    Calcitonin gene-related peptide (CGRP) has been viewed as a neuropeptide and vasodilator. However, CGRP is more appropriately thought of as a pleiotropic signaling molecule. Indeed, CGRP has key regulatory functions on immune and inflammatory processes within the skin. CGRP-containing nerves are intimately associated with epidermal LCs and CGRP has profound regulatory effects on Langerhans cell antigen-presenting capability. When LCs are exposed to CGRP in vitro, their ability to present antigen for in vivo priming of naïve mice or elicitation of delayed-type hypersensitivity is inhibited in at least some situations. Administration of CGRP intradermally inhibits acquisition of immunity to Th1-dominant haptens applied to the injected site while augmenting immunity to Th2-dominant haptens, although the cellular targets of activity in these experiments remains unclear. Although CGRP can be a pro-inflammatory agent, several studies have demonstrated that administration of CGRP can inhibit the elicitation of inflammation by inflammatory stimuli in vivo. In this regard, CGRP inhibits the release of certain chemokines by stimulated endothelial cells. This is likely to be physiologically relevant since cutaneous blood vessels are innervated by sensory nerves. Exciting new studies suggest a significant role for CGRP in the pathogenesis of psoriasis and, most strikingly, that CGRP inhibit the ability of LCs to transmit the human immunodeficiency virus 1 to T lymphocytes. A more complete understanding of the role of CGRP in the skin immune system may lead to new and novel approaches for the therapy of immune mediated skin disorders. PMID:25534428

  13. Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.


    Michelucci, Alessandro; Cordes, Thekla; Ghelfi, Jenny; Pailot, Arnaud; Reiling, Norbert; Goldmann, Oliver; Binz, Tina; Wegner, André; Tallam, Aravind; Rausell, Antonio; Buttini, Manuel; Linster, Carole L; Medina, Eva; Balling, Rudi; Hiller, Karsten


    Immunoresponsive gene 1 (Irg1) is highly expressed in mammalian macrophages during inflammation, but its biological function has not yet been elucidated. Here, we identify Irg1 as the gene coding for an enzyme producing itaconic acid (also known as methylenesuccinic acid) through the decarboxylation of cis-aconitate, a tricarboxylic acid cycle intermediate. Using a gain-and-loss-of-function approach in both mouse and human immune cells, we found Irg1 expression levels correlating with the amounts of itaconic acid, a metabolite previously proposed to have an antimicrobial effect. We purified IRG1 protein and identified its cis-aconitate decarboxylating activity in an enzymatic assay. Itaconic acid is an organic compound that inhibits isocitrate lyase, the key enzyme of the glyoxylate shunt, a pathway essential for bacterial growth under specific conditions. Here we show that itaconic acid inhibits the growth of bacteria expressing isocitrate lyase, such as Salmonella enterica and Mycobacterium tuberculosis. Furthermore, Irg1 gene silencing in macrophages resulted in significantly decreased intracellular itaconic acid levels as well as significantly reduced antimicrobial activity during bacterial infections. Taken together, our results demonstrate that IRG1 links cellular metabolism with immune defense by catalyzing itaconic acid production.

  14. Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production

    PubMed Central

    Michelucci, Alessandro; Cordes, Thekla; Ghelfi, Jenny; Pailot, Arnaud; Reiling, Norbert; Goldmann, Oliver; Binz, Tina; Wegner, André; Tallam, Aravind; Rausell, Antonio; Buttini, Manuel; Linster, Carole L.; Medina, Eva; Balling, Rudi; Hiller, Karsten


    Immunoresponsive gene 1 (Irg1) is highly expressed in mammalian macrophages during inflammation, but its biological function has not yet been elucidated. Here, we identify Irg1 as the gene coding for an enzyme producing itaconic acid (also known as methylenesuccinic acid) through the decarboxylation of cis-aconitate, a tricarboxylic acid cycle intermediate. Using a gain-and-loss-of-function approach in both mouse and human immune cells, we found Irg1 expression levels correlating with the amounts of itaconic acid, a metabolite previously proposed to have an antimicrobial effect. We purified IRG1 protein and identified its cis-aconitate decarboxylating activity in an enzymatic assay. Itaconic acid is an organic compound that inhibits isocitrate lyase, the key enzyme of the glyoxylate shunt, a pathway essential for bacterial growth under specific conditions. Here we show that itaconic acid inhibits the growth of bacteria expressing isocitrate lyase, such as Salmonella enterica and Mycobacterium tuberculosis. Furthermore, Irg1 gene silencing in macrophages resulted in significantly decreased intracellular itaconic acid levels as well as significantly reduced antimicrobial activity during bacterial infections. Taken together, our results demonstrate that IRG1 links cellular metabolism with immune defense by catalyzing itaconic acid production. PMID:23610393

  15. Diversification of innate immune genes: lessons from the purple sea urchin.


    Smith, L Courtney


    Pathogen diversification can alter infection virulence, which in turn drives the evolution of host immune diversification, resulting in countermeasures for survival in this arms race. Somatic recombination of the immunoglobulin gene family members is a very effective mechanism to diversify antibodies and T-cell receptors that function in the adaptive immune system. Although mechanisms to diversify innate immune genes are not clearly understood, a seemingly unlikely source for insight into innate immune diversification may be derived from the purple sea urchin, which has recently had its genome sequenced and annotated. Although there are many differences, some characteristics of the sea urchin make for a useful tool to understand the human immune system. The sea urchin is phylogenetically related to humans although, as a group, sea urchins are evolutionarily much older than mammals. Humans require both adaptive and innate immune responses to survive immune challenges, whereas sea urchins only require innate immune functions. Genes that function in immunity tend to be members of families, and the sea urchin has several innate immune gene families. One of these is the Sp185/333 gene family with about 50 clustered members that encode a diverse array of putative immune response proteins. Understanding gene diversification in the Sp185/333 family in the sea urchin may illuminate new mechanisms of diversification that could apply to gene families that function in innate immunity in humans, such as the killer immunoglobulin-like receptor genes.

  16. Ipr1 gene mediates innate immunity to tuberculosis

    PubMed Central

    Pan, Hui; Yan, Bo-Shiun; Rojas, Mauricio; Shebzukhov, Yuriy V.; Zhou, Hongwei; Kobzik, Lester; Higgins, Darren; Daly, Mark; Bloom, Barry R.; Kramnik, Igor


    An estimated 8 million people are infected each year with the pathogen, Mycobacterium tuberculosis, and over 2 million die annually1. Yet only about 10% of those infected develop tuberculosis. Genetic variation within host populations is known to play a significant role in humans and animals 2,3, but the nature of genetic control of host resistance to tuberculosis remains poorly understood. Previously we mapped a new genetic locus on mouse chromosome 1, designated sst1 (for supersusceptibility to tuberculosis1)4. Here we demonstrate in sst1 congenic mouse strains that this locus mediates innate immunity, and identify a candidate gene, Intracellular Pathogen Resistance 1 (Ipr1), within the sst1 locus. The Ipr1 gene is upregulated in the sst1 resistant macrophages upon activation and infection, but is not expressed in the sst1 susceptible macrophages. Expression of the Ipr1 transgene in the sst1 susceptible macrophages limits multiplication not only of MTB but also Listeria monocytogenes and switches a cell death pathway of the infected macrophages from necrosis to apoptosis. Our data suggest that the Ipr1 gene product may play a novel role in integrating signals generated by intracellular pathogens with mechanisms controlling innate immunity, cell death and pathogenesis. PMID:15815631

  17. Y-linked variation for autosomal immune gene regulation has the potential to shape sexually dimorphic immunity.


    Kutch, Ian C; Fedorka, Kenneth M


    Sexually dimorphic phenotypes arise from the differential expression of male and female shared genes throughout the genome. Unfortunately, the underlying molecular mechanisms by which dimorphic regulation manifests and evolves are unclear. Recent work suggests that Y-chromosomes may play an important role, given that Drosophila melanogaster Ys were shown to influence the regulation of hundreds of X and autosomal genes. For Y-linked regulatory variation (YRV) to facilitate sexually dimorphic evolution, however, it must exist within populations (where selection operates) and influence male fitness. These criteria have seldom been investigated, leaving the potential for dimorphic evolution via YRV unclear. Interestingly, male and female D. melanogaster differ in immune gene regulation. Furthermore, immune gene regulation appears to be influenced by the Y-chromosome, suggesting it may contribute to dimorphic immune evolution. We address this possibility by introgressing Y-chromosomes from a single wild population into an isogenic background (to create Y-lines) and assessing immune gene regulation and bacterial defence. We found that Y-line males differed in their immune gene regulation and their ability to defend against Serratia marcescens. Moreover, gene expression and bacterial defence were positively genetically correlated. These data indicate that the Y-chromosome has the potential to shape the evolution of sexually dimorphic immunity in this system.

  18. Y-linked variation for autosomal immune gene regulation has the potential to shape sexually dimorphic immunity

    PubMed Central

    Kutch, Ian C.; Fedorka, Kenneth M.


    Sexually dimorphic phenotypes arise from the differential expression of male and female shared genes throughout the genome. Unfortunately, the underlying molecular mechanisms by which dimorphic regulation manifests and evolves are unclear. Recent work suggests that Y-chromosomes may play an important role, given that Drosophila melanogaster Ys were shown to influence the regulation of hundreds of X and autosomal genes. For Y-linked regulatory variation (YRV) to facilitate sexually dimorphic evolution, however, it must exist within populations (where selection operates) and influence male fitness. These criteria have seldom been investigated, leaving the potential for dimorphic evolution via YRV unclear. Interestingly, male and female D. melanogaster differ in immune gene regulation. Furthermore, immune gene regulation appears to be influenced by the Y-chromosome, suggesting it may contribute to dimorphic immune evolution. We address this possibility by introgressing Y-chromosomes from a single wild population into an isogenic background (to create Y-lines) and assessing immune gene regulation and bacterial defence. We found that Y-line males differed in their immune gene regulation and their ability to defend against Serratia marcescens. Moreover, gene expression and bacterial defence were positively genetically correlated. These data indicate that the Y-chromosome has the potential to shape the evolution of sexually dimorphic immunity in this system. PMID:26631557

  19. Immune- and wound-dependent differential gene expression in an ancient insect.


    Johnston, Paul R; Rolff, Jens


    Two of the main functions of the immune system are to control infections and to contribute to wound closure. Here we present the results of an RNAseq study of immune- and wound-response gene expression in the damselfly Coenagrion puella, a representative of the odonates, the oldest taxon of winged insects. De novo assembly of RNAseq data revealed a rich repertoire of canonical immune pathways, as known from model insects, including recognition, transduction and effector gene expression. A shared set of immune and wound repair genes were differentially expressed in both wounded and immune-challenged larvae. Moreover 3-fold more immune genes were induced only in the immune-challenged treatment. This is consistent with the notion that the immune-system reads a balance of signals related to wounding and infection and that the response is tailored accordingly.

  20. Royal Decree: Gene Expression in Trans-Generationally Immune Primed Bumblebee Workers Mimics a Primary Immune Response.


    Barribeau, Seth M; Schmid-Hempel, Paul; Sadd, Ben M


    Invertebrates lack the cellular and physiological machinery of the adaptive immune system, but show specificity in their immune response and immune priming. Functionally, immune priming is comparable to immune memory in vertebrates. Individuals that have survived exposure to a given parasite are better protected against subsequent exposures. Protection may be cross-reactive, but demonstrations of persistent and specific protection in invertebrates are increasing. This immune priming can cross generations ("trans-generational" immune priming), preparing offspring for the prevailing parasite environment. While these phenomena gain increasing support, the mechanistic foundations underlying such immune priming, both within and across generations, remain largely unknown. Using a transcriptomic approach, we show that exposing bumblebee queens with an injection of heat-killed bacteria, known to induce trans-generational immune priming, alters daughter (worker) gene expression. Daughters, even when unexposed themselves, constitutively express a core set of the genes induced upon direct bacterial exposure, including high expression of antimicrobial peptides, a beta-glucan receptor protein implicated in bacterial recognition and the induction of the toll signaling pathway, and slit-3 which is important in honeybee immunity. Maternal exposure results in a distinct upregulation of their daughters' immune system, with a signature overlapping with the induced individual response to a direct exposure. This will mediate mother-offspring protection, but also associated costs related to reconfiguration of constitutive immune expression. Moreover, identification of conserved immune pathways in memory-like responses has important implications for our understanding of the innate immune system, including the innate components in vertebrates, which share many of these pathways.

  1. Successive Losses of Central Immune Genes Characterize the Gadiformes’ Alternate Immunity

    PubMed Central

    Solbakken, Monica H.; Rise, Matthew L.; Jakobsen, Kjetill S.; Jentoft, Sissel


    Great genetic variability among teleost immunomes, with gene losses and expansions of central adaptive and innate components, has been discovered through genome sequencing over the last few years. Here, we demonstrate that the innate Myxovirus resistance gene (Mx) is lost from the ancestor of Gadiformes and the closely related Stylephorus chordatus, thus predating the loss of Major Histocompatibility Complex class II (MHCII) in Gadiformes. Although the functional implication of Mx loss is still unknown, we demonstrate that this loss is one of several ancient events appearing in successive order throughout the evolution of teleost immunity. In particular, we find that the loss of Toll-like receptor 5 predates the loss of Mx involving the entire Paracanthopterygii lineage. Using a time-calibrated phylogeny, we show that loss of MHCII and Mx overlap with major paleoclimatic and geological events indicating that these genetic changes were adaptive responses to the changing environment at the time. PMID:27797950

  2. Successive Losses of Central Immune Genes Characterize the Gadiformes' Alternate Immunity.


    Solbakken, Monica H; Rise, Matthew L; Jakobsen, Kjetill S; Jentoft, Sissel


    Great genetic variability among teleost immunomes, with gene losses and expansions of central adaptive and innate components, has been discovered through genome sequencing over the last few years. Here, we demonstrate that the innate Myxovirus resistance gene (Mx) is lost from the ancestor of Gadiformes and the closely related Stylephorus chordatus, thus predating the loss of Major Histocompatibility Complex class II (MHCII) in Gadiformes. Although the functional implication of Mx loss is still unknown, we demonstrate that this loss is one of several ancient events appearing in successive order throughout the evolution of teleost immunity. In particular, we find that the loss of Toll-like receptor 5 predates the loss of Mx involving the entire Paracanthopterygii lineage. Using a time-calibrated phylogeny, we show that loss of MHCII and Mx overlap with major paleoclimatic and geological events indicating that these genetic changes were adaptive responses to the changing environment at the time.

  3. Multiple common variants for celiac disease influencing immune gene expression

    PubMed Central

    Dubois, Patrick CA; Trynka, Gosia; Franke, Lude; Hunt, Karen A; Romanos, Jihane; Curtotti, Alessandra; Zhernakova, Alexandra; Heap, Graham AR; Ádány, Róza; Aromaa, Arpo; Bardella, Maria Teresa; van den Berg, Leonard H; Bockett, Nicholas A; de la Concha, Emilio G.; Dema, Bárbara; Fehrmann, Rudolf SN; Fernández-Arquero, Miguel; Fiatal, Szilvia; Grandone, Elvira; Green, Peter M; Groen, Harry JM; Gwilliam, Rhian; Houwen, Roderick HJ; Hunt, Sarah E; Kaukinen, Katri; Kelleher, Dermot; Korponay-Szabo, Ilma; Kurppa, Kalle; MacMathuna, Padraic; Mäki, Markku; Mazzilli, Maria Cristina; McCann, Owen T; Mearin, M Luisa; Mein, Charles A; Mirza, Muddassar M; Mistry, Vanisha; Mora, Barbara; Morley, Katherine I; Mulder, Chris J; Murray, Joseph A; Núñez, Concepción; Oosterom, Elvira; Ophoff, Roel A; Polanco, Isabel; Peltonen, Leena; Platteel, Mathieu; Rybak, Anna; Salomaa, Veikko; Schweizer, Joachim J; Sperandeo, Maria Pia; Tack, Greetje J; Turner, Graham; Veldink, Jan H; Verbeek, Wieke HM; Weersma, Rinse K; Wolters, Victorien M; Urcelay, Elena; Cukrowska, Bozena; Greco, Luigi; Neuhausen, Susan L.; McManus, Ross; Barisani, Donatella; Deloukas, Panos; Barrett, Jeffrey C; Saavalainen, Paivi; Wijmenga, Cisca; van Heel, David A


    We performed a second-generation genome wide association study of 4,533 celiac disease cases and 10,750 controls. We genotyped 113 selected SNPs with PGWAS<10−4, and 18 SNPs from 14 known loci, in a further 4,918 cases and 5,684 controls. Variants from 13 new regions reached genome wide significance (Pcombined<5×10−8), most contain immune function genes (BACH2, CCR4, CD80, CIITA/SOCS1/CLEC16A, ICOSLG, ZMIZ1) with ETS1, RUNX3, THEMIS and TNFRSF14 playing key roles in thymic T cell selection. A further 13 regions had suggestive association evidence. In an expression quantitative trait meta-analysis of 1,469 whole blood samples, 20 of 38 (52.6%) tested loci had celiac risk variants correlated (P<0.0028, FDR 5%) with cis gene expression. PMID:20190752

  4. Evading the immune response upon in vivo gene therapy with viral vectors

    PubMed Central

    Sack, Brandon K


    Gene therapy has the potential to provide minimally invasive and long-term treatment for many inherited disorders that otherwise have poor prognoses and limited treatment options. The sustained therapeutic correction of genetic disease by viral gene transfer has been accomplished in patients with severe immune deficiencies, or by the transduction of an immune privileged site for the treatment of ocular disease. For other diseases and target tissues, immune responses to vectors or transgene products often present major obstacles for therapy. Innate and adaptive immunity, sometimes including preexisting or memory responses, may contribute by varying degrees to immune-mediated rejection and immunotoxicity. This review provides an overview of the immune responses to in vivo gene transfer with the most commonly used viral gene therapy vectors, and discusses strategies and protocols employed in evading the immune system in order to provide optimal gene therapy. PMID:19806497

  5. Passive Immunization against HIV/AIDS by Antibody Gene Transfer

    PubMed Central

    Yang, Lili; Wang, Pin


    Despite tremendous efforts over the course of many years, the quest for an effective HIV vaccine by the classical method of active immunization remains largely elusive. However, two recent studies in mice and macaques have now demonstrated a new strategy designated as Vectored ImmunoProphylaxis (VIP), which involves passive immunization by viral vector-mediated delivery of genes encoding broadly neutralizing antibodies (bnAbs) for in vivo expression. Robust protection against virus infection was observed in preclinical settings when animals were given VIP to express monoclonal neutralizing antibodies. This unorthodox approach raises new promise for combating the ongoing global HIV pandemic. In this article, we survey the status of antibody gene transfer, review the revolutionary progress on isolation of extremely bnAbs, detail VIP experiments against HIV and its related virus conduced in humanized mice and macaque monkeys, and discuss the pros and cons of VIP and its opportunities and challenges towards clinical applications to control HIV/AIDS endemics. PMID:24473340

  6. Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes.


    Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril


    In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  7. Genetic and evolutionary patterns of innate immune genes in the Pacific oyster Crassostrea gigas.


    Song, Kai; Li, Yingxiang; Huang, Baoyu; Li, Li; Zhang, Guofan


    The invertebrate innate immune system functions in immune defence and the stress response. However, knowledge of the genetic and evolutionary patterns of innate immune genes in Mollusca is limited, especially for oysters. Such information would help clarify how oysters adapt to pathogen-rich environments. Here, we characterized the genetic and evolutionary patterns of the innate immune genes in Crassostrea gigas, using population diversity analysis and evolution rates comparison. Innate immune genes have higher median nucleotide diversity than non-immune genes. Nucleotide diversity varied with functional regions and different immune-related gene families. Evolutionary analysis of two Crassostrea species showed that the innate immune genes are less conserved and have higher rates of evolution in C. gigas. We also noted a positive association between nucleotide diversity and selective pressures for genes having orthologues. Our findings will help determine the evolutionary patterns of innate immune genes and the association of these genes with mollusc immunity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Characterization of rainbow trout (Oncorhynchus mykiss) spleen transcriptome and identification of immune-related genes

    USDA-ARS?s Scientific Manuscript database

    Resistance against specific diseases is affecting profitability in fish production systems including rainbow trout. Limited information is known about functions and mechanisms of the immune gene pathways in teleosts. Immunogenomics are powerful tools to determine immune-related genes/gene pathways a...

  9. Gene Therapy for the Treatment of Primary Immune Deficiencies.


    Kuo, Caroline Y; Kohn, Donald B


    The use of gene therapy in the treatment of primary immune deficiencies (PID) has advanced significantly in the last decade. Clinical trials for X-linked severe combined immunodeficiency, adenosine deaminase deficiency (ADA), chronic granulomatous disease, and Wiskott-Aldrich syndrome have demonstrated that gene transfer into hematopoietic stem cells and autologous transplant can result in clinical improvement and is curative for many patients. Unfortunately, early clinical trials were complicated by vector-related insertional mutagenic events for several diseases with the exception of ADA-deficiency SCID. These results prompted the current wave of clinical trials for primary immunodeficiency using alternative retro- or lenti-viral vector constructs that are self-inactivating, and they have shown clinical efficacy without leukemic events thus far. The field of gene therapy continues to progress, with improvements in viral vector profiles, stem cell culturing techniques, and site-specific genome editing platforms. The future of gene therapy is promising, and we are quickly moving towards a time when it will be a standard cellular therapy for many forms of PID.

  10. Next-Generation Sequencing and the Crustacean Immune System: The Need for Alternatives in Immune Gene Annotation.


    Clark, K F; Greenwood, Spencer J


    Next-generation sequencing has been a huge benefit to investigators studying non-model species. High-throughput gene expression studies, which were once restricted to animals with extensive genomic resources, can now be applied to any species. Transcriptomic studies using RNA-Seq can discover hundreds of thousands of transcripts from any species of interest. The power and limitation of these techniques is the sheer size of the dataset that is acquired. Parsing these large datasets is becoming easier as more bioinformatic tools are available for biologists without extensive computer programming expertise. Gene annotation and physiological pathway tools such as Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) Orthology enable the application of the vast amount of information acquired from model organisms to non-model species. While noble in nature, utilization of these tools can inadvertently misrepresent transcriptomic data from non-model species via annotation omission. Annotation followed by molecular pathway analysis highlights pathways that are disproportionately affected by disease, stress, or the physiological condition being examined. Problems occur when gene annotation procedures only recognizes a subset, often 50% or less, of the genes differently expressed from a non-model organisms. Annotated transcripts normally belong to highly conserved metabolic or regulatory genes that likely have a secondary or tertiary role, if any at all, in immunity. They appear to be disproportionately affected simply because conserved genes are most easily annotated. Evolutionarily induced specialization of physiological pathways is a driving force of adaptive evolution, but it results in genes that have diverged sufficiently to prevent their identification and annotation through conventional gene or protein databases. The purpose of this manuscript is to highlight some of the challenges faced when annotating crustacean immune genes by using an American lobster

  11. The identification of immune genes in the milk transcriptome of the Tasmanian devil (Sarcophilus harrisii)

    PubMed Central

    Hewavisenti, Rehana V.; Morris, Katrina M.; O’Meally, Denis; Cheng, Yuanyuan; Papenfuss, Anthony T.


    Tasmanian devil (Sarcophilus harrisii) pouch young, like other marsupials, are born underdeveloped and immunologically naïve, and are unable to mount an adaptive immune response. The mother’s milk provides nutrients for growth and development as well as providing passive immunity. To better understand immune response in this endangered species, we set out to characterise the genes involved in passive immunity by sequencing and annotating the transcriptome of a devil milk sample collected during mid-lactation. At mid-lactation we expect the young to have heightened immune responses, as they have emerged from the pouch, encountering new pathogens. A total of 233,660 transcripts were identified, including approximately 17,827 unique protein-coding genes and 846 immune genes. The most highly expressed transcripts were dominated by milk protein genes such as those encoding early lactation protein, late lactation proteins, α-lactalbumin, α-casein and β-casein. There were numerous highly expressed immune genes including lysozyme, whey acidic protein, ferritin and major histocompatibility complex I and II. Genes encoding immunoglobulins, antimicrobial peptides, chemokines and immune cell receptors were also identified. The array of immune genes identified in this study reflects the importance of the milk in providing immune protection to Tasmanian devil young and provides the first insight into Tasmanian devil milk. PMID:26793426

  12. The identification of immune genes in the milk transcriptome of the Tasmanian devil (Sarcophilus harrisii).


    Hewavisenti, Rehana V; Morris, Katrina M; O'Meally, Denis; Cheng, Yuanyuan; Papenfuss, Anthony T; Belov, Katherine


    Tasmanian devil (Sarcophilus harrisii) pouch young, like other marsupials, are born underdeveloped and immunologically naïve, and are unable to mount an adaptive immune response. The mother's milk provides nutrients for growth and development as well as providing passive immunity. To better understand immune response in this endangered species, we set out to characterise the genes involved in passive immunity by sequencing and annotating the transcriptome of a devil milk sample collected during mid-lactation. At mid-lactation we expect the young to have heightened immune responses, as they have emerged from the pouch, encountering new pathogens. A total of 233,660 transcripts were identified, including approximately 17,827 unique protein-coding genes and 846 immune genes. The most highly expressed transcripts were dominated by milk protein genes such as those encoding early lactation protein, late lactation proteins, α-lactalbumin, α-casein and β-casein. There were numerous highly expressed immune genes including lysozyme, whey acidic protein, ferritin and major histocompatibility complex I and II. Genes encoding immunoglobulins, antimicrobial peptides, chemokines and immune cell receptors were also identified. The array of immune genes identified in this study reflects the importance of the milk in providing immune protection to Tasmanian devil young and provides the first insight into Tasmanian devil milk.

  13. Sequential displacement of Type VI Secretion System effector genes leads to evolution of diverse immunity gene arrays in Vibrio cholerae

    PubMed Central

    Kirchberger, Paul C.; Unterweger, Daniel; Provenzano, Daniele; Pukatzki, Stefan; Boucher, Yan


    Type VI secretion systems (T6SS) enable bacteria to engage neighboring cells in contact-dependent competition. In Vibrio cholerae, three chromosomal clusters each encode a pair of effector and immunity genes downstream of those encoding the T6SS structural machinery for effector delivery. Different combinations of effector-immunity proteins lead to competition between strains of V. cholerae, which are thought to be protected only from the toxicity of their own effectors. Screening of all publically available V. cholerae genomes showed that numerous strains possess long arrays of orphan immunity genes encoded in the 3′ region of their T6SS clusters. Phylogenetic analysis reveals that these genes are highly similar to those found in the effector-immunity pairs of other strains, indicating acquisition by horizontal gene transfer. Extensive genomic comparisons also suggest that successive addition of effector-immunity gene pairs replaces ancestral effectors, yet retains the cognate immunity genes. The retention of old immunity genes perhaps provides protection against nearby kin bacteria in which the old effector was not replaced. This mechanism, combined with frequent homologous recombination, is likely responsible for the high diversity of T6SS effector-immunity gene profiles observed for V. cholerae and closely related species. PMID:28327641

  14. A database for the analysis of immunity genes in Drosophila

    PubMed Central

    Lee, Mark J; Mondal, Ariful; Small, Chiyedza; Paddibhatla, Indira; Kawaguchi, Akira


    While microarray experiments generate voluminous data, discerning trends that support an existing or alternative paradigm is challenging. To synergize hypothesis building and testing, we designed the Pathogen Associated Drosophila MicroArray (PADMA) Database for easy retrieval and comparison of microarray results from immunity-related experiments ( PADMA also allows biologists to upload their microarray-results and compare it with datasets housed within the database. We tested PADMA using a preliminary dataset from Ganaspis xanthopoda-infected fly larvae, and uncovered unexpected trends in gene expression, reshaping our hypothesis. Thus, the PADMA database will be a useful resource to fly researchers to evaluate, revise and refine hypotheses. PMID:21273816

  15. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes

    NASA Astrophysics Data System (ADS)

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.


    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring.

  16. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport- and apolipoprotein genes

    PubMed Central

    Skjærven, Kaja H.; Jakt, Lars Martin; Dahl, John Arne; Espe, Marit; Aanes, Håvard; Hamre, Kristin; Fernandes, Jorge M. O.


    World Health Organization is concerned for parental vitamin deficiency and its effect on offspring health. This study examines the effect of a marginally dietary-induced parental one carbon (1-C) micronutrient deficiency on embryonic gene expression using zebrafish. Metabolic profiling revealed a reduced 1-C cycle efficiency in F0 generation. Parental deficiency reduced the fecundity and a total of 364 genes were differentially expressed in the F1 embryos. The upregulated genes (53%) in the deficient group were enriched in biological processes such as immune response and blood coagulation. Several genes encoding enzymes essential for the 1-C cycle and for lipid transport (especially apolipoproteins) were aberrantly expressed. We show that a parental diet deficient in micronutrients disturbs the expression in descendant embryos of genes associated with overall health, and result in inherited aberrations in the 1-C cycle and lipid metabolism. This emphasises the importance of parental micronutrient status for the health of the offspring. PMID:27731423

  17. Characterization of the rainbow trout spleen transcriptome and identification of immune-related genes

    USDA-ARS?s Scientific Manuscript database

    Disease susceptibility affects production efficiency and profitability in rainbow trout aquaculture. There is limited information available regarding the functions and mechanisms of teleost immune pathways. Immunogenomics provides powerful approaches to identify disease resistance genes/gene pathway...

  18. [Expression and immunity of multi-HIV B'/C subype genes in replicating DNA vaccines].


    Gao, Ying-ying; Deng, Yao; Qi, Xiang-rong; Zhang, Xiang-min; Meng, Xin; Wang, Hui-juan; Tan, Wen-jie; Ruan, Li


    To understand the effect of various gene structures of HIV B'/C subtype on the gene expression and immunity in DNA vaccine, replicating DNA vector pSCK2 was used to construct seven DNA vaccines carrying one or more of HIV B'/C subtype genes: gagpol, gp160 and rtn (rev, tat and nef fusion gene). Immunofluorescence staining indicated that Gag, Gp160, Rev, Tat and Nef could be expressed from the seven DNA vaccines. Stronger expression was observed with the gene in single-gene expression plasmid or with the gene located at upper-IRES in double- or multi-gene expression plasmid. ELISA test showed that Gag induced higher antibody response, but the antibody titers stimulated by Gp160, Pol, or RTN were very low. Both Gag single-gene expression plasmid and Gag-RTN double-gene expression plasmid separately inoculating induced stronger antibody response against Gag than Gag-Gp160 double-gene expression plasmid and Gagpol-Gp160-RTN multi-gene expression plasmid or combined inoculation of Gag and Gp160 single-gene expression plasmids did. ELISPOT detection showed that all the seven DNA vaccines could stimulate cellular immune response against Gag, Pol, Gp160, Tat, and Nef, respectively. Gagpol or Gp160 single-gene expression plasmid separately inoculating stimulated the strongest cellular immune response. Tat and Nef expressed in all the plasmids induced similar immune response. These results indicated that HIV B'/C subtype genes gagpol, gp160 and rtn could be efficiently expressed in the replicating DNA vaccine vector, single-gene expression plasmid had the higher gene expression level and induced stronger immune response; combined immunization of Gagpol and Gp160 had dramatically lower immunity than Gagpol or Gp160 separated immunization did. Immunity of RTN had no difference between combined and separated immunizations. Therefore, in case of immunization with DNA vaccines containing different HIV genes, it is necessary to optimize the combined immunization procedure

  19. Effect of feeding Lipopolysaccharide as an immunostimulant on immune response and immune gene expression of Labeo bata.


    Sahoo, Lopamudra; Parhi, Janmejay; Debnath, Chandan; Prasad, Kurcheti Pani


    This study investigates the effects of dietary lipopolysaccharide (LPS) as an immunostimulant on hematology, innate immunity, immune gene expression and protection against Edwardsiella tarda on Labeo bata. A basal diet supplemented with 0, 50, 100 and 150mg LPS kg(-1)diet was fed to the four different groups for 30days. The haematological (total erythrocyte count, total leukocyte count, total serum protein, albumin and globulin), innate immune parameters (respiratory burst, serum lysozyme, myeloperoxidase and serum bactericidal activity), immune gene expression (C3, β-2 microglobulin, lysozyme g, transferrin, IFN-1, IFN-γ) were monitored at 7th, 15th, 30th day and one day post challenge (DPC) with E. tarda. All the studied haematological, innate immune parameters and expression of immune gene increased significantly (p≤0.05) in LPS fed group in comparison with control. However the group fed 100mgkg(-1) LPS in feed showed highest activity on 7th day and 1DPC. The group fed 100mgkg(-1) LPS also recorded highest relative percent survivability after challenge with E. tarda. Therefore this study suggests that LPS at 100mgkg(-1) could be used as an immunostimulant in feed to enhance the protection of bata during periods of increased disease risk. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. From mammals to viruses: the Schlafen genes in developmental, proliferative and immune processes.


    de la Casa-Esperón, Elena


    The Schlafen genes have been associated with proliferation control and with several differentiation processes, as well as with disparate phenotypes such as immune response, embryonic lethality and meiotic drive. They constitute a gene family with widespread distribution in mammals, where they are expressed in several tissues, predominantly those of the immune system. Moreover, horizontal transfer of these genes to orthopoxviruses suggests a role of the viral Schlafens in evasion to the host immune response. The expression and functional studies of this gene family will be reviewed under the prism of their evolution and diversification, the challenges they pose and the future avenues of research.

  1. Fight or flight? - Flight increases immune gene expression but does not help to fight an infection.


    Woestmann, L; Kvist, J; Saastamoinen, M


    Flight represents a key trait in most insects, being energetically extremely demanding, yet often necessary for foraging and reproduction. Additionally, dispersal via flight is especially important for species living in fragmented landscapes. Even though, based on life-history theory, a negative relationship may be expected between flight and immunity, a number of previous studies have indicated flight to induce an increased immune response. In this study, we assessed whether induced immunity (i.e. immune gene expression) in response to 15-min forced flight treatment impacts individual survival of bacterial infection in the Glanville fritillary butterfly (Melitaea cinxia). We were able to confirm previous findings of flight-induced immune gene expression, but still observed substantially stronger effects on both gene expression levels and life span due to bacterial infection compared to flight treatment. Even though gene expression levels of some immunity-related genes were elevated due to flight, these individuals did not show increased survival of bacterial infection, indicating that flight-induced immune activation does not completely protect them from the negative effects of bacterial infection. Finally, an interaction between flight and immune treatment indicated a potential trade-off: flight treatment increased immune gene expression in naïve individuals only, whereas in infected individuals no increase in immune gene expression was induced by flight. Our results suggest that the up-regulation of immune genes upon flight is based on a general stress response rather than reflecting an adaptive response to cope with potential infections during flight or in new habitats.

  2. Identification of immune response-related genes in the Chinese oak silkworm, Antheraea pernyi by suppression subtractive hybridization.


    Liu, Qiu-Ning; Zhu, Bao-Jian; Wang, Lei; Wei, Guo-Qing; Dai, Li-Shang; Lin, Kun-Zhang; Sun, Yu; Qiu, Jian-Feng; Fu, Wei-Wei; Liu, Chao-Liang


    Insects possess an innate immune system that responds to invading microorganisms. In this study, a subtractive cDNA library was constructed to screen for immune response-related genes in the fat bodies of Antheraea pernyi (Lepidoptera: Saturniidae) pupa challenged with Escherichia coli. Four hundred putative EST clones were identified by suppression subtractive hybridization (SSH), including 50 immune response-related genes, three cytoskeleton genes, eight cell cycle and apoptosis genes, five respiration and energy metabolism genes, five transport genes, 40 metabolism genes, ten stress response genes, four transcription and translation regulation genes and 77 unknown genes. To verify the reliability of the SSH data, the transcription of a set of randomly selected immune response-related genes were confirmed by semi-quantitative reverse transcription-PCR (RT-PCR) and real-time quantitative reverse transcription-PCR (qRT-PCR). These identified immune response-related genes provide insight into understanding the innate immunity in A. pernyi.

  3. Genome-Wide RNAi Screens in C. elegans to Identify Genes Influencing Lifespan and Innate Immunity.


    Sinha, Amit; Rae, Robbie


    RNA interference is a rapid, inexpensive, and highly effective tool used to inhibit gene function. In C. elegans, whole genome screens have been used to identify genes involved with numerous traits including aging and innate immunity. RNAi in C. elegans can be carried out via feeding, soaking, or injection. Here we outline protocols used to maintain, grow, and carry out RNAi via feeding in C. elegans and determine whether the inhibited genes are essential for lifespan or innate immunity.

  4. Massive expansion and functional divergence of innate immune genes in a protostome

    PubMed Central

    Zhang, Linlin; Li, Li; Guo, Ximing; Litman, Gary W.; Dishaw, Larry J.; Zhang, Guofan


    The molecules that mediate innate immunity are encoded by relatively few genes and exhibit broad specificity. Detailed annotation of the Pacific oyster (Crassostrea gigas) genome, a protostome invertebrate, reveals large-scale duplication and divergence of multigene families encoding molecules that effect innate immunity. Transcriptome analyses indicate dynamic and orchestrated specific expression of numerous innate immune genes in response to experimental challenge with pathogens, including bacteria, and a pathogenic virus. Variable expression of individual members of the multigene families encoding these genes also occurs during different types of abiotic stress (environmentally-equivalent conditions of temperature, salinity and desiccation). Multiple families of immune genes are responsive in concert to certain biotic and abiotic challenges. Individual members of expanded families of immune genes are differentially expressed under both biotic challenge and abiotic stress conditions. Members of the same families of innate immune molecules also are transcribed in developmental stage- and tissue-specific manners. An integrated, highly complex innate immune system that exhibits remarkable discriminatory properties and responses to different pathogens as well as environmental stress has arisen through the adaptive recruitment of tandem duplicated genes. The co-adaptive evolution of stress and innate immune responses appears to have an ancient origin in phylogeny. PMID:25732911

  5. Identification and evolution of an NFAT gene involving Branchiostoma belcheri innate immunity.


    Song, Xiaojun; Hu, Jing; Jin, Ping; Chen, Liming; Ma, Fei


    The Nuclear Factor of Activated T cells (NFAT) plays an important role in innate and adaptive immunity, but no NFAT genes have yet been identified in amphioxus species. Here we identified and characterized an NFAT-like gene from Branchiostoma belcheri, and also studied extensively the evolutionary history of NFAT family genes. We found that the amphioxus genome contains an AmphiNFAT gene encoding an NFAT homolog. The AmphiNFAT gene was found to be involved in the innate immune response to LPS stimulation in B. belcheri and was ubiquitously and differentially expressed in all investigated tissues. The NFAT family genes were present in a common ancestor with cnidaria, and NFAT1-4 paralogs were lost early in Branchiostoma and Strongylocentrotus genomes. We discovered that NFAT family genes underwent strong purifying selection. Taken together, our findings provide an insight into the innate immune response of amphioxus and the evolution of the NFAT gene family.

  6. Microarray expression analysis of genes involved in innate immune memory in peritoneal macrophages.


    Yoshida, Keisuke; Renard-Guillet, Claire; Inoue, Kentaro; Shirahige, Katsuhiko; Okada-Hatakeyama, Mariko; Ishii, Shunsuke


    Immunological memory has been believed to be a feature of the adaptive immune system for long period, but recent reports suggest that the innate immune system also exhibits memory-like reaction. Although evidence of innate immune memory is accumulating, no in vivo experimental data has clearly implicated a molecular mechanism, or even a cell-type, for this phenomenon. In this study of data deposited into Gene Expression Omnibus (GEO) under GSE71111, we analyzed the expression profile of peritoneal macrophages isolated from mice pre-administrated with toll-like receptor (TLR) ligands, mimicking pathogen infection. In these macrophages, increased expression of a group of innate immunity-related genes was sustained over a long period of time, and these genes overlapped with ATF7-regulated genes. We conclude that ATF7 plays an important role in innate immune memory in macrophages.

  7. Do the genes of the innate immune response contribute to neuroprotection in Drosophila?


    Cantera, Rafael; Barrio, Rosa


    A profound debate exists on the relationship between neurodegeneration and the innate immune response in humans. Although it is clear that such a relation exists, the causes and consequences of this complex association remain to be determined in detail. Drosophila is being used to investigate the mechanisms involved in neurodegeneration, and all genomic studies on this issue have generated gene catalogues enriched in genes of the innate immune response. We review the data reported in these publications and propose that the abundance of immune genes in studies of neurodegeneration reflects at least two phenomena: (i) some proteins have functions in both immune and nervous systems, and (ii) immune genes might also be of neuroprotective value in Drosophila. This review opens this debate in Drosophila, which could thus be used as an instrumental model to elucidate this question.

  8. Reporter gene imaging of immune responses to cancer: progress and challenges.


    Dubey, Purnima


    Immune responses to cancer are dynamic processes which take place through the concerted activity of innate and adaptive cell populations. In order to fully understand the efficacy of immune therapies for cancer, it is critical to understand how the treatment modulates the function of each cell type involved in the anti-tumor immune response. Molecular imaging is a versatile method for longitudinal studies of cellular localization and function. The development of reporter genes for tracking cell movement and function was a powerful addition to the immunologist's toolbox. This review will highlight the advances and challenges in the use of reporter gene imaging to track immune cell localization and function in cancer.

  9. Comparative tissue expression of American lobster (Homarus americanus) immune genes during bacterial and scuticociliate challenge.


    Clark, K Fraser; Acorn, Adam R; Wang, Haili; Greenwood, Spencer J


    The American lobster (Homarus americanus) fishery is the most economically significant fishery in Canada; although comparatively little is known about the lobsters' response to pathogenic challenge. This is the first study to investigate the expression of immune genes in tissues outside of the lobster hepatopancreas in response to challenges by the Gram-positive bacteria, Aerococcus viridans var. homari or the scuticociliate parasite, Anophryoides haemophila. The hepatopancreas has been regarded as the major humoral immune organ in crustaceans, but the contribution of other organs and tissues to the molecular immune response has largely been overlooked. This study used RT-qPCR to monitor the gene expression of several immune genes including three anti-lipopolysaccharide isoforms (ALF) Homame ALF-B1, Homame ALF-C1 and ALFHa-1, acute phase serum amyloid protein A (SAA), as well as thioredoxin and hexokinase, in antennal gland and gill tissues. Our findings indicate that the gene expression of the SAA and all ALF isoforms in the antennal gland and gill tissues increased in response to pathogenic challenge. However, there was differential expression of individual ALF isoforms that were dependent on both the tissue, and the pathogen used in the challenge. The gene expression changes of several immune genes were found to be higher in the antennal gland than have been previously reported for the hepatopancreas. This study demonstrates that increased immune gene expression from the gill and antennal gland over the course of pathogen induced disease contributes to the immune response of H. americanus.

  10. Lung Adenocarcinoma and Squamous Cell Carcinoma Gene Expression Subtypes Demonstrate Significant Differences in Tumor Immune Landscape.


    Faruki, Hawazin; Mayhew, Gregory M; Serody, Jonathan S; Hayes, D Neil; Perou, Charles M; Lai-Goldman, Myla


    Molecular subtyping of lung adenocarcinoma (AD) and lung squamous cell carcinoma (SCC) reveal biologically diverse tumors that vary in their genomic and clinical attributes. Published immune cell signatures and several lung AD and SCC gene expression data sets, including The Cancer Genome Atlas, were used to examine immune response in relation to AD and SCC expression subtypes. Expression of immune cell populations and other immune related genes, including CD274 molecule gene (CD274) (programmed death ligand 1), was investigated in the tumor microenvironment relative to the expression subtypes of the AD (terminal respiratory unit, proximal proliferative, and proximal inflammatory) and SCC (primitive, classical, secretory, and basal) subtypes. Lung AD and SCC expression subtypes demonstrated significant differences in tumor immune landscape. The proximal proliferative subtype of AD demonstrated low immune cell expression among ADs whereas the secretory subtype showed elevated immune cell expression among SCCs. Tumor expression subtype was a better predictor of immune cell expression than CD274 (programmed death ligand 1) in SCC tumors but was a comparable predictor in AD tumors. Nonsilent mutation burden was not correlated with immune cell expression across subtypes; however, major histocompatibility complex class II gene expression was highly correlated with immune cell expression. Increased immune and major histocompatibility complex II gene expression was associated with improved survival in the terminal respiratory unit and proximal inflammatory subtypes of AD and in the primitive subtype of SCC. Molecular expression subtypes of lung AD and SCC demonstrate key and reproducible differences in immune host response. Evaluation of tumor expression subtypes as potential biomarkers for immunotherapy should be investigated. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  11. Identification and Functional Analysis of Antifungal Immune Response Genes in Drosophila

    PubMed Central

    Jin, Li Hua; Shim, Jaewon; Yoon, Joon Sun; Kim, Byungil; Kim, Jihyun; Kim-Ha, Jeongsil; Kim, Young-Joon


    Essential aspects of the innate immune response to microbial infection appear to be conserved between insects and mammals. Although signaling pathways that activate NF-κB during innate immune responses to various microorganisms have been studied in detail, regulatory mechanisms that control other immune responses to fungal infection require further investigation. To identify new Drosophila genes involved in antifungal immune responses, we selected genes known to be differentially regulated in SL2 cells by microbial cell wall components and tested their roles in antifungal defense using mutant flies. From 130 mutant lines, sixteen mutants exhibited increased sensitivity to fungal infection. Examination of their effects on defense against various types of bacteria and fungi revealed nine genes that are involved specifically in defense against fungal infection. All of these mutants displayed defects in phagocytosis or activation of antimicrobial peptide genes following infection. In some mutants, these immune deficiencies were attributed to defects in hemocyte development and differentiation, while other mutants showed specific defects in immune signaling required for humoral or cellular immune responses. Our results identify a new class of genes involved in antifungal immune responses in Drosophila. PMID:18833296

  12. Repeated observation of immune gene sets enrichment in women with non-small cell lung cancer

    PubMed Central

    Araujo, Jhajaira M.; Prado, Alexandra; Cardenas, Nadezhda K.; Zaharia, Mayer; Dyer, Richard; Doimi, Franco; Bravo, Leny; Pinillos, Luis; Morante, Zaida; Aguilar, Alfredo; Mas, Luis A.; Gomez, Henry L.; Vallejos, Carlos S.; Rolfo, Christian; Pinto, Joseph A.


    There are different biological and clinical patterns of lung cancer between genders indicating intrinsic differences leading to increased sensitivity to cigarette smoke-induced DNA damage, mutational patterns of KRAS and better clinical outcomes in women while differences between genders at gene-expression levels was not previously reported. Here we show an enrichment of immune genes in NSCLC in women compared to men. We found in a GSEA analysis (by biological processes annotated from Gene Ontology) of six public datasets a repeated observation of immune gene sets enrichment in women. “Immune system process”, “immune response”, “defense response”, “cellular defense response” and “regulation of immune system process” were the gene sets most over-represented while APOBEC3G, APOBEC3F, LAT, CD1D and CCL5 represented the top-five core genes. Characterization of immune cell composition with the platform CIBERSORT showed no differences between genders; however, there were differences when tumor tissues were compared to normal tissues. Our results suggest different immune responses in NSCLC between genders that could be related with the different clinical outcome. PMID:26958810

  13. Modulation of rainbow trout (Oncorhynchus mykiss) intestinal immune gene expression following bacterial challenge.


    Evenhuis, Jason P; Cleveland, Beth M


    The mucosal immune systems of fishes are still poorly understood, and defined models for studying natural host-pathogen interactions are lacking. The objective of this study was to evaluate different challenge models and pathogens to examine the magnitude of change in intestinal immune gene expression. Rainbow trout were exposed by immersion to Yersinia ruckeri or by intraperitoneal injection with Flavobacterium psychrophilum. At 3, 9, or 10 days post-challenge, pathogen load was quantified by plate count and intestinal tissue was removed and immune gene expression measured by real-time PCR. In general, the magnitude of infection was correlated with change in immune gene transcript abundance. We found that messages for the innate immune molecules, SAA, IL-8, INF-γ and TNF-α, as well as the message for IgM, were up-regulated in intestinal tissue in both challenge paradigms. A >250-fold increase was observed in SAA and 20-fold increase of IL-8 gene transcript abundance occurred on day 10 following challenge with F. psychrophilum. Within individual fish, there was a positive correlation between bacteria load in the spleen and the increase of immune gene message between 3 and 10 days post-infection. These findings demonstrate that measurable changes in immune gene expression occur in the intestine of rainbow trout following bath challenge with Y. ruckeri or injection challenge with F. psychrophilum. Published by Elsevier B.V.

  14. Repeated observation of immune gene sets enrichment in women with non-small cell lung cancer.


    Araujo, Jhajaira M; Prado, Alexandra; Cardenas, Nadezhda K; Zaharia, Mayer; Dyer, Richard; Doimi, Franco; Bravo, Leny; Pinillos, Luis; Morante, Zaida; Aguilar, Alfredo; Mas, Luis A; Gomez, Henry L; Vallejos, Carlos S; Rolfo, Christian; Pinto, Joseph A


    There are different biological and clinical patterns of lung cancer between genders indicating intrinsic differences leading to increased sensitivity to cigarette smoke-induced DNA damage, mutational patterns of KRAS and better clinical outcomes in women while differences between genders at gene-expression levels was not previously reported. Here we show an enrichment of immune genes in NSCLC in women compared to men. We found in a GSEA analysis (by biological processes annotated from Gene Ontology) of six public datasets a repeated observation of immune gene sets enrichment in women. "Immune system process", "immune response", "defense response", "cellular defense response" and "regulation of immune system process" were the gene sets most over-represented while APOBEC3G, APOBEC3F, LAT, CD1D and CCL5 represented the top-five core genes. Characterization of immune cell composition with the platform CIBERSORT showed no differences between genders; however, there were differences when tumor tissues were compared to normal tissues. Our results suggest different immune responses in NSCLC between genders that could be related with the different clinical outcome.

  15. Optimizing High Dimensional Gene Expression Studies for Immune Response Following Smallpox Vaccination Using Taqman® Low Density Immune Arrays

    PubMed Central

    Oberg, Ann L.; Dhiman, Neelam; Grill, Diane E.; Ryan, Jenna E.; Kennedy, Richard B.; Poland, Gregory A.


    Introduction We sought to determine the time and vaccinia virus dose combination that would maximize the number of acute immune response changes in response to vaccinia stimulation in preparation for a large gene expression microarray experiment. Methods PBMCs from ten subjects were exposed to five vaccinia virus doses for three lengths of time. Gene expression was measured for 90 immune response genes via Taqman® Low Density Immune Arrays. Expression data were normalized via model-based non-linear normalization. Linear mixed effects model results were used to standardize changes across genes and determine the time/multiplicity of infection (MOI) combination with the largest number of changes. Results The greatest number of changes occurred with a MOI of 5.0 and exposure time of 48 hours. Further inspection revealed that most changes had occurred earlier and faded at this combination. The second highest number of changes was found at a MOI of 0.5 PFU/cell and time of 18 hours. Conclusions We conclude a time of 18 hours with a MOI of 0.5 PFU/cell is the optimal time/MOI combination for the full scale gene expression study. The strategy described herein is a general and resource efficient way to make critical decisions regarding experimental parameters for studies utilizing expensive assays that interrogate a large number of variables. PMID:21277306

  16. Immunizations


    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Immunizations KidsHealth > For Teens > Immunizations Print A A A ... That Shot? en español Las vacunas Why Are Vaccinations Important? Measles, mumps, and whooping cough may seem ...

  17. Immunization


    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against things like measles, ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  18. Changing expression of vertebrate immunity genes in an anthropogenic environment: a controlled experiment.


    Hablützel, Pascal I; Brown, Martha; Friberg, Ida M; Jackson, Joseph A


    The effect of anthropogenic environments on the function of the vertebrate immune system is a problem of general importance. For example, it relates to the increasing rates of immunologically-based disease in modern human populations and to the desirability of identifying optimal immune function in domesticated animals. Despite this importance, our present understanding is compromised by a deficit of experimental studies that make adequately matched comparisons between wild and captive vertebrates. We transferred post-larval fishes (three-spined sticklebacks), collected in the wild, to an anthropogenic (captive) environment. We then monitored, over 11 months, how the systemic expression of immunity genes changed in comparison to cohort-matched wild individuals in the originator population (total n = 299). We found that a range of innate (lyz, defbl2, il1r-like, tbk1) and adaptive (cd8a, igmh) immunity genes were up-regulated in captivity, accompanied by an increase in expression of the antioxidant enzyme, gpx4a. For some genes previously known to show seasonality in the wild, this appeared to be reduced in captive fishes. Captive fishes tended to express immunity genes, including igzh, foxp3b, lyz, defbl2, and il1r-like, more variably. Furthermore, although gene co-expression patterns (analyzed through gene-by-gene correlations and mutual information theory based networks) shared common structure in wild and captive fishes, there was also significant divergence. For one gene in particular, defbl2, high expression was associated with adverse health outcomes in captive fishes. Taken together, these results demonstrate widespread regulatory changes in the immune system in captive populations, and that the expression of immunity genes is more constrained in the wild. An increase in constitutive systemic immune activity, such as we observed here, may alter the risk of immunopathology and contribute to variance in health in vertebrate populations exposed to

  19. The immune gene repertoire of an important viral reservoir, the Australian black flying fox

    PubMed Central


    Background Bats are the natural reservoir host for a range of emerging and re-emerging viruses, including SARS-like coronaviruses, Ebola viruses, henipaviruses and Rabies viruses. However, the mechanisms responsible for the control of viral replication in bats are not understood and there is little information available on any aspect of antiviral immunity in bats. Massively parallel sequencing of the bat transcriptome provides the opportunity for rapid gene discovery. Although the genomes of one megabat and one microbat have now been sequenced to low coverage, no transcriptomic datasets have been reported from any bat species. In this study, we describe the immune transcriptome of the Australian flying fox, Pteropus alecto, providing an important resource for identification of genes involved in a range of activities including antiviral immunity. Results Towards understanding the adaptations that have allowed bats to coexist with viruses, we have de novo assembled transcriptome sequence from immune tissues and stimulated cells from P. alecto. We identified about 18,600 genes involved in a broad range of activities with the most highly expressed genes involved in cell growth and maintenance, enzyme activity, cellular components and metabolism and energy pathways. 3.5% of the bat transcribed genes corresponded to immune genes and a total of about 500 immune genes were identified, providing an overview of both innate and adaptive immunity. A small proportion of transcripts found no match with annotated sequences in any of the public databases and may represent bat-specific transcripts. Conclusions This study represents the first reported bat transcriptome dataset and provides a survey of expressed bat genes that complement existing bat genomic data. In addition, these data provide insight into genes relevant to the antiviral responses of bats, and form a basis for examining the roles of these molecules in immune response to viral infection. PMID:22716473

  20. The immune gene repertoire of an important viral reservoir, the Australian black flying fox.


    Papenfuss, Anthony T; Baker, Michelle L; Feng, Zhi-Ping; Tachedjian, Mary; Crameri, Gary; Cowled, Chris; Ng, Justin; Janardhana, Vijaya; Field, Hume E; Wang, Lin-Fa


    Bats are the natural reservoir host for a range of emerging and re-emerging viruses, including SARS-like coronaviruses, Ebola viruses, henipaviruses and Rabies viruses. However, the mechanisms responsible for the control of viral replication in bats are not understood and there is little information available on any aspect of antiviral immunity in bats. Massively parallel sequencing of the bat transcriptome provides the opportunity for rapid gene discovery. Although the genomes of one megabat and one microbat have now been sequenced to low coverage, no transcriptomic datasets have been reported from any bat species. In this study, we describe the immune transcriptome of the Australian flying fox, Pteropus alecto, providing an important resource for identification of genes involved in a range of activities including antiviral immunity. Towards understanding the adaptations that have allowed bats to coexist with viruses, we have de novo assembled transcriptome sequence from immune tissues and stimulated cells from P. alecto. We identified about 18,600 genes involved in a broad range of activities with the most highly expressed genes involved in cell growth and maintenance, enzyme activity, cellular components and metabolism and energy pathways. 3.5% of the bat transcribed genes corresponded to immune genes and a total of about 500 immune genes were identified, providing an overview of both innate and adaptive immunity. A small proportion of transcripts found no match with annotated sequences in any of the public databases and may represent bat-specific transcripts. This study represents the first reported bat transcriptome dataset and provides a survey of expressed bat genes that complement existing bat genomic data. In addition, these data provide insight into genes relevant to the antiviral responses of bats, and form a basis for examining the roles of these molecules in immune response to viral infection.

  1. Selective Landscapes in newt Immune Genes Inferred from Patterns of Nucleotide Variation

    PubMed Central

    Fijarczyk, Anna; Dudek, Katarzyna; Babik, Wieslaw


    Host–pathogen interactions may result in either directional selection or in pressure for the maintenance of polymorphism at the molecular level. Hence signatures of both positive and balancing selection are expected in immune genes. Because both overall selective pressure and specific targets may differ between species, large-scale population genomic studies are useful in detecting functionally important immune genes and comparing selective landscapes between taxa. Such studies are of particular interest in amphibians, a group threatened worldwide by emerging infectious diseases. Here, we present an analysis of polymorphism and divergence of 634 immune genes in two lineages of Lissotriton newts: L. montandoni and L. vulgaris graecus. Variation in newt immune genes has been shaped predominantly by widespread purifying selection and strong evolutionary constraint, implying long-term importance of these genes for functioning of the immune system. The two evolutionary lineages differ in the overall strength of purifying selection which can partially be explained by demographic history but may also signal differences in long-term pathogen pressure. The prevalent constraint notwithstanding, 23 putative targets of positive selection and 11 putative targets of balancing selection were identified. The latter were detected by composite tests involving the demographic model and further validated in independent population samples. Putative targets of balancing selection encode proteins which may interact closely with pathogens but include also regulators of immune response. The identified candidates will be useful for testing whether genes affected by balancing selection are more prone to interspecific introgression than other genes in the genome. PMID:27702815

  2. Characterization of innate immunity genes in the parasitic nematode Brugia malayi.


    Libro, Silvia; Slatko, Barton E; Foster, Jeremy M

    The filarial nematode Brugia malayi is one of the causative agents of lymphatic filariasis, a neglected tropical disease that affects 120 million people worldwide. The limited effectiveness of available anthelmintics and the absence of a vaccine have prompted extensive research on the interaction between Brugia and its obligate bacterial endosymbiont, Wolbachia. Recent studies suggest that Wolbachia is able to manipulate its nematode host immunity but relatively little is known about the immune system of filarial nematodes. Therefore, elucidation of the mechanisms underlying the immune system of B. malayi may be useful for understanding how the symbiotic relationship is maintained and help in the identification of new drug targets. In order to characterize the main genetic pathways involved in B. malayi immunity, we exposed adult female worms to two bacterial lysates (Escherichia coli and Bacillus amyloliquefaciens), dsRNA and dsDNA. We performed transcriptome sequencing of worms exposed to each immune elicitor at two different timepoints. Gene expression analysis of untreated and immune-challenged worms was performed to characterize gene expression patterns associated with each type of immune stimulation. Our results indicate that different immune elicitors produced distinct expression patterns in B. malayi, with changes in the expression of orthologs of well-characterized C. elegans immune pathways such as insulin, TGF-β, and p38 MAPK pathways, as well as C-type lectins and several stress-response genes.

  3. Resolving misassembled cattle immune gene clusters with hierarchical, long read sequencing

    USDA-ARS?s Scientific Manuscript database

    Animal health is a critical component of productivity; however, current genomic selection genotyping tools have a paucity of genetic markers within key immune gene clusters (IGC) involved in the cattle innate and adaptive immune systems. With diseases such as Bovine Tuberculosis and Johne’s disease ...

  4. Modulation of rainbow trout (Oncorhynchus mykiss) intestinal immune gene expression following bacterial challenge

    USDA-ARS?s Scientific Manuscript database

    The mucosal immune system of fish is still poorly understood, and defined models for studying natural host-pathogen interaction are lacking. The objective of this study was to evaluate different challenge paradigms and pathogens to examine the magnitude of change in intestinal immune gene expressio...

  5. Intestinal immune gene response to bacterial challenge in rainbow trout (Oncorhynchus mykiss)

    USDA-ARS?s Scientific Manuscript database

    The mucosal immune system of fish is poorly understood and defined models for studying this system are lacking. The objective of this study was to evaluate different challenge paradigms and pathogens to examine the magnitude of change in intestinal immune gene expression. Rainbow trout were expos...

  6. Emerging roles of p53 and other tumour-suppressor genes in immune regulation

    PubMed Central

    Muñoz-Fontela, César; Mandinova, Anna; Aaronson, Stuart A.; Lee, Sam W.


    Tumour-suppressor genes are indispensable for the maintenance of genomic integrity. Recently, several of these genes, including p53, PTEN, RB1 and ARF, have been implicated in immune responses and inflammatory diseases. In particular, the p53 tumour-suppressor pathway is involved in crucial aspects of tumour immunology and in homeostatic regulation of immune responses. Other studies have identified roles for p53 in various cellular processes, including metabolism and stem cell maintenance. Here, we discuss the emerging roles of p53 and other tumour-suppressor genes in tumour immunology as well as in additional immunological settings, such as virus infection. This relatively unexplored area could yield important insights into the homeostatic control of immune cells in health and disease, and facilitate the development of more effective immunotherapies. Consequently, tumour-suppressor genes are emerging as potential guardians of immune integrity. PMID:27667712

  7. Manipulating the in vivo immune response by targeted gene knockdown.


    Lieberman, Judy


    Aptamers, nucleic acids selected for high affinity binding to proteins, can be used to activate or antagonize immune mediators or receptors in a location and cell-type specific manner and to enhance antigen presentation. They can also be linked to other molecules (other aptamers, siRNAs or miRNAs, proteins, toxins) to produce multifunctional compounds for targeted immune modulation in vivo. Aptamer-siRNA chimeras (AsiCs) that induce efficient cell-specific knockdown in immune cells in vitro and in vivo can be used as an immunological research tool or potentially as an immunomodulating therapeutic.

  8. Identification of candidate genes and mutations in QTL regions for immune responses in chicken.


    Siwek, M; Slawinska, A; Rydzanicz, M; Wesoly, J; Fraszczak, M; Suchocki, T; Skiba, J; Skiba, K; Szyda, J


    There are two categories of immune responses - innate and adaptive immunity - both having polygenic backgrounds and a significant environmental component. In our study, adaptive immunity was represented by the specific antibody response toward keyhole limpet hemocyanin (KLH); innate immunity was represented by natural antibodies toward lipopolysaccharide (LPS) and lipoteichoic acid (LTA). Defining genetic bases of immune responses leads from defining quantitative trait loci (QTL) toward a single mutation responsible for variation in the phenotypic trait. The goal of the reported study was to define candidate genes and mutations for the immune traits of interest in chicken by performing an association study of SNPs located in candidate genes defined in QTL regions. Candidate genes and SNPs in QTL regions were selected in silico. SNP association was based on a custom SNP panel, GoldenGate genotyping assay (Illumina) and two statistical models: random mixed model and CAR score. The most significant SNP for immune response toward KLH was located in the JMJD6 gene located on GGA18. Four SNPs in candidate genes FOXJ1 (GGA18), EPHB1 (GGA9), PTGER4 (GGAZ) and PRKCB (GGA14) showed association with natural antibodies for LPS. A single SNP in ITGB4 (GGA18) was associated with natural antibodies for LTA. All associated SNPs mentioned above showed additive effects.

  9. Immunomodulatory Effects of Saccharomyces cerevisiae Fermentation Product Supplementation on Immune Gene Expression and Lymphocyte Distribution in Immune Organs in Broilers

    PubMed Central

    Chou, Wen K.; Park, Jungwoo; Carey, John B.; McIntyre, Don R.; Berghman, Luc R.


    A study was conducted to evaluate the molecular and cellular immunomodulatory effects of a Saccharomyces cerevisiae fermentation product (Original XPC, Diamond V) in broilers. Our lab has previously demonstrated that broilers fed XPC generate faster and stronger antigen-specific humoral immune responses to Newcastle disease virus (NDV) vaccination. This study aims at investigating the mechanism behind this increased immunocompetence. One-day-old broilers were randomly assigned to one of two treatments: 1.25 kg/ton S. cerevisiae fermentation product (XPC treatment group) or control diet. Birds were vaccinated against NDV on day 1 (B1 strain) and day 21 (LaSota strain) post-hatch. Innate and adaptive immune-related gene expression profiles in central (thymus and bursa of Fabricius) and peripheral (spleen) immune organs were investigated at 14 and 28 days of age by qPCR array. Fold changes larger than 1.2 (P < 0.05) between treated and control were considered significant. Lymphocyte subpopulations in central and peripheral immune organs and blood leukocytes were analyzed by flow cytometry at 14, 21, 28, and 42 days of age. In the spleen, Th1 immune responses and antiviral genes, such as IFN-γ, and its downstream genes signal transducer and activator of transcription (STAT4) and NFκB, were significantly upregulated in the treated group by 14 days of age. In the thymus, genes belonging to different functional groups were influenced at different time points. Cytokine genes associated with lymphocyte maturation, differentiation, and proliferation, such as IL-1R, IL-2, and IL-15 were significantly upregulated in the treated group by 28 days of age. Genes preferentially expressed in the medulla of the thymus and mature thymocytes, such as Myxovirus resistance gene 1, interferon regulatory factor-1, interferon regulatory factor-7, and STAT1, were upregulated in the birds supplemented with XPC. Birds supplemented with XPC had significantly higher percentages

  10. In vivo effects of antibodies to immune response gene products: prevention of experimental allergic encephalitis.

    PubMed Central

    Steinman, L; Rosenbaum, J T; Sriram, S; McDevitt, H O


    Prevention of experimental allergic encephalitis in SJL/J [H-2s] mice was achieved with in vivo administration of antibody reactive with I-As gene products prior to immunization with spinal cord antigen. No protection was evident in animals that received antisera specific for I-Js gene products. Administration of antibody to I-As beginning 5 days after immunization with spinal cord antigen delayed, but did not prevent, the onset of experimental allergic encephalitis. PMID:6947275

  11. Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

    PubMed Central

    Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo


    The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

  12. Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.


    Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo


    The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

  13. Identification and Properties of the Genes Encoding Microcin E492 and Its Immunity Protein

    PubMed Central

    Lagos, Rosalba; Villanueva, Jorge E.; Monasterio, Octavio


    The gene coding for the immunity protein (mceB) and the structural gene of microcin E492 (mceA), a low-molecular-weight channel-forming bacteriocin produced by a strain of Klebsiella pneumoniae, have been characterized. The microcin gene codes for a precursor protein of either 99 or 103 amino acids. Protein sequencing of the N-terminal region of microcin E492 unequivocally identified this gene as the microcin structural gene and indicated that this microcin is synthesized as a precursor protein that is cleaved at either amino acid 15 or 19, at a site resembling the double-glycine motif. The gene encoding the 95-amino-acid immunity protein (mceB) was identified by cloning the DNA segment that encodes only this polypeptide into an expression vector and demonstrating the acquisition of immunity to microcin E492. As expected, the immunity protein was found to be associated with the inner membrane. Analysis of the DNA sequence indicates that these genes belong to the same family as microcin 24, and they do not share structural motifs with any other known channel-forming bacteriocin. The organization of the microcin- and immunity protein-encoding genes suggests that they are coordinately expressed. PMID:9864332

  14. Maternal transfer and transcriptional onset of immune genes during ontogenesis in Atlantic cod.


    Seppola, Marit; Johnsen, Hanne; Mennen, Saskia; Myrnes, Bjørnar; Tveiten, Helge


    The immune system in teleosts is not completely developed during embryonic and larval stages and immune competence is assumed to be restricted. This study is the first to address whether immune transcripts are maternally transferred to offspring and when immune genes are transcriptionally active in Atlantic cod (Gadus morhua). In unfertilised eggs, transcripts encoding lysozyme and cathelicidin were found indicating maternal transfer of antibacterial transcripts. Lysozyme activity was also present at this stage suggesting the presence of a functional protein. Transcripts of two other putative antibacterial genes (hepcidin and pentraxin) and antiviral genes (ISG15 and LGP2) were absent in unfertilised eggs. The transcriptional onset of these genes occurred during the gastrula period. Transcripts of the heavy chain constant regions of the immunoglobulin (Ig) D, membrane-associated and secreted form of IgM were absent in unfertilised eggs. Transcription of the heavy chain locus commenced at low levels during the segmentation period indicating the onset of B-cell development. Most innate immune genes showed an increase in transcription around hatch and first feeding, indicating a preparation for increased pathogen exposure at this time. Prior to and during metamorphosis all genes showed a pronounced elevation in transcript levels indicating a further maturation of the immune system during this period.

  15. Gene Expression Profile of the Hypothalamus in DNP-KLH Immunized Mice Following Electroacupuncture Stimulation

    PubMed Central

    Kim, Sun Kwang; Kim, Jeungshin; Ko, Eunjung; Kim, Hyunseong; Hwang, Deok-Sang; Lee, Sanghoon; Baek, Yonghyeon; Min, Byung-Il; Nam, Sangsoo; Bae, Hyunsu


    Clinical evidence indicates that electroacupuncture (EA) is effective for allergic disorder. Recent animal studies have shown that EA treatment reduces levels of IgE and Th2 cytokines in BALB/c mice immunized with 2,4-dinitrophenylated keyhole limpet protein (DNP-KLH). The hypothalamus, a brain center of the neural-immune system, is known to be activated by EA stimulation. This study was performed to identify and characterize the differentially expressed genes in the hypothalamus of DNP-KLH immunized mice that were stimulated with EA or only restrained. To this aim, we conducted a microarray analysis to evaluate the global gene expression profiles, using the hypothalamic RNA samples taken from three groups of mice: (i) normal control group (no treatments); (ii) IMH group (DNP-KLH immunization + restraint); and (iii) IMEA group (immunization + EA stimulation). The microarray analysis revealed that total 39 genes were altered in their expression levels by EA treatment. Ten genes, including T-cell receptor alpha variable region family 13 subfamily 1 (Tcra-V13.1), heat shock protein 1B (Hspa1b) and 2′–5′ oligoadenylate synthetase 1F (Oas1f), were up-regulated in the IMEA group when compared with the IMH group. In contrast, 29 genes, including decay accelerating factor 2 (Daf2), NAD(P)H dehydrogenase, quinone 1 (Nqo1) and programmed cell death 1 ligand 2 (Pdcd1lg2) were down-regulated in the IMEA group as compared with the IMH group. These results suggest that EA treatment can modulate immune response in DNP-KLH immunized mice by regulating expression levels of genes that are associated with innate immune, cellular defense and/or other kinds of immune system in the hypothalamus. PMID:21799680

  16. Effects of polyamines on cellular innate immune response and the expression of immune-relevant genes in gilthead seabream leucocytes.


    Reyes-Becerril, Martha; Ascencio-Valle, Felipe; Tovar-Ramírez, Dariel; Meseguer, José; Esteban, María Ángeles


    It is well known that the polyamines spermidine and spermine, along with the diamine putrescine, are involved in many cellular processes and they are known to play an important role in the control of the innate immune response in higher vertebrates. However, to the best of our knowledge, no studies have focused on their immunological implications in other vertebrates, such as fish. For this reason, the effects of polyamines on the cellular innate immune response and immune-related gene expression were evaluated in vitro, using seabream head-kidney leucocytes (HKL). For this study, head-kidney leucocytes were incubated with the polyamines putrescine, spermine or spermidine (0.005 and 0.0025%) for 0.50, 1, 2 or 4 h. No significant effect was observed on either leucocyte viability or the innate cellular immune responses (peroxidase content and phagocytic and respiratory burst activities). The polyamines produced an increase in respiratory burst and phagocytic ability when leucocytes were incubated principally with putrescine (0.005 and 0.0025%) after 2 and 4 h of the experiment. Finally, the expression levels of immune-associated genes (IgM, MHCIα, MHCIIα, C3, IL-1β, CD8, Hep, NCCRP-1, CSF-1 and TLR) were quantified by real-time PCR and some of them (C3, MHCI, CD8, IgM and Hep) were up-regulated by the higher polyamine concentration. Further studies are needed to ascertain how polyamines control the immune system of seabream as well as which mechanisms are involved.

  17. Immunity-related genes in Ixodes scapularis--perspectives from genome information.


    Smith, Alexis A; Pal, Utpal


    Ixodes scapularis, commonly known as the deer tick, transmits a wide array of human and animal pathogens including Borrelia burgdorferi. Despite substantial advances in our understanding of immunity in model arthropods, including other disease vectors, precisely how I. scapularis immunity functions and influences persistence of invading pathogens remains largely unknown. This review provides a comprehensive analysis of the recently sequenced I. scapularis genome for the occurrence of immune-related genes and related pathways. We will also discuss the potential influence of immunity-related genes on the persistence of tick-borne pathogens with an emphasis on the Lyme disease pathogen B. burgdorferi. Further enhancement of our knowledge of tick immune responses is critical to understanding the molecular basis of the persistence of tick-borne pathogens and development of novel interventions against the relevant infections.

  18. Gene expression analysis reveals the dysregulation of immune and metabolic pathways in Alzheimer's disease

    PubMed Central

    Li, Zhiyan; Xu, Panpan; Yao, Lifen


    In recent years, several pathway analyses of genome-wide association studies reported the involvement of metabolic and immune pathways in Alzheimer's disease (AD). Until now, the exact mechanisms of these pathways in AD are still unclear. Here, we conducted a pathway analysis of a whole genome AD case-control expression dataset (n=41, 25 AD cases and 16 controls) from the human temporal cortex tissue. Using the differently expressed AD genes, we identified significant KEGG pathways related to metabolism and immune processes. Using the up- and down- regulated AD gene list, we further found up-regulated AD gene were significantly enriched in immune and metabolic pathways. We further compare the immune and metabolic KEGG pathways from the expression dataset with those from previous GWAS datasets, and found that most of these pathways are shared in both GWAS and expression datasets. PMID:27732949

  19. Inducible Defenses Stay Up Late: Temporal Patterns of Immune Gene Expression in Tenebrio molitor

    PubMed Central

    Johnston, Paul R; Makarova, Olga; Rolff, Jens


    The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. PMID:24318927

  20. Inducible defenses stay up late: temporal patterns of immune gene expression in Tenebrio molitor.


    Johnston, Paul R; Makarova, Olga; Rolff, Jens


    The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. Copyright © 2014 Johnston et al.

  1. Marek's disease virus-induced immunosuppression: array analysis of chicken immune response gene expression profiling.


    Heidari, Mohammad; Sarson, Aimie J; Huebner, Marianne; Sharif, Shayan; Kireev, Dmitry; Zhou, Huaijun


    Marek's disease (MD) is a lymphoproliferative disease of chickens induced by a highly cell-associated oncogenic alpha-herpesvirus, Marek's disease virus (MDV). MDV replicates in chicken lymphocytes and establishes a latency infection within CD4(+) T cells. Host-virus interaction, immune responses to infection, and transcriptional profiling of chicken gene expression in MD are poorly understood. In this study we conducted a global host gene expression analysis in the splenocytes of MDV-infected chickens using oligonucleotide-based Affymetrix GeneChip Chicken Genome Arrays. These arrays contain probes for more than 32,000 chicken transcripts and most of the known MDV genes and open reading frames. Two-week-old MD-susceptible chickens were inoculated with an oncogenic strain of MDV, and spleen samples were collected 5 and 15 days post-infection (dpi) for RNA isolation and microarray analysis. Array results displayed a significant differential pattern of immune response transcriptome between the two phases of MDV infection. The expression levels of more than 22 immune-response and related genes were downregulated, while the expression levels of at least 58 genes were increased at 5 dpi (cytolytic infection), compared to age-matched control birds. In comparison, out of 73 immune-response and related genes, 67 genes were downregulated, with only 6 genes having higher expression levels at 15 dpi (latency infection). Cytokines, chemokines, MHC molecules and related receptors, and adhesion molecules were among the many MDV-induced downregulated genes that are critical for an effective antiviral immune response. In addition, several apoptosis-associated genes were decreased in expression during latent infection, suggesting an MDV-induced blocking of initiation or progression of programmed cell death processes. These chicken arrays are valuable tools in understanding the molecular mechanisms behind viral pathogenesis and chicken gene expression patterns, and associated

  2. Association of brain immune genes with social behavior of inbred mouse strains.


    Ma, Li; Piirainen, Sami; Kulesskaya, Natalia; Rauvala, Heikki; Tian, Li


    Social deficit is one of the core symptoms of neuropsychiatric diseases, in which immune genes play an important role. Although a few immune genes have been shown to regulate social and emotional behaviors, how immune gene network(s) may jointly regulate sociability has not been investigated so far. To decipher the potential immune-mediated mechanisms underlying social behavior, we first studied the brain microarray data of eight inbred mouse strains with known variations in social behavior and retrieved the differentially expressed immune genes. We then made a protein-protein interaction analysis of them to find the major networks and explored the potential association of these genes with the behavior and brain morphology in the mouse phenome database. To validate the expression and function of the candidate immune genes, we selected the C57BL/6 J and DBA/2 J strains among the eight inbred strains, compared their social behaviors in resident-intruder and 3-chambered social tests and the mRNA levels of these genes, and analyzed the correlations of these genes with the social behaviors. A group of immune genes were differentially expressed in the brains of these mouse strains. The representative C57BL/6 J and DBA/2 J strains displayed significant differences in social behaviors, DBA/2 J mice being less active in social dominance and social interaction than C57BL/6 J mice. The mRNA levels of H2-d1 in the prefrontal cortex, hippocampus, and hypothalamus and C1qb in the hippocampus of the DBA/2 J strain were significantly down-regulated as compared to those in the C57BL/6 J strain. In contrast, Polr3b in the hippocampus and Tnfsf13b in the prefrontal cortex of the DBA/2 J strain were up-regulated. Furthermore, C1qb, Cx3cl1, H2-d1, H2-k1, Polr3b, and Tnfsf13b were predicted to be associated with various behavioral and brain morphological features across the eight inbred strains. Importantly, the C1qb mRNA level was confirmed to be significantly correlated with the

  3. Specific Gene Expression Responses to Parasite Genotypes Reveal Redundancy of Innate Immunity in Vertebrates

    PubMed Central

    Haase, David; Rieger, Jennifer K.; Witten, Anika; Stoll, Monika; Bornberg-Bauer, Erich; Kalbe, Martin; Reusch, Thorsten B. H.


    Vertebrate innate immunity is the first line of defense against an invading pathogen and has long been assumed to be largely unspecific with respect to parasite/pathogen species. However, recent phenotypic evidence suggests that immunogenetic variation, i.e. allelic variability in genes associated with the immune system, results in host-parasite genotype-by-genotype interactions and thus specific innate immune responses. Immunogenetic variation is common in all vertebrate taxa and this reflects an effective immunological function in complex environments. However, the underlying variability in host gene expression patterns as response of innate immunity to within-species genetic diversity of macroparasites in vertebrates is unknown. We hypothesized that intra-specific variation among parasite genotypes must be reflected in host gene expression patterns. Here we used high-throughput RNA-sequencing to examine the effect of parasite genotypes on gene expression patterns of a vertebrate host, the three-spined stickleback (Gasterosteus aculeatus). By infecting naïve fish with distinct trematode genotypes of the species Diplostomum pseudospathaceum we show that gene activity of innate immunity in three-spined sticklebacks depended on the identity of an infecting macroparasite genotype. In addition to a suite of genes indicative for a general response against the trematode we also find parasite-strain specific gene expression, in particular in the complement system genes, despite similar infection rates of single clone treatments. The observed discrepancy between infection rates and gene expression indicates the presence of alternative pathways which execute similar functions. This suggests that the innate immune system can induce redundant responses specific to parasite genotypes. PMID:25254967

  4. Genomic Signatures of Selective Pressures and Introgression from Archaic Hominins at Human Innate Immunity Genes

    PubMed Central

    Deschamps, Matthieu; Laval, Guillaume; Fagny, Maud; Itan, Yuval; Abel, Laurent; Casanova, Jean-Laurent; Patin, Etienne; Quintana-Murci, Lluis


    Human genes governing innate immunity provide a valuable tool for the study of the selective pressure imposed by microorganisms on host genomes. A comprehensive, genome-wide study of how selective constraints and adaptations have driven the evolution of innate immunity genes is missing. Using full-genome sequence variation from the 1000 Genomes Project, we first show that innate immunity genes have globally evolved under stronger purifying selection than the remainder of protein-coding genes. We identify a gene set under the strongest selective constraints, mutations in which are likely to predispose individuals to life-threatening disease, as illustrated by STAT1 and TRAF3. We then evaluate the occurrence of local adaptation and detect 57 high-scoring signals of positive selection at innate immunity genes, variation in which has been associated with susceptibility to common infectious or autoimmune diseases. Furthermore, we show that most adaptations targeting coding variation have occurred in the last 6,000–13,000 years, the period at which populations shifted from hunting and gathering to farming. Finally, we show that innate immunity genes present higher Neandertal introgression than the remainder of the coding genome. Notably, among the genes presenting the highest Neandertal ancestry, we find the TLR6-TLR1-TLR10 cluster, which also contains functional adaptive variation in Europeans. This study identifies highly constrained genes that fulfill essential, non-redundant functions in host survival and reveals others that are more permissive to change—containing variation acquired from archaic hominins or adaptive variants in specific populations—improving our understanding of the relative biological importance of innate immunity pathways in natural conditions. PMID:26748513

  5. Genomic Signatures of Selective Pressures and Introgression from Archaic Hominins at Human Innate Immunity Genes.


    Deschamps, Matthieu; Laval, Guillaume; Fagny, Maud; Itan, Yuval; Abel, Laurent; Casanova, Jean-Laurent; Patin, Etienne; Quintana-Murci, Lluis


    Human genes governing innate immunity provide a valuable tool for the study of the selective pressure imposed by microorganisms on host genomes. A comprehensive, genome-wide study of how selective constraints and adaptations have driven the evolution of innate immunity genes is missing. Using full-genome sequence variation from the 1000 Genomes Project, we first show that innate immunity genes have globally evolved under stronger purifying selection than the remainder of protein-coding genes. We identify a gene set under the strongest selective constraints, mutations in which are likely to predispose individuals to life-threatening disease, as illustrated by STAT1 and TRAF3. We then evaluate the occurrence of local adaptation and detect 57 high-scoring signals of positive selection at innate immunity genes, variation in which has been associated with susceptibility to common infectious or autoimmune diseases. Furthermore, we show that most adaptations targeting coding variation have occurred in the last 6,000-13,000 years, the period at which populations shifted from hunting and gathering to farming. Finally, we show that innate immunity genes present higher Neandertal introgression than the remainder of the coding genome. Notably, among the genes presenting the highest Neandertal ancestry, we find the TLR6-TLR1-TLR10 cluster, which also contains functional adaptive variation in Europeans. This study identifies highly constrained genes that fulfill essential, non-redundant functions in host survival and reveals others that are more permissive to change-containing variation acquired from archaic hominins or adaptive variants in specific populations-improving our understanding of the relative biological importance of innate immunity pathways in natural conditions. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  6. Expression of immune-related genes of common carp during cyprinid herpesvirus 3 infection.


    Sunarto, Agus; McColl, Kenneth A


    Fish herpesviruses and their hosts may have coevolved for 400 to 450 million yr. During this coexistence, the hosts have equipped themselves with an elaborate immune system to defend themselves from invading viruses, whereas the viruses have developed strategies to evade host immunity, including the expression of cytokine genes that have been captured from the host. Taking advantage of our experimental model for cyprinid herpesvirus 3 (CyHV-3) persistence in carp, we studied the gene expression of host and virus immune-related genes in each stage of infection: acute, persistent and reactivation phases. IFNγ-1, IFNγ-2, IL-12 and IL-10 host genes, and the CyHV-3 vIL-10 gene (khvIL-10) were highly significantly up-regulated in different phases of CyHV-3 infection. Similarly, host IL-1β was up-regulated in the acute phase of CyHV-3 infection. There was no significant difference in the expression of host TNFα-1 and MHC-II genes during all phases of CyHV-3 infection. Based on the expression profile of carp immune-related genes in each stage of CyHV-3 infection, we propose a possible interaction between carp IL-12, carp IL-10 and khvIL-10 during the course of viral infection. To our knowledge, this is the first report on the expression of cytokine genes during all phases (acute, persistent and reactivation) of CyHV-3 infection.

  7. Adeno-associated virus (AAV) vectors in gene therapy: immune challenges and strategies to circumvent them.


    Hareendran, Sangeetha; Balakrishnan, Balaji; Sen, Dwaipayan; Kumar, Sanjay; Srivastava, Alok; Jayandharan, Giridhara R


    AAV-based gene transfer protocols have shown remarkable success when directed to immune-privileged sites such as for retinal disorders like Lebers congenital amaurosis. In contrast, AAV-mediated gene transfer into liver or muscle tissue for diseases such as hemophilia B, α1 anti-trypsin deficiency and muscular dystrophy has demonstrated a decline in gene transfer efficacy over time. It is now known that in humans, AAV triggers specific pathways that recruit immune sensors. These factors initiate an immediate reaction against either the viral capsid or the vector encoded protein as part of innate immune response or to produce a more specific adaptive response that generates immunological memory. The vector-transduced cells are then rapidly destroyed due to this immune activation. However, unlike other viral vectors, AAV is not immunogenic in murine models. Its immunogenicity becomes apparent only in large animal models and human subjects. Moreover, humans are natural hosts to AAV and exhibit a high seroprevalence against AAV vectors. This limits the widespread application of AAV vectors into patients with pre-existing neutralising antibodies or memory T cells. To address these issues, various strategies are being tested. Alternate serotype vectors (AAV1-10), efficient expression cassettes, specific tissue targeting, immune-suppression and engineered capsid variants are some approaches proposed to minimise this immune stimulation. In this review, we have summarised the nature of the immune response documented against AAV in various pre-clinical and clinical settings and have further discussed the strategies to evade them.

  8. Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis

    PubMed Central

    Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-hua; Xue, Dongbo


    Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including “immune response” as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma. PMID:28355233

  9. Intradermal gene immunization: the possible role of DNA uptake in the induction of cellular immunity to viruses.

    PubMed Central

    Raz, E; Carson, D A; Parker, S E; Parr, T B; Abai, A M; Aichinger, G; Gromkowski, S H; Singh, M; Lew, D; Yankauckas, M A


    The skin and mucous membranes are the anatomical sites were most viruses are first encountered by the immune system. Previous experiments have suggested that striated muscle cells are unique among mammalian cell types in their capacity to take up and express free DNA in the absence of a viral vector or physical carrier. However, we have found that mice injected into the superficial skin with free (naked) plasmid DNA encoding the influenza nucleoprotein gene had discrete foci of epidermal and dermal cells, including cells with dendritic morphology, that contained immunoreactive nucleoprotein antigen. A single intradermal administration of 0.3-15 micrograms of free plasmid DNA induced anti-nucleoprotein-specific antibody and cytotoxic T lymphocytes that persisted for at least 68-70 weeks after vaccination. Intradermal gene administration induced higher antibody titers than did direct gene injection into skeletal muscle and did not cause local inflammation or necrosis. Compared with control animals, the gene-injected mice were resistant to challenge with a heterologous strain of influenza virus. These results indicate that the cells of the skin can take up and express free foreign DNA and induce cellular and humoral immune responses against the encoded protein. We suggest that DNA uptake by the skin-associated lymphoid tissues may play a role in the induction of cytotoxic T cells against viruses and other intracellular pathogens. Images PMID:7937799

  10. Association of variants in innate immune genes with asthma and eczema

    PubMed Central

    Sharma, Sunita; Poon, Audrey; Himes, Blanca E.; Lasky-Su, Jessica; Sordillo, Joanne E.; Belanger, Kathleen; Milton, Donald K.; Bracken, Michael B.; Triche, Elizabeth W.; Leaderer, Brian P.; Gold, Diane R.; Litonjua, Augusto A.


    Background The innate immune pathway is important in the pathogenesis of asthma and eczema. However, only a few variants in these genes have been associated with either disease. We investigate the association between polymorphisms of genes in the innate immune pathway with childhood asthma and eczema. In addition, we compare individual associations with those discovered using a multivariate approach. Methods Using a novel method, case control based association testing (C2BAT), 569 single nucleotide polymorphisms (SNPs) in 44 innate immune genes were tested for association with asthma and eczema in children from the Boston Home Allergens and Asthma Study and the Connecticut Childhood Asthma Study. The screening algorithm was used to identify the top SNPs associated with asthma and eczema. We next investigated the interaction of innate immune variants with asthma and eczema risk using Bayesian networks. Results After correction for multiple comparisons, 7 SNPs in 6 genes (CARD25, TGFB1, LY96, ACAA1, DEFB1, and IFNG) were associated with asthma (adjusted p-value<0.02), while 5 SNPs in 3 different genes (CD80, STAT4, and IRAKI) were significantly associated with eczema (adjusted p-value < 0.02). None of these SNPs were associated with both asthma and eczema. Bayesian network analysis identified 4 SNPs that were predictive of asthma and 10 SNPs that predicted eczema. Of the genes identified using Bayesian networks, only CD80 was associated with eczema in the single-SNP study. Using novel methodology that allows for screening and replication in the same population, we have identified associations of innate immune genes with asthma and eczema. Bayesian network analysis suggests that additional SNPs influence disease susceptibility via SNP interactions. Conclusion Our findings suggest that innate immune genes contribute to the pathogenesis of asthma and eczema, and that these diseases likely have different genetic determinants. PMID:22192168

  11. Revealing Shared and Distinct Gene Network Organization in Arabidopsis Immune Responses by Integrative Analysis1

    PubMed Central

    Dong, Xiaobao; Jiang, Zhenhong; Peng, You-Liang; Zhang, Ziding


    Pattern-triggered immunity (PTI) and effector-triggered immunity (ETI) are two main plant immune responses to counter pathogen invasion. Genome-wide gene network organizing principles leading to quantitative differences between PTI and ETI have remained elusive. We combined an advanced machine learning method and modular network analysis to systematically characterize the organizing principles of Arabidopsis (Arabidopsis thaliana) PTI and ETI at three network resolutions. At the single network node/edge level, we ranked genes and gene interactions based on their ability to distinguish immune response from normal growth and successfully identified many immune-related genes associated with PTI and ETI. Topological analysis revealed that the top-ranked gene interactions tend to link network modules. At the subnetwork level, we identified a subnetwork shared by PTI and ETI encompassing 1,159 genes and 1,289 interactions. This subnetwork is enriched in interactions linking network modules and is also a hotspot of attack by pathogen effectors. The subnetwork likely represents a core component in the coordination of multiple biological processes to favor defense over development. Finally, we constructed modular network models for PTI and ETI to explain the quantitative differences in the global network architecture. Our results indicate that the defense modules in ETI are organized into relatively independent structures, explaining the robustness of ETI to genetic mutations and effector attacks. Taken together, the multiscale comparisons of PTI and ETI provide a systems biology perspective on plant immunity and emphasize coordination among network modules to establish a robust immune response. PMID:25614062

  12. Feminizing Wolbachia: a transcriptomics approach with insights on the immune response genes in Armadillidium vulgare

    PubMed Central


    Background Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., “symbiotic” animals) and uninfected ones (i.e., “asymbiotic” animals) as well as between animals challenged or not challenged by a pathogenic bacteria. Results Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen). Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. Conclusion This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host immunity when females are

  13. Induction of innate immune genes in brain create the neurobiology of addiction.


    Crews, F T; Zou, Jian; Qin, Liya


    Addiction occurs through repeated abuse of drugs that progressively reduce behavioral control and cognitive flexibility while increasing limbic negative emotion. Recent discoveries indicate neuroimmune signaling underlies addiction and co-morbid depression. Low threshold microglia undergo progressive stages of innate immune activation involving astrocytes and neurons with repeated drug abuse, stress, and/or cell damage signals. Increased brain NF-κB transcription of proinflammatory chemokines, cytokines, oxidases, proteases, TLR and other genes create loops amplifying NF-κB transcription and innate immune target gene expression. Human post-mortem alcoholic brain has increased NF-κB and NF-κB target gene message, increased microglial markers and chemokine-MCP1. Polymorphisms of human NF-κB1 and other innate immune genes contribute to genetic risk for alcoholism. Animal transgenic and genetic studies link NF-κB innate immune gene expression to alcohol drinking. Human drug addicts show deficits in behavioral flexibility modeled pre-clinically using reversal learning. Binge alcohol, chronic cocaine, and lesions link addiction neurobiology to frontal cortex, neuroimmune signaling and loss of behavioral flexibility. Addiction also involves increasing limbic negative emotion and depression-like behavior that is reflected in hippocampal neurogenesis. Innate immune activation parallels loss of neurogenesis and increased depression-like behavior. Protection against loss of neurogenesis and negative affect by anti-oxidant, anti-inflammatory, anti-depressant, opiate antagonist and abstinence from ethanol dependence link limbic affect to changes in innate immune signaling. The hypothesis that innate immune gene induction underlies addiction and affective disorders creates new targets for therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Feminizing Wolbachia: a transcriptomics approach with insights on the immune response genes in Armadillidium vulgare.


    Chevalier, Frédéric; Herbinière-Gaboreau, Juline; Charif, Delphine; Mitta, Guillaume; Gavory, Frédéric; Wincker, Patrick; Grève, Pierre; Braquart-Varnier, Christine; Bouchon, Didier


    Wolbachia are vertically transmitted bacteria known to be the most widespread endosymbiont in arthropods. They induce various alterations of the reproduction of their host, including feminization of genetic males in isopod crustaceans. In the pill bug Armadillidium vulgare, the presence of Wolbachia is also associated with detrimental effects on host fertility and lifespan. Deleterious effects have been demonstrated on hemocyte density, phenoloxidase activity, and natural hemolymph septicemia, suggesting that infected individuals could have defective immune capacities. Since nothing is known about the molecular mechanisms involved in Wolbachia-A. vulgare interactions and its secondary immunocompetence modulation, we developed a transcriptomics strategy and compared A. vulgare gene expression between Wolbachia-infected animals (i.e., "symbiotic" animals) and uninfected ones (i.e., "asymbiotic" animals) as well as between animals challenged or not challenged by a pathogenic bacteria. Since very little genetic data is available on A. vulgare, we produced several EST libraries and generated a total of 28 606 ESTs. Analyses of these ESTs revealed that immune processes were over-represented in most experimental conditions (responses to a symbiont and to a pathogen). Considering canonical crustacean immune pathways, these genes encode antimicrobial peptides or are involved in pathogen recognition, detoxification, and autophagy. By RT-qPCR, we demonstrated a general trend towards gene under-expression in symbiotic whole animals and ovaries whereas the same gene set tends to be over-expressed in symbiotic immune tissues. This study allowed us to generate the first reference transcriptome ever obtained in the Isopoda group and to identify genes involved in the major known crustacean immune pathways encompassing cellular and humoral responses. Expression of immune-related genes revealed a modulation of host immunity when females are infected by Wolbachia, including in ovaries

  15. In vivo monitoring of transfected DNA, gene expression kinetics, and cellular immune responses in mice immunized with a human NIS gene-expressing plasmid.


    Son, Hye-Youn; Jeon, Yong-Hyun; Chung, June-Key; Kim, Chul-Woo


    In assessing the effectiveness of DNA vaccines, it is important to monitor: (1) the kinetics of target gene expression in vivo; and (2) the movement of cells that become transfected with the plasmid DNA used in the immunization of a subject. In this study, we used, as a visual imaging marker, expression of the transfected human sodium/iodide symporter (hNIS) gene, which enhances intracellular radio-pertechnetate (TcO4-) accumulation. After intradermal (i.d.) and systemic injection of mice with pcDNA-hNIS and radioactive Technetium-99m (Tc-99m), respectively, whole-body images were obtained by nuclear scintigraphy. The migration of mice cells transfected with the hNIS gene was monitored over a 2-week period by gamma-radioactivity counting of isolated cell populations and was demonstrated in peripheral lymphoid tissues, especially in the draining lymph nodes (dLNs). Beginning at 24 h after DNA inoculation and continuing for the 2-week monitoring period, hNIS-expressing cells were observed specifically in the T-cell-rich zones of the paracortical area of the dLNs. Over the same time period, high levels of INF-γ-secreting CD8 T-cells were found in the dLNs of the pcDNA-hNIS immunized mice. Tumor growth was also significantly retarded in the mice that received hNIS DNA immunization followed by inoculation with CT26 colorectal adenocarcinoma cells that had been transfected with the rat NIS gene (rNIS), which is 93% homologous to the hNIS gene. In conclusion, mouse cells transfected with hNIS DNA after i.d. immunization were found to traffic to the dLNs, and hNIS gene expression in these cells continued for at least 2 weeks post immunization. Furthermore, sequential presentation of NIS DNA to T-cells by migratory antigen presenting cells could induce NIS DNA-specific Th1 immune responses and thus retard the growth of NIS-expressing tumors.

  16. Cancer-targeted BikDD gene therapy elicits protective antitumor immunity against lung cancer.


    Sher, Yuh-Pyng; Liu, Shih-Jen; Chang, Chun-Mien; Lien, Shu-Pei; Chen, Chien-Hua; Han, Zhenbo; Li, Long-Yuan; Chen, Jin-Shing; Wu, Cheng-Wen; Hung, Mien-Chie


    Targeted cancer-specific gene therapy is a promising strategy for treating metastatic lung cancer, which is a leading cause of lung cancer-related deaths. Previously, we developed a cancer-targeted gene therapy expression system with high tumor specificity and strong activity that selectively induced lung cancer cell killing without affecting normal cells in immunocompromised mice. Here, we found this cancer-targeted gene therapy, SV-BikDD, composed of the survivin promoter in the VP16-GAL4-WPRE integrated systemic amplifier system to drive the apoptotic gene BikDD, not only caused cytotoxic effects in cancer cells but also elicited a cancer-specific cytotoxic T lymphocyte response to synergistically increase the therapeutic effect and further develop an effective systemic antitumoral immunity against rechallenges of tumorigenic dose of parental tumor cells inoculated at distant sites in immunocompetent mice. In addition, this cancer-targeted gene therapy does not elicit an immune response against normal tissues, but CMV-BikDD treatment does. The therapeutic vector could also induce proinflammatory cytokines to activate innate immunity and provide some benefits in antitumor gene therapy. Thus, this study provides a promising strategy with benefit of antitumoral immune response worthy of further development in clinical trials for treating lung cancer via cancer-targeted gene therapy.

  17. Supranutritional dietary selenium depressed expression of selenoprotein genes in three immune organs of broilers.


    Tang, Jiayong; Huang, Xiaofeng; Wang, Longqiong; Li, Qiang; Xu, Jinyang; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Shang, Haiying; Zhao, Hua


    The objective of this study was to investigate the effects of supranutritional dietary selenium (Se) on selenoproteins expression in three immune organs of chickens. A total of 160 1-day-old male Cobb broilers were randomly divided into two groups and fed a Se-deficient corn-soybean basal diet supplemented with 0.3 (adequate) and 3.0 (excess) mg/kg Se for 42 days. Immune organs were collected, and effects of supranutritional Se on messenger RNA abundance of 23 selenoprotein genes and eight inflammation-related genes were compared at day 42. Also enzyme activities were measured at days 14, 28 and 42. The results showed supranutritional dietary Se depressed growth performance of chicken and down-regulated nine and three selenoprotein genes in thymus and spleen, respectively, and only Sepp1 was up-regulated in the bursa of Fabricius. Also three, three and seven inflammation-related genes were up-regulated in three organs, respectively. Supranutritional Se elevated (P < 0.05) activities of superoxidase dismutase, total antioxidant capacity and glutathione peroxidase, mainly in early stages. In summary, supranutritional Se resulted in down-regulation of selenoprotein genes and up-regulation of inflammation-related genes in three immune organs of chicken, which indicated potential roles of those selenoprotein genes in immune organs of the chicken. © 2016 Japanese Society of Animal Science.

  18. Transcriptional profiling of immune-related genes in Pacific white shrimp (Litopenaeus vannamei) during ontogenesis.


    Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M


    We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp.

  19. Genetic variation and haplotype structures of innate immunity genes in eastern India

    PubMed Central

    Bairagya, Bijan B.; Bhattacharya, Paramita; Bhattacharya, Sujit K.; Dey, Biplab; Dey, Uposoma; Ghosh, Trina; Maiti, Sujit; Majumder, Partha P.; Mishra, Kankadeb; Mukherjee, Sinchita; Mukherjee, Souvik; Narayanasamy, K.; Poddar, Sonia; Roy, Neeta Sarkar; Sengupta, Priya; Sharma, Sangeeta; Sur, Dipika; Sutradhar, Debabrata; Wagener, Diane K.


    This study reports results of an extensive and comprehensive study of genetic diversity in 12 genes of the innate immune system in a population of eastern India. Genomic variation was assayed in 171 individuals by resequencing ~75 kb of DNA comprising these genes in each individual. Almost half of the 548 DNA variants discovered was novel. DNA sequence comparisons with human and chimpanzee reference sequences revealed evolutionary features indicative of natural selection operating among individuals, who are residents of an area with a high load of microbial and other pathogens. Significant differences in allele and haplotype frequencies of the study population were observed with the HapMap populations. Gene and haplotype diversities were observed to be high. The genetic positioning of the study population among the HapMap populations based on data of the innate immunity genes substantially differed from what has been observed for Indian populations based on data of other genes. The reported range of variation in SNP density in the human genome is one SNP per 1.19 kb (chromosome 22) to one SNP per 2.18 kb (chromosome 19). The SNP density in innate immunity genes observed in this study (>3 SNPs kb−1) exceeds the highest density observed for any autosomal chromosome in the human genome. The extensive genomic variation and the distinct haplotype structure of innate immunity genes observed among individuals have possibly resulted from the impact of natural selection. PMID:18396467

  20. Innate immune gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.


    Shaughnessy, Ronan G; Meade, Kieran G; Cahalane, Sarah; Allan, Brenda; Reiman, Carla; Callanan, John J; O'Farrelly, Cliona


    Salmonella enterica serovar Typhimurium and Campylobacter jejuni are major human pathogens, yet colonise chickens without causing pathology. The aim of this study was to compare intestinal innate immune responses to both bacterial species, in a 4-week-old broiler chicken model. Challenged and control birds were sacrificed and tissue samples taken for histopathology and RNA extraction. No significant clinical or pathological changes were observed in response to infection with either bacterial species. Expression of selected genes involved in pathogen detection and the innate immune response were profiled in caecal tissues by quantitative real-time PCR. TLR4 and TLR21 gene expression was transiently increased in response to both bacterial species (P<0.05). Significant increases in TLR5 and TLR15 gene expression were detected in response to S. Typhimurium but not to C. jejuni. Transient increases of proinflammatory cytokine (IL6 and IFNG) and chemokine (IL8 and K60) genes increased as early as 6h in response to S. Typhimurium. Minimal cytokine gene expression was detected in response to C. jejuni after 20h. IL8 gene expression however, was significantly increased by 24-fold (P<0.01). The differential expression profiles of innate immune genes in both infection models shed light on the tailored responses of the host immune system to specific microbes. It is further evidence that innate regulation of these responses is an important prerequisite to preventing development of disease.

  1. Evolutionary History of the Cancer Immunity Antigen MAGE Gene Family

    PubMed Central

    Katsura, Yukako; Satta, Yoko


    The evolutionary mode of a multi-gene family can change over time, depending on the functional differentiation and local genomic environment of family members. In this study, we demonstrate such a change in the melanoma antigen (MAGE) gene family on the mammalian X chromosome. The MAGE gene family is composed of ten subfamilies that can be categorized into two types. Type I genes are of relatively recent origin, and they encode epitopes for human leukocyte antigen (HLA) in cancer cells. Type II genes are relatively ancient and some of their products are known to be involved in apoptosis or cell proliferation. The evolutionary history of the MAGE gene family can be divided into four phases. In phase I, a single-copy state of an ancestral gene and the evolutionarily conserved mode had lasted until the emergence of eutherian mammals. In phase II, eight subfamily ancestors, with the exception for MAGE-C and MAGE-D subfamilies, were formed via retrotransposition independently. This would coincide with a transposition burst of LINE elements at the eutherian radiation. However, MAGE-C was generated by gene duplication of MAGE-A. Phase III is characterized by extensive gene duplication within each subfamily and in particular the formation of palindromes in the MAGE-A subfamily, which occurred in an ancestor of the Catarrhini. Phase IV is characterized by the decay of a palindrome in most Catarrhini, with the exception of humans. Although the palindrome is truncated by frequent deletions in apes and Old World monkeys, it is retained in humans. Here, we argue that this human-specific retention stems from negative selection acting on MAGE-A genes encoding epitopes of cancer cells, which preserves their ability to bind to highly divergent HLA molecules. These findings are interpreted with consideration of the biological factors shaping recent human MAGE-A genes. PMID:21695252

  2. AAV gene transfer to the retina does not protect retrovirally transduced hepatocytes from the immune response.


    Bellodi-Privato, Marta; Le Meur, Guylène; Aubert, Dominique; Mendes-Madera, Alexandra; Pichard, Virginie; Rolling, Fabienne; Ferry, Nicolas


    Gene therapy of inherited hepatic disease relies on sustained expression of the therapeutic transgene. In many instances, such expression will require immune tolerization to the non-self therapeutic transgene product. We previously demonstrated that a cytotoxic immune response eliminated hepatocytes after in vivo transduction using recombinant retroviral vectors. In the present study we investigated whether prior gene transfer to the retina, which is suspected to induce immune tolerance, could alleviate the immune response occurring after retrovirus mediated gene transfer to the liver. Retinal cells were transduced using adeno-associated viral vectors harbouring a beta-galactosidase transgene. Sixty days later, regenerating hepatocytes were transduced after partial hepatectomy using a recombinant retrovirus carrying the transgene. Three weeks later, anti beta-galactosidase antibodies were present in all animals. Elimination of the transduced hepatocytes eventually occurred in all animals by 2 months after liver gene transfer, although sustained beta-galactosidase expression was still present in the retina in 66% of the animals. We conclude that although the retina behaves as an immunoprivileged site, gene expression in the subretinal space is not sufficient to induce immune tolerance to a transgene product expressed in the liver.

  3. Achilles is a circadian clock-controlled gene that regulates immune function in Drosophila.


    Li, Jiajia; Terry, Erin E; Fejer, Edith; Gamba, Diana; Hartmann, Natalie; Logsdon, Joseph; Michalski, Daniel; Rois, Lisa E; Scuderi, Maria J; Kunst, Michael; Hughes, Michael E


    The circadian clock is a transcriptional/translational feedback loop that drives the rhythmic expression of downstream mRNAs. Termed "clock-controlled genes," these molecular outputs of the circadian clock orchestrate cellular, metabolic, and behavioral rhythms. As part of our on-going work to characterize key upstream regulators of circadian mRNA expression, we have identified a novel clock-controlled gene in Drosophila melanogaster, Achilles (Achl), which is rhythmic at the mRNA level in the brain and which represses expression of antimicrobial peptides in the immune system. Achilles knock-down in neurons dramatically elevates expression of crucial immune response genes, including IM1 (Immune induced molecule 1), Mtk (Metchnikowin), and Drs (Drosomysin). As a result, flies with knocked-down Achilles expression are resistant to bacterial challenges. Meanwhile, no significant change in core clock gene expression and locomotor activity is observed, suggesting that Achilles influences rhythmic mRNA outputs rather than directly regulating the core timekeeping mechanism. Notably, Achilles knock-down in the absence of immune challenge significantly diminishes the fly's overall lifespan, indicating a behavioral or metabolic cost of constitutively activating this pathway. Together, our data demonstrate that (1) Achilles is a novel clock-controlled gene that (2) regulates the immune system, and (3) participates in signaling from neurons to immunological tissues. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Trypanosoma cruzi: H2 complex and genetic background influence on the humoral immune response against epimastigotes.


    Aguillón, J C; Hermosilla, T; Molina, M C; Morello, A; Repetto, Y; Orn, A; Ferreira, A


    Using A.SW, A.CA, B10.S and B10.M congenic mouse strains, we measured the IgG specific humoral immune responses against sonicated and live Trypanosoma cruzi epimastigotes. Genes located in the A background (A.SW and A.CA strains) mediate higher IgG responses against the parasite antigenic complexes than those located in the B background (strains B10.S and B10.M), regardless of the H2 haplotypes. Thus, non H2 genetic elements seem to be more important in determining differences in the total IgG immune response against T. cruzi. Whether a detectable H2 effect, in favor of the H2(s) haplotype, occurred in the A or B background, was contingent on the immunisation protocol used. Thus, the H2(s) haplotype mediates a higher IgG response in the A background, if immunised with live epimastigotes, and in the B background against sonicated epimastigotes. Most likely this represents a complex sequence of events, controlled by non-MHC genes, involving antigen handling and processing and depending on the physical form of antigen delivery.

  5. Genes of innate immunity and the biological response to inhaled ozone

    PubMed Central

    Li, Zhuowei; Tighe, Robert M.; Feng, Feifei; Ledford, Julie G.; Hollingsworth, John W.


    Ambient ozone has a significant impact on human health. We have made considerable progress in understanding the fundamental mechanisms that regulate the biological response to ozone. It is increasingly clear that genes of innate immunity play a central role in both infectious and non-infectious lung disease. The biological response to ambient ozone provides a clinically relevant environmental exposure that allows us to better understand the role of innate immunity in non-infectious airways disease. In this brief review, we focus on: (1) specific cell types in the lung modified by ozone; (2) ozone and oxidative stress; (3) the relationship between genes of innate immunity and ozone; (4) the role of extracellular matrix in reactive airways disease; and (5) the effect of ozone on the adaptive immune system. We summarize recent advances in understanding the mechanisms that ozone contributes to environmental airways disease. PMID:23169704

  6. Strategies to Modulate Immune Responses: A New Frontier for Gene Therapy

    PubMed Central

    Arruda, Valder R; Favaro, Patricia; Finn, Jonathan D


    The success of gene therapy strategies to cure disease relies on the control of unwanted immune responses to transgene products, genetically modified cells and/or to the vector. Effective treatment of an established immune response is much harder to achieve than prevention of a response before it has had a chance to develop. However, preventive strategies are not always effective in avoiding immune responses, thus the use of drugs to induce immunosuppression (IS) is required. The growing discovery of novel drugs provides a conceptual shift from using generalized, moderately intensive immunosuppressive regimens towards a refined approach to attain the optimal balance of naive cells, effector cells, memory cells, and regulatory cells, harnessing the natural tolerance mechanisms of the body. We review several strategies based on transient IS coupled with gene therapy for sustained immune tolerance induction to the therapeutic transgene. PMID:19584819

  7. Therapeutic antibody gene transfer: an active approach to passive immunity.


    Bakker, Joost M; Bleeker, Wim K; Parren, Paul W H I


    Advances in gene transfer approaches are enabling the possibility of applying therapeutic antibodies using DNA. In particular gene transfer in combination with electroporation is promising and can result in generating in vivo antibody concentrations in the low therapeutic range. However, several important problems need to be dealt with before antibody gene transfer can become a valuable supplement to the current therapies. As antibody production following gene transfer is difficult to control, the danger of inducing autoimmune conditions or uncontrollable side effects occurs in cases in which autologous antigens are targeted. It is suggested that the most promising area of application therefore appears to be infectious disease in which heterologous antigens are targeted and concerns for long-term antibody exposure are minimal. Finally, genes encoding fully human antibodies will enhance long-term expression and decrease problems linked to immunogenicity.

  8. Enhanced transcription of complement and coagulation genes in the absence of adaptive immunity

    PubMed Central

    Jima, Dereje D.; Shah, Radhika N.; Orcutt, Timothy M.; Joshi, Deepa; Law, J. McHugh; Litman, Gary W.; Trede, Nikolaus S.; Yoder, Jeffrey A.


    A recessive nonsense mutation in the zebrafish recombination activating gene 1 (rag1) gene results in defective V(D)J recombination; however, animals homozygous for this mutation (rag1-/-) are reportedly viable and fertile in standard, nonsterile aquarium conditions but display increased mortality after intraperitoneal injection with mycobacteria. Based on their survival in nonsterile environments, we hypothesized that the rag1-/- zebrafish may possess an “enhanced” innate immune response to compensate for the lack of an adaptive immune system. To test this hypothesis, microarray analyses were used to compare the expression profiles of the intestines and hematopoietic kidneys of rag1 deficient zebrafish to the expression profiles of control (heterozygous) siblings. The expression levels of 12 genes were significantly altered in the rag1-/- kidney including the up regulation of a putative interferon stimulated gene, and the down regulation of genes encoding fatty acid binding protein 10, keratin 5 and multiple heat shock proteins. The expression levels of 87 genes were shown to be significantly altered in the rag1-/- intestine; the majority of these differences reflect increased expression of innate immune genes, including those of the coagulation and complement pathways. Subsequent analyses of orthologous coagulation and complement genes in Rag1-/- mice indicate increased transcription of the complement C4 gene in the Rag1-/-intestine. PMID:19200601

  9. ImmuSort, a database on gene plasticity and electronic sorting for immune cells

    PubMed Central

    Wang, Pingzhang; Yang, Yehong; Han, Wenling; Ma, Dalong


    Gene expression is highly dynamic and plastic. We present a new immunological database, ImmuSort. Unlike other gene expression databases, ImmuSort provides a convenient way to view global differential gene expression data across thousands of experimental conditions in immune cells. It enables electronic sorting, which is a bioinformatics process to retrieve cell states associated with specific experimental conditions that are mainly based on gene expression intensity. A comparison of gene expression profiles reveals other applications, such as the evaluation of immune cell biomarkers and cell subsets, identification of cell specific and/or disease-associated genes or transcripts, comparison of gene expression in different transcript variants and probe set quality evaluation. A plasticity score is introduced to measure gene plasticity. Average rank and marker evaluation scores are used to evaluate biomarkers. The current version includes 31 human and 17 mouse immune cell groups, comprising 10,422 and 3,929 microarrays derived from public databases, respectively. A total of 20,283 human and 20,963 mouse genes are available to query in the database. Examples show the distinct advantages of the database. The database URL is PMID:25988315

  10. Candidate innate immune system gene expression in the ecological model Daphnia

    PubMed Central

    Decaestecker, Ellen; Labbé, Pierrick; Ellegaard, Kirsten; Allen, Judith E.; Little, Tom J.


    The last ten years have witnessed increasing interest in host–pathogen interactions involving invertebrate hosts. The invertebrate innate immune system is now relatively well characterised, but in a limited range of genetic model organisms and under a limited number of conditions. Immune systems have been little studied under real-world scenarios of environmental variation and parasitism. Thus, we have investigated expression of candidate innate immune system genes in the water flea Daphnia, a model organism for ecological genetics, and whose capacity for clonal reproduction facilitates an exceptionally rigorous control of exposure dose or the study of responses at many time points. A unique characteristic of the particular Daphnia clones and pathogen strain combinations used presently is that they have been shown to be involved in specific host–pathogen coevolutionary interactions in the wild. We choose five genes, which are strong candidates to be involved in Daphnia–pathogen interactions, given that they have been shown to code for immune effectors in related organisms. Differential expression of these genes was quantified by qRT-PCR following exposure to the bacterial pathogen Pasteuria ramosa. Constitutive expression levels differed between host genotypes, and some genes appeared to show correlated expression. However, none of the genes appeared to show a major modification of expression level in response to Pasteuria exposure. By applying knowledge from related genetic model organisms (e.g. Drosophila) to models for the study of evolutionary ecology and coevolution (i.e. Daphnia), the candidate gene approach is temptingly efficient. However, our results show that detection of only weak patterns is likely if one chooses target genes for study based on previously identified genome sequences by comparison to homologues from other related organisms. Future work on the Daphnia–Pasteuria system will need to balance a candidate gene approach with more

  11. Selective Landscapes in newt Immune Genes Inferred from Patterns of Nucleotide Variation.


    Fijarczyk, Anna; Dudek, Katarzyna; Babik, Wieslaw


    Host-pathogen interactions may result in either directional selection or in pressure for the maintenance of polymorphism at the molecular level. Hence signatures of both positive and balancing selection are expected in immune genes. Because both overall selective pressure and specific targets may differ between species, large-scale population genomic studies are useful in detecting functionally important immune genes and comparing selective landscapes between taxa. Such studies are of particular interest in amphibians, a group threatened worldwide by emerging infectious diseases. Here, we present an analysis of polymorphism and divergence of 634 immune genes in two lineages of Lissotriton newts: L. montandoni and L. vulgaris graecus Variation in newt immune genes has been shaped predominantly by widespread purifying selection and strong evolutionary constraint, implying long-term importance of these genes for functioning of the immune system. The two evolutionary lineages differ in the overall strength of purifying selection which can partially be explained by demographic history but may also signal differences in long-term pathogen pressure. The prevalent constraint notwithstanding, 23 putative targets of positive selection and 11 putative targets of balancing selection were identified. The latter were detected by composite tests involving the demographic model and further validated in independent population samples. Putative targets of balancing selection encode proteins which may interact closely with pathogens but include also regulators of immune response. The identified candidates will be useful for testing whether genes affected by balancing selection are more prone to interspecific introgression than other genes in the genome. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  12. Characterization of the rainbow trout spleen transcriptome and identification of immune-related genes

    PubMed Central

    Ali, Ali; Rexroad, Caird E.; Thorgaard, Gary H.; Yao, Jianbo; Salem, Mohamed


    Resistance against diseases affects profitability of rainbow trout. Limited information is available about functions and mechanisms of teleost immune pathways. Immunogenomics provides powerful tools to determine disease resistance genes/gene pathways and develop genetic markers for genomic selection. RNA-Seq sequencing of the rainbow trout spleen yielded 93,532,200 reads (100 bp). High quality reads were assembled into 43,047 contigs. 26,333 (61.17%) of the contigs had hits to the NR protein database and 7024 (16.32%) had hits to the KEGG database. Gene ontology showed significant percentages of transcripts assigned to binding (51%), signaling (7%), response to stimuli (9%) and receptor activity (4%) suggesting existence of many immune-related genes. KEGG annotation revealed 2825 sequences belonging to “organismal systems” with the highest number of sequences, 842 (29.81%), assigned to immune system. A number of sequences were identified for the first time in rainbow trout belonging to Toll-like receptor signaling (35), B cell receptor signaling pathway (44), T cell receptor signaling pathway (56), chemokine signaling pathway (73), Fc gamma R-mediated phagocytosis (52), leukocyte transendothelial migration (60) and NK cell mediated cytotoxicity (42). In addition, 51 transcripts were identified as spleen-specific genes. The list includes 277 full-length cDNAs. The presence of a large number of immune-related genes and pathways similar to other vertebrates suggests that innate and adaptive immunity in fish are conserved. This study provides deep-sequence data of rainbow trout spleen transcriptome and identifies many new immune-related genes and full-length cDNAs. This data will help identify allelic variations suitable for genomic selection and genetic manipulation in aquaculture. PMID:25352861

  13. Microgravity and immunity: Changes in lymphocyte gene expression.

    NASA Astrophysics Data System (ADS)

    Risin, D.; Ward, N. E.; Risin, S. A.; Pellis, N. R.

    Earlier studies had shown that modeled and true microgravity MG cause multiple direct effects on human lymphocytes MG inhibits lymphocyte locomotion suppresses polyclonal and antigen-specific activation affects signal transduction mechanisms as well as activation-induced apoptosis In this study we assessed changes in gene expression associated with lymphocyte exposure to microgravity in an attempt to identify microgravity-sensitive genes MGSG in general and specifically those genes that might be responsible for the functional and structural changes observed earlier Two sets of experiments targeting different goals were conducted In the first set T-lymphocytes from normal donors were activated with anti-CD3 and IL2 and then cultured in 1g static and modeled MG MMG conditions Rotating Wall Vessel bioreactor for 24 hours This setting allowed searching for MGSG by comparison of gene expression patterns in zero and 1 g gravity In the second set - activated T-cells after culturing for 24 hours in 1g and MMG were exposed three hours before harvesting to a secondary activation stimulus PHA thus triggering the apoptotic pathway Total RNA was extracted using the RNeasy isolation kit Qiagen Valencia CA Affymetrix Gene Chips U133A allowing testing for 18 400 human genes were used for microarray analysis The experiments were performed in triplicates with T-cells obtained from different blood donors to minimize the possible input of biological variation in gene expression and discriminate changes that are associated with the

  14. Contrasting invertebrate immune defense behaviors caused by a single gene, the Caenorhabditis elegans neuropeptide receptor gene npr-1.


    Nakad, Rania; Snoek, L Basten; Yang, Wentao; Ellendt, Sunna; Schneider, Franziska; Mohr, Timm G; Rösingh, Lone; Masche, Anna C; Rosenstiel, Philip C; Dierking, Katja; Kammenga, Jan E; Schulenburg, Hinrich


    The invertebrate immune system comprises physiological mechanisms, physical barriers and also behavioral responses. It is generally related to the vertebrate innate immune system and widely believed to provide nonspecific defense against pathogens, whereby the response to different pathogen types is usually mediated by distinct signalling cascades. Recent work suggests that invertebrate immune defense can be more specific at least at the phenotypic level. The underlying genetic mechanisms are as yet poorly understood. We demonstrate in the model invertebrate Caenorhabditis elegans that a single gene, a homolog of the mammalian neuropeptide Y receptor gene, npr-1, mediates contrasting defense phenotypes towards two distinct pathogens, the Gram-positive Bacillus thuringiensis and the Gram-negative Pseudomonas aeruginosa. Our findings are based on combining quantitative trait loci (QTLs) analysis with functional genetic analysis and RNAseq-based transcriptomics. The QTL analysis focused on behavioral immune defense against B. thuringiensis, using recombinant inbred lines (RILs) and introgression lines (ILs). It revealed several defense QTLs, including one on chromosome X comprising the npr-1 gene. The wildtype N2 allele for the latter QTL was associated with reduced defense against B. thuringiensis and thus produced an opposite phenotype to that previously reported for the N2 npr-1 allele against P. aeruginosa. Analysis of npr-1 mutants confirmed these contrasting immune phenotypes for both avoidance behavior and nematode survival. Subsequent transcriptional profiling of C. elegans wildtype and npr-1 mutant suggested that npr-1 mediates defense against both pathogens through p38 MAPK signaling, insulin-like signaling, and C-type lectins. Importantly, increased defense towards P. aeruginosa seems to be additionally influenced through the induction of oxidative stress genes and activation of GATA transcription factors, while the repression of oxidative stress genes

  15. De novo annotation of the immune-enriched transcriptome provides insights into immune system genes of Chinese sturgeon (Acipenser sinensis).


    Zhu, Rong; Du, He-Jun; Li, Shun-Yi; Li, Ya-Dong; Ni, Hong; Yu, Xue-Jing; Yang, Yan-Yan; Fan, Yu-Ding; Jiang, Nan; Zeng, Ling-Bing; Wang, Xing-Guo


    Chinese sturgeon (Acipenser sinensis), one of the oldest extant actinopterygian fishes with very high evolutionary, economical and conservation interest, is considered to be one of the critically endangered aquatic animals in China. Up to date, the immune system of this species remains largely undetermined with little sequence information publicly available. Herein, the first comprehensive transcriptome of immune tissues for Chinese sturgeon was characterized using Illumina deep sequencing. Over 67 million high-quality reads were generated and de novo assembled into the final set of 91,739 unique sequences. The annotation pipeline revealed that 25,871 unigenes were successfully annotated in the public databases, of which only 2002 had significant match to the existing sequences for the genus Acipenser. Overall 22,827 unigenes were categorized into 52 GO terms, 12,742 were classified into 26 KOG categories, and 4968 were assigned to 339 KEGG pathways. A more detailed annotation search showed the presence of a notable representation of immune-related genes, which suggests that this non-teleost actinopterygian fish harbors the same intermediates as in the well known immune pathways from mammals and teleosts, such as pattern recognition receptor (PRR) signaling pathway, JAK-STAT signaling pathway, complement and coagulation pathway, T-cell receptor (TCR) and B-cell receptor (BCR) signaling pathways. Additional genetic marker discovery led to the retrieval of 20,056 simple sequence repeats (SSRs) and 327,140 single nucleotide polymorphisms (SNPs). This immune-enriched transcriptome of Chinese sturgeon represents a rich resource that adds to the currently nascent field of chondrostean fish immunogenetics and furthers the conservation and management of this valuable fish.

  16. [The relationship between the polymorphism of immunity genes and both aging and age-related diseases].


    Ruan, Qing-Wei; Yu, Zhuo-Wei; Bao, Zhi-Jun; Ma, Yong-Xing


    Aging is acommon, progressive and irreversible state of multi-cell dysfunction. Immune aging mainly includes the declines of regenerative capacity and lymphoid lineage differentiation potential, the hyporesponsive to infection and vaccination, the hyperresponsive in the context of inflammatory pathology, and the increased risk of autoimmunity. The dysfunction of aged immune system accelerates the occurrence of aging and age-related diseases. The mutation of immunity genes that affect immune responses accelerates or slows aging process and age-related diseases. The frequencies of acquired immunity genes, such as immune protective HLA II DRB1*11 and DRB*16-associated haplotype, are increased in the longevity populations. The increased susceptibility of immune inflammatory response, morbidity and mortality in the elderly is often associated with decreased frequencies of anti-inflammatory factor IL-10 -1082G allele, TNF-β1 haplotype cnd10T/C, cnd25G/G, -988C/C, -800G/A, low proinflammatory fator TNFa level related extended TNF-A genotype -1031C/C, -863C/A, -857C/C, IL-6-174 CC and IFN-γ+874 T allele as well. The innate immunity genes, such as highly expressed anti-inflammatory +896 G KIR4 allele, CCR5Δ32 variant, -765 C Cox-2 allele, -1708 G and 21 C 5-Lox alleles are detected in centenarians. In age-related diseases, a higher CMV-specific IgG antibody level in elderly individuals is associated with a decreased frequency of KIR haplotypes KIR2DS5 and A1B10 and an increased frequency of MBL2 haplotypes LYPB, LYQC and HYPD that result in the absence of MBL2 protein. The increased frequencies of CRP ATG haplotypes and CFH 402 His allele indicate high mortality in the elderly. In the present study, we review the advances in the polymorphism and haplotype of innate and adoptive immunity genes, and their association with both aging and age-related diseases. To strengthen the analysis of extended haplotypes, epigenetic studies of immunity genes and genetic study of

  17. Exploiting Gene-Expression Deconvolution to Probe the Genetics of the Immune System.


    Steuerman, Yael; Gat-Viks, Irit


    Sequence variation can affect the physiological state of the immune system. Major experimental efforts targeted at understanding the genetic control of the abundance of immune cell subpopulations. However, these studies are typically focused on a limited number of immune cell types, mainly due to the use of relatively low throughput cell-sorting technologies. Here we present an algorithm that can reveal the genetic basis of inter-individual variation in the abundance of immune cell types using only gene expression and genotyping measurements as input. Our algorithm predicts the abundance of immune cell subpopulations based on the RNA levels of informative marker genes within a complex tissue, and then provides the genetic control on these predicted immune traits as output. A key feature of the approach is the integration of predictions from various sets of marker genes and refinement of these sets to avoid spurious signals. Our evaluation of both synthetic and real biological data shows the significant benefits of the new approach. Our method, VoCAL, is implemented in the freely available R package ComICS.

  18. Exploiting Gene-Expression Deconvolution to Probe the Genetics of the Immune System

    PubMed Central

    Steuerman, Yael; Gat-Viks, Irit


    Sequence variation can affect the physiological state of the immune system. Major experimental efforts targeted at understanding the genetic control of the abundance of immune cell subpopulations. However, these studies are typically focused on a limited number of immune cell types, mainly due to the use of relatively low throughput cell-sorting technologies. Here we present an algorithm that can reveal the genetic basis of inter-individual variation in the abundance of immune cell types using only gene expression and genotyping measurements as input. Our algorithm predicts the abundance of immune cell subpopulations based on the RNA levels of informative marker genes within a complex tissue, and then provides the genetic control on these predicted immune traits as output. A key feature of the approach is the integration of predictions from various sets of marker genes and refinement of these sets to avoid spurious signals. Our evaluation of both synthetic and real biological data shows the significant benefits of the new approach. Our method, VoCAL, is implemented in the freely available R package ComICS. PMID:27035464

  19. Systemic protein delivery by muscle-gene transfer is limited by a local immune response

    PubMed Central

    Wang, Lixin; Dobrzynski, Eric; Schlachterman, Alexander; Cao, Ou; Herzog, Roland W.


    Adeno-associated viral (AAV) vectors have been successfully used for therapeutic expression of systemic transgene products (such as factor IX or erythropoietin) following in vivo administration to skeletal muscle of animal models of inherited hematologic disorders. However, an immune response may be initiated if the transgene product represents a neoantigen. Here, we use ovalbumin (OVA) as a model antigen and demonstrate immune-mediated elimination of expression on muscle-directed AAV-2 gene transfer. Administration to immune competent mice resulted in transient systemic OVA expression. Within 10 days, OVA-specific T-helper cells had been activated in draining lymph nodes, an inflammatory immune response ensued, and OVA-expressing muscle fibers were destroyed by a cytotoxic CD8+ T-cell response. Use of a muscle-specific promoter did not prevent this immune response. Adoptively transferred CD4+ cells transgenic for a T-cell receptor specific to OVA peptide-major histocompatibility complex class II showed antigen-specific, vector dose-dependent proliferation confined to the draining lymph nodes of AAV-OVA–transduced muscle within 5 days after gene transfer and subsequently participated in lymphocytic infiltration of transduced muscle. This study documents that a local immune response limits sustained expression of a secreted protein in muscle gene transfer, a finding that may have consequences for design of clinical protocols. PMID:15713796

  20. Balancing selection on immunity genes: review of the current literature and new analysis in Drosophila melanogaster.


    Croze, Myriam; Živković, Daniel; Stephan, Wolfgang; Hutter, Stephan


    Balancing selection has been widely assumed to be an important evolutionary force, yet even today little is known about its abundance and its impact on the patterns of genetic diversity. Several studies have shown examples of balancing selection in humans, plants or parasites, and many genes under balancing selection are involved in immunity. It has been proposed that host-parasite coevolution is one of the main forces driving immune genes to evolve under balancing selection. In this paper, we review the literature on balancing selection on immunity genes in several organisms, including Drosophila. Furthermore, we performed a genome scan for balancing selection in an African population of Drosophila melanogaster using coalescent simulations of a demographic model with and without selection. We find very few genes under balancing selection and only one novel candidate gene related to immunity. Finally, we discuss the possible causes of the low number of genes under balancing selection. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

  1. Prognostic immune-related gene models for breast cancer: a pooled analysis.


    Zhao, Jianli; Wang, Ying; Lao, Zengding; Liang, Siting; Hou, Jingyi; Yu, Yunfang; Yao, Herui; You, Na; Chen, Kai


    Breast cancer, the most common cancer among women, is a clinically and biologically heterogeneous disease. Numerous prognostic tools have been proposed, including gene signatures. Unlike proliferation-related prognostic gene signatures, many immune-related gene signatures have emerged as principal biology-driven predictors of breast cancer. Diverse statistical methods and data sets were used for building these immune-related prognostic models, making it difficult to compare or use them in clinically meaningful ways. This study evaluated successfully published immune-related prognostic gene signatures through systematic validations of publicly available data sets. Eight prognostic models that were built upon immune-related gene signatures were evaluated. The performances of these models were compared and ranked in ten publicly available data sets, comprising a total of 2,449 breast cancer cases. Predictive accuracies were measured as concordance indices (C-indices). All tests of statistical significance were two-sided. Immune-related gene models performed better in estrogen receptor-negative (ER-) and lymph node-positive (LN+) breast cancer subtypes. The three top-ranked ER- breast cancer models achieved overall C-indices of 0.62-0.63. Two models predicted better than chance for ER+ breast cancer, with C-indices of 0.53 and 0.59, respectively. For LN+ breast cancer, four models showed predictive advantage, with C-indices between 0.56 and 0.61. Predicted prognostic values were positively correlated with ER status when evaluated using univariate analyses in most of the models under investigation. Multivariate analyses indicated that prognostic values of the three models were independent of known clinical prognostic factors. Collectively, these analyses provided a comprehensive evaluation of immune-related prognostic gene signatures. By synthesizing C-indices in multiple independent data sets, immune-related gene signatures were ranked for ER+, ER-, LN+, and LN- breast

  2. Microgravity and Immunity: Changes in Lymphocyte Gene Expression

    NASA Technical Reports Server (NTRS)

    Risin, D.; Pellis, N. R.; Ward, N. E.; Risin, S. A.


    Earlier studies had shown that modeled and true microgravity (MG) cause multiple direct effects on human lymphocytes. MG inhibits lymphocyte locomotion, suppresses polyclonal and antigen-specific activation, affects signal transduction mechanisms, as well as activation-induced apoptosis. In this study we assessed changes in gene expression associated with lymphocyte exposure to microgravity in an attempt to identify microgravity-sensitive genes (MGSG) in general and specifically those genes that might be responsible for the functional and structural changes observed earlier. Two sets of experiments targeting different goals were conducted. In the first set, T-lymphocytes from normal donors were activated with antiCD3 and IL2 and then cultured in 1g (static) and modeled MG (MMG) conditions (Rotating Wall Vessel bioreactor) for 24 hours. This setting allowed searching for MGSG by comparison of gene expression patterns in zero and 1 g gravity. In the second set - activated T-cells after culturing for 24 hours in 1g and MMG were exposed three hours before harvesting to a secondary activation stimulus (PHA) thus triggering the apoptotic pathway. Total RNA was extracted using the RNeasy isolation kit (Qiagen, Valencia, CA). Affymetrix Gene Chips (U133A), allowing testing for 18,400 human genes, were used for microarray analysis. In the first set of experiments MMG exposure resulted in altered expression of 89 genes, 10 of them were up-regulated and 79 down-regulated. In the second set, changes in expression were revealed in 85 genes, 20 were up-regulated and 65 were down-regulated. The analysis revealed that significant numbers of MGS genes are associated with signal transduction and apoptotic pathways. Interestingly, the majority of genes that responded by up- or down-regulation in the alternative sets of experiments were not the same, possibly reflecting different functional states of the examined T-lymphocyte populations. The responder genes (MGSG) might play an

  3. Natural genetic variation profoundly regulates gene expression in immune cells and dictates susceptibility to CNS autoimmunity.


    Bearoff, F; Del Rio, R; Case, L K; Dragon, J A; Nguyen-Vu, T; Lin, C-Y; Blankenhorn, E P; Teuscher, C; Krementsov, D N


    Regulation of gene expression in immune cells is known to be under genetic control, and likely contributes to susceptibility to autoimmune diseases such as multiple sclerosis (MS). How this occurs in concert across multiple immune cell types is poorly understood. Using a mouse model that harnesses the genetic diversity of wild-derived mice, more accurately reflecting genetically diverse human populations, we provide an extensive characterization of the genetic regulation of gene expression in five different naive immune cell types relevant to MS. The immune cell transcriptome is shown to be under profound genetic control, exhibiting diverse patterns: global, cell-specific and sex-specific. Bioinformatic analysis of the genetically controlled transcript networks reveals reduced cell type specificity and inflammatory activity in wild-derived PWD/PhJ mice, compared with the conventional laboratory strain C57BL/6J. Additionally, candidate MS-GWAS (genome-wide association study candidate genes for MS susceptibility) genes were significantly enriched among transcripts overrepresented in C57BL/6J cells compared with PWD. These expression level differences correlate with robust differences in susceptibility to experimental autoimmune encephalomyelitis, the principal model of MS, and skewing of the encephalitogenic T-cell responses. Taken together, our results provide functional insights into the genetic regulation of the immune transcriptome, and shed light on how this in turn contributes to susceptibility to autoimmune disease.

  4. Complement C3 gene: Expression characterization and innate immune response in razor clam Sinonovacula constricta.


    Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale


    Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta.

  5. Identification of immunity-related genes in the burying beetle Nicrophorus vespilloides by suppression subtractive hybridization.


    Vogel, H; Badapanda, C; Vilcinskas, A


    Burying beetles reproduce on small vertebrate cadavers which they bury in the soil after localization through volatiles emitted from the carcass. They then chemically preserve the carcass and prepare it as a diet for the adults and their offspring. It is predicted that exposure to high loads of soil and/or carrion-associated microbes necessitates an effective immune system. In the present paper, we report experimental screening for immunity-related genes in the burying beetle Nicrophorus vespilloides using the suppression subtractive hybridization approach. A total of 1179 putative gene objects were identified in the Nicrophorus cDNA library, which was enriched for transcripts differentially expressed upon challenge with heat-inactivated bacteria. In addition to genes known to be involved in immunity-related recognition and signalling, we found transcripts encoding for antimicrobial peptides and for an array of enzymes that can be linked to immunity or to stress-induced pathways. We also determined proteins that may contribute to detoxification of toxins produced by microbial competitors. In addition, factors involved in mRNA stability determination and central components of the RNA interference machinery were identified, implying transcriptional reprogramming and potential stress-induced retrotransposon elimination. The identified candidate immune effector and stress-related genes may provide important information about the unusual ecology and evolution of the burying beetles.

  6. Identification and analysis of divergent immune gene families within the Tasmanian devil genome.


    Morris, Katrina M; Cheng, Yuanyuan; Warren, Wesley; Papenfuss, Anthony T; Belov, Katherine


    The Tasmanian devil (Sarcophilus harrisii) is being threatened with extinction in the wild by a disease known as devil facial tumour disease (DFTD). In order to prevent the spread of this disease a thorough understanding of the Tasmanian devil immune system and its response to the disease is required. In 2011 and 2012 two genome sequencing projects of the Tasmania devil were released. This has provided us with the raw data required to begin to investigate the Tasmanian devil immunome in depth. In this study we characterise immune gene families of the Tasmanian devil. We focus on immunoglobulins, T cell receptors and cytokine families. We identify and describe 119 cytokines including 40 interleukins, 39 chemokines, 8 interferons, 18 tumour necrosis family cytokines and 14 additional cytokines. Constant regions for immunoglobulins and T cell receptors were also identified. The repertoire of genes in these families was similar to the opossum, however devil specific duplications were seen and orthologs to eutherian genes not previously identified in any marsupial were also identified. By using multiple data sources as well as targeted search methods, highly divergent genes across the Tasmanian devil immune system were identified and characterised. This understanding will allow for the development of devil specific assays and reagents and allow for future studies into the immune response of the Tasmanian devil immune system to DFTD.

  7. Altered expression of immune-related genes in children with Down syndrome.


    Zampieri, Bruna Lancia; Biselli-Périco, Joice Matos; de Souza, Jorge Estefano Santana; Bürger, Matheus Carvalho; Silva Júnior, Wilson Araújo; Goloni-Bertollo, Eny Maria; Pavarino, Erika Cristina


    Individuals with Down syndrome (DS) have a high incidence of immunological alterations with increased susceptibility to bacterial and viral infections and high frequency of different types of hematologic malignancies and autoimmune disorders. In the current study, we profiled the expression pattern of 92 immune-related genes in peripheral blood mononuclear cells (PBMCs) of two different groups, children with DS and control children, to identify differentially expressed genes that might be of pathogenetic importance for the development and phenotype of the immunological alterations observed in individuals with DS. PBMCs samples were obtained from six DS individuals with karyotypically confirmed full trisomy 21 and six healthy control individuals (ages 2-6 years). Gene expression was profiled in duplicate according to the manufacturer's instructions provided by commercially available TaqMan Human Immune Array representing 92 immune function genes and four reference genes on a 96-plex gene card. A set of 17 differentially expressed genes, not located on chromosome 21 (HSA21), involved in immune and inflammatory pathways was identified including 13 genes (BCL2, CCL3, CCR7, CD19, CD28, CD40, CD40LG, CD80, EDN1, IKBKB, IL6, NOS2 and SKI) significantly down-regulated and four genes (BCL2L1, CCR2, CCR5 and IL10) significantly up-regulated in children with DS. These findings highlight a list of candidate genes for further investigation into the molecular mechanism underlying DS pathology and reinforce the secondary effects of the presence of a third copy of HSA21.

  8. Multiplex immune-related genes expression analysis response to bacterial challenge in mud crab, Scylla paramamosain.


    Zhang, Fengying; Jiang, Keji; Sun, Manman; Zhang, Dan; Ma, Lingbo


    Crabs lack an acquired adaptive immune system and host defense is believed to depend entirely on innate, non-adaptive mechanisms to resist invasion by pathogens. Discovery of immune-related factors are helpful for understanding the molecular response of crabs to pathogens. The mud crab Scylla paramamosain is an important marine species for aquaculture in China because of its high nutritional value for humans. In recent years, the crab is prone to being infected by microbes with the enlargement of breeding scale. In this study, eight immune-related genes were analyzed by multiplex genes expression analysis using the GenomeLab GeXP analysis system (Beckman Coulter). The expression levels of all the detected genes rose after challenged by the live bacteria, but the levels of only four genes (C-type lectin, alpha 2-macroglobulin, HSP70 and thioredoxin 1) increased after challenge in heat-killed bacteria group. So the live bacteria were more effective in motivating expressions of immune factors than heat-killed bacteria. However, the transcript of C-type lectin firstly increased at 1 h after challenge in both heat-killed and live bacteria group. This indicated that C-type lectin was a quite susceptive immune factor responding to external pathogen. In group challenged by live bacteria, the genes of alpha 2-macroglobulin, HSP40, thioredoxin 1 and prophenoloxidase activating factor (PPAF) showed response earlier than the other genes. The rise of PPAF expression preceded prophenoloxidase (proPO), which suggested that PPAF might trigger production of proPO transcripts in the early stage of phenoloxidase reaction system. C-type lectin, proPO, thioredoxin 1, HSP40, and alpha 2-macroglobulin are very important immunity factors in response to bacterial infection. According to the result of heat-killed group, HSP70 is a sensitively inductive factor to foreign stimulus compared with the other genes. The multi-gene analysis presented an alternative approach for screening of immune

  9. Nucleic acid vaccination of Brucella abortus ribosomal L7/L12 gene elicits immune response.


    Kurar, E; Splitter, G A


    Nucleic acid vaccines provide an exciting approach for antigen presentation to the immune system. As a test of this new methodology, the immune response to the in vivo-expressed Brucella abortus ribosomal L7/12 gene in the muscle cells of mice was examined. To accomplish this goal the eukaryotic expression systems pcDNA3 and p6 were used. Single intramuscular injection of the L7/L12 gene driven by the human cytomegalovirus (CMV) promoter (pcDNA3) or bovine MHC 1 promoter (p6) resulted in intracellular expression of the B. abortus L7/L12 immunodominant protein encoded by this gene. This application facilitated directed antigen presentation to the immune system and established specific antibody and T-cell responses compared with vector only (pcDNA3) negative controls and B. abortus S19 injected positive controls. Although pcDNA3-encoded L7/L12 gene-inoculated mice possessed significant protection, p6-L7/L12 did not engender significant protection against B. abortus S2308 infection compared to positive control mice. These data suggest a promising antigen-specific response, and L7/L12 nucleic acid vaccination may be an initial step in the development of genetically engineered candidate vaccines against brucellosis. This study for the first time focuses on DNA immunization of a gene from B. abortus.

  10. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing

    PubMed Central

    Vannette, Rachel L.; Mohamed, Abbas; Johnson, Brian R.


    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging. PMID:26549293

  11. Eda haplotypes in three-spined stickleback are associated with variation in immune gene expression

    PubMed Central

    Robertson, Shaun; Bradley, Janette E.; MacColl, Andrew D. C.


    Haplotypes underlying local adaptation and speciation are predicted to have numerous phenotypic effects, but few genes involved have been identified, with much work to date concentrating on visible, morphological, phenotypes. The link between genes controlling these adaptive morphological phenotypes and the immune system has seldom been investigated, even though changes in the immune system could have profound adaptive consequences. The Eda gene in three-spined stickleback is one of the best studied major adaptation genes; it directly controls bony plate architecture and has been associated with additional aspects of adaptation to freshwater. Here, we exposed F2 hybrids, used to separate Eda genotype from genetic background, to contrasting conditions in semi-natural enclosures. We demonstrate an association between the Eda haplotype block and the expression pattern of key immune system genes. Furthermore, low plated fish grew less and experienced higher burdens of a common ectoparasite with fitness consequences. Little is currently known about the role of the immune system in facilitating adaptation to novel environments, but this study provides an indication of its potential importance. PMID:28195171

  12. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.


    Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R


    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

  13. Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).


    Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine


    The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. © 2015 The Authors. Molecular Ecology Published

  14. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others


    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  15. Immunization.

    ERIC Educational Resources Information Center

    Guerin, Nicole; And Others


    Contents of this double journal issue concern immunization and primary health care of children. The issue decribes vaccine storage and sterilization techniques, giving particular emphasis to the role of the cold chain, i.e., the maintenance of a specific temperature range to assure potency of vaccines as they are moved from a national storage…

  16. Characterizing the Infection-Induced Transcriptome of Nasonia vitripennis Reveals a Preponderance of Taxonomically-Restricted Immune Genes

    PubMed Central

    Sackton, Timothy B.; Werren, John H.; Clark, Andrew G.


    The innate immune system in insects consists of a conserved core signaling network and rapidly diversifying effector and recognition components, often containing a high proportion of taxonomically-restricted genes. In the absence of functional annotation, genes encoding immune system proteins can thus be difficult to identify, as homology-based approaches generally cannot detect lineage-specific genes. Here, we use RNA-seq to compare the uninfected and infection-induced transcriptome in the parasitoid wasp Nasonia vitripennis to identify genes regulated by infection. We identify 183 genes significantly up-regulated by infection and 61 genes significantly down-regulated by infection. We also produce a new homology-based immune catalog in N. vitripennis, and show that most infection-induced genes cannot be assigned an immune function from homology alone, suggesting the potential for substantial novel immune components in less well-studied systems. Finally, we show that a high proportion of these novel induced genes are taxonomically restricted, highlighting the rapid evolution of immune gene content. The combination of functional annotation using RNA-seq and homology-based annotation provides a robust method to characterize the innate immune response across a wide variety of insects, and reveals significant novel features of the Nasonia immune response. PMID:24386321

  17. Spatial and temporal coordination of expression of immune response genes during Pseudomonas infection of horseshoe crab, Carcinoscorpius rotundicauda.


    Ding, J L; Tan, K C; Thangamani, S; Kusuma, N; Seow, W K; Bui, T H H; Wang, J; Ho, B


    Knowledge on how genes are turned on/off during infection and immunity is lacking. Here, we report the co-regulation of diverse clusters of functionally related immune response genes in a horseshoe crab, Carcinoscorpius rotundicauda. Expressed sequence tag (EST) clusters for frontline immune defense, cell signalling, apoptosis and stress response genes were expressed or repressed spatio-temporally during the acute phase of Pseudomonas infection. An infection time course monitored by virtual Northern evaluation indicates upregulation of genes in blood cells (amebocytes) at 3-h postinfection, whereas most of the hepatopancreas genes remained down regulated over 72 h of infection. Thus, the two tissues orchestrate a coordinated and timely response to infection. The hepatopancreas probably immuno-modulates the expression of other genes and serves as a reservoir for later response, if/when chronic infection ensues. On the other hand, being the first to encounter pathogens, we reasoned that amebocytes would respond acutely to infection. Besides acute transactivation of the immune genes, the amebocytes maintained morphological integrity, indicating their ability to synthesise and store/secrete the immune proteins and effectors to sustain the frontline innate immune defense, while simultaneously elicit complement-mediated phagocytosis of the invading pathogen. Our results show that the immune response against Pseudomonas infection is spatially and temporally coordinated. Genes and Immunity (2005) 6, 557-574. doi:10.1038/sj.gene.6364240; published online 7 July 2005.

  18. An MHC class I immune evasion gene of Marek׳s disease virus.


    Hearn, Cari; Preeyanon, Likit; Hunt, Henry D; York, Ian A


    Marek׳s disease virus (MDV) is a widespread α-herpesvirus of chickens that causes T cell tumors. Acute, but not latent, MDV infection has previously been shown to lead to downregulation of cell-surface MHC class I (Virology 282:198-205 (2001)), but the gene(s) involved have not been identified. Here we demonstrate that an MDV gene, MDV012, is capable of reducing surface expression of MHC class I on chicken cells. Co-expression of an MHC class I-binding peptide targeted to the endoplasmic reticulum (bypassing the requirement for the TAP peptide transporter) partially rescued MHC class I expression in the presence of MDV012, suggesting that MDV012 is a TAP-blocking MHC class I immune evasion protein. This is the first unique non-mammalian MHC class I immune evasion gene identified, and suggests that α-herpesviruses have conserved this function for at least 100 million years.

  19. Trans-Species Polymorphism in Immune Genes: General Pattern or MHC-Restricted Phenomenon?

    PubMed Central

    Vinkler, Michal


    Immunity exhibits extraordinarily high levels of variation. Evolution of the immune system in response to host-pathogen interactions in particular ecological contexts appears to be frequently associated with diversifying selection increasing the genetic variability. Many studies have documented that immunologically relevant polymorphism observed today may be tens of millions years old and may predate the emergence of present species. This pattern can be explained by the concept of trans-species polymorphism (TSP) predicting the maintenance and sharing of favourable functionally important alleles of immune-related genes between species due to ongoing balancing selection. Despite the generality of this concept explaining the long-lasting adaptive variation inherited from ancestors, current research in TSP has vastly focused only on major histocompatibility complex (MHC). In this review we summarise the evidence available on TSP in human and animal immune genes to reveal that TSP is not a MHC-specific evolutionary pattern. Further research should clearly pay more attention to the investigation of TSP in innate immune genes and especially pattern recognition receptors which are promising candidates for this type of evolution. More effort should also be made to distinguish TSP from convergent evolution and adaptive introgression. Identification of balanced TSP variants may represent an accurate approach in evolutionary medicine to recognise disease-resistance alleles. PMID:26090501

  20. Identification of immune inducible genes from the velvet worm Epiperipatus biolleyi (Onychophora).


    Altincicek, Boran; Vilcinskas, Andreas


    Onychophora are the next relatives of Arthropoda and, hence, represent an important taxon to unravel relationships among Insecta, Crustacea, Arachnida, and Myriapoda. Here, we screened for immune inducible genes from the onychophoran Epiperipatus biolleyi (Peripatidae) by injecting crude bacterial LPS and applying the suppression subtractive hybridization technique. Our analysis of 288 cDNAs resulted in identification of 36 novel genes in E. biolleyi whose potential homologues from other animals are known to mediate immune-related signaling (e.g. mitogen-activated protein kinase kinase 1 and immunoglobulin enhancer binding protein), to be involved in cellular processes (e.g. perilipin and myosin light chain), or to act as immune effector molecules (e.g. lysosomal beta-galactosidase, a putative antimicrobial peptide and a potential thiolester containing protein). Comparisons with homologous genes from other animals including the two most favored ecdysozoan model organisms of innate immunity research, the nematode Caenorhabditis elegans and the fruit fly Drosophila melanogaster, provide further insights into the origin and evolution of Arthropoda immunity.

  1. Temperature stress affects the expression of immune response genes in the alfalfa leafcutting bee, Megachile rotundata.


    Xu, J; James, Rosalind R


    Environmental stresses are thought to be associated with increases in disease suceptibility, attributable to evolutionary trade-offs between the energy demands required to deal with stress vs pathogens. We compared the effects of temperature stress and pathogen exposure on the immune response of a solitary bee, Megachile rotundata. Using an oligonucleotide microarray with 125 genes (375 probes), we determined that both high and low temperatures increased the expression of immune response genes in M. rotundata and reduced levels of a disease called chalkbrood. In the absence of the pathogen, trypsin-like serine and pathogen recognition proteases were most highly expressed at the lowest rearing temperature (20°C), while immune response signalling pathways and melanization were highly expressed at the warmest temperature tested (35°C). In pathogen-exposed bees, immune response genes tended to be most highly expressed at moderate temperatures, where we also saw the greatest infection levels. Temperature stress appears to have activated immunity before the pathogen elicited a response from the host, and this early activity prevented infection under stressful conditions. In this insect, the trade-off in energetic costs associated with stress and infection may be partially avoided by the use of conserved responses that reduce the effects of both.

  2. Natural genetic variation profoundly regulates gene expression in immune cells and dictates susceptibility to CNS autoimmunity

    PubMed Central

    Bearoff, Frank; del Rio, Roxana; Case, Laure K.; Dragon, Julie A.; Nguyen-Vu, Trang; Lin, Chin-Yo; Blankenhorn, Elizabeth P.; Teuscher, Cory; Krementsov, Dimitry N.


    Regulation of gene expression in immune cells is known to be under genetic control, and likely contributes to susceptibility to autoimmune diseases, such as multiple sclerosis (MS). How this occurs in concert across multiple immune cell types is poorly understood. Using a mouse model that harnesses the genetic diversity of wild-derived mice, more accurately reflecting genetically diverse human populations, we provide an extensive characterization of the genetic regulation of gene expression in five different naïve immune cell types relevant to MS. The immune cell transcriptome is shown to be under profound genetic control, exhibiting diverse patterns: global, cell-specific, and sex-specific. Bioinformatic analysis of the genetically-controlled transcript networks reveals reduced cell type-specificity and inflammatory activity in wild-derived PWD/PhJ mice, compared with the conventional laboratory strain C57BL/6J. Additionally, candidate MS-GWAS genes were significantly enriched among transcripts overrepresented in C57BL/6J cells compared to PWD. These expression level differences correlate with robust differences in susceptibility to experimental autoimmune encephalomyelitis, the principal model of MS, and skewing of the encephalitogenic T cell responses. Taken together, our results provide functional insights into the genetic regulation of the immune transcriptome, and shed light on how this in turn contributes to susceptibility to autoimmune disease. PMID:27653816

  3. Construction of an integrated gene regulatory network link to stress-related immune system in cattle.


    Behdani, Elham; Bakhtiarizadeh, Mohammad Reza


    The immune system is an important biological system that is negatively impacted by stress. This study constructed an integrated regulatory network to enhance our understanding of the regulatory gene network used in the stress-related immune system. Module inference was used to construct modules of co-expressed genes with bovine leukocyte RNA-Seq data. Transcription factors (TFs) were then assigned to these modules using Lemon-Tree algorithms. In addition, the TFs assigned to each module were confirmed using the promoter analysis and protein-protein interactions data. Therefore, our integrated method identified three TFs which include one TF that is previously known to be involved in immune response (MYBL2) and two TFs (E2F8 and FOXS1) that had not been recognized previously and were identified for the first time in this study as novel regulatory candidates in immune response. This study provides valuable insights on the regulatory programs of genes involved in the stress-related immune system.

  4. Dual Expression Profile of Type VI Secretion System Immunity Genes Protects Pandemic Vibrio cholerae

    PubMed Central

    Miyata, Sarah T.; Unterweger, Daniel; Rudko, Sydney P.; Pukatzki, Stefan


    The Vibrio cholerae type VI secretion system (T6SS) assembles as a molecular syringe that injects toxic protein effectors into both eukaryotic and prokaryotic cells. We previously reported that the V. cholerae O37 serogroup strain V52 maintains a constitutively active T6SS to kill other Gram-negative bacteria while being immune to attack by kin bacteria. The pandemic O1 El Tor V. cholerae strain C6706 is T6SS-silent under laboratory conditions as it does not produce T6SS structural components and effectors, and fails to kill Escherichia coli prey. Yet, C6706 exhibits full resistance when approached by T6SS-active V52. These findings suggested that an active T6SS is not required for immunity against T6SS-mediated virulence. Here, we describe a dual expression profile of the T6SS immunity protein-encoding genes tsiV1, tsiV2, and tsiV3 that provides pandemic V. cholerae strains with T6SS immunity and allows T6SS-silent strains to maintain immunity against attacks by T6SS-active bacterial neighbors. The dual expression profile allows transcription of the three genes encoding immunity proteins independently of other T6SS proteins encoded within the same operon. One of these immunity proteins, TsiV2, protects against the T6SS effector VasX which is encoded immediately upstream of tsiV2. VasX is a secreted, lipid-binding protein that we previously characterized with respect to T6SS-mediated virulence towards the social amoeba Dictyostelium discoideum. Our data suggest the presence of an internal promoter in the open reading frame of vasX that drives expression of the downstream gene tsiV2. Furthermore, VasX is shown to act in conjunction with VasW, an accessory protein to VasX, to compromise the inner membrane of prokaryotic target cells. The dual regulatory profile of the T6SS immunity protein-encoding genes tsiV1, tsiV2, and tsiV3 permits V. cholerae to tightly control T6SS gene expression while maintaining immunity to T6SS activity. PMID:24348240

  5. TGFβ receptor 1: an immune susceptibility gene in HPV-associated cancer.


    Levovitz, Chaya; Chen, Dan; Ivansson, Emma; Gyllensten, Ulf; Finnigan, John P; Alshawish, Sara; Zhang, Weijia; Schadt, Eric E; Posner, Marshal R; Genden, Eric M; Boffetta, Paolo; Sikora, Andrew G


    Only a minority of those exposed to human papillomavirus (HPV) develop HPV-related cervical and oropharyngeal cancer. Because host immunity affects infection and progression to cancer, we tested the hypothesis that genetic variation in immune-related genes is a determinant of susceptibility to oropharyngeal cancer and other HPV-associated cancers by performing a multitier integrative computational analysis with oropharyngeal cancer data from a head and neck cancer genome-wide association study (GWAS). Independent analyses, including single-gene, gene-interconnectivity, protein-protein interaction, gene expression, and pathway analysis, identified immune genes and pathways significantly associated with oropharyngeal cancer. TGFβR1, which intersected all tiers of analysis and thus selected for validation, replicated significantly in the head and neck cancer GWAS limited to HPV-seropositive cases and an independent cervical cancer GWAS. The TGFβR1 containing p38-MAPK pathway was significantly associated with oropharyngeal cancer and cervical cancer, and TGFβR1 was overexpressed in oropharyngeal cancer, cervical cancer, and HPV(+) head and neck cancer tumors. These concordant analyses implicate TGFβR1 signaling as a process dysregulated across HPV-related cancers. This study demonstrates that genetic variation in immune-related genes is associated with susceptibility to oropharyngeal cancer and implicates TGFβR1/TGFβ signaling in the development of both oropharyngeal cancer and cervical cancer. Better understanding of the immunogenetic basis of susceptibility to HPV-associated cancers may provide insight into host/virus interactions and immune processes dysregulated in the minority of HPV-exposed individuals who progress to cancer.

  6. TGFβ Receptor 1: An Immune Susceptibility Gene in HPV-Associated Cancer

    PubMed Central

    Levovitz, Chaya; Chen, Dan; Ivansson, Emma; Gyllensten, Ulf; Finnigan, John P.; Alshawish, Sara; Zhang, Weijia; Schadt, Eric E.; Posner, Marshal R.; Genden, Eric M.; Boffetta, Paolo; Sikora, Andrew G.


    Only a minority of those exposed to human papillomavirus (HPV) develop HPV-related cervical and oropharyngeal cancer. Because host immunity affects infection and progression to cancer, we tested the hypothesis that genetic variation in immune-related genes is a determinant of susceptibility to oropharyngeal cancer and other HPV-associated cancers by performing a multitier integrative computational analysis with oropharyngeal cancer data from a head and neck cancer genome-wide association study (GWAS). Independent analyses, including single-gene, gene-interconnectivity, protein–protein interaction, gene expression, and pathway analysis, identified immune genes and pathways significantly associated with oropharyngeal cancer. TGFβR1, which intersected all tiers of analysis and thus selected for validation, replicated significantly in the head and neck cancer GWAS limited to HPV-seropositive cases and an independent cervical cancer GWAS. The TGFβR1 containing p38–MAPK pathway was significantly associated with oropharyngeal cancer and cervical cancer, and TGFβR1 was overexpressed in oropharyngeal cancer, cervical cancer, and HPV+ head and neck cancer tumors. These concordant analyses implicate TGFβR1 signaling as a process dysregulated across HPV-related cancers. This study demonstrates that genetic variation in immune-related genes is associated with susceptibility to oropharyngeal cancer and implicates TGFβR1/TGFβ signaling in the development of both oropharyngeal cancer and cervical cancer. Better understanding of the immunogenetic basis of susceptibility to HPV-associated cancers may provide insight into host/virus interactions and immune processes dysregulated in the minority of HPV-exposed individuals who progress to cancer. PMID:25273091

  7. Autologous haematopoietic stem cell transplantation reduces abnormalities in the expression of immune genes in multiple sclerosis.


    de Paula A Sousa, Alessandra; Malmegrim, Kelen C R; Panepucci, Rodrigo A; Brum, Doralina S; Barreira, Amilton A; Carlos Dos Santos, Antonio; Araújo, Amélia G; Covas, Dimas Tadeu; Oliveira, Maria C; Moraes, Daniela A; Pieroni, Fabiano; Barros, George M; Simões, Belinda P; Nicholas, Richard; Burt, Richard K; Voltarelli, Júlio C; Muraro, Paolo A


    Autologous haematopoietic stem-cell transplantation (AHSCT) has been experimented as a treatment in patients affected by severe forms of multiple sclerosis (MS) who failed to respond to standard immunotherapy. The rationale of AHSCT is to 'reboot' the immune system and reconstitute a new adaptive immunity. The aim of our study was to identify, through a robust and unbiased transcriptomic analysis, any changes of gene expression in T-cells potentially underlying the treatment effect in patients who underwent non-myeloablative AHSCT for treatment of MS. We evaluated by microarray DNA-chip technology the gene expression of peripheral CD4+ and CD8+ T-cell subsets sorted from patients with MS patients before AHSCT, at 6 months, 1 year and 2 years after AHSCT and from healthy control subjects. Hierarchical clustering analysis revealed that reconstituted CD8+ T-cells of MS patients at 2 years post-transplantation, aggregated together with healthy controls, suggesting a normalization of gene expression in CD8+ cells post-therapy. When we compared the gene expression in MS patients before and after therapy, we detected a large number of differentially expressed genes (DEG) in both CD8+ and CD4+ T-cell subsets at all time points after transplantation. We catalogued the biological function of DEG and we selected 27 genes known to be involved in immune function for accurate quantification of gene expression by real-time PCR. The analysis confirmed and extended with quantitative data, a number of significant changes in both the CD4+ and CD8+ T-cells subsets from MS post-transplant. Notably, CD8+ T-cells revealed more extensive changes in the expression of genes involved in effector immune responses.

  8. Protein-poor diet reduces host-specific immune gene expression in Bombus terrestris

    PubMed Central

    Brunner, Franziska S.; Schmid-Hempel, Paul; Barribeau, Seth M.


    Parasites infect hosts non-randomly as genotypes of hosts vary in susceptibility to the same genotypes of parasites, but this specificity may be modulated by environmental factors such as nutrition. Nutrition plays an important role for any physiological investment. As immune responses are costly, resource limitation should negatively affect immunity through trade-offs with other physiological requirements. Consequently, nutritional limitation should diminish immune capacity in general, but does it also dampen differences among hosts? We investigated the effect of short-term pollen deprivation on the immune responses of our model host Bombus terrestris when infected with the highly prevalent natural parasite Crithidia bombi. Bumblebees deprived of pollen, their protein source, show reduced immune responses to infection. They failed to upregulate a number of genes, including antimicrobial peptides, in response to infection. In particular, they also showed less specific immune expression patterns across individuals and colonies. These findings provide evidence for how immune responses on the individual-level vary with important elements of the environment and illustrate how nutrition can functionally alter not only general resistance, but also alter the pattern of specific host–parasite interactions. PMID:24850921

  9. Candidate Gene Approach for Parasite Resistance in Sheep – Variation in Immune Pathway Genes and Association with Fecal Egg Count

    PubMed Central

    Periasamy, Kathiravan; Pichler, Rudolf; Poli, Mario; Cristel, Silvina; Cetrá, Bibiana; Medus, Daniel; Basar, Muladno; A. K., Thiruvenkadan; Ramasamy, Saravanan; Ellahi, Masroor Babbar; Mohammed, Faruque; Teneva, Atanaska; Shamsuddin, Mohammed; Podesta, Mario Garcia; Diallo, Adama


    Sheep chromosome 3 (Oar3) has the largest number of QTLs reported to be significantly associated with resistance to gastro-intestinal nematodes. This study aimed to identify single nucleotide polymorphisms (SNPs) within candidate genes located in sheep chromosome 3 as well as genes involved in major immune pathways. A total of 41 SNPs were identified across 38 candidate genes in a panel of unrelated sheep and genotyped in 713 animals belonging to 22 breeds across Asia, Europe and South America. The variations and evolution of immune pathway genes were assessed in sheep populations across these macro-environmental regions that significantly differ in the diversity and load of pathogens. The mean minor allele frequency (MAF) did not vary between Asian and European sheep reflecting the absence of ascertainment bias. Phylogenetic analysis revealed two major clusters with most of South Asian, South East Asian and South West Asian breeds clustering together while European and South American sheep breeds clustered together distinctly. Analysis of molecular variance revealed strong phylogeographic structure at loci located in immune pathway genes, unlike microsatellite and genome wide SNP markers. To understand the influence of natural selection processes, SNP loci located in chromosome 3 were utilized to reconstruct haplotypes, the diversity of which showed significant deviations from selective neutrality. Reduced Median network of reconstructed haplotypes showed balancing selection in force at these loci. Preliminary association of SNP genotypes with phenotypes recorded 42 days post challenge revealed significant differences (P<0.05) in fecal egg count, body weight change and packed cell volume at two, four and six SNP loci respectively. In conclusion, the present study reports strong phylogeographic structure and balancing selection operating at SNP loci located within immune pathway genes. Further, SNP loci identified in the study were found to have potential for

  10. Innate immune response gene expression profiles of N9 microglia are pathogen-type specific.


    McKimmie, Clive S; Roy, Douglas; Forster, Thorsten; Fazakerley, John K


    Glial cells, particularly microglia, are thought to play a pivotal role in initiating and guiding innate immune responses to CNS infections and in perpetuating inflammation and pathology in CNS diseases such as multiple sclerosis and Alzheimer's disease. We describe here the development and use of a new microarray designed to specifically profile transcript expression of innate immunity genes. Microarray analysis validated by quantitative PCR demonstrated an extensive range of pattern recognition receptor gene expression in resting N9 microglia, including Toll-like receptors, scavenger receptors and lectins. Stimulation with LPS or infection with virus modulated pattern recognition receptor, cytokine, chemokine and other innate immune transcripts in a distinct and stimulus-specific manner. This study demonstrates that a single glial cell phenotype has an innate capability to detect infection, determine its form and generate specific responses.

  11. Testosterone regulates thyroid cancer progression by modifying tumor suppressor genes and tumor immunity

    PubMed Central

    Zhang, Lisa J.; Xiong, Yin; Nilubol, Naris; He, Mei; Bommareddi, Swaroop; Zhu, Xuguang; Jia, Li; Xiao, Zhen; Park, Jeong-Won; Xu, Xia; Patel, Dhaval; Willingham, Mark C.; Cheng, Sheue-yann; Kebebew, Electron


    Cancer gender disparity has been observed for a variety of human malignancies. Thyroid cancer is one such cancer with a higher incidence in women, but more aggressive disease in men. There is scant evidence on the role of sex hormones on cancer initiation/progression. Using a transgenic mouse model of follicular thyroid cancer (FTC), we found castration led to lower rates of cancer in females and less advanced cancer in males. Mechanistically, less advanced cancer in castrated males was due to increased expression of tumor suppressor (Glipr1, Sfrp1) and immune-regulatory genes and higher tumor infiltration with M1 macrophages and CD8 cells. Functional study showed that GLIPR1 reduced cell growth and increased chemokine secretion (Ccl5) that activates immune cells. Our data demonstrate that testosterone regulates thyroid cancer progression by reducing tumor suppressor gene expression and tumor immunity. PMID:25576159

  12. Combining Cytotoxic and Immune-Mediated Gene Therapy to Treat Brain Tumors

    PubMed Central

    Curtin, James F.; King, Gwendalyn D.; Candolfi, Marianela; Greeno, Remy B.; Kroeger, Kurt M.; Lowenstein, Pedro R.; Castro, Maria G.


    Glioblastoma (GBM) is a type of intracranial brain tumor, for which there is no cure. In spite of advances in surgery, chemotherapy and radiotherapy, patients die within a year of diagnosis. Therefore, there is a critical need to develop novel therapeutic approaches for this disease. Gene therapy, which is the use of genes or other nucleic acids as drugs, is a powerful new treatment strategy which can be developed to treat GBM. Several treatment modalities are amenable for gene therapy implementation, e.g. conditional cytotoxic approaches, targeted delivery of toxins into the tumor mass, immune stimulatory strategies, and these will all be the focus of this review. Both conditional cytotoxicity and targeted toxin mediated tumor death, are aimed at eliminating an established tumor mass and preventing further growth. Tumors employ several defensive strategies that suppress and inhibit anti-tumor immune responses. A better understanding of the mechanisms involved in eliciting anti-tumor immune responses has identified promising targets for immunotherapy. Immunotherapy is designed to aid the immune system to recognize and destroy tumor cells in order to eliminate the tumor burden. Also, immune-therapeutic strategies have the added advantage that an activated immune system has the capability of recognizing tumor cells at distant sites from the primary tumor, therefore targeting metastasis distant from the primary tumor locale. Pre-clinical models and clinical trials have demonstrated that in spite of their location within the central nervous system (CNS), a tissue described as ‘immune privileged’, brain tumors can be effectively targeted by the activated immune system following various immunotherapeutic strategies. This review will highlight recent advances in brain tumor immunotherapy, with particular emphasis on advances made using gene therapy strategies, as well as reviewing other novel therapies that can be used in combination with immunotherapy. Another

  13. Combining cytotoxic and immune-mediated gene therapy to treat brain tumors.


    Curtin, James F; King, Gwendalyn D; Candolfi, Marianela; Greeno, Remy B; Kroeger, Kurt M; Lowenstein, Pedro R; Castro, Maria G


    Glioblastoma (GBM) is a type of intracranial brain tumor, for which there is no cure. In spite of advances in surgery, chemotherapy and radiotherapy, patients die within a year of diagnosis. Therefore, there is a critical need to develop novel therapeutic approaches for this disease. Gene therapy, which is the use of genes or other nucleic acids as drugs, is a powerful new treatment strategy which can be developed to treat GBM. Several treatment modalities are amenable for gene therapy implementation, e.g. conditional cytotoxic approaches, targeted delivery of toxins into the tumor mass, immune stimulatory strategies, and these will all be the focus of this review. Both conditional cytotoxicity and targeted toxin mediated tumor death, are aimed at eliminating an established tumor mass and preventing further growth. Tumors employ several defensive strategies that suppress and inhibit anti-tumor immune responses. A better understanding of the mechanisms involved in eliciting anti-tumor immune responses has identified promising targets for immunotherapy. Immunotherapy is designed to aid the immune system to recognize and destroy tumor cells in order to eliminate the tumor burden. Also, immune-therapeutic strategies have the added advantage that an activated immune system has the capability of recognizing tumor cells at distant sites from the primary tumor, therefore targeting metastasis distant from the primary tumor locale. Pre-clinical models and clinical trials have demonstrated that in spite of their location within the central nervous system (CNS), a tissue described as 'immune privileged', brain tumors can be effectively targeted by the activated immune system following various immunotherapeutic strategies. This review will highlight recent advances in brain tumor immunotherapy, with particular emphasis on advances made using gene therapy strategies, as well as reviewing other novel therapies that can be used in combination with immunotherapy. Another important

  14. Immune genes and divergent antimicrobial peptides in flies of the subgenus Drosophila.


    Hanson, Mark A; Hamilton, Phineas T; Perlman, Steve J


    Drosophila is an important model for studying the evolution of animal immunity, due to the powerful genetic tools developed for D. melanogaster. However, Drosophila is an incredibly speciose lineage with a wide range of ecologies, natural histories, and diverse natural enemies. Surprisingly little functional work has been done on immune systems of species other than D. melanogaster. In this study, we examine the evolution of immune genes in the speciose subgenus Drosophila, which diverged from the subgenus Sophophora (that includes D. melanogaster) approximately 25-40 Mya. We focus on D. neotestacea, a woodland species used to study interactions between insects and parasitic nematodes, and combine recent transcriptomic data with infection experiments to elucidate aspects of host immunity. We found that the vast majority of genes involved in the D. melanogaster immune response are conserved in D. neotestacea, with a few interesting exceptions, particularly in antimicrobial peptides (AMPs); until recently, AMPs were not thought to evolve rapidly in Drosophila. Unexpectedly, we found a distinct diptericin in subgenus Drosophila flies that appears to have evolved under diversifying (positive) selection. We also describe the presence of the AMP drosocin, which was previously thought to be restricted to the subgenus Sophophora, in the subgenus Drosophila. We challenged two subgenus Drosophila species, D. neotestacea and D. virilis with bacterial and fungal pathogens and quantified AMP expression. While diptericin in D. virilis was induced by exposure to gram-negative bacteria, it was not induced in D. neotestacea, showing that conservation of immune genes does not necessarily imply conservation of the realized immune response. Our study lends support to the idea that invertebrate AMPs evolve rapidly, and that Drosophila harbor a diverse repertoire of AMPs with potentially important functional consequences.

  15. SAFB1 Mediates Repression of Immune Regulators and Apoptotic Genes in Breast Cancer Cells*

    PubMed Central

    Hammerich-Hille, Stephanie; Kaipparettu, Benny A.; Tsimelzon, Anna; Creighton, Chad J.; Jiang, Shiming; Polo, Jose M.; Melnick, Ari; Meyer, Rene; Oesterreich, Steffi


    The scaffold attachment factors SAFB1 and SAFB2 are paralogs, which are involved in cell cycle regulation, apoptosis, differentiation, and stress response. They have been shown to function as estrogen receptor corepressors, and there is evidence for a role in breast tumorigenesis. To identify their endogenous target genes in MCF-7 breast cancer cells, we utilized a combined approach of chromatin immunoprecipitation (ChIP)-on-chip and gene expression array studies. By performing ChIP-on-chip on microarrays containing 24,000 promoters, we identified 541 SAFB1/SAFB2-binding sites in promoters of known genes, with significant enrichment on chromosomes 1 and 6. Gene expression analysis revealed that the majority of target genes were induced in the absence of SAFB1 or SAFB2 and less were repressed. Interestingly, there was no significant overlap between the genes identified by ChIP-on-chip and gene expression array analysis, suggesting regulation through regions outside the proximal promoters. In contrast to SAFB2, which shared most of its target genes with SAFB1, SAFB1 had many unique target genes, most of them involved in the regulation of the immune system. A subsequent analysis of the estrogen treatment group revealed that 12% of estrogen-regulated genes were dependent on SAFB1, with the majority being estrogen-repressed genes. These were primarily genes involved in apoptosis, such as BBC3, NEDD9, and OPG. Thus, this study confirms the primary role of SAFB1/SAFB2 as corepressors and also uncovers a previously unknown role for SAFB1 in the regulation of immune genes and in estrogen-mediated repression of genes. PMID:19901029

  16. Repurposed transcriptomic data facilitate discovery of innate immunity toll-like receptor (TLR) Genes across Lophotrochozoa.


    Halanych, Kenneth M; Kocot, Kevin M


    The growing volume of genomic data from across life represents opportunities for deriving valuable biological information from data that were initially collected for another purpose. Here, we use transcriptomes collected for phylogenomic studies to search for toll-like receptor (TLR) genes in poorly sampled lophotrochozoan clades (Annelida, Mollusca, Brachiopoda, Phoronida, and Entoprocta) and one ecdysozoan clade (Priapulida). TLR genes are involved in innate immunity across animals by recognizing potential microbial infection. They have an extracellular leucine-rich repeat (LRR) domain connected to a transmembrane domain and an intracellular toll/interleukin-1 receptor (TIR) domain. Consequently, these genes are important in initiating a signaling pathway to trigger defense. We found at least one TLR ortholog in all but two taxa examined, suggesting that a broad array of lophotrochozoans may have innate immune systems similar to those observed in vertebrates and arthropods. Comparison to the SMART database confirmed the presence of both the LRR and the TIR protein motifs characteristic of TLR genes. Because we looked at only one transcriptome per species, discovery of TLR genes was limited for most taxa. However, several TRL-like genes that vary in the number and placement of LRR domains were found in phoronids. Additionally, several contigs contained LRR domains but lacked TIR domains, suggesting they were not TLRs. Many of these LRR-containing contigs had other domains (e.g., immunoglobin) and are likely involved in innate immunity. © 2014 Marine Biological Laboratory.

  17. Disruption of Rpp1-mediated soybean rust immunity by virus-induced gene silencing.


    Cooper, Bret; Campbell, Kimberly B; McMahon, Michael B; Luster, Douglas G


    Phakopsora pachyrhizi, a fungus that causes rust disease on soybean, has potential to impart significant yield loss and disrupt food security and animal feed production. Rpp1 is a soybean gene that confers immunity to soybean rust, and it is important to understand how it regulates the soybean defense system and to use this knowledge to protect commercial crops. It was previously discovered that some soybean proteins resembling transcription factors accumulate in the nucleus of Rpp1 soybeans. To determine if they contribute to immunity, Bean pod mottle virus was used to attenuate or silence the expression of their genes. Rpp1 plants subjected to virus-induced gene silencing exhibited reduced amounts of RNA for 5 of the tested genes, and the plants developed rust-like symptoms after subsequent inoculation with fungal spores. Symptoms were associated with the accumulation of rust fungal RNA and protein. Silenced plants also had reduced amounts of RNA for the soybean Myb84 transcription factor and soybean isoflavone O-methyltransferase, both of which are important to phenylpropanoid biosynthesis and lignin formation, crucial components of rust resistance. These results help resolve some of the genes that contribute to Rpp1-mediated immunity and improve upon the knowledge of the soybean defense system. It is possible that these genes could be manipulated to enhance rust resistance in otherwise susceptible soybean cultivars.

  18. Disruption of Rpp1-mediated soybean rust immunity by virus-induced gene silencing

    PubMed Central

    Cooper, Bret; Campbell, Kimberly B; McMahon, Michael B; Luster, Douglas G


    Phakopsora pachyrhizi, a fungus that causes rust disease on soybean, has potential to impart significant yield loss and disrupt food security and animal feed production. Rpp1 is a soybean gene that confers immunity to soybean rust, and it is important to understand how it regulates the soybean defense system and to use this knowledge to protect commercial crops. It was previously discovered that some soybean proteins resembling transcription factors accumulate in the nucleus of Rpp1 soybeans. To determine if they contribute to immunity, Bean pod mottle virus was used to attenuate or silence the expression of their genes. Rpp1 plants subjected to virus-induced gene silencing exhibited reduced amounts of RNA for 5 of the tested genes, and the plants developed rust-like symptoms after subsequent inoculation with fungal spores. Symptoms were associated with the accumulation of rust fungal RNA and protein. Silenced plants also had reduced amounts of RNA for the soybean Myb84 transcription factor and soybean isoflavone O-methyltransferase, both of which are important to phenylpropanoid biosynthesis and lignin formation, crucial components of rust resistance. These results help resolve some of the genes that contribute to Rpp1-mediated immunity and improve upon the knowledge of the soybean defense system. It is possible that these genes could be manipulated to enhance rust resistance in otherwise susceptible soybean cultivars. PMID:24401541

  19. Analysis of dysregulation of immune system in pancreatic cancer based on gene expression profile.


    Wang, Baosheng; Sun, Shaolong; Liu, Zhen


    The aim of this study was to explore the dysregulated expression of the immune system in pancreatic cancer and clarify the pathogenesis of pancreatic cancer. The Dataset GSE15471 was downloaded from GEO database, Student's t test was used to screen differentially expressed genes (DEGs) between the pancreatic cancer group and the normal control group. Kyoto Encyclopedia of Genes and Genomes (KEGG) provides functional annotation was employed to explore the significant DEGs involved in biological functions. We got 988 significantly DEGs, including 832 up-regulated genes and 156 down-regulated genes. The ratio of up-regulated genes and down-regulated genes was 5.3. Total 13 biological pathways which were significant enriched with DEGs by KEGG pathway enrichment analysis. Finally, we constructed a overall network of the immune system in pancreatic cancer with these biological pathways information. Our study reveals that dysregulated pathways in pancreatic cancer associated with the immune system. Besides, we also identify some important molecular biomarkers of the pancreatic cancer, including CXCR4 and CD4. Dysfunctional pathways and important molecular biomarkers of pancreatic cancer will provide useful information for potential treatment of pancreatic cancer.

  20. Structural but not functional conservation of an immune molecule: a tachylectin-like gene in Hydractinia.


    Mali, Brahim; Soza-Ried, Jorge; Frohme, Marcus; Frank, Uri


    Tachylectin-related proteins are a recently characterized group of pattern recognition molecules, functioning in the innate immunity of various animals, from the ancient sponges to vertebrates. Tachylectins are characterized by six internal tandem repeats forming beta-propeller domains. We have identified and characterized a tachylectin-related gene in the colonial marine hydroid, Hydractinia echinata. The predicted gene product, termed CTRN, contained an N-terminal signal peptide and had a well-conserved tachylectin-like structure. RT-PCR analyses revealed only post-metamorphic expression while no mRNA was detected during embryonic development or in planula larvae. Exposure of colonies to LPS under conditions known to activate an immune response in Hydractinia did not result in upregulation of the gene. In situ hybridization analysis of metamorphosed animals detected CTRN transcripts only in a small subpopulation of neurons and their precursor cells, localized in a ring-like structure around the mouth of polyps. The same ring-like structure of CTRN expressing neurons was also observed in young polyp buds, predicting the position of the future mouth. This type of expression pattern can hardly be attributed to an immune-relevant gene. Thus, despite high structural similarity to tachylectins, this cnidarian member of this group seems to be an exception to all other tachylectins identified so far as it seems to have no function in cnidarian innate immunity.

  1. Differential expression of immune genes of adult honey bee (Apis mellifera) after inoculated by Nosema ceranae

    USDA-ARS?s Scientific Manuscript database

    Nosema ceranae is a microsporidium parasite infecting adult honey bees (Apis mellifera) and is known to have affects at both the individual and colony level. In this study, the expression levels were measured for four antimicrobial peptide encoding genes that are associated with bee humoral immunity...

  2. Evolution of the Schlafen genes, a gene family associated with embryonic lethality, meiotic drive, immune processes and orthopoxvirus virulence.


    Bustos, Olivia; Naik, Saijal; Ayers, Gayle; Casola, Claudio; Perez-Lamigueiro, Maria A; Chippindale, Paul T; Pritham, Ellen J; de la Casa-Esperón, Elena


    Genes of the Schlafen family, first discovered in mouse, are expressed in hematopoietic cells and are involved in immune processes. Previous results showed that they are candidate genes for two major phenomena: meiotic drive and embryonic lethality (DDK syndrome). However, these genes remain poorly understood, mostly due to the limitations imposed by their similarity, close location and the potential functional redundancy of the gene family members. Here we use genomic and phylogenetic studies to investigate the evolution and role of this family of genes. Our results show that the Schlafen family is widely distributed in mammals, where we recognize four major clades that experienced lineage-specific expansions or contractions in various orders, including primates and rodents. In addition, we identified members of the Schlafen family in Chondrichthyes and Amphibia, indicating an ancient origin of these genes. We find evidence that positive selection has acted on many Schlafen genes. Moreover, our analyses indicate that a member of the Schlafen family was horizontally transferred from murine rodents to orthopoxviruses, where it is hypothesized to play a role in allowing the virus to survive host immune defense mechanisms. The functional relevance of the viral Schlafen sequences is further underscored by our finding that they are evolving under purifying selection. This is of particular importance, since orthopoxviruses infect mammals and include variola, the causative agent of smallpox, and monkeypox, an emerging virus of great concern for human health.

  3. High amino acid diversity and positive selection at a putative coral immunity gene (tachylectin-2)

    PubMed Central


    Background Genes involved in immune functions, including pathogen recognition and the activation of innate defense pathways, are among the most genetically variable known, and the proteins that they encode are often characterized by high rates of amino acid substitutions, a hallmark of positive selection. The high levels of variation characteristic of immunity genes make them useful tools for conservation genetics. To date, highly variable immunity genes have yet to be found in corals, keystone organisms of the world's most diverse marine ecosystem, the coral reef. Here, we examine variation in and selection on a putative innate immunity gene from Oculina, a coral genus previously used as a model for studies of coral disease and bleaching. Results In a survey of 244 Oculina alleles, we find high nonsynonymous variation and a signature of positive selection, consistent with a putative role in immunity. Using computational protein structure prediction, we generate a structural model of the Oculina protein that closely matches the known structure of tachylectin-2 from the Japanese horseshoe crab (Tachypleus tridentatus), a protein with demonstrated function in microbial recognition and agglutination. We also demonstrate that at least three other genera of anthozoan cnidarians (Acropora, Montastrea and Nematostella) possess proteins structurally similar to tachylectin-2. Conclusions Taken together, the evidence of high amino acid diversity, positive selection and structural correspondence to the horseshoe crab tachylectin-2 suggests that this protein is 1) part of Oculina's innate immunity repertoire, and 2) evolving adaptively, possibly under selective pressure from coral-associated microorganisms. Tachylectin-2 may serve as a candidate locus to screen coral populations for their capacity to respond adaptively to future environmental change. PMID:20482872

  4. Diversity in the Toll-Like Receptor Genes of the African Penguin (Spheniscus demersus)

    PubMed Central

    Dalton, Desiré Lee; Vermaak, Elaine; Roelofse, Marli; Kotze, Antoinette


    The African penguin, Spheniscus demersus, is listed as Endangered by the IUCN Red List of Threatened Species due to the drastic reduction in population numbers over the last 20 years. To date, the only studies on immunogenetic variation in penguins have been conducted on the major histocompatibility complex (MHC) genes. It was shown in humans that up to half of the genetic variability in immune responses to pathogens are located in non-MHC genes. Toll-like receptors (TLRs) are now increasingly being studied in a variety of taxa as a broader approach to determine functional genetic diversity. In this study, we confirm low genetic diversity in the innate immune region of African penguins similar to that observed in New Zealand robin that has undergone several severe population bottlenecks. Single nucleotide polymorphism (SNP) diversity across TLRs varied between ex situ and in situ penguins with the number of non-synonymous alterations in ex situ populations (n = 14) being reduced in comparison to in situ populations (n = 16). Maintaining adaptive diversity is of vital importance in the assurance populations as these animals may potentially be used in the future for re-introductions. Therefore, this study provides essential data on immune gene diversity in penguins and will assist in providing an additional monitoring tool for African penguin in the wild, as well as to monitor diversity in ex situ populations and to ensure that diversity found in the in situ populations are captured in the assurance populations. PMID:27760133

  5. Diversity in the Toll-Like Receptor Genes of the African Penguin (Spheniscus demersus).


    Dalton, Desiré Lee; Vermaak, Elaine; Roelofse, Marli; Kotze, Antoinette


    The African penguin, Spheniscus demersus, is listed as Endangered by the IUCN Red List of Threatened Species due to the drastic reduction in population numbers over the last 20 years. To date, the only studies on immunogenetic variation in penguins have been conducted on the major histocompatibility complex (MHC) genes. It was shown in humans that up to half of the genetic variability in immune responses to pathogens are located in non-MHC genes. Toll-like receptors (TLRs) are now increasingly being studied in a variety of taxa as a broader approach to determine functional genetic diversity. In this study, we confirm low genetic diversity in the innate immune region of African penguins similar to that observed in New Zealand robin that has undergone several severe population bottlenecks. Single nucleotide polymorphism (SNP) diversity across TLRs varied between ex situ and in situ penguins with the number of non-synonymous alterations in ex situ populations (n = 14) being reduced in comparison to in situ populations (n = 16). Maintaining adaptive diversity is of vital importance in the assurance populations as these animals may potentially be used in the future for re-introductions. Therefore, this study provides essential data on immune gene diversity in penguins and will assist in providing an additional monitoring tool for African penguin in the wild, as well as to monitor diversity in ex situ populations and to ensure that diversity found in the in situ populations are captured in the assurance populations.

  6. Innate immune-stimulating and immune genes up-regulating activities of three types of alginate from Sargassum siliquosum in Pacific white shrimp, Litopenaeus vannamei.


    Yudiati, Ervia; Isnansetyo, Alim; Murwantoko; Ayuningtyas; Triyanto; Handayani, Christina Retna


    The Total Haemocyte Count (THC), phenoloxidase (PO), Superoxide Dismutase (SOD) activity, Phagocytic Activity/Index and Total Protein Plasma (TPP) were examined after feeding the white shrimp Litopenaeus vannamei with diets supplemented with three different types of alginates (acid, calcium and sodium alginates). Immune-related genes expression was evaluated by quantitative Real Time PCR (qRT-PCR). Results indicated that the immune parameters directly increased according to the doses of alginates and time. The 2.0 g kg(-1) of acid and sodium alginate treatments were gave better results. Four immune-related genes expression i.e. LGBP, Toll, Lectin, proPO were up regulated. It is therefore concluded that the supplementation of alginate of Sargassum siliquosum on the diet of L. vannamei enhanced the innate immunity as well as the expression of immune-related genes. It is the first report on the simultaneous evaluation of three alginate types to enhance innate immune parameters and immune-related genes expression in L. vannamei.

  7. Mycobacterium tuberculosis Requires Phosphate-Responsive Gene Regulation To Resist Host Immunity

    PubMed Central

    Leistikow, Rachel L.; Kirksey, Meghan A.; Voskuil, Martin I.; McKinney, John D.


    Mycobacterium tuberculosis persists in the tissues of mammalian hosts despite inducing a robust immune response dominated by the macrophage-activating cytokine gamma interferon (IFN-γ). We identified the M. tuberculosis phosphate-specific transport (Pst) system component PstA1 as a factor required to resist IFN-γ-dependent immunity. A ΔpstA1 mutant was fully virulent in IFN-γ−/− mice but attenuated in wild-type (WT) mice and mice lacking specific IFN-γ-inducible immune mechanisms: nitric oxide synthase (NOS2), phagosome-associated p47 GTPase (Irgm1), or phagocyte oxidase (phox). These phenotypes suggest that ΔpstA1 bacteria are sensitized to an IFN-γ-dependent immune mechanism(s) other than NOS2, Irgm1, or phox. In other species, the Pst system has a secondary role as a negative regulator of phosphate starvation-responsive gene expression through an interaction with a two-component signal transduction system. In M. tuberculosis, we found that ΔpstA1 bacteria exhibited dysregulated gene expression during growth in phosphate-rich medium that was mediated by the two-component sensor kinase/response regulator system SenX3-RegX3. Remarkably, deletion of the regX3 gene suppressed the replication and virulence defects of ΔpstA1 bacteria in NOS2−/− mice, suggesting that M. tuberculosis requires the Pst system to negatively regulate activity of RegX3 in response to available phosphate in vivo. We therefore speculate that inorganic phosphate is readily available during replication in the lung and is an important signal controlling M. tuberculosis gene expression via the Pst-SenX3-RegX3 signal transduction system. Inability to sense this environmental signal, due to Pst deficiency, results in dysregulation of gene expression and sensitization of the bacteria to the host immune response. PMID:23132496

  8. Pyrosequencing and characterization of immune response genes from the American dog tick, Dermacentor variabilis (L.).


    Jaworski, D C; Zou, Z; Bowen, C J; Wasala, N B; Madden, R; Wang, Y; Kocan, K M; Jiang, H; Dillwith, J W


    Ticks continue to be a threat to animal and human health, and new and novel control strategies are needed for ticks and tick-borne pathogens. The characterization of the tick-pathogen interface and the tick immune response to microbial infections is fundamental toward the formulation of new control strategies for ticks and the pathogens they transmit. Our overall hypothesis for this research is that the tick immune system manages the maintenance of pathogens. Therefore, discovery of tick immune response genes may provide targets for novel control strategies directed toward reducing vector competency and pathogen transmission. In these studies, 454 pyrosequencing, a high-throughput genomic sequencing method was used to discover tick genes expressed in response to bacterial and fungal infections. Expressed sequence tags (ESTs) were analysed from Dermacentor variabilis ticks that had been injected with bacteria (Escherichia coli, Bacillus subtilis, Micrococcus luteus) or fungi (Saccharomyces cerevisiae and Candida albicans) and ticks that were naturally infected with the intracellular bacterium, Anaplasma marginale. By this approach, ESTs were assembled into 5995 contigs. Contigs fell into the five main functional categories of metabolism, genetic information processing, environmental information processing, cellular processes and human diseases. We identified more than 30 genes that are likely to encode for proteins involved in tick immune function. We further analysed by reverse transcriptase PCR (RT-PCR) the expression of 22 of these genes in each of our bacterial or fungal treatment groups and found that seven were up-regulated. Up-regulation of these seven genes was confirmed for bacterial, but not fungal treatment by quantitative PCR (qPCR). One of these products was novel, encoding a new tick defensin. Our results clearly demonstrate the complexities of the tick immune system and mark new directions for further study and characterization of proteins that

  9. A comprehensive transcriptome and immune-gene repertoire of the lepidopteran model host Galleria mellonella

    PubMed Central


    Background The larvae of the greater wax moth Galleria mellonella are increasingly used (i) as mini-hosts to study pathogenesis and virulence factors of prominent bacterial and fungal human pathogens, (ii) as a whole-animal high throughput infection system for testing pathogen mutant libraries, and (iii) as a reliable host model to evaluate the efficacy of antibiotics against human pathogens. In order to compensate for the lack of genomic information in Galleria, we subjected the transcriptome of different developmental stages and immune-challenged larvae to next generation sequencing. Results We performed a Galleria transcriptome characterization on the Roche 454-FLX platform combined with traditional Sanger sequencing to obtain a comprehensive transcriptome. To maximize sequence diversity, we pooled RNA extracted from different developmental stages, larval tissues including hemocytes, and from immune-challenged larvae and normalized the cDNA pool. We generated a total of 789,105 pyrosequencing and 12,032 high-quality Sanger EST sequences which clustered into 18,690 contigs with an average length of 1,132 bases. Approximately 40% of the ESTs were significantly similar (E ≤ e-03) to proteins of other insects, of which 45% have a reported function. We identified a large number of genes encoding proteins with established functions in immunity related sensing of microbial signatures and signaling, as well as effector molecules such as antimicrobial peptides and inhibitors of microbial proteinases. In addition, we found genes known as mediators of melanization or contributing to stress responses. Using the transcriptomic data, we identified hemolymph peptides and proteins induced upon immune challenge by 2D-gelelectrophoresis combined with mass spectrometric analysis. Conclusion Here, we have developed extensive transcriptomic resources for Galleria. The data obtained is rich in gene transcripts related to immunity, expanding remarkably our knowledge about immune and

  10. Expression profile of human immune-responsive gene 1 and generation and characterization of polyclonal antiserum.


    Xiao, Wei; Wang, Lan; Xiao, Ruijing; Wu, Mengjun; Tan, Jinquan; He, Yuling


    Murine immune-responsive gene 1 (IRG1) plays significant roles in embryonic implantation and neurodegeneration. The expression pattern of the human IRG1 gene, however, has not yet been established, and the predicted gene sequence has been revised several times according to computed expressed sequence tags (ESTs). To determine the human IRG1 gene expression profile, human fetal tissue samples, peripheral blood mononuclear cells (PBMCs) from normal healthy subjects, and the human leukemia cell lines THP-1 and K-562 challenged with lipopolysaccharide (LPS) were subjected to RT-PCR using degenerate primers. The results indicated that the IRG1 gene is differentially expressed in human fetal PBMCs and LPS-stimulated adult PBMCs. The amplified gene fragment was cloned into the pET32a(+) vector and fusion-expressed with a His-tag in a prokaryotic system. After affinity chromatography, human IRG1h fusion proteins were isolated by SDS-PAGE and identified by mass spectrometric analysis for use as an immunogen to immunize rabbits. The titer and specificity of the purified rabbit antiserum were sufficient to measure human IRG1 gene expression in various tissues and cultures. This purified polyclonal antiserum will allow us to initiate studies to elucidate the biological roles of the human IRG1 gene.

  11. Effect of immune gene silencing in WSSV infected tiger shrimp Penaeus monodon.


    Shekhar, M S; Gomathi, A; Dubey, N K; Vinaya Kumar, K; Vijayan, K K


    White spot syndrome virus, continues to cause huge economic loss to aquaculture industry. In the absence of effective therapeutics to control WSSV, it is important to understand the host pathogen interaction at the molecular level. Suppression subtractive hybridization (SSH) cDNA library was constructed which led to identification of several differentially expressed genes in response to WSSV infection in Penaeus monodon. The genes expressed in SSH cDNA library of shrimp gill and gut tissues belonged to a wide range of biological functions. The three differentially expressed genes, Single von Willebrand factor type C domain protein (pmSVC), P53 protein gene (pmP53) and ADP ribosylation factor (pmArf) were up-regulated against WSSV infection and were further characterized by gene silencing to study the role of these shrimp immune genes on WSSV multiplication. The sequence-specific knock down of pmSVC, pmP53 and pmArf using the dsRNA revealed that in pmSVC-dsRNA inoculated shrimps WSSV replication was more with increased viral copy numbers when compared with pmP53-dsRNA and pmArf -dsRNA inoculated shrimps. The varied response of immune genes to WSSV infection, indicated that host genes may either inhibit virus replication to some extent or might act as a target to facilitate viral pathogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Molecular profiling of T-helper immune genes during dengue virus infection

    PubMed Central

    Chen, Jincheng; Ng, Mary Mah Lee; Chu, Justin Jang Hann


    In this study, we provide a comprehensive molecular profiling of the involvement of T- helper (Th) genes during dengue virus infection of different cell types. The Th gene profiles of three human cell types (monocytes, T-cells and hepatocytes) were analyzed simultaneously via array-based RT-PCR upon infection with dengue virus. Differential regulation of 41 Th genes was identified and of which 20 of those genes may contribute to immuno-pathogenesis of dengue virus infection by regulating inflammation, thrombocytopenia and vascular permeability. Among the strongly up-regulated genes were the RANTES, CC-CKR3, IRF4, CLEC2C, IL-6 and TLR6, which are potent inducer of inflammation and vascular permeability. Profiling genes obtained from this study may serve as potential biomarkers and the modulation of Th immune responses during dengue virus infection has important implications in disease outcome. PMID:19117515

  13. Genetic variations in interleukin-12 related genes in immune-mediated diseases.


    van Wanrooij, R L J; Zwiers, A; Kraal, G; Bouma, G


    The interleukin-12 (IL-12) family comprises a group of heterodimeric cytokines and their respective receptors that play key roles in immune responses. A growing number of autoimmune diseases has been found to be associated with genetic variation in these genes. Based on their respective associations with the IL-12 genes, autoimmune diseases appear to cluster in two groups that either show strong associations with the Th1/Th17 pathway (as indicated by genetic association with IL12B and IL23R) or the Th1/IL-35 pathway as the consequence of their association with polymorphisms in the IL12A gene region. The genetic associations are described in relation to what is known of the functionality of these genes in the various diseases. Comparing association data for gene families in different diseases may lead to better insight in the function of the genes in the onset and course of the disease. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Immune deficiency enhances expression of recombinant human antibody in mice after nonviral in vivo gene transfer.


    Kitaguchi, Kohji; Toda, Mikako; Takekoshi, Masataka; Maeda, Fumiko; Muramatsu, Tatsuo; Murai, Atsushi


    A cDNA encoding human antibody against hepatitis B virus was expressed in normal and severe combined immune deficiency (SCID) mice to clarify whether or not host immune status affects circulating levels of the recombinant human antibody (RhAb) after nonviral in vivo gene transfer. For transferring genes, either electroporation (EP) or hydrodynamics-based transfection (HD) was employed. The former was applied to the leg muscle to express the gene, while the latter primarily targeted foreign gene expression in the liver. The expressed RhAb was secreted into the blood circulation, and its existence was assayed by ELISA. Prior to the investigation of host immune status, suitable forms of plasmid expression vectors and types of electrodes were determined in normal mice. Results showed that the vector encoding both the light and heavy chains driven by the CMV promoter had the highest plasma RhAb concentrations, and a pair of pincette-type electrodes conferred the best performance. In both EP and HD, the SCID state showed an increased and prolonged RhAb production in the blood circulation due probably to suppressed recognition of RhAb as a foreign protein to the host animal. The difference in gene transfer methods demonstrated a characteristic pattern: an early and sharp rise followed by a relatively rapid decrease in HD, in contrast to a gradual rise followed by a plateau level maintained in EP. As a result, with the same amount of gene transferred, the plasma RhAb concentrations for the first 7 or 8 weeks were higher in HD than EP, while the reverse was true for the latter period. Multiple gene transfer contributed to maintaining and prolonging high RhAb concentrations in plasma by both methods with similar characteristic patterns accompanying the respective gene transfer method. These results suggest the importance of host immunological potency for maintaining plasma RhAb concentrations if these gene transfer technologies are used for clinical and therapeutic purposes.

  15. DNA Vaccines: Protective Immunizations by Parenteral, Mucosal, and Gene-Gun Inoculations

    NASA Astrophysics Data System (ADS)

    Fynan, Ellen F.; Webster, Robert G.; Fuller, Deborah H.; Haynes, Joel R.; Santoro, Joseph C.; Robinson, Harriet L.


    Plasmid DNAs expressing influenza virus hemagglutinin glycoproteins have been tested for their ability to raise protective immunity against lethal influenza challenges of the same subtype. In trials using two inoculations of from 50 to 300 μg of purified DNA in saline, 67-95% of test mice and 25-63% of test chickens have been protected against a lethal influenza challenge. Parenteral routes of inoculation that achieved good protection included intramuscular and intravenous injections. Successful mucosal routes of vaccination included DNA drops administered to the nares or trachea. By far the most efficient DNA immunizations were achieved by using a gene gun to deliver DNA-coated gold beads to the epidermis. In mice, 95% protection was achieved by two immunizations with beads loaded with as little as 0.4 μg of DNA. The breadth of routes supporting successful DNA immunizations, coupled with the very small amounts of DNA required for gene-gun immunizations, highlight the potential of this remarkably simple technique for the development of subunit vaccines.

  16. Gene, environment, microbiome and mucosal immune tolerance in rheumatoid arthritis

    PubMed Central

    Deane, Kevin D.; Scher, Jose U.


    RA is a complex multifactorial chronic disease that transitions through several stages. Multiple studies now support that there is a prolonged phase in early RA development during which there is serum elevation of RA-related autoantibodies including RF and ACPAs in the absence of clinically evident synovitis. This suggests that RA pathogenesis might originate in an extra-articular location, which we hypothesize is a mucosal site. In discussing this hypothesis, we will present herein the current understanding of mucosal immunology, including a discussion about the generation of autoimmune responses at these surfaces. We will also examine how other factors such as genes, microbes and other environmental toxins (including tobacco smoke) could influence the triggering of autoimmunity at mucosal sites and eventually systemic organ disease. We will also propose a research agenda to improve our understanding of the role of mucosal inflammation in the development of RA. PMID:25539828

  17. Zinc–gene interaction related to inflammatory/immune response in ageing

    PubMed Central

    Malavolta, Marco


    The pivotal role played by zinc–gene interaction in affecting some relevant cytokines (IL-6 and TNF-α) and heat shock proteins (HSP70-2) in ageing, successful ageing (nonagenarians) and the most common age-related diseases, such as atherosclerosis and infections, is now recognized. The polymorphisms of genes codifying proteins related to the inflammation are predictive on one hand in longevity, on the other hand they are associated with atherosclerosis or severe infections. Since the health life-span has a strong genetic component, which in turn also affected by nutritional factors like zinc, the association of these polymorphisms with innate immune response, zinc ion bioavailability and Metallothioneins (MT) homeostasis is an useful tool to unravel the role played by zinc–gene interactions in longevity, especially due to the inability of MT in zinc release in ageing and chronic inflammation. In ageing, this last fact leads to depressed innate immune response for host defence. In contrast, in very old age the inflammation is lower with subsequent more zinc ion bioavailability, less MT gene expression and satisfactory innate immunity. Therefore, the zinc–gene (IL-6, TNF-α, Hsp70-2) interactions, via MT homeostasis, are crucial to achieve successful ageing. PMID:18850188

  18. Widespread Decreased Expression of Immune Function Genes in Human Peripheral Blood Following Radiation Exposure

    PubMed Central

    Paul, Sunirmal; Smilenov, Lubomir B.; Amundson, Sally A.


    We report a large-scale reduced expression of genes in pathways related to cell-type specific immunity functions that emerges from microarray analysis 48 h after ex vivo γ-ray irradiation (0, 0.5, 2, 5, 8 Gy) of human peripheral blood from five donors. This response is similar to that seen in patients at 24 h after the start of total-body irradiation and strengthens the rationale for the ex vivo model as an adjunct to human in vivo studies. The most marked response was in genes associated with natural killer (NK) cell immune functions, reflecting a relative loss of NK cells from the population. T- and B-cell mediated immunity genes were also significantly represented in the radiation response. Combined with our previous studies, a single gene expression signature was able to predict radiation dose range with 97% accuracy at times from 6–48 h after exposure. Gene expression signatures that may report on the loss or functional deactivation of blood cell subpopulations after radiation exposure may be particularly useful both for triage biodosimetry and for monitoring the effect of radiation mitigating treatments. PMID:24168352

  19. Immune disease-associated variants in gene enhancers point to BET epigenetic mechanisms for therapeutic intervention.


    Tough, David F; Prinjha, Rab K


    Genome-wide association studies have identified thousands of single nucleotide polymorphisms in the human genome that are statistically associated with particular disease traits. In this Perspective, we review emerging data suggesting that most single nucleotide polymorphisms associated with immune-mediated diseases are found in regulatory regions of the DNA - parts of the genome that control expression of the protein encoding genes - rather than causing mutations in proteins. We discuss how the emerging understanding of particular gene regulatory regions, gene enhancers and the epigenetic mechanisms by which they are regulated is opening up new opportunities for the treatment of immune-mediated diseases, focusing particularly on the BET family of epigenetic reader proteins as potential therapeutic targets.

  20. Differentiating functional roles of gene expression from immune and non-immune cells in mouse colitis by bone marrow transplantation.


    Koon, Hon Wai; Ho, Samantha; Cheng, Michelle; Ichikawa, Ryan; Pothoulakis, Charalabos


    To understand the role of a gene in the development of colitis, we compared the responses of wild-type mice and gene-of-interest deficient knockout mice to colitis. If the gene-of-interest is expressed in both bone marrow derived cells and non-bone marrow derived cells of the host; however, it is possible to differentiate the role of a gene of interest in bone marrow derived cells and non- bone marrow derived cells by bone marrow transplantation technique. To change the bone marrow derived cell genotype of mice, the original bone marrow of recipient mice were destroyed by irradiation and then replaced by new donor bone marrow of different genotype. When wild-type mice donor bone marrow was transplanted to knockout mice, we could generate knockout mice with wild-type gene expression in bone marrow derived cells. Alternatively, when knockout mice donor bone marrow was transplanted to wild-type recipient mice, wild-type mice without gene-of-interest expressing from bone marrow derived cells were produced. However, bone marrow transplantation may not be 100% complete. Therefore, we utilized cluster of differentiation (CD) molecules (CD45.1 and CD45.2) as markers of donor and recipient cells to track the proportion of donor bone marrow derived cells in recipient mice and success of bone marrow transplantation. Wild-type mice with CD45.1 genotype and knockout mice with CD45.2 genotype were used. After irradiation of recipient mice, the donor bone marrow cells of different genotypes were infused into the recipient mice. When the new bone marrow regenerated to take over its immunity, the mice were challenged by chemical agent (dextran sodium sulfate, DSS 5%) to induce colitis. Here we also showed the method to induce colitis in mice and evaluate the role of the gene of interest expressed from bone-marrow derived cells. If the gene-of-interest from the bone derived cells plays an important role in the development of the disease (such as colitis), the phenotype of the

  1. Differentiating Functional Roles of Gene Expression from Immune and Non-immune Cells in Mouse Colitis by Bone Marrow Transplantation

    PubMed Central

    Koon, Hon Wai; Ho, Samantha; Cheng, Michelle; Ichikawa, Ryan; Pothoulakis, Charalabos


    To understand the role of a gene in the development of colitis, we compared the responses of wild-type mice and gene-of-interest deficient knockout mice to colitis. If the gene-of-interest is expressed in both bone marrow derived cells and non-bone marrow derived cells of the host; however, it is possible to differentiate the role of a gene of interest in bone marrow derived cells and non- bone marrow derived cells by bone marrow transplantation technique. To change the bone marrow derived cell genotype of mice, the original bone marrow of recipient mice were destroyed by irradiation and then replaced by new donor bone marrow of different genotype. When wild-type mice donor bone marrow was transplanted to knockout mice, we could generate knockout mice with wild-type gene expression in bone marrow derived cells. Alternatively, when knockout mice donor bone marrow was transplanted to wild-type recipient mice, wild-type mice without gene-of-interest expressing from bone marrow derived cells were produced. However, bone marrow transplantation may not be 100% complete. Therefore, we utilized cluster of differentiation (CD) molecules (CD45.1 and CD45.2) as markers of donor and recipient cells to track the proportion of donor bone marrow derived cells in recipient mice and success of bone marrow transplantation. Wild-type mice with CD45.1 genotype and knockout mice with CD45.2 genotype were used. After irradiation of recipient mice, the donor bone marrow cells of different genotypes were infused into the recipient mice. When the new bone marrow regenerated to take over its immunity, the mice were challenged by chemical agent (dextran sodium sulfate, DSS 5%) to induce colitis. Here we also showed the method to induce colitis in mice and evaluate the role of the gene of interest expressed from bone-marrow derived cells. If the gene-of-interest from the bone derived cells plays an important role in the development of the disease (such as colitis), the phenotype of the

  2. Immunogenic Subtypes of Breast Cancer Delineated by Gene Classifiers of Immune Responsiveness

    PubMed Central

    Miller, Lance D.; Chou, Jeff A.; Black, Michael A.; Print, Cristin; Chifman, Julia; Alistar, Angela; Putti, Thomas; Zhou, Xiaobo; Bedognetti, Davide; Hendrickx, Wouter; Pullikuth, Ashok; Rennhack, Jonathan; Andrechek, Eran R.; Demaria, Sandra; Wang, Ena; Marincola, Francesco M.


    The abundance and functional orientation of tumor-infiltrating lymphocytes in breast cancer is associated with distant metastasis-free survival, yet how this association is influenced by tumor phenotypic heterogeneity is poorly understood. Here, a bioinformatics approach defined tumor biological attributes that influence this association, and delineated tumor subtypes that may differ in their ability to sustain durable antitumor immune responses. A large database of breast tumor expression profiles and associated clinical data was compiled, from which the ability of phenotypic markers to significantly influence the prognostic performance of a classification model that incorporates immune cell-specific gene signatures was ascertained. Markers of cell proliferation and intrinsic molecular subtype reproducibly distinguished two breast cancer subtypes that we refer to as immune benefit-enabled (IBE) and immune benefit-disabled (IBD). The IBE tumors, comprised mostly of highly proliferative tumors of the basal-like, HER2-enriched, and luminal B subtypes, could be stratified by the immune classifier into significantly different prognostic groups, while IBD tumors could not, indicating the potential for productive engagement of metastasis-protective immunity in IBE tumors, but not IBD tumors. The prognostic stratification in IBE was independent of conventional variables. Gene network analysis predicted the activation of tumor necrosis factor–α/interferon-γ signaling pathways in IBE tumors and the activation of the transforming growth factor–β pathway in IBD tumors. This supports a model in which breast tumors can be distinguished on the basis of their potential for metastasis-protective immune responsiveness. Whether IBE and IBD represent clinically-relevant contexts for evaluating sensitivity to immunotherapeutic agents warrants further investigation. PMID:27197066

  3. Differential expression of Toll-like receptor pathway genes in chicken embryo fibroblasts from chickens resistant and susceptible to Marek’s disease

    USDA-ARS?s Scientific Manuscript database

    The Toll-like receptor (TLR) signaling pathway is one of the innate immune defense mechanisms against pathogens in vertebrates and invertebrates. However, the role of TLR in non-MHC genetic resistance or susceptibility to Marek’s disease (MD) in the chicken is yet to be elucidated. Chicken embryo fi...

  4. Immune-Related Gene Expression Patterns in GPV- or H9N2-Infected Goose Spleens

    PubMed Central

    Chen, Shun; Wang, Anqi; Sun, Lipei; Liu, Fei; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Yang, Qiao; Wu, Ying; Sun, Kunfeng; Chen, Xiaoyue; Cheng, Anchun


    Goose parvovirus (GPV) and avian influenza virus subtype H9N2 are single-stranded DNA (ssDNA) and single-stranded RNA (ssRNA) viruses, respectively, both of which can spread in goslings and cause a significant economic loss. To explore the comprehensive transcriptome of GPV- or H9N2-infected goose spleens and to understand the immune responses induced by a DNA virus (GPV) or a RNA virus (H9N2), RNA-seq was performed on the spleens of goslings at the fifth day post infection. In the present study, 2604 and 2409 differentially expressed unigenes were identified in the GPV- and H9N2-infected groups, respectively. Through KEGG pathway enrichment analyses, the up-regulated transcripts in the two virus-infected groups were mainly involved in immune-related pathways. In addition, the two virus-infected groups displayed similar expression patterns in the immune response pathways, including pattern-recognition receptor signaling pathways, the antigen processing and presentation pathway, the NF-κB signaling pathway and the JAK-STAT signaling pathway, as well as cytokines. Furthermore, most of the immune-related genes, particularly TLR7, TRAF3, Mx, TRIM25, CD4, and CD8α, increased in response to GPV and H9N2 infection. However, the depression of NF-κB signaling may be a mechanism by which the viruses evade the host immune system or a strategy to achieve immune homeostasis. PMID:27916934

  5. Molecular Evolution of Immune Genes in the Malaria Mosquito Anopheles gambiae

    PubMed Central

    Lehmann, Tovi; Hume, Jen C. C.; Licht, Monica; Burns, Christopher S.; Wollenberg, Kurt; Simard, Fred; Ribeiro, Jose' M. C.


    Background As pathogens that circumvent the host immune response are favoured by selection, so are host alleles that reduce parasite load. Such evolutionary processes leave their signature on the genes involved. Deciphering modes of selection operating on immune genes might reveal the nature of host-pathogen interactions and factors that govern susceptibility in host populations. Such understanding would have important public health implications. Methodology/Findings We analyzed polymorphisms in four mosquito immune genes (SP14D1, GNBP, defensin, and gambicin) to decipher selection effects, presumably mediated by pathogens. Using samples of Anopheles arabiensis, An. quadriannulatus and four An. gambiae populations, as well as published sequences from other Culicidae, we contrasted patterns of polymorphisms between different functional units of the same gene within and between populations. Our results revealed selection signatures operating on different time scales. At the most recent time scale, within-population diversity revealed purifying selection. Between populations and between species variation revealed reduced differentiation (GNBP and gambicin) at coding vs. noncoding- regions, consistent with balancing selection. McDonald-Kreitman tests between An. quadriannulatus and both sibling species revealed higher fixation rate of synonymous than nonsynonymous substitutions (GNBP) in accordance with frequency dependent balancing selection. At the longest time scale (>100 my), PAML analysis using distant Culicid taxa revealed positive selection at one codon in gambicin. Patterns of genetic variation were independent of exposure to human pathogens. Significance and Conclusions Purifying selection is the most common form of selection operating on immune genes as it was detected on a contemporary time scale on all genes. Selection for “hypervariability” was not detected, but negative balancing selection, detected at a recent evolutionary time scale between sibling

  6. Protein Poly(ADP-ribosyl)ation Regulates Arabidopsis Immune Gene Expression and Defense Responses

    PubMed Central

    Feng, Baomin; Liu, Chenglong; de Oliveira, Marcos V. V.; Intorne, Aline C.; Li, Bo; Babilonia, Kevin; de Souza Filho, Gonçalo A.; Shan, Libo; He, Ping


    Perception of microbe-associated molecular patterns (MAMPs) elicits transcriptional reprogramming in hosts and activates defense to pathogen attacks. The molecular mechanisms underlying plant pattern-triggered immunity remain elusive. A genetic screen identified Arabidopsis poly(ADP-ribose) glycohydrolase 1 (atparg1) mutant with elevated immune gene expression upon multiple MAMP and pathogen treatments. Poly(ADP-ribose) glycohydrolase (PARG) is predicted to remove poly(ADP-ribose) polymers on acceptor proteins modified by poly(ADP-ribose) polymerases (PARPs) with three PARPs and two PARGs in Arabidopsis genome. AtPARP1 and AtPARP2 possess poly(ADP-ribose) polymerase activity, and the activity of AtPARP2 was enhanced by MAMP treatment. AtPARG1, but not AtPARG2, carries glycohydrolase activity in vivo and in vitro. Importantly, mutation (G450R) in atparg1 blocks its activity and the corresponding residue is highly conserved and essential for human HsPARG activity. Consistently, mutant atparp1atparp2 plants exhibited compromised immune gene activation and enhanced susceptibility to pathogen infections. Our study indicates that protein poly(ADP-ribosyl)ation plays critical roles in plant immune gene expression and defense to pathogen attacks. PMID:25569773

  7. Protein poly(ADP-ribosyl)ation regulates arabidopsis immune gene expression and defense responses.


    Feng, Baomin; Liu, Chenglong; de Oliveira, Marcos V V; Intorne, Aline C; Li, Bo; Babilonia, Kevin; de Souza Filho, Gonçalo A; Shan, Libo; He, Ping


    Perception of microbe-associated molecular patterns (MAMPs) elicits transcriptional reprogramming in hosts and activates defense to pathogen attacks. The molecular mechanisms underlying plant pattern-triggered immunity remain elusive. A genetic screen identified Arabidopsis poly(ADP-ribose) glycohydrolase 1 (atparg1) mutant with elevated immune gene expression upon multiple MAMP and pathogen treatments. Poly(ADP-ribose) glycohydrolase (PARG) is predicted to remove poly(ADP-ribose) polymers on acceptor proteins modified by poly(ADP-ribose) polymerases (PARPs) with three PARPs and two PARGs in Arabidopsis genome. AtPARP1 and AtPARP2 possess poly(ADP-ribose) polymerase activity, and the activity of AtPARP2 was enhanced by MAMP treatment. AtPARG1, but not AtPARG2, carries glycohydrolase activity in vivo and in vitro. Importantly, mutation (G450R) in atparg1 blocks its activity and the corresponding residue is highly conserved and essential for human HsPARG activity. Consistently, mutant atparp1atparp2 plants exhibited compromised immune gene activation and enhanced susceptibility to pathogen infections. Our study indicates that protein poly(ADP-ribosyl)ation plays critical roles in plant immune gene expression and defense to pathogen attacks.

  8. Identification of a vir-orthologous immune evasion gene family from primate malaria parasites.


    Prajapati, Surendra Kumar; Singh, Om Prakash


    The immune evasion gene family of malaria parasites encodes variant surface proteins that are expressed at the surface of infected erythrocytes and help the parasite in evading the host immune response by means of antigenic variation. The identification of Plasmodium vivax vir orthologous immune evasion gene family from primate malaria parasites would provide new insight into the evolution of virulence and pathogenesis. Three vir subfamilies viz. vir-B, vir-D and vir-G were successfully PCR amplified from primate malaria parasites, cloned and sequenced. DNA sequence analysis confirmed orthologues of vir-D subfamily in Plasmodium cynomolgi, Plasmodium simium, Plasmodium simiovale and Plasmodium fieldi. The identified vir-D orthologues are 1-9 distinct members of the immune evasion gene family which have 68-83% sequence identity with vir-D and 71.2-98.5% sequence identity within the members identified from primate malaria parasites. The absence of other vir subfamilies among primate malaria parasites reflects the limitations in the experimental approach. This study clearly identified the presence of vir-D like sequences in four species of Plasmodium infecting primates that would be useful in understanding the evolution of virulence in malaria parasites.

  9. Major role of local immune responses in antibody formation to factor IX in AAV gene transfer.


    Wang, L; Cao, O; Swalm, B; Dobrzynski, E; Mingozzi, F; Herzog, R W


    The risk of an immune response to the coagulation factor IX (F.IX) transgene product is a concern in gene therapy for the X-linked bleeding disorder hemophilia B. In order to investigate the mechanism of F.IX-specific lymphocyte activation in the context of adeno-associated viral (AAV) gene transfer to skeletal muscle, we injected AAV-2 vector expressing human F.IX (hF.IX) into outbred immune-competent mice. Systemic hF.IX levels were transiently detected in the circulation, but diminished concomitant with activation of CD4+ T and B cells. ELISPOT assays documented robust responses to hF.IX in the draining lymph nodes of injected muscle by day 14. Formation of inhibitory antibodies to hF.IX was observed over a wide range of vector doses, with increased doses causing stronger immune responses. A prolonged inflammatory reaction in muscle started at 1.5-2 months, but ultimately failed to eliminate transgene expression. By 1.5 months, hF.IX antigen re-emerged in circulation in approximately 70% of animals injected with high vector dose. Hepatic gene transfer elicited only infrequent and weaker immune responses, with higher vector doses causing a reduction in T-cell responses to hF.IX. In summary, the data document substantial influence of target tissue, local antigen presentation, and antigen levels on lymphocyte responses to F.IX.

  10. Identification of host immune regulation candidate genes of Toxascaris leonina by expression sequenced tags (ESTs) analysis.


    Cho, Min Kyoung; Lee, Keun Hee; Lee, Sun Joo; Kang, Se Won; Ock, Mee Sun; Hong, Yeon Chul; Lee, Yong Seok; Yu, Hak Sun


    Toxascaris leonina adult worms live in the gastrointestinal tract of dog, cat, and fox, releasing eggs which enter the environment by the fecal route. Previously, we reported that T. leonina adult worm derived protein was able to inhibit OVA-specific Th2 responses, and in particular, immunization with parasite proteins exerts a more profound protective effect than allergen treatment. In order to gain greater insight into the relevant immune evasion mechanisms as well as basic scientific information, we have generated ESTs of T. leonina adult female worm and investigated their functions using euKaryotic Orthologous Groups (KOG) database analysis. From the randomly selected plasmids containing DNA inserts, a total of 487 reads were collected from the T. leonina adult worm cDNA library. The annotated ESTs were classified into 25 KOG categories; the most of ESTs (7.90%) were annotated with energy production and conversion, and the second highly annotated category is translation, ribosomal structure and biogenesis related ESTs (7.69%). We also identified many host-parasite immune related genes including C-type lectin, galectin, SXP, and cathepsin L-like cysteine protease coding genes. It is necessary to get more information regarding these genes for understanding about the mechanisms of immune evasion of Toxascaris.

  11. The surprisingly complex immune gene repertoire of a simple sponge, exemplified by the NLR genes: a capacity for specificity?


    Degnan, Sandie M


    Most bacteria are not pathogenic to animals, and may instead serve beneficial functions. The requisite need for animals to differentiate between microbial friend and foe is likely borne from a deep evolutionary imperative to recognise self from non-self, a service ably provided by the innate immune system. Recent findings from an ancient lineage of simple animals - marine sponges - have revealed an unexpectedly large and diverse suite of genes belonging to one family of pattern recognition receptors, namely the NLR genes. Because NLRs can recognise a broad spectrum of microbial ligands, they may play a critical role in mediating the animal-bacterial crosstalk needed for sophisticated discrimination between microbes of various relationships. The building blocks for an advanced NLR-based immune specificity encoded in the genome of the coral reef sponge Amphimedon queenslandica may provide a specialisation and diversity of responses that equals, or even exceeds, that of vertebrate NLRs.

  12. Altered endometrial immune gene expression in beef heifers with retarded embryos.


    Beltman, M E; Forde, N; Lonergan, P; Crowe, M A


    The aim of the present study was to compare endometrial gene expression profiles in a group of beef heifers yielding viable or retarded embryos on Day 7 after oestrus as a means of potentially explaining differences in embryo survival rates. Heifers were classified as either: (1) viable, when the embryo collected on Day 7 after oestrus was at the correct developmental stage (i.e. morula/early blastocyst); or (2) retarded, when the embryo was arrested at the 2-16-cell stage. The focus of the present study was on genes that were associated with either the pro- or anti-inflammatory immune response. Endometrial gene expression was determined using quantitative real-time polymerase chain reaction analysis. Expression of the β-defensin (DEFB1), interferon (IFN)-α (IFNA), IFN-γ (IFNG), interleukin (IL)-6 (IL6), IL-10 (IL10), forkhead box P3 (FOXP3) and natural cytotoxicity triggering receptor 1 (NCR1) genes was lower in endometria from viable than retarded heifers. Expression of the nuclear factor of kappa light polypeptide gene enhancer in B cells 1 (NKFB1), transforming growth factor (TGF)-β (TGFB), IFN-γ-inducible protein 16 (IFI16) and IL-21 (IL21) genes was higher in viable than retarded heifers. We propose that small disturbances in the expression of immune genes in the endometrium on Day 7 after oestrus can have detrimental effects on embryo survival.

  13. Blood gene expression profiles suggest altered immune function associated with symptoms of generalized anxiety disorder

    PubMed Central

    Wingo, Aliza P.; Gibson, Greg


    Prospective epidemiological studies found that generalized anxiety disorder (GAD) can impair immune function and increase risk for cardiovascular disease or events. Mechanisms underlying the physiological reverberations of anxiety, however, are still elusive. Hence, we aimed to investigate molecular processes mediating effects of anxiety on physical health using blood gene expression profiles of 336 community participants (157 anxious and 179 control). We examined genome-wide differential gene expression in anxiety, as well as associations between nine major modules of co-regulated transcripts in blood gene expression and anxiety. No significant differential expression was observed in women, but 631 genes were differentially expressed between anxious and control men at the false discovery rate of 0.1 after controlling for age, body mass index, race, and batch effect. Gene set enrichment analysis (GSEA) revealed that genes with altered expression levels in anxious men were involved in response of various immune cells to vaccination and to acute viral and bacterial infection, and in a metabolic network affecting traits of metabolic syndrome. Further, we found one set of 260 co-regulated genes to be significantly associated with anxiety in men after controlling for the relevant covariates, and demonstrate its equivalence to a component of the stress-related conserved transcriptional response to adversity profile. Taken together, our results suggest potential molecular pathways that can explain negative effects of GAD observed in epidemiological studies. Remarkably, even mild anxiety, which most of our participants had, was associated with observable changes in immune-related gene expression levels. Our findings generate hypotheses and provide incremental insights into molecular mechanisms mediating negative physiological effects of GAD. PMID:25300922

  14. Blood gene expression profiles suggest altered immune function associated with symptoms of generalized anxiety disorder.


    Wingo, Aliza P; Gibson, Greg


    Prospective epidemiological studies found that generalized anxiety disorder (GAD) can impair immune function and increase risk for cardiovascular disease or events. Mechanisms underlying the physiological reverberations of anxiety, however, are still elusive. Hence, we aimed to investigate molecular processes mediating effects of anxiety on physical health using blood gene expression profiles of 336 community participants (157 anxious and 179 control). We examined genome-wide differential gene expression in anxiety, as well as associations between nine major modules of co-regulated transcripts in blood gene expression and anxiety. No significant differential expression was observed in women, but 631 genes were differentially expressed between anxious and control men at the false discovery rate of 0.1 after controlling for age, body mass index, race, and batch effect. Gene set enrichment analysis (GSEA) revealed that genes with altered expression levels in anxious men were involved in response of various immune cells to vaccination and to acute viral and bacterial infection, and in a metabolic network affecting traits of metabolic syndrome. Further, we found one set of 260 co-regulated genes to be significantly associated with anxiety in men after controlling for the relevant covariates, and demonstrate its equivalence to a component of the stress-related conserved transcriptional response to adversity profile. Taken together, our results suggest potential molecular pathways that can explain negative effects of GAD observed in epidemiological studies. Remarkably, even mild anxiety, which most of our participants had, was associated with observable changes in immune-related gene expression levels. Our findings generate hypotheses and provide incremental insights into molecular mechanisms mediating negative physiological effects of GAD.

  15. Effector CD4+ T cell expression signatures and immune-mediated disease associated genes.


    Zhang, Wei; Ferguson, John; Ng, Sok Meng; Hui, Ken; Goh, Gerald; Lin, Aiping; Esplugues, Enric; Flavell, Richard A; Abraham, Clara; Zhao, Hongyu; Cho, Judy H


    Genome-wide association studies (GWAS) in immune-mediated diseases have identified over 150 associated genomic loci. Many of these loci play a role in T cell responses, and regulation of T cell differentiation plays a critical role in immune-mediated diseases; however, the relationship between implicated disease loci and T cell differentiation is incompletely understood. To further address this relationship, we examined differential gene expression in naïve human CD4+ T cells, as well as in in vitro differentiated Th1, memory Th17-negative and Th17-enriched CD4+ T cells subsets using microarray and RNASeq. We observed a marked enrichment for increased expression in memory CD4+ compared to naïve CD4+ T cells of genes contained among immune-mediated disease loci. Within memory T cells, expression of disease-associated genes was typically increased in Th17-enriched compared to Th17-negative cells. Utilizing RNASeq and promoter methylation studies, we identified a differential regulation pattern for genes solely expressed in Th17 cells (IL17A and CCL20) compared to genes expressed in both Th17 and Th1 cells (IL23R and IL12RB2), where high levels of promoter methylation are correlated to near zero RNASeq levels for IL17A and CCL20. These findings have implications for human Th17 celI plasticity and for the regulation of Th17-Th1 expression signatures. Importantly, utilizing RNASeq we found an abundant isoform of IL23R terminating before the transmembrane domain that was enriched in Th17 cells. In addition to molecular resolution, we find that RNASeq provides significantly improved power to define differential gene expression and identify alternative gene variants relative to microarray analysis. The comprehensive integration of differential gene expression between cell subsets with disease-association signals, and functional pathways provides insight into disease pathogenesis.

  16. Immune gene discovery by expressed sequence tag (EST) analysis of hemocytes in the ridgetail white prawn Exopalaemon carinicauda

    PubMed Central

    Duan, Yafei; Liu, Ping; Li, Jitao; Li, Jian; Chen, Ping


    The ridgetail white prawn Exopalaemon carinicauda is one of the most important commercial species in eastern China. However, little information of immune genes in E. carinicauda has been reported. To identify distinctive genes associated with immunity, an expressed sequence tag (EST) library was constructed from hemocytes of E. carinicauda. A total of 3411 clones were sequenced, yielding 2853 ESTs and the average sequence length is 436 bp. The cluster and assembly analysis yielded 1053 unique sequences including 329 contigs and 724 singletons. Blast analysis identified 593 (56.3%) of the unique sequences as orthologs of genes from other organisms (E-value < 1e-5). Based on the COG and Gene Ontology (GO), 593 unique sequences were classified. Through comparison with previous studies, 153 genes assembled from 367 ESTs have been identified as possibly involved in defense or immune functions. These genes are categorized into seven categories according to their putative functions in shrimp immune system: antimicrobial peptides, prophenoloxidase activating system, antioxidant defense systems, chaperone proteins, clottable proteins, pattern recognition receptors and other immune-related genes. According to EST abundance, the major immune-related genes were thioredoxin (141, 4.94% of all ESTs) and calmodulin (14, 0.49% of all ESTs). The EST sequences of E. carinicauda hemocytes provide important information of the immune system and lay the groundwork for development of molecular markers related to disease resistance in prawn species. PMID:23092732

  17. Control of separate pathogenic autoantibody responses marks MHC gene contributions to murine lupus.


    Vyse, T J; Halterman, R K; Rozzo, S J; Izui, S; Kotzin, B L


    Previous studies have suggested that MHC and non-MHC genes contribute to the development of autoimmune disease in F1 hybrids of New Zealand black (NZB) and white (NZW) mice. We conducted a genome-wide screen of 148 female (NZB x NZW)F1 x NZB backcross mice to map dominant NZW genetic loci linked with lupus disease traits. In this backcross analysis, inheritance of the NZW MHC (H2(d/z) vs. H2(d/d)) was strongly linked with the development of lupus nephritis (P approximately 1 x 10(-16)), increasing the risk of disease by over 30-fold. H2(d/z) was also linked with elevated serum levels of IgG autoantibodies to single-stranded DNA, double-stranded DNA, histones, and chromatin but not with anti-gp70 autoantibodies, measured as circulating gp70-anti-gp70 immune complexes. Non-MHC contributions from NZW seemed weak in comparison to MHC, although NZW loci on chromosomes 7 and 16 were noted to be suggestively linked with autoantibody production. Strikingly, H2(d/z) (compared with H2(d/d)) enhanced antinuclear antibodies in a coordinate fashion but did not affect anti-gp70 production in the current backcross. However, the opposite influence was noted for H2(d/z) (compared with H2(z/z)) when (NZB x NZW)F1 x NZW backcross mice were analyzed. These results suggest that H2(z) and H2(d) haplotypes differentially regulate two different sets of nephritogenic autoantibody responses. This study confirms a critical role for H2(z) compared with other dominant NZW loci in (NZB x NZW)F1 mice and provides an explanation as to why H2(d/z) heterozygosity is required for full expression of disease in this model.

  18. In ovo vaccination with the Eimeria tenella EtMIC2 gene induces protective immunity against coccidiosis.


    Ding, Xicheng; Lillehoj, Hyun S; Dalloul, Rami A; Min, Wongi; Sato, Takanori; Yasuda, Atsushi; Lillehoj, Erik P


    An Eimeria tenella microneme recombinant gene (EtMIC2) and encoded protein were evaluated as potential vaccines against avian coccidiosis. In ovo inoculation with the EtMIC2 gene increased anti-EtMIC2 antibody titers at days 10 and 17 following E. tenella infection. In addition, vaccinated birds developed protective immunity against infection by E. tenella as assessed by significantly increased body weight gain and decreased fecal oocyst shedding compared with non-vaccinated controls. Vaccination with the EtMIC2 gene also led to protective immunity against infection by E. acervulina, but not E. maxima. Combined in ovo DNA vaccination plus post-hatch boosting with EtMIC2 DNA or protein did not improve antibody titers or protective immunity beyond that achieved with in ovo vaccination alone. These results provide evidence that in ovo immunization with a recombinant Eimeria microneme gene stimulates protective intestinal immunity against coccidiosis.

  19. Gene therapy for immune disorders: good news tempered by bad news.


    Puck, Jennifer M; Malech, Harry L


    After a dozen years of human gene therapy trials characterized by minimal gene correction and disappointing clinical impact, the field of gene therapy received some good news in 2000. Infants with X-linked severe combined immunodeficiency who received retroviral gene addition to cells from their bone marrow developed impressive immune reconstitution. During the following 2 years, additional patients were treated and the news was even better-babies receiving gene therapy had sustained T-cell production and in several cases developed better cell function than most patients treated with standard bone marrow transplants. Unfortunately, bad news followed. Three of the patients experienced leukemic T-cell expansions, found to be associated with retroviral insertions into genomic DNA. Where does the field stand today?

  20. Adaptive evolution at immune system genes and deep pregnancy implantation in primates.


    Civetta, Alberto


    A major evolutionary change in the lineage ancestral to humans, chimpanzee and gorilla (HCG) has been the embedding of the embryo into maternal tissue. Thus, the first layer of cells (trophoblast) to differentiate after fertilization must adapt to invade the uterus. Such event would likely leave signatures of positive selection at genes with roles in embryo implantation. Here, 163 pregnancy implantation genes are tested for evidence of adaptive diversification in the ancestral lineage to HCG. Two immune system genes, HLA-E and KIR2DL4 showed evidence of positive selection. Some of the positive selected sites involve amino acid substitution with predicted damaging effects on protein function, thus highlighting the possibility of antagonistic pleiotropic effects. Selection at a gene coding for a receptor expressed in uterine cells (KIR) that interacts with trophoblast human leukocyte antigen (HLA) genes suggests a main role for immunological adaptations in embryo deep invasion of the maternal endometrium. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. The innate immune repertoire in cnidaria--ancestral complexity and stochastic gene loss.


    Miller, David J; Hemmrich, Georg; Ball, Eldon E; Hayward, David C; Khalturin, Konstantin; Funayama, Noriko; Agata, Kiyokazu; Bosch, Thomas C G


    Characterization of the innate immune repertoire of extant cnidarians is of both fundamental and applied interest--it not only provides insights into the basic immunological 'tool kit' of the common ancestor of all animals, but is also likely to be important in understanding the global decline of coral reefs that is presently occurring. Recently, whole genome sequences became available for two cnidarians, Hydra magnipapillata and Nematostella vectensis, and large expressed sequence tag (EST) datasets are available for these and for the coral Acropora millepora. To better understand the basis of innate immunity in cnidarians, we scanned the available EST and genomic resources for some of the key components of the vertebrate innate immune repertoire, focusing on the Toll/Toll-like receptor (TLR) and complement pathways. A canonical Toll/TLR pathway is present in representatives of the basal cnidarian class Anthozoa, but neither a classic Toll/TLR receptor nor a conventional nuclear factor (NF)-kappaB could be identified in the anthozoan Hydra. Moreover, the detection of complement C3 and several membrane attack complex/perforin domain (MAC/PF) proteins suggests that a prototypic complement effector pathway may exist in anthozoans, but not in hydrozoans. Together with data for several other gene families, this implies that Hydra may have undergone substantial secondary gene loss during evolution. Such losses are not confined to Hydra, however, and at least one MAC/PF gene appears to have been lost from Nematostella. Consideration of these patterns of gene distribution underscores the likely significance of gene loss during animal evolution whilst indicating ancient origins for many components of the vertebrate innate immune system.

  2. The innate immune repertoire in Cnidaria - ancestral complexity and stochastic gene loss

    PubMed Central

    Miller, David J; Hemmrich, Georg; Ball, Eldon E; Hayward, David C; Khalturin, Konstantin; Funayama, Noriko; Agata, Kiyokazu; Bosch, Thomas CG


    Background Characterization of the innate immune repertoire of extant cnidarians is of both fundamental and applied interest - it not only provides insights into the basic immunological 'tool kit' of the common ancestor of all animals, but is also likely to be important in understanding the global decline of coral reefs that is presently occurring. Recently, whole genome sequences became available for two cnidarians, Hydra magnipapillata and Nematostella vectensis, and large expressed sequence tag (EST) datasets are available for these and for the coral Acropora millepora. Results To better understand the basis of innate immunity in cnidarians, we scanned the available EST and genomic resources for some of the key components of the vertebrate innate immune repertoire, focusing on the Toll/Toll-like receptor (TLR) and complement pathways. A canonical Toll/TLR pathway is present in representatives of the basal cnidarian class Anthozoa, but neither a classic Toll/TLR receptor nor a conventional nuclear factor (NF)-κB could be identified in the anthozoan Hydra. Moreover, the detection of complement C3 and several membrane attack complex/perforin domain (MAC/PF) proteins suggests that a prototypic complement effector pathway may exist in anthozoans, but not in hydrozoans. Together with data for several other gene families, this implies that Hydra may have undergone substantial secondary gene loss during evolution. Such losses are not confined to Hydra, however, and at least one MAC/PF gene appears to have been lost from Nematostella. Conclusion Consideration of these patterns of gene distribution underscores the likely significance of gene loss during animal evolution whilst indicating ancient origins for many components of the vertebrate innate immune system. PMID:17437634

  3. SNP/haplotype associations in cytokine and cytokine receptor genes and immunity to rubella vaccine.


    Dhiman, Neelam; Haralambieva, Iana H; Kennedy, Richard B; Vierkant, Robert A; O'Byrne, Megan M; Ovsyannikova, Inna G; Jacobson, Robert M; Poland, Gregory A


    An effective immune response to vaccination is, in part, a complex interaction of alleles of multiple genes regulating cytokine networks. We conducted a genotyping study of Th1/Th2/inflammatory cytokines/cytokine receptors in healthy children (n = 738, 11-19 years) to determine associations between individual single-nucleotide polymorphisms (SNPs)/haplotypes and immune outcomes after two doses of rubella vaccine. SNPs (n = 501) were selected using the ldSelect-approach and genotyped using Illumina GoldenGate and TaqMan assays. Rubella-IgG levels were measured by immunoassay and secreted cytokines by ELISA. Linear regression and post hoc haplotype analyses were used to determine associations between single SNPs/haplotypes and immune outcomes. Increased carriage of minor alleles for the promoter SNPs (rs2844482 and rs2857708) of the TNFA gene were associated with dose-related increases in rubella antibodies. IL-6 secretion was co-directionally associated (p < or = 0.01) with five intronic SNPs in the TNFRSF1B gene in an allele dose-related manner, while five promoter/intronic SNPs in the IL12B gene were associated with variations in IL-6 secretion. TNFA haplotype AAACGGGGC (t-statistic = 3.32) and IL12B promoter haplotype TAG (t-statistic = 2.66) were associated with higher levels of (p < or = 0.01) rubella-IgG and IL-6 secretion, respectively. We identified individual SNPs/haplotypes in TNFA/TNFRSF1B and IL12B genes that appear to modulate immunity to rubella vaccination. Identification of such "genetic fingerprints" may predict the outcome of vaccine response and inform new vaccine strategies.

  4. ImmuCo: a database of gene co-expression in immune cells

    PubMed Central

    Wang, Pingzhang; Qi, Huiying; Song, Shibin; Li, Shuang; Huang, Ningyu; Han, Wenling; Ma, Dalong


    Current gene co-expression databases and correlation networks do not support cell-specific analysis. Gene co-expression and expression correlation are subtly different phenomena, although both are likely to be functionally significant. Here, we report a new database, ImmuCo (, which is a cell-specific database that contains information about gene co-expression in immune cells, identifying co-expression and correlation between any two genes. The strength of co-expression of queried genes is indicated by signal values and detection calls, whereas expression correlation and strength are reflected by Pearson correlation coefficients. A scatter plot of the signal values is provided to directly illustrate the extent of co-expression and correlation. In addition, the database allows the analysis of cell-specific gene expression profile across multiple experimental conditions and can generate a list of genes that are highly correlated with the queried genes. Currently, the database covers 18 human cell groups and 10 mouse cell groups, including 20 283 human genes and 20 963 mouse genes. More than 8.6 × 108 and 7.4 × 108 probe set combinations are provided for querying each human and mouse cell group, respectively. Sample applications support the distinctive advantages of the database. PMID:25326331

  5. Polymorphisms in Anopheles gambiae Immune Genes Associated with Natural Resistance to Plasmodium falciparum

    PubMed Central

    Harris, Caroline; Lambrechts, Louis; Rousset, François; Abate, Luc; Nsango, Sandrine E.; Fontenille, Didier; Morlais, Isabelle; Cohuet, Anna


    Many genes involved in the immune response of Anopheles gambiae, the main malaria vector in Africa, have been identified, but whether naturally occurring polymorphisms in these genes underlie variation in resistance to the human malaria parasite, Plasmodium falciparum, is currently unknown. Here we carried out a candidate gene association study to identify single nucleotide polymorphisms (SNPs) associated with natural resistance to P. falciparum. A. gambiae M form mosquitoes from Cameroon were experimentally challenged with three local wild P. falciparum isolates. Statistical associations were assessed between 157 SNPs selected from a set of 67 A. gambiae immune-related genes and the level of infection. Isolate-specific associations were accounted for by including the effect of the isolate in the analysis. Five SNPs were significantly associated to the infection phenotype, located within or upstream of AgMDL1, CEC1, Sp PPO activate, Sp SNAKElike, and TOLL6. Low overall and local linkage disequilibrium indicated high specificity in the loci found. Association between infection phenotype and two SNPs was isolate-specific, providing the first evidence of vector genotype by parasite isolate interactions at the molecular level. Four SNPs were associated to either oocyst presence or load, indicating that the genetic basis of infection prevalence and intensity may differ. The validity of the approach was verified by confirming the functional role of Sp SNAKElike in gene silencing assays. These results strongly support the role of genetic variation within or near these five A. gambiae immune genes, in concert with other genes, in natural resistance to P. falciparum. They emphasize the need to distinguish between infection prevalence and intensity and to account for the genetic specificity of vector-parasite interactions in dissecting the genetic basis of Anopheles resistance to human malaria. PMID:20862317

  6. Caste-, sex-, and age-dependent expression of immune-related genes in a Japanese subterranean termite, Reticulitermes speratus

    PubMed Central

    Kobayashi, Kazuya; Matsuura, Kenji


    Insects protect themselves from microbial infections through innate immune responses, including pathogen recognition, phagocytosis, the activation of proteolytic cascades, and the synthesis of antimicrobial peptides. Termites, eusocial insects inhabiting microbe-rich wood, live in closely-related family groups that are susceptible to shared pathogen infections. To resist pathogenic infection, termite families have evolved diverse immune adaptations at both individual and societal levels, and a strategy of trade-offs between reproduction and immunity has been suggested. Although termite immune-inducible genes have been identified, few studies have investigated the differential expression of these genes between reproductive and neuter castes, and between sexes in each caste. In this study, we compared the expression levels of immune-related genes among castes, sexes, and ages in a Japanese subterranean termite, Reticulitermes speratus. Using RNA-seq, we found 197 immune-related genes, including 40 pattern recognition proteins, 97 signalling proteins, 60 effectors. Among these genes, 174 showed differential expression among castes. Comparing expression levels between males and females in each caste, we found sexually dimorphic expression of immune-related genes not only in reproductive castes, but also in neuter castes. Moreover, we identified age-related differential expression of 162 genes in male and/or female reproductives. In addition, although R. speratus is known to use the antibacterial peptide C-type lysozyme as an egg recognition pheromone, we determined that R. speratus has not only C-type, but also P-type and I-type lysozymes, as well as other termite species. Our transcriptomic analyses revealed immune response plasticity among all castes, and sex-biased expression of immune genes even in neuter castes, suggesting a sexual division of labor in the immune system of R. speratus. This study heightens the understanding of the evolution of antimicrobial

  7. Transcriptome sequencing of black grouse (Tetrao tetrix) for immune gene discovery and microsatellite development.


    Wang, Biao; Ekblom, Robert; Castoe, Todd A; Jones, Eleanor P; Kozma, Radoslav; Bongcam-Rudloff, Erik; Pollock, David D; Höglund, Jacob


    The black grouse (Tetrao tetrix) is a galliform bird species that is important for both ecological studies and conservation genetics. Here, we report the sequencing of the spleen transcriptome of black grouse using 454 GS FLX Titanium sequencing. We performed a large-scale gene discovery analysis with a focus on genes that might be related to fitness in this species and also identified a large set of microsatellites. In total, we obtained 182 179 quality-filtered sequencing reads that we assembled into 9035 contigs. Using these contigs and 15 794 length-filtered (greater than 200 bp) singletons, we identified 7762 transcripts that appear to be homologues of chicken genes. A specific BLAST search with an emphasis on immune genes found 308 homologous chicken genes that have immune function, including ten major histocompatibility complex-related genes located on chicken chromosome 16. We also identified 1300 expressed sequence tag microsatellites and were able to design suitable flanking primers for 526 of these. A preliminary test of the polymorphism of the microsatellites found 10 polymorphic microsatellites of the 102 tested. Genomic resources generated in this study should greatly benefit future ecological, evolutionary and conservation genetic studies on this species.

  8. SARS-CoV regulates immune function-related gene expression in human monocytic cells.


    Hu, Wanchung; Yen, Yu-Ting; Singh, Sher; Kao, Chuan-Liang; Wu-Hsieh, Betty A


    Severe acute respiratory syndrome (SARS) is characterized by acute respiratory distress syndrome (ARDS) and pulmonary fibrosis, and monocytes/macrophages are the key players in the pathogenesis of SARS. In this study, we compared the transcriptional profiles of SARS coronavirus (SARS-CoV)-infected monocytic cells against that infected by coronavirus 229E (CoV-229E). Total RNA was extracted from infected DC-SIGN-transfected monocytes (THP-1-DC-SIGN) at 6 and 24 h after infection, and the gene expression was profiled in oligonucleotide-based microarrays. Analysis of immune-related gene expression profiles showed that at 24 h after SARS-CoV infection: (1) IFN-α/β-inducible and cathepsin/proteasome genes were downregulated; (2) hypoxia/hyperoxia-related genes were upregulated; and (3) TLR/TLR-signaling, cytokine/cytokine receptor-related, chemokine/chemokine receptor-related, lysosome-related, MHC/chaperon-related, and fibrosis-related genes were differentially regulated. These results elucidate that SARS-CoV infection regulates immune-related genes in monocytes/macrophages, which may be important to the pathogenesis of SARS.

  9. Transcriptome sequencing of black grouse (Tetrao tetrix) for immune gene discovery and microsatellite development

    PubMed Central

    Wang, Biao; Ekblom, Robert; Castoe, Todd A.; Jones, Eleanor P.; Kozma, Radoslav; Bongcam-Rudloff, Erik; Pollock, David D.; Höglund, Jacob


    The black grouse (Tetrao tetrix) is a galliform bird species that is important for both ecological studies and conservation genetics. Here, we report the sequencing of the spleen transcriptome of black grouse using 454 GS FLX Titanium sequencing. We performed a large-scale gene discovery analysis with a focus on genes that might be related to fitness in this species and also identified a large set of microsatellites. In total, we obtained 182 179 quality-filtered sequencing reads that we assembled into 9035 contigs. Using these contigs and 15 794 length-filtered (greater than 200 bp) singletons, we identified 7762 transcripts that appear to be homologues of chicken genes. A specific BLAST search with an emphasis on immune genes found 308 homologous chicken genes that have immune function, including ten major histocompatibility complex-related genes located on chicken chromosome 16. We also identified 1300 expressed sequence tag microsatellites and were able to design suitable flanking primers for 526 of these. A preliminary test of the polymorphism of the microsatellites found 10 polymorphic microsatellites of the 102 tested. Genomic resources generated in this study should greatly benefit future ecological, evolutionary and conservation genetic studies on this species. PMID:22724064

  10. AAV2-mediated in vivo immune gene therapy of solid tumours

    PubMed Central


    Background Many strategies have been adopted to unleash the potential of gene therapy for cancer, involving a wide range of therapeutic genes delivered by various methods. Immune therapy has become one of the major strategies adopted for cancer gene therapy and seeks to stimulate the immune system to target tumour antigens. In this study, the feasibility of AAV2 mediated immunotherapy of growing tumours was examined, in isolation and combined with anti-angiogenic therapy. Methods Immune-competent Balb/C or C57 mice bearing subcutaneous JBS fibrosarcoma or Lewis Lung Carcinoma (LLC) tumour xenografts respectively were treated by intra-tumoural administration of AAV2 vector encoding the immune up-regulating cytokine granulocyte macrophage-colony stimulating factor (GM-CSF) and the co-stimulatory molecule B7-1 to subcutaneous tumours, either alone or in combination with intra-muscular (IM) delivery of AAV2 vector encoding Nk4 14 days prior to tumour induction. Tumour growth and survival was monitored for all animals. Cured animals were re-challenged with tumourigenic doses of the original tumour type. In vivo cytotoxicity assays were used to investigate establishment of cell-mediated responses in treated animals. Results AAV2-mediated GM-CSF, B7-1 treatment resulted in a significant reduction in tumour growth and an increase in survival in both tumour models. Cured animals were resistant to re-challenge, and induction of T cell mediated anti-tumour responses were demonstrated. Adoptive transfer of splenocytes to naïve animals prevented tumour establishment. Systemic production of Nk4 induced by intra-muscular (IM) delivery of Nk4 significantly reduced subcutaneous tumour growth. However, combination of Nk4 treatment with GM-CSF, B7-1 therapy reduced the efficacy of the immune therapy. Conclusions Overall, this study demonstrates the potential for in vivo AAV2 mediated immune gene therapy, and provides data on the inter-relationship between tumour vasculature and

  11. Variability of innate immune system genes in Native American populations-relationship with history and epidemiology.


    Lindenau, Juliana Dal-Ri; Salzano, Francisco Mauro; Hurtado, Ana Magdalena; Hill, Kim R; Petzl-Erler, Maria Luiza; Tsuneto, Luiza Tamie; Hutz, Mara Helena


    The immune system of a host, defending him/her against invading pathogens, has two main subsystems: innate immunity and acquired immunity. There are several evidences showing that Native American populations are immunologically different from non-Native populations. Our aim was to describe the variability of innate immune system genes in Native American populations. We investigated heterozygozities and patterns of population differentiation (FST ) of 14 polymorphisms related to the innate immune response in five Native American populations (Aché, Guarani-Kaiowá, Guarani-Ñandeva, Kaingang, and Xavante) and the results were compared with the three major world population data (YRI, CEU, and CHB) available at the 1,000 genomes database. Mean heterozygosities ranged between 0.241 ± 0.057 (Aché) and 0.343 ± 0.033 (Kaingang), but no significant differences were observed (Friedman test, P = 0.197). Mean heterozygosities were also not significantly different when Amerindians were pooled and compared with the 1000 genomes populations (Friedman test, P = 0.506). When the Native American populations were grouped as Amerindians, a significantly higher FST value (0.194) was observed between the Amerindian and African populations. The Ewens-Watterson neutrality test showed that these markers are not under strong selective pressure. Native American populations present similar levels of heterozygosity as those of other continents, but are different from Africans in the frequency of polymorphisms of innate immune genes. This higher differentiation is probably due to demographic processes that occurred during the out-of-Africa event. © 2015 Wiley Periodicals, Inc.

  12. The evolution and functional characterization of miiuy croaker cytosolic gene LGP2 involved in immune response.


    Han, Jingjing; Wang, Yanjin; Chu, Qing; Xu, Tianjun


    The laboratory of genetics and physiology 2 (LGP2) is a member of retinoic acid-inducible gene I (RIG-I)-like receptors (RLR receptors), which may participate in the immune regulation process. The role of LGP2 on modulating signaling was ambiguous, some researchers suggested that the regulation mechanism of LGP2 to melanoma differentiation-associated gene 5 (MDA5) and retinoic acid inducible gene-I (RIG-I) were different. In this study, the bioinformatics and functions of LGP2 from miiuy croaker (mmLGP2) were characterized. Comparative genomic analysis showed that the evolution of LGP2 in mammals was more conserved than it in fish. LGP2 contains three structural domains: ResIII, HelicaseC and RD, and ResIII structural domain of LGP2 was extremely conservative. The mmLGP2 was ubiquitously expressed in the tested miiuy croaker tissues and the expressions were significantly upregulated after stimulation with poly(I:C), indicating that LGP2 might participate in the immune response, especially antiviral immunity. Furthermore, immunofluorescence of miiuy croaker LGP2 presents in the cytoplasm in Hela cells. The overexpression of mmLGP2 can activate ISRE, but cannot activate NF-κB luciferase reporter, implying that mmLGP2 might act as a positive regulator in immune responses through activating ISRE to induce the expression of IFN. The research of mmLGP2 will enrich the information of fish LGP2, and the functional experiments will be helpful for the future research about fish immune systems. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Cellular immune response against firefly luciferase after sleeping beauty-mediated gene transfer in vivo.


    Podetz-Pedersen, Kelly M; Vezys, Vaiva; Somia, Nikunj V; Russell, Stephen J; McIvor, R Scott


    The Sleeping Beauty (SB) transposon system has been shown to mediate new gene sequence integration resulting in long-term expression. Here the effectiveness of hyperactive SB100X transposase was tested, and we found that hydrodynamic co-delivery of a firefly luciferase transposon (pT2/CaL) along with SB100X transposase (pCMV-SB100X) resulted in remarkably sustained, high levels of luciferase expression. However, after 4 weeks there was a rapid, animal-by-animal loss of luciferase expression that was not observed in immunodeficient mice. We hypothesized that this sustained, high-level luciferase expression achieved using the SB100X transposase elicits an immune response in pT2/CaL co-administered mice, which was supported by the rapid loss of luciferase expression upon challenge of previously treated animals and in naive animals adoptively transferred with splenocytes from previously treated animals. Specificity of the immune response to luciferase was demonstrated by increased cytokine expression in splenocytes after exposure to luciferase peptide in parallel with MHC I-luciferase peptide tetramer binding. This anti-luciferase immune response observed following continuous, high-level luciferase expression in vivo clearly impacts its use as an in vivo reporter. As both an immunogen and an extremely sensitive reporter, luciferase is also a useful model system for the study of immune responses following in vivo gene transfer and expression.

  14. Cellular Immune Response Against Firefly Luciferase After Sleeping Beauty–Mediated Gene Transfer In Vivo

    PubMed Central

    Podetz-Pedersen, Kelly M.; Vezys, Vaiva; Somia, Nikunj V.; Russell, Stephen J.


    Abstract The Sleeping Beauty (SB) transposon system has been shown to mediate new gene sequence integration resulting in long-term expression. Here the effectiveness of hyperactive SB100X transposase was tested, and we found that hydrodynamic co-delivery of a firefly luciferase transposon (pT2/CaL) along with SB100X transposase (pCMV-SB100X) resulted in remarkably sustained, high levels of luciferase expression. However, after 4 weeks there was a rapid, animal-by-animal loss of luciferase expression that was not observed in immunodeficient mice. We hypothesized that this sustained, high-level luciferase expression achieved using the SB100X transposase elicits an immune response in pT2/CaL co-administered mice, which was supported by the rapid loss of luciferase expression upon challenge of previously treated animals and in naive animals adoptively transferred with splenocytes from previously treated animals. Specificity of the immune response to luciferase was demonstrated by increased cytokine expression in splenocytes after exposure to luciferase peptide in parallel with MHC I–luciferase peptide tetramer binding. This anti-luciferase immune response observed following continuous, high-level luciferase expression in vivo clearly impacts its use as an in vivo reporter. As both an immunogen and an extremely sensitive reporter, luciferase is also a useful model system for the study of immune responses following in vivo gene transfer and expression. PMID:25093708

  15. Progressive histological damage in renal allografts is associated with expression of innate and adaptive immunity genes

    PubMed Central

    Naesens, Maarten; Khatri, Purvesh; Li, Li; Sigdel, Tara K.; Vitalone, Matthew J.; Chen, Rong; Butte, Atul J.; Salvatierra, Oscar; Sarwal, Minnie M.


    The degree of progressive chronic histological damage is associated with long-term renal allograft survival. In order to identify promising molecular targets for timely intervention, we examined renal allograft protocol and indication biopsies from 120 low-risk pediatric and adolescent recipients by whole-genome microarray expression profiling. In data-driven analysis, we found a highly regulated pattern of adaptive and innate immune gene expression that correlated with established or ongoing histological chronic injury, and also with development of future chronic histological damage, even in histologically pristine kidneys. Hence, histologically unrecognized immunological injury at a molecular level sets the stage for the development of chronic tissue injury, while the same molecular response is accentuated during established and worsening chronic allograft damage. Irrespective of the hypothesized immune or nonimmune trigger for chronic allograft injury, a highly orchestrated regulation of innate and adaptive immune responses was found in the graft at the molecular level. This occurred months before histologic lesions appear, and quantitatively below the diagnostic threshold of classic T-cell or antibody-mediated rejection. Thus, measurement of specific immune gene expression in protocol biopsies may be warranted to predict the development of subsequent chronic injury in histologically quiescent grafts and as a means to titrate immunosuppressive therapy. PMID:21881554

  16. Immune-related gene expression in nurse honey bees (Apis mellifera) exposed to synthetic acaricides.


    Garrido, Paula Melisa; Antúnez, Karina; Martín, Mariana; Porrini, Martín Pablo; Zunino, Pablo; Eguaras, Martín Javier


    The mite Varroa destructor is an ectoparasite affecting honey bees worldwide. Synthetic acaricides have been among the principal tools available to beekeepers for its control, although several studies have shown its negative effects on honey bee physiology. Recent research suggests that those molecules strongly impact on immune signaling cascades and cellular immunity. In the present work, LC(50) in six-day-old bees were determined for the following acaricides: tau-fluvalinate, flumethrin, amitraz and coumaphos. According to this obtained value, a group of individuals was treated with each acaricide and then processed for qPCR analysis. Transcript levels for genes encoding antimicrobial peptides and immune-related proteins were assessed. Flumethrin increased the expression of hymenoptaecin when comparing treated and control bees. Significant differences were recorded between coumaphos and flumethrin treatments, while the first one reduced the expression of hymenoptaecin and abaecin, the last one up-regulated their expressions. No significant statistically changes were recorded in the expression levels of vitellogenin, lysozyme or glucose dehydrogenase among bees treated with acaricides and control bees. This work constitutes the first report, under laboratory conditions, about induction of immune related genes in response to synthetic miticides. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Evolution of a polydnavirus gene in relation to parasitoid-host species immune resistance.


    Dupas, Stéphane; Gitau, Catherine Wanjiru; Branca, Antoine; Le Rü, Bruno Pierre; Silvain, Jean-François


    CrV1, a polydisperse DNA virus (polydnavirus or PDV) gene contributes to the suppression of host immunity in Cotesia genus parasitoids. Its molecular evolution was analyzed in relation to levels of resistance in the sympatric host species. Natural selection for nonsynonymous substitutions (positive Darwinian selection) was observed at specific amino acid sites among CrV1 variants; particularly, between parasitoid strains immune suppressive and nonimmune suppressive to the main resistant stem borer host, Busseola fusca. In Cotesia sesamiae, geographic distribution of CrV1 alleles in Kenya was correlated to the relative abundance of B. fusca. These results suggest that PDV genes evolve through natural selection and are genetically linked to factors of suppression of local host resistance. We discuss the forces driving the evolution of CrV1 and its use as a marker to understand parasitoid adaptation to host resistance in biological control.

  18. Discovery of immune-related genes expressed in hemocytes of the tarantula spider Acanthoscurria gomesiana.


    Lorenzini, Daniel M; da Silva, Pedro I; Soares, Marcelo B; Arruda, Paulo; Setubal, João; Daffre, Sirlei


    The present study reports the identification of immune related transcripts from hemocytes of the spider Acanthoscurria gomesiana by high throughput sequencing of expressed sequence tags (ESTs). To generate ESTs from hemocytes, two cDNA libraries were prepared: one by directional cloning (primary) and the other by the normalization of the first (normalized). A total of 7584 clones were sequenced and the identical ESTs were clustered, resulting in 3723 assembled sequences (AS). At least 20% of these sequences are putative novel genes. The automatic functional annotation of AS based on Gene Ontology revealed several abundant transcripts related to the following functional classes: hemocyanin, lectin, and structural constituents of ribosome and cytoskeleton. From this annotation, 73 transcripts possibly involved in immune response were also identified, suggesting the existence of several molecular processes not previously described for spiders, such as: pathogen recognition, coagulation, complement activation, cell adhesion and intracellular signaling pathway for the activation of cellular defenses.

  19. Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.


    Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z


    The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.

  20. Enhanced immune response with foot and mouth disease virus VP1 and interleukin-1 fusion genes.


    Park, Jong Hyeon; Kim, Sun Jin; Oem, Jae Ku; Lee, Kwang Nyeong; Kim, Yong Joo; Kye, Soo Jeong; Park, Jee Yong; Joo, Yi Seok


    The capsid of the foot and mouth disease (FMD) virus carries the epitopes that are critical for inducing the immune response. In an attempt to enhance the specific immune response, plasmid DNA was constructed to express VP1/interleukin-1alpha (IL-1alpha) and precursor capsid (P1) in combination with 2A (P1-2A)/IL-1alpha under the control of the human cytomegalovirus (HCMV) immediateearly promoter and intron. After DNA transfection into MA104 (monkey kidney) cells, Western blotting and an immunofluorescence assay were used to confirm the expression of VP1 or P1-2A and IL-1alpha. Mice were inoculated with the encoding plasmids via the intradermal route, and the IgG1 and IgG2a levels were used to determine the immune responses. These results show that although the immunized groups did not carry a high level of neutralizing antibodies, the plasmids encoding the VP1/ IL-1alpha, and P1-2A /IL-1alpha fused genes were effective in inducing an enhanced immune response.

  1. Expression analysis of innate immunity related genes in the true/field blast resistance gene-mediated defence response.


    Wang, Debing; Qin, Yonghua; Han, Jingluan; Zhang, Ling; Xu, Xin; Liu, Xuequn; Wang, Chuntai; Liu, Xinqiong


    Rice blast resistance (R) genes-mediated resistance response depends on various resistance-related genes involved in incompatible interactions. In this work, the expression profiles of innate rice immunity related genes were examined in the mediated resistance response of true/field resistance genes. Three sets of rice near-isogenic lines (NILs) were used: the resistant NILs carrying true resistance genes in the genetic background of the susceptible cultivar Nipponbare (NB), NB-Pib, NB-Pizt, NB-Pik and NB-Pita2; NILs bearing field resistance genes pi21 in the susceptible cultivar Aichiasahi (AA) AA-pi21, Kahei (KHR). The marker gene OsWRKY45 of salicylic acid (SA) signalling was upregulated in all tested cultivars. And, JAmyb (marker gene of jasmonic acid signalling) showed higher upregulation in the resistance lines with nucleotide-binding sites and leucine-rich repeat (NBS-LRR) R genes Pib, Pizt, Pik, Pita2 and Pikahei than in NB and KHS. SalT of abscisic acid (ABA) signalling may be involved in the R/Avr interaction, including Pizt, Pik, pi21 and Pikahei. However, SalT was shown to negatively regulate Pib/AvrPib interaction. OsPR1b and PBZ1 were differentially expressed and strongly activated at a later stage by 48 h post-inoculation. Interestingly, there was evidence that OsPR1b and PBZ1 played an important role in the pi21-mediated response. It was shown that OsRAR1 could be upregulated in the true resistance line NB-Pita2 and the field resistance line KHR, while OsSGT1 and OsHSP90 could be upregulated in all tested lines. The involvement of these genes illustrated the complexity of the downstream signalling pathways in the mediated resistance response of true/field resistance genes.

  2. Identification and characterization of a TAB1 gene involved in innate immunity of amphioxus (Branchiostoma belcheri).


    Yin, Denghua; Li, Wenjuan; Fu, Meili; Chen, Liming; Ma, Fei; Jin, Ping


    Transforming growth factor-β activated kinase-1 (TAK1) is an essential regulator in toll-like receptor (TLR), tumor necrosis factor (TNF) and interleukin-1 (IL-1) signaling pathways, and plays very important roles in animal innate immunity. TAK1-binding protein, TAB1, can specifically regulate the activation of TAK1. However, the TAB1 gene in amphioxus has not yet been identified to date. In this study, we identified and characterized a TAB1 gene from Branchiostoma belcheri (designed as AmphiTAB1). Our results showed that the full-length cDNA of AmphiTAB1 is 2281bp long with an open reading frame (ORF) of 1659bp that encodes a predicted protein of 553 amino acids containing a typical PP2Cc domain. Phylogenetic analysis indicated that the AmphiTAB1 gene was located between invertebrates and vertebrates, suggesting that the AmphiTAB1 gene is a member of the TAB1 gene family. Real-time PCR analysis indicated that the AmphiTAB1 was ubiquitously and differentially expressed in six investigated tissues (gills, hepatic cecum, intestine, muscles, notochord and gonad). After lipopolysaccharide stimulation, the expression of AmphiTAB1 was significantly up-regulated at 6h, which shows that AmphiTAB1 may be involved in the host immune response. In addition, the recombinant TAB1 expressed in vitro shows a molecular mass of 62kDa and Western blot confirmed it, which proved it is an encoding isoform. Taken together, our findings provide an insight into innate immune response of amphioxus and evolution of the TAB1 gene family.

  3. Trans-species polymorphism at antimicrobial innate immunity cathelicidin genes of Atlantic cod and related species.


    Halldórsdóttir, Katrín; Árnason, Einar


    Natural selection, the most important force in evolution, comes in three forms. Negative purifying selection removes deleterious variation and maintains adaptations. Positive directional selection fixes beneficial variants, producing new adaptations. Balancing selection maintains variation in a population. Important mechanisms of balancing selection include heterozygote advantage, frequency-dependent advantage of rarity, and local and fluctuating episodic selection. A rare pathogen gains an advantage because host defenses are predominantly effective against prevalent types. Similarly, a rare immune variant gives its host an advantage because the prevalent pathogens cannot escape the host's apostatic defense. Due to the stochastic nature of evolution, neutral variation may accumulate on genealogical branches, but trans-species polymorphisms are rare under neutrality and are strong evidence for balancing selection. Balanced polymorphism maintains diversity at the major histocompatibility complex (MHC) in vertebrates. The Atlantic cod is missing genes for both MHC-II and CD4, vital parts of the adaptive immune system. Nevertheless, cod are healthy in their ecological niche, maintaining large populations that support major commercial fisheries. Innate immunity is of interest from an evolutionary perspective, particularly in taxa lacking adaptive immunity. Here, we analyze extensive amino acid and nucleotide polymorphisms of the cathelicidin gene family in Atlantic cod and closely related taxa. There are three major clusters, Cath1, Cath2, and Cath3, that we consider to be paralogous genes. There is extensive nucleotide and amino acid allelic variation between and within clusters. The major feature of the results is that the variation clusters by alleles and not by species in phylogenetic trees and discriminant analysis of principal components. Variation within the three groups shows trans-species polymorphism that is older than speciation and that is suggestive of

  4. Molecular clock of HIV-1 envelope genes under early immune selection


    Park, Sung Yong; Love, Tanzy M. T.; Perelson, Alan S.; ...


    Here, the molecular clock hypothesis that genes or proteins evolve at a constant rate is a key tool to reveal phylogenetic relationships among species. Using the molecular clock, we can trace an infection back to transmission using HIV-1 sequences from a single time point. Whether or not a strict molecular clock applies to HIV-1’s early evolution in the presence of immune selection has not yet been fully examined.

  5. Robust TLR4-induced gene expression patterns are not an accurate indicator of human immunity

    PubMed Central


    Background Activation of Toll-like receptors (TLRs) is widely accepted as an essential event for defence against infection. Many TLRs utilize a common signalling pathway that relies on activation of the kinase IRAK4 and the transcription factor NFκB for the rapid expression of immunity genes. Methods 21 K DNA microarray technology was used to evaluate LPS-induced (TLR4) gene responses in blood monocytes from a child with an IRAK4-deficiency. In vitro responsiveness to LPS was confirmed by real-time PCR and ELISA and compared to the clinical predisposition of the child and IRAK4-deficient mice to Gram negative infection. Results We demonstrated that the vast majority of LPS-responsive genes in IRAK4-deficient monocytes were greatly suppressed, an observation that is consistent with the described role for IRAK4 as an essential component of TLR4 signalling. The severely impaired response to LPS, however, is inconsistent with a remarkably low incidence of Gram negative infections observed in this child and other children with IRAK4-deficiency. This unpredicted clinical phenotype was validated by demonstrating that IRAK4-deficient mice had a similar resistance to infection with Gram negative S. typhimurium as wildtype mice. A number of immunity genes, such as chemokines, were expressed at normal levels in human IRAK4-deficient monocytes, indicating that particular IRAK4-independent elements within the repertoire of TLR4-induced responses are expressed. Conclusions Sufficient defence to Gram negative immunity does not require IRAK4 or a robust, 'classic' inflammatory and immune response. PMID:20105294

  6. Molecular clock of HIV-1 envelope genes under early immune selection

    SciTech Connect

    Park, Sung Yong; Love, Tanzy M. T.; Perelson, Alan S.; Mack, Wendy J.; Lee, Ha Youn


    Here, the molecular clock hypothesis that genes or proteins evolve at a constant rate is a key tool to reveal phylogenetic relationships among species. Using the molecular clock, we can trace an infection back to transmission using HIV-1 sequences from a single time point. Whether or not a strict molecular clock applies to HIV-1’s early evolution in the presence of immune selection has not yet been fully examined.

  7. Probiotics prevent necrotizing enterocolitis by modulating enterocyte genes that regulate innate immune-mediated inflammation.


    Ganguli, Kriston; Meng, Di; Rautava, Samuli; Lu, Lei; Walker, W Allan; Nanthakumar, Nanda


    Necrotizing enterocolitis (NEC), an extensive intestinal inflammatory disease of premature infants, is caused, in part, by an excessive inflammatory response to initial bacterial colonization due to the immature expression of innate immune response genes. In a randomized placebo-controlled clinical trial, supplementation of very low birth weight infants with probiotics significantly reduced the incidence of NEC. The primary goal of this study was to determine whether secreted products of these two clinically effective probiotic strains, Bifidobacterium infantis and Lactobacillus acidophilus, prevented NEC by accelerating the maturation of intestinal innate immune response genes and whether both strains are required for this effect. After exposure to probiotic conditioned media (PCM), immature human enterocytes, immature human intestinal xenografts, and primary enterocyte cultures of NEC tissue (NEC-IEC) were assayed for an IL-8 and IL-6 response to inflammatory stimuli. The latter two models were also assayed for innate immune response gene expression. In the immature xenograft, PCM exposure significantly attenuated LPS and IL-1β-induced IL-8 and IL-6 expression, decreased TLR2 mRNA and TLR4 mRNA, and increased mRNA levels of specific negative regulators of inflammation, SIGIRR and Tollip. In NEC-IEC, PCM decreased TLR2-dependent IL-8 and IL-6 induction and increased SIGIRR and Tollip expression. The attenuated inflammatory response with PCM was reversed with Tollip siRNA-mediated knockdown. The anti-inflammatory secreted factor is a 5- to 10-kDa molecule resistant to DNase, RNase, protease, heat stress, and acid exposure. B. infantis-conditioned media showed superior anti-inflammatory properties to that of L. acidophilus in immature human enterocytes, suggesting a strain specificity to this effect. We conclude that PCM promotes maturation of innate immune response gene expression, potentially explaining the protective effects of probiotics in clinical NEC.

  8. Genome-wide characterization and expression profiling of immune genes in the diamondback moth, Plutella xylostella (L.)

    PubMed Central

    Xia, Xiaofeng; Yu, Liying; Xue, Minqian; Yu, Xiaoqiang; Vasseur, Liette; Gurr, Geoff M.; Baxter, Simon W.; Lin, Hailan; Lin, Junhan; You, Minsheng


    The diamondback moth, Plutella xylostella (L.), is a destructive pest that attacks cruciferous crops worldwide. Immune responses are important for interactions between insects and pathogens and information on these underpins the development of strategies for biocontrol-based pest management. Little, however, is known about immune genes and their regulation patterns in P. xylostella. A total of 149 immune-related genes in 20 gene families were identified through comparison of P. xylostella genome with the genomes of other insects. Complete and conserved Toll, IMD and JAK-STAT signaling pathways were found in P. xylostella. Genes involved in pathogen recognition were expanded and more diversified than genes associated with intracellular signal transduction. Gene expression profiles showed that the IMD pathway may regulate expression of antimicrobial peptide (AMP) genes in the midgut, and be related to an observed down-regulation of AMPs in experimental lines of insecticide-resistant P. xylostella. A bacterial feeding study demonstrated that P. xylostella could activate different AMPs in response to bacterial infection. This study has established a framework of comprehensive expression profiles that highlight cues for immune regulation in a major pest. Our work provides a foundation for further studies on the functions of P. xylostella immune genes and mechanisms of innate immunity. PMID:25943446

  9. Genome-wide characterization and expression profiling of immune genes in the diamondback moth, Plutella xylostella (L.).


    Xia, Xiaofeng; Yu, Liying; Xue, Minqian; Yu, Xiaoqiang; Vasseur, Liette; Gurr, Geoff M; Baxter, Simon W; Lin, Hailan; Lin, Junhan; You, Minsheng


    The diamondback moth, Plutella xylostella (L.), is a destructive pest that attacks cruciferous crops worldwide. Immune responses are important for interactions between insects and pathogens and information on these underpins the development of strategies for biocontrol-based pest management. Little, however, is known about immune genes and their regulation patterns in P. xylostella. A total of 149 immune-related genes in 20 gene families were identified through comparison of P. xylostella genome with the genomes of other insects. Complete and conserved Toll, IMD and JAK-STAT signaling pathways were found in P. xylostella. Genes involved in pathogen recognition were expanded and more diversified than genes associated with intracellular signal transduction. Gene expression profiles showed that the IMD pathway may regulate expression of antimicrobial peptide (AMP) genes in the midgut, and be related to an observed down-regulation of AMPs in experimental lines of insecticide-resistant P. xylostella. A bacterial feeding study demonstrated that P. xylostella could activate different AMPs in response to bacterial infection. This study has established a framework of comprehensive expression profiles that highlight cues for immune regulation in a major pest. Our work provides a foundation for further studies on the functions of P. xylostella immune genes and mechanisms of innate immunity.

  10. Adult Drosophila melanogaster evolved for antibacterial defense invest in infection-induced expression of both humoral and cellular immunity genes

    PubMed Central


    Background While the transcription of innate immunity genes in response to bacterial infection has been well-characterised in the Drosophila model, we recently demonstrated the capacity for such transcription to evolve in flies selected for improved antibacterial defense. Here we use this experimental system to examine how insects invest in constitutive versus infection-induced transcription of immunity genes. These two strategies carry with them different consequences with respect to energetic and pleiotropic costs and may be more or less effective in improving defense depending on whether the genes contribute to humoral or cellular aspects of immunity. Findings Contrary to expectation we show that selection preferentially increased the infection-induced expression of both cellular and humoral immunity genes. Given their functional roles, infection induced increases in expression were expected for the humoral genes, while increases in constitutive expression were expected for the cellular genes. We also report a restricted ability to improve transcription of immunity genes that is on the order of 2-3 fold regardless of total transcription level of the gene. Conclusions The evolved increases in infection-induced expression of the cellular genes may result from specific cross talk with humoral pathways or from generalised strategies for enhancing immunity gene transcription. A failure to see improvements in constitutive expression of the cellular genes suggests either that increases might come at too great a cost or that patterns of expression in adults are decoupled from the larval phase where increases would be most effective. The similarity in fold change increase across all immunity genes may suggest a shared mechanism for the evolution of increased transcription in small, discrete units such as duplication of cis-regulatory elements. PMID:21859495

  11. Th1/Th2 Cytokines: An Easy Model to Study Gene Expression in Immune Cells

    PubMed Central

    González-Polo, Rosa A.; Soler, Germán; Fuentes, José M.


    This report describes a laboratory exercise that was incorporated into a Cell Biology and Molecular Biology advanced course. The exercise was made for a class size with eight students and was designed to reinforce the understanding of basic molecular biology techniques. Students used the techniques of reverse transcription and arginase activity measurement as well as nitric oxide determination to discover whether two specific genes were expressed by cytokine-stimulated dendritic cells. The experiment served as the basis for discussing the importance of differential gene expression inside the eukaryotic cell and the importance of cytokines in the immune system. PMID:17012221

  12. TH1/TH2 cytokines: an easy model to study gene expression in immune cells.


    Morán, José M; González-Polo, Rosa A; Soler, Germán; Fuentes, José M


    This report describes a laboratory exercise that was incorporated into a Cell Biology and Molecular Biology advanced course. The exercise was made for a class size with eight students and was designed to reinforce the understanding of basic molecular biology techniques. Students used the techniques of reverse transcription and arginase activity measurement as well as nitric oxide determination to discover whether two specific genes were expressed by cytokine-stimulated dendritic cells. The experiment served as the basis for discussing the importance of differential gene expression inside the eukaryotic cell and the importance of cytokines in the immune system.

  13. Differentiated regulation of immune-response related genes between LUAD and LUSC subtypes of lung cancers

    PubMed Central

    Chen, Mengzhu; Liu, Xiuying; Du, Jie; Wang, Xiu-Jie; Xia, Lixin


    Lung squamous cell carcinoma (LUSC) and lung adenocarcinoma (LUAD) are the two major subtypes of lung cancer, with LUSC exhibits faster progression rate than LUAD. To investigate the roles of immune-response related genes (IRGs) in lung cancer progression, we used LUAD and LUSC samples at different cancer progression stages, and identified that the expression profiles of IRGs could serve as a better classification marker for cancerous tissues of both LUAD and LUSC. We found that the expression changes of IRGs were different between LUAD and LUSC. Cell cycle promoting genes, including KIFs and proteasomes, showed faster up-regulation in LUSC, whereas immune response promoting genes, including MHC molecules and chemokines, were more rapidly repressed in LUSC. Comparative pathway analysis revealed that members of the Toll-like receptor and T cell receptor signaling pathways exhibited diverged expression changes between LUAD and LUSC, especially at the early cancer stages. Our results revealed the difference of LUAD and LUSC from the immune response point of view, and provided new clues for the differential treatment of LUAD and LUSC. PMID:27863400

  14. The extent to which immunity, apoptosis and detoxification gene expression interact with 17 alpha-methyltestosterone.


    Abo-Al-Ela, Haitham G; El-Nahas, Abeer F; Mahmoud, Shawky; Ibrahim, Essam M


    Innate immunity is the first line of defence against invasion by foreign pathogens. One widely used synthetic androgen for the production of all-male fish, particularly commercially valuable Nile tilapia, Oreochromis niloticus, is 17 alpha-methyltestosterone (MT). The present study investigates the effect of MT on innate immunity, cellular apoptosis and detoxification and the mortality rate, during and after the feeding of fry with 0-, 40-and 60-mg MT/kg. Expression analysis was completed on interleukin 1 beta (il1β), interleukin 8 (il8), tumour necrosis factor alpha (tnfα), CXC2- and CC-chemokines, interferon (ifn), myxovirus resistance (mx), toll-like receptor 7 (tlr7), immunoglobulin M heavy chain (IgM heavy chain), vitellogenin (vtg), cellular apoptosis susceptibility (cas) and glutathione S-transferase α1 (gstα1). Expression analysis revealed that MT had a significant impact on these genes, and this impact varied from induction to repression during and after the treatment. Linear regression analysis showed a significant association between the majority of the tested gene transcript levels and mortality rates on the 7(th) and 21(st) days of hormonal treatment and 2 weeks following hormonal cessation. The results are thoroughly discussed in this article. This is the first report concerning the hazardous effect of MT on a series of genes involved in immunity, apoptosis and detoxification in the Nile tilapia fry.

  15. Prediction of Cellular Immune Responses against CFTR in Patients with Cystic Fibrosis after Gene Therapy

    PubMed Central

    Figueredo, Joanita; Limberis, Maria P.; Wilson, James M.


    Different classes of mutations (class I–VI) of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene are responsible for lung/pancreatic disease. The most common mutation, ΔF508, is characterized by expression of precursor forms of CFTR but no functional CFTR. Since only 5–10% of normal CFTR function is required to correct the electrophysiologic defect across the airway epithelium, gene therapy holds promise for treatment of patients with CF lung disease. However, efficient delivery and transgene expression are not the only parameters that may influence the success of gene therapy. Host-specific immune responses generated against the therapeutic CFTR protein may pose a problem, especially when the coding sequence between the normal CFTR and mutated CFTR differ. This phenomenon is more pertinent to class I mutations in which large fragments of the protein are not expressed. However, T cells directed against epitopes that span sequences containing class II–V mutations are also possible. We used MHC-binding prediction programs to predict the probability of cellular immune responses that may be generated against CFTR in ΔF508 homozygote patients. Results obtained from running the prediction algorithms yielded a few high-scoring MHC-Class I binders within the specific sequences, suggesting that there is a possibility of the host to mount a cellular immune response against CFTR, even when the difference between therapeutic and host CFTR is a single amino acid (F) at position 508. PMID:17218617

  16. Dietary fermentable fiber upregulated immune related genes expression, increased innate immune response and resistance of rainbow trout (Oncorhynchus mykiss) against Aeromonas hydrophila.


    Yarahmadi, Peyman; Kolangi Miandare, Hamed; Farahmand, Hamid; Mirvaghefi, Alireza; Hoseinifar, Seyed Hossein


    This trial was carried out to investigate the effects of dietary administration of Vitacel(®), a commercial fermentable fiber, on immune related genes (Lysozyme, TNFα and HSP70) expression, innate immune response and resistance of rainbow trout against Aeromonas hydrophila. 120 healthy rainbow trout (81.65 ± 1.49 g) were distributed in six fiberglass tanks assigned to two treatments. The treatments were feeding rainbow trout with diets supplemented with 0 (control) or 10 g kg(-1) Vitacel(®) for 45 days. The results revealed that administration of fermentable fiber significantly (P < 0.05) upregulated lysozyme and TNFα gene expression. HSP70 gene expression was significantly lower in Vitacel(®) fed fish at the end of trial (P < 0.05). Furthermore dietary administrations of Vitacel(®) remarkably elevated rainbow trout innate immune parameters include serum lysozyme, ACH50, bactericidal activity and agglutination antibody titer (P < 0.05). Administration of 10 g kg(-1) Vitacel(®) significantly increased rainbow trout resistance against A. hydrophila (P < 0.05). The results of present study revealed that dietary Vitacel(®) can upregulates immune related genes expression and elevates innate immune response and disease resistance of rainbow trout. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Extensive innate immune gene activation accompanies brain aging, increasing vulnerability to cognitive decline and neurodegeneration: a microarray study

    PubMed Central


    Background This study undertakes a systematic and comprehensive analysis of brain gene expression profiles of immune/inflammation-related genes in aging and Alzheimer’s disease (AD). Methods In a well-powered microarray study of young (20 to 59 years), aged (60 to 99 years), and AD (74 to 95 years) cases, gene responses were assessed in the hippocampus, entorhinal cortex, superior frontal gyrus, and post-central gyrus. Results Several novel concepts emerge. First, immune/inflammation-related genes showed major changes in gene expression over the course of cognitively normal aging, with the extent of gene response far greater in aging than in AD. Of the 759 immune-related probesets interrogated on the microarray, approximately 40% were significantly altered in the SFG, PCG and HC with increasing age, with the majority upregulated (64 to 86%). In contrast, far fewer immune/inflammation genes were significantly changed in the transition to AD (approximately 6% of immune-related probesets), with gene responses primarily restricted to the SFG and HC. Second, relatively few significant changes in immune/inflammation genes were detected in the EC either in aging or AD, although many genes in the EC showed similar trends in responses as in the other brain regions. Third, immune/inflammation genes undergo gender-specific patterns of response in aging and AD, with the most pronounced differences emerging in aging. Finally, there was widespread upregulation of genes reflecting activation of microglia and perivascular macrophages in the aging brain, coupled with a downregulation of select factors (TOLLIP, fractalkine) that when present curtail microglial/macrophage activation. Notably, essentially all pathways of the innate immune system were upregulated in aging, including numerous complement components, genes involved in toll-like receptor signaling and inflammasome signaling, as well as genes coding for immunoglobulin (Fc) receptors and human leukocyte antigens I

  18. Long-term programming of antigen-specific immunity from gene expression signatures in the PBMC of rhesus macaques immunized with an SIV DNA vaccine.


    Belisle, Sarah E; Yin, Jiangmei; Shedlock, Devon J; Dai, Anlan; Yan, Jian; Hirao, Lauren; Kutzler, Michele A; Lewis, Mark G; Andersen, Hanne; Lank, Simon M; Karl, Julie A; O'Connor, David H; Khan, Amir; Sardesai, Niranjan; Chang, Jean; Aicher, Lauri; Palermo, Robert E; Weiner, David B; Katze, Michael G; Boyer, Jean


    While HIV-1-specific cellular immunity is thought to be critical for the suppression of viral replication, the correlates of protection have not yet been determined. Rhesus macaques (RM) are an important animal model for the study and development of vaccines against HIV/AIDS. Our laboratory has helped to develop and study DNA-based vaccines in which recent technological advances, including genetic optimization and in vivo electroporation (EP), have helped to dramatically boost their immunogenicity. In this study, RMs were immunized with a DNA vaccine including individual plasmids encoding SIV gag, env, and pol alone, or in combination with a molecular adjuvant, plasmid DNA expressing the chemokine ligand 5 (RANTES), followed by EP. Along with standard immunological assays, flow-based activation analysis without ex vivo restimulation and high-throughput gene expression analysis was performed. Strong cellular immunity was induced by vaccination which was supported by all assays including PBMC microarray analysis that identified the up-regulation of 563 gene sequences including those involved in interferon signaling. Furthermore, 699 gene sequences were differentially regulated in these groups at peak viremia following SIVmac251 challenge. We observed that the RANTES-adjuvanted animals were significantly better at suppressing viral replication during chronic infection and exhibited a distinct pattern of gene expression which included immune cell-trafficking and cell cycle genes. Furthermore, a greater percentage of vaccine-induced central memory CD8+ T-cells capable of an activated phenotype were detected in these animals as measured by activation analysis. Thus, co-immunization with the RANTES molecular adjuvant followed by EP led to the generation of cellular immunity that was transcriptionally distinct and had a greater protective efficacy than its DNA alone counterpart. Furthermore, activation analysis and high-throughput gene expression data may provide better

  19. Allele frequency net: a database and online repository for immune gene frequencies in worldwide populations

    PubMed Central

    Gonzalez-Galarza, Faviel F.; Christmas, Stephen; Middleton, Derek; Jones, Andrew R.


    The allele frequency net database ( is an online repository that contains information on the frequencies of immune genes and their corresponding alleles in different populations. The extensive variability observed in genes and alleles related to the immune system response and its significance in transplantation, disease association studies and diversity in populations led to the development of this electronic resource. At present, the system contains data from 1133 populations in 608 813 individuals on the frequency of genes from different polymorphic regions such as human leukocyte antigens, killer-cell immunoglobulin-like receptors, major histocompatibility complex Class I chain-related genes and a number of cytokine gene polymorphisms. The project was designed to create a central source for the storage of frequency data and provide individuals with a set of bioinformatics tools to analyze the occurrence of these variants in worldwide populations. The resource has been used in a wide variety of contexts, including clinical applications (histocompatibility, immunology, epidemiology and pharmacogenetics) and population genetics. Demographic information, frequency data and searching tools can be freely accessed through the website. PMID:21062830

  20. Linking Transcriptional Changes over Time in Stimulated Dendritic Cells to Identify Gene Networks Activated during the Innate Immune Response

    PubMed Central

    Patil, Ashwini; Kumagai, Yutaro; Liang, Kuo-ching; Suzuki, Yutaka; Nakai, Kenta


    The innate immune response is primarily mediated by the Toll-like receptors functioning through the MyD88-dependent and TRIF-dependent pathways. Despite being widely studied, it is not yet completely understood and systems-level analyses have been lacking. In this study, we identified a high-probability network of genes activated during the innate immune response using a novel approach to analyze time-course gene expression profiles of activated immune cells in combination with a large gene regulatory and protein-protein interaction network. We classified the immune response into three consecutive time-dependent stages and identified the most probable paths between genes showing a significant change in expression at each stage. The resultant network contained several novel and known regulators of the innate immune response, many of which did not show any observable change in expression at the sampled time points. The response network shows the dominance of genes from specific functional classes during different stages of the immune response. It also suggests a role for the protein phosphatase 2a catalytic subunit α in the regulation of the immunoproteasome during the late phase of the response. In order to clarify the differences between the MyD88-dependent and TRIF-dependent pathways in the innate immune response, time-course gene expression profiles from MyD88-knockout and TRIF-knockout dendritic cells were analyzed. Their response networks suggest the dominance of the MyD88-dependent pathway in the innate immune response, and an association of the circadian regulators and immunoproteasomal degradation with the TRIF-dependent pathway. The response network presented here provides the most probable associations between genes expressed in the early and the late phases of the innate immune response, while taking into account the intermediate regulators. We propose that the method described here can also be used in the identification of time-dependent gene sub

  1. Linking transcriptional changes over time in stimulated dendritic cells to identify gene networks activated during the innate immune response.


    Patil, Ashwini; Kumagai, Yutaro; Liang, Kuo-Ching; Suzuki, Yutaka; Nakai, Kenta


    The innate immune response is primarily mediated by the Toll-like receptors functioning through the MyD88-dependent and TRIF-dependent pathways. Despite being widely studied, it is not yet completely understood and systems-level analyses have been lacking. In this study, we identified a high-probability network of genes activated during the innate immune response using a novel approach to analyze time-course gene expression profiles of activated immune cells in combination with a large gene regulatory and protein-protein interaction network. We classified the immune response into three consecutive time-dependent stages and identified the most probable paths between genes showing a significant change in expression at each stage. The resultant network contained several novel and known regulators of the innate immune response, many of which did not show any observable change in expression at the sampled time points. The response network shows the dominance of genes from specific functional classes during different stages of the immune response. It also suggests a role for the protein phosphatase 2a catalytic subunit α in the regulation of the immunoproteasome during the late phase of the response. In order to clarify the differences between the MyD88-dependent and TRIF-dependent pathways in the innate immune response, time-course gene expression profiles from MyD88-knockout and TRIF-knockout dendritic cells were analyzed. Their response networks suggest the dominance of the MyD88-dependent pathway in the innate immune response, and an association of the circadian regulators and immunoproteasomal degradation with the TRIF-dependent pathway. The response network presented here provides the most probable associations between genes expressed in the early and the late phases of the innate immune response, while taking into account the intermediate regulators. We propose that the method described here can also be used in the identification of time-dependent gene sub

  2. Humoral immunity to AAV vectors in gene therapy: challenges and potential solutions.


    Masat, Elisa; Pavani, Giulia; Mingozzi, Federico


    Gene transfer trials with adeno-associated virus (AAV) vectors have initiated to unveil the therapeutic potential of this approach, with some of the most exciting results coming from clinical studies of gene transfer for hemophilia B, congenital blindness, and the recent market approval of the first AAV-based gene therapy in Europe. With clinical development, however, some of the limitations of in vivo gene transfer have emerged; in particular the host immune system represents an important obstacle to be overcome in terms of both safety and efficacy of gene transfer in vivo with AAV vectors. Results in humans undergoing gene transfer indicate that capsid-specific T cell responses directed against transduced cells may limit the duration of transgene expression following AAV gene transfer, and similarly anti-AAV neutralizing antibodies can completely prevent transduction of a target tissue, resulting in lack of efficacy. Anti-AAV neutralizing antibodies are highly prevalent in humans, and the frequency of subjects with detectable titers can reach up to two thirds of the population. The approach to the problem of preexisting humoral immunity to AAV so far has been the exclusion of seropositive subjects, but this solution is far from being optimal. Several additional strategies have been proposed and tested in a variety of preclinical animal models. Future studies will help defining the optimal strategy, or combination of strategies, to successfully treat subjects with preexisting antibodies to AAV due to natural infection or to prior administration of AAV vectors. These advancements will likely have a significant impact on the field of gene transfer with AAV vectors.

  3. Gene Networks Specific for Innate Immunity Define Post-Traumatic Stress Disorder

    PubMed Central

    Breen, Michael S.; Maihofer, Adam X.; Glatt, Stephen J.; Tylee, Daniel S.; Chandler, Sharon D.; Tsuang, Ming T.; Risbrough, Victoria B.; Baker, Dewleen G.; O’Connor, Daniel T.; Nievergelt, Caroline M.; Woelk, Christopher H.


    The molecular factors involved in the development of Post-Traumatic Stress Disorder (PTSD) remain poorly understood. Previous transcriptomic studies investigating the mechanisms of PTSD apply targeted approaches to identify individual genes under a cross-sectional framework lack a holistic view of the behaviours and properties of these genes at the system-level. Here we sought to apply an unsupervised gene-network based approach to a prospective experimental design using whole-transcriptome RNA-Seq gene expression from peripheral blood leukocytes of U.S. Marines (N=188), obtained both pre- and post-deployment to conflict zones. We identified discrete groups of co-regulated genes (i.e., co-expression modules) and tested them for association to PTSD. We identified one module at both pre- and post-deployment containing putative causal signatures for PTSD development displaying an over-expression of genes enriched for functions of innate-immune response and interferon signalling (Type-I and Type-II). Importantly, these results were replicated in a second non-overlapping independent dataset of U.S. Marines (N=96), further outlining the role of innate immune and interferon signalling genes within co-expression modules to explain at least part of the causal pathophysiology for PTSD development. A second module, consequential of trauma exposure, contained PTSD resiliency signatures and an over-expression of genes involved in hemostasis and wound responsiveness suggesting that chronic levels of stress impair proper wound healing during/after exposure to the battlefield while highlighting the role of the hemostatic system as a clinical indicator of chronic-based stress. These findings provide novel insights for early preventative measures and advanced PTSD detection, which may lead to interventions that delay or perhaps abrogate the development of PTSD. PMID:25754082

  4. Immune response to lentiviral bilirubin UDP-glucuronosyltransferase gene transfer in fetal and neonatal rats.


    Seppen, J; van Til, N P; van der Rijt, R; Hiralall, J K; Kunne, C; Elferink, R P J Oude


    Gene therapy for inherited disorders might cause an immune response to the therapeutic protein. A solution would be to introduce the gene in the fetal or neonatal period, which should lead to tolerization. Lentiviral vectors mediate long-term gene expression, and are well suited for gene therapy early in development. A model for fetal or neonatal gene therapy is the inherited disorder of bilirubin metabolism, Crigler-Najjar disease (CN). The absence of bilirubin UDP-glucoronyltransferase (UGT1A1) activity in CN patients causes high serum levels of unconjugated bilirubin and brain damage in infancy. CN is attractive for the development of gene therapy because the mutant Gunn rat closely mimics the human disease. Injection of UGT1A1 lentiviral vectors corrected the hyperbilirubinemia for more than a year in rats injected as fetuses and for up to 18 weeks in rats injected the day of birth. UGT1A1 gene transfer was confirmed by the presence of bilirubin glucuronides in bile. All animals injected with UGT1A1 lentiviral vectors developed antibodies to UGT1A1. Animals injected with green fluorescent protein (GFP) lentiviral vectors did not develop antibodies to GFP. Our results indicate that fetal and neonatal gene therapy with immunogenic proteins such as UGT1A1 does not necessarily lead to tolerization.

  5. Innate immunity gene expression changes in critically ill patients with sepsis and disease-related malnutrition

    PubMed Central

    Sarnecka, Agnieszka; Dąbrowska, Aleksandra; Kosałka, Katarzyna; Wachowska, Ewelina; Bałan, Barbara J.; Jankowska, Marta; Korta, Teresa; Niewiński, Grzegorz; Kański, Andrzej; Mikaszewska-Sokolewicz, Małgorzata; Omidi, Mohammad; Majewska, Krystyna; Słotwińska, Sylwia M.


    The aim of this study was an attempt to determine whether the expression of genes involved in innate antibacterial response (TL R2, NOD 1, TRAF6, HMGB 1 and Hsp70) in peripheral blood leukocytes in critically ill patients, may undergo significant changes depending on the severity of the infection and the degree of malnutrition. The study was performed in a group of 128 patients with infections treated in the intensive care and surgical ward. In 103/80.5% of patients, infections had a severe course (sepsis, severe sepsis, septic shock, mechanical ventilation of the lungs). Clinical monitoring included diagnosis of severe infection (according to the criteria of the ACC P/SCC M), assessment of severity of the patient condition and risk of death (APACHE II and SAPS II), nutritional assessment (NRS 2002 and SGA scales) and the observation of the early results of treatment. Gene expression at the mRNA level was analyzed by real-time PCR. The results of the present study indicate that in critically ill patients treated in the IC U there are significant disturbances in the expression of genes associated with innate antimicrobial immunity, which may have a significant impact on the clinical outcome. The expression of these genes varies depending on the severity of the patient condition, severity of infection and nutritional status. Expression disorders of genes belonging to innate antimicrobial immunity should be diagnosed as early as possible, monitored during the treatment and taken into account during early therapeutic treatment (including early nutrition to support the functions of immune cells). PMID:26648775

  6. Cia27 is a novel non-MHC arthritis severity locus on rat chromosome 10 syntenic to the rheumatoid arthritis 17q22-q25 locus.


    Brenner, M; Laragione, T; Yarlett, N C; Li, W; Mello, A; Gulko, P S


    Cia27 on rat chromosome 10 is a collagen-induced arthritis (CIA) severity quantitative trait locus originally identified in a study of (DA x ACI) F2. As an initial step towards the positional cloning of the Cia27 gene, a 17 cM (21 Mb) interval from the DA strain (arthritis-susceptible) containing the two-logarithm of odds support interval comprising Cia27 was introgressed into the ACI (arthritis-resistant) background through genotype-guided congenic breeding. ACI.DA(Cia27) congenics developed a significantly more severe form of arthritis (CIA), with a 5.9-fold increase in median arthritis severity index, a parameter known to correlate with synovial inflammation, and cartilage and bone erosions, compared with ACI (P< or =0.001). The arthritis severity enhancing effect could be detected from day 21 onwards. Rats heterozygous at the congenic interval developed a disease similar to ACI rats, suggesting that DA alleles operate in a recessive manner. Levels of autoantibodies anti-rat type II collagen did not correlate with arthritis severity. Synovial tissue mRNA levels of interleukin-1beta (IL-1beta) were significantly increased in ACI.DA(Cia27) congenics compared with ACI. These results demonstrate that Cia27 harbors a novel arthritis severity regulatory gene. The identification of this gene should facilitate the identification of the rheumatoid arthritis gene mapped to the human syntenic region on chromosome 17q22-q25.

  7. Temozolomide does not impair gene therapy-mediated antitumor immunity in syngeneic brain tumor models

    PubMed Central

    Wibowo, Mia; Ahlzadeh, Gabrielle E; Puntel, Mariana; Ghiasi, Homayon; Kamran, Neha; Paran, Christopher; Lowenstein, Pedro R; Castro, Maria G


    Purpose Glioblastoma multiforme (GBM) is the most common primary brain cancer in adults. Chemotherapy with temozolomide (TMZ) significantly prolongs the survival of GBM patients. However, the 3-year survival is still ~5%. Herein we combined intratumoral administration of an adenoviral vector expressing Flt3L (Ad-Flt3L) with systemic TMZ in order to assess its impact on therapeutic efficacy. Experimental Design Wild type or immunodeficient mice bearing intracranial GBM or metastatic melanoma were treated with an intratumoral injection of Ad-Flt3L alone or in combination with the conditionally cytotoxic enzyme thymidine kinase (Ad-TK), followed by systemic administration of ganciclovir and TMZ. We monitored survival and measured the tumor-infiltrating immune cells. Results While treatment with TMZ alone led to a small improvement in median survival, when used in combination with gene therapy-mediated immunotherapy it significantly increased the survival of tumor-bearing mice. The anti-tumor effect was further enhanced by concomitant intratumoral administration of Ad-TK, leading to 50–70% long-term survival in all tumor models. Although TMZ reduced the content of T cells in the tumor, this did not affect the therapeutic efficacy. The anti-tumor effect of Ad-Flt3L+Ad-TK+TMZ required an intact immune system, since the treatment failed when administered to KO mice that lacked lymphocytes or dendritic cells. Conclusions Our results challenge the notion that chemotherapy leads to a state of immune-suppression which impairs the ability of the immune system to mount an effective anti-tumor response. Our work indicates that TMZ does not inhibit antitumor immunity and supports its clinical implementation in combination with immune-mediated therapies. PMID:24501391

  8. Turning (Ir gene) low responders into high responders by antibody manipulation of the developing immune system.

    PubMed Central

    Martinz, C; Marcos, M A; Pereira, P; Marquez, C; Toribio, M; de la Hera, A; Cazenave, P A; Coutinho, A


    The ability of helper T cells directed against trinitrophenyl-modified syngeneic spleen cells to recognize low-hapten densities on target cells is under major histocompatibility complex-linked Ir gene control. Thus, BALB/c (H-2d) mice are low responders while H-2 congenic BALB.C3H (H-2k) mice are high responders. Immunization of adult BALB/c mice with the monoclonal antibody F6(51), directed to shared idiotopes by anti-trinitrophenyl antibodies and clonal receptors on anti-trinitrophenyl-self helper T cells, leads to the production of high titers of circulating idiotype, has no influence on helper T cell idiotypic profiles, but shifts to a high-responder phenotype the ability of helper T cells to recognize low-hapten densities. These effects on Ir gene phenotype are even more striking in untreated progenies from F6(51)-immunized BALB/c females, which are better responders than genetically high-responder BALB.C3H mice, although completely different in the expression of the F6(51)-defined clonotype. The general significance of these findings on Ir gene-directed T-cell repertoire selection is discussed, for they constitute formal evidence against antigen-presentation as a mechanism of Ir gene effects and strong support for the importance of maternal influences on the development of T-cell repertoires. PMID:2954161

  9. Perforin gene transfer into hematopoietic stem cells improves immune dysregulation in murine models of perforin deficiency.


    Carmo, Marlene; Risma, Kimberly A; Arumugam, Paritha; Tiwari, Swati; Hontz, Adrianne E; Montiel-Equihua, Claudia A; Alonso-Ferrero, Maria E; Blundell, Michael P; Schambach, Axel; Baum, Christopher; Malik, Punam; Thrasher, Adrian J; Jordan, Michael B; Gaspar, H Bobby


    Defects in perforin lead to the failure of T and NK cell cytotoxicity, hypercytokinemia, and the immune dysregulatory condition known as familial hemophagocytic lymphohistiocytosis (FHL). The only curative treatment is allogeneic hematopoietic stem cell transplantation which carries substantial risks. We used lentiviral vectors (LV) expressing the human perforin gene, under the transcriptional control of the ubiquitous phosphoglycerate kinase promoter or a lineage-specific perforin promoter, to correct the defect in different murine models. Following LV-mediated gene transfer into progenitor cells from perforin-deficient mice, we observed perforin expression in mature T and NK cells, and there was no evidence of progenitor cell toxicity when transplanted into irradiated recipients. The resulting perforin-reconstituted NK cells showed partial recovery of cytotoxicity, and we observed full recovery of cytotoxicity in polyclonal CD8(+) T cells. Furthermore, reconstituted T cells with defined antigen specificity displayed normal cytotoxic function against peptide-loaded targets. Reconstituted CD8(+) lymphoblasts had reduced interferon-γ secretion following stimulation in vitro, suggesting restoration of normal immune regulation. Finally, upon viral challenge, mice with >30% engraftment of gene-modified cells exhibited reduction of cytokine hypersecretion and cytopenias. This study demonstrates the potential of hematopoietic stem cell gene therapy as a curative treatment for perforin-deficient FHL.

  10. Dissecting the contributions of time and microbe density to variation in immune gene expression.


    Tate, Ann T; Graham, Andrea L


    Widespread differential expression of immunological genes is a hallmark of the response to infection in almost all surveyed taxa. However, several challenges remain in the attempt to connect differences in gene expression with functional outcomes like parasite killing and host survival. For example, temporal gene expression patterns are not always monotonic (unidirectional slope), yielding results that qualitatively depend on the time point selected for analysis. They may also be correlated to microbe density, confounding the strength of an immune response and resistance to parasites. In this study, we analyse these relationships in an mRNA-seq time series of Tribolium castaneum infected with Bacillus thuringiensis Our results suggest that many extracellular immunological components with known roles in immunity, like antimicrobial peptides and recognition proteins, are highly correlated to microbe load. On the other hand, intracellular components of immunological signalling pathways overwhelmingly show non-monotonic temporal patterns of gene expression, despite the underlying assumption of monotonicity in most ecological and comparative transcriptomics studies that rely on cross-sectional analyses. Our results raise a host of new questions, including to what extent variation in host resistance, infection tolerance and immunopathology can be explained by variation in the slope or sensitivity of these newly characterized patterns. © 2017 The Author(s).

  11. Polymorphisms in innate immunity genes and lung cancer risk in Xuanwei, China

    SciTech Connect

    Shen, M.; Vermeulen, R.; Rajaraman, P.; Menashe, I.; He, X.Z.; Chapman, R.S.; Yeager, M.; Thomas, G.; Burdett, L.; Hutchinson, A.; Yuenger, J.; Chanock, S.; Lan, Q.


    The high incidence of lung cancer in Xuanwei County, China has been attributed to exposure to indoor smoky coal emissions that contain polycyclic aromatic hydrocarbons (PAHs). The inflammatory response induced by coal smoke components may promote lung tumor development. We studied the association between single nucleotide polymorphisms (SNPs) in genes involved in innate immunity and lung cancer risk in a population-based case-control study (122 cases and 122 controls) in Xuanwei. A total of 1,360 tag SNPs in 149 gene regions were included in the analysis. FCER2 rs7249320 was the most significant SNP (OR: 0.30; 95% Cl: 0.16-0.55; P: 0.0001; false discovery rate value, 0.13) for variant carriers. The gene regions ALOX12B/ALOX15B and KLK2 were associated with increased lung cancer risk globally (false discovery rate value < 0.15). In addition, there were positive interactions between KLK15 rs3745523 and smoky coal use (OR: 9.40; P-interaction = 0.07) and between FCER2 rs7249320 and KLK2 rs2739476 (OR: 10.77; P-interaction = 0.003). Our results suggest that genetic polymorphisms in innate immunity genes may play a role in the genesis of lung cancer caused by PAH-containing coal smoke. Integrin/receptor and complement pathways as well as IgE regulation are particularly noteworthy.

  12. Perforin Gene Transfer Into Hematopoietic Stem Cells Improves Immune Dysregulation in Murine Models of Perforin Deficiency

    PubMed Central

    Carmo, Marlene; Risma, Kimberly A; Arumugam, Paritha; Tiwari, Swati; Hontz, Adrianne E; Montiel-Equihua, Claudia A; Alonso-Ferrero, Maria E; Blundell, Michael P; Schambach, Axel; Baum, Christopher; Malik, Punam; Thrasher, Adrian J; Jordan, Michael B; Gaspar, H Bobby


    Defects in perforin lead to the failure of T and NK cell cytotoxicity, hypercytokinemia, and the immune dysregulatory condition known as familial hemophagocytic lymphohistiocytosis (FHL). The only curative treatment is allogeneic hematopoietic stem cell transplantation which carries substantial risks. We used lentiviral vectors (LV) expressing the human perforin gene, under the transcriptional control of the ubiquitous phosphoglycerate kinase promoter or a lineage-specific perforin promoter, to correct the defect in different murine models. Following LV-mediated gene transfer into progenitor cells from perforin-deficient mice, we observed perforin expression in mature T and NK cells, and there was no evidence of progenitor cell toxicity when transplanted into irradiated recipients. The resulting perforin-reconstituted NK cells showed partial recovery of cytotoxicity, and we observed full recovery of cytotoxicity in polyclonal CD8+ T cells. Furthermore, reconstituted T cells with defined antigen specificity displayed normal cytotoxic function against peptide-loaded targets. Reconstituted CD8+ lymphoblasts had reduced interferon-γ secretion following stimulation in vitro, suggesting restoration of normal immune regulation. Finally, upon viral challenge, mice with >30% engraftment of gene-modified cells exhibited reduction of cytokine hypersecretion and cytopenias. This study demonstrates the potential of hematopoietic stem cell gene therapy as a curative treatment for perforin-deficient FHL. PMID:25523759

  13. Genome-wide association study implicates immune activation of multiple integrin genes in inflammatory bowel disease

    PubMed Central

    Lamb, Christopher A.; Luo, Yang; Kennedy, Nicholas A.; Jostins, Luke; Rice, Daniel L.; Gutierrez-Achury, Javier; Ji, Sun-Gou; Heap, Graham; Nimmo, Elaine R.; Edwards, Cathryn; Henderson, Paul; Mowat, Craig; Sanderson, Jeremy; Satsangi, Jack; Simmons, Alison; Wilson, David C.; Tremelling, Mark; Hart, Ailsa; Mathew, Christopher G.; Newman, William G.; Parkes, Miles; Lees, Charlie W.; Uhlig, Holm; Hawkey, Chris; Prescott, Natalie J.; Ahmad, Tariq; Mansfield, John C.; Anderson, Carl A.; Barrett, Jeffrey C.


    Genetic association studies have identified 215 risk loci for inflammatory bowel disease 1–8, which have revealed fundamental aspects of its molecular biology. We performed a genome-wide association study of 25,305 individuals, and meta-analyzed with published summary statistics, yielding a total sample size of 59,957 subjects. We identified 25 new loci, three of which contain integrin genes that encode proteins in pathways identified as important therapeutic targets in inflammatory bowel disease. The associated variants are correlated with expression changes in response to immune stimulus at two of these genes (ITGA4, ITGB8) and at previously implicated loci (ITGAL, ICAM1). In all four cases, the expression increasing allele also increases disease risk. We also identified likely causal missense variants in the primary immune deficiency gene PLCG2 and a negative regulator of inflammation, SLAMF8. Our results demonstrate that new common variant associations continue to identify genes relevant to therapeutic target identification and prioritization. PMID:28067908

  14. Dynamics of immune system gene expression upon bacterial challenge and wounding in a social insect (Bombus terrestris).


    Erler, Silvio; Popp, Mario; Lattorff, H Michael G


    The innate immune system which helps individuals to combat pathogens comprises a set of genes representing four immune system pathways (Toll, Imd, JNK and JAK/STAT). There is a lack of immune genes in social insects (e.g. honeybees) when compared to Diptera. Potentially, this might be compensated by an advanced system of social immunity (synergistic action of several individuals). The bumble bee, Bombus terrestris, is a primitively eusocial species with an annual life cycle and colonies headed by a single queen. We used this key pollinator to study the temporal dynamics of immune system gene expression in response to wounding and bacterial challenge.Antimicrobial peptides (AMP) (abaecin, defensin 1, hymenoptaecin) were strongly up-regulated by wounding and bacterial challenge, the latter showing a higher impact on the gene expression level. Sterile wounding down-regulated TEP A, an effector gene of the JAK/STAT pathway, and bacterial infection influenced genes of the Imd (relish) and JNK pathway (basket). Relish was up-regulated within the first hour after bacterial challenge, but decreased strongly afterwards. AMP expression following wounding and bacterial challenge correlates with the expression pattern of relish whereas correlated expression with dorsal was absent. Although expression of AMPs was high, continuous bacterial growth was observed throughout the experiment.Here we demonstrate for the first time the temporal dynamics of immune system gene expression in a social insect. Wounding and bacterial challenge affected the innate immune system significantly. Induction of AMP expression due to wounding might comprise a pre-adaptation to accompanying bacterial infections. Compared with solitary species this social insect exhibits reduced immune system efficiency, as bacterial growth could not be inhibited. A negative feedback loop regulating the Imd-pathway is suggested. AMPs, the end product of the Imd-pathway, inhibited the up-regulation of the transcription

  15. Effect of Dactylogyrus catlaius (Jain 1961) infection in Labeo rohita (Hamilton 1822): innate immune responses and expression profile of some immune related genes.


    Dash, Pujarini; Kar, Banya; Mishra, Arpita; Sahoo, P K


    The monogenean ectoparasite, Dactylogyrus sp. is a major pathogen in freshwater aquaculture. The immune responses in parasitized fish were analyzed by quantitation of innate immune factors (natural agglutinin level, haemolysin titre, antiprotease, lysozyme and myeloperoxidase activities) in serum and immune-relevant gene expression in gill and anterior kidney. The antiprotease activity and natural agglutinin level were found to be significantly higher and lysozyme activity was significantly lower in parasitized fish. Most of the genes viz., beta2-microglobulin (beta2M), major histocompatibility complex I (MHCI), MHCII, tumor necrosis factor alpha (TNFalpha) and toll-like receptor 22 (TLR22) in gill samples were significantly down-regulated in the experimental group. In the anterior kidney, the expression of superoxide dismutase and interleukin 1beta (IL1beta) were significantly up-regulated whereas a significant down regulation of MHCII and TNFalpha was also observed. The down-regulation of most of the genes viz, MHCI, beta2M, MHCII, TLR22 and TNFalpha in infected gills indicated a well evolved mechanism in this parasite to escape the host immune response. The modulation of innate and adaptive immunity by this parasite can be further explored to understand host susceptibility.

  16. Common Genetic Variants Found in HLA and KIR Immune Genes in Autism Spectrum Disorder

    PubMed Central

    Torres, Anthony R.; Sweeten, Thayne L.; Johnson, Randall C.; Odell, Dennis; Westover, Jonna B.; Bray-Ward, Patricia; Ward, David C.; Davies, Christopher J.; Thomas, Aaron J.; Croen, Lisa A.; Benson, Michael


    The “common variant—common disease” hypothesis was proposed to explain diseases with strong inheritance. This model suggests that a genetic disease is the result of the combination of several common genetic variants. Common genetic variants are described as a 5% frequency differential between diseased vs. matched control populations. This theory was recently supported by an epidemiology paper stating that about 50% of genetic risk for autism resides in common variants. However, rare variants, rather than common variants, have been found in numerous genome wide genetic studies and many have concluded that the “common variant—common disease” hypothesis is incorrect. One interpretation is that rare variants are major contributors to genetic diseases and autism involves the interaction of many rare variants, especially in the brain. It is obvious there is much yet to be learned about autism genetics. Evidence has been mounting over the years indicating immune involvement in autism, particularly the HLA genes on chromosome 6 and KIR genes on chromosome 19. These two large multigene complexes have important immune functions and have been shown to interact to eliminate unwanted virally infected and malignant cells. HLA proteins have important functions in antigen presentation in adaptive immunity and specific epitopes on HLA class I proteins act as cognate ligands for KIR receptors in innate immunity. Data suggests that HLA alleles and KIR activating genes/haplotypes are common variants in different autism populations. For example, class I allele (HLA-A2 and HLA-G 14 bp-indel) frequencies are significantly increased by more than 5% over control populations (Table 2). The HLA-DR4 Class II and shared epitope frequencies are significantly above the control populations (Table 2). Three activating KIR genes: 3DS1, 2DS1, and 2DS2 have increased frequencies of 15, 22, and 14% in autism populations, respectively. There is a 6% increase in total activating KIR genes in

  17. Common Genetic Variants Found in HLA and KIR Immune Genes in Autism Spectrum Disorder.


    Torres, Anthony R; Sweeten, Thayne L; Johnson, Randall C; Odell, Dennis; Westover, Jonna B; Bray-Ward, Patricia; Ward, David C; Davies, Christopher J; Thomas, Aaron J; Croen, Lisa A; Benson, Michael


    The "common variant-common disease" hypothesis was proposed to explain diseases with strong inheritance. This model suggests that a genetic disease is the result of the combination of several common genetic variants. Common genetic variants are described as a 5% frequency differential between diseased vs. matched control populations. This theory was recently supported by an epidemiology paper stating that about 50% of genetic risk for autism resides in common variants. However, rare variants, rather than common variants, have been found in numerous genome wide genetic studies and many have concluded that the "common variant-common disease" hypothesis is incorrect. One interpretation is that rare variants are major contributors to genetic diseases and autism involves the interaction of many rare variants, especially in the brain. It is obvious there is much yet to be learned about autism genetics. Evidence has been mounting over the years indicating immune involvement in autism, particularly the HLA genes on chromosome 6 and KIR genes on chromosome 19. These two large multigene complexes have important immune functions and have been shown to interact to eliminate unwanted virally infected and malignant cells. HLA proteins have important functions in antigen presentation in adaptive immunity and specific epitopes on HLA class I proteins act as cognate ligands for KIR receptors in innate immunity. Data suggests that HLA alleles and KIR activating genes/haplotypes are common variants in different autism populations. For example, class I allele (HLA-A2 and HLA-G 14 bp-indel) frequencies are significantly increased by more than 5% over control populations (Table 2). The HLA-DR4 Class II and shared epitope frequencies are significantly above the control populations (Table 2). Three activating KIR genes: 3DS1, 2DS1, and 2DS2 have increased frequencies of 15, 22, and 14% in autism populations, respectively. There is a 6% increase in total activating KIR genes in autism over

  18. Gene therapy for hemophilia "A" and "B": efficacy, safety and immune consequences.


    Chuah, M; Vandendriessche, T


    The first successful gene therapy trials for the treatment of hereditary disorders underscore the potential of gene therapy to combat disease and alleviate human suffering. The development of gene therapy for hemophilia is not only a research priority in its own right but also serves as an ideal trailblazer for many different diseases. Significant progress has recently been made in the development of gene therapy for the treatment of hemophilia A and B. Long-term therapeutic levels of factor VIII and IX could be expressed following gene therapy in hemophilic mice, stably correcting the bleeding diathesis. These advances parallel the development of improved gene delivery systems. The induction of neutralizing antibodies (inhibitors) to the clotting factors could potentially preclude stable phenotypic correction. The risk of inhibitor formation varied, depending at least in part on the type of vector used and its in vivo tropism. We also demonstrated that the risk of immune responses to the vector particles, the clotting factors and/or transduced cells can be reduced by using vectors that only minimally interact with antigen presenting cells. In hemophilic mice, robust and stable clotting factor expression levels were achieved using adeno-associated viral vectors based on the newly disovered serotypes AAV8 and AAV9 which can efficient deliver the clotting factor genes into hepatocytes without triggering any inflammatory responses or adverse events. Pre-clinical studies in large animal models will be initiated to further validate these improved AAV vectors to ultimately justify a clinical trial in patients with severe hemophilia.

  19. The acute phase response of cod (Gadus morhua L.): expression of immune response genes.


    Audunsdottir, Sigridur S; Magnadottir, Bergljot; Gisladottir, Berglind; Jonsson, Zophonias O; Bragason, Birkir Th


    An acute phase response (APR) was experimentally induced in Atlantic cod (Gadus morhua L.) by intramuscular injection of turpentine oil. The change in the expression of immune related genes was monitored in the anterior kidney and the spleen over a period of 7 days. The genes examined were two types of pentraxins, apolipoprotein A1 (ApoA-I), the complement component C3, interleukin-1β (IL-1β), transferrin, cathelicidin, and hepcidin. All genes were constitutively expressed in both organs and their expression amplified by the turpentine injection. A pattern of response was observed both with respect to the organ preference and to the timing of a maximum response. The increased gene expression of the pentraxins, ApoA-I and C3 was restricted to the anterior kidney, the gene expression of IL-1β, cathelicidin, and transferrin increased in both organs, while hepcidin gene expression was only significantly increased in the spleen. The pentraxins and ApoA-I appear to be early mediators of APR in cod, possibly stimulating C3 and IL-1β response, while the antimicrobial peptides may play a minor role. The increase in transferrin gene expression in both organs, and apparent indifference to cortisol release associated with the turpentine injection, suggests that this could be a typical acute phase protein in cod.

  20. Expression of Immune-Related Genes of Ducks Infected with Avian Pathogenic Escherichia coli (APEC)

    PubMed Central

    Li, Rong; Li, Ning; Zhang, Jinzhou; Wang, Yao; Liu, Jiyuan; Cai, Yumei; Chai, Tongjie; Wei, Liangmeng


    Avian pathogenic Escherichia coli (APEC) can cause severe disease in ducks, characterized by perihepatitis, pericarditis, and airsacculitis. Although the studies of bacteria isolation and methods of detection have been reported, host immune responses to APEC infection remain unclear. In response, we systemically examined the expression of immune-related genes and bacteria distribution in APEC-infected ducks. Results demonstrated that APEC can quickly replicate in the liver, spleen, and brain, with the highest bacteria content at 2 days post infection. The expression of toll-like receptors (TLRs), avian β-defensins (AvBDs) and major histocompatibility complex (MHC) were tested in the liver, spleen, and brain of infected ducks. TLR2, TLR4, TLR5, and TLR15 showed different expression patterns, which indicated that they all responded to APEC infection. The expression of AvBD2 was upregulated in all tested tissues during the 3 days of testing, whereas the expression of AvBD4, AvBD5, AvBD7, and AvBD9 were downregulated, and though MHC-I was upregulated on all test days, MHC-II was dramatically downregulated. Overall, our results suggest that APEC can replicate in various tissues in a short time, and the activation of host immune responses begins at onset of infection. These findings thus clarify duck immune responses to APEC infection and offer insights into its pathogenesis. PMID:27199963

  1. F2 Gel Matrix a Novel Delivery System for Immune and Gene Vaccinations.


    Tuorkey, Muobarak J


    Exploiting the immune system to abolish cancer growth via vaccination is a promising strategy but that is limited by many clinical issues. For DNA vaccines, viral vectors as a delivery system mediate a strong immune response due to their protein structure, which could afflect the cellular uptake of the genetic vector or even induce cytotoxic immune responses against transfected cells. Recently, synthetic DNA delivery systems have been developed and recommended as much easier and simple approaches for DNA delivery compared with viral vectors. These are based on the attraction of the positively charged cationic transfection reagents to negatively charged DNA molecules, which augments the cellular DNA uptake. In fact, there are three major cellular barriers which hinder successful DNA delivery systems: low uptake across the plasma membrane; inadequate release of DNA molecules with limited stability; and lack of nuclear targeting. Recently, a polysaccharide polymer produced by microalgae has been synthesized in a form of polymeric fiber material polyNacetyl glucosamine (pGlcNAc). Due its unique properties, the F2 gel matrix was suggested as an effective delivery system for immune and gene vaccinations.

  2. The heterogeneous immune microenvironment in breast cancer is affected by hypoxia-related genes.


    Duechler, Markus; Peczek, Lukasz; Zuk, Karolina; Zalesna, Izabela; Jeziorski, Arkadiusz; Czyz, Malgorzata


    The immune system constitutes an important first-line defence against malignant transformation. However, cancer mediated immunosuppression inactivates the mechanisms of host immune surveillance. Cancer cells shut down anti-cancer immunity through direct cell-cell interactions with leukocytes and through soluble factors, establishing an immunosuppressive environment for unimpeded cancer growth. The composition of the immunosuppressive microenvironment in breast tumours is not well documented. To address this question, selected immunosuppressive factors were analyzed in tumour specimens from 33 breast cancer patients after surgery. The mRNA expression of selected genes was quantified in fresh tumour samples. Tumour infiltrating leukocytes were characterized by flow cytometry to identify regulatory T cells, myeloid derived suppressor cells, and type 2 macrophages. Statistical analysis revealed several interesting correlations between the studied parameters and clinical features. Overall, a surprisingly high degree of heterogeneity in the composition of the immunosuppressive environment was found across all breast cancer samples which adds to the complexity of this disease. The influence of the hypoxia inducible factors (HIFs) on the immune microenvironment was also addressed. The level of HIFs correlated with hormone receptor status and the expression of several immunosuppressive molecules. Targeting HIFs might not only sensitize breast tumours for radiation and chemotherapies but also interfere with cancer immunosuppression.

  3. Quantitative dynamic imaging of immune cell signalling using lentiviral gene transfer.


    Bagnall, J; Boddington, C; Boyd, J; Brignall, R; Rowe, W; Jones, N A; Schmidt, L; Spiller, D G; White, M R H; Paszek, P


    Live-cell imaging of fluorescent fusion proteins has transformed our understanding of mammalian cell signalling and function. However, some cellular systems such as immune cells are unsuitable or refractory to many existing transgene delivery methods thus limiting systematic analyses. Here, a flexible lentiviral gene transfer platform for dynamic time-lapse imaging has been developed and validated with single-molecule spectroscopy, mathematical modelling and transcriptomics and used for analysis of a set of inflammation-related signalling networks. Time-lapse imaging of nuclear factor kappa B (NF-κB), signal transducer and activator of transcription (STATs) and nuclear factor of activated T-cells (NFAT) in mammalian immune cell lines provided evidence for heterogeneous temporal encoding of inflammatory signals. In particular, the absolute quantification of single-cell responses over time via fluorescent correlation spectroscopy (FCS) showed that NF-κB p65 activation in response to tumour necrosis factor α (TNFα) was differentially encoded in variable amplitude of nuclear translocation between immune and non-immune cells. The absolute number of activated molecules was dictated in part by the cell size, suggesting a morphology-dependent regulatory mechanism. The developed platform will enable further absolute quantitative analyses of the dynamic interactions between signalling networks, in and between individual cells, allowing better integration with mathematical models of signalling networks.

  4. Genetic polymorphisms in host antiviral genes: associations with humoral and cellular immunity to measles vaccine.


    Haralambieva, Iana H; Ovsyannikova, Inna G; Umlauf, Benjamin J; Vierkant, Robert A; Shane Pankratz, V; Jacobson, Robert M; Poland, Gregory A


    Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella (MMR) vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction for FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and

  5. Gene expression based evidence of innate immune response activation in the epithelium with oral lichen planus

    PubMed Central

    Adami, Guy R.; Yeung, Alexander C.F.; Stucki, Grant; Kolokythas, Antonia; Sroussi, Herve Y.; Cabay, Robert J.; Kuzin, Igor; Schwartz, Joel L.


    Objective Oral lichen planus (OLP) is a disease of the oral mucosa of unknown cause producing lesions with an intense band-like inflammatory infiltrate of T cells to the subepithelium and keratinocyte cell death. We performed gene expression analysis of the oral epithelium of lesions in subjects with OLP and its sister disease, oral lichenoid reaction (OLR), in order to better understand the role of the keratinocytes in these diseases. Design Fourteen patients with OLP or OLR were included in the study, along with a control group of 23 subjects with a variety of oral diseases and a normal group of 17 subjects with no clinically visible mucosal abnormalities. Various proteins have been associated with OLP, based on detection of secreted proteins or changes in RNA levels in tissue samples consisting of epithelium, stroma, and immune cells. The mRNA level of twelve of these genes expressed in the epithelium was tested in the three groups. Results Four genes showed increased expression in the epithelium of OLP patients: CD14, CXCL1, IL8, and TLR1, and at least two of these proteins, TLR1 and CXCL1, were expressed at substantial levels in oral keratinocytes. Conclusions Because of the large accumulation of T cells in lesions of OLP it has long been thought to be an adaptive immunity malfunction. We provide evidence that there is increased expression of innate immune genes in the epithelium with this illness, suggesting a role for this process in the disease and a possible target for treatment. PMID:24581860

  6. Evolution of a Novel Antiviral Immune-Signaling Interaction by Partial-Gene Duplication

    PubMed Central

    Korithoski, Bryan; Kolaczkowski, Oralia; Mukherjee, Krishanu; Kola, Reema; Earl, Chandra; Kolaczkowski, Bryan


    The RIG-like receptors (RLRs) are related proteins that identify viral RNA in the cytoplasm and activate cellular immune responses, primarily through direct protein-protein interactions with the signal transducer, IPS1. Although it has been well established that the RLRs, RIG-I and MDA5, activate IPS1 through binding between the twin caspase activation and recruitment domains (CARDs) on the RLR and a homologous CARD on IPS1, it is less clear which specific RLR CARD(s) are required for this interaction, and almost nothing is known about how the RLR-IPS1 interaction evolved. In contrast to what has been observed in the presence of immune-modulating K63-linked polyubiquitin, here we show that—in the absence of ubiquitin—it is the first CARD domain of human RIG-I and MDA5 (CARD1) that binds directly to IPS1 CARD, and not the second (CARD2). Although the RLRs originated in the earliest animals, both the IPS1 gene and the twin-CARD domain architecture of RIG-I and MDA5 arose much later in the deuterostome lineage, probably through a series of tandem partial-gene duplication events facilitated by tight clustering of RLRs and IPS1 in the ancestral deuterostome genome. Functional differentiation of RIG-I CARD1 and CARD2 appears to have occurred early during this proliferation of RLR and related CARDs, potentially driven by adaptive coevolution between RIG-I CARD domains and IPS1 CARD. However, functional differentiation of MDA5 CARD1 and CARD2 occurred later. These results fit a general model in which duplications of protein-protein interaction domains into novel gene contexts could facilitate the expansion of signaling networks and suggest a potentially important role for functionally-linked gene clusters in generating novel immune-signaling pathways. PMID:26356745

  7. A long noncoding RNA induced by TLRs mediates both activation and repression of immune response genes

    PubMed Central

    Carpenter, Susan; Atianand, Maninjay; Aiello, Daniel; Ricci, Emiliano; Gandhi, Pallavi; Hall, Lisa L.; Byron, Meg; Monks, Brian; Henry-Bezy, Meabh; O’Neill, Luke A.J; Lawrence, Jeanne B.; Moore, Melissa J.; Caffrey, Daniel R.; Fitzgerald, Katherine A.


    An inducible program of inflammatory gene expression is central to anti-microbial defenses. Signal-dependent activation of transcription factors, transcriptional co-regulators and chromatin modifying factors collaborate to control this response. Here we identify a long noncoding RNA that acts as a key regulator of this inflammatory response. Germline-encoded receptors such as the Toll-like receptors induce the expression of numerous lncRNAs. One of these, lincRNA-Cox2 mediates both the activation and repression of distinct classes of immune genes. Transcriptional repression of target genes is dependent on interactions of lincRNA-Cox2 with heterogeneous nuclear ribonucleoprotein A/B and A2/B1. Collectively, these studies unveil a central role of lincRNA-Cox2 as a broad acting regulatory component of the circuit that controls the inflammatory response. PMID:23907535

  8. The effects of dietary Immunogen on innate immune response, immune related genes expression and disease resistance of rainbow trout (Oncorhynchus mykiss).


    Yar Ahmadi, Peyman; Farahmand, Hamid; Kolangi Miandare, Hamed; Mirvaghefi, Alireza; Hoseinifar, Seyed Hossein


    This study investigates the effects of prebiotic Immunogen on lysozyme, TNFα and HSP70 gene expression in head kidney, humoral innate immune parameters and resistant to Aeromonas hydrophila of rainbow trout. 120 healthy rainbow trout (81.65 ± 1.49 g) were distributed in six fiberglass tanks assigned to two groups fed control or diet supplemented with 2 g kg(-1) Immunogen for 45 days. The results revealed that administration of Immunogen significantly (P < 0.05) up regulated lysozyme and TNFα gene expression. HSP70 gene expression was significantly (P < 0.05) lower in Immunogen fed fish at the end of trial. Humoral innate immune parameters (lysozyme activity, ACH50 and bactericidal activity) were significantly (P < 0.05) increased whether 15 or 45 days after feeding on Immunogen supplemented diet. However, significant (P < 0.05) increase in agglutination antibody titer observed just after 45 days feeding on Immunogen. Rainbow trout fed with 2 g kg(-1) Immunogen showed remarkably higher resistance against A. hydrophila (64.44% survival) compared to the control group (24.44% survival). These results confirm that Immunogen can up regulates immune related genes expression, stimulates immune response that per se enhances disease resistance in rainbow trout. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Inactivation of conserved genes induces microbial aversion, drug detoxification, and innate immunity in C.elegans

    PubMed Central

    Melo, Justine A.; Ruvkun, Gary


    Summary The nematode C. elegans consumes benign bacteria such as E. coli and is repelled by pathogens and toxins. Here we show that RNAi and toxin-mediated disruption of core cellular activities, including translation, respiration, and protein turnover, stimulates behavioral avoidance of attractive E. coli. RNAi of such essential processes also induces expression of detoxification and innate immune response genes in the absence of toxins or pathogens. Disruption of core processes in non-neuronal tissues can stimulate aversion behavior, revealing a neuroendocrine axis of control. Microbial avoidance requires serotonergic and Jnk kinase signaling. We propose that surveillance pathways oversee critical cellular activities to detect pathogens, many of which deploy toxins and virulence factors to disrupt these same host pathways. Variation in cellular surveillance and endocrine pathways controlling behavior, detoxification and immunity selected by past toxin or microbial interactions could underlie aberrant responses to foods, medicines, and microbes. PMID:22500807

  10. Estrogen regulation of gene expression in the teleost fish immune system.


    Burgos-Aceves, Mario Alberto; Cohen, Amit; Smith, Yoav; Faggio, Caterina


    Elucidating the mechanisms of estrogens-induced immunomodulation in teleost fish is of great importance due to the observed worldwide continuing decrease in pristine environments. However, little is know about the immunotoxicological consequences of exposure to these chemicals in fish, or of the mechanisms through which these effects are mediated. In this review, we summarize the results showing estrogens (natural or synthetic) acting through estrogen receptors and regulating specific target genes, also through microRNAs (miRNAs), leading to modulation of the immune functioning. The identification and characterization of miRNAs will provide new opportunities for functional genome research on teleost immune system and can also be useful when screening for novel molecule biomarkers for environmental pollution.

  11. The Associations between Immunity-Related Genes and Breast Cancer Prognosis in Korean Women

    PubMed Central

    Choi, Jaesung; Song, Nan; Han, Sohee; Chung, Seokang; Sung, Hyuna; Lee, Ji-young; Jung, Sunjae; Park, Sue K.; Yoo, Keun-Young; Han, Wonshik; Lee, Jong Won; Noh, Dong-Young; Kang, Daehee; Choi, Ji-Yeob


    We investigated the role of common genetic variation in immune-related genes on breast cancer disease-free survival (DFS) in Korean women. 107 breast cancer patients of the Seoul Breast Cancer Study (SEBCS) were selected for this study. A total of 2,432 tag single nucleotide polymorphisms (SNPs) in 283 immune-related genes were genotyped with the GoldenGate Oligonucleotide pool assay (OPA). A multivariate Cox-proportional hazard model and polygenic risk score model were used to estimate the effects of SNPs on breast cancer prognosis. Harrell’s C index was calculated to estimate the predictive accuracy of polygenic risk score model. Subsequently, an extended gene set enrichment analysis (GSEA-SNP) was conducted to approximate the biological pathway. In addition, to confirm our results with current evidence, previous studies were systematically reviewed. Sixty-two SNPs were statistically significant at p-value less than 0.05. The most significant SNPs were rs1952438 in SOCS4 gene (hazard ratio (HR) = 11.99, 95% CI = 3.62–39.72, P = 4.84E-05), rs2289278 in TSLP gene (HR = 4.25, 95% CI = 2.10–8.62, P = 5.99E-05) and rs2074724 in HGF gene (HR = 4.63, 95% CI = 2.18–9.87, P = 7.04E-05). In the polygenic risk score model, the HR of women in the 3rd tertile was 6.78 (95% CI = 1.48–31.06) compared to patients in the 1st tertile of polygenic risk score. Harrell’s C index was 0.813 with total patients and 0.924 in 4-fold cross validation. In the pathway analysis, 18 pathways were significantly associated with breast cancer prognosis (P<0.1). The IL-6R, IL-8, IL-10RB, IL-12A, and IL-12B was associated with the prognosis of cancer in data of both our study and a previous study. Therefore, our results suggest that genetic polymorphisms in immune-related genes have relevance to breast cancer prognosis among Korean women. PMID:25075970

  12. Differentially expressed immune-related genes in hemocytes of the pearl oyster Pinctada fucata against allograft identified by transcriptome analysis.


    Wei, Jinfen; Liu, Baosuo; Fan, Sigang; Li, Haimei; Chen, Mingqiang; Zhang, Bo; Su, Jiaqi; Meng, Zihao; Yu, Dahui


    The pearl oyster Pinctada fucata is commonly cultured for marine pearls in China. To culture pearls, a mantle piece from a donor pearl oyster is grafted with a nucleus into a receptor. This transplanted mantle piece may be rejected by the immune system of the recipient oyster, thus reducing the success of transplantation. However, there have been limited studies about the oyster's immune defense against allograft. In this study, hemocyte transcriptome analysis was performed to detect the immune responses to allograft in P. fucata at 0 h and 48 h after a transplant. The sequencing reaction produced 92.5 million reads that were mapped against the reference genome sequences of P. fucata. The Gene Ontology (GO) annotation and the Kyoto Encyclopedia of Genes and Genomes (KEGG) were used to identify all immune-related differentially expressed genes (DEGs). Compared with patterns at 0 h, a total of 798 DEGs were identified, including 410 up-regulated and 388 down-regulated genes at 48 h. The expression levels of interleukin receptor and toll-like receptor in hemocytes were increased significantly 48 h post-transplant, indicating that the oyster immune response was induced. Finally, altered levels of 18 randomly selected immune-related DEGs were confirmed by quantitative real-time PCR (qRT-PCR). Our results provide the basis for further analysis of the immune rejection of allotransplantation.

  13. Effects of excretory/secretory products from Anisakis simplex (Nematoda) on immune gene expression in rainbow trout (Oncorhynchus mykiss).


    Bahlool, Qusay Z M; Skovgaard, Alf; Kania, Per W; Buchmann, Kurt


    Excretory/secretory (ES) products are molecules produced by parasitic nematodes, including larval Anisakis simplex, a parasite occurring in numerous marine fish hosts. The effects of these substances on host physiology have not been fully described. The present work elucidates the influence of ES substances on the fish immune system by measuring immune gene expression in spleen and liver of rainbow trout (Oncorhynchus mykiss) injected intraperitoneally with ES products isolated from A. simplex third stage larvae. The overall gene expression profile of exposed fish showed a generalized down-regulation of the immune genes tested, suggesting a role of ES proteins in immunomodulation. We also tested the enzymatic activity of the ES proteins and found that lipase, esterase/lipase, valine and cysteine arylamidases, naphthol-AS-BI-phosphohydrolase and α-galactosidase activities were present in the ES solution. This type of hydrolytic enzyme activity may play a role in nematode penetration of host tissue. In addition, based on the notion that A. simplex ES products may have an immune-depressive effect (by minimizing immune gene expression) it could also be suggested that worm enzymes directly target host immune molecules which would add to a decreased host immune response and increased worm survival. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Exomic sequencing of immune-related genes reveals novel candidate variants associated with alopecia universalis.


    Lee, Seungbok; Paik, Seung Hwan; Kim, Hyun-Jin; Ryu, Hyeong Ho; Cha, Soeun; Jo, Seong Jin; Eun, Hee Chul; Seo, Jeong-Sun; Kim, Jong-Il; Kwon, Oh Sang


    Alopecia areata (AA) is a common autoimmune disorder mostly presented as round patches of hair loss and subclassified into alopecia totalis/alopecia universalis (AT/AU) based on the area of alopecia. Although AA is relatively common, only 5% of AA patients progress to AT/AU, which affect the whole scalp and whole body respectively. To determine genetic determinants of this orphan disease, we undertook whole-exome sequencing of 6 samples from AU patients, and 26 variants in immune-related genes were selected as candidates. When an additional 14 AU samples were genotyped for these candidates, 6 of them remained at the level of significance in comparison with 155 Asian controls (p<1.92×10(-3)). Linkage disequilibrium was observed between some of the most significant SNPs, including rs41559420 of HLA-DRB5 (p<0.001, OR 44.57) and rs28362679 of BTNL2 (p<0.001, OR 30.21). While BTNL2 was reported as a general susceptibility gene of AA previously, HLA-DRB5 has not been implicated in AA. In addition, we found several genetic variants in novel genes (HLA-DMB, TLR1, and PMS2) and discovered an additional locus on HLA-A, a known susceptibility gene of AA. This study provides further evidence for the association of previously reported genes with AA and novel findings such as HLA-DRB5, which might represent a hidden culprit gene for AU.

  15. Ontology based molecular signatures for immune cell types via gene expression analysis.


    Meehan, Terrence F; Vasilevsky, Nicole A; Mungall, Christopher J; Dougall, David S; Haendel, Melissa A; Blake, Judith A; Diehl, Alexander D


    New technologies are focusing on characterizing cell types to better understand their heterogeneity. With large volumes of cellular data being generated, innovative methods are needed to structure the resulting data analyses. Here, we describe an 'Ontologically BAsed Molecular Signature' (OBAMS) method that identifies novel cellular biomarkers and infers biological functions as characteristics of particular cell types. This method finds molecular signatures for immune cell types based on mapping biological samples to the Cell Ontology (CL) and navigating the space of all possible pairwise comparisons between cell types to find genes whose expression is core to a particular cell type's identity. We illustrate this ontological approach by evaluating expression data available from the Immunological Genome project (IGP) to identify unique biomarkers of mature B cell subtypes. We find that using OBAMS, candidate biomarkers can be identified at every strata of cellular identity from broad classifications to very granular. Furthermore, we show that Gene Ontology can be used to cluster cell types by shared biological processes in order to find candidate genes responsible for somatic hypermutation in germinal center B cells. Moreover, through in silico experiments based on this approach, we have identified genes sets that represent genes overexpressed in germinal center B cells and identify genes uniquely expressed in these B cells compared to other B cell types. This work demonstrates the utility of incorporating structured ontological knowledge into biological data analysis - providing a new method for defining novel biomarkers and providing an opportunity for new biological insights.

  16. Is There a Relationship Between CXCR4 Gene Expression and Prognosis of Immune Thrombocytopenia in Children?


    Saeidi, Sajedeh; Mohammadi-Asl, Javad; Far, Mohammad Ali Jalali; Asnafi, Ali Amin; Dehuri, Firouzeh; Tavakolifar, Yousef; Saki, Najmaldin


    Immune thrombocytopenia (ITP) is a common autoimmune disorder characterized by decreased platelet count (thrombocytopenia) and bleeding symptoms due to production of autoantibodies against platelets. Chemokines are molecules inducing chemotaxis and play an important role in megakaryopoiesis, including CXCR4 chemokine receptor. CXCR4 is expressed on cells of megakaryocytic series, especially platelets, and triggers several mechanisms in these cells. The purpose of this study was to evaluate the pattern of CXCR4 gene changes upon diagnosis and after treatment and its comparison with laboratory findings in peripheral blood samples from newly diagnosed ITP patients. 35 newly diagnosed patients with ITP and 35 healthy controls were enrolled in this study. CXCR4 gene expression was investigated before and after treatment using real-time PCR. HPRT gene was used as the reference gene to calculate the expression rate of CXCR4 as CXCR4/HPRT ratio. CXCR4 gene expression upon diagnosis and after treatment in peripheral blood plasma of ITP patients showed a significant decrease in comparison with the control group while its expression did not change before and after treatment. No significant correlation was found between the expression of this gene and laboratory parameters. Due to unpredictable course of ITP in patients and the possibility of its progress to refractory form, accurate choice of a biomarker is essential for evaluating prognosis and detection of resistant forms.

  17. The Equine Embryo Influences Immune-Related Gene Expression in the Oviduct.


    Smits, Katrien; De Coninck, Dieter I M; Van Nieuwerburgh, Filip; Govaere, Jan; Van Poucke, Mario; Peelman, Luc; Deforce, Dieter; Van Soom, Ann


    Although the equine oviduct clearly affects early embryo development and the selective transport of equine embryos through the oviduct indicates a reciprocal interaction, the influence of the embryo on gene expression in the oviduct remains to be determined in the horse. The aim of this study was to examine this by means of RNA sequencing. Four days after ovulation, epithelial cells ipsilateral and contralateral to the ovulation side from five cyclic and five pregnant mares were collected from the oviduct. RNA was extracted, samples were sequenced, and data analysis was performed to determine differentially expressed genes (DEGs) (P value ≤0.05 and absolute fold change ≥2) and to provide functional interpretation. A total of 10 743 transcripts were identified and 253 genes were found to be upregulated and 108 to be downregulated in the pregnant ipsilateral oviduct when compared to the cyclic ipsilateral oviduct. Comparison of the ipsilateral and the contralateral oviduct indicated 164 DEGs in pregnant mares and 77 DEGs in cyclic mares. Enriched functional categories were detected only in the comparison of pregnant and cyclic ipsilateral oviducts and showed that the equine embryo affects the expression of immune response-related genes in the oviduct, with marked upregulation of interferon-associated genes. This research represents the foundation for further assessment of the role of specific genes in the early embryo-maternal dialogue of the horse. © 2016 by the Society for the Study of Reproduction, Inc.

  18. Social environment is associated with gene regulatory variation in the rhesus macaque immune system.


    Tung, Jenny; Barreiro, Luis B; Johnson, Zachary P; Hansen, Kasper D; Michopoulos, Vasiliki; Toufexis, Donna; Michelini, Katelyn; Wilson, Mark E; Gilad, Yoav


    Variation in the social environment is a fundamental component of many vertebrate societies. In humans and other primates, adverse social environments often translate into lasting physiological costs. The biological mechanisms associated with these effects are therefore of great interest, both for understanding the evolutionary impacts of social behavior and in the context of human health. However, large gaps remain in our understanding of the mechanisms that mediate these effects at the molecular level. Here we addressed these questions by leveraging the power of an experimental system that consisted of 10 social groups of female macaques, in which each individual's social status (i.e., dominance rank) could be experimentally controlled. Using this paradigm, we show that dominance rank results in a widespread, yet plastic, imprint on gene regulation, such that peripheral blood mononuclear cell gene expression data alone predict social status with 80% accuracy. We investigated the mechanistic basis of these effects using cell type-specific gene expression profiling and glucocorticoid resistance assays, which together contributed to rank effects on gene expression levels for 694 (70%) of the 987 rank-related genes. We also explored the possible contribution of DNA methylation levels to these effects, and identified global associations between dominance rank and methylation profiles that suggest epigenetic flexibility in response to status-related behavioral cues. Together, these results illuminate the importance of the molecular response to social conditions, particularly in the immune system, and demonstrate a key role for gene regulation in linking the social environment to individual physiology.

  19. Immune and inflammatory gene signature in rat cerebrum in subarachnoid hemorrhage with microarray analysis.


    Lee, Chu-I; Chou, An-Kuo; Lin, Ching-Chih; Chou, Chia-Hua; Loh, Joon-Khim; Lieu, Ann-Shung; Wang, Chih-Jen; Huang, Chi-Ying F; Howng, Shen-Long; Hong, Yi-Ren


    Cerebral vasospasm following subarachnoid hemorrhage (SAH) has been studied in terms of a contraction of the major cerebral arteries, but the effect of cerebrum tissue in SAH is not yet well understood. To gain insight into the biology of SAH-expressing cerebrum, we employed oligonucleotide microarrays to characterize the gene expression profiles of cerebrum tissue at the early stage of SAH. Functional gene expression in the cerebrum was analyzed 2 h following stage 1-hemorrhage in Sprague-Dawley rats. mRNA was investigated by performing microarray and quantitative real-time PCR analyses, and protein expression was determined by Western blot analysis. In this study, 18 upregulated and 18 downregulated genes displayed at least a 1.5-fold change. Five genes were verified by real-time PCR, including three upregulated genes [prostaglandin E synthase (PGES), CD14 antigen, and tissue inhibitor of metalloproteinase 1 (TIMP1)] as well as two downregulated genes [KRAB-zinc finger protein-2 (KZF-2) and γ-aminobutyric acid B receptor 1 (GABA B receptor)]. Notably, there were functional implications for the three upregulated genes involved in the inflammatory SAH process. However, the mechanisms leading to decreased KZF-2 and GABA B receptor expression in SAH have never been characterized. We conclude that oligonucleotide microarrays have the potential for use as a method to identify candidate genes associated with SAH and to provide novel investigational targets, including genes involved in the immune and inflammatory response. Furthermore, understanding the regulation of MMP9/TIMP1 during the early stages of SAH may elucidate the pathophysiological mechanisms in SAH rats.

  20. Local gene expression and immune responses of vaginal DNA vaccination using a needle-free injector.


    Kanazawa, Takanori; Takashima, Yuuki; Tamura, Toshiaki; Tsuchiya, Miki; Shibata, Yasunori; Udagawa, Haruhide; Okada, Hiroaki


    The vaginal mucosa is the most common site of initiation of virus infections that are transmitted through heterosexual intercourse, including HIV and papillomavirus. Thus, in order to prevent or treat these infections, strong vaginal immunity is required as the first line of defense. In this study, to establish a less invasive, safe, convenient and effective immunization method, we examined the local (skin and vagina) gene transfection efficiency of a non-needle jet injector for daily insulin injection. In the skin experiment, the needle-free injector resulted in a marked increase in marker gene expression, compared to the conventional needle-syringe injection. In addition, intradermal DNA vaccination using the needle-free injector dramatically induced IFN-gamma and antibody systemic responses in mice. Furthermore, we investigated the applicability of the needle-free injector as a vaginal vaccination tool in rabbits. Vaginal gene expression using the needle-free injector was significantly greater than that using needle-syringe injection. Moreover, intravaginal vaccination by the needle-free injector promoted vaginal IgA secretion and IFN-gamma mRNA expression in the blood lymphocytes, to a degree significantly higher than that by needle-syringe injection. In conclusion, local vaginal DNA vaccination using a needle-free jet injector is a promising approach for the prevention and treatment of mucosal infectious diseases.

  1. Altered miRNAs expression profiles and modulation of immune response genes and proteins during neonatal sepsis.


    Chen, Jiande; Jiang, Siyuan; Cao, Yun; Yang, Yi


    The dysregulated expression of miRNAs in the immune system may be critical for immune responses to pathogens and evolve into the inflammation seen in sepsis. The aim of this study is to explore the important role of miRNAs in the regulation of the immune response during neonatal sepsis. Using a microarray we performed the miRNA expression profiling of peripheral blood leukocytes from neonates with sepsis and uninfected neonates. Based on the predicted target genes of these miRNAs we selected 26 immune-related miRNAs out of the differentially expressed miRNAs for further testing by quantitative PCR. We simultaneously detected the immune response genes by PCR array and plasma cytokine levels using a protein chip to investigate the effect of the altered miRNAs on the immune response in neonatal sepsis. There were 10 immune regulatory miRNAs whose expression was significantly changed more than two fold in the neonates with sepsis compared with the uninfected neonates. The expression levels of 11 immune response genes and the plasma levels of 15 cytokines or receptors were significantly up- or down-regulated in the neonates with sepsis compared to the uninfected neonates. This comprehensive analysis suggests that the altered miRNAs modulate the immune response during neonatal sepsis in a way that represses the inflammatory response. Our investigation demonstrated some miRNAs with altered expression levels and their probable association with the regulation of immune response during neonatal sepsis. The characteristics of the neonatal inflammatory response could be attributed to immature immune function of neonates.

  2. Expression of immune genes in systemic and mucosal immune tissues of channel catfish vaccinated with live theronts of Ichthyophthirius multifiliis

    USDA-ARS?s Scientific Manuscript database

    Ichthyophthiriasis caused by Ichthyophthirius multifiliis (Ich) has a worldwide distribution and affects almost all species of freshwater fishes. Fish surviving natural infection and/or immunized with Ich develop strong innate and adaptive immune responses. However, there is a lack of the knowledge ...

  3. Immune response in mice and cattle after immunization with a Boophilus microplus DNA vaccine containing bm86 gene.


    Ruiz, Lina María; Orduz, Sergio; López, Elkin D; Guzmán, Fanny; Patarroyo, Manuel E; Armengol, Gemma


    Plasmid pBMC2 encoding antigen Bm86 from a Colombian strain of cattle tick Boophilus microplus, was used for DNA-mediated immunization of BALB/c mice, employing doses of 10 and 50microg, delivered by intradermic and intramuscular routes. Anti-Bm86 antibody levels were significantly higher compared to control mice treated with PBS. In the evaluation of immunoglobulin isotypes, significant levels of IgG2a and IgG2b were observed in mice immunized with 50microg of pBMC2. Measurement of interleukine (IL) levels (IL-4, IL-5, IL-12(p40)) and interferon-gamma (IFN-gamma) in the sera of mice immunized with pBMC2 indicated high levels of IL-4 and IL-5, although there were also significant levels of IFN-gamma. Mice immunized with pBMC2 showed antigen-specific stimulation of splenocytes according to the incorporation of bromodeoxyuridine and IFN-gamma secretion. In all trials, mice injected intramuscularly with 50microg of pBMC2 presented the highest immune response. Moreover, cattle immunized with this DNA vaccine showed antibody production significantly different to the negative control. In conclusion, these results suggest the potential of DNA immunization with pBMC2 to induce humoral and cellular immune responses against B. microplus.

  4. Wolbachia Stimulates Immune Gene Expression and Inhibits Plasmodium Development in Anopheles gambiae

    PubMed Central

    Kambris, Zakaria; Blagborough, Andrew M.; Pinto, Sofia B.; Blagrove, Marcus S. C.; Godfray, H. Charles J.; Sinden, Robert E.; Sinkins, Steven P.


    The over-replicating wMelPop strain of the endosymbiont Wolbachia pipientis has recently been shown to be capable of inducing immune upregulation and inhibition of pathogen transmission in Aedes aegypti mosquitoes. In order to examine whether comparable effects would be seen in the malaria vector Anopheles gambiae, transient somatic infections of wMelPop were created by intrathoracic inoculation. Upregulation of six selected immune genes was observed compared to controls, at least two of which (LRIM1 and TEP1) influence the development of malaria parasites. A stably infected An. gambiae cell line also showed increased expression of malaria-related immune genes. Highly significant reductions in Plasmodium infection intensity were observed in the wMelPop-infected cohort, and using gene knockdown, evidence for the role of TEP1 in this phenotype was obtained. Comparing the levels of upregulation in somatic and stably inherited wMelPop infections in Ae. aegypti revealed that levels of upregulation were lower in the somatic infections than in the stably transinfected line; inhibition of development of Brugia filarial nematodes was nevertheless observed in the somatic wMelPop infected females. Thus we consider that the effects observed in An. gambiae are also likely to be more pronounced if stably inherited wMelPop transinfections can be created, and that somatic infections of Wolbachia provide a useful model for examining effects on pathogen development or dissemination. The data are discussed with respect to the comparative effects on malaria vectorial capacity of life shortening and direct inhibition of Plasmodium development that can be produced by Wolbachia. PMID:20949079

  5. The PLA2 gene mediates the humoral immune responses in Bactrocera dorsalis (Hendel).


    Li, Qiujia; Dong, Xiaolong; Zheng, Weiwei; Zhang, Hongyu


    The phospholipase A2 (PLA2) gene encodes the enzyme that catalyzes the hydrolysis of phospholipids (PLs) from the sn-2 position. However, little is known about its role in humoral immune responses. In this study, we investigated the expression profile of PLA2 in different tissues and developmental stages in Bactrocera dorsalis (Hendel), and the results showed that the transcriptional level of PLA2 was high in the egg and mature stage and in the testis tissue. Bacterial infection increased the expression of PLA2, and the highest degree of up-regulation appeared in the fat body. Silencing PLA2 influenced the expression of immune-related genes, including MyD88 and defensin in the Toll pathway and relish and diptericin in the Imd pathway. Moreover, the expression of MyD88 and defensin was down-regulated significantly in the ds-PLA2 group compared with those in the ds-egfp group when B. dorsalis was infected with L. monocytogenes and S. aureus, indicating that PLA2 was involved in the activation of the Toll pathway. Meanwhile, infection with L. monocytogenes and E. coli, which activate the Imd pathway, does not increase the mRNA levels of relish and diptericin in the ds-PLA2 group as severely as it increases those in the ds-egfp group, indicating that the Imd pathway was also repressed after silencing PLA2. Notably, the development of lipid droplets in fat body cells was influenced by silencing PLA2, implying that PLA2 affects the function of fat body tissue. These results suggest that the PLA2 gene may mediate humoral immune responses by reducing lipid storage in fat body cells in B. dorsalis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Developmental alterations in CNS stress-related gene expression following postnatal immune activation.


    Amath, A; Foster, J A; Sidor, M M


    Early-life adversity is associated with dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis and increased susceptibility to later-life psychopathology. Specifically, there is mounting evidence suggesting that the immune system plays an important role in central nervous system (CNS) development and in the programing of behavior. The current study investigated how early-life immune challenge affects the development of CNS stress neurocircuitry by examining the gene expression profile of corticotropin-releasing hormone (CRH), CRH receptors, and the major corticosteroid receptors within the limbic-hypothalamic circuit of the developing rodent brain. Mice were administered a 0.05 mg/kg lipopolysaccharide (LPS) injection on postnatal day (P) 3 and 5 and gene expression was assessed using in situ hybridization from P14 to P28. Target genes investigated were CRH, CRH receptor-1 (CRHR1), CRH receptor-2, the mineralocorticoid receptor, and the glucocorticoid receptor (GR). Early LPS challenge resulted in a transient decrease in CRHR1 mRNA expression in the cornuammonis 1 (CA1) and CA3 regions of the hippocampus that were accompanied by increased hippocampal GR mRNA expression in the CA1 region between P14 and P21. This was followed by increased hypothalamic CRH expression in LPS-mice on P28. Our current findings suggest that early-life LPS challenge impacts the developmental trajectory of CNS stress neurocircuitry. These results lend insight into the molecular basis for the later development of stress-related behaviors as previously described in early immune challenge rodents.

  7. Trans-species polymorphism at antimicrobial innate immunity cathelicidin genes of Atlantic cod and related species

    PubMed Central

    Árnason, Einar


    Natural selection, the most important force in evolution, comes in three forms. Negative purifying selection removes deleterious variation and maintains adaptations. Positive directional selection fixes beneficial variants, producing new adaptations. Balancing selection maintains variation in a population. Important mechanisms of balancing selection include heterozygote advantage, frequency-dependent advantage of rarity, and local and fluctuating episodic selection. A rare pathogen gains an advantage because host defenses are predominantly effective against prevalent types. Similarly, a rare immune variant gives its host an advantage because the prevalent pathogens cannot escape the host’s apostatic defense. Due to the stochastic nature of evolution, neutral variation may accumulate on genealogical branches, but trans-species polymorphisms are rare under neutrality and are strong evidence for balancing selection. Balanced polymorphism maintains diversity at the major histocompatibility complex (MHC) in vertebrates. The Atlantic cod is missing genes for both MHC-II and CD4, vital parts of the adaptive immune system. Nevertheless, cod are healthy in their ecological niche, maintaining large populations that support major commercial fisheries. Innate immunity is of interest from an evolutionary perspective, particularly in taxa lacking adaptive immunity. Here, we analyze extensive amino acid and nucleotide polymorphisms of the cathelicidin gene family in Atlantic cod and closely related taxa. There are three major clusters, Cath1, Cath2, and Cath3, that we consider to be paralogous genes. There is extensive nucleotide and amino acid allelic variation between and within clusters. The major feature of the results is that the variation clusters by alleles and not by species in phylogenetic trees and discriminant analysis of principal components. Variation within the three groups shows trans-species polymorphism that is older than speciation and that is suggestive of

  8. A database for the analysis of immunity genes in Drosophila: PADMA database.


    Lee, Mark J; Mondal, Ariful; Small, Chiyedza; Paddibhatla, Indira; Kawaguchi, Akira; Govind, Shubha


    While microarray experiments generate voluminous data, discerning trends that support an existing or alternative paradigm is challenging. To synergize hypothesis building and testing, we designed the Pathogen Associated Drosophila MicroArray (PADMA) database for easy retrieval and comparison of microarray results from immunity-related experiments ( PADMA also allows biologists to upload their microarray-results and compare it with datasets housed within PADMA. We tested PADMA using a preliminary dataset from Ganaspis xanthopoda-infected fly larvae, and uncovered unexpected trends in gene expression, reshaping our hypothesis. Thus, the PADMA database will be a useful resource to fly researchers to evaluate, revise, and refine hypotheses.

  9. Zebra Fish Lacking Adaptive Immunity Acquire an Antiviral Alert State Characterized by Upregulated Gene Expression of Apoptosis, Multigene Families, and Interferon-Related Genes.


    García-Valtanen, Pablo; Martínez-López, Alicia; López-Muñoz, Azucena; Bello-Perez, Melissa; Medina-Gali, Regla M; Ortega-Villaizán, María Del Mar; Varela, Monica; Figueras, Antonio; Mulero, Víctoriano; Novoa, Beatriz; Estepa, Amparo; Coll, Julio


    To investigate fish innate immunity, we have conducted organ and cell immune-related transcriptomic as well as immunohistologic analysis in mutant zebra fish (Danio rerio) lacking adaptive immunity (rag1(-/-)) at different developmental stages (egg, larvae, and adult), before and after infection with spring viremia carp virus (SVCV). The results revealed that, compared to immunocompetent zebra fish (rag1(+/+) ), rag1(-/-) acquired increased resistance to SVCV with age, correlating with elevated transcript levels of immune genes in skin/fins and lymphoid organs (head kidney and spleen). Gene sets corresponding to apoptotic functions, immune-related multigene families, and interferon-related genes were constitutively upregulated in uninfected adult rag1(-/-) zebra fish. Overexpression of activated CASPASE-3 in different tissues before and after infection with SVCV further confirmed increased apoptotic function in rag1(-/-) zebra fish. Concurrently, staining of different tissue samples with a pan-leukocyte antibody marker showed abundant leukocyte infiltrations in SVCV-infected rag1(-/-) fish, coinciding with increased transcript expression of genes related to NK-cells and macrophages, suggesting that these genes played a key role in the enhanced immune response of rag1(-/-) zebra fish to SVCV lethal infection. Overall, we present evidence that indicates that rag1(-/-) zebra fish acquire an antiviral alert state while they reach adulthood in the absence of adaptive immunity. This antiviral state was characterized by (i) a more rapid response to viral infection, which resulted in increased survival, (ii) the involvement of NK-cell- and macrophage-mediated transcript responses rather than B- and/or T-cell dependent cells, and (iii) enhanced apoptosis, described here for the first time, as well as the similar modulation of multigene family/interferon-related genes previously associated to fish that survived lethal viral infections. From this and other studies, it might

  10. HER2/neu DNA vaccination by intradermal gene delivery in a mouse tumor model: Gene gun is superior to jet injector in inducing CTL responses and protective immunity.


    Nguyen-Hoai, Tam; Kobelt, Dennis; Hohn, Oliver; Vu, Minh D; Schlag, Peter M; Dörken, Bernd; Norley, Steven; Lipp, Martin; Walther, Wolfgang; Pezzutto, Antonio; Westermann, Jörg


    DNA vaccines are potential tools for the induction of immune responses against both infectious disease and cancer. The dermal application of DNA vaccines is of particular interest since the epidermal and dermal layers of the skin are characterized by an abundance of antigen-presenting cells (APCs). The aim of our study was to compare tumor protection as obtained by two different methods of intradermal DNA delivery (gene gun and jet injector) in a well-established HER2/neu mouse tumor model. BALB/c mice were immunized twice with a HER2/neu-coding plasmid by gene gun or jet injector. Mice were then subcutaneously challenged with HER2/neu(+) syngeneic D2F2/E2 tumor cells. Protection against subsequent challenges with tumor cells as well as humoral and T-cell immune responses induced by the vaccine were monitored. Gene gun immunization was far superior to jet injector both in terms of tumor protection and induction of HER2/neu-specific immune responses. After gene gun immunization, 60% of the mice remained tumor-free until day 140 as compared with 25% after jet injector immunization. Furthermore, gene gun vaccination was able to induce both a strong T(H)1-polarized T-cell response with detectable cytotoxic T-lymphocyte (CTL) activity and a humoral immune response against HER2/neu, whereas the jet injector was not. Although the disadvantages that were associated with the use of the jet injector in our model may be overcome with methodological modifications and/or in larger animals, which exhibit a thicker skin and/or subcutaneous muscle tissue, we conclude that gene gun delivery constitutes the method of choice for intradermal DNA delivery in preclinical mouse models and possibly also for the clinical development of DNA-based vaccines.

  11. De novo transcriptomic analysis of peripheral blood lymphocytes from the Chinese goose: gene discovery and immune system pathway description.


    Tariq, Mansoor; Chen, Rong; Yuan, Hongyu; Liu, Yanjie; Wu, Yanan; Wang, Junya; Xia, Chun


    The Chinese goose is one of the most economically important poultry birds and is a natural reservoir for many avian viruses. However, the nature and regulation of the innate and adaptive immune systems of this waterfowl species are not completely understood due to limited information on the goose genome. Recently, transcriptome sequencing technology was applied in the genomic studies focused on novel gene discovery. Thus, this study described the transcriptome of the goose peripheral blood lymphocytes to identify immunity relevant genes. De novo transcriptome assembly of the goose peripheral blood lymphocytes was sequenced by Illumina-Solexa technology. In total, 211,198 unigenes were assembled from the 69.36 million cleaned reads. The average length, N50 size and the maximum length of the assembled unigenes were 687 bp, 1,298 bp and 18,992 bp, respectively. A total of 36,854 unigenes showed similarity by BLAST search against the NCBI non-redundant (Nr) protein database. For functional classification, 163,161 unigenes were comprised of three Gene Ontology (Go) categories and 67 subcategories. A total of 15,334 unigenes were annotated into 25 eukaryotic orthologous groups (KOGs) categories. Kyoto Encyclopedia of Genes and Genomes (KEGG) database annotated 39,585 unigenes into six biological functional groups and 308 pathways. Among the 2,757 unigenes that participated in the 15 immune system KEGG pathways, 125 of the most important immune relevant genes were summarized and analyzed by STRING analysis to identify gene interactions and relationships. Moreover, 10 genes were confirmed by PCR and analyzed. Of these 125 unigenes, 109 unigenes, approximately 87%, were not previously identified in the goose. This de novo transcriptome analysis could provide important Chinese goose sequence information and highlights the value of new gene discovery, pathways investigation and immune system gene identification, and comparison with other avian species as useful tools to

  12. De Novo Transcriptomic Analysis of Peripheral Blood Lymphocytes from the Chinese Goose: Gene Discovery and Immune System Pathway Description

    PubMed Central

    Tariq, Mansoor; Chen, Rong; Yuan, Hongyu; Liu, Yanjie; Wu, Yanan; Wang, Junya; Xia, Chun


    Background The Chinese goose is one of the most economically important poultry birds and is a natural reservoir for many avian viruses. However, the nature and regulation of the innate and adaptive immune systems of this waterfowl species are not completely understood due to limited information on the goose genome. Recently, transcriptome sequencing technology was applied in the genomic studies focused on novel gene discovery. Thus, this study described the transcriptome of the goose peripheral blood lymphocytes to identify immunity relevant genes. Principal Findings De novo transcriptome assembly of the goose peripheral blood lymphocytes was sequenced by Illumina-Solexa technology. In total, 211,198 unigenes were assembled from the 69.36 million cleaned reads. The average length, N50 size and the maximum length of the assembled unigenes were 687 bp, 1,298 bp and 18,992 bp, respectively. A total of 36,854 unigenes showed similarity by BLAST search against the NCBI non-redundant (Nr) protein database. For functional classification, 163,161 unigenes were comprised of three Gene Ontology (Go) categories and 67 subcategories. A total of 15,334 unigenes were annotated into 25 eukaryotic orthologous groups (KOGs) categories. Kyoto Encyclopedia of Genes and Genomes (KEGG) database annotated 39,585 unigenes into six biological functional groups and 308 pathways. Among the 2,757 unigenes that participated in the 15 immune system KEGG pathways, 125 of the most important immune relevant genes were summarized and analyzed by STRING analysis to identify gene interactions and relationships. Moreover, 10 genes were confirmed by PCR and analyzed. Of these 125 unigenes, 109 unigenes, approximately 87%, were not previously identified in the goose. Conclusion This de novo transcriptome analysis could provide important Chinese goose sequence information and highlights the value of new gene discovery, pathways investigation and immune system gene identification, and comparison with

  13. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell-directed gene therapy of murine hemophilia A.


    Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B


    Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV.

  14. Oral immune priming with Bacillus thuringiensis induces a shift in the gene expression of Tribolium castaneum larvae.


    Greenwood, Jenny M; Milutinović, Barbara; Peuß, Robert; Behrens, Sarah; Esser, Daniela; Rosenstiel, Philip; Schulenburg, Hinrich; Kurtz, Joachim


    The phenomenon of immune priming, i.e. enhanced protection following a secondary exposure to a pathogen, has now been demonstrated in a wide range of invertebrate species. Despite accumulating phenotypic evidence, knowledge of its mechanistic underpinnings is currently very limited. Here we used the system of the red flour beetle, Tribolium castaneum and the insect pathogen Bacillus thuringiensis (Bt) to further our molecular understanding of the oral immune priming phenomenon. We addressed how ingestion of bacterial cues (derived from spore supernatants) of an orally pathogenic and non-pathogenic Bt strain affects gene expression upon later challenge exposure, using a whole-transcriptome sequencing approach. Whereas gene expression of individuals primed with the orally non-pathogenic strain showed minor changes to controls, we found that priming with the pathogenic strain induced regulation of a large set of distinct genes, many of which are known immune candidates. Intriguingly, the immune repertoire activated upon priming and subsequent challenge qualitatively differed from the one mounted upon infection with Bt without previous priming. Moreover, a large subset of priming-specific genes showed an inverse regulation compared to their regulation upon challenge only. Our data demonstrate that gene expression upon infection is strongly affected by previous immune priming. We hypothesise that this shift in gene expression indicates activation of a more targeted and efficient response towards a previously encountered pathogen, in anticipation of potential secondary encounter.

  15. Effects of FVIII immunity on hepatocyte and hematopoietic stem cell–directed gene therapy of murine hemophilia A

    PubMed Central

    Lytle, Allison M; Brown, Harrison C; Paik, Na Yoon; Knight, Kristopher A; Wright, J Fraser; Spencer, H Trent; Doering, Christopher B


    Immune responses to coagulation factors VIII (FVIII) and IX (FIX) represent primary obstacles to hemophilia treatment. Previously, we showed that hematopoietic stem cell (HSC) retroviral gene therapy induces immune nonresponsiveness to FVIII in both naive and preimmunized murine hemophilia A settings. Liver-directed adeno-associated viral (AAV)-FIX vector gene transfer achieved similar results in preclinical hemophilia B models. However, as clinical immune responses to FVIII and FIX differ, we investigated the ability of liver-directed AAV-FVIII gene therapy to affect FVIII immunity in hemophilia A mice. Both FVIII naive and preimmunized mice were administered recombinant AAV8 encoding a liver-directed bioengineered FVIII expression cassette. Naive animals receiving high or mid-doses subsequently achieved near normal FVIII activity levels. However, challenge with adjuvant-free recombinant FVIII induced loss of FVIII activity and anti-FVIII antibodies in mid-dose, but not high-dose AAV or HSC lentiviral (LV) vector gene therapy cohorts. Furthermore, unlike what was shown previously for FIX gene transfer, AAV-FVIII administration to hemophilia A inhibitor mice conferred no effect on anti-FVIII antibody or inhibitory titers. These data suggest that functional differences exist in the immune modulation achieved to FVIII or FIX in hemophilia mice by gene therapy approaches incorporating liver-directed AAV vectors or HSC-directed LV. PMID:26909355

  16. Identification of immune system and response genes, and novel mutations causing melanotic tumor formation in Drosophila melanogaster

    SciTech Connect

    Rodriguez, A.; Zhou, Zhijian; Tang, My Lien


    We are using Drosophila as a model system for analysis of immunity and tumor formation and have conducted two types of screens using enhancer detector strains to find genes related to these processes: genes expressed in the immune system (type A; hemocytes, lymph glands and fat body) and genes increased in expression by bacterial infection (type B). For type A, tissue-specific reporter gene activity was determined. For type B, a variation of enhancer detection was devised in which {beta}-galactosidase is assayed spectrophotometrically with and without bacterial infection. Because of immune system involvement in melanotic tumor formation, a third type was hypothesized to be found among types A and B: genes that, when mutated, have a melanotic tumor phenotype. Enhancer detector strains (2800) were screened for type A, 900 for B, and 11 retained for further analysis. Complementation tests, cytological mapping, P-element mobilization, and determination of lethal phase and mutant phenotype have identified six novel genes, Dorothy, wizard, toto, viking, Thor and dappled, and one previously identified gene, Collagen IV. All are associated with reporter gene expression in at least one immune system tissue. Thor has increased expression upon infection. Mutations of wizard and dappled have a melanotic tumor phenotype. 72 refs., 6 figs., 3 tabs.

  17. Immune signatures and disorder-specific patterns in a cross-disorder gene expression analysis

    PubMed Central

    de Jong, Simone; Newhouse, Stephen J.; Patel, Hamel; Lee, Sanghyuck; Dempster, David; Curtis, Charles; Paya-Cano, Jose; Murphy, Declan; Wilson, C. Ellie; Horder, Jamie; Mendez, M. Andreina; Asherson, Philip; Rivera, Margarita; Costello, Helen; Maltezos, Stefanos; Whitwell, Susannah; Pitts, Mark; Tye, Charlotte; Ashwood, Karen L.; Bolton, Patrick; Curran, Sarah; McGuffin, Peter; Dobson, Richard; Breen, Gerome


    Background Recent studies point to overlap between neuropsychiatric disorders in symptomatology and genetic aetiology. Aims To systematically investigate genomics overlap between childhood and adult attention-deficit hyperactivity disorder (ADHD), autism spectrum disorder (ASD) and major depressive disorder (MDD). Method Analysis of whole-genome blood gene expression and genetic risk scores of 318 individuals. Participants included individuals affected with adult ADHD (n = 93), childhood ADHD (n = 17), MDD (n = 63), ASD (n = 51), childhood dual diagnosis of ADHD–ASD (n = 16) and healthy controls (n = 78). Results Weighted gene co-expression analysis results reveal disorder-specific signatures for childhood ADHD and MDD, and also highlight two immune-related gene co-expression modules correlating inversely with MDD and adult ADHD disease status. We find no significant relationship between polygenic risk scores and gene expression signatures. Conclusions Our results reveal disorder overlap and specificity at the genetic and gene expression level. They suggest new pathways contributing to distinct pathophysiology in psychiatric disorders and shed light on potential shared genomic risk factors. PMID:27151072

  18. KIR Genes and Patterns Given by the A Priori Algorithm: Immunity for Haematological Malignancies

    PubMed Central

    Rodríguez-Escobedo, J. Gilberto; García-Sepúlveda, Christian A.; Cuevas-Tello, Juan C.


    Killer-cell immunoglobulin-like receptors (KIRs) are membrane proteins expressed by cells of innate and adaptive immunity. The KIR system consists of 17 genes and 614 alleles arranged into different haplotypes. KIR genes modulate susceptibility to haematological malignancies, viral infections, and autoimmune diseases. Molecular epidemiology studies rely on traditional statistical methods to identify associations between KIR genes and disease. We have previously described our results by applying support vector machines to identify associations between KIR genes and disease. However, rules specifying which haplotypes are associated with greater susceptibility to malignancies are lacking. Here we present the results of our investigation into the rules governing haematological malignancy susceptibility. We have studied the different haplotypic combinations of 17 KIR genes in 300 healthy individuals and 43 patients with haematological malignancies (25 with leukaemia and 18 with lymphomas). We compare two machine learning algorithms against traditional statistical analysis and show that the “a priori” algorithm is capable of discovering patterns unrevealed by previous algorithms and statistical approaches. PMID:26495028

  19. RNA sequencing analysis of human podocytes reveals glucocorticoid regulated gene networks targeting non-immune pathways.


    Jiang, Lulu; Hindmarch, Charles C T; Rogers, Mark; Campbell, Colin; Waterfall, Christy; Coghill, Jane; Mathieson, Peter W; Welsh, Gavin I


    Glucocorticoids are steroids that reduce inflammation and are used as immunosuppressive drugs for many diseases. They are also the mainstay for the treatment of minimal change nephropathy (MCN), which is characterised by an absence of inflammation. Their mechanisms of action remain elusive. Evidence suggests that immunomodulatory drugs can directly act on glomerular epithelial cells or 'podocytes', the cell type which is the main target of injury in MCN. To understand the nature of glucocorticoid effects on non-immune cell functions, we generated RNA sequencing data from human podocyte cell lines and identified the genes that are significantly regulated in dexamethasone-treated podocytes compared to vehicle-treated cells. The upregulated genes are of functional relevance to cytoskeleton-related processes, whereas the downregulated genes mostly encode pro-inflammatory cytokines and growth factors. We observed a tendency for dexamethasone-upregulated genes to be downregulated in MCN patients. Integrative analysis revealed gene networks composed of critical signaling pathways that are likely targeted by dexamethasone in podocytes.

  20. RNA sequencing analysis of human podocytes reveals glucocorticoid regulated gene networks targeting non-immune pathways

    PubMed Central

    Jiang, Lulu; Hindmarch, Charles C. T.; Rogers, Mark; Campbell, Colin; Waterfall, Christy; Coghill, Jane; Mathieson, Peter W.; Welsh, Gavin I.


    Glucocorticoids are steroids that reduce inflammation and are used as immunosuppressive drugs for many diseases. They are also the mainstay for the treatment of minimal change nephropathy (MCN), which is characterised by an absence of inflammation. Their mechanisms of action remain elusive. Evidence suggests that immunomodulatory drugs can directly act on glomerular epithelial cells or ‘podocytes’, the cell type which is the main target of injury in MCN. To understand the nature of glucocorticoid effects on non-immune cell functions, we generated RNA sequencing data from human podocyte cell lines and identified the genes that are significantly regulated in dexamethasone-treated podocytes compared to vehicle-treated cells. The upregulated genes are of functional relevance to cytoskeleton-related processes, whereas the downregulated genes mostly encode pro-inflammatory cytokines and growth factors. We observed a tendency for dexamethasone-upregulated genes to be downregulated in MCN patients. Integrative analysis revealed gene networks composed of critical signaling pathways that are likely targeted by dexamethasone in podocytes. PMID:27774996

  1. KIR Genes and Patterns Given by the A Priori Algorithm: Immunity for Haematological Malignancies.


    Rodríguez-Escobedo, J Gilberto; García-Sepúlveda, Christian A; Cuevas-Tello, Juan C


    Killer-cell immunoglobulin-like receptors (KIRs) are membrane proteins expressed by cells of innate and adaptive immunity. The KIR system consists of 17 genes and 614 alleles arranged into different haplotypes. KIR genes modulate susceptibility to haematological malignancies, viral infections, and autoimmune diseases. Molecular epidemiology studies rely on traditional statistical methods to identify associations between KIR genes and disease. We have previously described our results by applying support vector machines to identify associations between KIR genes and disease. However, rules specifying which haplotypes are associated with greater susceptibility to malignancies are lacking. Here we present the results of our investigation into the rules governing haematological malignancy susceptibility. We have studied the different haplotypic combinations of 17 KIR genes in 300 healthy individuals and 43 patients with haematological malignancies (25 with leukaemia and 18 with lymphomas). We compare two machine learning algorithms against traditional statistical analysis and show that the "a priori" algorithm is capable of discovering patterns unrevealed by previous algorithms and statistical approaches.

  2. Exposure to West Nile Virus Increases Bacterial Diversity and Immune Gene Expression in Culex pipiens

    PubMed Central

    Zink, Steven D.; Van Slyke, Greta A.; Palumbo, Michael J.; Kramer, Laura D.; Ciota, Alexander T.


    Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance in WNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia. PMID:26516902

  3. Covariation in stress and immune gene expression in a range expanding bird.


    Martin, Lynn B; Liebl, Andrea L; Kilvitis, Holly J


    The enemy release hypothesis (ERH) posits that hosts encounter fewer infectious parasites when they arrive in new areas, so individuals that adjust their immune defenses most effectively should thrive and even expand the range of that species. An important aspect of vertebrate immune defense is inflammation, as it provides rapid defense against diverse parasites. Glucocorticoids (GCs) are integral to the regulation of inflammation, so here we investigated whether and how covariation in the expression of genes affecting the regulation of inflammation and GCs might have impacted the house sparrow (Passer domesticus) invasion of Kenya. Toll-like receptors 2 and 4 (TLRs) detect microbial threats and instigate inflammatory responses, whereas the glucocorticoid receptor (GR) is integral to resolving inflammation via both local and systemic pathways. As with a previous study on circulating leukocytes, we found that splenic TLR-4 and TLR-2 (the latter marginally non-significant) expression was higher in younger than older populations but only when differences in spleen size were considered; birds at the range edge had larger spleens. In regards to covariation, we found that TLR-2, TLR-4 and GR expression were closely inter-related within individuals, but covariation did not differ among populations. Subsequently, our data suggest that house sparrows are using variants of a common stress-immune regulatory mechanism to expand their Kenyan range.

  4. The effect of PDIA3 gene knockout on the mucosal immune function in IBS rats

    PubMed Central

    Zhuang, Zhao-Meng; Wang, Xiao-Teng; Zhang, Lu; Tao, Li-Yuan; Lv, Bin


    Objective: To observe the changes of intestinal inflammation on PDIA3 gene knockout IBS rats and its effect on immune function. Methods: 36 SD rats were randomly divided into four groups: the control group (n = 8); IBS- empty virus group (IBS-GFP, which); IBS-PDIA3 knockout group (n = 12); IBS- the control group (n = 12). After modeling, colon and ileocecal tissue pathology in each group were observed separately. Changes of immune and inflammatory markers were measured. At the same time, ultrastructural changes in each group were observed by electron microscopy. Results: Compared with the IBS control group, inflammation was reduced significantly in IBS-PDIA3 knockout group. IgE, IL-4 and IL-9 and the level of intestinal trypsin type were decreased significantly. Furthermore, mast cell degranulation and PAR 2 receptor reduced significantly. Conclusion: PDIA3 may play an important role in the development of IBS by mediating through immune responses of mucosal abnormalities. However, the mechanism needs to be confirmed in further study. PMID:26221224

  5. Genetic determinants of HIV-1 infection and progression to AIDS: immune response genes.


    Kaur, G; Mehra, N


    Genomic studies involving well-defined multicenter cohorts of HIV-1/AIDS covering multiple populations have led to a greater understanding of the role of host determinants in viral acquisition, disease progression, transmission, and response to anti-retroviral therapy. Similarly, recent knowledge on the virus genetic diversity has helped in elucidating mechanisms leading to the evolution of viral escape mutants and the role played by host immune determinants, in particular the major histocompatibility complex (MHC) associated genes. At least two alleles, HLA-B*27 and B*57, have been identified as 'protective' against HIV-1 while B*35 and B*53 act as susceptibility favoring factors. How human leukocyte antigen (HLA)-mediated selection drives the evolution of HIV-1 and which circulating variants are more likely to evade immune surveillance of the population are now beginning to become clear. Importantly, the rare HLA alleles in a population bear a selective advantage to the host because these can induce immune responses against pre-adapted viruses. It is conceivable that previously established protective HLA associations are shifting with the evolving cytotoxic T lymphocyte (CTL) epitopes and may not remain protective in future. At the same time, this process is unraveling novel sub-dominant epitopes of the virus which could now be incorporated as the dominant target CTL epitopes. An insight into the population-specific correlates of protection is hence necessary for designing future anti-HIV therapeutic and/or prophylactic vaccine formulation(s).

  6. Transcriptome profiling analysis of naked carp (Gymnocypris przewalskii) provides insights into the immune-related genes in highland fish.


    Tong, Chao; Zhang, Cunfang; Zhang, Renyi; Zhao, Kai


    The naked carp, Gymnocypris przewalskii, is one of the dominant aquaculture fish species in Qinghai Province, China. Its wild stocks have severely suffered from overfishing, and the farming species are vulnerable to various pathogens infections. Here we report the first immune-related tissues transcriptome of a wild naked carp using a deep sequencing approach. A total of 158,087 unigenes are generated, 2687 gill-specific gene and 3215 kidney-specific genes are identified, respectively. Gene ontology analysis shows that 51,671 unigenes are involved in three major functional categories: biological process, cellular component, and molecular function. Further analysis shows that numerous consensus sequences are homologous to known immune-related genes. Pathways mapping annotate 56,270 unigenes and identify a large number of immune-related pathways. In addition, we focus on the immune-related genes and gene family in Toll-like receptor signaling pathway involved in innate immunity, including toll-like receptors (TLRs), interferon regulatory factors (IRFs), interleukins (ILs) and tumor necrosis factors (TNFs). Eventually, we identify 5 TLRs, 4 IRFs, 3 ILs and 2 TNFs with a completed coding sequence though mining the transcriptome data. Phylogeny analysis shows these genes of naked carp are mostly close to zebrafish. Protein domain and selection pressure analyses together show that all these genes are highly conserved in gene sequence and protein domain structure with other species, and purifying selection underwent in these genes, implied functionally important features are conserved in the genes above. Intriguingly, we detect positive selection signals in naked carp TLR4, and significant divergence occurred among tested species TLR4, suggested that naked carp TLR4 function may be affected. Finally, we identify 23,867 simple sequence repeat (SSR) marks in this transcriptome. Taken together, this study not only contributes a large number of candidate genes in naked carp

  7. Rapid identification of genes controlling virulence and immunity in malaria parasites

    PubMed Central

    Xangsayarath, Phonepadith; Tang, Jianxia; Yahata, Kazuhide; Zoungrana, Augustin; Mitaka, Hayato; Acharjee, Arita; Datta, Partha P.; Hunt, Paul; Carter, Richard; Kaneko, Osamu; Mustonen, Ville; Pain, Arnab


    Identifying the genetic determinants of phenotypes that impact disease severity is of fundamental importance for the design of new interventions against malaria. Here we present a rapid genome-wide approach capable of identifying multiple genetic drivers of medically relevant phenotypes within malaria parasites via a single experiment at single gene or allele resolution. In a proof of principle study, we found that a previously undescribed single nucleotide polymorphism in the binding domain of the erythrocyte binding like protein (EBL) conferred a dramatic change in red blood cell invasion in mutant rodent malaria parasites Plasmodium yoelii. In the same experiment, we implicated merozoite surface protein 1 (MSP1) and other polymorphic proteins, as the major targets of strain-specific immunity. Using allelic replacement, we provide functional validation of the substitution in the EBL gene controlling the growth rate in the blood stages of the parasites. PMID:28704525

  8. Innate immune responses: Crosstalk of signaling and regulation of gene transcription

    SciTech Connect

    Zhong Bo; Tien Po; Shu Hongbing . E-mail:


    Innate immune responses to pathogens such as bacteria and viruses are triggered by recognition of specific structures of invading pathogens called pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) that are located at plasma membrane or inside cells. Stimulation of different PAMPs activates Toll-like receptor (TLR)-dependent and -independent signaling pathways that lead to activation of transcription factors nuclear factor-{kappa}B (NF-{kappa}B), interferon regulatory factor 3/7 (IRF3/7) and/or activator protein-1 (AP-1), which collaborate to induce transcription of a large number of downstream genes. This review focuses on the rapid progress that has recently improved our understanding of the crosstalk among the pathways and the precise regulation of transcription of the downstream genes.

  9. Cathepsin L and cystatin B gene expression discriminates immune coelomic cells in the leech Theromyzon tessulatum.


    Lefebvre, Christophe; Vandenbulcke, Franck; Bocquet, Béatrice; Tasiemski, Aurélie; Desmons, Annie; Verstraete, Mathilde; Salzet, Michel; Cocquerelle, Claude


    Previous studies evidenced that cystatin B-like gene is specifically expressed and induced in large circulating coelomic cells following bacterial challenge in the leech Theromyzon tessulatum. In order to understand the role of that cysteine proteinase inhibitor during immune response, we investigated the existence of members of cathepsin family. We cloned a cathepsin L-like gene and studied its tissue distribution. Immunohistochemical studies using anti-cathepsin L and anti-cystatin B antibodies and ultrastructural results demonstrated the presence of three distinct coelomic cell populations: (1) the chloragocytes, which were initially defined as large coelomocytes, (2) the granular amoebocytes and (3) small coelomic cells. Among those cells, while chloragocytes contain cystatin B and cathepsin L, granular amoebocytes contain only cathepsin L and the third cell population contains neither cathepsin nor inhibitor. Finally, results evidenced that cathepsin L immunopositive granular amoebocytes are chemoattracted to the site of injury and phagocyte bacteria.

  10. Heme Signaling Impacts Global Gene Expression, Immunity and Dengue Virus Infectivity in Aedes aegypti

    PubMed Central

    Bottino-Rojas, Vanessa; Talyuli, Octávio A. C.; Jupatanakul, Natapong; Sim, Shuzhen; Dimopoulos, George; Venancio, Thiago M.; Bahia, Ana C.; Sorgine, Marcos H.; Oliveira, Pedro L.; Paiva-Silva, Gabriela O.


    Blood-feeding mosquitoes are exposed to high levels of heme, the product of hemoglobin degradation. Heme is a pro-oxidant that influences a variety of cellular processes. We performed a global analysis of heme-regulated Aedes aegypti (yellow fever mosquito) transcriptional changes to better understand influence on mosquito physiology at the molecular level. We observed an iron- and reactive oxygen species (ROS)-independent signaling induced by heme that comprised genes related to redox metabolism. By modulating the abundance of these transcripts, heme possibly acts as a danger signaling molecule. Furthermore, heme triggered critical changes in the expression of energy metabolism and immune response genes, altering the susceptibility towards bacteria and dengue virus. These findings seem to have implications on the adaptation of mosquitoes to hematophagy and consequently on their ability to transmit diseases. Altogether, these results may also contribute to the understanding of heme cell biology in eukaryotic cells. PMID:26275150

  11. Transcriptome Analysis of the White Body of the Squid Euprymna tasmanica with Emphasis on Immune and Hematopoietic Gene Discovery

    PubMed Central

    Salazar, Karla A.; Joffe, Nina R.; Dinguirard, Nathalie; Houde, Peter; Castillo, Maria G.


    In the mutualistic relationship between the squid Euprymna tasmanica and the bioluminescent bacterium Vibrio fischeri, several host factors, including immune-related proteins, are known to interact and respond specifically and exclusively to the presence of the symbiont. In squid and octopus, the white body is considered to be an immune organ mainly due to the fact that blood cells, or hemocytes, are known to be present in high numbers and in different developmental stages. Hence, the white body has been described as the site of hematopoiesis in cephalopods. However, to our knowledge, there are no studies showing any molecular evidence of such functions. In this study, we performed a transcriptomic analysis of white body tissue of the Southern dumpling squid, E. tasmanica. Our primary goal was to gain insights into the functions of this tissue and to test for the presence of gene transcripts associated with hematopoietic and immune processes. Several hematopoiesis genes including CPSF1, GATA 2, TFIID, and FGFR2 were found to be expressed in the white body. In addition, transcripts associated with immune-related signal transduction pathways, such as the toll-like receptor/NF-κβ, and MAPK pathways were also found, as well as other immune genes previously identified in E. tasmanica’s sister species, E. scolopes. This study is the first to analyze an immune organ within cephalopods, and to provide gene expression data supporting the white body as a hematopoietic tissue. PMID:25775132

  12. Overwintering Is Associated with Reduced Expression of Immune Genes and Higher Susceptibility to Virus Infection in Honey Bees.


    Steinmann, Nadja; Corona, Miguel; Neumann, Peter; Dainat, Benjamin


    The eusocial honey bee, Apis mellifera, has evolved remarkable abilities to survive extreme seasonal differences in temperature and availability of resources by dividing the worker caste into two groups that differ in physiology and lifespan: summer and winter bees. Most of the recent major losses of managed honey bee colonies occur during the winter, suggesting that winter bees may have compromised immune function and higher susceptibility to diseases. We tested this hypothesis by comparing the expression of eight immune genes and naturally occurring infection levels of deformed wing virus (DWV), one of the most widespread viruses in A. mellifera populations, between summer and winter bees. Possible interactions between immune response and physiological activity were tested by measuring the expression of vitellogenin and methyl farnesoate epoxidase, a gene coding for the last enzyme involved in juvenile hormone biosynthesis. Our data show that high DWV loads in winter bees correlate with reduced expression of genes involved in the cellular immune response and physiological activity and high expression of humoral immune genes involved in antibacterial defense compared with summer bees. This expression pattern could reflect evolutionary adaptations to resist bacterial pathogens and economize energy during the winter under a pathogen landscape with reduced risk of pathogenic viral infections. The outbreak of Varroa destructor infestation could have overcome these adaptations by promoting the transmission of viruses. Our results suggest that reduced cellular immune function during the winter may have increased honey bee's susceptibility to DWV. These results contribute to our understanding of honey bee colony losses in temperate regions.

  13. Comparative transcriptomics of stickleback immune gene responses upon infection by two helminth parasites, Diplostomum pseudospathaceum and Schistocephalus solidus.


    Haase, David; Rieger, Jenny K; Witten, Anika; Stoll, Monika; Bornberg-Bauer, Erich; Kalbe, Martin; Schmidt-Drewello, Alexander; Scharsack, Jörn P; Reusch, Thorsten B H


    Immune systems of vertebrates are much more diverse than previously thought, in particular at the base of the vertebrate clade. RNA-seq was used to describe in detail the transcriptomic response of stickleback hosts to infection by two helminth parasites, the trematode Diplostomum pseudospathaceum (2 genotypes plus a genotype mix) and the cestode Schistocephalus solidus. Based on a global transcription profiling, we present immune genes that are active during chronic or multiple repeated infection. We found that the transcription profiles of D. pseudospathaceum genotypes were as divergent as those of the two parasite species. When comparing the host immune response, only 5 immune genes were consistently upregulated upon infection by both species. These genes indicated a role for enhanced toll like receptor (TLR) activity (CTSK, CYP27B1) and an associated positive regulation of macrophages (CYP27B1, THBS1) for general helminth defense. We interpret the largely differentiated gene expression response among parasite species as general redundancy of the vertebrate immune system, which was also visible in genotype-specific responses among the different D. pseudospathaceum infections. The present study provides the first evidence that IL4-mediated activation of T-helper lymphocyte cells is also important in anti-helminthic immune responses of teleost fish.

  14. Immunosuppressive Myeloid Cells' Blockade in the Glioma Microenvironment Enhances the Efficacy of Immune-Stimulatory Gene Therapy.


    Kamran, Neha; Kadiyala, Padma; Saxena, Meghna; Candolfi, Marianela; Li, Youping; Moreno-Ayala, Mariela A; Raja, Nicholas; Shah, Diana; Lowenstein, Pedro R; Castro, Maria G


    Survival of glioma (GBM) patients treated with the current standard of care remains dismal. Immunotherapeutic approaches that harness the cytotoxic and memory potential of the host immune system have shown great benefit in other cancers. GBMs have developed multiple strategies, including the accumulation of myeloid-derived suppressor cells (MDSCs) to induce immunosuppression. It is therefore imperative to develop multipronged approaches when aiming to generate a robust anti-tumor immune response. Herein, we tested whether combining MDSC depletion or checkpoint blockade would augment the efficacy of immune-stimulatory herpes simplex type-I thymidine kinase (TK) plus Fms-like tyrosine kinase ligand (Flt3L)-mediated immune stimulatory gene therapy. Our results show that MDSCs constitute >40% of the tumor-infiltrating immune cells. These cells express IL-4Rα, inducible nitric oxide synthase (iNOS), arginase, programmed death ligand 1 (PDL1), and CD80, molecules that are critically involved in antigen-specific T cell suppression. Depletion of MDSCs strongly enhanced the TK/Flt3L gene therapy-induced tumor-specific CD8 T cell response, which lead to increased median survival and percentage of long-term survivors. Also, combining PDL1 or CTLA-4 immune checkpoint blockade greatly improved the efficacy of TK/Flt3L gene therapy. Our results, therefore, indicate that blocking MDSC-mediated immunosuppression holds great promise for increasing the efficacy of gene therapy-mediated immunotherapies for GBM.

  15. Transcriptome analysis of the white body of the squid Euprymna tasmanica with emphasis on immune and hematopoietic gene discovery.


    Salazar, Karla A; Joffe, Nina R; Dinguirard, Nathalie; Houde, Peter; Castillo, Maria G


    In the mutualistic relationship between the squid Euprymna tasmanica and the bioluminescent bacterium Vibrio fischeri, several host factors, including immune-related proteins, are known to interact and respond specifically and exclusively to the presence of the symbiont. In squid and octopus, the white body is considered to be an immune organ mainly due to the fact that blood cells, or hemocytes, are known to be present in high numbers and in different developmental stages. Hence, the white body has been described as the site of hematopoiesis in cephalopods. However, to our knowledge, there are no studies showing any molecular evidence of such functions. In this study, we performed a transcriptomic analysis of white body tissue of the Southern dumpling squid, E. tasmanica. Our primary goal was to gain insights into the functions of this tissue and to test for the presence of gene transcripts associated with hematopoietic and immune processes. Several hematopoiesis genes including CPSF1, GATA 2, TFIID, and FGFR2 were found to be expressed in the white body. In addition, transcripts associated with immune-related signal transduction pathways, such as the toll-like receptor/NF-κβ, and MAPK pathways were also found, as well as other immune genes previously identified in E. tasmanica's sister species, E. scolopes. This study is the first to analyze an immune organ within cephalopods, and to provide gene expression data supporting the white body as a hematopoietic tissue.

  16. System-Wide Associations between DNA-Methylation, Gene Expression, and Humoral Immune Response to Influenza Vaccination

    PubMed Central

    Zimmermann, Michael T.; Oberg, Ann L.; Grill, Diane E.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Kennedy, Richard B.; Poland, Gregory A.


    Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50–74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant’s propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens. PMID:27031986

  17. Gene Expression Alterations in Immune System Pathways in the Thymus after Exposure to Immunosuppressive Chemicals

    PubMed Central

    Frawley, Rachel; White, Kimber; Brown, Ronnetta; Musgrove, Deborah; Walker, Nigel; Germolec, Dori


    Background Dysregulation of positive and negative selection, antigen presentation, or apoptosis in the thymus can lead to immunosuppression or autoimmunity. Diethylstilbestrol (DES), dexamethasone (DEX), cyclophosphamide (CPS), and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) are immunosuppressive chemicals that induce similar immunotoxic effects in the thymus, however, the mechanism of toxicity is purported to be different for each compound. Objectives We hypothesized that genomic analysis of thymus after chemical-induced atrophy would yield transcriptional profiles that suggest pathways of toxicity associated with reduced function. Methods Female B6C3F1 mice were exposed to these immunosuppressive agents and changes in gene expression and immune cell subpopulations were evaluated. Results All four chemicals induced thymic atrophy and changes in both the relative proportion and absolute number of CD3+, CD4+/CD8−, CD4−/CD8+, and CD4+/CD8+ thymocytes. The most significant impact of exposure to DEX, DES, and CPS was modulation of gene expression in the T-cell receptor (TCR) complex and TCR and CD28 signaling pathways; this could represent a common mechanism of action and play a pivotal role in lineage commitment and development of T cells. Up-regulation of genes associated with the antigen presentation and dendritic cell maturation pathways was the most distinctive effect of TCDD exposure. These elements, which were also up-regulated by DEX and DES, contribute to positive and negative selection. Conclusions Genomic analysis revealed gene expression changes in several pathways that are commonly associated with xenobiotic-induced immune system perturbations, particularly those that contribute to the development and maturation of thymic T cells. PMID:21041162

  18. Structure and immune expression analysis of hemoglobin genes from the blood clam Tegillarca granosa.


    Bao, Y B; Wang, Q; Guo, X M; Lin, Z H


    Hemoglobin (Hb) is the major protein component of erythrocytes in animals with red blood, although it can serve additional functions beyond the transport of oxygen. The blood clam (Tegillarca granosa) is one of the few mollusks that has Hb, although the structure and function of molluskan Hbs remain unclear. We characterized two unique and highly compartmentalized blood clam hemoglobin genes, Tg-HbIIA and Tg-HbIIB, at the molecular level. The full-length cDNA of Tg-HbIIA was 731 bp with a 450-bp open reading frame encoding 150 amino acids; that of Tg-HbIIB was 698 bp, with a 456-bp open reading frame encoding 152 amino acids. Their intronic regions were amplified by PCR. The two genes showed the typical 2 intron/3 exon organization found in T. granosa. The 3-D structures of the three blood clam Tg-Hbs were predicted using the SWISS-MODEL Protein Modeling Server, and a phylogenetic analysis was conducted to investigate its evolution. As quantified by qRT-PCR, the expression levels of Tg-HbIIA and Tg-HbIIB were significantly upregulated upon challenge by Vibrio parahaemolyticus, lipopolysaccharides, and peptidoglycans. Three Hb isoforms, Tg-HbI, Tg-HbIIA, and Tg-HbIIB, were found. Specific structures and evolutionary features were found in these molluskan Hb genes. Challenge experiments indicated that Tg-Hbs are involved in immune defense responses against bacterial infection and bacterial pathogenic factors. As this is the first functional research on Hb genes in the blood clam, our findings provide new insight into the innate immune defense mechanisms of T. granosa.

  19. Gene expression profiling of coelomic cells and discovery of immune-related genes in the earthworm, Eisenia andrei, using expressed sequence tags.


    Tak, Eun Sik; Cho, Sung-Jin; Park, Soon Cheol


    The coelomic cells of the earthworm consist of leukocytes, chlorogocytes, and coelomocytes, which play an important role in innate immunity reactions. To gain insight into the expression profiles of coelomic cells of the earthworm, Eisenia andrei, we analyzed 1151 expressed sequence tags (ESTs) derived from the cDNA library of the coelomic cells. Among the 1151 ESTs analyzed, 493 ESTs (42.8%) showed a significant similarity to known genes and represented 164 unique genes, of which 93 ESTs were singletons and 71 ESTs manifested as two or more ESTs. From the 164 unique genes sequenced, we found 24 immune-related and cell defense genes. Furthermore, real-time PCR analysis showed that levels of lysenin-related proteins mRNA in coelomic cells of E. andrei were upregulated after the injection of Bacillus subtilis bacteria. This EST data-set would provide a valuable resource for future researches of earthworm immune system.

  20. Genome-Wide Association Studies Suggest Limited Immune Gene Enrichment in Schizophrenia Compared to 5 Autoimmune Diseases.


    Pouget, Jennie G; Gonçalves, Vanessa F; Spain, Sarah L; Finucane, Hilary K; Raychaudhuri, Soumya; Kennedy, James L; Knight, Jo


    There has been intense debate over the immunological basis of schizophrenia, and the potential utility of adjunct immunotherapies. The major histocompatibility complex is consistently the most powerful region of association in genome-wide association studies (GWASs) of schizophrenia and has been interpreted as strong genetic evidence supporting the immune hypothesis. However, global pathway analyses provide inconsistent evidence of immune involvement in schizophrenia, and it remains unclear whether genetic data support an immune etiology per se. Here we empirically test the hypothesis that variation in immune genes contributes to schizophrenia. We show that there is no enrichment of immune loci outside of the MHC region in the largest genetic study of schizophrenia conducted to date, in contrast to 5 diseases of known immune origin. Among 108 regions of the genome previously associated with schizophrenia, we identify 6 immune candidates (DPP4, HSPD1, EGR1, CLU, ESAM, NFATC3) encoding proteins with alternative, nonimmune roles in the brain. While our findings do not refute evidence that has accumulated in support of the immune hypothesis, they suggest that genetically mediated alterations in immune function may not play a major role in schizophrenia susceptibility. Instead, there may be a role for pleiotropic effects of a small number of immune genes that also regulate brain development and plasticity. Whether immune alterations drive schizophrenia progression is an important question to be addressed by future research, especially in light of the growing interest in applying immunotherapies in schizophrenia. © The Author 2016. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center.

  1. Systemic Sclerosis is a Complex Disease Associated Mainly with Immune Regulatory and Inflammatory Genes

    PubMed Central

    Jin, Jingxiao; Chou, Chou; Lima, Maria; Zhou, Danielle; Zhou, Xiaodong


    Systemic sclerosis (SSc) is a fibrotic and autoimmune disease characterized clinically by skin and internal organ fibrosis and vascular damage, and serologically by the presence of circulating autoantibodies. Although etiopathogenesis is not yet well understood, the results of numerous genetic association studies support genetic contributions as an important factor to SSc. In this paper, the major genes of SSc are reviewed. The most recent genome-wide association studies (GWAS) are taken into account along with robust candidate gene studies. The literature search was performed on genetic association studies of SSc in PubMed between January 2000 and March 2014 while eligible studies generally had over 600 total participants with replication. A few genetic association studies with related functional changes in SSc patients were also included. A total of forty seven genes or specific genetic regions were reported to be associated with SSc, although some are controversial. These genes include HLA genes, STAT4, CD247, TBX21, PTPN22, TNFSF4, IL23R, IL2RA, IL-21, SCHIP1/IL12A, CD226, BANK1, C8orf13-BLK, PLD4, TLR-2, NLRP1, ATG5, IRF5, IRF8, TNFAIP3, IRAK1, NFKB1, TNIP1, FAS, MIF, HGF, OPN, IL-6, CXCL8, CCR6, CTGF, ITGAM, CAV1, MECP2, SOX5, JAZF1, DNASEIL3, XRCC1, XRCC4, PXK, CSK, GRB10, NOTCH4, RHOB, KIAA0319, PSD3 and PSOR1C1. These genes encode proteins mainly involved in immune regulation and inflammation, and some of them function in transcription, kinase activity, DNA cleavage and repair. The discovery of various SSc-associated genes is important in understanding the genetics of SSc and potential pathogenesis that contribute to the development of this disease. PMID:25328554

  2. Genetic Organization of Plasmid ColJs, Encoding Colicin Js Activity, Immunity, and Release Genes

    PubMed Central

    Šmajs, David; Weinstock, George M.


    The 5.2-kb ColJs plasmid of a colicinogenic strain of Shigella sonnei (colicin type 7) was isolated and sequenced. pColJs was partly homologous to pColE1 and to pesticin-encoding plasmid pPCP1, mainly in the rep, mob, and cer regions. A 1.2-kb unique region of pColJs showed significantly different G+C content (34%) compared to the rest of pColJs (53%). Within the unique region, seven open reading frames (ORFs) were identified. ORF94 was shown to code for colicin Js activity (cja), a 94-amino-acid polypeptide (molecular mass, 10.4 kDa); ORF129 (cji) was shown to code for the 129-amino-acid colicin Js immunity protein (molecular mass, 14.3 kDa); and ORF65 was shown to be involved in colicin Js release by producer bacteria (cjl) coding for a 65-amino-acid polypeptide (molecular mass, 7.5 kDa). In contrast to the gene order in other colicin operons, the cjl gene was found upstream from cja. Moreover, the promoter upstream from cjl was similar to promoters described upstream from several colicin activity genes. The cji gene was found to be located downstream from cja with a transcription polarity opposite to that of the cjl and cja genes. The cja, cji, and cjl genes were not similar to other known colicin genes. Colicin Js was purified as an inactive fusion protein with an N-terminal histidine tag. Activity of the purified fusion form of colicin Js was restored after cleavage of the amino acids fused to the colicin Js N terminus. PMID:11395458

  3. Identification of Aadnr1, a novel gene related to innate immunity and apoptosis in Aedes albopictus.


    Li, Xiaomei; Meng, Kun; Qiao, Jialu; Liu, Hao; Zhong, Chunyan; Liu, Qingzhen


    Innate immunity and apoptosis play critical roles in defending pathogens in insects. In Drosophila, Dnr1 was reported as a negative regulator of apoptosis and immune deficiency (Imd) pathway which belongs to innate immunity. Aedes albopictus is an important kind of arbovirus vector and becoming a significant threat to public health due to its rapid global expansion. Here we identified an ortholog of dnr1 from A. albopictus, named as Aadnr1. Aadnr1 encoded a putative protein containing an N-terminal FERM domain and a C-terminal RING domain. AaDnr1 shared high identity with dipteran insects Dnr1 orthologs. Phylogenetic analyses showed that the closest relative of AaDnr1 was Aedes aegypti Dnr1. Real-time PCR proved that Aadnr1 mRNA was expressed ubiquitously during developmental and adult stages. Transcriptional levels of Aadnr1 were decreased drastically in C6/36 cells underwent apoptosis induced by Actinomycin D (Act D) treatment. Partial silence of Aadnr1 enhanced Act D-induced caspase activity. When challenged by heat-inactivated E. coli, transcriptional level of Aadnr1 was also decreased dramatically in C6/36 cells. While when C6/36 cells were infected with Sindbis virus TE/GFP, transcriptional level of Aadnr1 was reduced and recovered repeatedly, with an overall decreasing trend. It was also shown in this study that similar to Drosophila Dnr1, RING domain destabilized AaDnr1 protein. Taken together, the study identified an innate immunity and apoptosis related gene Aadnr1 in A. albopictus. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Identification of immune-relevant genes in histoincompatible rejecting colonies of the tunicate Botryllus schlosseri.


    Oren, Matan; Douek, Jacob; Fishelson, Zvi; Rinkevich, Baruch


    The colonial ascidian Botryllus schlosseri manifests a unique allorecognition system that is controlled by a single histocompatibility haplotype, the Fu/HC locus. When two allogeneic incompatible colonies come into direct contact, they develop inflammatory-like rejection lesions, called points of rejection (POR). While screening for differentially expressed genes during POR formation, we developed and analyzed a cDNA library of expressed sequence tags (ESTs) with 1693 unique ESTs that were clustered and assembled into 217 contigs and 1476 singlets. About 51% of these ESTs showed high similarity (E-value 0.005) to known database sequences, of which 123 matches were identified as immune-relevant genes encoding for stress proteins, pattern recognition receptors and complement proteins, proteases and protease inhibitors, cell adhesion and coagulation proteins, cytokine-related proteins, programmed cell death and proteasome-associated proteins. This first EST wide-screening analysis of the Botryllus allorecognition effector arm reveals a complex innate immune system, hallmarked by a whole genome response to allorecognition challenge.

  5. Combined Tbet and IL12 gene therapy elicits and recruits superior antitumor immunity in vivo.


    Qu, Yanyan; Chen, Lu; Lowe, Devin B; Storkus, Walter J; Taylor, Jennifer L


    We have recently shown that intratumor (i.t.) injection of syngenic dendritic cells (DC) engineered to express the transcription factor Tbet (TBX21) promotes protective type-1 T cell-mediated immunity via a mechanism that is largely interleukin (IL)-12p70-independent. Since IL-12 is a classical promoter of type-1 immunity, the current study was undertaken to determine whether gene therapy using combined Tbet and IL-12 complementary DNA (cDNA) would yield improved antitumor efficacy based on the complementary/synergistic action of these biologic modifiers. Mice bearing established subcutaneous (s.c.) tumors injected with DC concomitantly expressing ectopic Tbet and IL12 (i.e., DC.Tbet/IL12) displayed superior (i) rates of tumor rejection and extended overall survival, (ii) cross-priming of Tc1 reactive against antigens expressed within the tumor microenvironment, and (iii) infiltration of CD8(+) T cells into treated tumors in association with elevated locoregional production of CXCR3 ligand chemokines. In established bilateral tumor models, i.t. delivery of DC.Tbet/IL12 into a single lesion led to slowed growth or regression at both tumor sites. Furthermore, DC.Tbet/IL12 pulsed with tumor antigen-derived peptides and injected as a therapy distal to the tumor site prevented tumor growth and activated robust antigen-specific Tc1 responses. These data support the translation use of combined Tbet and IL-12p70 gene therapy in the cancer setting.

  6. Expression of Immune-Related Genes during Loach (Misgurnus anguillicaudatus) Embryonic and Early Larval Development

    PubMed Central

    Lee, Jang Wook; Kim, Jung Eun; Goo, In Bon; Hwang, Ju-Ae; Im, Jea Hyun; Choi, Hye-Sung; Lee, Jeong-Ho


    Early life stage mortality in fish is one of the problems faced by loach aquaculture. However, our understanding of immune system in early life stage fish is still incomplete, and the information available is restricted to a few fish species. In the present work, we investigated the expression of immune-related transcripts in loach during early development. In fishes, recombination-activating gene 1 (RAG-1) and sacsin (SACS) have been considered as immunological function. In this study, the expression of the both genes was assessed throughout the early developmental stages of loach using real-time PCR method. maRAG-1 mRNA was first detected in 0 dph, observed the increased mostly until 40 dph. Significant expression of maRAG-1 was detected in 0 to 40 dph. These patterns of expression may suggest that the loach start to develop its function after hatching. On the other hand, maSACS was detected in unfertilized oocyte to molura stages and 0 to 40 dph. maSACS mRNA transcripts were detected in unfertilized oocytes, suggesting that they are maternally transferred. PMID:26973969

  7. Molecular clock of HIV-1 envelope genes under early immune selection.


    Park, Sung Yong; Love, Tanzy M T; Perelson, Alan S; Mack, Wendy J; Lee, Ha Youn


    The molecular clock hypothesis that genes or proteins evolve at a constant rate is a key tool to reveal phylogenetic relationships among species. Using the molecular clock, we can trace an infection back to transmission using HIV-1 sequences from a single time point. Whether or not a strict molecular clock applies to HIV-1's early evolution in the presence of immune selection has not yet been fully examined. We identified molecular clock signatures from 1587 previously published HIV-1 full envelope gene sequences obtained since acute infection in 15 subjects. Each subject's sequence diversity linearly increased during the first 150 days post infection, with rates ranging from [Formula: see text] to [Formula: see text] with a mean of [Formula: see text] per base per day. The rate of diversification for 12 out of the 15 subjects was comparable to the neutral evolution rate. While temporal diversification was consistent with evolution patterns in the absence of selection, mutations from the founder virus were highly clustered on statistically identified selection sites, which diversified more than 65 times faster than non-selection sites. By mathematically quantifying deviations from the molecular clock under various selection scenarios, we demonstrate that the deviation from a constant clock becomes negligible as multiple escape lineages emerge. The most recent common ancestor of a virus pair from distinct escape lineages is most likely the transmitted founder virus, indicating that HIV-1 molecular dating is feasible even after the founder viruses are no longer detectable. The ability of HIV-1 to escape from immune surveillance in many different directions is the driving force of molecular clock persistence. This finding advances our understanding of the robustness of HIV-1's molecular clock under immune selection, implying the potential for molecular dating.

  8. Molecular characterization of Ran gene up-regulated in large yellow croaker (Pseudosciaena crocea) immunity.


    Han, Fang; Wang, Xiao-Qing; Yao, Cui-luan; Wang, Zhi-yong


    RanGTPase, one family of small G protein superfamily, has been widely demonstrated to be involved in transport system between cytoplasm and nucleus. However the knowledge about the function of RanGTPase in immunity remains limited. In this report, Ran gene (named LycRan) cDNA was cloned from the large yellow croaker, Pseudosciaena crocea, a marine fish. The full-length cDNA of LycRan was of 1033 bp, including a 5'-terminal untranslated region (UTR) of 43 bp, 3'-terminal UTR of 338 bp and an open reading frame (ORF) of 648 bp encoding a polypeptide of 216 amino acids. The deduced protein is highly homologous, it shares 90.74%, 88.89%, 89.35% and 85.20% identities with those of salmon, frog, human and fruit fly respectively. RT-PCR analysis indicated that LycRan gene was constitutively expressed in 9 tissues examined, including kidney, liver, gill, muscle, spleen, skin, heart, intestine and blood. The result of quantitative Real-Time RT-PCR analysis revealed the highest expression in kidney and the weakest expression in skin. Time course analysis showed that LycRan expression was obviously up-regulated in kidney, blood and spleen after immunization with either poly I:C or formalin-inactive Gram-negative bacterium Vibrio parahaemolyticus. It indicated that the highest expression was 2.8 times (at 48 h) as much as that in the control in the kidney (p < 0.05) challenged by poly I:C and 3.2 times (at 24 h) in the blood (p < 0.05) challenged by bacteria. These results suggested that LycRan might play an important role in large yellow croaker defense against the pathogen infection. Our study, therefore, might provide a clue to elucidate the large yellow croaker innate immunity.

  9. Gene Vaccination to Bias the Immune Response to Amyloid-β Peptide as Therapy for Alzheimer Disease

    PubMed Central

    Qu, Baoxi; Rosenberg, Roger N.; Li, Liping; Boyer, Philip J.; Johnston, Stephen A.


    Background The amyloid-β (Aβ) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Aβ1–42 (Aβ42) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Aβ in patients with AD was shown to be effective in reducing Aβ deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Aβ42 that produced antibody response but avoided an adverse cell-mediated immune effect. Objective To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Methods Mice were vaccinated with a plasmid that encodes Aβ42, administered by gene gun. The immune response of the mice to Aβ42 was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Aβ42-specific T-cell response as measured by interferon-γ enzyme-linked immunospot (ELISPOT) assay. Results Gene-gun delivery of the mouse Aβ42 dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-γ release with mouse Aβ42 peptide and Aβ9–18 showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Aβ42 gene vaccine. Western blot evaluation showed both human and mouse Aβ monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Aβ42 monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Aβ1–42 and Aβ1–16, or with plasmid without the Aβgene

  10. Identification of Immune Related LRR-Containing Genes in Maize (Zea mays L.) by Genome-Wide Sequence Analysis

    PubMed Central

    Song, Wei; Wang, Baoqiang; Li, Xinghua; Wei, Jianfen; Chen, Ling; Zhang, Dongmin; Zhang, Wenying; Li, Ronggai


    A large number of immune receptors consist of nucleotide binding site-leucine rich repeat (NBS-LRR) proteins and leucine rich repeat-receptor-like kinases (LRR-RLK) that play a crucial role in plant disease resistance. Although many NBS-LRR genes have been previously identified in Zea mays, there are no reports on identifying NBS-LRR genes encoded in the N-terminal Toll/interleukin-1 receptor (TIR) motif and identifying genome-wide LRR-RLK genes. In the present study, 151 NBS-LRR genes and 226 LRR-RLK genes were identified after performing bioinformatics analysis of the entire maize genome. Of these identified genes, 64 NBS-LRR genes and four TIR-NBS-LRR genes were identified for the first time. The NBS-LRR genes are unevenly distributed on each chromosome with gene clusters located at the distal end of each chromosome, while LRR-RLK genes have a random chromosomal distribution with more paired genes. Additionally, six LRR-RLK/RLPs including FLS2, PSY1R, PSKR1, BIR1, SERK3, and Cf5 were characterized in Zea mays for the first time. Their predicted amino acid sequences have similar protein structures with their respective homologues in other plants, indicating that these maize LRR-RLK/RLPs have the same functions as their homologues act as immune receptors. The identified gene sequences would assist in the study of their functions in maize. PMID:26609518

  11. NF-Y and the immune response: Dissecting the complex regulation of MHC genes.


    Sachini, Nikoleta; Papamatheakis, Joseph


    Nuclear Factor Y (NF-Y) was first described as one of the CCAAT binding factors. Although CCAAT motifs were found to be present in various genes, NF-Y attracted a lot of interest early on, due to its role in Major Histocompatibility Complex (MHC) gene regulation. MHC genes are crucial in immune response and show peculiar expression patterns. Among other conserved elements on MHC promoters, an NF-Y binding CCAAT box was found to contribute to MHC transcriptional regulation. NF-Y along with other DNA binding factors assembles in a stereospecific manner to form a multiprotein scaffold, the MHC enhanceosome, which is necessary but not sufficient to drive transcription. Transcriptional activation is achieved by the recruitment of yet another factor, the class II transcriptional activator (CIITA). In this review, we briefly discuss basic findings on MHCII transcription regulation and we highlight NF-Y different modes of function in MHCII gene activation. This article is part of a Special Issue entitled: Nuclear Factor Y in Development and Disease, edited by Prof. Roberto Mantovani. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Cortisol-treated zebrafish embryos develop into pro-inflammatory adults with aberrant immune gene regulation

    PubMed Central

    Hartig, Ellen I.; Zhu, Shusen; King, Benjamin L.


    ABSTRACT Chronic early-life stress increases adult susceptibility to numerous health problems linked to chronic inflammation. One way that this may occur is via glucocorticoid-induced developmental programming. To gain insight into such programming we treated zebrafish embryos with cortisol and examined the effects on both larvae and adults. Treated larvae had elevated whole-body cortisol and glucocorticoid signaling, and upregulated genes associated with defense response and immune system processes. In adulthood the treated fish maintained elevated basal cortisol levels in the absence of exogenous cortisol, and constitutively mis-expressed genes involved in defense response and its regulation. Adults derived from cortisol-treated embryos displayed defective tailfin regeneration, heightened basal expression of pro-inflammatory genes, and failure to appropriately regulate those genes following injury or immunological challenge. These results support the hypothesis that chronically elevated glucocorticoid signaling early in life directs development of a pro-inflammatory adult phenotype, at the expense of immunoregulation and somatic regenerative capacity. PMID:27444789

  13. The evolution of the immune-type gene family Rhamnospondin in cnidarians.


    López, Javier A; Fain, Matthew G; Cadavid, Luis F


    Rhamnose-binding lectins (RBLs) in vertebrates function in immunity as pattern recognition receptors, opsonization agents, and activators of pro-inflammatory cytokines. Although they have been identified in some invertebrate taxa, their distribution, function, and evolutionary patterns in basal metazoans, remain largely unknown. A unique RBL-containing protein composed of 8 thrombospondin type 1 repeats (TSRs) and a single RBL domain has been identified in the colonial hydroid Hydractinia symbiolongicarpus. This Rhamnospondin (Rsp) gene was specifically and constitutively expressed in the mouth of feeding polyps. Here we report the full characterization of a second Rsp gene from a H. symbiolongicarpus BAC library. Rsp1 and Rsp2 were 1.1kb apart, shared the same domain architecture and were 93% identical. Introns differed substantially in size and sequence, excepting two introns that were nearly identical, suggesting the action of inter-locus recombination. Sequencing full-length cDNAs from a wild-type individual corroborated the exon boundaries predicted from genomic DNA and showed gene polymorphism at both loci. Database searches and phylogenetic analyses showed that Rsp was found only in hydrozoans, indicating that it is an innovation of the cnidarian class Hydrozoa. Phylogenetic analysis of Rsp sequences in hydroids show a tendency of clustering paralogous genes, suggesting that they have evolved by concerted evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Associations between polymorphisms in the antiviral TRIM genes and measles vaccine immunity.


    Ovsyannikova, Inna G; Haralambieva, Iana H; Vierkant, Robert A; O'Byrne, Megan M; Poland, Gregory A


    The role of polymorphisms within the antiviral tripartite motif (TRIM) genes in measles vaccine adaptive immune responses was examined. A limited association was found between TRIM5 (rs7122620) and TRIM25 (rs205499) gene polymorphisms and measles-specific antibody levels. However, many associations were found between TRIM gene SNPs and variations in cellular responses (IFN-γ Elispot and secreted cytokines IL-2, IL-6, IL-10, IFN-γ, and TNF-α). TRIM22 rs2291841 was significantly associated with an increased IFN-γ Elispot response (35 vs. 102 SFC per 2×10(5)PBMC, p=0.009, q=0.71) in Caucasians. A non-synonymous TRIM25 rs205498 (in LD with other SNPs, r(2)≥0.56), as well as the TRIM25 AAAGGAAAGGAGT haplotype, was associated with a decreased IFN-γ Elispot response (t-statistic -2.32, p=0.02) in African-Americans. We also identified polymorphisms in the TRIM5, TRIM22, and TRIM25 genes that were associated with significant differences in cytokine responses. Additional studies are necessary to replicate our findings and to examine the functional consequences of these associations.

  15. The impact of human and mouse differences in NOS2 gene expression on the brain's redox and immune environment.


    Hoos, Michael D; Vitek, Michael P; Ridnour, Lisa A; Wilson, Joan; Jansen, Marilyn; Everhart, Angela; Wink, David A; Colton, Carol A


    Mouse models are used in the study of human disease. Despite well-known homologies, the difference in immune response between mice and humans impacts the application of data derived from mice to human disease outcomes. Nitric oxide synthase-2 (NOS2) is a key gene that displays species-specific outcomes via altered regulation of the gene promoter and via post-transcriptional mechanisms in humans that are not found in mice. The resulting levels of NO produced by activation of human NOS2 are different from the levels of NO produced by mouse Nos2. Since both tissue redox environment and immune responsiveness are regulated by the level of NO and its interactions, we investigated the significance of mouse and human differences on brain oxidative stress and on immune activation in HuNOS2tg/mNos2-/- mice that express the entire human NOS2 gene and that lack a functional mNos2 compared to wild type (WT) mice that express normal mNos2. Similarly to human, brain tissue from HuNOS2tg/mNos2-/- mice showed the presence of a NOS2 gene 3'UTR binding site. We also identified miRNA-939, the binding partner for this site, in mouse brain lysates and further demonstrated reduced levels of nitric oxide (NO) typical of the human immune response on injection with lipopolysaccharide (LPS). HuNOS2tg/mNos2-/- brain samples were probed for characteristic differences in redox and immune gene profiles compared to WT mice using gene arrays. Selected genes were also compared against mNos2-/- brain lysates. Reconstitution of the human NOS2 gene significantly altered genes that encode multiple anti-oxidant proteins, oxidases, DNA repair, mitochondrial proteins and redox regulated immune proteins. Expression levels of typical pro-inflammatory, anti-inflammatory and chemokine genes were not significantly different with the exception of increased TNFα and Ccr1 mRNA expression in the HuNOS2tg/mNos2-/- mice compared to WT or mNos2-/- mice. NO is a principle factor in establishing the tissue redox

  16. Ontology based molecular signatures for immune cell types via gene expression analysis

    PubMed Central


    Background New technologies are focusing on characterizing cell types to better understand their heterogeneity. With large volumes of cellular data being generated, innovative methods are needed to structure the resulting data analyses. Here, we describe an ‘Ontologically BAsed Molecular Signature’ (OBAMS) method that identifies novel cellular biomarkers and infers biological functions as characteristics of particular cell types. This method finds molecular signatures for immune cell types based on mapping biological samples to the Cell Ontology (CL) and navigating the space of all possible pairwise comparisons between cell types to find genes whose expression is core to a particular cell type’s identity. Results We illustrate this ontological approach by evaluating expression data available from the Immunological Genome project (IGP) to identify unique biomarkers of mature B cell subtypes. We find that using OBAMS, candidate biomarkers can be identified at every strata of cellular identity from broad classifications to very granular. Furthermore, we show that Gene Ontology can be used to cluster cell types by shared biological processes in order to find candidate genes responsible for somatic hypermutation in germinal center B cells. Moreover, through in silico experiments based on this approach, we have identified genes sets that represent genes overexpressed in germinal center B cells and identify genes uniquely expressed in these B cells compared to other B cell types. Conclusions This work demonstrates the utility of incorporating structured ontological knowledge into biological data analysis – providing a new method for defining novel biomarkers and providing an opportunity for new biological insights. PMID:24004649

  17. Atlantic salmon populations reveal adaptive divergence of immune related genes - a duplicated genome under selection.


    Kjærner-Semb, Erik; Ayllon, Fernando; Furmanek, Tomasz; Wennevik, Vidar; Dahle, Geir; Niemelä, Eero; Ozerov, Mikhail; Vähä, Juha-Pekka; Glover, Kevin A; Rubin, Carl J; Wargelius, Anna; Edvardsen, Rolf B


    Populations of Atlantic salmon display highly significant genetic differences with unresolved molecular basis. These differences may result from separate postglacial colonization patterns, diversifying natural selection and adaptation, or a combination. Adaptation could be influenced or even facilitated by the recent whole genome duplication in the salmonid lineage which resulted in a partly tetraploid species with duplicated genes and regions. In order to elucidate the genes and genomic regions underlying the genetic differences, we conducted a genome wide association study using whole genome resequencing data from eight populations from Northern and Southern Norway. From a total of ~4.5 million sequencing-derived SNPs, more than 10 % showed significant differentiation between populations from these two regions and ten selective sweeps on chromosomes 5, 10, 11, 13-15, 21, 24 and 25 were identified. These comprised 59 genes, of which 15 had one or more differentiated missense mutation. Our analysis showed that most sweeps have paralogous regions in the partially tetraploid genome, each lacking the high number of significant SNPs found in the sweeps. The most significant sweep was found on Chr 25 and carried several missense mutations in the antiviral mx genes, suggesting that these populations have experienced differing viral pressures. Interestingly the second most significant sweep, found on Chr 5, contains two genes involved in the NF-KB pathway (nkap and nkrf), which is also a known pathogen target that controls a large number of processes in animals. Our results show that natural selection acting on immune related genes has contributed to genetic divergence between salmon populations in Norway. The differences between populations may have been facilitated by the plasticity of the salmon genome. The observed signatures of selection in duplicated genomic regions suggest that the recently duplicated genome has provided raw material for evolutionary adaptation.

  18. Expression of immune genes on chromosome 6p21.3-22.1 in schizophrenia.


    Sinkus, Melissa L; Adams, Catherine E; Logel, Judith; Freedman, Robert; Leonard, Sherry


    Schizophrenia is a common mental illness with a large genetic component. Three genome-wide association studies have implicated the major histocompatibility complex gene region on chromosome 6p21.3-22.1 in schizophrenia. In addition, nicotine, which is commonly abused in schizophrenia, affects the expression of central nervous system immune genes. Messenger RNA levels for genes in the 6p21.3-22.1 region were measured in human postmortem hippocampus of 89 subjects. The effects of schizophrenia diagnosis, smoking and systemic inflammatory illness were compared. Cell-specific expression patterns for the class I major histocompatibility complex gene HLA-A were explored utilizing in situ hybridization. Expression of five genes was altered in schizophrenic subjects. Messenger RNA levels for the class I major histocompatibility complex antigen HLA-B were increased in schizophrenic nonsmokers, while levels for smokers were indistinguishable from those of controls. β2 microglobulin, HLA-A and Notch4 were all expressed in a pattern where inflammatory illness was associated with increased expression in controls but not in subjects with schizophrenia. Schizophrenia was also associated with increased expression of Butyrophilin 2A2. HLA-A was expressed in glutamatergic and GABAergic neurons in the dentate gyrus, hilus, and the stratum pyramidale of the CA1-CA4 regions of the hippocampus, but not in astrocytes. In conclusion, the expression of genes from the major histocompatibility complex region of chromosome 6 with likely roles in synaptic development is altered in schizophrenia. There were also significant interactions between schizophrenia diagnosis and both inflammatory illness and smoking.

  19. Evolution of African swine fever virus genes related to evasion of host immune response.


    Frączyk, Magdalena; Woźniakowski, Grzegorz; Kowalczyk, Andrzej; Bocian, Łukasz; Kozak, Edyta; Niemczuk, Krzysztof; Pejsak, Zygmunt


    African swine fever (ASF) is a notifiable and one of the most complex and devastating infectious disease of pigs, wild boars and other representatives of Suidae family. African swine fever virus (ASFV) developed various molecular mechanisms to evade host immune response including alteration of interferon production by multigene family protein (MGF505-2R), inhibition of NF-κB and nuclear activating factor in T-cells by the A238L protein, or modulation of host defense by CD2v lectin-like protein encoded by EP402R and EP153R genes. The current situation concerning ASF in Poland seems to be stable in comparison to other eastern European countries but up-to-date in total 106 ASF cases in wild boar and 5 outbreaks in pigs were identified. The presented study aimed to reveal and summarize the genetic variability of genes related to inhibition or modulation of infected host response among 67 field ASF isolates collected from wild boar and pigs. The nucleotide sequences derived from the analysed A238L and EP153R regions showed 100% identity. However, minor but remarkable genetic diversity was found within EP402R and MGF505-2R genes suggesting slow molecular evolution of circulating ASFV isolates and the important role of this gene in modulation of interferon I production and hemadsorption phenomenon. The obtained nucleotide sequences of Polish ASFV isolates were closely related to Georgia 2007/1 and Odintsovo 02/14 isolates suggesting their common Caucasian origin. In the case of EP402R and partially in MGF505-2R gene the identified genetic variability was related to spatio-temporal occurrence of particular cases and outbreaks what may facilitate evolution tracing of ASFV isolates. This is the first report indicating identification of genetic variability within the genes related to evasion of host immune system which may be used to trace the direction of ASFV isolates molecular evolution. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Deletion of the K1L Gene Results in a Vaccinia Virus That Is Less Pathogenic Due to Muted Innate Immune Responses, yet Still Elicits Protective Immunity.


    Bravo Cruz, Ariana G; Han, Aiguo; Roy, Edward J; Guzmán, Arielle B; Miller, Rita J; Driskell, Elizabeth A; O'Brien, William D; Shisler, Joanna L


    All viruses strategically alter the antiviral immune response to their benefit. The vaccinia virus (VACV) K1 protein has multiple immunomodulatory effects in tissue culture models of infection, including NF-κB antagonism. However, the effect of K1 during animal infection is poorly understood. We determined that a K1L-less vaccinia virus (vΔK1L) was less pathogenic than wild-type VACV in intranasal and intradermal models of infection. Decreased pathogenicity was correlated with diminished virus replication in intranasally infected mice. However, in intradermally inoculated ears, vΔK1L replicated to levels nearly identical to those of VACV, implying that the decreased immune response to vΔK1L infection, not virus replication, dictated lesion size. Several lines of evidence support this theory. First, vΔK1L induced slightly less edema than vK1L, as revealed by histopathology and noninvasive quantitative ultrasound technology (QUS). Second, infiltrating immune cell populations were decreased in vΔK1L-infected ears. Third, cytokine and chemokine gene expression was decreased in vΔK1L-infected ears. While these results identified the biological basis for smaller lesions, they remained puzzling; because K1 antagonizes NF-κB in vitro, antiviral gene expression was expected to be higher during vΔK1L infection. Despite these diminished innate immune responses, vΔK1L vaccination induced a protective VACV-specific CD8(+) T cell response and protected against a lethal VACV challenge. Thus, vΔK1L is the first vaccinia virus construct reported that caused a muted innate immune gene expression profile and decreased immune cell infiltration in an intradermal model of infection yet still elicited protective immunity.IMPORTANCE The vaccinia virus (VACV) K1 protein inhibits NF-κB activation among its other antagonistic functions. A virus lacking K1 (vΔK1L) was predicted to be less pathogenic because it would trigger a more robust antiviral immune response than VACV

  1. CD14, a Key Candidate Gene Associated with Specific Immune Response to Cockroach

    PubMed Central

    Gao, Peisong; Grigoryev, Dmitry N.; Rafaels, Nicholas M.; Mu, Deguang; Wright, Jerry M.; Cheadle, Christopher; Togias, Alkis; Beaty, Terri H.; Mathias, Rasika A.; Schroeder, John T.; Barnes, Kathleen C.


    Summary Background Sensitization to cockroach allergen is one of the strongest predictors of asthma morbidity, especially among African Americans. Objective Our aims were to determine the genomic basis of cockroach sensitization and the specific response to cockroach antigen. Methods We investigated the Th1/Th2 cytokine profile of co-cultured plasmacytoid DCs (pDCs) and CD4+ T cells and the “transcript signature” of the immune response to cockroach antigen using high-throughput expression profiling of co-cultured cells. Results We observed significantly elevated levels of IL-13, IL-10 and TNF-α, but undetectable levels of IL-12p70 and IFN-α, when cultures were exposed to crude cockroach antigen. A significant difference was observed for IL-13 between cockroach allergic and non-allergic individuals (p = 0.039). Microarray analyses demonstrated a greater response at 48 hours compared to 4 hours, with 50 genes being uniquely expressed in cockroach antigen-treated cells, including CD14, S100A8, CCL8, and IFI44L. The increased CD14 expression was further observed in purified pDCs, human monocytic THP-1 cells, and supernatant of co-cultured pDCs and CD4+ T cells in exposure to cockroach extract. Furthermore, the most differential expression of CD14 between cockroach allergy and non-cockroach allergy was only observed among individuals with the CC “high-risk” genotype of the CD14 -260C/T. Ingenuity Pathways Analysis (IPA) analyses suggested the interferon-signaling as the most significant canonical pathway. Conclusion Our results suggest these differentially expressed genes, particularly CD14, and genes in the interferon-signaling pathway may be important candidates for further investigation of their role in the immune response to cockroach allergen. PMID:20618347

  2. Polymorphisms in inflammatory and immune response genes associated with cerebral cavernous malformation type 1 severity

    PubMed Central

    Choquet, Hélène; Pawlikowska, Ludmila; Nelson, Jeffrey; McCulloch, Charles E.; Akers, Amy; Baca, Beth; Khan, Yasir; Hart, Blaine; Morrison, Leslie; Kim, Helen


    Background Familial cerebral cavernous malformation type 1 (CCM1) is an autosomal dominant disease caused by mutations in the Krev Interaction Trapped 1 (KRIT1/CCM1) gene, and characterized by multiple brain lesions that often result in intracerebral hemorrhage (ICH), seizures, and neurological deficits. Carriers of the same genetic mutation can present with variable symptoms and severity of disease, suggesting the influence of modifier factors. Evidence is emerging that inflammation and immune response play a role in the pathogenesis of CCM. The purpose of this study was to investigate whether common variants in inflammatory and immune response genes influence the severity of familial CCM1 disease, as manifested by ICH and greater brain lesion count. Methods Hispanic CCM1 patients (n=188) harboring the founder Q455X ‘common Hispanic mutation’ (CHM) in the KRIT1 gene were analyzed at baseline. Participants were enrolled between June 2010 and March 2014 either through the Brain Vascular Malformation Consortium (BVMC) study or through the Angioma Alliance organization. Clinical assessment and cerebral susceptibility-weighted magnetic resonance imaging were performed to determine ICH as well as total and large (≥5 mm in diameter) lesion counts. Samples were genotyped on the Affymetrix Axiom Genome-Wide LAT1 Human Array. We analyzed 830 variants in 56 inflammatory and immune response genes for association with ICH and residuals of log-transformed total or large lesion count adjusted for age at enrollment and gender. Variants were analyzed individually, grouped by sub-pathways or whole pathway. Results At baseline, 30.3% of CCM1-CHM subjects had ICH, with a mean ± standard deviation (SD) of 60.1 ± 115.0 (range 0 to 713) for total lesions and 4.9 ± 8.7 (range 0 to 104) for large lesions. The heritability estimates explained by all autosomal variants were 0.20 (SE=0.31), 0.81 (SE=0.17) and 0.48 (SE=0.19), for ICH, total lesion count and large lesion count

  3. De Novo assembly of the Japanese flounder (Paralichthys olivaceus) spleen transcriptome to identify putative genes involved in immunity.


    Huang, Lin; Li, Guiyang; Mo, Zhaolan; Xiao, Peng; Li, Jie; Huang, Jie


    Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Asia and has suffered from disease outbreaks caused by various pathogens, which requires more information for immune relevant genes on genome background. However, genomic and transcriptomic data for Japanese flounder remain scarce, which limits studies on the immune system of this species. In this study, we characterized the Japanese flounder spleen transcriptome using an Illumina paired-end sequencing platform to identify putative genes involved in immunity. A cDNA library from the spleen of P. olivaceus was constructed and randomly sequenced using an Illumina technique. The removal of low quality reads generated 12,196,968 trimmed reads, which assembled into 96,627 unigenes. A total of 21,391 unigenes (22.14%) were annotated in the NCBI Nr database, and only 1.1% of the BLASTx top-hits matched P. olivaceus protein sequences. Approximately 12,503 (58.45%) unigenes were categorized into three Gene Ontology groups, 19,547 (91.38%) were classified into 26 Cluster of Orthologous Groups, and 10,649 (49.78%) were assigned to six Kyoto Encyclopedia of Genes and Genomes pathways. Furthermore, 40,928 putative simple sequence repeats and 47, 362 putative single nucleotide polymorphisms were identified. Importantly, we identified 1,563 putative immune-associated unigenes that mapped to 15 immune signaling pathways. The P. olivaceus transciptome data provides a rich source to discover and identify new genes, and the immune-relevant sequences identified here will facilitate our understanding of the mechanisms involved in the immune response. Furthermore, the plentiful potential SSRs and SNPs found in this study are important resources with respect to future development of a linkage map or marker assisted breeding programs for the flounder.

  4. Threonine modulates immune response, antioxidant status and gene expressions of antioxidant enzymes and antioxidant-immune-cytokine-related signaling molecules in juvenile blunt snout bream (Megalobrama amblycephala).


    Habte-Tsion, Habte-Michael; Ren, Mingchun; Liu, Bo; Ge, Xianping; Xie, Jun; Chen, Ruli


    A 9-week feeding trial was conducted to investigate the effects of graded dietary threonine (Thr) levels (0.58-2.58%) on the hematological parameters, immune response, antioxidant status and hepatopancreatic gene expression of antioxidant enzymes and antioxidant-immune-cytokine-related signaling molecules in juvenile blunt snout bream. For this purpose, 3 tanks were randomly arranged and assigned to each experimental diet. Fish were fed with their respective diet to apparent satiation 4 times daily. The results indicated that white blood cell, red blood cell and haemoglobin significantly responded to graded dietary Thr levels, while hematocrit didn't. Complement components (C3 and C4), total iron-binding capacity (TIBC), immunoglobulin M (IgM), superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) increased with increasing dietary Thr levels up to 1.58-2.08% and thereafter tended to decrease. Dietary Thr regulated the gene expressions of Cu/Zn-SOD, Mn-SOD and CAT, GPx1, glutathione S-transferase mu (GST), nuclear factor erythroid 2-related factor 2 (Nrf2), heat shock protein-70 (Hsp70), tumor necrosis factor-alpha (TNF-α), apolipoprotein A-I (ApoA1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and fructose-bisphosphate aldolase B (ALDOB); while the gene expression of peroxiredoxin II (PrxII) was not significantly modified by graded Thr levels. These genes are involved in different functions including antioxidant, immune, and defense responses, energy metabolism and protein synthesis. Therefore, this study could provide a new molecular tool for studies in fish immunonutrition and shed light on the regulatory mechanisms that dietary Thr improved the antioxidant and immune capacities of fish.

  5. Cord blood gene expression supports that prenatal exposure to perfluoroalkyl substances causes depressed immune functionality in early childhood.


    Pennings, Jeroen L A; Jennen, Danyel G J; Nygaard, Unni C; Namork, Ellen; Haug, Line S; van Loveren, Henk; Granum, Berit


    Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are a class of synthetic compounds that have widespread use in consumer and industrial applications. PFAS are considered environmental pollutants that have various toxic properties, including effects on the immune system. Recent human studies indicate that prenatal exposure to PFAS leads to suppressed immune responses in early childhood. In this study, data from the Norwegian BraMat cohort was used to investigate transcriptomics profiles in neonatal cord blood and their association with maternal PFAS exposure, anti-rubella antibody levels at 3 years of age and the number of common cold episodes until 3 years. Genes associated with PFAS exposure showed enrichment for immunological and developmental functions. The analyses identified a toxicogenomics profile of 52 PFAS exposure-associated genes that were in common with genes associated with rubella titers and/or common cold episodes. This gene set contains several immunomodulatory genes (CYTL1, IL27) as well as other immune-associated genes (e.g. EMR4P, SHC4, ADORA2A). In addition, this study identified PPARD as a PFAS toxicogenomics marker. These markers can serve as the basis for further mechanistic or epidemiological studies. This study provides a transcriptomics connection between prenatal PFAS exposure and impaired immune function in early childhood and supports current views on PPAR- and NF-κB-mediated modes of action. The findings add to the available evidence that PFAS exposure is immunotoxic in humans and support regulatory policies to phase out these substances.

  6. Possible influence of B chromosomes on genes included in immune response and parasite burden in Apodemus flavicollis.


    Adnađević, Tanja; Jovanović, Vladimir M; Blagojević, Jelena; Budinski, Ivana; Cabrilo, Borislav; Bjelić-Čabrilo, Olivera; Bijelić-Čabrilo, Olivera; Vujošević, Mladen


    Genetic background underlying wild populations immune response to different parasites is still not well understood. We studied immune response to multiple infections and to competition between different parasite species at different developmental stages in population of yellow-necked mouse, Apodemus flavicollis. Quantitative real-time PCR was used to investigate associations of MHC II-DRB, IL-10 and Tgf-β genes expressions with presence of intestinal parasites at different developmental stages. Furthermore, we were interested whether the host related characteristics (sex, age, body condition, presence of B chromosomes or expression of other genes) or characteristics of present parasites (number of adult parasites of each identified species, egg count of each parasite genus, total number of nematode individuals) affect differential expression of the studied genes. A significant invert association between the expression of MHC II-DRB and Tgf-β gene was found, which together with absence of IL-10 association confirmed modified Th2 as the main type of immune response to nematode infections. Effect of recorded parasites and parasite life-cycle stage on expression levels of MHC II-DRB gene was detected only through interactions with host-related characteristics such as sex, age, and the presence of B chromosomes. The presence of B chromosomes is associated with lower expression level of Tgf-β gene. Although the influence of host genetic background on parasite infection has already been well documented, this is the first study in mammals that gave presence of B chromosomes on immune response full consideration.

  7. Hepatic expression patterns of inflammatory and immune response genes associated with obesity and NASH in morbidly obese patients.


    Bertola, Adeline; Bonnafous, Stéphanie; Anty, Rodolphe; Patouraux, Stéphanie; Saint-Paul, Marie-Christine; Iannelli, Antonio; Gugenheim, Jean; Barr, Jonathan; Mato, José M; Le Marchand-Brustel, Yannick; Tran, Albert; Gual, Philippe


    Obesity modulates inflammation and activation of immune pathways which can lead to liver complications. We aimed at identifying expression patterns of inflammatory and immune response genes specifically associated with obesity and NASH in the liver of morbidly obese patients. Expression of 222 genes was evaluated by quantitative RT-PCR in the liver of morbidly obese patients with histologically normal liver (n = 6), or with severe steatosis without (n = 6) or with NASH (n = 6), and in lean controls (n = 5). Hepatic expression of 58 out of 222 inflammatory and immune response genes was upregulated in NASH patients. The most notable changes occurred in genes encoding chemokines and chemokine receptors involved in leukocyte recruitment, CD and cytokines involved in the T cell activation towards a Th1 phenotype, and immune semaphorins. This regulation seems to be specific for the liver since visceral adipose tissue expression and serum levels of MCP1, IP10, TNFα and IL6 were not modified. Importantly, 47 other genes were already upregulated in histologically normal liver (e.g. CRP, Toll-like receptor (TLR) pathway). Interestingly, serum palmitate, known to activate the TLR pathway, was increased with steatosis. The liver of obese patients without histological abnormalities already displayed a low-grade inflammation and could be more responsive to activators of the TLR pathway. NASH was then characterized by a specific gene signature. These findings help to identify new potential actors of the pathogenesis of NAFLD.

  8. Transcriptomics of the late gestation ovine fetal brain: modeling the co-expression of immune marker genes.


    Rabaglino, Maria B; Keller-Wood, Maureen; Wood, Charles E


    Major changes in gene expression occur in the fetal brain to modulate the function of this organ postnatally. Thus, factors can alter the genomics of the fetal brain, predisposing to neurological disorders later in life. We hypothesized that the physiological dynamics of the immune system transcriptome of the fetal brain during the last stage of gestation will reveal patterns of immune function and development in the developing brain. In this study we applied weighted gene co-expression analysis of microarrays performed on ovine fetal brain samples, to model the changes in gene expression throughout the second half of gestation. Clusters of co-expressed genes that strongly increase in expression toward the first day of extra-uterine life are related to the hematopoietic lineage, while activation of immune pathways is induced after birth. Moreover, the pattern of gene expression suggests induction of tolerance mechanisms, probably necessary to protect highly produced proteins--such as myelin basic protein--from an autoimmune attack. This study provides insight into the dramatic changes in gene expression that take place in the brain during the fetal life, especially during the last stage of gestation, and suggests that the immune system may have an important role in maturation of the fetal brain, which if disrupted or altered, could have negative consequences in postnatal life.

  9. Conjugal immunity of Streptomyces strains carrying the integrative element pSAM2 is due to the pif gene (pSAM2 immunity factor).


    Possoz, Christophe; Gagnat, Josette; Sezonov, Guennadi; Guérineau, Michel; Pernodet, Jean-Luc


    Mechanisms of conjugal immunity preventing redundant exchange between two cells harbouring the same conjugative element have been reported in diverse bacteria. Such a system does exist for pSAM2, a conjugative and integrative element of Streptomyces. The apparition of the conjugative free form of pSAM2 in the donor strain during mating can be considered as the initial step of transfer. We analysed the genes involved in transfer inhibition by mating donors harbouring pSAM2 with recipient strains containing different regions of pSAM2. The conjugal immunity was previously thought to be mediated by the transcriptional repressor KorSA. Although the transfer efficiency is reduced by its presence in the recipient, the initiation of the transfer process is not affected. In contrast, the presence in the recipient strain of a single pSAM2 gene, pif (pSAM2 immunity factor), was sufficient to abolish both transfer and initiation of transfer. Thus, the clustered genes korSA and pif act complementarily to maintain pSAM2 in a 'prophage' state under non-conjugal conditions. KorSA is involved in intracellular signalling, whereas Pif participates in intercellular signalling. The Pif nudix motif is essential for its activity. This is the first protein of the nudix family shown to be involved in bacterial conjugation.

  10. A member of the immunoglobulin superfamily, orange-spotted grouper novel immune gene EcVig, is induced by immune stimulants and type I interferon.


    Yeh, Ying-Chun; Wang, Ting-Yu; Chou, Hsin-Yiu; Lin, Han-You; Chen, Tzong-Yueh; Aoki, Takashi; Wang, Han-Ching


    A novel grouper immune gene, EcVig was identified in orange-spotted grouper (Epinephelus coioides). We recently determined that EcVig expression can be induced by infection with nervous necrosis virus (NNV, an RNA virus), whereas NNV replication may be suppressed when EcVig was overexpressed. Although EcVig appeared to be involved in grouper antiviral activity, its immune effects have not been well characterized. In the present study, two PAMPs (pathogen-associated molecular patterns; lipopolysaccharides [LPS] and synthetic double-stranded RNA polyriboinosinic-polyribocytidylic acid [poly(I:C)]), as well as fish DNA virus (red sea bream iridovirus, RSIV; grouper iridovirus, GIV), were used to study EcVig responses in orange-spotted grouper. In addition, groupers were given recombinant type I interferon to determine whether EcVig expression was induced. Poly(I:C) rapidly induced substantial expression of EcVig, whereas LPS stimulation did not appear to have any effect in grouper intestine. Expression levels of total EcVig and other IFN-stimulated genes (ISGs) were all significantly increased after RSIV and GIV infection. Furthermore, stimulation of recombinant type I IFN also increased EcVig expression. We conclude that EcVig may be a novel IFN-stimulated gene that demonstrates an antiviral immune response.

  11. Differential expression of immune-related genes between healthy volunteers and type 2 diabetic patients with spleen-deficiency pattern.


    Chen, Longhui; Yang, Zemin; Chen, Weiwen; Li, Ruliu; Lin, Chuanquan; Guan, Lihua; Zhu, Zhangzhi; Chen, Ruifang; Li, Saimei; Zhao, Lingbo; Zeng, Jinhao; Wang, Jianhua


    To investigate the clinical differentia tion of spleen-deficiency pattern (SDP), a group of symptoms and signs defined in terms of Traditional Chinese Medicine for its clinical practice. Peripheral venous blood (> 3 mL) was collected from each of six type 2 diabetes mellitus (T2DM)-SDP patients and six healthy volunteers. After the isolation of peripheral white blood cells (PWBCs), total RNA was extracted, and quality control was performed on all RNA samples. Microarray experiments were conducted using the Agilent human whole genome gene chip, and genes demonstrating differential expression were screened. Bioinformatics analysis was conducted on these genes using several online databases. We screened a total of 175 differentially expressed genes (DEGs), of which 111 (63%) were down-regulated and 64 (37%) were up-regulated in T2DM-SDP patients compared with healthy controls. Among the 175 genes, 158 had biological function annotations: 46 (29%) were directly related to an individual's immune regulation or response, 25 (16%) were associated with substance and energy metabolism of PWBCs which could also indirectly influence immunity, and the remaining 87 (55%) were involved in a variety of PWBC biological processes that might eventually influence the immune function. Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis revealed that the DEGs were predominantly enriched in seven immune-related pathways. Hierarchical cluster analysis identified gene expression patterns that were distinguishable between the two study groups. Our results suggest that T2DM-SDP patients experience significant hypoimmunity and/or immune dysfunctions, and possess a specific gene expression profile. These findings offer new insights into SDP and the clinical pattern differentiation of T2DM-SDP.

  12. Parallel declines in cognition, motivation, and locomotion in aging mice: association with immune gene upregulation in the medial prefrontal cortex

    PubMed Central

    Bordner, Kelly A.; Kitchen, Robert R.; Carlyle, Becky; George, Elizabeth D.; Mahajan, Milind C.; Mane, Shrikant M.; Taylor, Jane R.; Simen, Arthur A.


    Aging in humans is associated with parallel changes in cognition, motivation, and motoric performance. Based on the human aging literature, we hypothesized that this constellation of age-related changes is mediated by the medial prefrontal cortex and that it would be observed in aging mice. Toward this end, we performed detailed assessments of cognition, motivation, and motoric behavior in aging mice. We assessed behavioral and cognitive performance in C57Bl/6 mice aged 6, 18, and 24 months, and followed this with microarray analysis of tissue from the medial prefrontal cortex and analysis of serum cytokine levels. Multivariate modeling of these data suggested that the age-related changes in cognition, motivation, motor performance, and prefrontal immune gene expression were highly correlated. Peripheral cytokine levels were also correlated with these variables, but less strongly than measures of prefrontal immune gene upregulation. To determine whether the observed immune gene expression changes were due to prefrontal microglial cells, we isolated CD11b-positive cells from the prefrontal cortex and subject them to next-generation RNA sequencing. Many of the immune changes present in whole medial prefrontal cortex were enriched in this cell population. These data suggest that, as in humans, cognition, motivation, and motoric performance in the mouse change together with age and are strongly associated with CNS immune gene upregulation. PMID:21453768

  13. A sulfated galactans supplemented diet enhances the expression of immune genes and protects against Vibrio parahaemolyticus infection in shrimp.


    Rudtanatip, Tawut; Boonsri, Nantavadee; Asuvapongpatana, Somluk; Withyachumnarnkul, Boonsirm; Wongprasert, Kanokpan


    A sulfated galactans (SG) supplemented diet was evaluated for the potential to stimulate immune activity in shrimp Penaeus vannamei (P. vannamei). Shrimp given the SG supplemented diet (0.5, 1 and 2% w/w) for 7 days showed enhanced expression of the downstream signaling mediator of lipopolysaccharide and β-1,3-glucan binding protein (LGBP) and immune related genes including p-NF-κB, IMD, IKKβ and IKKε, antimicrobial peptide PEN-4, proPO-I and II. Following immersion with Vibrio parahaemolyticus (V. parahaemolyticus) for 14 days, the shrimp given the SG supplemented diet (1 and 2% w/w) showed a decrease in bacterial colonies and bacterial toxin gene expression, compared to shrimp given a normal diet, and they reached 50% mortality at day 14. However, shrimp given the normal diet and challenged with the bacteria reached 100% mortality at day 6. SG-fed shrimp increased expression of immune genes related to LGBP signaling at day 1 after the bacterial immersion compared to control (no immersion), which later decreased to control levels. Shrimp on the normal diet also increased expression of immune related genes at day 1 after immersion which however decreased below control levels by day 3. Taken together, the results indicate the efficacy of the SG supplemented diet to enhance the immune activity in shrimp which could offer protection from V. parahaemolyticus infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Immune gene expression in the spleen of chickens experimentally infected with Ascaridia galli.


    Dalgaard, Tina S; Skovgaard, Kerstin; Norup, Liselotte R; Pleidrup, Janne; Permin, Anders; Schou, Torben W; Vadekær, Dorte F; Jungersen, Gregers; Juul-Madsen, Helle R


    Ascaridia galli is a gastrointestinal nematode infecting chickens. Chickens kept in alternative rearing systems or at free-range experience increased risk for infection with resulting high prevalences. A. galli infection causes reduced weight gain, decreased egg production and in severe cases increased mortality. More importantly, the parasitised chickens are more susceptible to secondary infections and their ability to develop vaccine-induced protective immunity against other diseases may be compromised. Detailed information about the immune response to the natural infection may be exploited to enable future vaccine development. In the present study, expression of immune genes in the chicken spleen during an experimental infection with A. galli was investigated using the Fluidigm(®) BioMark™ microfluidic qPCR platform which combines automatic high-throughput with attractive low sample and reagent consumption. Spleenic transcription of immunological genes was compared between infected chickens and non-infected controls at week 2, 6, and 9 p.i. corresponding to different stages of parasite development/maturation. At week 2 p.i. increased expression of IL-13 was observed in infected chickens. Increased expression of MBL, CRP, IFN-α, IL-1β, IL-8, IL-12β and IL-18 followed at week 6 p.i. and at both week 6 and 9 p.i. expression of DEFβ1 was highly increased in infected chickens. In summary, apart from also earlier reported increased expression of the Th2 signature cytokine IL-13 we observed only few differentially expressed genes at week 2 p.i. which corresponds to the larvae histotrophic phase. In contrast, we observed increased expression of pro-inflammatory cytokines and acute phase proteins in infected chickens, by week 6 p.i. where the larvae re-enter the intestinal lumen. Increased expression of DEFβ1 was observed in infected chickens at week 6 p.i. but also at week 9 p.i. which corresponds to a matured stage where adult worms are present in the

  15. Molecular characterization and immune response expression of the QM gene from the scallop Chlamys farreri.


    Chen, Guofu; Zhang, Chunyun; Wang, Yue; Wang, Yuanyuan; Guo, Changlu; Wang, Chongming


    The scallop Chlamys farreri is an important aquaculture species in northern China. However, the sustainable development of the scallop industry is currently threatened by several pathogens that cause mass mortality of this mollusk. Therefore, a complete understanding of the immune response mechanisms involved in host-virus interactions is necessary. This study reports a novel QM gene from C. farreri. This gene was first identified as a putative tumor suppressor gene from human and then confirmed to participate in several functions, including immune response. The QM gene from C. farreri (CfQM) was identified by suppression subtractive hybridization, and its full-length (763 bp) cDNA was obtained through rapid amplification of cDNA ends. The cDNA of CfQM contained a short 5'-UTR of 22 bp and a 3'-UTR of 84 bp. Its ORF comprised 657 nucleotides that encode 218 amino acids with a molecular weight of approximately 28.3 kDa and an isoelectric point of 10.06. The deduced amino acid sequence of CfQM contained a series of conserved functional motifs that belong to the QM family. Phylogenetic analysis revealed that CfQM was closely related to other mollusk QM proteins, and altogether they form a mollusk QM protein subfamily that displays evolutionary conservation from yeast to human. The tissue-specific expression and transcriptional regulation of CfQM were investigated by quantitative real-time PCR in response to bacterial (Vibrio anguillarum) and viral (acute viral necrobiotic virus) challenges. The transcript level of CfQM was high in all of the examined tissues in a constitutive manner. The highest and lowest expression levels of CfQM were measured in the hepatopancreas and hemocyte, respectively. Upon bacterial and viral challenges, the relative mRNA expression of CfQM sharply increased at 6 h post-infection (hpi) and then normalized at 48 hpi. These findings suggest that CfQM can respond to and protect against pathogen challenge. To the best of our knowledge, this

  16. Systems Biology Analysis of Gene Expression during In Vivo Mycobacterium avium paratuberculosis Enteric Colonization Reveals Role for Immune Tolerance

    PubMed Central

    Khare, Sangeeta; Lawhon, Sara D.; Drake, Kenneth L.; Nunes, Jairo E. S.; Figueiredo, Josely F.; Rossetti, Carlos A.; Gull, Tamara; Everts, Robin E.; Lewin, Harris A.; Galindo, Cristi L.; Garner, Harold R.; Adams, Leslie Garry


    Survival and persistence of Mycobacterium avium subsp. paratuberculosis (MAP) in the intestinal mucosa is associated with host immune tolerance. However, the initial events during MAP interaction with its host that lead to pathogen survival, granulomatous inflammation, and clinical disease progression are poorly defined. We hypothesize that immune tolerance is initiated upon initial contact of MAP with the intestinal Peyer's patch. To test our hypothesis, ligated ileal loops in neonatal calves were infected with MAP. Intestinal tissue RNAs were collected (0.5, 1, 2, 4, 8 and 12 hrs post-infection), processed, and hybridized to bovine gene expression microarrays. By comparing the gene transcription responses of calves infected with the MAP, informative complex patterns of expression were clearly visible. To interpret these complex data, changes in the gene expression were further analyzed by dynamic Bayesian analysis, and genes were grouped into the specific pathways and gene ontology categories to create a holistic model. This model revealed three different phases of responses: i) early (30 min and 1 hr post-infection), ii) intermediate (2, 4 and 8 hrs post-infection), and iii) late (12 hrs post-infection). We describe here the data that include expression profiles for perturbed pathways, as well as, mechanistic genes (genes predicted to have regulatory influence) that are associated with immune tolerance. In the Early Phase of MAP infection, multiple pathways were initiated in response to MAP invasion via receptor mediated endocytosis and changes in intestinal permeability. During the Intermediate Phase, perturbed pathways involved the inflammatory responses, cytokine-cytokine receptor interaction, and cell-cell signaling. During the Late Phase of infection, gene responses associated with immune tolerance were initiated at the level of T-cell signaling. Our study provides evidence that MAP infection resulted in differentially regulated genes, perturbed pathways

  17. Systems biology analysis of gene expression during in vivo Mycobacterium avium paratuberculosis enteric colonization reveals role for immune tolerance.


    Khare, Sangeeta; Lawhon, Sara D; Drake, Kenneth L; Nunes, Jairo E S; Figueiredo, Josely F; Rossetti, Carlos A; Gull, Tamara; Everts, Robin E; Lewin, Harris A; Galindo, Cristi L; Garner, Harold R; Adams, Leslie Garry


    Survival and persistence of Mycobacterium avium subsp. paratuberculosis (MAP) in the intestinal mucosa is associated with host immune tolerance. However, the initial events during MAP interaction with its host that lead to pathogen survival, granulomatous inflammation, and clinical disease progression are poorly defined. We hypothesize that immune tolerance is initiated upon initial contact of MAP with the intestinal Peyer's patch. To test our hypothesis, ligated ileal loops in neonatal calves were infected with MAP. Intestinal tissue RNAs were collected (0.5, 1, 2, 4, 8 and 12 hrs post-infection), processed, and hybridized to bovine gene expression microarrays. By comparing the gene transcription responses of calves infected with the MAP, informative complex patterns of expression were clearly visible. To interpret these complex data, changes in the gene expression were further analyzed by dynamic Bayesian analysis, and genes were grouped into the specific pathways and gene ontology categories to create a holistic model. This model revealed three different phases of responses: i) early (30 min and 1 hr post-infection), ii) intermediate (2, 4 and 8 hrs post-infection), and iii) late (12 hrs post-infection). We describe here the data that include expression profiles for perturbed pathways, as well as, mechanistic genes (genes predicted to have regulatory influence) that are associated with immune tolerance. In the Early Phase of MAP infection, multiple pathways were initiated in response to MAP invasion via receptor mediated endocytosis and changes in intestinal permeability. During the Intermediate Phase, perturbed pathways involved the inflammatory responses, cytokine-cytokine receptor interaction, and cell-cell signaling. During the Late Phase of infection, gene responses associated with immune tolerance were initiated at the level of T-cell signaling. Our study provides evidence that MAP infection resulted in differentially regulated genes, perturbed pathways

  18. The role of the innate immune response regulatory gene ABCF1 in mammalian embryogenesis and development.


    Wilcox, Sara M; Arora, Hitesh; Munro, Lonna; Xin, Jian; Fenninger, Franz; Johnson, Laura A; Pfeifer, Cheryl G; Choi, Kyung Bok; Hou, Juan; Hoodless, Pamela A; Jefferies, Wilfred A


    ABCF1 is an ABC transporter family protein that has been shown to regulate innate immune response and is a risk gene for autoimmune pancreatitis and arthritis. Unlike other members of ABC transporter family, ABCF1 lacks trans-membrane domains and is thought to function in translation initiation through an interaction with eukaryotic translation initiation factor 2 (eIF2). To study ABCF1 expression and function in development and disease, we used a single gene trap insertion in the Abcf1 gene in murine embryonic stem cells (ES cells) that allowed lineage tracing of the endogenous Abcf1 promoter by following the expression of a β-galactosidase reporter gene. From the ES cells, heterozygous mice (Abcf1+/-) were produced. No live born Abcf1-/- progeny were ever generated, and the lethality was not mouse strain-specific. Thus, we have determined that Abcf1 is an essential gene in development. Abcf1-/- mice were found to be embryonic lethal at 3.5 days post coitum (dpc), while Abcf1+/- mice appeared developmentally normal. Abcf1+/- mice were fertile and showed no significant differences in their anatomy when compared with their wild type littermates. The Abcf1 promoter was found to be active in all organs in adult mice, but varies in levels of expression in specific cell types within tissues. Furthermore, we observed high promoter activity in the blastocysts and embryos. Overall, Abcf1 expression in embryos is required for development and its expression in adults was highly correlated with actively proliferating and differentiating cell types.

  19. Innate immune genes in persistent mating-induced endometritis in horses.


    Marth, Christina D; Firestone, Simon M; Hanlon, Dave; Glenton, Lisa Y; Browning, Glenn F; Young, Neil D; Krekeler, Natali


    Persistent mating-induced endometritis (PMIE) severely decreases fertility in horses. The aim of the present study was to evaluate differences between horses susceptible to PMIE and a control group in terms of the expression of selected immune response and effector genes, and the effects of oestrous cycle stage on this expression. Endometrial biopsies from 18 uterine samples of mares in the control group (eight in dioestrus, 10 in oestrus) and 16 PMIE-susceptible mares (four in dioestrus, 12 in oestrus) were analysed by quantitative real-time reverse transcription-polymerase chain reaction. Genes for pathogen recognition receptors Toll-like receptor 2 (TLR2) and NLR family CARD domain containing 5 (NLRC5), as well as tissue-specific inhibitor of metalloproteinase 1 (TIMP1), C-X-C motif chemokine ligand (CXCL) 9, CXCL10 and CXCL11 and uteroferrin were expressed at similar levels in the control group and in susceptible mares. Genes for C-C motif chemokine ligand 2 (CCL2) and the antimicrobial peptides secreted phospholipase A2 (sPLA2), lipocalin 2 and lactoferrin were all expressed at higher levels in susceptible compared with control mares. The expression of genes for the antimicrobial peptides equine β-defensin 1 (EBD1), lysozyme (LYZ) and secretory leukoprotease inhibitor (SLPI) was also higher in susceptible than control mares. The diagnostic sensitivity of assays for EBD1, LYZ and SLP1 gene expression to detect susceptibility to PMIE was estimated to be 100%, 94% and 100% respectively, with specificities of 83%, 78% and 78% respectively. When all three tests were positive, the specificity increased to 94%, with an overall sensitivity of 94%. The present study has yielded insights into pathophysiological changes in mares susceptible to PMIE and identified robust diagnostic markers (EBD1, LYZ and SLPI) for susceptibility to this disease.

  20. Association between Age at Diagnosis of Graves' Disease and Variants in Genes Involved in Immune Response

    PubMed Central

    Jurecka-Lubieniecka, Beata; Ploski, Rafal; Kula, Dorota; Krol, Aleksandra; Bednarczuk, Tomasz; Kolosza, Zofia; Tukiendorf, Andrzej; Szpak-Ulczok, Sylwia; Stanjek-Cichoracka, Anita; Polanska, Joanna; Jarzab, Barbara


    Background Graves' disease (GD) is a complex disease in which genetic predisposition is modified by environmental factors. The aim of the study was to examine the association between genetic variants in genes encoding proteins involved in immune response and the age at diagnosis of GD. Methods 735 GD patients and 1216 healthy controls from Poland were included into the study. Eight genetic variants in the HLA-DRB1, TNF, CTLA4, CD40, NFKb, PTPN22, IL4 and IL10 genes were genotyped. Patients were stratified by the age at diagnosis of GD and the association with genotype was analysed. Results Polymorphism in the HLA-DRB1, TNF and CTLA4 genes were associated with GD. The carriers of the HLA DRB1*03 allele were more frequent in patients with age at GD diagnosis ≤30 years than in patients with older age at GD diagnosis. Conclusions HLADRB1*03 allele is associated with young age at diagnosis of Graves' disease in polish population. PMID:23544060

  1. Gene/cell therapy approaches for Immune Dysregulation Polyendocrinopathy Enteropathy X-linked syndrome.


    Passerini, Laura; Santoni de Sio, Francesca R; Porteus, Matthew H; Bacchetta, Rosa


    Immune dysregulation, Polyendocrinopathy, Enteropathy, X-linked (IPEX) syndrome is a rare autoimmune disease due to mutations in the gene encoding for Forkhead box P3 (FOXP3), a transcription factor fundamental for the function of thymus-derived (t) regulatory T (Treg) cells. The dysfunction of Treg cells results in the development of devastating autoimmune manifestations affecting multiple organs, eventually leading to premature death in infants, if not promptly treated by hematopoietic stem cell transplantation (HSCT). Novel gene therapy strategies can be developed for IPEX syndrome as more definitive cure than allogeneic HSCT. Here we describe the therapeutic approaches, alternative to HSCT, currently under development. We described that effector T cells can be converted in regulatory T cells by LV-mediated FOXP3-gene transfer in differentiated T lymphocytes. Despite FOXP3 mutations mainly affect a highly specific T cell subset, manipulation of stem cells could be required for long-term remission of the disease. Therefore, we believe that a more comprehensive strategy should aim at correcting FOXP3-mutated stem cells. Potentials and hurdles of both strategies will be highlighted here.

  2. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera

    PubMed Central

    Mao, Wenfu; Schuler, Mary A.; Berenbaum, May R.


    As a managed pollinator, the honey bee Apis mellifera is critical to the American agricultural enterprise. Recent colony losses have thus raised concerns; possible explanations for bee decline include nutritional deficiencies and exposures to pesticides and pathogens. We determined that constituents found in honey, including p-coumaric acid, pinocembrin, and pinobanksin 5-methyl ether, specifically induce detoxification genes. These inducers are primarily found not in nectar but in pollen in the case of p-coumaric acid (a monomer of sporopollenin, the principal constituent of pollen cell walls) and propolis, a resinous material gathered and processed by bees to line wax cells. RNA-seq analysis (massively parallel RNA sequencing) revealed that p-coumaric acid specifically up-regulates all classes of detoxification genes as well as select antimicrobial peptide genes. This up-regulation has functional significance in that that adding p-coumaric acid to a diet of sucrose increases midgut metabolism of coumaphos, a widely used in-hive acaricide, by ∼60%. As a major component of pollen grains, p-coumaric acid is ubiquitous in the natural diet of honey bees and may function as a nutraceutical regulating immune and detoxification processes. The widespread apicultural use of honey substitutes, including high-fructose corn syrup, may thus compromise the ability of honey bees to cope with pesticides and pathogens and contribute to colony losses. PMID:23630255

  3. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera.


    Mao, Wenfu; Schuler, Mary A; Berenbaum, May R


    As a managed pollinator, the honey bee Apis mellifera is critical to the American agricultural enterprise. Recent colony losses have thus raised concerns; possible explanations for bee decline include nutritional deficiencies and exposures to pesticides and pathogens. We determined that constituents found in honey, including p-coumaric acid, pinocembrin, and pinobanksin 5-methyl ether, specifically induce detoxification genes. These inducers are primarily found not in nectar but in pollen in the case of p-coumaric acid (a monomer of sporopollenin, the principal constituent of pollen cell walls) and propolis, a resinous material gathered and processed by bees to line wax cells. RNA-seq analysis (massively parallel RNA sequencing) revealed that p-coumaric acid specifically up-regulates all classes of detoxification genes as well as select antimicrobial peptide genes. This up-regulation has functional significance in that that adding p-coumaric acid to a diet of sucrose increases midgut metabolism of coumaphos, a widely used in-hive acaricide, by ∼60%. As a major component of pollen grains, p-coumaric acid is ubiquitous in the natural diet of honey bees and may function as a nutraceutical regulating immune and detoxification processes. The widespread apicultural use of honey substitutes, including high-fructose corn syrup, may thus compromise the ability of honey bees to cope with pesticides and pathogens and contribute to colony losses.

  4. Identification and isolation of stimulator of interferon genes (STING): an innate immune sensory and adaptor gene from camelids.


    Premraj, A; Aleyas, A G; Nautiyal, B; Rasool, T J


    The mechanism by which type I interferon-mediated antiviral response is mounted by hosts against invading pathogen is an intriguing one. Of late, an endoplasmic reticulum transmembrane protein encoded by a gene called stimulator of interferon genes (STING) is implicated in the innate signalling pathways and has been identified and cloned in few mammalian species including human, mouse and pig. In this article, we report the identification of STING from three different species of a highly conserved family of mammals - the camelids. cDNAs encoding the STING of Old World camels - dromedary camel (Camelus dromedarius) and bactrian camel (Camelus bactrianus) and a New World camel - llama (Llama glama) were amplified using conserved primers and RACE. The complete STING cDNA of dromedary camel is 2171 bp long with a 706-bp 5' untranslated regions (UTR), an 1137-bp open reading frame (ORF) and a 328-bp 3' UTR. Sequence and phylogenetic analysis of the ORF of STING from these three camelids indicate high level of similarity among camelids and conservation of critical amino acid residues across different species. Quantitative real-time PCR analysis revealed high levels of STING mRNA expression in blood, spleen, lymph node and lung. The identification of camelid STING will help in better understanding of the role of this molecule in the innate immunity of the camelids and other mammals.

  5. Oral delivery of live yeast Debaryomyces hansenii modulates the main innate immune parameters and the expression of immune-relevant genes in the gilthead seabream (Sparus aurata L.).


    Reyes-Becerril, Martha; Salinas, Irene; Cuesta, Alberto; Meseguer, José; Tovar-Ramirez, Dariel; Ascencio-Valle, Felipe; Esteban, Maria Angeles


    Microorganisms isolated from fish can be used as prophylactic tools for aquaculture in the form of probiotic preparations. The purpose of this study was to evaluate the effects of dietary administration of the live yeast Debaryomyces hansenii CBS 8339 on the gilthead seabream (Sparus aurata L.) innate immune responses. Seabream were fed control or D. hansenii-supplemented diets (10(6) colony forming units, CFU g(-1)) for 4 weeks. Humoral (seric alternative complement and peroxidase activities), and cellular (peroxidase, phagocytic, respiratory burst and cytotoxic activities) innate immune parameters and antioxidant enzymes (superoxide dismutase (SOD) and catalase (CAT)) were measured from serum, head-kidney leucocytes and liver, respectively, after 2 and 4 weeks of feeding. Expression levels of immune-associated genes, Hep, IgM, TCR-beta, NCCRP-1, MHC-II alpha, CSF-1R, C3, TNF-alpha and IL-1 beta, were also evaluated by real-time PCR in head-kidney, liver and intestine. Humoral immune parameters were not significantly affected by the dietary supplementation of yeast at any time of the experiment. On the other hand, D. hansenii administration significantly enhanced leucocyte peroxidase and respiratory burst activity at week 4. Phagocytic and cytotoxic activities had significantly increased by week 2 of feeding yeast but unchanged by week 4. A significant increase in liver SOD activity was observed at week 2 of feeding with the supplemented diet; however CAT activity was not affected by the dietary yeast supplement at any time of the experiment. Finally, the yeast supplemented diet down-regulated the expression of most seabream genes, except C3, in liver and intestine and up-regulated all of them in the head-kidney. These results strongly support the idea that live yeast Debaryomyces hansenii strain CBS 8339 can stimulate the innate immune parameters in seabream, especially at cellular level.

  6. Venom of Parasitoid, Pteromalus puparum, Suppresses Host, Pieris rapae, Immune Promotion by Decreasing Host C-Type Lectin Gene Expression

    PubMed Central

    Fang, Qi; Wang, Fei; Gatehouse, John A.; Gatehouse, Angharad M. R.; Chen, Xue-xin; Hu, Cui; Ye, Gong-yin


    Background Insect hosts have evolved immunity against invasion by parasitoids, and in co-evolutionary response parasitoids have also developed strategies to overcome host immune systems. The mechanisms through which parasitoid venoms disrupt the promotion of host immunity are still unclear. We report here a new mechanism evolved by parasitoid Pteromalus puparum, whose venom inhibited the promotion of immunity in its host Pieris rapae (cabbage white butterfly). Methodology/Principal Findings A full-length cDNA encoding a C-type lectin (Pr-CTL) was isolated from P. rapae. Quantitative PCR and immunoblotting showed that injection of bacterial and inert beads induced expression of Pr-CTL, with peaks of mRNA and Pr-CTL protein levels at 4 and 8 h post beads challenge, respectively. In contrast, parasitoid venom suppressed Pr-CTL expression when co-injected with beads, in a time and dose-dependent manner. Immunolocalization and immunoblotting results showed that Pr-CTL was first detectable in vesicles present in cytoplasm of granulocytes in host hemolymph, and was then secreted from cells into circulatory fluid. Finally, the secreted Pr-CTL bound to cellular membranes of both granulocytes and plasmatocytes. Injection of double-stranded RNA specific for target gene decreased expression of Pr-CTL, and a few other host immune-related genes. Suppression of Pr-CTL expression also down-regulated antimicrobial and phenoloxidase activities, and reducing phagocytotic and encapsulation rates in host. The inhibitory effect of parasitoid venom on host encapsulation is consistent with its effect in suppressing Pr-CTL expression. Binding assay results showed that recombinant Pr-CTL directly attached to the surface of P. puparum egges. We infer that Pr-CTL may serve as an immune signalling co-effector, first binding to parasitoid eggs, regulating expression of a set of immune-related genes and promoting host immunity. Conclusions/Significance P. puparum venom inhibits promotion of host

  7. Burkholderia pseudomallei Differentially Regulates Host Innate Immune Response Genes for Intracellular Survival in Lung Epithelial Cells

    PubMed Central

    Vellasamy, Kumutha Malar; Mariappan, Vanitha; Shankar, Esaki M.; Vadivelu, Jamuna


    Background Burkholderia pseudomallei, the causative agent of melioidosis poses a serious threat to humankind. B. pseudomallei secretes numerous virulence proteins that alter host cell functions to escape from intracellular immune sensors. However, the events underlying disease pathogenesis are poorly understood. Methods We determined the ability of B. pseudomallei to invade and survive intracellularly in A549 human lung epithelial cells, and also investigated the early transcriptional responses using an Illumina HumanHT-12 v4 microarray platform, after three hours of exposure to live B. pseudomallei (BCMS) and its secreted proteins (CCMS). Results We found that the ability of B. pseudomallei to invade and survive intracellularly correlated with increase of multiplicity of infection and duration of contact. Activation of host carbohydrate metabolism and apoptosis as well as suppression of amino acid metabolism and innate immune responses both by live bacteria and its secreted proteins were evident. These early events might be linked to initial activation of host genes directed towards bacterial dissemination from lungs to target organs (via proposed in vivo mechanisms) or to escape potential sensing by macrophages. Conclusion Understanding the early responses of A549 cells toward B. pseudomallei infection provide preliminary insights into the likely pathogenesis mechanisms underlying melioidosis, and could contribute to development of novel intervention strategies to combat B. pseudomallei infections. PMID:27367858

  8. Digital Quantification of Gene Expression in Sequential Breast Cancer Biopsies Reveals Activation of an Immune Response

    PubMed Central

    Jeselsohn, Rinath M.; Werner, Lillian; Regan, Meredith M.; Fatima, Aquila; Gilmore, Lauren; Collins, Laura C.; Beck, Andrew H.; Bailey, Shannon T.; He, Housheng Hansen; Buchwalter, Gilles; Brown, Myles; Iglehart, J. Dirk; Richardson, Andrea; Come, Steven E.


    Advancements in molecular biology have unveiled multiple breast cancer promoting pathways and potential therapeutic targets. Large randomized clinical trials remain the ultimate means of validating therapeutic efficacy, but they require large cohorts of patients and are lengthy and costly. A useful approach is to conduct a window of opportunity study in which patients are exposed to a drug pre-surgically during the interval between the core needle biopsy and the definitive surgery. These are non-therapeutic studies and the end point is not clinical or pathological response but rather evaluation of molecular changes in the tumor specimens that can predict response. However, since the end points of the non-therapeutic studies are biologic, it is critical to first define the biologic changes that occur in the absence of treatment. In this study, we compared the molecular profiles of breast cancer tumors at the time of the diagnostic biopsy versus the definitive surgery in the absence of any intervention using the Nanostring nCounter platform. We found that while the majority of the transcripts did not vary between the two biopsies, there was evidence of activation of immune related genes in response to the first biopsy and further investigations of the immune changes after a biopsy in early breast cancer seem warranted. PMID:23741308

  9. Therapeutic Response in Feline Sandhoff Disease Despite Immunity to Intracranial Gene Therapy

    PubMed Central

    Bradbury, Allison M; Cochran, J Nicholas; McCurdy, Victoria J; Johnson, Aime K; Brunson, Brandon L; Gray-Edwards, Heather; Leroy, Stanley G; Hwang, Misako; Randle, Ashley N; Jackson, Laura S; Morrison, Nancy E; Baek, Rena C; Seyfried, Thomas N; Cheng, Seng H; Cox, Nancy R; Baker, Henry J; Cachón-González, M Begona; Cox, Timothy M; Sena-Esteves, Miguel; Martin, Douglas R


    Salutary responses to adeno-associated viral (AAV) gene therapy have been reported in the mouse model of Sandhoff disease (SD), a neurodegenerative lysosomal storage disease caused by deficiency of β-N-acetylhexosaminidase (Hex). While untreated mice reach the humane endpoint by 4.1 months of age, mice treated by a single intracranial injection of vectors expressing human hexosaminidase may live a normal life span of 2 years. When treated with the same therapeutic vectors used in mice, two cats with SD lived to 7.0 and 8.2 months of age, compared with an untreated life span of 4.5 ± 0.5 months (n = 11). Because a pronounced humoral immune response to both the AAV1 vectors and human hexosaminidase was documented, feline cDNAs for the hexosaminidase α- and β-subunits were cloned into AAVrh8 vectors. Cats treated with vectors expressing feline hexosaminidase produced enzymatic activity >75-fold normal at the brain injection site with little evidence of an immune infiltrate. Affected cats treated with feline-specific vectors by bilateral injection of the thalamus lived to 10.4 ± 3.7 months of age (n = 3), or 2.3 times as long as untreated cats. These studies support the therapeutic potential of AAV vectors for SD and underscore the importance of species-specific cDNAs for translational research. PMID:23689599

  10. Immunization with the cysteine proteinase Ldccys1 gene from Leishmania (Leishmania) chagasi and the recombinant Ldccys1 protein elicits protective immune responses in a murine model of visceral leishmaniasis.


    Ferreira, Josie Haydée L; Gentil, Luciana Girotto; Dias, Suzana Souza; Fedeli, Carlos Eduardo C; Katz, Simone; Barbiéri, Clara Lúcia


    The gene Ldccys1 encoding a cysteine proteinase of 30 kDa from Leishmania (Leishmania) chagasi, as well as the recombinant cysteine proteinase rLdccys1, obtained by cloning and expression of the Ldccys1 gene in the pHIS vector, were used to evaluate their ability to induce immune protective responses in BALB/c mice against L. (L.) chagasi infection. Mice were immunized subcutaneously with rLdccys1 plus Bacille Calmette Guerin (BCG) or Propionibacterium acnes as adjuvants or intramuscularly with a plasmid carrying the Ldccys1 gene (Ldccys1/pcDNA3) and CpG ODN as the adjuvant, followed by a booster with rLdccys1 plus CpG ODN. Two weeks after immunization the animals were challenged with 1 x 10(7) amastigotes of L. (L.) chagasi. Both immunization protocols induced significant protection against L. (L.) chagasi infection as shown by a very low parasite load in the spleen of immunized mice compared to the non-immunized controls. However, DNA immunization was 10-fold more protective than immunization with the recombinant protein. Whereas rLdccys1 induced a significant secretion of IFN-gamma and nitric oxide (NO), animals immunized with the Ldccys1 gene increased the production of IgG2a antibodies, IFN-gamma and NO. These results indicated that protection triggered by the two immunization protocols was correlated to a predominant Th1 response.

  11. Widespread seasonal gene expression reveals annual differences in human immunity and physiology

    PubMed Central

    Dopico, Xaquin Castro; Evangelou, Marina; Ferreira, Ricardo C.; Guo, Hui; Pekalski, Marcin L.; Smyth, Deborah J.; Cooper, Nicholas; Burren, Oliver S.; Fulford, Anthony J.; Hennig, Branwen J.; Prentice, Andrew M.; Ziegler, Anette-G.; Bonifacio, Ezio; Wallace, Chris; Todd, John A.


    Seasonal variations are rarely considered a contributing component to human tissue function or health, although many diseases and physiological process display annual periodicities. Here we find more than 4,000 protein-coding mRNAs in white blood cells and adipose tissue to have seasonal expression profiles, with inverted patterns observed between Europe and Oceania. We also find the cellular composition of blood to vary by season, and these changes, which differ between the United Kingdom and The Gambia, could explain the gene expression periodicity. With regards to tissue function, the immune system has a profound pro-inflammatory transcriptomic profile during European winter, with increased levels of soluble IL-6 receptor and C-reactive protein, risk biomarkers for cardiovascular, psychiatric and autoimmune diseases that have peak incidences in winter. Circannual rhythms thus require further exploration as contributors to various aspects of human physiology and disease. PMID:25965853

  12. Control of immune ligands by members of a cytomegalovirus gene expansion suppresses natural killer cell activation

    PubMed Central

    Fielding, Ceri A; Weekes, Michael P; Nobre, Luis V; Ruckova, Eva; Wilkie, Gavin S; Paulo, Joao A; Chang, Chiwen; Suárez, Nicolás M; Davies, James A; Antrobus, Robin; Stanton, Richard J; Aicheler, Rebecca J; Nichols, Hester; Vojtesek, Borek; Trowsdale, John; Davison, Andrew J; Gygi, Steven P


    The human cytomegalovirus (HCMV) US12 family consists of ten sequentially arranged genes (US12-21) with poorly characterized function. We now identify novel natural killer (NK) cell evasion functions for four members: US12, US14, US18 and US20. Using a systematic multiplexed proteomics approach to quantify ~1300 cell surface and ~7200 whole cell proteins, we demonstrate that the US12 family selectively targets plasma membrane proteins and plays key roles in regulating NK ligands, adhesion molecules and cytokine receptors. US18 and US20 work in concert to suppress cell surface expression of the critical NKp30 ligand B7-H6 thus inhibiting NK cell activation. The US12 family is therefore identified as a major new hub of immune regulation. DOI: PMID:28186488

  13. Dietary sodium propionate affects mucosal immune parameters, growth and appetite related genes expression: Insights from zebrafish model.


    Hoseinifar, Seyed Hossein; Safari, Roghieh; Dadar, Maryam


    Propionate is a short-chain fatty acid (SCFA) that improves physiological and pathophysiological properties. However, there is limited information available about the effects of SCFAs on mucosal immune parameters as well as growth and appetite related genes expression. The aim of the present study was to evaluate the effect of sodium propionate (SP) intake on the mucosal immune parameters, growth and appetite related genes expression using zebrafish (Danio rerio) as model organism. Zebrafish fed control or diet supplemented with different levels (0.5, 1 and 2%) of SP for 8weeks. At the end of feeding trial, the expression of the key genes related to growth and appetite (GH, IGF1, MYSTN and Ghrl) was evaluated. Also, mucosal immune parameters (Total Ig, lysozyme and protease activity) were studied in skin mucus of zebrafish. The results showed that dietary administration of SP significantly (P<0.05) up-regulated the expression of GH, IGF1 and down-regulated MYSTN gene. Also, feeding zebrafish with SP supplemented diet significantly increased appetite related gene expression (P<0.05) with a more pronounced effect in higher inclusion levels. Compared with control group, the expression of appetite related gene (Ghrl) was remarkably (P<0.05) higher in SP fed zebrafish. Also, elevated mucosal immune parameters was observed in zebrafish fed SP supplemented diet. The present results revealed beneficial effects of dietary SP on mucosal immune response and growth and appetite related genes expression. These results also highlighted the potential use of SP as additive in human diets. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Effect of Ipr1 on expression levels of immune genes related to macrophage anti-infection of mycobacterium tuberculosis

    PubMed Central

    Li, Na; Liu, Pengfei; Wang, Lianwen; Liu, Jingbo; Yuan, Xiao; Meng, Wei; Dong, Yan; Li, Boqing


    Background: Intracellular pathogen resistance 1 (Ipr1) has been found in macrophages and plays a pivotal role in fighting against Mycobacterium tuberculosis (Mtb) infection. This study is designed to evaluate the effect of Iprl on the expression of macrophage genes related to the anti-infection of Mtb. Design or methods: In the experimental and control groups, the macrophages were infected with Mycobacterium H37Ra, and then the related immune genes between two groups were detected using microarray assay. Real-time quantitative PCR was applied to detect the differences in the expression of three up-regulated genes detected by microarray assay and to verify the reliability of microarray assay. Results: The expression of Iprl up-regulated 11 genes related to macrophage anti-immunity involved TLRs signaling pathway including TLR2 and TLR4, Irak1, Traf7, Ifngr1 and Tnfrsfla. No significant difference was found in terms of the molecular expression involved in regulation of the adaptive immune response, such as IL-1 and IL-12. The results of real-time PCR were consistent with the findings of microarray assay. Conclusions: The expression of Iprl gene probably promotes macrophage activity and enhances the ability of macrophages to fight against Mtb infection. The underlying mechanism may be achieved by up-regulating the expression levels of innate immunity genes, especially TLR2/TLR4 and signal transduction molecules, which is determined using microarray assay. All these findings offer the basis for subsequent study of the mechanisms of Ipr1 gene in host innate immunity against Mtb infection. PMID:26064231

  15. High-Throughput Sequence Analysis of Turbot (Scophthalmus maximus) Transcriptome Using 454-Pyrosequencing for the Discovery of Antiviral Immune Genes

    PubMed Central

    Pereiro, Patricia; Balseiro, Pablo; Romero, Alejandro; Dios, Sonia; Forn-Cuni, Gabriel; Fuste, Berta; Planas, Josep V.; Beltran, Sergi; Novoa, Beatriz; Figueras, Antonio


    Background Turbot (Scophthalmus maximus L.) is an important aquacultural resource both in Europe and Asia. However, there is little information on gene sequences available in public databases. Currently, one of the main problems affecting the culture of this flatfish is mortality due to several pathogens, especially viral diseases which are not treatable. In order to identify new genes involved in immune defense, we conducted 454-pyrosequencing of the turbot transcriptome after different immune stimulations. Methodology/Principal Findings Turbot were injected with viral stimuli to increase the expression level of immune-related genes. High-throughput deep sequencing using 454-pyrosequencing technology yielded 915,256 high-quality reads. These sequences were assembled into 55,404 contigs that were subjected to annotation steps. Intriguingly, 55.16% of the deduced protein was not significantly similar to any sequences in the databases used for the annotation and only 0.85% of the BLASTx top-hits matched S. maximus protein sequences. This relatively low level of annotation is possibly due to the limited information for this specie and other flatfish in the database. These results suggest the identification of a large number of new genes in turbot and in fish in general. A more detailed analysis showed the presence of putative members of several innate and specific immune pathways. Conclusions/Significance To our knowledge, this study is the first transcriptome analysis using 454-pyrosequencing for turbot. Previously, there were only 12,471 EST and less of 1,500 nucleotide sequences for S. maximus in NCBI database. Our results provide a rich source of data (55,404 contigs and 181,845 singletons) for discovering and identifying new genes, which will serve as a basis for microarray construction, gene expression characterization and for identification of genetic markers to be used in several applications. Immune stimulation in turbot was very effective, obtaining an

  16. Expression profiling analysis of immune-related genes in channel catfish (Ictalurus punctatus) skin mucus following Flavobacterium columnare challenge.


    Ren, Yichao; Zhao, Honggang; Su, Baofeng; Peatman, Eric; Li, Chao


    Fish are covered by a watery gel-mucus, mainly secreted by the goblet cells, serving as the physical and biochemical barrier between the external environment and the interior milieu, playing more important roles in fish that without scale. Despite the important roles of mucus in fish immunity, the knowledge of detailed molecular events happened during infection process is still limited. While most studies were focused on characterizing the protein and enzyme activities in the mucus following challenge, no studies have examined the gene expression profiles in fish mucus. In this regard, herein we carried out the first gene profiling analysis in catfish mucus using real-time PCR. Ten important immune-related genes were selected according to our previous studies. Their expression levels were examined in the early timepoints (namely, 1 h, 2 h, 4 h, 8 h, and 24 h) following Flavobacterium columnare challenge. Notably, expression levels of most of the selected genes were rapidly altered by the challenge. Seven genes were down-regulated, while only three genes were up-regulated. In addition, the gene expression patterns in mucus were very different from the mucosal surfaces (skin, gill and intestine) and the classical immune organs (liver, spleen and kidney). The unique expression patterns obtained here may be resulted from the great advantage of the large amount of attached bacteria in the mucus than the internal tissues, and resulted from the bacteria virulent actors to suppress the host immune response. Taken together, our results can expand our knowledge of fish mucosal immunity, and the un-lethal mucus sampling can provide early insight for developing the strategies for selection of disease resistant families and strains in catfish as well as other fish species.

  17. Finding immune gene expression differences induced by marine bacterial pathogens in the deep-sea hydrothermal vent mussel Bathymodiolus azoricus

    NASA Astrophysics Data System (ADS)

    Martins, E.; Queiroz, A.; Serrão Santos, R.; Bettencourt, R.


    The deep-sea hydrothermal vent mussel Bathymodiolus azoricus lives in a natural environment characterized by extreme conditions of hydrostatic pressure, temperature, pH, high concentrations of heavy metals, methane and hydrogen sulphide. The deep-sea vent biological systems represent thus the opportunity to study and provide new insights into the basic physiological principles that govern the defense mechanisms in vent animals and to understand how they cope with microbial infections. Hence, the importance of understanding this animal's innate defense mechanisms, by examining its differential immune gene expressions toward different pathogenic agents. In the present study, B. azoricus mussels were infected with single suspensions of marine bacterial pathogens, consisting of Vibrio splendidus, Vibrio alginolyticus, or Vibrio anguillarum, and a pool of these Vibrio strains. Flavobacterium suspensions were also used as an irrelevant bacterium. Gene expression analyses were carried out using gill samples from animals dissected at 12 h and 24 h post-infection times by means of quantitative-Polymerase Chain Reaction aimed at targeting several immune genes. We also performed SDS-PAGE protein analyses from the same gill tissues. We concluded that there are different levels of immune gene expression between the 12 h and 24 h exposure times to various bacterial suspensions. Our results from qPCR demonstrated a general pattern of gene expression, decreasing from 12 h over 24 h post-infection. Among the bacteria tested, Flavobacterium is the microorganism species inducing the highest gene expression level in 12 h post-infections animals. The 24 h infected animals revealed, however, greater gene expression levels, using V. splendidus as the infectious agent. The SDS-PAGE analysis also pointed at protein profile differences between 12 h and 24 h, particularly around a protein area, of 18 KDa molecular mass, where most dissimilarities were found. Multivariate analyses

  18. Finding immune gene expression differences induced by marine bacterial pathogens in the Deep-sea hydrothermal vent mussel Bathymodiolus azoricus

    NASA Astrophysics Data System (ADS)

    Martins, E.; Queiroz, A.; Serrão Santos, R.; Bettencourt, R.


    The deep-sea hydrothermal vent mussel Bathymodiolus azoricus lives in a natural environment characterised by extreme conditions of hydrostatic pressure, temperature, pH, high concentrations of heavy metals, methane and hydrogen sulphide. The deep-sea vent biological systems represent thus the opportunity to study and provide new insights into the basic physiological principles that govern the defense mechanisms in vent animals and to understand how they cope with microbial infections. Hence, the importance of understanding this animal's innate defense mechanisms, by examining its differential immune gene expressions toward different pathogenic agents. In the present study, B. azoricus mussels were infected with single suspensions of marine bacterial pathogens, consisting of Vibrio splendidus, Vibrio alginolyticus, or Vibrio anguillarum, and a pool of these Vibrio bacteria. Flavobacterium suspensions were also used as a non-pathogenic bacterium. Gene expression analyses were carried out using gill samples from infected animals by means of quantitative-Polymerase Chain Reaction aimed at targeting several immune genes. We also performed SDS-PAGE protein analyses from the same gill tissues. We concluded that there are different levels of immune gene expression between the 12 h to 24 h exposure times to various bacterial suspensions. Our results from qPCR demonstrated a general pattern of gene expression, decreasing from 12 h over 24 h post-infection. Among the bacteria tested, Flavobacterium is the bacterium inducing the highest gene expression level in 12 h post-infections animals. The 24 h infected animals revealed, however, greater gene expression levels, using V. splendidus as the infectious agent. The SDS-PAGE analysis also pointed at protein profile differences between 12 h and 24 h, particularly evident for proteins of 18-20 KDa molecular mass, where most dissimilarity was found. Multivariate analyses demonstrated that immune genes, as well as experimental

  19. Expression Analysis of Immune Related Genes Identified from the Coelomocytes of Sea Cucumber (Apostichopus japonicus) in Response to LPS Challenge

    PubMed Central

    Dong, Ying; Sun, Hongjuan; Zhou, Zunchun; Yang, Aifu; Chen, Zhong; Guan, Xiaoyan; Gao, Shan; Wang, Bai; Jiang, Bei; Jiang, Jingwei


    The sea cucumber (Apostichopus japonicus) occupies a basal position during the evolution of deuterostomes and is also an important aquaculture species. In order to identify more immune effectors, transcriptome sequencing of A. japonicus coelomocytes in response to lipopolysaccharide (LPS) challenge was performed using the Illumina HiSeq™ 2000 platform. One hundred and seven differentially expressed genes were selected and divided into four functional categories including pathogen recognition (25 genes), reorganization of cytoskeleton (27 genes), inflammation (41 genes) and apoptosis (14 genes). They were analyzed to elucidate the mechanisms of host-pathogen interactions and downstream signaling transduction. Quantitative real-time polymerase chain reactions (qRT-PCRs) of 10 representative genes validated the accuracy and reliability of RNA sequencing results with the correlation coefficients from 0.88 to 0.98 and p-value <0.05. Expression analysis of immune-related genes after LPS challenge will be useful in understanding the immune response mechanisms of A. japonicus against pathogen invasion and developing strategies for resistant markers selection. PMID:25421239

  20. Tumor-derived exosomes regulate expression of immune function-related genes in human T cell subsets

    PubMed Central

    Muller, Laurent; Mitsuhashi, Masato; Simms, Patricia; Gooding, William E.; Whiteside, Theresa L.


    Tumor cell-derived exosomes (TEX) suppress functions of immune cells. Here, changes in the gene profiles of primary human T lymphocytes exposed in vitro to exosomes were evaluated. CD4+ Tconv, CD8+ T or CD4+ CD39+ Treg were isolated from normal donors’ peripheral blood and co-incubated with TEX or exosomes isolated from supernatants of cultured dendritic cells (DEX). Expression levels of 24–27 immune response-related genes in these T cells were quantified by qRT-PCR. In activated T cells, TEX and DEX up-regulated mRNA expression levels of multiple genes. Multifactorial data analysis of ΔCt values identified T cell activation and the immune cell type, but not exosome source, as factors regulating gene expression by exosomes. Treg were more sensitive to TEX-mediated effects than other T cell subsets. In Treg, TEX-mediated down-regulation of genes regulating the adenosine pathway translated into high expression of CD39 and increased adenosine production. TEX also induced up-regulation of inhibitory genes in CD4+ Tconv, which translated into a loss of CD69 on their surface and a functional decline. Exosomes are not internalized by T cells, but signals they carry and deliver to cell surface receptors modulate gene expression and functions of human T lymphocytes. PMID:26842680

  1. Tumor-derived exosomes regulate expression of immune function-related genes in human T cell subsets.


    Muller, Laurent; Mitsuhashi, Masato; Simms, Patricia; Gooding, William E; Whiteside, Theresa L


    Tumor cell-derived exosomes (TEX) suppress functions of immune cells. Here, changes in the gene profiles of primary human T lymphocytes exposed in vitro to exosomes were evaluated. CD4(+) Tconv, CD8(+) T or CD4(+) CD39(+) Treg were isolated from normal donors' peripheral blood and co-incubated with TEX or exosomes isolated from supernatants of cultured dendritic cells (DEX). Expression levels of 24-27 immune response-related genes in these T cells were quantified by qRT-PCR. In activated T cells, TEX and DEX up-regulated mRNA expression levels of multiple genes. Multifactorial data analysis of ΔCt values identified T cell activation and the immune cell type, but not exosome source, as factors regulating gene expression by exosomes. Treg were more sensitive to TEX-mediated effects than other T cell subsets. In Treg, TEX-mediated down-regulation of genes regulating the adenosine pathway translated into high expression of CD39 and increased adenosine production. TEX also induced up-regulation of inhibitory genes in CD4(+) Tconv, which translated into a loss of CD69 on their surface and a functional decline. Exosomes are not internalized by T cells, but signals they carry and deliver to cell surface receptors modulate gene expression and functions of human T lymphocytes.

  2. Expression of Innate Immune Response Genes in Liver and Three Types of Adipose Tissue in Cloned Pigs

    PubMed Central

    Rødgaard, Tina; Skovgaard, Kerstin; Stagsted, Jan


    Abstract The pig has been proposed as a relevant model for human obesity-induced inflammation, and cloning may improve the applicability of this model. We tested the assumptions that cloning would reduce interindividual variation in gene expression of innate immune factors and that their expression would remain unaffected by the cloning process. We investigated the expression of 40 innate immune factors by high-throughput quantitative real-time PCR in samples from liver, abdominal subcutaneous adipose tissue (SAT), visceral adipose tissue (VAT), and neck SAT in cloned pigs compared to normal outbred pigs. The variation in gene expression was found to be similar for the two groups, and the expression of a small number of genes was significantly affected by cloning. In the VAT and abdominal SAT, six out of seven significantly differentially expressed genes were downregulated in the clones. In contrast, most differently expressed genes in both liver and neck SAT were upregulated (seven out of eight). Remarkably, acute phase proteins (APPs) dominated the upregulated genes in the liver, whereas APP expression was either unchanged or downregulated in abdominal SAT and VAT. The general conclusion from this work is that cloning leads to subtle changes in specific subsets of innate immune genes. Such changes, even if minor, may have phenotypic effects over time, e.g., in models of long-term inflammation related to obesity. PMID:22928970

  3. Expression of innate immune response genes in liver and three types of adipose tissue in cloned pigs.


    Rødgaard, Tina; Skovgaard, Kerstin; Stagsted, Jan; Heegaard, Peter M H


    The pig has been proposed as a relevant model for human obesity-induced inflammation, and cloning may improve the applicability of this model. We tested the assumptions that cloning would reduce interindividual variation in gene expression of innate immune factors and that their expression would remain unaffected by the cloning process. We investigated the expression of 40 innate immune factors by high-throughput quantitative real-time PCR in samples from liver, abdominal subcutaneous adipose tissue (SAT), visceral adipose tissue (VAT), and neck SAT in cloned pigs compared to normal outbred pigs. The variation in gene expression was found to be similar for the two groups, and the expression of a small number of genes was significantly affected by cloning. In the VAT and abdominal SAT, six out of seven significantly differentially expressed genes were downregulated in the clones. In contrast, most differently expressed genes in both liver and neck SAT were upregulated (seven out of eight). Remarkably, acute phase proteins (APPs) dominated the upregulated genes in the liver, whereas APP expression was either unchanged or downregulated in abdominal SAT and VAT. The general conclusion from this work is that cloning leads to subtle changes in specific subsets of innate immune genes. Such changes, even if minor, may have phenotypic effects over time, e.g., in models of long-term inflammation related to obesity.

  4. The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

    PubMed Central

    Ovsyannikova, Inna G.; Haralambieva, Iana H.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.


    Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11–22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 105 PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR 2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines. PMID:21424379

  5. Peripheral arterial occlusive disease: global gene expression analyses suggest a major role for immune and inflammatory responses.


    Fu, Shijun; Zhao, Haiguang; Shi, Jiantao; Abzhanov, Arhat; Crawford, Keith; Ohno-Machado, Lucila; Zhou, Jianqin; Du, Yanzhi; Kuo, Winston Patrick; Zhang, Ji; Jiang, Mier; Jin, Jason Gang


    Peripheral arterial disease (PAD), a major manifestation of atherosclerosis, is associated with significant cardiovascular morbidity, limb loss and death. However, mechanisms underlying the genesis and progression of the disease are far from clear. Genome-wide gene expression profiling of clinical samples may represent an effective approach to gain relevant information. After histological classification, a total of 30 femoral artery samples, including 11 intermediate lesions, 14 advanced lesions and 5 normal femoral arteries, were profiled using Affymetrix microarray platform. Following real-time RT-PCR validation, different algorithms of gene selection and clustering were applied to identify differentially expressed genes. Under a stringent cutoff, i.e., a false discovery rate (FDR) <0.5%, we found 366 genes were differentially regulated in intermediate lesions and 447 in advanced lesions. Of these, 116 genes were overlapped between intermediate and advanced lesions, including 68 up-regulated genes and 48 down-regulated ones. In these differentially regulated genes, immune/inflammatory genes were significantly up-regulated in different stages of PAD, (85/230 in intermediate lesions, 37/172 in advanced lesions). Through literature mining and pathway analysis using different databases such as Gene Ontology (GO), and the Kyoto Encyclopedia of Gene and Genomics (KEGG), genes involved in immune/inflammatory responses were significantly enriched in up-regulated genes at different stages of PAD(p < 0.05), revealing a significant correlation between immune/inflammatory responses and disease progression. Moreover, immune-related pathways such as Toll-like receptor signaling and natural killer cell mediated cytotoxicity were particularly enriched in intermediate and advanced lesions (P < 0.05), highlighting their pathogenic significance during disease progression. Lines of evidence revealed in this study not only support previous hypotheses, primarily based on studies of

  6. Red mark syndrome in rainbow trout Oncorhynchus mykiss: investigation of immune responses in lesions using histology, immunohistochemistry and analysis of immune gene expression.


    McCarthy, Ú; Casadei, E; Wang, T; Secombes, C J


    Red mark syndrome (RMS) is an economically significant disease which affects farmed rainbow trout in the United Kingdom, in the US and in mainland Europe. From the pattern of incidence, it appears to be transmissable, although no causative agent has yet been identified. RMS presents as a severe lymphocytic infiltration centred on the dermis and an alternative, host-focused approach was taken to understand the disease through investigating immune responses occurring in the lesion. Lesion and non-lesion skin at different stages of lesion development were examined using histochemistry and immunohistochemistry on paraffin sections. Expression of immune-related genes was compared between lesion and non-lesion skin. Investigation of early stage lesions suggested that the initial immune response is targeted at the region of the scale pocket, with lymphocyte infiltration and anti-tumour necrosis factor (TNF)-α staining of the stratum spongiosum, and increased numbers of major histocompatibility complex (MHC) II-positive cells immediately adjacent to the scale pocket. Gene expression analysis suggested a counterbalancing T helper (Th)1 and T regulatory (Treg) - type response is occurring in the lesion, with repression of Th2 and Th17-type responses. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  7. Impact of date palm fruits extracts and probiotic enriched diet on antioxidant status, innate immune response and immune-related gene expression of European seabass (Dicentrarchus labrax).


    Guardiola, F A; Porcino, C; Cerezuela, R; Cuesta, A; Faggio, C; Esteban, M A


    The application of additives in the diet as plants or extracts of plants as natural and innocuous compounds has potential in aquaculture as an alternative to antibiotics and immunoprophylactics. The aim of the current study was to evaluate the potential effects of dietary supplementation of date palm fruit extracts alone or in combination with Pdp11 probiotic on serum antioxidant status, on the humoral and cellular innate immune status, as well as, on the expression levels of some immune-related genes in head-kidney and gut of European sea bass (Dicentrarchus labrax) after 2 and 4 weeks of administration. This study showed for the first time in European sea bass an immunostimulation in several of the parameters evaluated in fish fed with date palm fruits extracts enriched diet or fed with this substance in combination with Pdp 11 probiotic, mainly after 4 weeks of treatment. In the same way, dietary supplementation of mixture diet has positive effects on the expression levels of immune-related genes, chiefly in head-kidney of Dicentrarchus labrax. Therefore, the combination of both could be considered of great interest as potential additives for farmed fish. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Altered gene expression patterns of innate and adaptive immunity pathways in transgenic rainbow trout harboring Cecropin P1 transgene.


    Lo, Jay H; Lin, Chun-Mean; Chen, Maria J; Chen, Thomas T


    We have recently developed several homozygous families of transgenic rainbow trout harbouring cecropin P1 transgene. These fish exhibit resistance characteristic to infection by Aeromonas salmonicida and infectious hematopoietic necrosis virus (IHNV). In our earlier studies we have reported that treatment of a rainbow trout macrophage cell line (RTS11) with a linear cationic α-helical antimicrobial peptide (e.g., cecropin B) resulted in elevated levels of expression of two pro-inflammatory relevant genes (e.g., IL-1β and COX-2). Therefore, we hypothesized that in addition to the direct antimicrobial activity of cecropin P1 in the disease resistant transgenic rainbow trout, this antimicrobial peptide may also affect the expression of immune relevant genes in the host. To confirm this hypothesis, we launched a study to determine the global gene expression profiles in three immune competent organs of cecropin P1 transgenic rainbow trout by using a 44k salmonid microarray. From the microarray data, a total of 2480 genes in the spleen, 3022 in the kidney, and 2102 in the liver were determined as differentially expressed genes (DEGs) in the cecropin P1 transgenic rainbow trout when compared to the non-transgenics. There were 478 DEGs in common among three tissues. Enrichment analyses conducted by two different bioinformatics tools revealed a tissue specific profile of functional pathway perturbation. Many of them were directly related to innate immune system such as phagocytosis, lysosomal processing, complement activation, antigen processing/presentation, and leukocyte migration. Perturbation of other biological functions that might contribute indirectly to host immunity was also observed. The gene product of cecropin P1 transgene produced in the disease resistant transgenic rainbow trout not only can kill the pathogens directly but also exert multifaceted immunomodulatory properties to boost host immunity. The identified genes involved in different pathways related

  9. A mimotope gene encoding the major IgE epitope of allergen Phl p 5 for epitope-specific immunization.


    Wallmann, J; Proell, M; Stepanoska, T; Hantusch, B; Pali-Schöll, I; Thalhamer, T; Thalhamer, J; Jensen-Jarolim, E; Hartl, A


    A gene vaccine based on a mammalian expression vector containing the sequence of a peptide mimotope of Phl p 5 was constructed. To test whether mimotope gene vaccines can induce allergen-specific antibody responses via molecular mimicry, BALB/c mice were immunized using the mimotope construct with or without a tetanus toxin T-helper epitope. Moreover, intradermal injection was compared to epidermal application via gene gun immunization. Immunization with both mimotope gene constructs elicited allergen-specific antibody responses. As expected, gene gun bombardment induced a Th2-biased immune response, typically associated with IgG1 and IgE antibody production. In contrast, intradermal injection of the vaccine triggered IgG2a antibody expression without any detectable IgE levels, thus biasing the immune response towards Th1. In an RBL assay, mimotope-specific IgG antibodies were able to prevent cross-linking of allergen-specific IgE by Phl p 5. A construct coding for the complete Phl p 5 induced T-cell activation, IFN-gamma and IL-4 production. In contrast, the mimotope-DNA construct being devoid of allergen-specific T-cell epitopes had no capacity to activate allergen-specific T cells. Taken together, our data show that it is feasible to induce blocking IgG antibodies with a mimotope-DNA construct when applied intradermally. Thus the mimotope-DNA strategy has two advantages: (1) the avoidance of IgE induction and (2) the avoidance of triggering allergen-specific T-lymphocytes. We therefore suggest that mimotope gene vaccines are potential candidates for epitope-specific immunotherapy of type I allergy.

  10. Immune response and survival of Circulifer haematoceps to Spiroplasma citri infection requires expression of the gene hexamerin.


    Eliautout, Rémi; Dubrana, Marie-Pierre; Vincent-Monégat, Carole; Vallier, Agnès; Braquart-Varnier, Christine; Poirié, Marylène; Saillard, Colette; Heddi, Abdelaziz; Arricau-Bouvery, Nathalie


    Spiroplasma citri is a cell wall-less bacterium that infects plants. It is transmitted by the leafhopper Circulifer haematoceps, which hosts this bacterium in the haemocel and insect tissues. Bacterial factors involved in spiroplasma colonization of the insect host have been identified, but the immune response of the leafhopper to S. citri infection remains unknown. In this study, we showed that C. haematoceps activates both humoral and cellular immune responses when challenged with bacteria. When infected by S. citri, C. haematoceps displayed a specific immune response, evidenced by activation of phagocytosis and upregulation of a gene encoding the protein hexamerin. S. citri infection also resulted in decreased phenoloxidase-like activity. Inhibition of hexamerin by RNA interference resulted in a significant reduction in phenoloxidase-like activity and increased mortality of infected leafhoppers. Therefore, the gene hexamerin is involved in S. citri control by interfering with insect phenoloxidase activity.

  11. Elucidating the role of highly homologous Nicotiana benthamiana ubiquitin E2 gene family members in plant immunity through an improved virus-induced gene silencing approach.


    Zhou, Bangjun; Zeng, Lirong


    Virus-induced gene silencing (VIGS) has been used in many plant species as an attractive post transcriptional gene silencing (PTGS) method for studying gene function either individually or at large-scale in a high-throughput manner. However, the specificity and efficiency for knocking down members of a highly homologous gene family have remained to date a significant challenge in VIGS due to silencing of off-targets. Here we present an improved method for the selection and evaluation of gene fragments used for VIGS to specifically and efficiently knock down members of a highly homologous gene family. Using this method, we knocked down twelve and four members, respectively of group III of the gene family encoding ubiquitin-conjugating enzymes (E2) in Nicotiana benthamiana. Assays using these VIGS-treated plants revealed that the group III E2s are essential for plant development, plant immunity-associated reactive oxygen species (ROS) production, expression of the gene NbRbohB that is required for ROS production, and suppression of immunity-associated programmed cell death (PCD) by AvrPtoB, an effector protein of the bacterial pathogen Pseudomons syringae. Moreover, functional redundancy for plant development and ROS production was found to exist among members of group III E2s. We have found that employment of a gene fragment as short as approximately 70 base pairs (bp) that contains at least three mismatched nucleotides to other genes within any 21-bp sequences prevents silencing of off-target(s) in VIGS. This improved approach in the selection and evaluation of gene fragments allows for specific and efficient knocking down of highly homologous members of a gene family. Using this approach, we implicated N. benthamiana group III E2s in plant development, immunity-associated ROS production, and suppression of multiple immunity-associated PCD by AvrPtoB. We also unraveled functional redundancy among group III members in their requirement for plant development and