Diversity of human copy number variation and multicopy genes.
Sudmant, Peter H; Kitzman, Jacob O; Antonacci, Francesca; Alkan, Can; Malig, Maika; Tsalenko, Anya; Sampas, Nick; Bruhn, Laurakay; Shendure, Jay; Eichler, Evan E
2010-10-29
Copy number variants affect both disease and normal phenotypic variation, but those lying within heavily duplicated, highly identical sequence have been difficult to assay. By analyzing short-read mapping depth for 159 human genomes, we demonstrated accurate estimation of absolute copy number for duplications as small as 1.9 kilobase pairs, ranging from 0 to 48 copies. We identified 4.1 million "singly unique nucleotide" positions informative in distinguishing specific copies and used them to genotype the copy and content of specific paralogs within highly duplicated gene families. These data identify human-specific expansions in genes associated with brain development, reveal extensive population genetic diversity, and detect signatures consistent with gene conversion in the human species. Our approach makes ~1000 genes accessible to genetic studies of disease association.
Extensive Copy-Number Variation of Young Genes across Stickleback Populations
Eizaguirre, Christophe; Samonte, Irene E.; Kalbe, Martin; Lenz, Tobias L.; Stoll, Monika; Bornberg-Bauer, Erich; Milinski, Manfred; Reusch, Thorsten B. H.
2014-01-01
Duplicate genes emerge as copy-number variations (CNVs) at the population level, and remain copy-number polymorphic until they are fixed or lost. The successful establishment of such structural polymorphisms in the genome plays an important role in evolution by promoting genetic diversity, complexity and innovation. To characterize the early evolutionary stages of duplicate genes and their potential adaptive benefits, we combine comparative genomics with population genomics analyses to evaluate the distribution and impact of CNVs across natural populations of an eco-genomic model, the three-spined stickleback. With whole genome sequences of 66 individuals from populations inhabiting three distinct habitats, we find that CNVs generally occur at low frequencies and are often only found in one of the 11 populations surveyed. A subset of CNVs, however, displays copy-number differentiation between populations, showing elevated within-population frequencies consistent with local adaptation. By comparing teleost genomes to identify lineage-specific genes and duplications in sticklebacks, we highlight rampant gene content differences among individuals in which over 30% of young duplicate genes are CNVs. These CNV genes are evolving rapidly at the molecular level and are enriched with functional categories associated with environmental interactions, depicting the dynamic early copy-number polymorphic stage of genes during population differentiation. PMID:25474574
Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia
Kojima, Kenji K.
2015-01-01
Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an “archaeal” RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes. PMID:26556480
Models for loosely linked gene duplicates suggest lengthy persistence of both copies.
O'Hely, Martin; Wockner, Leesa
2007-06-21
Consider the appearance of a duplicate copy of a gene at a locus linked loosely, if at all, to the locus at which the gene is usually found. If all copies of the gene are subject to non-functionalizing mutations, then two fates are possible: loss of functional copies at the duplicate locus (loss of duplicate expression), or loss of functional copies at the original locus (map change). This paper proposes a simple model to address the probability of map change, the time taken for a map change and/or loss of duplicate expression, and considers where in the spectrum between loss of duplicate expression and map change such a duplicate complex is likely to be found. The findings are: the probability of map change is always half the reciprocal of the population size N, the time for a map change to occur is order NlogN generations, and that there is a marked tendency for duplicates to remain near equi-frequency with the gene at the original locus for a large portion of that time. This is in excellent agreement with simulations.
Gene copy number evolution during tetraploid cotton radiation.
Rong, J; Feltus, F A; Liu, L; Lin, L; Paterson, A H
2010-11-01
After polyploid formation, retention or loss of duplicated genes is not random. Genes with some functional domains are convergently restored to 'singleton' state after many independent genome duplications, and have been referred to as 'duplication-resistant' (DR) genes. To further explore the timeframe for their restoration to the singleton state, 27 cotton homologs of genes found to be 'DR' in Arabidopsis were selected based on diagnostic Pfam domains. Their copy numbers were studied using southern hybridization and sequence analysis in five tetraploid species and their ancestral A and D genome diploids. DR genes had significantly lower copy number than gene families hybridizing to randomly selected cotton ESTs. Three DR genes showed complete loss of D genome-derived homoeologs in some or all tetraploid species. Prior analysis has shown gene loss in polyploid cotton to be rare, and herein only one randomly selected gene showed loss of a homoeolog in only one of the five tetraploid species (Gossypium mustelinum). BAC sequencing confirmed two cases of gene loss in tetraploid cotton. Divergence among 5' sequences of DR genes amplified from G. arboreum, G. raimondii, and Gossypioides kirkii was correlated with gene copy number. These results show that genes containing Pfam domains associated with duplication resistance in Arabidopsis have also been preferentially restored to low copy number after a more recent polyploidization event in cotton. In tetraploid cotton, genes from the progenitor D genome seem to experience more gene copy number divergence than genes from the A genome. Together with D subgenome-biased alterations in gene expression, perhaps gene loss may contribute to the relatively larger portion of quantitative trait variation attributable to D than A subgenome chromosomes of tetraploid cotton.
Shirak, A; Golik, M; Lee, B-Y; Howe, A E; Kocher, T D; Hulata, G; Ron, M; Seroussi, E
2008-11-01
Lipocalins are involved in the binding of small molecules like sex steroids. We show here that the previously reported tilapia male-specific protein (MSP) is a lipocalin encoded by a variety of paralogous and homologous genes in different tilapia species. Exon-intron boundaries of MSP genes were typical of the six-exon genomic structure of lipocalins, and the transcripts were capable of encoding 200 amino-acid polypeptides that consisted of a putative signal peptide and a lipocalin domain. Cysteine residues are conserved in positions analogous to those forming the three disulfide bonds characteristic of the ligand pocket. The calculated molecular mass of the secreted MSP (20.4 kDa) was less than half of that observed, suggesting that it is highly glycosylated like its homologue tributyltin-binding protein. Analysis of sequence variations revealed three types of paralogs MSPA, MSPB and MSPC. Expression of both MSPA and MSPB was detected in testis. In haploid Oreochromis niloticus embryos, each of these types consisted of two closely related paralogs, and asymmetry between MSP copy numbers on the maternal (six copies) and the paternal (three copies) chromosomes was observed. Using this polymorphism we mapped MSPA and MSPC to linkage group 12 of an F(2) mapping family derived from a cross between O. niloticus and Oreochromis aureus. Females with high MSP copy number were more frequent by more than twofold than males. Gender-MSPC combinations showed significant deviation from expected Mendelian segregation (P=0.009) suggesting elimination of males with MSPC copies. We discuss different hypotheses to explain this elimination, including possibility for allelic conflict resulted by the hybridization.
Copy number analysis reveals a novel multiexon deletion of the COLQ gene in congenital myasthenia.
Wang, Wei; Wu, Yanhong; Wang, Chen; Jiao, Jinsong; Klein, Christopher J
2016-12-01
Congenital myasthenic syndrome (CMS) is genetically and clinically heterogeneous. 1 Despite a considerable number of causal genes discovered, many patients are left without a specific diagnosis after genetic testing. The presumption is that novel genes yet to be discovered will account for the majority of such patients. However, it is also possible that we are neglecting a type of genetic variation: copy number changes (>50 bp) as causal for some of these patients. Next-generation sequencing (NGS) can simultaneously screen all known causal genes 2 and is increasingly being validated to have a potential to identify copy number changes. 3 We present a CMS case who did not receive a genetic diagnosis from previous Sanger sequencing, but through a novel copy number analysis algorithm integrated into our targeted NGS panel, we discovered a novel copy number mutation in the COLQ gene and made a genetic diagnosis. This discovery expands the genotype-phenotype correlation of CMS, leads to improved genetic counsel, and allows for specific pharmacologic treatment. 1 .
Selection of suitable endogenous reference genes for relative copy number detection in sugarcane.
Xue, Bantong; Guo, Jinlong; Que, Youxiong; Fu, Zhiwei; Wu, Luguang; Xu, Liping
2014-05-19
Transgene copy number has a great impact on the expression level and stability of exogenous gene in transgenic plants. Proper selection of endogenous reference genes is necessary for detection of genetic components in genetically modification (GM) crops by quantitative real-time PCR (qPCR) or by qualitative PCR approach, especially in sugarcane with polyploid and aneuploid genomic structure. qPCR technique has been widely accepted as an accurate, time-saving method on determination of copy numbers in transgenic plants and on detection of genetically modified plants to meet the regulatory and legislative requirement. In this study, to find a suitable endogenous reference gene and its real-time PCR assay for sugarcane (Saccharum spp. hybrids) DNA content quantification, we evaluated a set of potential "single copy" genes including P4H, APRT, ENOL, CYC, TST and PRR, through qualitative PCR and absolute quantitative PCR. Based on copy number comparisons among different sugarcane genotypes, including five S. officinarum, one S. spontaneum and two S. spp. hybrids, these endogenous genes fell into three groups: ENOL-3--high copy number group, TST-1 and PRR-1--medium copy number group, P4H-1, APRT-2 and CYC-2--low copy number group. Among these tested genes, P4H, APRT and CYC were the most stable, while ENOL and TST were the least stable across different sugarcane genotypes. Therefore, three primer pairs of P4H-3, APRT-2 and CYC-2 were then selected as the suitable reference gene primer pairs for sugarcane. The test of multi-target reference genes revealed that the APRT gene was a specific amplicon, suggesting this gene is the most suitable to be used as an endogenous reference target for sugarcane DNA content quantification. These results should be helpful for establishing accurate and reliable qualitative and quantitative PCR analysis of GM sugarcane.
Gene copy number variation and its significance in cyanobacterial phylogeny
2012-01-01
Background In eukaryotes, variation in gene copy numbers is often associated with deleterious effects, but may also have positive effects. For prokaryotes, studies on gene copy number variation are rare. Previous studies have suggested that high numbers of rRNA gene copies can be advantageous in environments with changing resource availability, but further association of gene copies and phenotypic traits are not documented. We used one of the morphologically most diverse prokaryotic phyla to test whether numbers of gene copies are associated with levels of cell differentiation. Results We implemented a search algorithm that identified 44 genes with highly conserved copies across 22 fully sequenced cyanobacterial taxa. For two very basal cyanobacterial species, Gloeobacter violaceus and a thermophilic Synechococcus species, distinct phylogenetic positions previously found were supported by identical protein coding gene copy numbers. Furthermore, we found that increased ribosomal gene copy numbers showed a strong correlation to cyanobacteria capable of terminal cell differentiation. Additionally, we detected extremely low variation of 16S rRNA sequence copies within the cyanobacteria. We compared our results for 16S rRNA to three other eubacterial phyla (Chroroflexi, Spirochaetes and Bacteroidetes). Based on Bayesian phylogenetic inference and the comparisons of genetic distances, we could confirm that cyanobacterial 16S rRNA paralogs and orthologs show significantly stronger conservation than found in other eubacterial phyla. Conclusions A higher number of ribosomal operons could potentially provide an advantage to terminally differentiated cyanobacteria. Furthermore, we suggest that 16S rRNA gene copies in cyanobacteria are homogenized by both concerted evolution and purifying selection. In addition, the small ribosomal subunit in cyanobacteria appears to evolve at extraordinary slow evolutionary rates, an observation that has been made previously for morphological
DR-Integrator: a new analytic tool for integrating DNA copy number and gene expression data.
Salari, Keyan; Tibshirani, Robert; Pollack, Jonathan R
2010-02-01
DNA copy number alterations (CNA) frequently underlie gene expression changes by increasing or decreasing gene dosage. However, only a subset of genes with altered dosage exhibit concordant changes in gene expression. This subset is likely to be enriched for oncogenes and tumor suppressor genes, and can be identified by integrating these two layers of genome-scale data. We introduce DNA/RNA-Integrator (DR-Integrator), a statistical software tool to perform integrative analyses on paired DNA copy number and gene expression data. DR-Integrator identifies genes with significant correlations between DNA copy number and gene expression, and implements a supervised analysis that captures genes with significant alterations in both DNA copy number and gene expression between two sample classes. DR-Integrator is freely available for non-commercial use from the Pollack Lab at http://pollacklab.stanford.edu/ and can be downloaded as a plug-in application to Microsoft Excel and as a package for the R statistical computing environment. The R package is available under the name 'DRI' at http://cran.r-project.org/. An example analysis using DR-Integrator is included as supplemental material. Supplementary data are available at Bioinformatics online.
ROS1 gene rearrangement and copy number gain in non-small cell lung cancer.
Jin, Yan; Sun, Ping-Li; Kim, Hyojin; Park, Eunhyang; Shim, Hyo Sup; Jheon, Sanghoon; Kim, Kwhanmien; Lee, Choon-Taek; Chung, Jin-Haeng
2015-01-01
ROS1 has attracted much attention as a possible oncogenic driver and ROS1-rearranged tumors show sensitivity to most ALK inhibitors. We aimed to clarify the prevalence of ROS1 gene rearrangement and investigate the clinical implications of ROS1 gene copy number gain (CNG) in non-small cell lung cancer (NSCLC) patients. We carried out fluorescent in situ hybridization with ROS1 and centromere enumeration 6 probes and immunohistochemistry for ROS1 protein expression. ROS1 rearrangement was detected in 3 of 375 samples (0.8 %); all of whom were female, never-smokers, and harbored an adenocarcinoma component. ROS1 gene CNG was found in 18 cases (4.8 %). ROS1 gene CNG was significantly associated with shorter disease-free survival (DFS, 12 vs. 58 months; p = 0.003) and shorter overall survival (OS, 40 vs. 67 months; p <0.001) than the group without CNG. Multivariate analysis confirmed that ROS1 gene CNG was significantly associated with poorer DFS (hazard ratio [HR]=2.16, 95 % confidence interval [CI] = 1.22-3.81, p = 0.008), and OS ([HR] = 2.53, 95 % [CI] = 1.31-4.89, p = 0.006). ROS1 protein overexpression was observed in 5.0 % (18 out of 357), of which 2 cases harbored ROS1 gene rearrangement. There was no statistically significant correlation between ROS1 gene CNG and protein overexpression. This study demonstrated ROS1 gene rearrangement was detected in 0.8 % of surgically resected NSCLC; and ROS1 gene CNG is an independent poor prognostic factor. This survival analyses may contribute to future studies on the utility of ROS1-targeted therapy for patients.
Fakhro, Khalid A.; Choi, Murim; Ware, Stephanie M.; Belmont, John W.; Towbin, Jeffrey A.; Lifton, Richard P.; Khokha, Mustafa K.; Brueckner, Martina
2011-01-01
Dominant human genetic diseases that impair reproductive fitness and have high locus heterogeneity constitute a problem for gene discovery because the usual criterion of finding more mutations in specific genes than expected by chance may require extremely large populations. Heterotaxy (Htx), a congenital heart disease resulting from abnormalities in left-right (LR) body patterning, has features suggesting that many cases fall into this category. In this setting, appropriate model systems may provide a means to support implication of specific genes. By high-resolution genotyping of 262 Htx subjects and 991 controls, we identify a twofold excess of subjects with rare genic copy number variations in Htx (14.5% vs. 7.4%, P = 1.5 × 10−4). Although 7 of 45 Htx copy number variations were large chromosomal abnormalities, 38 smaller copy number variations altered a total of 61 genes, 22 of which had Xenopus orthologs. In situ hybridization identified 7 of these 22 genes with expression in the ciliated LR organizer (gastrocoel roof plate), a marked enrichment compared with 40 of 845 previously studied genes (sevenfold enrichment, P < 10−6). Morpholino knockdown in Xenopus of Htx candidates demonstrated that five (NEK2, ROCK2, TGFBR2, GALNT11, and NUP188) strongly disrupted both morphological LR development and expression of pitx2, a molecular marker of LR patterning. These effects were specific, because 0 of 13 control genes from rare Htx or control copy number variations produced significant LR abnormalities (P = 0.001). These findings identify genes not previously implicated in LR patterning. PMID:21282601
Fakhro, Khalid A; Choi, Murim; Ware, Stephanie M; Belmont, John W; Towbin, Jeffrey A; Lifton, Richard P; Khokha, Mustafa K; Brueckner, Martina
2011-02-15
Dominant human genetic diseases that impair reproductive fitness and have high locus heterogeneity constitute a problem for gene discovery because the usual criterion of finding more mutations in specific genes than expected by chance may require extremely large populations. Heterotaxy (Htx), a congenital heart disease resulting from abnormalities in left-right (LR) body patterning, has features suggesting that many cases fall into this category. In this setting, appropriate model systems may provide a means to support implication of specific genes. By high-resolution genotyping of 262 Htx subjects and 991 controls, we identify a twofold excess of subjects with rare genic copy number variations in Htx (14.5% vs. 7.4%, P = 1.5 × 10(-4)). Although 7 of 45 Htx copy number variations were large chromosomal abnormalities, 38 smaller copy number variations altered a total of 61 genes, 22 of which had Xenopus orthologs. In situ hybridization identified 7 of these 22 genes with expression in the ciliated LR organizer (gastrocoel roof plate), a marked enrichment compared with 40 of 845 previously studied genes (sevenfold enrichment, P < 10(-6)). Morpholino knockdown in Xenopus of Htx candidates demonstrated that five (NEK2, ROCK2, TGFBR2, GALNT11, and NUP188) strongly disrupted both morphological LR development and expression of pitx2, a molecular marker of LR patterning. These effects were specific, because 0 of 13 control genes from rare Htx or control copy number variations produced significant LR abnormalities (P = 0.001). These findings identify genes not previously implicated in LR patterning.
van den Broek, Evert; van Lieshout, Stef; Rausch, Christian; Ylstra, Bauke; van de Wiel, Mark A; Meijer, Gerrit A; Fijneman, Remond J A; Abeln, Sanne
2016-01-01
Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs) of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large) series of tumor samples. 'GeneBreak' is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH) or by (low-pass) whole genome sequencing (WGS). First, 'GeneBreak' collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, 'GeneBreak', is implemented in R ( www.cran.r-project.org ) and is available from Bioconductor ( www.bioconductor.org/packages/release/bioc/html/GeneBreak.html ).
Ji, Hanlee; Kumm, Jochen; Zhang, Michael; Farnam, Kyle; Salari, Keyan; Faham, Malek; Ford, James M.; Davis, Ronald W.
2006-01-01
Genomic instability is a major feature of neoplastic development in colorectal carcinoma and other cancers. Specific genomic instability events, such as deletions in chromosomes and other alterations in gene copy number, have potential utility as biologically relevant prognostic biomarkers. For example, genomic deletions on chromosome arm 18q are an indicator of colorectal carcinoma behavior and potentially useful as a prognostic indicator. Adapting a novel genomic technology called molecular inversion probes which can determine gene copy alterations, such as genomic deletions, we designed a set of probes to interrogate several hundred individual exons of >200 cancer genes with an overall distribution covering all chromosome arms. In addition, >100 probes were designed in close proximity of microsatellite markers on chromosome arm 18q. We analyzed a set of colorectal carcinoma cell lines and primary colorectal tumor samples for gene copy alterations and deletion mutations in exons. Based on clustering analysis, we distinguished the different categories of genomic instability among the colorectal cancer cell lines. Our analysis of primary tumors uncovered several distinct categories of colorectal carcinoma, each with specific patterns of 18q deletions and deletion mutations in specific genes. This finding has potential clinical ramifications given the application of 18q loss of heterozygosity events as a potential indicator for adjuvant treatment in stage II colorectal carcinoma. PMID:16912164
Engineered promoters enable constant gene expression at any copy number in bacteria.
Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A
2018-04-01
The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.
Chen, Pu; Ma, Mingyi; Shang, Huifang; Su, Dan; Zhang, Sizhong; Yang, Yuan
2009-12-01
To standardize the experimental procedure of the gene test for autosomal dominant cerebellar ataxias (ADCA), and provide the basis for quantitative criteria of the dynamic mutation of spinocerebellar ataxia (SCA) genes in Chinese population. Genotyping of the dynamic mutation loci of the SCA1, SCA2, SCA3, SCA6 and SCA7 genes was performed, using florescence PCR-capillary electrophoresis followed by DNA sequencing, to investigate the variation range of copy number of CAG tandem repeat of the genes in 263 probands of ADCA pedigrees and 261 non-related normal controls. Based on the sequencing result, the bias of the CAG copy number estimation using capillary electrophoresis with different DNA controls was compared to analyze the technical detailes of the electrophresis method in testing the dynamic mutation sites. PCR products containing dynamic mutation loci of the SCA genes showed significantly higher mobility than that of molecular weigh marker with relatively balanced GC content. This was particularly obvious in the SCA2, SCA 6 and SCA7 genes whereas the deviation of copy number could be corrected to +/-1 when known CAG copy number fragments were used as controls. The mobility of PCR products was primarily related to the copy number of CAG repeat when the fragments contained normal CAG repeat. In the 263 ADCA pedigrees, 6 (2.28%) carried SCA1 gene mutation, 8 (3.04%) had SCA2 mutation and 81 (30.80%) harbored SCA3 mutation. The gene mutation of SCA6 and SCA7 was not found. The normal variation range of the CAG repeat was 17-36 copies in SCA1 gene, 13-30 copies in SCA2, 14-39 copies in SCA3, 6-16 copies in SCA6 and 6-13 copies in SCA7. The heterozygosity was 76.1%, 17.7%, 74.4%, 72.1% and 41.3%, respectively. The mutation range of the CAG repeat was 49-56 copies in SCA1 gene, 36-41 copies in SCA2, 59-81 copies in SCA3. Neither homozygous mutation of an SCA gene nor double heterozygous mutation of the SCA genes was observed in the study. The copy number of the CAG
Cramer, Dina; Serrano, Luis; Schaefer, Martin H
2016-11-10
Copy number alterations (CNAs) in cancer patients show a large variability in their number, length and position, but the sources of this variability are not known. CNA number and length are linked to patient survival, suggesting clinical relevance. We have identified genes that tend to be mutated in samples that have few or many CNAs, which we term CONIM genes (COpy Number Instability Modulators). CONIM proteins cluster into a densely connected subnetwork of physical interactions and many of them are epigenetic modifiers. Therefore, we investigated how the epigenome of the tissue-of-origin influences the position of CNA breakpoints and the properties of the resulting CNAs. We found that the presence of heterochromatin in the tissue-of-origin contributes to the recurrence and length of CNAs in the respective cancer type.
Tissue Non-Specific Genes and Pathways Associated with Diabetes: An Expression Meta-Analysis.
Mei, Hao; Li, Lianna; Liu, Shijian; Jiang, Fan; Griswold, Michael; Mosley, Thomas
2017-01-21
We performed expression studies to identify tissue non-specific genes and pathways of diabetes by meta-analysis. We searched curated datasets of the Gene Expression Omnibus (GEO) database and identified 13 and five expression studies of diabetes and insulin responses at various tissues, respectively. We tested differential gene expression by empirical Bayes-based linear method and investigated gene set expression association by knowledge-based enrichment analysis. Meta-analysis by different methods was applied to identify tissue non-specific genes and gene sets. We also proposed pathway mapping analysis to infer functions of the identified gene sets, and correlation and independent analysis to evaluate expression association profile of genes and gene sets between studies and tissues. Our analysis showed that PGRMC1 and HADH genes were significant over diabetes studies, while IRS1 and MPST genes were significant over insulin response studies, and joint analysis showed that HADH and MPST genes were significant over all combined data sets. The pathway analysis identified six significant gene sets over all studies. The KEGG pathway mapping indicated that the significant gene sets are related to diabetes pathogenesis. The results also presented that 12.8% and 59.0% pairwise studies had significantly correlated expression association for genes and gene sets, respectively; moreover, 12.8% pairwise studies had independent expression association for genes, but no studies were observed significantly different for expression association of gene sets. Our analysis indicated that there are both tissue specific and non-specific genes and pathways associated with diabetes pathogenesis. Compared to the gene expression, pathway association tends to be tissue non-specific, and a common pathway influencing diabetes development is activated through different genes at different tissues.
Dietary Variation and Evolution of Gene Copy Number among Dog Breeds
Reiter, Taylor; Jagoda, Evelyn; Capellini, Terence D.
2016-01-01
Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR), phytanol-CoA 2-hydroxylase (PHYH), and pancreatic α-amylase 2B (AMY2B). These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs. PMID:26863414
Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.
Reiter, Taylor; Jagoda, Evelyn; Capellini, Terence D
2016-01-01
Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR), phytanol-CoA 2-hydroxylase (PHYH), and pancreatic α-amylase 2B (AMY2B). These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.
Low copy number of the salivary amylase gene predisposes to obesity.
Falchi, Mario; El-Sayed Moustafa, Julia Sarah; Takousis, Petros; Pesce, Francesco; Bonnefond, Amélie; Andersson-Assarsson, Johanna C; Sudmant, Peter H; Dorajoo, Rajkumar; Al-Shafai, Mashael Nedham; Bottolo, Leonardo; Ozdemir, Erdal; So, Hon-Cheong; Davies, Robert W; Patrice, Alexandre; Dent, Robert; Mangino, Massimo; Hysi, Pirro G; Dechaume, Aurélie; Huyvaert, Marlène; Skinner, Jane; Pigeyre, Marie; Caiazzo, Robert; Raverdy, Violeta; Vaillant, Emmanuel; Field, Sarah; Balkau, Beverley; Marre, Michel; Visvikis-Siest, Sophie; Weill, Jacques; Poulain-Godefroy, Odile; Jacobson, Peter; Sjostrom, Lars; Hammond, Christopher J; Deloukas, Panos; Sham, Pak Chung; McPherson, Ruth; Lee, Jeannette; Tai, E Shyong; Sladek, Robert; Carlsson, Lena M S; Walley, Andrew; Eichler, Evan E; Pattou, Francois; Spector, Timothy D; Froguel, Philippe
2014-05-01
Common multi-allelic copy number variants (CNVs) appear enriched for phenotypic associations compared to their biallelic counterparts. Here we investigated the influence of gene dosage effects on adiposity through a CNV association study of gene expression levels in adipose tissue. We identified significant association of a multi-allelic CNV encompassing the salivary amylase gene (AMY1) with body mass index (BMI) and obesity, and we replicated this finding in 6,200 subjects. Increased AMY1 copy number was positively associated with both amylase gene expression (P = 2.31 × 10(-14)) and serum enzyme levels (P < 2.20 × 10(-16)), whereas reduced AMY1 copy number was associated with increased BMI (change in BMI per estimated copy = -0.15 (0.02) kg/m(2); P = 6.93 × 10(-10)) and obesity risk (odds ratio (OR) per estimated copy = 1.19, 95% confidence interval (CI) = 1.13-1.26; P = 1.46 × 10(-10)). The OR value of 1.19 per copy of AMY1 translates into about an eightfold difference in risk of obesity between subjects in the top (copy number > 9) and bottom (copy number < 4) 10% of the copy number distribution. Our study provides a first genetic link between carbohydrate metabolism and BMI and demonstrates the power of integrated genomic approaches beyond genome-wide association studies.
Gaber, Rania; Watermann, Iris; Kugler, Christian; Vollmer, Ekkehard; Perner, Sven; Reck, Martin; Goldmann, Torsten
2017-01-01
Targeting epidermal growth factor receptor (EGFR) in patients with non-small-cell lung cancer (NSCLC) having EGFR mutations is associated with an improved overall survival. The aim of this study is to verify, if EGFR mutations detected by immunohistochemistry (IHC) is a convincing way to preselect patients for DNA-sequencing and to figure out, the statistical association between EGFR mutation, wild-type EGFR overexpression, gene copy number gain, which are the main factors inducing EGFR tumorigenic activity and the clinicopathological data. Two hundred sixteen tumor tissue samples of primarily chemotherapeutic naïve NSCLC patients were analyzed for EGFR mutations E746-A750del and L858R and correlated with DNA-sequencing. Two hundred six of which were assessed by IHC, using 6B6 and 43B2 specific antibodies followed by DNA-sequencing of positive cases and 10 already genotyped tumor tissues were also included to investigate debugging accuracy of IHC. In addition, EGFR wild-type overexpression was IHC evaluated and EGFR gene copy number determination was performed by fluorescence in situ hybridization (FISH). Forty-one÷206 (19.9%) cases were positive for mutated EGFR by IHC. Eight of them had EGFR mutations of exons 18-21 by DNA-sequencing. Hit rate of 10 already genotyped NSCLC mutated cases was 90% by IHC. Positive association was found between EGFR mutations determined by IHC and both EGFR overexpression and increased gene copy number (p=0.002 and p<0.001, respectively). Additionally, positive association was detected between EGFR mutations, high tumor grade and clinical stage (p<0.001). IHC staining with mutation specific antibodies was demonstrated as a possible useful screening test to preselect patients for DNA-sequencing.
Aims: Compare specificity and sensitivity of quantitative PCR (qPCR) assays targeting single and multi-copy gene regions of Escherichia coli. Methods and Results: A previously reported assay targeting the uidA gene (uidA405) was used as the basis for comparing the taxono...
Diversity and population-genetic properties of copy number variations and multicopy genes in cattle
Bickhart, Derek M.; Xu, Lingyang; Hutchison, Jana L.; Cole, John B.; Null, Daniel J.; Schroeder, Steven G.; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S.; Van Tassell, Curtis P.; Schnabel, Robert D.; Taylor, Jeremy F.; Lewin, Harris A.; Liu, George E.
2016-01-01
The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1. Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. PMID:27085184
Tokar, Tomas; Pastrello, Chiara; Ramnarine, Varune R.; Zhu, Chang-Qi; Craddock, Kenneth J.; Pikor, Larrisa A.; Vucic, Emily A.; Vary, Simon; Shepherd, Frances A.; Tsao, Ming-Sound; Lam, Wan L.; Jurisica, Igor
2018-01-01
In many cancers, significantly down- or upregulated genes are found within chromosomal regions with DNA copy number alteration opposite to the expression changes. Generally, this paradox has been overlooked as noise, but can potentially be a consequence of interference of epigenetic regulatory mechanisms, including microRNA-mediated control of mRNA levels. To explore potential associations between microRNAs and paradoxes in non-small-cell lung cancer (NSCLC) we curated and analyzed lung adenocarcinoma (LUAD) data, comprising gene expressions, copy number aberrations (CNAs) and microRNA expressions. We integrated data from 1,062 tumor samples and 241 normal lung samples, including newly-generated array comparative genomic hybridization (aCGH) data from 63 LUAD samples. We identified 85 “paradoxical” genes whose differential expression consistently contrasted with aberrations of their copy numbers. Paradoxical status of 70 out of 85 genes was validated on sample-wise basis using The Cancer Genome Atlas (TCGA) LUAD data. Of these, 41 genes are prognostic and form a clinically relevant signature, which we validated on three independent datasets. By meta-analysis of results from 9 LUAD microRNA expression studies we identified 24 consistently-deregulated microRNAs. Using TCGA-LUAD data we showed that deregulation of 19 of these microRNAs explains differential expression of the paradoxical genes. Our results show that deregulation of paradoxical genes is crucial in LUAD and their expression pattern is maintained epigenetically, defying gene copy number status. PMID:29507679
Single-Copy Genes as Molecular Markers for Phylogenomic Studies in Seed Plants
De La Torre, Amanda R.; Sterck, Lieven; Cánovas, Francisco M.; Avila, Concepción; Merino, Irene; Cabezas, José Antonio; Cervera, María Teresa; Ingvarsson, Pär K.
2017-01-01
Phylogenetic relationships among seed plant taxa, especially within the gymnosperms, remain contested. In contrast to angiosperms, for which several genomic, transcriptomic and phylogenetic resources are available, there are few, if any, molecular markers that allow broad comparisons among gymnosperm species. With few gymnosperm genomes available, recently obtained transcriptomes in gymnosperms are a great addition to identifying single-copy gene families as molecular markers for phylogenomic analysis in seed plants. Taking advantage of an increasing number of available genomes and transcriptomes, we identified single-copy genes in a broad collection of seed plants and used these to infer phylogenetic relationships between major seed plant taxa. This study aims at extending the current phylogenetic toolkit for seed plants, assessing its ability for resolving seed plant phylogeny, and discussing potential factors affecting phylogenetic reconstruction. In total, we identified 3,072 single-copy genes in 31 gymnosperms and 2,156 single-copy genes in 34 angiosperms. All studied seed plants shared 1,469 single-copy genes, which are generally involved in functions like DNA metabolism, cell cycle, and photosynthesis. A selected set of 106 single-copy genes provided good resolution for the seed plant phylogeny except for gnetophytes. Although some of our analyses support a sister relationship between gnetophytes and other gymnosperms, phylogenetic trees from concatenated alignments without 3rd codon positions and amino acid alignments under the CAT + GTR model, support gnetophytes as a sister group to Pinaceae. Our phylogenomic analyses demonstrate that, in general, single-copy genes can uncover both recent and deep divergences of seed plant phylogeny. PMID:28460034
tRNA gene copy number variation in humans
Iben, James R.; Maraia, Richard J.
2014-01-01
The human tRNAome consists of more than 500 interspersed tRNA genes comprising 51 anticodon families of largely unequal copy number. We examined tRNA gene copy number variation (tgCNV) in six individuals; two kindreds of two parents and a child, using high coverage whole genome sequence data. Such differences may be important because translation of some mRNAs is sensitive to the relative amounts of tRNAs and because tRNA competition determines translational efficiency vs. fidelity and production of native vs. misfolded proteins. We identified several tRNA gene clusters with CNV, which in some cases were part of larger iterations. In addition there was an isolated tRNALysCUU gene that was absent as a homozygous deletion in one of the parents. When assessed by semiquantitative PCR in 98 DNA samples representing a wide variety of ethnicities, this allele was found deleted in hetero- or homozygosity in all groups at ~50% frequency. This is the first report of copy number variation of human tRNA genes. We conclude that tgCNV exists at significant levels among individual humans and discuss the results in terms of genetic diversity and prior genome wide association studies (GWAS) that suggest the importance of the ratio of tRNALys isoacceptors in Type-2 diabetes. PMID:24342656
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Zhang, Yi-Bing; Liu, Ting-Kai; Jiang, Jun; Shi, Jun; Liu, Ying; Li, Shun; Gui, Jian-Fang
2013-01-01
Gig2 (grass carp reovirus (GCRV)-induced gene 2) is first identified as a novel fish interferon (IFN)-stimulated gene (ISG). Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD) hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose) polymerases (PARPs), and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Genomic instability is a hallmark of human cancer, and results in widespread somatic copy number alterations. We used a genome-scale shRNA viability screen in human cancer cell lines to systematically identify genes that are essential in the context of particular copy-number alterations (copy-number associated gene dependencies). The most enriched class of copy-number associated gene dependencies was CYCLOPS (Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS) genes, and spliceosome components were the most prevalent.
McTavish, H; LaQuier, F; Arciero, D; Logan, M; Mundfrom, G; Fuchs, J A; Hooper, A B
1993-04-01
The genome of Nitrosomonas europaea contains at least three copies each of the genes coding for hydroxylamine oxidoreductase (HAO) and cytochrome c554. A copy of an HAO gene is always located within 2.7 kb of a copy of a cytochrome c554 gene. Cytochrome P-460, a protein that shares very unusual spectral features with HAO, was found to be encoded by a gene separate from the HAO genes.
Turner, Andrew; Sasse, Jurgen; Varadi, Aniko
2016-10-19
Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.
Meyers, Robin M; Bryan, Jordan G; McFarland, James M; Weir, Barbara A; Sizemore, Ann E; Xu, Han; Dharia, Neekesh V; Montgomery, Phillip G; Cowley, Glenn S; Pantel, Sasha; Goodale, Amy; Lee, Yenarae; Ali, Levi D; Jiang, Guozhi; Lubonja, Rakela; Harrington, William F; Strickland, Matthew; Wu, Ting; Hawes, Derek C; Zhivich, Victor A; Wyatt, Meghan R; Kalani, Zohra; Chang, Jaime J; Okamoto, Michael; Stegmaier, Kimberly; Golub, Todd R; Boehm, Jesse S; Vazquez, Francisca; Root, David E; Hahn, William C; Tsherniak, Aviad
2017-12-01
The CRISPR-Cas9 system has revolutionized gene editing both at single genes and in multiplexed loss-of-function screens, thus enabling precise genome-scale identification of genes essential for proliferation and survival of cancer cells. However, previous studies have reported that a gene-independent antiproliferative effect of Cas9-mediated DNA cleavage confounds such measurement of genetic dependency, thereby leading to false-positive results in copy number-amplified regions. We developed CERES, a computational method to estimate gene-dependency levels from CRISPR-Cas9 essentiality screens while accounting for the copy number-specific effect. In our efforts to define a cancer dependency map, we performed genome-scale CRISPR-Cas9 essentiality screens across 342 cancer cell lines and applied CERES to this data set. We found that CERES decreased false-positive results and estimated sgRNA activity for both this data set and previously published screens performed with different sgRNA libraries. We further demonstrate the utility of this collection of screens, after CERES correction, for identifying cancer-type-specific vulnerabilities.
Meyers, Robin M.; Bryan, Jordan G.; McFarland, James M.; Weir, Barbara A.; Sizemore, Ann E.; Xu, Han; Dharia, Neekesh V.; Montgomery, Phillip G.; Cowley, Glenn S.; Pantel, Sasha; Goodale, Amy; Lee, Yenarae; Ali, Levi D.; Jiang, Guozhi; Lubonja, Rakela; Harrington, William F.; Strickland, Matthew; Wu, Ting; Hawes, Derek C.; Zhivich, Victor A.; Wyatt, Meghan R.; Kalani, Zohra; Chang, Jaime J.; Okamoto, Michael; Stegmaier, Kimberly; Golub, Todd R.; Boehm, Jesse S.; Vazquez, Francisca; Root, David E.; Hahn, William C.; Tsherniak, Aviad
2017-01-01
The CRISPR-Cas9 system has revolutionized gene editing both on single genes and in multiplexed loss-of-function screens, enabling precise genome-scale identification of genes essential to proliferation and survival of cancer cells1,2. However, previous studies reported that a gene-independent anti-proliferative effect of Cas9-mediated DNA cleavage confounds such measurement of genetic dependency, leading to false positive results in copy number amplified regions3,4. We developed CERES, a computational method to estimate gene dependency levels from CRISPR-Cas9 essentiality screens while accounting for the copy-number-specific effect. As part of our efforts to define a cancer dependency map, we performed genome-scale CRISPR-Cas9 essentiality screens across 342 cancer cell lines and applied CERES to this dataset. We found that CERES reduced false positive results and estimated sgRNA activity for both this dataset and previously published screens performed with different sgRNA libraries. Here, we demonstrate the utility of this collection of screens, upon CERES correction, in revealing cancer-type-specific vulnerabilities. PMID:29083409
Fan, Hui-Min; Wu, Ling-Jie; Hu, Feng-Yu; Yang, Zhan
2012-08-01
To study the gene copy number, mRNA transcription and protien expression of programmed cell death 1 (PD-1) gene in primary hepatocellular carcinoma (PHC) patients and normal control individuals (NC) who are anti-HBs positive, and to investigate the variations in PD-1 gene copy numbers and its relationship with PHC. Real-time PCR was adopted to detect the PD-1 gene copy numbers and their mRNA expressions in peripheral blood mononuclear cells (PBMCs) from 24 samples of PHC patients and 26 of NC. Protein expression level of PD-1 on CD8+ T was analyzed by flow cytometry. In terms of number of PD-1 gene copy numbers, the percentage of cases of haploid (single) was 34.62% and 4.17% in PHC group and control group respectively while the percentage of cases of diploid (double) was 61.54% and 95.83% respectively. The difference between the two was statistically significant (chi2 = 7.639, P = 0.006). The rate of cases with double PD-1 gene copy numbers was found to be higher in patients with PHC than in control group. It was also found that the average expression of PD-1 mRNA was 2.35E-03 in control group and 1.23E-03 in PHC group. The expression level was significant lower in PHC group than that in control group when compared by using Mann-whitey technic (U = 153, P = 0.009). Furthermore, the frequency of PD-1 protein expression on CD8+ T cells was 3.72 +/- 0.32 in control group and 16.13 +/- 1.68 in PHC group. The level of PD-1 mRNA expression was higher in PHC and significant differences was shown between two groups (t = -7.073, P = 0.000). Our study suggests that the variation in PD-1 gene copy number may trigger primary hepatocellular carcinoma to HBV carriers. The relationship between the variation of PD-1 gene copy numbers and its association with primary hepatocellular carcinoma is worth further focus.
Sun, Yue; Joyce, Priya Aiyar
2017-11-01
Droplet digital PCR combined with the low copy ACT allele as endogenous reference gene, makes accurate and rapid estimation of gene copy number in Q208 A and Q240 A attainable. Sugarcane is an important cultivated crop with both high polyploidy and aneuploidy in its 10 Gb genome. Without a known copy number reference gene, it is difficult to accurately estimate the copy number of any gene of interest by PCR-based methods in sugarcane. Recently, a new technology, known as droplet digital PCR (ddPCR) has been developed which can measure the absolute amount of the target DNA in a given sample. In this study, we deduced the true copy number of three endogenous genes, actin depolymerizing factor (ADF), adenine phosphoribosyltransferase (APRT) and actin (ACT) in three Australian sugarcane varieties, using ddPCR by comparing the absolute amounts of the above genes with a transgene of known copy number. A single copy of the ACT allele was detected in Q208 A , two copies in Q240 A , but was absent in Q117. Copy number variation was also observed for both APRT and ADF, and ranged from 9 to 11 in the three tested varieties. Using this newly developed ddPCR method, transgene copy number was successfully determined in 19 transgenic Q208 A and Q240 A events using ACT as the reference endogenous gene. Our study demonstrates that ddPCR can be used for high-throughput genetic analysis and is a quick, accurate and reliable alternative method for gene copy number determination in sugarcane. This discovered ACT allele would be a suitable endogenous reference gene for future gene copy number variation and dosage studies of functional genes in Q208 A and Q240 A .
Niu, Ao-lei; Wang, Yin-qiu; Zhang, Hui; Liao, Cheng-hong; Wang, Jin-kai; Zhang, Rui; Che, Jun; Su, Bing
2011-10-12
Homeobox genes are the key regulators during development, and they are in general highly conserved with only a few reported cases of rapid evolution. RHOXF2 is an X-linked homeobox gene in primates. It is highly expressed in the testicle and may play an important role in spermatogenesis. As male reproductive system is often the target of natural and/or sexual selection during evolution, in this study, we aim to dissect the pattern of molecular evolution of RHOXF2 in primates and its potential functional consequence. We studied sequences and copy number variation of RHOXF2 in humans and 16 nonhuman primate species as well as the expression patterns in human, chimpanzee, white-browed gibbon and rhesus macaque. The gene copy number analysis showed that there had been parallel gene duplications/losses in multiple primate lineages. Our evidence suggests that 11 nonhuman primate species have one RHOXF2 copy, and two copies are present in humans and four Old World monkey species, and at least 6 copies in chimpanzees. Further analysis indicated that the gene duplications in primates had likely been mediated by endogenous retrovirus (ERV) sequences flanking the gene regions. In striking contrast to non-human primates, humans appear to have homogenized their two RHOXF2 copies by the ERV-mediated non-allelic recombination mechanism. Coding sequence and phylogenetic analysis suggested multi-lineage strong positive selection on RHOXF2 during primate evolution, especially during the origins of humans and chimpanzees. All the 8 coding region polymorphic sites in human populations are non-synonymous, implying on-going selection. Gene expression analysis demonstrated that besides the preferential expression in the reproductive system, RHOXF2 is also expressed in the brain. The quantitative data suggests expression pattern divergence among primate species. RHOXF2 is a fast-evolving homeobox gene in primates. The rapid evolution and copy number changes of RHOXF2 had been driven by
Li, Jiao; Su, Wei; Zhang, Sheng; Hu, Yunhui; Liu, Jingjing; Zhang, Xiaobei; Bai, Jingchao; Yuan, Weiping; Hu, Linping; Cheng, Tao; Zetterberg, Anders; Lei, Zhenmin; Zhang, Jin
2015-05-01
The epidermal growth factor receptor (EGFR)/PI3K/AKT signaling pathway aberrations play significant roles in breast cancer occurrence and development. However, the status of EGFR and AKT1 gene copy numbers remains unclear. In this study, we showed that the rates of EGFR and AKT1 gene copy number alterations were associated with the prognosis of breast cancer. Among 205 patients, high EGFR and AKT1 gene copy numbers were observed in 34.6% and 27.8% of cases by multi-gene fluorescence in situ hybridization, respectively. Co-heightened EGFR/AKT1 gene copy numbers were identified in 11.7% cases. No changes were found in 49.3% of patients. Although changes in EGFR and AKT1 gene copy numbers had no correlation with patients' age, tumor stage, histological grade and the expression status of other molecular makers, high EGFR (P = 0.0002) but not AKT1 (P = 0.1177) gene copy numbers correlated with poor 5-year overall survival. The patients with co-heightened EGFR/AKT1 gene copy numbers displayed a poorer prognosis than those with tumors with only high EGFR gene copy numbers (P = 0.0383). Both Univariate (U) and COX multivariate (C) analyses revealed that high EGFR and AKT1 gene copy numbers (P = 0.000 [U], P = 0.0001 [C]), similar to histological grade (P = 0.001 [U], P = 0.012 [C]) and lymph node metastasis (P = 0.046 [U], P = 0.158 [C]), were independent prognostic indicators of 5-year overall survival. These results indicate that high EGFR and AKT1 gene copy numbers were relatively frequent in breast cancer. Co-heightened EGFR/AKT1 gene copy numbers had a worse outcome than those with only high EGFR gene copy numbers, suggesting that evaluation of these two genes together may be useful for selecting patients for anti-EGFR-targeted therapy or anti-EGFR/AKT1-targeted therapy and for predicting outcomes. © 2015 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.
From DNA Copy Number to Gene Expression: Local aberrations, Trisomies and Monosomies
NASA Astrophysics Data System (ADS)
Shay, Tal
aberration profile' is then combined with chromosomal arm status (gain/loss) to define a succinct genomic signature for each tumor. Unsupervised clustering of the samples based on these genomic signatures can reveal novel tumor subtypes. This approach was applied to datasets from three types of brain tumors: Glioblastoma, Medulloblastoma and Neuroblastoma, and identified a new subtype in Medulloblastoma, characterized by many chromosomal aberrations. Elucidating the transcriptional effect of monosomy and trisomy. Trisomy and monosomy are expected to impact the expression of genes that are located on the affected chromosome. Analysis of several cancer datasets revealed that not all the genes on the aberrant chromosome are affected by the change of copy number. Affected genes exhibit a wide range of expression changes with varying penetrance. Specifically, (1) The effect of trisomy is much more conserved among individuals than the effect of monosomy and (2) the expression level of a gene in the diploid is significantly correlated with the level of change between the diploid and the trisomy or monosomy.
Rusz, Orsolya; Papp, Orsolya; Vízkeleti, Laura; Molnár, Béla Ákos; Bende, Kristóf Csaba; Lotz, Gábor; Ács, Balázs; Kahán, Zsuzsanna; Székely, Tamás; Báthori, Ágnes; Szundi, Csilla; Kulka, Janina; Szállási, Zoltán; Tőkés, Anna-Mária
2018-05-16
To determine the associations between lysosomal-associated transmembrane protein 4b (LAPTM4B) gene copy number and response to different chemotherapy regimens in hormone receptor negative (HR-) primary breast carcinomas. Two cohorts were analyzed: (1) 69 core biopsies from HR-breast carcinomas treated with neoadjuvant chemotherapy (anthracycline based in 72.5% of patients and non-anthracycline based in 27.5% of patients). (2) Tissue microarray (TMA) of 74 HR-breast carcinomas treated with adjuvant therapy (77.0% of the patients received anthracycline, 17.6% of the patients non-anthracycline-based therapy, and in 5.4% of the cases, no treatment data are available). Interphase FISH technique was applied on pretreatment core biopsies (cohort I) and on TMAs (cohort II) using custom-made dual-labelled FISH probes (LAPTM4B/CEN8q FISH probe Abnova Corp.). In the neoadjuvant cohort in the anthracycline-treated group, we observed a significant difference (p = 0.029) of average LAPTM4B copy number between the non-responder and pathological complete responder groups (4.1 ± 1.1 vs. 2.6 ± 0.1). In the adjuvant setting, the anthracycline-treated group of metastatic breast carcinomas was characterized by higher LAPTM4B copy number comparing to the non-metastatic ones (p = 0.046). In contrast, in the non-anthracycline-treated group of patients, we did not find any LAPTM4B gene copy number differences between responder vs. non-responder groups or between metastatic vs. non-metastatic groups. Our results confirm the possible role of the LAPTM4B gene in anthracycline resistance in HR- breast cancer. Analyzing LAPTM4B copy number pattern may support future treatment decision.
Screening for common copy-number variants in cancer genes.
Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L
2010-12-01
For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.
Huo, Zhen; Zeng, Xuan; Wu, Shafei; Wu, Huanwen; Meng, Yunxiao; Liu, Yuanyuan; Luo, Yufeng; Cao, Jinling; Liang, Zhiyong
2015-08-01
To explore the diagnostic value of MYB protein expression for adenoid cystic carcinoma and its differential diagnosis from other salivary gland tumors, and to further investigate the status of MYB gene copy number. MYB expression was studied by immunohistochemistry in 34 adenoid cystic carcinomas, 55 non-adenoid cystic carcinomas (other salivary gland tumors) including 10 pleomorphic adenomas, 10 basal cell adenomas, 10 epithelial-myoepithelial carcinomas, 9 basal cell adenocarcinomas, 8 mucoepidermoid carcinomas, 4 carcinoma in pleomorphic adenomas, and 4 polymorphous low-grade adenocarcinoma. MYB gene copy number status was detected by FISH in MYB protein-positive cases. 82.4% (28/34) of adenoid cystic carcinomas were MYB protein-positive, compared with 9.1% (5/55) of non-adenoid cystic carcinomas, and the difference between the two groups was statistically significant (P < 0.01). 2/18 of adenoid cystic carcinomas had duplication of MYB gene by FISH, and all non-adenoid cystic carcinomas were negative although the difference was not statistically significant (P = 0.435). MYB protein expression is a useful diagnostic marker for adenoid cystic carcinomas in its separation from other salivary gland tumors. In addition, duplication of MYB gene is no a major mechanism for the MYB protein overexpression.
Sung, Chang Ohk; Choi, Chel Hun; Ko, Young-Hyeh; Ju, Hyunjeong; Choi, Yoon-La; Kim, Nyunsu; Kang, So Young; Ha, Sang Yun; Choi, Kyusam; Bae, Duk-Soo; Lee, Jeong-Won; Kim, Tae-Joong; Song, Sang Yong; Kim, Byoung-Gie
2013-05-01
Ovarian clear cell adenocarcinoma (Ov-CCA) is a distinctive subtype of ovarian epithelial carcinoma. In this study, we performed array comparative genomic hybridization (aCGH) and paired gene expression microarray of 19 fresh-frozen samples and conducted integrative analysis. For the copy number alterations, significantly amplified regions (false discovery rate [FDR] q <0.05) were 1q21.3 and 8q24.3, and significantly deleted regions were 3p21.31, 4q12, 5q13.2, 5q23.2, 5q31.1, 7p22.1, 7q11.23, 8p12, 9p22.1, 11p15.1, 12p13.31, 15q11.2, 15q21.2, 18p11.31, and 22q11.21 using the Genomic Identification of Significant Targets in Cancer (GISTIC) analysis. Integrative analysis revealed 94 genes demonstrating frequent copy number alterations (>25% of samples) that correlated with gene expression (FDR <0.05). These genes were mainly located on 8p11.21, 8p21.2-p21.3, 8q22.1, 8q24.3, 17q23.2-q23.3, 19p13.3, and 19p13.11. Among the regions, 8q24.3 was found to contain the most genes (30 of 94 genes) including PTK2. The 8q24.3 region was indicated as the most significant region, as supported by copy number, GISTIC, and integrative analysis. Pathway analysis using differentially expressed genes on 8q24.3 revealed several major nodes, including PTK2. In conclusion, we identified a set of 94 candidate genes with frequent copy number alterations that correlated with gene expression. Specific chromosomal alterations, such as the 8q24.3 gain containing PTK2, could be a therapeutic target in a subset of Ov-CCAs. Copyright © 2013. Published by Elsevier Inc.
Yin, L G; Zou, Z Q; Zhao, H Y; Zhang, C L; Shen, J G; Qi, L; Qi, M; Xue, Z Q
2014-01-01
Adenocarcinoma (ADC) and squamous cell carcinomas (SCC) are two subtypes of non-small cell lung carcinomas which are regarded as the leading cause of cancer-related malignancy worldwide. The aim of this study is to detect the differentially methylated loci (DMLs) and differentially methylated genes (DMGs) of these two tumor sets, and then to illustrate the different expression level of specific methylated genes. Using TCGA database and Illumina HumanMethylation 27 arrays, we first screened the DMGs and DMLs in tumor samples. Then, we explored the BiologicalProcess terms of hypermethylated and hypomethylated genes using Functional Gene Ontology (GO) catalogues. Hypermethylation intensively occurred in CpG-island, whereas hypomethylation was located in non-CpG-island. Most SCC and ADC hypermethylated genes involved GO function of DNA dependenit regulation of transcription, and hypomethylated genes mainly 'enriched in the term of immune responses. Additionally, the expression level of specific differentially methylated genesis distinctbetween ADC and SCC. It is concluded that ADC and SCC have different methylated status that might play an important role in carcinogenesis.
Copy number of ArsR reporter plasmid determines its arsenite response and metal specificity.
Fang, Yun; Zhu, Chunjie; Chen, Xingjuan; Wang, Yan; Xu, Meiying; Sun, Guoping; Guo, Jun; Yoo, Jinnon; Tie, Cuijuan; Jiang, Xin; Li, Xianqiang
2018-05-16
The key component in bacteria-based biosensors is a transcriptional reporter employed to monitor induction or repression of a reporter gene corresponding to environmental change. In this study, we made a series of reporters in order to achieve highly sensitive detection of arsenite. From these reporters, two biosensors were developed by transformation of Escherichia coli DH5α with pLHPars9 and pLLPars9, consisting of either a high or low copy number plasmid, along with common elements of ArsR-luciferase fusion and addition of two binding sequences, one each from E. coli and Acidithiobacillus ferrooxidans chromosome, in front of the R773 ArsR operon. Both of them were highly sensitive to arsenite, with a low detection limit of 0.04 μM arsenite (~ 5 μg/L). They showed a wide dynamic range of detection up to 50 μM using high copy number pLHPars9 and 100 μM using low copy number pLLPars9. Significantly, they differ in metal specificity, pLLPars9 more specific to arsenite, while pLHPars9 to both arsenite and antimonite. The only difference between pLHPars9 and pLLPars9 is their copy numbers of plasmid and corresponding ratios of ArsR to its binding promoter/operator sequence. Therefore, we propose a working model in which DNA bound-ArsR is different from its free form in metal specificity.
Reis-Cunha, João Luís; Valdivia, Hugo O; Bartholomeu, Daniella Castanheira
2018-02-01
Trypanosomatids are a group of kinetoplastid parasites including some of great public health importance, causing debilitating and life-long lasting diseases that affect more than 24 million people worldwide. Among the trypanosomatids, Trypanosoma cruzi, Trypanosoma brucei and species from the Leishmania genus are the most well studied parasites, due to their high prevalence in human infections. These parasites have an extreme genomic and phenotypic variability, with a massive expansion in the copy number of species-specific multigene families enrolled in host-parasite interactions that mediate cellular invasion and immune evasion processes. As most trypanosomatids are heteroxenous, and therefore their lifecycles involve the transition between different hosts, these parasites have developed several strategies to ensure a rapid adaptation to changing environments. Among these strategies, a rapid shift in the repertoire of expressed genes, genetic variability and genome plasticity are key mechanisms. Trypanosomatid genomes are organized into large directional gene clusters that are transcribed polycistronically, where genes derived from the same polycistron may have very distinct mRNA levels. This particular mode of transcription implies that the control of gene expression operates mainly at post-transcriptional level. In this sense, gene duplications/losses were already associated with changes in mRNA levels in these parasites. Gene duplications also allow the generation of sequence variability, as the newly formed copy can diverge without loss of function of the original copy. Recently, aneuploidies have been shown to occur in several Leishmania species and T. cruzi strains. Although aneuploidies are usually associated with debilitating phenotypes in superior eukaryotes, recent data shows that it could also provide increased fitness in stress conditions and generate drug resistance in unicellular eukaryotes. In this review, we will focus on gene and chromosomal copy
RUBIC identifies driver genes by detecting recurrent DNA copy number breaks
van Dyk, Ewald; Hoogstraat, Marlous; ten Hoeve, Jelle; Reinders, Marcel J. T.; Wessels, Lodewyk F. A.
2016-01-01
The frequent recurrence of copy number aberrations across tumour samples is a reliable hallmark of certain cancer driver genes. However, state-of-the-art algorithms for detecting recurrent aberrations fail to detect several known drivers. In this study, we propose RUBIC, an approach that detects recurrent copy number breaks, rather than recurrently amplified or deleted regions. This change of perspective allows for a simplified approach as recursive peak splitting procedures and repeated re-estimation of the background model are avoided. Furthermore, we control the false discovery rate on the level of called regions, rather than at the probe level, as in competing algorithms. We benchmark RUBIC against GISTIC2 (a state-of-the-art approach) and RAIG (a recently proposed approach) on simulated copy number data and on three SNP6 and NGS copy number data sets from TCGA. We show that RUBIC calls more focal recurrent regions and identifies a much larger fraction of known cancer genes. PMID:27396759
EPSPS Gene Copy Number and Whole-Plant Glyphosate Resistance Level in Kochia scoparia
Gaines, Todd A.; Barker, Abigail L.; Patterson, Eric L.; Westra, Philip; Westra, Eric P.; Wilson, Robert G.; Jha, Prashant; Kumar, Vipan
2016-01-01
Glyphosate-resistant (GR) Kochia scoparia has evolved in dryland chemical fallow systems throughout North America and the mechanism of resistance involves 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene duplication. Agricultural fields in four states were surveyed for K. scoparia in 2013 and tested for glyphosate-resistance level and EPSPS gene copy number. Glyphosate resistance was confirmed in K. scoparia populations collected from sugarbeet fields in Colorado, Wyoming, and Nebraska, and Montana. Glyphosate resistance was also confirmed in K. scoparia accessions collected from wheat-fallow fields in Montana. All GR samples had increased EPSPS gene copy number, with median population values up to 11 from sugarbeet fields and up to 13 in Montana wheat-fallow fields. The results indicate that glyphosate susceptibility can be accurately diagnosed using EPSPS gene copy number. PMID:27992501
EPSPS Gene Copy Number and Whole-Plant Glyphosate Resistance Level in Kochia scoparia.
Gaines, Todd A; Barker, Abigail L; Patterson, Eric L; Westra, Philip; Westra, Eric P; Wilson, Robert G; Jha, Prashant; Kumar, Vipan; Kniss, Andrew R
2016-01-01
Glyphosate-resistant (GR) Kochia scoparia has evolved in dryland chemical fallow systems throughout North America and the mechanism of resistance involves 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene duplication. Agricultural fields in four states were surveyed for K. scoparia in 2013 and tested for glyphosate-resistance level and EPSPS gene copy number. Glyphosate resistance was confirmed in K. scoparia populations collected from sugarbeet fields in Colorado, Wyoming, and Nebraska, and Montana. Glyphosate resistance was also confirmed in K. scoparia accessions collected from wheat-fallow fields in Montana. All GR samples had increased EPSPS gene copy number, with median population values up to 11 from sugarbeet fields and up to 13 in Montana wheat-fallow fields. The results indicate that glyphosate susceptibility can be accurately diagnosed using EPSPS gene copy number.
Copy number polymorphism of the salivary amylase gene: implications in human nutrition research.
Santos, J L; Saus, E; Smalley, S V; Cataldo, L R; Alberti, G; Parada, J; Gratacòs, M; Estivill, X
2012-01-01
The salivary α-amylase is a calcium-binding enzyme that initiates starch digestion in the oral cavity. The α-amylase genes are located in a cluster on the chromosome that includes salivary amylase genes (AMY1), two pancreatic α-amylase genes (AMY2A and AMY2B) and a related pseudogene. The AMY1 genes show extensive copy number variation which is directly proportional to the salivary α-amylase content in saliva. The α-amylase amount in saliva is also influenced by other factors, such as hydration status, psychosocial stress level, and short-term dietary habits. It has been shown that the average copy number of AMY1 gene is higher in populations that evolved under high-starch diets versus low-starch diets, reflecting an intense positive selection imposed by diet on amylase copy number during evolution. In this context, a number of different aspects can be considered in evaluating the possible impact of copy number variation of the AMY1 gene on nutrition research, such as issues related to human diet gene evolution, action on starch digestion, effect on glycemic response after starch consumption, modulation of the action of α-amylases inhibitors, effect on taste perception and satiety, influence on psychosocial stress and relation to oral health. Copyright © 2012 S. Karger AG, Basel.
Detection of MET Gene Copy Number in Cancer Samples Using the Droplet Digital PCR Method.
Zhang, Yanni; Tang, En-Tzu; Du, Zhiqiang
2016-01-01
The analysis of MET gene copy number (CN) has been considered to be a potential biomarker to predict the response to MET-targeted therapies in various cancers. However, the current standard methods to determine MET CN are SNP 6.0 in the genomic DNA of cancer cell lines and fluorescence in situ hybridization (FISH) in tumor models, respectively, which are costly and require advanced technical skills and result in relatively subjective judgments. Therefore, we employed a novel method, droplet digital PCR (ddPCR), to determine the MET gene copy number with high accuracy and precision. The genomic DNA of cancer cell lines or tumor models were tested and compared with the MET gene CN and MET/CEN-7 ratio determined by SNP 6.0 and FISH, respectively. In cell lines, the linear association of the MET CN detected by ddPCR and SNP 6.0 is strong (Pearson correlation = 0.867). In tumor models, the MET CN detected by ddPCR was significantly different between the MET gene amplification and non-amplification groups according to FISH (mean: 15.4 vs 2.1; P = 0.044). Given that MET gene amplification is defined as MET CN >5.5 by ddPCR, the concordance rate between ddPCR and FISH was 98.0%, and Cohen's kappa coefficient was 0.760 (95% CI, 0.498-1.000; P <0.001). The results demonstrated that the ddPCR method has the potential to quantify the MET gene copy number with high precision and accuracy as compared with the results from SNP 6.0 and FISH in cancer cell lines and tumor samples, respectively.
Bassuk, Alexander G.; Muthuswamy, Lakshmi B.; Boland, Riley; Smith, Tiffany L.; Hulstrand, Alissa M.; Northrup, Hope; Hakeman, Matthew; Dierdorff, Jason M.; Yung, Christina K.; Long, Abby; Brouillette, Rachel B.; Au, Kit Sing; Gurnett, Christina; Houston, Douglas W.; Cornell, Robert A.; Manak, J. Robert
2013-01-01
Neural tube defects (NTDs) are common birth defects of complex etiology. Family and population-based studies have confirmed a genetic component to NTDs. However, despite more than three decades of research, the genes involved in human NTDs remain largely unknown. We tested the hypothesis that rare copy number variants (CNVs), especially de novo germline CNVs, are a significant risk factor for NTDs. We used array-based comparative genomic hybridization (aCGH) to identify rare CNVs in 128 Caucasian and 61 Hispanic patients with non-syndromic lumbar-sacral myelomeningocele. We also performed aCGH analysis on the parents of affected individuals with rare CNVs where parental DNA was available (42 sets). Among the eight de novo CNVs that we identified, three generated copy number changes of entire genes. One large heterozygous deletion removed 27 genes, including PAX3, a known spina bifida-associated gene. A second CNV altered genes (PGPD8, ZC3H6) for which little is known regarding function or expression. A third heterozygous deletion removed GPC5 and part of GPC6, genes encoding glypicans. Glypicans are proteoglycans that modulate the activity of morphogens such as Sonic Hedgehog (SHH) and bone morphogenetic proteins (BMPs), both of which have been implicated in NTDs. Additionally, glypicans function in the planar cell polarity (PCP) pathway, and several PCP genes have been associated with NTDs. Here, we show that GPC5 orthologs are expressed in the neural tube, and that inhibiting their expression in frog and fish embryos results in NTDs. These results implicate GPC5 as a gene required for normal neural tube development. PMID:23223018
Plasmodium copy number variation scan: gene copy numbers evaluation in haploid genomes.
Beghain, Johann; Langlois, Anne-Claire; Legrand, Eric; Grange, Laura; Khim, Nimol; Witkowski, Benoit; Duru, Valentine; Ma, Laurence; Bouchier, Christiane; Ménard, Didier; Paul, Richard E; Ariey, Frédéric
2016-04-12
In eukaryotic genomes, deletion or amplification rates have been estimated to be a thousand more frequent than single nucleotide variation. In Plasmodium falciparum, relatively few transcription factors have been identified, and the regulation of transcription is seemingly largely influenced by gene amplification events. Thus copy number variation (CNV) is a major mechanism enabling parasite genomes to adapt to new environmental changes. Currently, the detection of CNVs is based on quantitative PCR (qPCR), which is significantly limited by the relatively small number of genes that can be analysed at any one time. Technological advances that facilitate whole-genome sequencing, such as next generation sequencing (NGS) enable deeper analyses of the genomic variation to be performed. Because the characteristics of Plasmodium CNVs need special consideration in algorithms and strategies for which classical CNV detection programs are not suited a dedicated algorithm to detect CNVs across the entire exome of P. falciparum was developed. This algorithm is based on a custom read depth strategy through NGS data and called PlasmoCNVScan. The analysis of CNV identification on three genes known to have different levels of amplification and which are located either in the nuclear, apicoplast or mitochondrial genomes is presented. The results are correlated with the qPCR experiments, usually used for identification of locus specific amplification/deletion. This tool will facilitate the study of P. falciparum genomic adaptation in response to ecological changes: drug pressure, decreased transmission, reduction of the parasite population size (transition to pre-elimination endemic area).
Zauber, Peter; Marotta, Stephen; Sabbath-Solitare, Marlene
2016-03-12
Changes in the number of alleles of a chromosome may have an impact upon gene expression. Loss of heterozygosity (LOH) indicates that one allele of a gene has been lost, and knowing the exact copy number of the gene would indicate whether duplication of the remaining allele has occurred. We were interested to determine the copy number of the Adenomatous Polyposis Coli (APC) gene in sporadic colorectal cancers with LOH. We selected 38 carcinomas with LOH for the APC gene region of chromosome 5, as determined by amplification of the CA repeat region within the D5S346 loci. The copy number status of APC was ascertained using the SALSA® MLPA® P043-B1 APC Kit. LOH for the DCC gene, KRAS gene mutation, and microsatellite instability were also evaluated for each tumor, utilizing standard polymerase chain reaction methods. No tumor demonstrated microsatellite instability. LOH of the DCC gene was also present in 33 of 36 (91.7%) informative tumors. A KRAS gene mutation was present in 16 of the 38 (42.1%) tumors. Twenty-four (63.2%) of the tumors were copy number neutral, 10 (26.3%) tumors demonstrated major loss, while two (5.3%) showed partial loss. Two tumors (5.3%) had copy number gain. Results of APC and DCC LOH, KRAS and microsatellite instability indicate our colorectal cancer cases were typical of sporadic cancers following the 'chromosomal instability' pathway. The majority of our colorectal carcinomas with LOH for APC gene are copy number neutral. However, one-third of our cases showed copy number loss, suggesting that duplication of the remaining allele is not required for the development of a colorectal carcinoma.
UGT2B17 and SULT1A1 gene copy number variation (CNV) detection by LabChip microfluidic technology.
Gaedigk, Andrea; Gaedigk, Roger; Leeder, J Steven
2010-05-01
Gene copy number variations (CNVs) are increasingly recognized to play important roles in the expression of genes and hence on their respective enzymatic activities. This has been demonstrated for a number of drug metabolizing genes, such as UDP-glucuronosyltransferases 2B17 (UGT2B17) and sulfotransferase 1A1 (SULT1A1), which are subject to genetic heterogeneity, including CNV. Quantitative assays to assess gene copy number are therefore becoming an integral part of accurate genotype assessment and phenotype prediction. In this study, we evaluated a microfluidics-based system, the Bio-Rad Experion system, to determine the power and utility of this platform to detect UGT2B17 and SULT1A1 CNV in DNA samples derived from blood and tissue. UGT2B17 is known to present with 0, 1 or 2 and SULT1A1 with up to 5 gene copies. Distinct clustering (p<0.001) into copy number groups was achieved for both genes. DNA samples derived from blood exhibited less inter-run variability compared to DNA samples obtained from liver tissue. This variability may be caused by tissue-specific PCR inhibitors as it could be overcome by using DNA from another tissue, or after the DNA had undergone whole genome amplification. This method produced results comparable to those reported for other quantitative test platforms.
Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas
2016-05-01
Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Li, Chunyan; Bai, Jingchao; Hao, Xiaomeng; Zhang, Sheng; Hu, Yunhui; Zhang, Xiaobei; Yuan, Weiping; Hu, Linping; Cheng, Tao; Zetterberg, Anders; Lee, Mong-Hong; Zhang, J
2014-01-01
Breast cancer is a disease of cell cycle, and the dysfunction of cell cycle checkpoints plays a vital role in the occurrence and development of breast cancer. We employed multi-gene fluorescence in situ hybridization (M-FISH) to investigate gene copy number aberrations (CNAs) of 4 genes (Rb1, CHEK2, c-Myc, CCND1) that are involved in the regulation of cell cycle, in order to analyze the impact of gene aberrations on prognosis in the young breast cancer patients. Gene copy number aberrations of these 4 genes were more frequently observed in young breast cancer patients when compared with the older group. Further, these CNAs were more frequently seen in Luminal B type, Her2 overexpression, and tiple-negative breast cancer (TNBC) type in young breast cancer patients. The variations of CCND1, Rb1, and CHEK2 were significantly correlated with poor survival in the young breast cancer patient group, while the amplification of c-Myc was not obviously correlated with poor survival in young breast cancer patients. Thus, gene copy number aberrations (CNAs) of cell cycle-regulated genes can serve as an important tool for prognosis in young breast cancer patients. PMID:24621502
Mark Welch, David B; Cummings, Michael P; Hillis, David M; Meselson, Matthew
2004-02-10
Rotifers of the asexual class Bdelloidea are unusual in possessing two or more divergent copies of every gene that has been examined. Phylogenetic analysis of the heat-shock gene hsp82 and the TATA-box-binding protein gene tbp in multiple bdelloid species suggested that for each gene, each copy belonged to one of two lineages that began to diverge before the bdelloid radiation. Such gene trees are consistent with the two lineages having descended from former alleles that began to diverge after meiotic segregation ceased or from subgenomes of an alloploid ancestor of the bdelloids. However, the original analyses of bdelloid gene-copy divergence used only a single outgroup species and were based on parsimony and neighbor joining. We have now used maximum likelihood and Bayesian inference methods and, for hsp82, multiple outgroups in an attempt to produce more robust gene trees. Here we report that the available data do not unambiguously discriminate between gene trees that root the origin of hsp82 and tbp copy divergence before the bdelloid radiation and those which indicate that the gene copies began to diverge within bdelloid families. The remarkable presence of multiple diverged gene copies in individual genomes is nevertheless consistent with the loss of sex in an ancient ancestor of bdelloids.
Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number.
Price, Ric N; Uhlemann, Anne-Catrin; Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev
The borders of Thailand harbour the world's most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6.3 (95% CI 2.9-13.8, p<0.001) after mefloquine monotherapy and 5.4 (2.0-14.6, p=0.001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a parasite transport protein, is the best overall predictor of treatment failure with
[Detection of the exogenous gene copy number of the transgenic tomato anti-caries vaccine].
Bai, Guo-hui; Liu, Jian-guo; Tian, Yuan; Chen, Zhu; Bai, Peng-yuan; Han, Qi; Gu, Yu; Guan, Xiao-yan; Wang, Hai-hui
2013-12-01
To detect the exogenous gene copy number of the transgenic tomato anti-caries vaccine by using the SYBR Green real-time PCR. Recombinant plasmid pEAC10 and pEPC10 were used as standard to detect genome samples of exogenous gene pacA-ctxB and pacP-ctxB by SYBR green fluorescent quantitation, then the average value was calculated as gene copy number. The copy number of the transgenic tomato carrying pacA-ctxB was 1.3 and the pacP-ctxB was 3.2. The transgenic tomato plants which have high stability are low-copy transgenic plants. Supported by National Natural Science Foundation of China (30160086, 81260164), Science and Technical Fund of Guizhou Province (LKZ[2011]41), Project of Technology Innovation Team in Guizhou Province, Leading Academic Discipline Construction Project in Guizhou Province and Excellent Scientific Research Team Cultivation Project in Zunyi Medical College ([2012]12).
Garcia, Nelson; Messing, Joachim
2017-01-01
The TEL2, TTI1, and TTI2 proteins are co-chaperones for heat shock protein 90 (HSP90) to regulate the protein folding and maturation of phosphatidylinositol 3-kinase-related kinases (PIKKs). Referred to as the TTT complex, the genes that encode them are highly conserved from man to maize. TTT complex and PIKK genes exist mostly as single copy genes in organisms where they have been characterized. Members of this interacting protein network in maize were identified and synteny analyses were performed to study their evolution. Similar to other species, there is only one copy of each of these genes in maize which was due to a loss of the duplicated copy created by ancient allotetraploidy. Moreover, the retained copies of the TTT complex and the PIKK genes tolerated extensive retrotransposon insertion in their introns that resulted in increased gene lengths and gene body methylation, without apparent effect in normal gene expression and function. The results raise an interesting question on whether the reversion to single copy was due to selection against deleterious unbalanced gene duplications between members of the complex as predicted by the gene balance hypothesis, or due to neutral loss of extra copies. Uneven alteration of dosage either by adding extra copies or modulating gene expression of complex members is being proposed as a means to investigate whether the data supports the gene balance hypothesis or not.
Kon, M; Suzuki, E; Dung, V C; Hasegawa, Y; Mitsui, T; Muroya, K; Ueoka, K; Igarashi, N; Nagasaki, K; Oto, Y; Hamajima, T; Yoshino, K; Igarashi, M; Kato-Fukui, Y; Nakabayashi, K; Hayashi, K; Hata, K; Matsubara, Y; Moriya, K; Ogata, T; Nonomura, K; Fukami, M
2015-03-01
What percentage of cases with non-syndromic hypospadias can be ascribed to mutations in known causative/candidate/susceptibility genes or submicroscopic copy-number variations (CNVs) in the genome? Monogenic and digenic mutations in known causative genes and cryptic CNVs account for >10% of cases with non-syndromic hypospadias. While known susceptibility polymorphisms appear to play a minor role in the development of this condition, further studies are required to validate this observation. Fifteen causative, three candidate, and 14 susceptible genes, and a few submicroscopic CNVs have been implicated in non-syndromic hypospadias. Systematic mutation screening and genome-wide copy-number analysis of 62 patients. The study group consisted of 57 Japanese and five Vietnamese patients with non-syndromic hypospadias. Systematic mutation screening was performed for 25 known causative/candidate/susceptibility genes using a next-generation sequencer. Functional consequences of nucleotide alterations were assessed by in silico assays. The frequencies of polymorphisms in the patient group were compared with those in the male general population. CNVs were analyzed by array-based comparative genomic hybridization and characterized by fluorescence in situ hybridization. Seven of 62 patients with anterior or posterior hypospadias carried putative pathogenic mutations, such as hemizygous mutations in AR, a heterozygous mutation in BNC2, and homozygous mutations in SRD5A2 and HSD3B2. Two of the seven patients had mutations in multiple genes. We did not find any rare polymorphisms that were abundant specifically in the patient group. One patient carried mosaic dicentric Y chromosome. The patient group consisted solely of Japanese and Vietnamese individuals and clinical and hormonal information of the patients remained rather fragmentary. In addition, mutation analysis focused on protein-altering substitutions. Our data provide evidence that pathogenic mutations can underlie both
Lyng, Heidi; Lando, Malin; Brøvig, Runar S; Svendsrud, Debbie H; Johansen, Morten; Galteland, Eivind; Brustugun, Odd T; Meza-Zepeda, Leonardo A; Myklebost, Ola; Kristensen, Gunnar B; Hovig, Eivind; Stokke, Trond
2008-01-01
Absolute tumor DNA copy numbers can currently be achieved only on a single gene basis by using fluorescence in situ hybridization (FISH). We present GeneCount, a method for genome-wide calculation of absolute copy numbers from clinical array comparative genomic hybridization data. The tumor cell fraction is reliably estimated in the model. Data consistent with FISH results are achieved. We demonstrate significant improvements over existing methods for exploring gene dosages and intratumor copy number heterogeneity in cancers. PMID:18500990
Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number
Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev
2015-01-01
Summary Background The borders of Thailand harbour the world’s most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. Methods The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Findings Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6·3 (95% CI 2·9–13·8, p<0·001) after mefloquine monotherapy and 5·4 (2·0-14·6, p=0·001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Interpretation Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Relevance to practice Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a
Spies, Annika; Korzun, Viktor; Bayles, Rosemary; Rajaraman, Jeyaraman; Himmelbach, Axel; Hedley, Pete E.; Schweizer, Patrick
2012-01-01
Race-non-specific, or quantitative, pathogen resistance is of high importance to plant breeders due to its expected durability. However, it is usually controlled by multiple quantitative trait loci (QTL) and therefore difficult to handle in practice. Knowing the genes that underlie race-non-specific resistance (NR) would allow its exploitation in a more targeted manner. Here, we performed an association-genetic study in a customized worldwide collection of spring barley accessions for candidate genes of race-NR to the powdery mildew fungus Blumeria graminis f. sp. hordei (Bgh) and combined data with results from QTL mapping as well as functional-genomics approaches. This led to the identification of 11 associated genes with converging evidence for an important role in race-NR in the presence of the Mlo gene for basal susceptibility. Outstanding in this respect was the gene encoding the transcription factor WRKY2. The results suggest that unlocking plant genetic resources and integrating functional-genomic with genetic approaches can accelerate the discovery of genes underlying race-NR in barley and other crop plants. PMID:22629270
Increased copy number of the DLX4 homeobox gene in breast axillary lymph node metastasis
Torresan, Clarissa; Oliveira, Márcia M.C.; Pereira, Silma R.F.; Ribeiro, Enilze M.S.F.; Marian, Catalin; Gusev, Yuriy; Lima, Rubens S.; Urban, Cicero A.; Berg, Patricia E.; Haddad, Bassem R.; Cavalli, Iglenir J.; Cavalli, Luciane R.
2017-01-01
DLX4 is a homeobox gene strongly implicated in breast tumor progression and invasion. Our main objective was to determine the DLX4 copy number status in sentinel lymph node (SLN) metastasis to assess its involvement in the initial stages of the axillary metastatic process. A total of 37 paired samples of SLN metastasis and primary breast tumors (PBT) were evaluated by fluorescence in situ hybridization, quantitative polymerase chain reaction and array comparative genomic hybridization assays. DLX4 increased copy number was observed in 21.6% of the PBT and 24.3% of the SLN metastasis; regression analysis demonstrated that the DLX4 alterations observed in the SLN metastasis were dependent on the ones in the PBT, indicating that they occur in the primary tumor cell populations and are maintained in the early axillary metastatic site. In addition, regression analysis demonstrated that DLX4 alterations (and other DLX and HOXB family members) occurred independently of the ones in the HER2/NEU gene, the main amplification driver on the 17q region. Additional studies evaluating DLX4 copy number in non-SLN axillary lymph nodes and/or distant breast cancer metastasis are necessary to determine if these alterations are carried on and maintained during more advanced stages of tumor progression and if could be used as a predictive marker for axillary involvement. PMID:24947980
Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin
2010-07-27
The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.
Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting.
Aguirre, Andrew J; Meyers, Robin M; Weir, Barbara A; Vazquez, Francisca; Zhang, Cheng-Zhong; Ben-David, Uri; Cook, April; Ha, Gavin; Harrington, William F; Doshi, Mihir B; Kost-Alimova, Maria; Gill, Stanley; Xu, Han; Ali, Levi D; Jiang, Guozhi; Pantel, Sasha; Lee, Yenarae; Goodale, Amy; Cherniack, Andrew D; Oh, Coyin; Kryukov, Gregory; Cowley, Glenn S; Garraway, Levi A; Stegmaier, Kimberly; Roberts, Charles W; Golub, Todd R; Meyerson, Matthew; Root, David E; Tsherniak, Aviad; Hahn, William C
2016-08-01
The CRISPR/Cas9 system enables genome editing and somatic cell genetic screens in mammalian cells. We performed genome-scale loss-of-function screens in 33 cancer cell lines to identify genes essential for proliferation/survival and found a strong correlation between increased gene copy number and decreased cell viability after genome editing. Within regions of copy-number gain, CRISPR/Cas9 targeting of both expressed and unexpressed genes, as well as intergenic loci, led to significantly decreased cell proliferation through induction of a G2 cell-cycle arrest. By examining single-guide RNAs that map to multiple genomic sites, we found that this cell response to CRISPR/Cas9 editing correlated strongly with the number of target loci. These observations indicate that genome targeting by CRISPR/Cas9 elicits a gene-independent antiproliferative cell response. This effect has important practical implications for the interpretation of CRISPR/Cas9 screening data and confounds the use of this technology for the identification of essential genes in amplified regions. We found that the number of CRISPR/Cas9-induced DNA breaks dictates a gene-independent antiproliferative response in cells. These observations have practical implications for using CRISPR/Cas9 to interrogate cancer gene function and illustrate that cancer cells are highly sensitive to site-specific DNA damage, which may provide a path to novel therapeutic strategies. Cancer Discov; 6(8); 914-29. ©2016 AACR.See related commentary by Sheel and Xue, p. 824See related article by Munoz et al., p. 900This article is highlighted in the In This Issue feature, p. 803. 2016 American Association for Cancer Research.
Pohl, Nélida; Sison-Mangus, Marilou P; Yee, Emily N; Liswi, Saif W; Briscoe, Adriana D
2009-05-13
The increase in availability of genomic sequences for a wide range of organisms has revealed gene duplication to be a relatively common event. Encounters with duplicate gene copies have consequently become almost inevitable in the context of collecting gene sequences for inferring species trees. Here we examine the effect of incorporating duplicate gene copies evolving at different rates on tree reconstruction and time estimation of recent and deep divergences in butterflies. Sequences from ultraviolet-sensitive (UVRh), blue-sensitive (BRh), and long-wavelength sensitive (LWRh) opsins,EF-1 and COI were obtained from 27 taxa representing the five major butterfly families (5535 bp total). Both BRh and LWRh are present in multiple copies in some butterfly lineages and the different copies evolve at different rates. Regardless of the phylogenetic reconstruction method used, we found that analyses of combined data sets using either slower or faster evolving copies of duplicate genes resulted in a single topology in agreement with our current understanding of butterfly family relationships based on morphology and molecules. Interestingly, individual analyses of BRh and LWRh sequences also recovered these family-level relationships. Two different relaxed clock methods resulted in similar divergence time estimates at the shallower nodes in the tree, regardless of whether faster or slower evolving copies were used, with larger discrepancies observed at deeper nodes in the phylogeny. The time of divergence between the monarch butterfly Danaus plexippus and the queen D. gilippus (15.3-35.6 Mya) was found to be much older than the time of divergence between monarch co-mimic Limenitis archippus and red-spotted purple L. arthemis (4.7-13.6 Mya), and overlapping with the time of divergence of the co-mimetic passionflower butterflies Heliconius erato and H. melpomene (13.5-26.1 Mya). Our family-level results are congruent with recent estimates found in the literature and indicate
Pohl, Nélida; Sison-Mangus, Marilou P; Yee, Emily N; Liswi, Saif W; Briscoe, Adriana D
2009-01-01
Background The increase in availability of genomic sequences for a wide range of organisms has revealed gene duplication to be a relatively common event. Encounters with duplicate gene copies have consequently become almost inevitable in the context of collecting gene sequences for inferring species trees. Here we examine the effect of incorporating duplicate gene copies evolving at different rates on tree reconstruction and time estimation of recent and deep divergences in butterflies. Results Sequences from ultraviolet-sensitive (UVRh), blue-sensitive (BRh), and long-wavelength sensitive (LWRh) opsins,EF-1α and COI were obtained from 27 taxa representing the five major butterfly families (5535 bp total). Both BRh and LWRh are present in multiple copies in some butterfly lineages and the different copies evolve at different rates. Regardless of the phylogenetic reconstruction method used, we found that analyses of combined data sets using either slower or faster evolving copies of duplicate genes resulted in a single topology in agreement with our current understanding of butterfly family relationships based on morphology and molecules. Interestingly, individual analyses of BRh and LWRh sequences also recovered these family-level relationships. Two different relaxed clock methods resulted in similar divergence time estimates at the shallower nodes in the tree, regardless of whether faster or slower evolving copies were used, with larger discrepancies observed at deeper nodes in the phylogeny. The time of divergence between the monarch butterfly Danaus plexippus and the queen D. gilippus (15.3–35.6 Mya) was found to be much older than the time of divergence between monarch co-mimic Limenitis archippus and red-spotted purple L. arthemis (4.7–13.6 Mya), and overlapping with the time of divergence of the co-mimetic passionflower butterflies Heliconius erato and H. melpomene (13.5–26.1 Mya). Our family-level results are congruent with recent estimates found in
Yoshida, Tsuyoshi; Kobayashi, Takumi; Itoda, Masaya; Muto, Taika; Miyaguchi, Ken; Mogushi, Kaoru; Shoji, Satoshi; Shimokawa, Kazuro; Iida, Satoru; Uetake, Hiroyuki; Ishikawa, Toshiaki; Sugihara, Kenichi; Mizushima, Hiroshi; Tanaka, Hiroshi
2010-07-29
Colorectal cancer (CRC) is one of the most frequently occurring cancers in Japan, and thus a wide range of methods have been deployed to study the molecular mechanisms of CRC. In this study, we performed a comprehensive analysis of CRC, incorporating copy number aberration (CRC) and gene expression data. For the last four years, we have been collecting data from CRC cases and organizing the information as an "omics" study by integrating many kinds of analysis into a single comprehensive investigation. In our previous studies, we had experienced difficulty in finding genes related to CRC, as we observed higher noise levels in the expression data than in the data for other cancers. Because chromosomal aberrations are often observed in CRC, here, we have performed a combination of CNA analysis and expression analysis in order to identify some new genes responsible for CRC. This study was performed as part of the Clinical Omics Database Project at Tokyo Medical and Dental University. The purpose of this study was to investigate the mechanism of genetic instability in CRC by this combination of expression analysis and CNA, and to establish a new method for the diagnosis and treatment of CRC. Comprehensive gene expression analysis was performed on 79 CRC cases using an Affymetrix Gene Chip, and comprehensive CNA analysis was performed using an Affymetrix DNA Sty array. To avoid the contamination of cancer tissue with normal cells, laser micro-dissection was performed before DNA/RNA extraction. Data analysis was performed using original software written in the R language. We observed a high percentage of CNA in colorectal cancer, including copy number gains at 7, 8q, 13 and 20q, and copy number losses at 8p, 17p and 18. Gene expression analysis provided many candidates for CRC-related genes, but their association with CRC did not reach the level of statistical significance. The combination of CNA and gene expression analysis, together with the clinical information
Pan, W J; Blackburn, E H
1995-01-01
The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211
Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil
2017-10-27
Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes
Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai
2014-10-29
Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.
Finding-specific display presets for computed radiography soft-copy reading.
Andriole, K P; Gould, R G; Webb, W R
1999-05-01
Much work has been done to optimize the display of cross-sectional modality imaging examinations for soft-copy reading (i.e., window/level tissue presets, and format presentations such as tile and stack modes, four-on-one, nine-on-one, etc). Less attention has been paid to the display of digital forms of the conventional projection x-ray. The purpose of this study is to assess the utility of providing presets for computed radiography (CR) soft-copy display, based not on the window/level settings, but on processing applied to the image optimized for visualization of specific findings, pathologies, etc (i.e., pneumothorax, tumor, tube location). It is felt that digital display of CR images based on finding-specific processing presets has the potential to: speed reading of digital projection x-ray examinations on soft copy; improve diagnostic efficacy; standardize display across examination type, clinical scenario, important key findings, and significant negatives; facilitate image comparison; and improve confidence in and acceptance of soft-copy reading. Clinical chest images are acquired using an Agfa-Gevaert (Mortsel, Belgium) ADC 70 CR scanner and Fuji (Stamford, CT) 9000 and AC2 CR scanners. Those demonstrating pertinent findings are transferred over the clinical picture archiving and communications system (PACS) network to a research image processing station (Agfa PS5000), where the optimal image-processing settings per finding, pathologic category, etc, are developed in conjunction with a thoracic radiologist, by manipulating the multiscale image contrast amplification (Agfa MUSICA) algorithm parameters. Soft-copy display of images processed with finding-specific settings are compared with the standard default image presentation for 50 cases of each category. Comparison is scored using a 5-point scale with the positive scale denoting the standard presentation is preferred over the finding-specific processing, the negative scale denoting the finding-specific
Copy number variation detection in cattle reveals potential breed specific differences
USDA-ARS?s Scientific Manuscript database
Copy Number Variations (CNVs) are large, common deletions or duplications of genome sequence among individuals of a species that have been linked to diseases and phenotypic traits. For example, a CNV-generating, translocation mechanism encompassing the KIT gene is responsible for color sidedness in ...
Choi, Y-J; Nam, Y-S; Yun, J M; Park, J H; Cho, B L; Son, H-Y; Kim, J I; Yun, J W
2015-12-01
Salivary amylase gene (AMY1) copy number variations (CNVs) correlate directly with salivary amylase activity and serum amylase levels. Previously, individuals with high AMY1 CNVs exhibited low postprandial glucose levels and postprandial early insulin surge, suggesting that high AMY1 gene copy numbers may play a role in lowering the risk of insulin resistance. We verified the relationship between AMY1 CNVs and homeostatic model assessment-insulin resistance (HOMA-IR) in a cohort of 1257 Korean men aged 20-65 years who visited two medical centres for regular health check-ups, and in subgroups of current smokers and regular alcohol drinkers. Individuals with fasting plasma glucose levels > 10.0 mmol/l, HbA1c ≥ 64 mmol/mol (8.0%) or who used oral hypoglycaemic agents or insulin were excluded. AMY1 CNVs correlated negatively with HOMA-IR even after adjusting for covariates (e.g. BMI, systolic blood pressure, triacylglycerol, alcohol consumption, smoking and physical activity). When the participants were divided according to current smoking and alcohol consumption habits, negative correlations between AMY1 CNVs and HOMA-IR were more evident among non-smokers and regular drinkers and were non-significant among smokers and non-regular drinkers. Low AMY1 CNVs correlated with high insulin resistance in asymptomatic Korean men, and such a relationship presented differently according to the status of smoking and alcohol consumption. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.
Sakudoh, Takashi; Nakashima, Takeharu; Kuroki, Yoko; Fujiyama, Asao; Kohara, Yuji; Honda, Naoko; Fujimoto, Hirofumi; Shimada, Toru; Nakagaki, Masao; Banno, Yutaka; Tsuchida, Kozo
2011-03-01
The carotenoid-binding protein (CBP) of the domesticated silkworm, Bombyx mori, a major determinant of cocoon color, is likely to have been substantially influenced by domestication of this species. We analyzed the structure of the CBP gene in multiple strains of B. mori, in multiple individuals of the wild silkworm, B. mandarina (the putative wild ancestor of B. mori), and in a number of other lepidopterans. We found the CBP gene copy number in genomic DNA to vary widely among B. mori strains, ranging from 1 to 20. The copies of CBP are of several types, based on the presence of a retrotransposon or partial deletion of the coding sequence. In contrast to B. mori, B. mandarina was found to possess a single copy of CBP without the retrotransposon insertion, regardless of habitat. Several other lepidopterans were found to contain sequences homologous to CBP, revealing that this gene is evolutionarily conserved in the lepidopteran lineage. Thus, domestication can generate significant diversity of gene copy number and structure over a relatively short evolutionary time. © 2011 by the Genetics Society of America
Diversity in Copy Number and Structure of a Silkworm Morphogenetic Gene as a Result of Domestication
Sakudoh, Takashi; Nakashima, Takeharu; Kuroki, Yoko; Fujiyama, Asao; Kohara, Yuji; Honda, Naoko; Fujimoto, Hirofumi; Shimada, Toru; Nakagaki, Masao; Banno, Yutaka; Tsuchida, Kozo
2011-01-01
The carotenoid-binding protein (CBP) of the domesticated silkworm, Bombyx mori, a major determinant of cocoon color, is likely to have been substantially influenced by domestication of this species. We analyzed the structure of the CBP gene in multiple strains of B. mori, in multiple individuals of the wild silkworm, B. mandarina (the putative wild ancestor of B. mori), and in a number of other lepidopterans. We found the CBP gene copy number in genomic DNA to vary widely among B. mori strains, ranging from 1 to 20. The copies of CBP are of several types, based on the presence of a retrotransposon or partial deletion of the coding sequence. In contrast to B. mori, B. mandarina was found to possess a single copy of CBP without the retrotransposon insertion, regardless of habitat. Several other lepidopterans were found to contain sequences homologous to CBP, revealing that this gene is evolutionarily conserved in the lepidopteran lineage. Thus, domestication can generate significant diversity of gene copy number and structure over a relatively short evolutionary time. PMID:21242537
USDA-ARS?s Scientific Manuscript database
Despite a recent new classification, a stable tree of life for the cycads has been elusive, particularly regarding resolution of Bowenia, Stangeria and Dioon. In this study we apply five single copy nuclear genes (SCNGs) to the phylogeny of the order Cycadales. We specifically aim to evaluate seve...
Kejnovský, E; Vrána, J; Matsunaga, S; Soucek, P; Siroký, J; Dolezel, J; Vyskot, B
2001-07-01
The dioecious white campion Silene latifolia (syn. Melandrium album) has heteromorphic sex chromosomes, XX in females and XY in males, that are larger than the autosomes and enable their separation by flow sorting. The group of MROS genes, the first male-specifically expressed genes in dioecious plants, was recently identified in S. latifolia. To localize the MROS genes, we used the flow-sorted X chromosomes and autosomes as a template for PCR with internal primers. Our results indicate that the MROS3 gene is located in at least two copies tandemly arranged on the X chromosome with additional copy(ies) on the autosome(s), while MROS1, MROS2, and MROS4 are exclusively autosomal. The specificity of PCR products was checked by digestion with a restriction enzyme or reamplification using nested primers. Homology search of databases has shown the presence of five MROS3 homologues in A. thaliana, four of them arranged in two tandems, each consisting of two copies. We conclude that MROS3 is a low-copy gene family, connected with the proper pollen development, which is present not only in dioecious but also in other dicot plant species.
Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella.
Carabajal Paladino, Leonela Z; Nguyen, Petr; Síchová, Jindra; Marec, František
2014-01-01
We work on the development of transgenic sexing strains in the codling moth, Cydia pomonella (Tortricidae), which would enable to produce male-only progeny for the population control of this pest using sterile insect technique (SIT). To facilitate this research, we have developed a number of cytogenetic and molecular tools, including a physical map of the codling moth Z chromosome using BAC-FISH (fluorescence in situ hybridization with bacterial artificial chromosome probes). However, chromosomal localization of unique, single-copy sequences such as a transgene cassette by conventional FISH remains challenging. In this study, we adapted a FISH protocol with tyramide signal amplification (TSA-FISH) for detection of single-copy genes in Lepidoptera. We tested the protocol with probes prepared from partial sequences of Z-linked genes in the codling moth. Using a modified TSA-FISH protocol we successfully mapped a partial sequence of the Acetylcholinesterase 1 (Ace-1) gene to the Z chromosome and confirmed thus its Z-linkage. A subsequent combination of BAC-FISH with BAC probes containing anticipated neighbouring Z-linked genes and TSA-FISH with the Ace-1 probe allowed the integration of Ace-1 in the physical map of the codling moth Z chromosome. We also developed a two-colour TSA-FISH protocol which enabled us simultaneous localization of two Z-linked genes, Ace-1 and Notch, to the expected regions of the Z chromosome. We showed that TSA-FISH represents a reliable technique for physical mapping of genes on chromosomes of moths and butterflies. Our results suggest that this technique can be combined with BAC-FISH and in the future used for physical localization of transgene cassettes on chromosomes of transgenic lines in the codling moth or other lepidopteran species. Furthermore, the developed protocol for two-colour TSA-FISH might become a powerful tool for synteny mapping in non-model organisms.
Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella
2014-01-01
Background We work on the development of transgenic sexing strains in the codling moth, Cydia pomonella (Tortricidae), which would enable to produce male-only progeny for the population control of this pest using sterile insect technique (SIT). To facilitate this research, we have developed a number of cytogenetic and molecular tools, including a physical map of the codling moth Z chromosome using BAC-FISH (fluorescence in situ hybridization with bacterial artificial chromosome probes). However, chromosomal localization of unique, single-copy sequences such as a transgene cassette by conventional FISH remains challenging. In this study, we adapted a FISH protocol with tyramide signal amplification (TSA-FISH) for detection of single-copy genes in Lepidoptera. We tested the protocol with probes prepared from partial sequences of Z-linked genes in the codling moth. Results Using a modified TSA-FISH protocol we successfully mapped a partial sequence of the Acetylcholinesterase 1 (Ace-1) gene to the Z chromosome and confirmed thus its Z-linkage. A subsequent combination of BAC-FISH with BAC probes containing anticipated neighbouring Z-linked genes and TSA-FISH with the Ace-1 probe allowed the integration of Ace-1 in the physical map of the codling moth Z chromosome. We also developed a two-colour TSA-FISH protocol which enabled us simultaneous localization of two Z-linked genes, Ace-1 and Notch, to the expected regions of the Z chromosome. Conclusions We showed that TSA-FISH represents a reliable technique for physical mapping of genes on chromosomes of moths and butterflies. Our results suggest that this technique can be combined with BAC-FISH and in the future used for physical localization of transgene cassettes on chromosomes of transgenic lines in the codling moth or other lepidopteran species. Furthermore, the developed protocol for two-colour TSA-FISH might become a powerful tool for synteny mapping in non-model organisms. PMID:25471491
Non-fluent speech following stroke is caused by impaired efference copy.
Feenaughty, Lynda; Basilakos, Alexandra; Bonilha, Leonardo; den Ouden, Dirk-Bart; Rorden, Chris; Stark, Brielle; Fridriksson, Julius
2017-09-01
Efference copy is a cognitive mechanism argued to be critical for initiating and monitoring speech: however, the extent to which breakdown of efference copy mechanisms impact speech production is unclear. This study examined the best mechanistic predictors of non-fluent speech among 88 stroke survivors. Objective speech fluency measures were subjected to a principal component analysis (PCA). The primary PCA factor was then entered into a multiple stepwise linear regression analysis as the dependent variable, with a set of independent mechanistic variables. Participants' ability to mimic audio-visual speech ("speech entrainment response") was the best independent predictor of non-fluent speech. We suggest that this "speech entrainment" factor reflects integrity of internal monitoring (i.e., efference copy) of speech production, which affects speech initiation and maintenance. Results support models of normal speech production and suggest that therapy focused on speech initiation and maintenance may improve speech fluency for individuals with chronic non-fluent aphasia post stroke.
Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K
2011-04-04
New levels of gene regulation with microRNA (miR) and gene copy number alterations (CNAs) have been identified as playing a role in various cancers. We have previously reported that sporadic breast cancer tissues exhibit significant alteration in H2AX gene copy number. However, how CNA affects gene expression and what is the role of miR, miR-24-2, known to regulate H2AX expression, in the background of the change in copy number, are not known. Further, many miRs, including miR-24-2, are implicated as playing a role in cell proliferation and apoptosis, but their specific target genes and the pathways contributing to them remain unexplored. Changes in gene copy number and mRNA/miR expression were estimated using real-time polymerase chain reaction assays in two mammalian cell lines, MCF-7 and HeLa, and in a set of sporadic breast cancer tissues. In silico analysis was performed to find the putative target for miR-24-2. MCF-7 cells were transfected with precursor miR-24-2 oligonucleotides, and the gene expression levels of BRCA1, BRCA2, ATM, MDM2, TP53, CHEK2, CYT-C, BCL-2, H2AFX and P21 were examined using TaqMan gene expression assays. Apoptosis was measured by flow cytometric detection using annexin V dye. A luciferase assay was performed to confirm BCL-2 as a valid cellular target of miR-24-2. It was observed that H2AX gene expression was negatively correlated with miR-24-2 expression and not in accordance with the gene copy number status, both in cell lines and in sporadic breast tumor tissues. Further, the cells overexpressing miR-24-2 were observed to be hypersensitive to DNA damaging drugs, undergoing apoptotic cell death, suggesting the potentiating effect of mir-24-2-mediated apoptotic induction in human cancer cell lines treated with anticancer drugs. BCL-2 was identified as a novel cellular target of miR-24-2. mir-24-2 is capable of inducing apoptosis by modulating different apoptotic pathways and targeting BCL-2, an antiapoptotic gene. The study suggests
Iddawela, Mahesh; Rueda, Oscar; Eremin, Jenny; Eremin, Oleg; Cowley, Jed; Earl, Helena M; Caldas, Carlos
2017-07-11
An absence of reliable molecular markers has hampered individualised breast cancer treatments, and a major limitation for translational research is the lack of fresh tissue. There are, however, abundant banks of formalin-fixed paraffin-embedded (FFPE) tissue. This study evaluated two platforms available for the analysis of DNA copy number and gene expression using FFPE samples. The cDNA-mediated annealing, selection, extension, and ligation assay (DASL™) has been developed for gene expression analysis and the Molecular Inversion Probes assay (Oncoscan™), were used for copy number analysis using FFPE tissues. Gene expression and copy number were evaluated in core-biopsy samples from patients with breast cancer undergoing neoadjuvant chemotherapy (NAC). Forty-three core-biopsies were evaluated and characteristic copy number changes in breast cancers, gains in 1q, 8q, 11q, 17q and 20q and losses in 6q, 8p, 13q and 16q, were confirmed. Regions that frequently exhibited gains in tumours showing a pathological complete response (pCR) to NAC were 1q (55%), 8q (40%) and 17q (40%), whereas 11q11 (37%) gain was the most frequent change in non-pCR tumours. Gains associated with poor survival were 11q13 (62%), 8q24 (54%) and 20q (47%). Gene expression assessed by DASL correlated with immunohistochemistry (IHC) analysis for oestrogen receptor (ER) [area under the curve (AUC) = 0.95], progesterone receptor (PR)(AUC = 0.90) and human epidermal growth factor type-2 receptor (HER-2) (AUC = 0.96). Differential expression analysis between ER+ and ER- cancers identified over-expression of TTF1, LAF-4 and C-MYB (p ≤ 0.05), and between pCR vs non-pCRs, over-expression of CXCL9, AREG, B-MYB and under-expression of ABCG2. This study was an integrative analysis of copy number and gene expression using FFPE core biopsies and showed that molecular marker data from FFPE tissues were consistent with those in previous studies using fresh-frozen samples. FFPE tissue can provide
Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene.
Amit, Maayan; Sela, Noa; Keren, Hadas; Melamed, Ze'ev; Muler, Inna; Shomron, Noam; Izraeli, Shai; Ast, Gil
2007-11-29
Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.
Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei
2017-11-01
Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.
Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin
2017-01-01
Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy. PMID:29155896
Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc
2016-01-01
Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611
Specificity and non-specificity in RNA–protein interactions
Jankowsky, Eckhard; Harris, Michael E.
2016-01-01
Gene expression is regulated by complex networks of interactions between RNAs and proteins. Proteins that interact with RNA have been traditionally viewed as either specific or non-specific; specific proteins interact preferentially with defined RNA sequence or structure motifs, whereas non-specific proteins interact with RNA sites devoid of such characteristics. Recent studies indicate that the binary “specific vs. non-specific” classification is insufficient to describe the full spectrum of RNA–protein interactions. Here, we review new methods that enable quantitative measurements of protein binding to large numbers of RNA variants, and the concepts aimed as describing resulting binding spectra: affinity distributions, comprehensive binding models and free energy landscapes. We discuss how these new methodologies and associated concepts enable work towards inclusive, quantitative models for specific and non-specific RNA–protein interactions. PMID:26285679
Personalized gene silencing therapeutics for Huntington disease.
Kay, C; Skotte, N H; Southwell, A L; Hayden, M R
2014-07-01
Gene silencing offers a novel therapeutic strategy for dominant genetic disorders. In specific diseases, selective silencing of only one copy of a gene may be advantageous over non-selective silencing of both copies. Huntington disease (HD) is an autosomal dominant disorder caused by an expanded CAG trinucleotide repeat in the Huntingtin gene (HTT). Silencing both expanded and normal copies of HTT may be therapeutically beneficial, but preservation of normal HTT expression is preferred. Allele-specific methods can selectively silence the mutant HTT transcript by targeting either the expanded CAG repeat or single nucleotide polymorphisms (SNPs) in linkage disequilibrium with the expansion. Both approaches require personalized treatment strategies based on patient genotypes. We compare the prospect of safe treatment of HD by CAG- and SNP-specific silencing approaches and review HD population genetics used to guide target identification in the patient population. Clinical implementation of allele-specific HTT silencing faces challenges common to personalized genetic medicine, requiring novel solutions from clinical scientists and regulatory authorities. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Kim, Eun Kyung; Kim, Sewha
2016-03-17
Anaplastic lymphoma kinase (ALK) gene aberrations-such as mutations, amplifications, and copy number gains-represent a major genetic predisposition to neuroblastoma (NB). This study aimed to evaluate the correlation between ALK gene copy number status, ALK protein expression, and clinicopathological parameters. We retrospectively retrieved 30 cases of poorly differentiated NB and constructed tissue microarrays (TMAs). ALK copy number changes were assessed by fluorescence in situ hybridization (FISH) assays, and ALK immunohistochemistry (IHC) testing was performed using three different antibodies (ALK1, D5F3, and 5A4 clones). ALK amplification and copy number gain were observed in 10% (3/30) and 53.3% (16/30) of the cohort, respectively. There were positive correlations between ALK copy number and IHC positive rate in ALK1 and 5A4 antibodies (p= < 0.001 and 0.019, respectively). ALK1, D5F3, and 5A4 antibodies equally showed 100% sensitivity in detecting ALK amplification. However, the sensitivity for detecting copy number gain differed among the three antibodies, with 75% sensitivity in D5F3 and 0% sensitivity in ALK1. ALK-amplified NBs were correlated with synchronous MYCN amplification and chromosome 1p deletion. ALK IHC positivity was frequently observed in INSS stage IV and high-risk group patients. In conclusion, this study identified that an increase in the ALK copy number is a frequent genetic alteration in poorly differentiated NB. ALK-amplified NBs showed consistent ALK IHC positivity with all kinds of antibodies. In contrast, the detection performance of ALK copy number gain was antibody dependent, with the D5F3 antibody showing the best sensitivity.
Kim, Eun Kyung; Kim, Sewha
2017-01-01
Anaplastic lymphoma kinase ( ALK) gene aberrations-such as mutations, amplifications, and copy number gains-represent a major genetic predisposition to neuroblastoma (NB). This study aimed to evaluate the correlation between ALK gene copy number status, ALK protein expression, and clinicopathological parameters. We retrospectively retrieved 30 cases of poorly differentiated NB and constructed tissue microarrays (TMAs). ALK copy number changes were assessed by fluorescence in situ hybridization (FISH) assays, and ALK immunohistochemistry (IHC) testing was performed using three different antibodies (ALK1, D5F3, and 5A4 clones). ALK amplification and copy number gain were observed in 10% (3/30) and 53.3% (16/30) of the cohort, respectively. There were positive correlations between ALK copy number and IHC-positive rate in ALK1 and 5A4 antibodies ( P < 0.001 and P = 0.019, respectively). ALK1, D5F3, and 5A4 antibodies equally showed 100% sensitivity in detecting ALK amplification. However, the sensitivity for detecting copy number gain differed among the three antibodies, with 75% sensitivity in D5F3 and 0% sensitivity in ALK1. ALK-amplified NBs were correlated with synchronous MYCN amplification and chromosome 1p deletion. ALK IHC positivity was frequently observed in INSS stage IV and high-risk group patients. In conclusion, this study identified that an increase in the ALK copy number is a frequent genetic alteration in poorly differentiated NB. ALK-amplified NBs showed consistent ALK IHC positivity with all kinds of antibodies. In contrast, the detection performance of ALK copy number gain was antibody dependent, with the D5F3 antibody showing the best sensitivity.
Ziemons, Sandra; Koutsantas, Katerina; Becker, Kordula; Dahlmann, Tim; Kück, Ulrich
2017-02-16
Multi-copy gene integration into microbial genomes is a conventional tool for obtaining improved gene expression. For Penicillium chrysogenum, the fungal producer of the beta-lactam antibiotic penicillin, many production strains carry multiple copies of the penicillin biosynthesis gene cluster. This discovery led to the generally accepted view that high penicillin titers are the result of multiple copies of penicillin genes. Here we investigated strain P2niaD18, a production line that carries only two copies of the penicillin gene cluster. We performed pulsed-field gel electrophoresis (PFGE), quantitative qRT-PCR, and penicillin bioassays to investigate production, deletion and overexpression strains generated in the P. chrysogenum P2niaD18 background, in order to determine the copy number of the penicillin biosynthesis gene cluster, and study the expression of one penicillin biosynthesis gene, and the penicillin titer. Analysis of production and recombinant strain showed that the enhanced penicillin titer did not depend on the copy number of the penicillin gene cluster. Our assumption was strengthened by results with a penicillin null strain lacking pcbC encoding isopenicillin N synthase. Reintroduction of one or two copies of the cluster into the pcbC deletion strain restored transcriptional high expression of the pcbC gene, but recombinant strains showed no significantly different penicillin titer compared to parental strains. Here we present a molecular genetic analysis of production and recombinant strains in the P2niaD18 background carrying different copy numbers of the penicillin biosynthesis gene cluster. Our analysis shows that the enhanced penicillin titer does not strictly depend on the copy number of the cluster. Based on these overall findings, we hypothesize that instead, complex regulatory mechanisms are prominently implicated in increased penicillin biosynthesis in production strains.
2013-01-01
Background The sequenced genomes of cucumber, melon and watermelon have relatively few R-genes, with 70, 75 and 55 copies only, respectively. The mechanism for low copy number of R-genes in Cucurbitaceae genomes remains unknown. Results Manual annotation of R-genes in the sequenced genomes of Cucurbitaceae species showed that approximately half of them are pseudogenes. Comparative analysis of R-genes showed frequent loss of R-gene loci in different Cucurbitaceae species. Phylogenetic analysis, data mining and PCR cloning using degenerate primers indicated that Cucurbitaceae has limited number of R-gene lineages (subfamilies). Comparison between R-genes from Cucurbitaceae and those from poplar and soybean suggested frequent loss of R-gene lineages in Cucurbitaceae. Furthermore, the average number of R-genes per lineage in Cucurbitaceae species is approximately 1/3 that in soybean or poplar. Therefore, both loss of lineages and deficient duplications in extant lineages accounted for the low copy number of R-genes in Cucurbitaceae. No extensive chimeras of R-genes were found in any of the sequenced Cucurbitaceae genomes. Nevertheless, one lineage of R-genes from Trichosanthes kirilowii, a wild Cucurbitaceae species, exhibits chimeric structures caused by gene conversions, and may contain a large number of distinct R-genes in natural populations. Conclusions Cucurbitaceae species have limited number of R-gene lineages and each genome harbors relatively few R-genes. The scarcity of R-genes in Cucurbitaceae species was due to frequent loss of R-gene lineages and infrequent duplications in extant lineages. The evolutionary mechanisms for large variation of copy number of R-genes in different plant species were discussed. PMID:23682795
Spherical body protein 2 truncated copy 11 as a specific babesia bovis attenuation marker
USDA-ARS?s Scientific Manuscript database
Background: Spherical body protein 2 (SBP-2) truncated copies 7, 9 and 11, gene transcripts in Babesia bovis, were recently reported to be significantly up-regulated in two geographically distinct attenuated B. bovis strains. Results: Sequence comparisons between the sbp2t7, 9 and 11 genes among geo...
Sequenza: allele-specific copy number and mutation profiles from tumor sequencing data.
Favero, F; Joshi, T; Marquard, A M; Birkbak, N J; Krzystanek, M; Li, Q; Szallasi, Z; Eklund, A C
2015-01-01
Exome or whole-genome deep sequencing of tumor DNA along with paired normal DNA can potentially provide a detailed picture of the somatic mutations that characterize the tumor. However, analysis of such sequence data can be complicated by the presence of normal cells in the tumor specimen, by intratumor heterogeneity, and by the sheer size of the raw data. In particular, determination of copy number variations from exome sequencing data alone has proven difficult; thus, single nucleotide polymorphism (SNP) arrays have often been used for this task. Recently, algorithms to estimate absolute, but not allele-specific, copy number profiles from tumor sequencing data have been described. We developed Sequenza, a software package that uses paired tumor-normal DNA sequencing data to estimate tumor cellularity and ploidy, and to calculate allele-specific copy number profiles and mutation profiles. We applied Sequenza, as well as two previously published algorithms, to exome sequence data from 30 tumors from The Cancer Genome Atlas. We assessed the performance of these algorithms by comparing their results with those generated using matched SNP arrays and processed by the allele-specific copy number analysis of tumors (ASCAT) algorithm. Comparison between Sequenza/exome and SNP/ASCAT revealed strong correlation in cellularity (Pearson's r = 0.90) and ploidy estimates (r = 0.42, or r = 0.94 after manual inspecting alternative solutions). This performance was noticeably superior to previously published algorithms. In addition, in artificial data simulating normal-tumor admixtures, Sequenza detected the correct ploidy in samples with tumor content as low as 30%. The agreement between Sequenza and SNP array-based copy number profiles suggests that exome sequencing alone is sufficient not only for identifying small scale mutations but also for estimating cellularity and inferring DNA copy number aberrations. © The Author 2014. Published by Oxford University Press on behalf of
Venturelli, Gustavo L; Brod, Fábio C A; Rossi, Gabriela B; Zimmermann, Naíra F; Oliveira, Jaison P; Faria, Josias C; Arisi, Ana C M
2014-11-01
The Embrapa 5.1 genetically modified (GM) common bean was approved for commercialization in Brazil. Methods for the quantification of this new genetically modified organism (GMO) are necessary. The development of a suitable endogenous reference is essential for GMO quantification by real-time PCR. Based on this, a new taxon-specific endogenous reference quantification assay was developed for Phaseolus vulgaris L. Three genes encoding common bean proteins (phaseolin, arcelin, and lectin) were selected as candidates for endogenous reference. Primers targeting these candidate genes were designed and the detection was evaluated using the SYBR Green chemistry. The assay targeting lectin gene showed higher specificity than the remaining assays, and a hydrolysis probe was then designed. This assay showed high specificity for 50 common bean samples from two gene pools, Andean and Mesoamerican. For GM common bean varieties, the results were similar to those obtained for non-GM isogenic varieties with PCR efficiency values ranging from 92 to 101 %. Moreover, this assay presented a limit of detection of ten haploid genome copies. The primers and probe developed in this work are suitable to detect and quantify either GM or non-GM common bean.
Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene
Amit, Maayan; Sela, Noa; Keren, Hadas; Melamed, Ze'ev; Muler, Inna; Shomron, Noam; Izraeli, Shai; Ast, Gil
2007-01-01
Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains. PMID:18047649
Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons
Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.
2017-01-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516
Heritable heading time variation in wheat lines with the same number of Ppd-B1 gene copies.
Ivaničová, Zuzana; Valárik, Miroslav; Pánková, Kateřina; Trávníčková, Martina; Doležel, Jaroslav; Šafář, Jan; Milec, Zbyněk
2017-01-01
The ability of plants to identify an optimal flowering time is critical for ensuring the production of viable seeds. The main environmental factors that influence the flowering time include the ambient temperature and day length. In wheat, the ability to assess the day length is controlled by photoperiod (Ppd) genes. Due to its allohexaploid nature, bread wheat carries the following three Ppd-1 genes: Ppd-A1, Ppd-B1 and Ppd-D1. While photoperiod (in)sensitivity controlled by Ppd-A1 and Ppd-D1 is mainly determined by sequence changes in the promoter region, the impact of the Ppd-B1 alleles on the heading time has been linked to changes in the copy numbers (and possibly their methylation status) and sequence changes in the promoter region. Here, we report that plants with the same number of Ppd-B1 copies may have different heading times. Differences were observed among F7 lines derived from crossing two spring hexaploid wheat varieties. Several lines carrying three copies of Ppd-B1 headed 16 days later than other plants in the population with the same number of gene copies. This effect was associated with changes in the gene expression level and methylation of the Ppd-B1 gene.
Heritable heading time variation in wheat lines with the same number of Ppd-B1 gene copies
Ivaničová, Zuzana; Valárik, Miroslav; Pánková, Kateřina; Trávníčková, Martina; Doležel, Jaroslav; Šafář, Jan
2017-01-01
The ability of plants to identify an optimal flowering time is critical for ensuring the production of viable seeds. The main environmental factors that influence the flowering time include the ambient temperature and day length. In wheat, the ability to assess the day length is controlled by photoperiod (Ppd) genes. Due to its allohexaploid nature, bread wheat carries the following three Ppd-1 genes: Ppd-A1, Ppd-B1 and Ppd-D1. While photoperiod (in)sensitivity controlled by Ppd-A1 and Ppd-D1 is mainly determined by sequence changes in the promoter region, the impact of the Ppd-B1 alleles on the heading time has been linked to changes in the copy numbers (and possibly their methylation status) and sequence changes in the promoter region. Here, we report that plants with the same number of Ppd-B1 copies may have different heading times. Differences were observed among F7 lines derived from crossing two spring hexaploid wheat varieties. Several lines carrying three copies of Ppd-B1 headed 16 days later than other plants in the population with the same number of gene copies. This effect was associated with changes in the gene expression level and methylation of the Ppd-B1 gene. PMID:28846721
Platt, Adam; Morten, John; Ji, Qunsheng; Elvin, Paul; Womack, Chris; Su, Xinying; Donald, Emma; Gray, Neil; Read, Jessica; Bigley, Graham; Blockley, Laura; Cresswell, Carl; Dale, Angela; Davies, Amanda; Zhang, Tianwei; Fan, Shuqiong; Fu, Haihua; Gladwin, Amanda; Harrod, Grace; Stevens, James; Williams, Victoria; Ye, Qingqing; Zheng, Li; de Boer, Richard; Herbst, Roy S; Lee, Jin-Soo; Vasselli, James
2015-03-23
To determine the prevalence of RET rearrangement genes, RET copy number gains and expression in tumor samples from four Phase III non-small-cell lung cancer (NSCLC) trials of vandetanib, a selective inhibitor of VEGFR, RET and EGFR signaling, and to determine any association with outcome to vandetanib treatment. Archival tumor samples from the ZODIAC ( NCT00312377 , vandetanib ± docetaxel), ZEAL ( NCT00418886 , vandetanib ± pemetrexed), ZEPHYR ( NCT00404924 , vandetanib vs placebo) and ZEST ( NCT00364351 , vandetanib vs erlotinib) studies were evaluated by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) in 944 and 1102 patients. The prevalence of RET rearrangements by FISH was 0.7% (95% CI 0.3-1.5%) among patients with a known result. Seven tumor samples were positive for RET rearrangements (vandetanib, n = 3; comparator, n = 4). 2.8% (n = 26) of samples had RET amplification (innumerable RET clusters, or ≥7 copies in > 10% of tumor cells), 8.1% (n = 76) had low RET gene copy number gain (4-6 copies in ≥40% of tumor cells) and 8.3% (n = 92) were RET expression positive (signal intensity ++ or +++ in >10% of tumor cells). Of RET-rearrangement-positive patients, none had an objective response in the vandetanib arm and one patient responded in the comparator arm. Radiologic evidence of tumor shrinkage was observed in two patients treated with vandetanib and one treated with comparator drug. The objective response rate was similar in the vandetanib and comparator arms for patients positive for RET copy number gains or RET protein expression. We have identified prevalence for three RET biomarkers in a population predominated by non-Asians and smokers. RET rearrangement prevalence was lower than previously reported. We found no evidence of a differential benefit for efficacy by IHC and RET gene copy number gains. The low prevalence of RET rearrangements (0.7%) prevents firm conclusions regarding association of vandetanib treatment with
Target genes discovery through copy number alteration analysis in human hepatocellular carcinoma.
Gu, De-Leung; Chen, Yen-Hsieh; Shih, Jou-Ho; Lin, Chi-Hung; Jou, Yuh-Shan; Chen, Chian-Feng
2013-12-21
High-throughput short-read sequencing of exomes and whole cancer genomes in multiple human hepatocellular carcinoma (HCC) cohorts confirmed previously identified frequently mutated somatic genes, such as TP53, CTNNB1 and AXIN1, and identified several novel genes with moderate mutation frequencies, including ARID1A, ARID2, MLL, MLL2, MLL3, MLL4, IRF2, ATM, CDKN2A, FGF19, PIK3CA, RPS6KA3, JAK1, KEAP1, NFE2L2, C16orf62, LEPR, RAC2, and IL6ST. Functional classification of these mutated genes suggested that alterations in pathways participating in chromatin remodeling, Wnt/β-catenin signaling, JAK/STAT signaling, and oxidative stress play critical roles in HCC tumorigenesis. Nevertheless, because there are few druggable genes used in HCC therapy, the identification of new therapeutic targets through integrated genomic approaches remains an important task. Because a large amount of HCC genomic data genotyped by high density single nucleotide polymorphism arrays is deposited in the public domain, copy number alteration (CNA) analyses of these arrays is a cost-effective way to reveal target genes through profiling of recurrent and overlapping amplicons, homozygous deletions and potentially unbalanced chromosomal translocations accumulated during HCC progression. Moreover, integration of CNAs with other high-throughput genomic data, such as aberrantly coding transcriptomes and non-coding gene expression in human HCC tissues and rodent HCC models, provides lines of evidence that can be used to facilitate the identification of novel HCC target genes with the potential of improving the survival of HCC patients.
The positioning logic and copy number control of genes in bacteria under stress
NASA Astrophysics Data System (ADS)
Zhang, Qiucen; Austin, Robert; Vyawahare, Saurabh; Lau, Alexandra
2013-03-01
Escherichia coli (E. coli) cells when challenged with sublethal concentrations of the genotoxic antibiotic ciprofloxacin cease to divide and form long filaments which contain multiple bacterial chromosomes. These filaments are individual mesoscopic environmental niches which provide protection for a community of chromosomes (as opposed to cells) under mutagenic stress and can provide an evolutionary fitness advantage within the niche. We use comparative genomic hybridization to show that the mesoscopic niche evolves within 20 minutes of ciprofloxacin exposure via replication of multiple copies of genes expressing ATP dependent transporters. We show that this rapid genomic amplification is done in a time efficient manner via placement of the genes encoding the pumps near the origin of replication on the bacterial chromosome. The de-amplification of multiple copies back to the wild type number is a function of the duration is a function of the ciprofloxacin exposure duration: the longer the exposure, the slower the removal of the multiple copies. The project described was supported by the National Science Foundation and the National Cancer Institute
Cuscó, Ivon; Medrano, Andrés; Gener, Blanca; Vilardell, Mireia; Gallastegui, Fátima; Villa, Olaya; González, Eva; Rodríguez-Santiago, Benjamín; Vilella, Elisabet; Del Campo, Miguel; Pérez-Jurado, Luis A
2009-05-15
Autism spectrum disorders (ASDs) constitute a group of severe neurodevelopmental conditions with complex multifactorial etiology. In order to explore the hypothesis that submicroscopic genomic rearrangements underlie some ASD cases, we have analyzed 96 Spanish patients with idiopathic ASD after extensive clinical and laboratory screening, by array comparative genomic hybridization (aCGH) using a homemade bacterial artificial chromosome (BAC) array. Only 13 of the 238 detected copy number alterations, ranging in size from 89 kb to 2.4 Mb, were present specifically in the autistic population (12 out of 96 individuals, 12.5%). Following validation by additional molecular techniques, we have characterized these novel candidate regions containing 24 different genes including alterations in two previously reported regions of chromosome 7 associated with the ASD phenotype. Some of the genes located in ASD-specific copy number variants act in common pathways, most notably the phosphatidylinositol signaling and the glutamatergic synapse, both known to be affected in several genetic syndromes related with autism and previously associated with ASD. Our work supports the idea that the functional alteration of genes in related neuronal networks is involved in the etiology of the ASD phenotype and confirms a significant diagnostic yield for aCGH, which should probably be included in the diagnostic workup of idiopathic ASD.
Cuscó, Ivon; Medrano, Andrés; Gener, Blanca; Vilardell, Mireia; Gallastegui, Fátima; Villa, Olaya; González, Eva; Rodríguez-Santiago, Benjamín; Vilella, Elisabet; Del Campo, Miguel; Pérez-Jurado, Luis A.
2009-01-01
Autism spectrum disorders (ASDs) constitute a group of severe neurodevelopmental conditions with complex multifactorial etiology. In order to explore the hypothesis that submicroscopic genomic rearrangements underlie some ASD cases, we have analyzed 96 Spanish patients with idiopathic ASD after extensive clinical and laboratory screening, by array comparative genomic hybridization (aCGH) using a homemade bacterial artificial chromosome (BAC) array. Only 13 of the 238 detected copy number alterations, ranging in size from 89 kb to 2.4 Mb, were present specifically in the autistic population (12 out of 96 individuals, 12.5%). Following validation by additional molecular techniques, we have characterized these novel candidate regions containing 24 different genes including alterations in two previously reported regions of chromosome 7 associated with the ASD phenotype. Some of the genes located in ASD-specific copy number variants act in common pathways, most notably the phosphatidylinositol signaling and the glutamatergic synapse, both known to be affected in several genetic syndromes related with autism and previously associated with ASD. Our work supports the idea that the functional alteration of genes in related neuronal networks is involved in the etiology of the ASD phenotype and confirms a significant diagnostic yield for aCGH, which should probably be included in the diagnostic workup of idiopathic ASD. PMID:19246517
van der Ley, P
1988-11-01
Gonococci express a family of related outer membrane proteins designated protein II (P.II). These surface proteins are subject to both phase variation and antigenic variation. The P.II gene repertoire of Neisseria gonorrhoeae strain JS3 was found to consist of at least ten genes, eight of which were cloned. Sequence analysis and DNA hybridization studies revealed that one particular P.II-encoding sequence is present in three distinct, but almost identical, copies in the JS3 genome. These genes encode the P.II protein that was previously identified as P.IIc. Comparison of their sequences shows that the multiple copies of this P.IIc-encoding gene might have been generated by both gene conversion and gene duplication.
Aluminum tolerance in maize is associated with higher MATE1 gene copy number
Maron, Lyza G.; Guimarães, Claudia T.; Kirst, Matias; Albert, Patrice S.; Birchler, James A.; Bradbury, Peter J.; Buckler, Edward S.; Coluccio, Alison E.; Danilova, Tatiana V.; Kudrna, David; Magalhaes, Jurandir V.; Piñeros, Miguel A.; Schatz, Michael C.; Wing, Rod A.; Kochian, Leon V.
2013-01-01
Genome structure variation, including copy number variation and presence/absence variation, comprises a large extent of maize genetic diversity; however, its effect on phenotypes remains largely unexplored. Here, we describe how copy number variation underlies a rare allele that contributes to maize aluminum (Al) tolerance. Al toxicity is the primary limitation for crop production on acid soils, which make up 50% of the world’s potentially arable lands. In a recombinant inbred line mapping population, copy number variation of the Al tolerance gene multidrug and toxic compound extrusion 1 (MATE1) is the basis for the quantitative trait locus of largest effect on phenotypic variation. This expansion in MATE1 copy number is associated with higher MATE1 expression, which in turn results in superior Al tolerance. The three MATE1 copies are identical and are part of a tandem triplication. Only three maize inbred lines carrying the three-copy allele were identified from maize and teosinte diversity panels, indicating that copy number variation for MATE1 is a rare, and quite likely recent, event. These maize lines with higher MATE1 copy number are also Al-tolerant, have high MATE1 expression, and originate from regions of highly acidic soils. Our findings show a role for copy number variation in the adaptation of maize to acidic soils in the tropics and suggest that genome structural changes may be a rapid evolutionary response to new environments. PMID:23479633
Inferring species trees from incongruent multi-copy gene trees using the Robinson-Foulds distance
2013-01-01
Background Constructing species trees from multi-copy gene trees remains a challenging problem in phylogenetics. One difficulty is that the underlying genes can be incongruent due to evolutionary processes such as gene duplication and loss, deep coalescence, or lateral gene transfer. Gene tree estimation errors may further exacerbate the difficulties of species tree estimation. Results We present a new approach for inferring species trees from incongruent multi-copy gene trees that is based on a generalization of the Robinson-Foulds (RF) distance measure to multi-labeled trees (mul-trees). We prove that it is NP-hard to compute the RF distance between two mul-trees; however, it is easy to calculate this distance between a mul-tree and a singly-labeled species tree. Motivated by this, we formulate the RF problem for mul-trees (MulRF) as follows: Given a collection of multi-copy gene trees, find a singly-labeled species tree that minimizes the total RF distance from the input mul-trees. We develop and implement a fast SPR-based heuristic algorithm for the NP-hard MulRF problem. We compare the performance of the MulRF method (available at http://genome.cs.iastate.edu/CBL/MulRF/) with several gene tree parsimony approaches using gene tree simulations that incorporate gene tree error, gene duplications and losses, and/or lateral transfer. The MulRF method produces more accurate species trees than gene tree parsimony approaches. We also demonstrate that the MulRF method infers in minutes a credible plant species tree from a collection of nearly 2,000 gene trees. Conclusions Our new phylogenetic inference method, based on a generalized RF distance, makes it possible to quickly estimate species trees from large genomic data sets. Since the MulRF method, unlike gene tree parsimony, is based on a generic tree distance measure, it is appealing for analyses of genomic data sets, in which many processes such as deep coalescence, recombination, gene duplication and losses as
Pezer, Željka; Chung, Amanda G.; Karn, Robert C.
2017-01-01
Abstract The Androgen-binding protein (Abp) gene region of the mouse genome contains 64 genes, some encoding pheromones that influence assortative mating between mice from different subspecies. Using CNVnator and quantitative PCR, we explored copy number variation in this gene family in natural populations of Mus musculus domesticus (Mmd) and Mus musculus musculus (Mmm), two subspecies of house mice that form a narrow hybrid zone in Central Europe. We found that copy number variation in the center of the Abp gene region is very common in wild Mmd, primarily representing the presence/absence of the final duplications described for the mouse genome. Clustering of Mmd individuals based on this variation did not reflect their geographical origin, suggesting no population divergence in the Abp gene cluster. However, copy number variation patterns differ substantially between Mmd and other mouse taxa. Large blocks of Abp genes are absent in Mmm, Mus musculus castaneus and an outgroup, Mus spretus, although with differences in variation and breakpoint locations. Our analysis calls into question the reliance on a reference genome for interpreting the detailed organization of genes in taxa more distant from the Mmd reference genome. The polymorphic nature of the gene family expansion in all four taxa suggests that the number of Abp genes, especially in the central gene region, is not critical to the survival and reproduction of the mouse. However, Abp haplotypes of variable length may serve as a source of raw genetic material for new signals influencing reproductive communication and thus speciation of mice. PMID:28575204
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Sønderstrup, Ida Marie Heeholm; Nygård, Sune Boris; Poulsen, Tim Svenstrup; Linnemann, Dorte; Stenvang, Jan; Nielsen, Hans Jørgen; Bartek, Jiri; Brünner, Nils; Nørgaard, Peter; Riis, Lene
2015-06-01
Topoisomerase 1 (TOP1) and 2A (TOP2A) are potential predictive biomarkers for irinotecan and anthracycline treatment, respectively, in colorectal cancer (CRC), and we have recently reported a high frequency of gene gain of the TOP1 and TOP2A genes in CRC. Furthermore, Mismatch Repair (MMR) subtypes of CRC have been associated with benefit from adjuvant chemotherapy of primary CRC. Given the involvement of the topoisomerase enzymes in DNA replication and repair, we raised the hypothesis that an association may exist between TOP gene copy numbers and MMR proficiency/deficiency in CRC. Test cohort: FISH analysis with an in-house TOP1/CEN20 probe mix and a commercially available TOP2A/CEN17 (Dako, Glostrup, Denmark) probe mix was performed on archival formalin fixed paraffin embedded (FFPE) tissue samples from 18 patients with proficient MMR (pMMR) CRC and 18 patients with deficient MMR (dMMR) CRC. TOP1 and TOP2A gene copy numbers and their ratios per nucleus were correlated with MMR status using the Mann-Whitney test. Validation cohort: FFPE samples from 154 patients with primary stage III CRC (originally included in the RANX05 study) were classified according to MMR status by immunohistochemical analysis using validated antibodies for MLH1, MLH2, MSH6 and PMS2, and information on TOP1, CEN20, TOP2A and CEN17 status was previously published for this cohort. The observed TOP1 gene copy numbers in the 36 CRC test cohort were significantly greater (p < 0.01) in the pMMR subgroup (mean: 3.84, SD: 2.03) than in the dMMR subgroup (mean: 1.50, SD: 0.12). Similarly, the TOP2A copy numbers were significantly greater (p < 0.01) in the pMMR subgroup (mean: 1.99, SD: 0.52) than in the dMMR subgroup (mean: 1.52, SD: 0.10). These findings were confirmed in the validation cohort, where in the pMMR subgroup 51% had ≥2 extra TOP1 copies per cell, while all tumors classified as dMMR had diploid TOP1 status and mean TOP2A copy numbers were 2.30 (SD: 1.36) and 1.80 (SD: 0.31) (p = 0
iGC-an integrated analysis package of gene expression and copy number alteration.
Lai, Yi-Pin; Wang, Liang-Bo; Wang, Wei-An; Lai, Liang-Chuan; Tsai, Mong-Hsun; Lu, Tzu-Pin; Chuang, Eric Y
2017-01-14
With the advancement in high-throughput technologies, researchers can simultaneously investigate gene expression and copy number alteration (CNA) data from individual patients at a lower cost. Traditional analysis methods analyze each type of data individually and integrate their results using Venn diagrams. Challenges arise, however, when the results are irreproducible and inconsistent across multiple platforms. To address these issues, one possible approach is to concurrently analyze both gene expression profiling and CNAs in the same individual. We have developed an open-source R/Bioconductor package (iGC). Multiple input formats are supported and users can define their own criteria for identifying differentially expressed genes driven by CNAs. The analysis of two real microarray datasets demonstrated that the CNA-driven genes identified by the iGC package showed significantly higher Pearson correlation coefficients with their gene expression levels and copy numbers than those genes located in a genomic region with CNA. Compared with the Venn diagram approach, the iGC package showed better performance. The iGC package is effective and useful for identifying CNA-driven genes. By simultaneously considering both comparative genomic and transcriptomic data, it can provide better understanding of biological and medical questions. The iGC package's source code and manual are freely available at https://www.bioconductor.org/packages/release/bioc/html/iGC.html .
Vacca, G M; Dettori, M L; Balia, F; Luridiana, S; Mura, M C; Carcangiu, V; Pazzola, M
2013-09-01
The purpose was to analyze the growth hormone GH1/GH2-N and GH2-Z gene copies and to assess their possible association with milk traits in Sarda sheep. Two hundred multiparous lactating ewes were monitored. The two gene copies were amplified separately and each was used as template for a nested PCR, to investigate single strand conformation polymorphism (SSCP) of the 5'UTR, exon-1, exon-5 and 3'UTR DNA regions. SSCP analysis revealed marked differences in the number of polymorphic patterns between the two genes. Sequencing revealed five nucleotide changes at the GH1/GH2-N gene. Five nucleotide changes occurred at the GH2-Z gene: one was located in exon-5 (c.556G > A) and resulted in a putative amino acid substitution G186S. All the nucleotide changes were copy-specific, except c.*30delT, which was common to both GH1/GH2-N and GH2-Z. Variability in the promoter regions of each gene might have consequences on the expression level, due to the involvement in potential transcription factor binding sites. Both gene copies influenced milk yield. A correlation with milk protein and casein content was also evidenced. These results may have implications that make them useful for future breeding strategies in dairy sheep breeding.
ALK gene copy number gain and its clinical significance in hepatocellular carcinoma.
Jia, Shou-Wei; Fu, Sha; Wang, Fang; Shao, Qiong; Huang, Hong-Bing; Shao, Jian-Yong
2014-01-07
To examine the status and clinical significance of anaplastic lymphoma kinase (ALK) gene alterations in hepatocellular carcinoma (HCC) patients. A total of 213 cases of HCC were examined by fluorescent in situ hybridization using dual color break-apart ALK probes for the detection of chromosomal translocation and gene copy number gain. HCC tissue microarrays were constructed, and the correlation between the ALK status and clinicopathological variables was assessed by χ(2) test or Fisher's exact test. Survival analysis was estimated using the Kaplan-Meier approach with a Log-rank test. Univariate and multivariate analyses of clinical variables were performed using the Cox proportional hazards regression model. ALK gene translocation was not observed in any of the HCC cases included in the present study. ALK gene copy number gain (ALK/CNG) (≥ 4 copies/cell) was detected in 28 (13.15%) of the 213 HCC patients. The 3-year progression-free-survival (PFS) rate for ALK/CNG-positive HCC patients was significantly poorer than ALK/CNG-negative patients (27.3% vs 42.5%, P = 0.048), especially for patients with advanced stage III/IV (0% vs 33.5%, P = 0.007), and patients with grade III disease (24.8% vs 49.9%, P = 0.023). ALK/CNG-positive HCC patients had a significantly poorer prognosis than ALK/CNG-negative patients in the subgroup that was negative for serum hepatitis B virus DNA, with significantly different 3-year overall survival rates (18.2% vs 63.6%, P = 0.021) and PFS rates (18.2% vs 46.9%, P = 0.019). Multivariate Cox proportional hazards regression analysis suggested that ALK/CNG prevalence can predict death in HCC (HR = 1.596; 95%CI: 1.008-2.526, P = 0.046). ALK/CNG, but not translocation of ALK, is present in HCC and may be an unfavorable prognostic predictor.
ALK gene copy number gain and its clinical significance in hepatocellular carcinoma
Jia, Shou-Wei; Fu, Sha; Wang, Fang; Shao, Qiong; Huang, Hong-Bing; Shao, Jian-Yong
2014-01-01
AIM: To examine the status and clinical significance of anaplastic lymphoma kinase (ALK) gene alterations in hepatocellular carcinoma (HCC) patients. METHODS: A total of 213 cases of HCC were examined by fluorescent in situ hybridization using dual color break-apart ALK probes for the detection of chromosomal translocation and gene copy number gain. HCC tissue microarrays were constructed, and the correlation between the ALK status and clinicopathological variables was assessed by χ2 test or Fisher’s exact test. Survival analysis was estimated using the Kaplan-Meier approach with a Log-rank test. Univariate and multivariate analyses of clinical variables were performed using the Cox proportional hazards regression model. RESULTS: ALK gene translocation was not observed in any of the HCC cases included in the present study. ALK gene copy number gain (ALK/CNG) (≥ 4 copies/cell) was detected in 28 (13.15%) of the 213 HCC patients. The 3-year progression-free-survival (PFS) rate for ALK/CNG-positive HCC patients was significantly poorer than ALK/CNG-negative patients (27.3% vs 42.5%, P = 0.048), especially for patients with advanced stage III/IV (0% vs 33.5%, P = 0.007), and patients with grade III disease (24.8% vs 49.9%, P = 0.023). ALK/CNG-positive HCC patients had a significantly poorer prognosis than ALK/CNG-negative patients in the subgroup that was negative for serum hepatitis B virus DNA, with significantly different 3-year overall survival rates (18.2% vs 63.6%, P = 0.021) and PFS rates (18.2% vs 46.9%, P = 0.019). Multivariate Cox proportional hazards regression analysis suggested that ALK/CNG prevalence can predict death in HCC (HR = 1.596; 95%CI: 1.008-2.526, P = 0.046). CONCLUSION: ALK/CNG, but not translocation of ALK, is present in HCC and may be an unfavorable prognostic predictor. PMID:24415871
TEGS-CN: A Statistical Method for Pathway Analysis of Genome-wide Copy Number Profile.
Huang, Yen-Tsung; Hsu, Thomas; Christiani, David C
2014-01-01
The effects of copy number alterations make up a significant part of the tumor genome profile, but pathway analyses of these alterations are still not well established. We proposed a novel method to analyze multiple copy numbers of genes within a pathway, termed Test for the Effect of a Gene Set with Copy Number data (TEGS-CN). TEGS-CN was adapted from TEGS, a method that we previously developed for gene expression data using a variance component score test. With additional development, we extend the method to analyze DNA copy number data, accounting for different sizes and thus various numbers of copy number probes in genes. The test statistic follows a mixture of X (2) distributions that can be obtained using permutation with scaled X (2) approximation. We conducted simulation studies to evaluate the size and the power of TEGS-CN and to compare its performance with TEGS. We analyzed a genome-wide copy number data from 264 patients of non-small-cell lung cancer. With the Molecular Signatures Database (MSigDB) pathway database, the genome-wide copy number data can be classified into 1814 biological pathways or gene sets. We investigated associations of the copy number profile of the 1814 gene sets with pack-years of cigarette smoking. Our analysis revealed five pathways with significant P values after Bonferroni adjustment (<2.8 × 10(-5)), including the PTEN pathway (7.8 × 10(-7)), the gene set up-regulated under heat shock (3.6 × 10(-6)), the gene sets involved in the immune profile for rejection of kidney transplantation (9.2 × 10(-6)) and for transcriptional control of leukocytes (2.2 × 10(-5)), and the ganglioside biosynthesis pathway (2.7 × 10(-5)). In conclusion, we present a new method for pathway analyses of copy number data, and causal mechanisms of the five pathways require further study.
Allele-specific copy-number discovery from whole-genome and whole-exome sequencing
Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J.; Szatkiewicz, Jin P.
2015-01-01
Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. PMID:25883151
Dillon, Andrew; Varanasi, Vijay K.; Koo, Dal-Hoe; Nakka, Sridevi; Peterson, Dallas E.; Friebe, Bernd
2017-01-01
Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate resistance in A. tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We analyzed the distribution of EPSPS copies in the genome of A. tuberculatus using fluorescence in situ hybridization on mitotic metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to pericentromeric regions of two homologous chromosomes in glyphosate sensitive A. tuberculatus. In glyphosate-resistant plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly, two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report illustrates the physical mapping of amplified EPSPS copies in A. tuberculatus. PMID:27956489
Pezer, Željka; Chung, Amanda G; Karn, Robert C; Laukaitis, Christina M
2017-06-01
The Androgen-binding protein ( Abp ) gene region of the mouse genome contains 64 genes, some encoding pheromones that influence assortative mating between mice from different subspecies. Using CNVnator and quantitative PCR, we explored copy number variation in this gene family in natural populations of Mus musculus domesticus ( Mmd ) and Mus musculus musculus ( Mmm ), two subspecies of house mice that form a narrow hybrid zone in Central Europe. We found that copy number variation in the center of the Abp gene region is very common in wild Mmd , primarily representing the presence/absence of the final duplications described for the mouse genome. Clustering of Mmd individuals based on this variation did not reflect their geographical origin, suggesting no population divergence in the Abp gene cluster. However, copy number variation patterns differ substantially between Mmd and other mouse taxa. Large blocks of Abp genes are absent in Mmm , Mus musculus castaneus and an outgroup, Mus spretus , although with differences in variation and breakpoint locations. Our analysis calls into question the reliance on a reference genome for interpreting the detailed organization of genes in taxa more distant from the Mmd reference genome. The polymorphic nature of the gene family expansion in all four taxa suggests that the number of Abp genes, especially in the central gene region, is not critical to the survival and reproduction of the mouse. However, Abp haplotypes of variable length may serve as a source of raw genetic material for new signals influencing reproductive communication and thus speciation of mice. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Samadian, Soroush; Bruce, Jeff P; Pugh, Trevor J
2018-03-01
Somatic copy number variations (CNVs) play a crucial role in development of many human cancers. The broad availability of next-generation sequencing data has enabled the development of algorithms to computationally infer CNV profiles from a variety of data types including exome and targeted sequence data; currently the most prevalent types of cancer genomics data. However, systemic evaluation and comparison of these tools remains challenging due to a lack of ground truth reference sets. To address this need, we have developed Bamgineer, a tool written in Python to introduce user-defined haplotype-phased allele-specific copy number events into an existing Binary Alignment Mapping (BAM) file, with a focus on targeted and exome sequencing experiments. As input, this tool requires a read alignment file (BAM format), lists of non-overlapping genome coordinates for introduction of gains and losses (bed file), and an optional file defining known haplotypes (vcf format). To improve runtime performance, Bamgineer introduces the desired CNVs in parallel using queuing and parallel processing on a local machine or on a high-performance computing cluster. As proof-of-principle, we applied Bamgineer to a single high-coverage (mean: 220X) exome sequence file from a blood sample to simulate copy number profiles of 3 exemplar tumors from each of 10 tumor types at 5 tumor cellularity levels (20-100%, 150 BAM files in total). To demonstrate feasibility beyond exome data, we introduced read alignments to a targeted 5-gene cell-free DNA sequencing library to simulate EGFR amplifications at frequencies consistent with circulating tumor DNA (10, 1, 0.1 and 0.01%) while retaining the multimodal insert size distribution of the original data. We expect Bamgineer to be of use for development and systematic benchmarking of CNV calling algorithms by users using locally-generated data for a variety of applications. The source code is freely available at http://github.com/pughlab/bamgineer.
Ooi, Delicia Shu Qin; Tan, Verena Ming Hui; Ong, Siong Gim; Chan, Yiong Huak; Heng, Chew Kiat; Lee, Yung Seng
2017-01-01
The human salivary (AMY1) gene, encoding salivary α-amylase, has variable copy number variants (CNVs) in the human genome. We aimed to determine if real-time quantitative polymerase chain reaction (qPCR) and the more recently available Droplet Digital PCR (ddPCR) can provide a precise quantification of the AMY1 gene copy number in blood, buccal cells and saliva samples derived from the same individual. Seven participants were recruited and DNA was extracted from the blood, buccal cells and saliva samples provided by each participant. Taqman assay real-time qPCR and ddPCR were conducted to quantify AMY1 gene copy numbers. Statistical analysis was carried out to determine the difference in AMY1 gene copy number between the different biological specimens and different assay methods. We found significant within-individual difference (p<0.01) in AMY1 gene copy number between different biological samples as determined by qPCR. However, there was no significant within-individual difference in AMY1 gene copy number between different biological samples as determined by ddPCR. We also found that AMY1 gene copy number of blood samples were comparable between qPCR and ddPCR, while there is a significant difference (p<0.01) between AMY1 gene copy numbers measured by qPCR and ddPCR for both buccal swab and saliva samples. Despite buccal cells and saliva samples being possible sources of DNA, it is pertinent that ddPCR or a single biological sample, preferably blood sample, be used for determining highly polymorphic gene copy numbers like AMY1, due to the large within-individual variability between different biological samples if real time qPCR is employed.
Mayer, Melanie G; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J
2015-06-01
Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for
Ngwa, Felexce F; Madramootoo, Chandra A; Jabaji, Suha
2014-08-01
Increased incidences of mixed assemblages of microcystin-producing and nonproducing cyanobacterial strains in freshwater bodies necessitate development of reliable proxies for cyanotoxin risk assessment. Detection of microcystin biosynthetic genes in water blooms of cyanobacteria is generally indicative of the presence of potentially toxic cyanobacterial strains. Although much effort has been devoted toward elucidating the microcystin biosynthesis mechanisms in many cyanobacteria genera, little is known about the impacts of co-occurring cyanobacteria on cellular growth, mcy gene expression, or mcy gene copy distribution. The present study utilized conventional microscopy, qPCR assays, and enzyme-linked immunosorbent assay to study how competition between microcystin-producing Microcystis aeruginosa CPCC 299 and Planktothrix agardhii NIVA-CYA 126 impacts mcyE gene expression, mcyE gene copies, and microcystin concentration under controlled laboratory conditions. Furthermore, analyses of environmental water samples from the Missisquoi Bay, Quebec, enabled us to determine how the various potential toxigenic cyanobacterial biomass proxies correlated with cellular microcystin concentrations in a freshwater lake. Results from our laboratory study indicated significant downregulation of mcyE gene expression in mixed cultures of M. aeruginosa plus P. agardhii on most sampling days in agreement with depressed growth recorded in the mixed cultures, suggesting that interaction between the two species probably resulted in suppressed growth and mcyE gene expression in the mixed cultures. Furthermore, although mcyE gene copies and McyE transcripts were detected in all laboratory and field samples with measureable microcystin levels, only mcyE gene copies showed significant positive correlations (R(2) > 0.7) with microcystin concentrations, while McyE transcript levels did not. These results suggest that mcyE gene copies are better indicators of potential risks from microcystins
Rapidly Evolving Toll-3/4 Genes Encode Male-Specific Toll-Like Receptors in Drosophila.
Levin, Tera C; Malik, Harmit S
2017-09-01
Animal Toll-like receptors (TLRs) have evolved through a pattern of duplication and divergence. Whereas mammalian TLRs directly recognize microbial ligands, Drosophila Tolls bind endogenous ligands downstream of both developmental and immune signaling cascades. Here, we find that most Toll genes in Drosophila evolve slowly with little gene turnover (gains/losses), consistent with their important roles in development and indirect roles in microbial recognition. In contrast, we find that the Toll-3/4 genes have experienced an unusually rapid rate of gene gains and losses, resulting in lineage-specific Toll-3/4s and vastly different gene repertoires among Drosophila species, from zero copies (e.g., D. mojavensis) to nineteen copies (e.g., D. willistoni). In D. willistoni, we find strong evidence for positive selection in Toll-3/4 genes, localized specifically to an extracellular region predicted to overlap with the binding site of Spätzle, the only known ligand of insect Tolls. However, because Spätzle genes are not experiencing similar selective pressures, we hypothesize that Toll-3/4s may be rapidly evolving because they bind to a different ligand, akin to TLRs outside of insects. We further find that most Drosophila Toll-3/4 genes are either weakly expressed or expressed exclusively in males, specifically in the germline. Unlike other Toll genes in D. melanogaster, Toll-3, and Toll-4 have apparently escaped from essential developmental roles, as knockdowns have no substantial effects on viability or male fertility. Based on these findings, we propose that the Toll-3/4 genes represent an exceptionally rapidly evolving lineage of Drosophila Toll genes, which play an unusual, as-yet-undiscovered role in the male germline. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Rapidly Evolving Toll-3/4 Genes Encode Male-Specific Toll-Like Receptors in Drosophila
Levin, Tera C.; Malik, Harmit S.
2017-01-01
Abstract Animal Toll-like receptors (TLRs) have evolved through a pattern of duplication and divergence. Whereas mammalian TLRs directly recognize microbial ligands, Drosophila Tolls bind endogenous ligands downstream of both developmental and immune signaling cascades. Here, we find that most Toll genes in Drosophila evolve slowly with little gene turnover (gains/losses), consistent with their important roles in development and indirect roles in microbial recognition. In contrast, we find that the Toll-3/4 genes have experienced an unusually rapid rate of gene gains and losses, resulting in lineage-specific Toll-3/4s and vastly different gene repertoires among Drosophila species, from zero copies (e.g., D. mojavensis) to nineteen copies (e.g., D. willistoni). In D. willistoni, we find strong evidence for positive selection in Toll-3/4 genes, localized specifically to an extracellular region predicted to overlap with the binding site of Spätzle, the only known ligand of insect Tolls. However, because Spätzle genes are not experiencing similar selective pressures, we hypothesize that Toll-3/4s may be rapidly evolving because they bind to a different ligand, akin to TLRs outside of insects. We further find that most Drosophila Toll-3/4 genes are either weakly expressed or expressed exclusively in males, specifically in the germline. Unlike other Toll genes in D. melanogaster, Toll-3, and Toll-4 have apparently escaped from essential developmental roles, as knockdowns have no substantial effects on viability or male fertility. Based on these findings, we propose that the Toll-3/4 genes represent an exceptionally rapidly evolving lineage of Drosophila Toll genes, which play an unusual, as-yet-undiscovered role in the male germline. PMID:28541576
Vaghjiani, Vijesh; Cain, Jason E; Lee, William; Vaithilingam, Vijayaganapathy; Tuch, Bernard E; St John, Justin C
2017-10-15
Mitochondrial deoxyribonucleic acid (mtDNA) copy number is tightly regulated during pluripotency and differentiation. There is increased demand of cellular adenosine triphosphate (ATP) during differentiation for energy-intensive cell types such as hepatocytes and neurons to meet the cell's functional requirements. During hepatocyte differentiation, mtDNA copy number should be synchronously increased to generate sufficient ATP through oxidative phosphorylation. Unlike bone marrow mesenchymal cells, mtDNA copy number failed to increase by 28 days of differentiation of human amniotic epithelial cells (hAEC) into hepatocyte-like cells (HLC) despite their expression of some end-stage hepatic markers. This was due to higher levels of DNA methylation at exon 2 of POLGA, the mtDNA-specific replication factor. Treatment with a DNA demethylation agent, 5-azacytidine, resulted in increased mtDNA copy number, reduced DNA methylation at exon 2 of POLGA, and reduced hepatic gene expression. Depletion of mtDNA followed by subsequent differentiation did not increase mtDNA copy number, but reduced DNA methylation at exon 2 of POLGA and increased expression of hepatic and pluripotency genes. We encapsulated hAEC in barium alginate microcapsules and subsequently differentiated them into HLC. Encapsulation resulted in no net increase of mtDNA copy number but a significant reduction in DNA methylation of POLGA. RNAseq analysis showed that differentiated HLC express hepatocyte-specific genes but also increased expression of inflammatory interferon genes. Differentiation in encapsulated cells showed suppression of inflammatory genes as well as increased expression of genes associated with hepatocyte function pathways and networks. This study demonstrates that an increase in classical hepatic gene expression can be achieved in HLC through encapsulation, although they fail to effectively regulate mtDNA copy number.
Xiao, P; Niu, L L; Zhao, Q J; Chen, X Y; Wang, L J; Li, L; Zhang, H P; Guo, J Z; Xu, H Y; Zhong, T
2017-11-16
The origins and phylogeny of different sheep breeds has been widely studied using polymorphisms within the mitochondrial hypervariable region. However, little is known about the mitochondrial DNA (mtDNA) content and phylogeny based on mtDNA protein-coding genes. In this study, we assessed the phylogeny and copy number of the mtDNA in eight indigenous (population size, n=184) and three introduced (n=66) sheep breeds in China based on five mitochondrial coding genes (COX1, COX2, ATP8, ATP6 and COX3). The mean haplotype and nucleotide diversities were 0.944 and 0.00322, respectively. We identified a correlation between the lineages distribution and the genetic distance, whereby Valley-type Tibetan sheep had a closer genetic relationship with introduced breeds (Dorper, Poll Dorset and Suffolk) than with other indigenous breeds. Similarly, the Median-joining profile of haplotypes revealed the distribution of clusters according to genetic differences. Moreover, copy number analysis based on the five mitochondrial coding genes was affected by the genetic distance combining with genetic phylogeny; we also identified obvious non-synonymous mutations in ATP6 between the different levels of copy number expressions. These results imply that differences in mitogenomic compositions resulting from geographical separation lead to differences in mitochondrial function.
Allele-specific copy-number discovery from whole-genome and whole-exome sequencing.
Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J; Szatkiewicz, Jin P
2015-08-18
Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The CRISPR/Cas9 system enables genome editing and somatic cell genetic screens in mammalian cells. We performed genome-scale loss-of-function screens in 33 cancer cell lines to identify genes essential for proliferation/survival and found a strong correlation between increased gene copy number and decreased cell viability after genome editing. Within regions of copy-number gain, CRISPR/Cas9 targeting of both expressed and unexpressed genes, as well as intergenic loci, led to significantly decreased cell proliferation through induction of a G2 cell-cycle arrest.
Lin, Huan-Ting; Okumura, Takashi; Yatsuda, Yukinori; Ito, Satoru; Nakauchi, Hiromitsu; Otsu, Makoto
2016-10-01
Stable gene transfer into target cell populations via integrating viral vectors is widely used in stem cell gene therapy (SCGT). Accurate vector copy number (VCN) estimation has become increasingly important. However, existing methods of estimation such as real-time quantitative PCR are more restricted in practicality, especially during clinical trials, given the limited availability of sample materials from patients. This study demonstrates the application of an emerging technology called droplet digital PCR (ddPCR) in estimating VCN states in the context of SCGT. Induced pluripotent stem cells (iPSCs) derived from a patient with X-linked chronic granulomatous disease were used as clonable target cells for transduction with alpharetroviral vectors harboring codon-optimized CYBB cDNA. Precise primer-probe design followed by multiplex analysis conferred assay specificity. Accurate estimation of per-cell VCN values was possible without reliance on a reference standard curve. Sensitivity was high and the dynamic range of detection was wide. Assay reliability was validated by observation of consistent, reproducible, and distinct VCN clustering patterns for clones of transduced iPSCs with varying numbers of transgene copies. Taken together, use of ddPCR appears to offer a practical and robust approach to VCN estimation with a wide range of clinical and research applications.
Lin, Huan-Ting; Okumura, Takashi; Yatsuda, Yukinori; Ito, Satoru; Nakauchi, Hiromitsu; Otsu, Makoto
2016-01-01
Stable gene transfer into target cell populations via integrating viral vectors is widely used in stem cell gene therapy (SCGT). Accurate vector copy number (VCN) estimation has become increasingly important. However, existing methods of estimation such as real-time quantitative PCR are more restricted in practicality, especially during clinical trials, given the limited availability of sample materials from patients. This study demonstrates the application of an emerging technology called droplet digital PCR (ddPCR) in estimating VCN states in the context of SCGT. Induced pluripotent stem cells (iPSCs) derived from a patient with X-linked chronic granulomatous disease were used as clonable target cells for transduction with alpharetroviral vectors harboring codon-optimized CYBB cDNA. Precise primer–probe design followed by multiplex analysis conferred assay specificity. Accurate estimation of per-cell VCN values was possible without reliance on a reference standard curve. Sensitivity was high and the dynamic range of detection was wide. Assay reliability was validated by observation of consistent, reproducible, and distinct VCN clustering patterns for clones of transduced iPSCs with varying numbers of transgene copies. Taken together, use of ddPCR appears to offer a practical and robust approach to VCN estimation with a wide range of clinical and research applications. PMID:27763786
Singh, Gulshan; Vajpayee, Poornima; Rani, Neetika; Amoah, Isaac Dennis; Stenström, Thor Axel; Shanker, Rishi
2016-08-15
The emergence of antimicrobial resistant bacteria is an important public health and environmental contamination issue. Antimicrobials of β-lactam group accounts for approximately two thirds, by weight, of all antimicrobials administered to humans due to high clinical efficacy and low toxicity. This study explores β-lactam resistance determinant gene (blaTEM) as emerging contaminant in Indo-Gangetic region using qPCR in molecular beacon format. Quantitative Microbial Risk Assessment (QMRA) approach was adopted to predict risk to human health associated with consumption/exposure of surface water, potable water and street foods contaminated with bacteria having blaTEM gene. It was observed that surface water and sediments of the river Ganga and Gomti showed high numbers of blaTEM gene copies and varied significantly (p<0.05) among the sampling locations. The potable water collected from drinking water facility and clinical settings exhibit significant number of blaTEM gene copies (13±0.44-10200±316 gene copies/100mL). It was observed that E.crassipes among aquatic flora encountered in both the rivers had high load of blaTEM gene copies. The information on prevalence of environmental reservoirs of blaTEM gene containing bacteria in Indo-Gangetic region and risk associated will be useful for formulating strategies to protect public from menace of clinical risks linked with antimicrobial resistant bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.
Copy number variation of the APC gene is associated with regulation of bone mineral density☆
Chew, Shelby; Dastani, Zari; Brown, Suzanne J.; Lewis, Joshua R.; Dudbridge, Frank; Soranzo, Nicole; Surdulescu, Gabriela L.; Richards, J. Brent; Spector, Tim D.; Wilson, Scott G.
2012-01-01
Introduction Genetic studies of osteoporosis have commonly examined SNPs in candidate genes or whole genome analyses, but insertions and deletions of DNA, collectively called copy number variations (CNVs), also comprise a large amount of the genetic variability between individuals. Previously, SNPs in the APC gene have been strongly associated with femoral neck and lumbar spine volumetric bone mineral density in older men. In addition, familial adenomatous polyposis patients carrying heterozygous mutations in the APC gene have been shown to have significantly higher mean bone mineral density than age- and sex-matched controls suggesting the importance of this gene in regulating bone mineral density. We examined CNV within the APC gene region to test for association with bone mineral density. Methods DNA was extracted from venous blood, genotyped using the Human Hap610 arrays and CNV determined from the fluorescence intensity data in 2070 Caucasian men and women aged 47.0 ± 13.0 (mean ± SD) years, to assess the effects of the CNV on bone mineral density at the forearm, spine and total hip sites. Results Data for covariate adjusted bone mineral density from subjects grouped by APC CNV genotype showed significant difference (P = 0.02–0.002). Subjects with a single copy loss of APC had a 7.95%, 13.10% and 13.36% increase in bone mineral density at the forearm, spine and total hip sites respectively, compared to subjects with two copies of the APC gene. Conclusions These data support previous findings of APC regulating bone mineral density and demonstrate that a novel CNV of the APC gene is significantly associated with bone mineral density in Caucasian men and women. PMID:22884971
2013-01-01
Background Mitochondrial genomic (mitogenomic) reorganizations are rarely found in closely-related animals, yet drastic reorganizations have been found in the Ranoides frogs. The phylogenetic relationships of the three major ranoid taxa (Natatanura, Microhylidae, and Afrobatrachia) have been problematic, and mitogenomic information for afrobatrachians has not been available. Several molecular models for mitochondrial (mt) gene rearrangements have been proposed, but observational evidence has been insufficient to evaluate them. Furthermore, evolutionary trends in rearranged mt genes have not been well understood. To gain molecular and phylogenetic insights into these issues, we analyzed the mt genomes of four afrobatrachian species (Breviceps adspersus, Hemisus marmoratus, Hyperolius marmoratus, and Trichobatrachus robustus) and performed molecular phylogenetic analyses. Furthermore we searched for two evolutionary patterns expected in the rearranged mt genes of ranoids. Results Extensively reorganized mt genomes having many duplicated and rearranged genes were found in three of the four afrobatrachians analyzed. In fact, Breviceps has the largest known mt genome among vertebrates. Although the kinds of duplicated and rearranged genes differed among these species, a remarkable gene rearrangement pattern of non-tandemly copied genes situated within tandemly-copied regions was commonly found. Furthermore, the existence of concerted evolution was observed between non-neighboring copies of triplicated 12S and 16S ribosomal RNA regions. Conclusions Phylogenetic analyses based on mitogenomic data support a close relationship between Afrobatrachia and Microhylidae, with their estimated divergence 100 million years ago consistent with present-day endemism of afrobatrachians on the African continent. The afrobatrachian mt data supported the first tandem and second non-tandem duplication model for mt gene rearrangements and the recombination-based model for concerted
Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek
2015-10-01
Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1.
Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek
2015-01-01
Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1. PMID:26423656
González, Juan R; Carrasco, Josep L; Armengol, Lluís; Villatoro, Sergi; Jover, Lluís; Yasui, Yutaka; Estivill, Xavier
2008-01-01
Background MLPA method is a potentially useful semi-quantitative method to detect copy number alterations in targeted regions. In this paper, we propose a method for the normalization procedure based on a non-linear mixed-model, as well as a new approach for determining the statistical significance of altered probes based on linear mixed-model. This method establishes a threshold by using different tolerance intervals that accommodates the specific random error variability observed in each test sample. Results Through simulation studies we have shown that our proposed method outperforms two existing methods that are based on simple threshold rules or iterative regression. We have illustrated the method using a controlled MLPA assay in which targeted regions are variable in copy number in individuals suffering from different disorders such as Prader-Willi, DiGeorge or Autism showing the best performace. Conclusion Using the proposed mixed-model, we are able to determine thresholds to decide whether a region is altered. These threholds are specific for each individual, incorporating experimental variability, resulting in improved sensitivity and specificity as the examples with real data have revealed. PMID:18522760
Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A.
2016-01-01
Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766
Zhang, Gui-Min; Zheng, Li; He, Hua; Song, Cheng-Chuang; Zhang, Zi-Jing; Cao, Xiu-Kai; Lei, Chu-Zhao; Lan, Xian-Yong; Qi, Xing-Lei; Chen, Hong; Huang, Yong-Zhen
2018-03-20
Copy number variations (CNVs) recently have been recognized as another important genetic variability followed single nucleotide polymorphisms (SNPs). The guanylate binding protein 2 (GBP2) gene plays an important role in cell proliferation. This study was performed to determine the presence of GBP2 CNV (relative to Angus cattle) in 466 individuals representing six main cattle breeds from China, identify its relationship with growth, and explore the biological effects of gene expression. There were two CNV regions in the GBP2 gene, for three types, CNV1 loss type (relative to Angus cattle) was more frequent in XN than other breeds, and CNV2 loss type (relative to Angus cattle) was more frequent in XN and CDM than other breeds. Though the GBP2 gene copy number presented no correlation with the transcriptional expression of JX (P > .05), but the transcriptional expression in heart is higher than other tissues, and the copy number in muscles and fat of JX is higher than others breeds. Statistical analysis revealed that the GBP2 gene CNV1 and CNV2 were significantly associated with growth traits (P < .05). In conclusion, this research established the correlations between CNVs of GBP2 gene and growth traits in different cattle breeds, and our results suggested that the CNVs in GBP2 gene may be considered markers for the molecular breeding of Chinese beef cattle. Copyright © 2018. Published by Elsevier B.V.
van Wieringen, Wessel N; van de Wiel, Mark A
2011-05-01
Realizing that genes often operate together, studies into the molecular biology of cancer shift focus from individual genes to pathways. In order to understand the regulatory mechanisms of a pathway, one must study its genes at all molecular levels. To facilitate such study at the genomic level, we developed exploratory factor analysis for the characterization of the variability of a pathway's copy number data. A latent variable model that describes the call probability data of a pathway is introduced and fitted with an EM algorithm. In two breast cancer data sets, it is shown that the first two latent variables of GO nodes, which inherit a clear interpretation from the call probabilities, are often related to the proportion of aberrations and a contrast of the probabilities of a loss and of a gain. Linking the latent variables to the node's gene expression data suggests that they capture the "global" effect of genomic aberrations on these transcript levels. In all, the proposed method provides an possibly insightful characterization of pathway copy number data, which may be fruitfully exploited to study the interaction between the pathway's DNA copy number aberrations and data from other molecular levels like gene expression.
Yu, Hongsong; Luo, Le; Wu, Lili; Zheng, Minming; Zhang, Lijun; Liu, Yunjia; Li, Hua; Cao, Qingfeng; Kijlstra, Aize; Yang, Peizeng
2015-11-01
Previous studies have identified that disturbed apoptosis was involved in the pathogenesis of Behçet disease (BD) and Vogt-Koyanagi-Harada (VKH) syndrome. This study aims to investigate whether copy number variations of apoptosis-related genes, including FAS, CASPASE8, CASPASE3, and BCL2, are associated with BD and VKH syndrome in Han Chinese. A two-stage association study was performed in 1,014 BD patients, 1,051 VKH syndrome patients, and 2,076 healthy controls. TaqMan(®) Copy Number Assays and real-time PCR were performed. The first-stage study showed that increased frequency of high FAS copy number (>2) was found in BD (P = 1.05 × 10(-3) ) and VKH syndrome (P = 2.56 × 10(-3) ). Replication and combined study confirmed the association of high copy number (>2) of FAS with BD (P = 3.35 × 10(-8) ) and VKH syndrome (P = 9.77 × 10(-8) ). A significant upregulated mRNA expression of FAS was observed in anti-CD3/CD28 antibodies-stimulated CD4(+) T cells from individuals carrying a high gene copy number (>2) as compared to normal diploid 2 copy number carriers (P = 0.004). Moreover, the mRNA expression of FAS both in active patients with BD and VKH syndrome was significantly higher than that in controls (P = 0.001 and P = 0.007, respectively). Our findings suggest that a high copy number of FAS gene confers risk for BD and VKH syndrome. © 2015 WILEY PERIODICALS, INC.
Mayer, Melanie G.; Rödelsperger, Christian; Witte, Hanh; Riebesell, Metta; Sommer, Ralf J.
2015-01-01
Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains´ pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as major target for
Butchbach, Matthew E. R.
2016-01-01
Proximal spinal muscular atrophy (SMA), a leading genetic cause of infant death worldwide, is an early-onset, autosomal recessive neurodegenerative disease characterized by the loss of spinal α-motor neurons. This loss of α-motor neurons is associated with muscle weakness and atrophy. SMA can be classified into five clinical grades based on age of onset and severity of the disease. Regardless of clinical grade, proximal SMA results from the loss or mutation of SMN1 (survival motor neuron 1) on chromosome 5q13. In humans a large tandem chromosomal duplication has lead to a second copy of the SMN gene locus known as SMN2. SMN2 is distinguishable from SMN1 by a single nucleotide difference that disrupts an exonic splice enhancer in exon 7. As a result, most of SMN2 mRNAs lack exon 7 (SMNΔ7) and produce a protein that is both unstable and less than fully functional. Although only 10–20% of the SMN2 gene product is fully functional, increased genomic copies of SMN2 inversely correlates with disease severity among individuals with SMA. Because SMN2 copy number influences disease severity in SMA, there is prognostic value in accurate measurement of SMN2 copy number from patients being evaluated for SMA. This prognostic value is especially important given that SMN2 copy number is now being used as an inclusion criterion for SMA clinical trials. In addition to SMA, copy number variations (CNVs) in the SMN genes can affect the clinical severity of other neurological disorders including amyotrophic lateral sclerosis (ALS) and progressive muscular atrophy (PMA). This review will discuss how SMN1 and SMN2 CNVs are detected and why accurate measurement of SMN1 and SMN2 copy numbers is relevant for SMA and other neurodegenerative diseases. PMID:27014701
Peretti, U; Ferrara, R; Pilotto, S; Kinspergher, S; Caccese, M; Santo, A; Brunelli, M; Caliò, A; Carbognin, L; Sperduti, I; Garassino, M; Chilosi, M; Scarpa, A; Tortora, G; Bria, E
2016-08-25
The correlation between ALK gene copy number gain (ALK-CNG) and prognosis in the context of advanced non-small-cell lung cancer (NSCLC) remains a controversial issue. This study aimed to evaluate the association among ALK-CNG according to Fluorescent In Situ Hybridization (FISH), clinical characteristics and survival in resectable and advanced NSCLC. Clinical and pathological data of patients with resectable and advanced NSCLC were retrospectively collected. Tumor tissues were analyzed for ALK-CNG by FISH, and patients were divided in 3 groups/patterns on the basis of ALK signals: disomic [Pattern A], 3-7 signals [Pattern B], >7 signals [Pattern C]. The association between clinical and pathological features and ALK-CNG patterns was evaluated. Disease/progression-free and overall survival (DFS/PFS and OS) were estimated using the Kaplan-Meyer method. A number of 128 (76.6 %) out of the 167 eligible patients were evaluable for ALK-CNG, displaying pattern A, B and C in 71 (42.5 %), 42 (25.1 %) and 15 (9 %) patients, respectively. Gains in ALK-CNG appear to be more frequent in smokers/former smokers than in non-smokers (74.2 % versus 20.4 %, respectively, p = 0.03). Pattern A and C seem more frequently associated with higher T-stage (T3-4), while pattern B appears more represented in lower T-stage (T 1-2) (p = 0.06). No significant differences in survival rate were observed among the above groups. A high ALK-CNG pattern might be associated with smoking status and theoretically it might mirror genomic instability. The implications for prognosis should be prospectively investigated and validated in larger patients' series. We confirm that all the study was performed in accordance with relevant guidelines and regulations and that all the protocol (part of a larger project MFAG 2013 N.14282) was approved by the local Ethics Committee of the Azienda Ospedaliera Universitaria Integrata of Verona on November 11st, 2014.
Lidholm, J; Gustafsson, P
1992-11-01
A comparative transcription analysis of the chloroplast trnK-psbA-trnH region of the two pine species Pinus contorta and Pinus sylvestris is reported. The chloroplast genome of P. contorta has previously been shown to contain a duplicated psbA gene copy integrated closely upstream of the split trnK gene. This rearrangement has resulted in the gene order psbAI-trnK-psbAII-trnH, where psbAII is the ancestral psbA gene copy. In P. sylvestris, a species which lacks the psbA duplication, transcription of the trnK gene originates from a position 291 bp upstream of the trnK 5' exon, adjacent to a canonical promoter structure. In P. contorta, the corresponding promoter structure has been separated from the trnK gene by the insertion of psbAI, and has, in addition, been partially deleted. Analysis of the transcriptional organization of the trnK-psbA-trnH region of the two pine species revealed that the trnK gene in P. contorta is transcriptionally fused to the inserted psbAI gene copy. As a result, trnK is under the control of the psbA promoter in this species and has therefore acquired psbA-like expression characteristics. In P. sylvestris, accumulation of trnK transcripts is not significantly higher in light-grown than in dark-grown seedlings. In contrast, the level of trnK transcripts in P. contorta is approximately 12-fold higher in the light than in the dark. When light-grown seedlings of the two pine species were compared, an approximately 20-fold higher level of trnK RNAs was found in P. contorta. In both pine species, evidence was obtained for trnK-psbA and psbA-trnH co-transcription.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ozden, Sibel, E-mail: stopuz@istanbul.edu.tr; Turgut Kara, Neslihan; Sezerman, Osman Ugur
Altered expression of tumor suppressor genes and oncogenes, which is regulated in part at the level of DNA methylation, is an important event involved in non-genotoxic carcinogenesis. This may serve as a marker for early detection of non-genotoxic carcinogens. Therefore, we evaluated the effects of non-genotoxic hepatocarcinogens, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), hexachlorobenzene (HCB), methapyrilene (MPY) and male rat kidney carcinogens, d-limonene, p-dichlorobenzene (DCB), chloroform and ochratoxin A (OTA) on global and CpG island promoter methylation in their respective target tissues in rats. No significant dose-related effects on global DNA hypomethylation were observed in tissues of rats compared to vehicle controls using LC–MS/MSmore » in response to short-term non-genotoxic carcinogen exposure. Initial experiments investigating gene-specific methylation using methylation-specific PCR and bisulfite sequencing, revealed partial methylation of p16 in the liver of rats treated with HCB and TCDD. However, no treatment related effects on the methylation status of Cx32, e-cadherin, VHL, c-myc, Igfbp2, and p15 were observed. We therefore applied genome-wide DNA methylation analysis using methylated DNA immunoprecipitation combined with microarrays to identify alterations in gene-specific methylation. Under the conditions of our study, some genes were differentially methylated in response to MPY and TCDD, whereas d-limonene, DCB and chloroform did not induce any methylation changes. 90-day OTA treatment revealed enrichment of several categories of genes important in protein kinase activity and mTOR cell signaling process which are related to OTA nephrocarcinogenicity. - Highlights: • Studied non-genotoxic carcinogens caused no change on global DNA hypomethylation. • d-Limonene, DCB and chloroform did not show any genome-wide methylation changes. • Some genes were differentially methylated in response to MPY, TCDD and OTA. • Protein kinase
Salati, Simona; Zini, Roberta; Nuzzo, Simona; Guglielmelli, Paola; Pennucci, Valentina; Prudente, Zelia; Ruberti, Samantha; Rontauroli, Sebastiano; Norfo, Ruggiero; Bianchi, Elisa; Bogani, Costanza; Rotunno, Giada; Fanelli, Tiziana; Mannarelli, Carmela; Rosti, Vittorio; Salmoiraghi, Silvia; Pietra, Daniela; Ferrari, Sergio; Barosi, Giovanni; Rambaldi, Alessandro; Cazzola, Mario; Bicciato, Silvio; Tagliafico, Enrico; Vannucchi, Alessandro M; Manfredini, Rossella
2016-04-01
Primary myelofibrosis (PMF) is a Myeloproliferative Neoplasm (MPN) characterized by megakaryocyte hyperplasia, progressive bone marrow fibrosis, extramedullary hematopoiesis and transformation to Acute Myeloid Leukemia (AML). A number of phenotypic driver (JAK2, CALR, MPL) and additional subclonal mutations have been described in PMF, pointing to a complex genomic landscape. To discover novel genomic lesions that can contribute to disease phenotype and/or development, gene expression and copy number signals were integrated and several genomic abnormalities leading to a concordant alteration in gene expression levels were identified. In particular, copy number gain in the polyamine oxidase (PAOX) gene locus was accompanied by a coordinated transcriptional up-regulation in PMF patients. PAOX inhibition resulted in rapid cell death of PMF progenitor cells, while sparing normal cells, suggesting that PAOX inhibition could represent a therapeutic strategy to selectively target PMF cells without affecting normal hematopoietic cells' survival. Moreover, copy number loss in the chromatin modifier HMGXB4 gene correlates with a concomitant transcriptional down-regulation in PMF patients. Interestingly, silencing of HMGXB4 induces megakaryocyte differentiation, while inhibiting erythroid development, in human hematopoietic stem/progenitor cells. These results highlight a previously un-reported, yet potentially interesting role of HMGXB4 in the hematopoietic system and suggest that genomic and transcriptional imbalances of HMGXB4 could contribute to the aberrant expansion of the megakaryocytic lineage that characterizes PMF patients. © 2015 UICC.
Vishwanathan, Nandita; Bandyopadhyay, Arpan; Fu, Hsu-Yuan; Johnson, Kathryn C; Springer, Nathan M; Hu, Wei-Shou
2017-08-01
Chinese Hamster Ovary (CHO) cells are aneuploid in nature. The genome of recombinant protein producing CHO cell lines continuously undergoes changes in its structure and organization. We analyzed nine cell lines, including parental cell lines, using a comparative genomic hybridization (CGH) array focused on gene-containing regions. The comparison of CGH with copy-number estimates from sequencing data showed good correlation. Hierarchical clustering of the gene copy number variation data from CGH data revealed the lineage relationships between the cell lines. On analyzing the clones of a clonal population, some regions with altered genomic copy number status were identified indicating genomic changes during passaging. A CGH array is thus an effective tool in quantifying genomic alterations in industrial cell lines and can provide insights into the changes in the genomic structure during cell line derivation and long term culture. Biotechnol. Bioeng. 2017;114: 1903-1908. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Iben, James R.; Maraia, Richard J.
2012-01-01
tRNA genes are interspersed throughout eukaryotic DNA, contributing to genome architecture and evolution in addition to translation of the transcriptome. Codon use correlates with tRNA gene copy number in noncomplex organisms including yeasts. Synonymous codons impact translation with various outcomes, dependent on relative tRNA abundances. Availability of whole-genome sequences allowed us to examine tRNA gene copy number variation (tgCNV) and codon use in four Schizosaccharomyces species and Saccharomyces cerevisiae. tRNA gene numbers vary from 171 to 322 in the four Schizosaccharomyces despite very high similarity in other features of their genomes. In addition, we performed whole-genome sequencing of several related laboratory strains of Schizosaccharomyces pombe and found tgCNV at a cluster of tRNA genes. We examined for the first time effects of wobble rules on correlation of tRNA gene number and codon use and showed improvement for S. cerevisiae and three of the Schizosaccharomyces species. In contrast, correlation in Schizosaccharomyces japonicus is poor due to markedly divergent tRNA gene content, and much worsened by the wobble rules. In japonicus, some tRNA iso-acceptor genes are absent and others are greatly reduced relative to the other yeasts, while genes for synonymous wobble iso-acceptors are amplified, indicating wobble use not apparent in any other eukaryote. We identified a subset of japonicus-specific wobbles that improves correlation of codon use and tRNA gene content in japonicus. We conclude that tgCNV is high among Schizo species and occurs in related laboratory strains of S. pombe (and expectedly other species), and tRNAome-codon analyses can provide insight into species-specific wobble decoding. PMID:22586155
LATS2 tumour specific mutations and down-regulation of the gene in non-small cell carcinoma.
Strazisar, Mojca; Mlakar, Vid; Glavac, Damjan
2009-06-01
LATS2 is a new member of the LATS tumour suppressor family. The human LATS2 gene is located at chromosome 13q11-12, a hot spot (67%) for loss of heterozygosity (LOH) in non-small cell lung cancer (NSCLC). We screened 129 non-small cell lung cancer samples and 13 lung cancer cell lines, initially for mutations in the LATS2 gene and subsequently for mutations in P53 and K-RAS genes. Either polymorphisms or mutations were identified in over 50 percent of analysed tumours. A novel missense mutation, S1073R, and a large deletion of 8 amino acids in the PAPA-repeat region were detected in 9 and 2 NSCLC tumours, respectively. Those mutations were not identified in the 13 lung cancer cell lines. Mutations were tumour specific and were absent from adjacent normal tissue and healthy controls. Down-regulation of the LATS2 gene was observed in most NSCLC tumours but was not related to any mutation or polymorphism. Tumours with a LATS2 mutation often also harbour a P53 but not K-RAS gene mutation and were mostly in an advanced stage of development, with regional lymph node involvement.
DNA replication stress restricts ribosomal DNA copy number
Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin
2017-01-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237
DNA replication stress restricts ribosomal DNA copy number.
Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L
2017-09-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
Ribera, Jordi; Zamora, Lurdes; García, Olga; Hernández-Rivas, Jesús-María; Genescà, Eulàlia; Ribera, Josep-Maria
2016-12-02
Unlike Burkitt lymphoma, molecular abnormalities other than C-MYC rearrangements have scarcely been studied in patients with mature B acute lymphoblastic leukemia (B-ALL). The aim of this study was to analyze the frequency and prognostic significance of copy number alterations (CNA) in genes involved in lymphoid differentiation, cell cycle and tumor suppression in adult patients with B-ALL. We have analyzed by multiplex ligation-dependent probe amplification the genetic material from bone marrow at diagnosis from 25 adult B-ALL patients treated with rituximab and specific chemotherapy. The most frequent CNA were alterations in the 14q32.33 region (11 cases, 44%) followed by alterations in the cell cycle regulator genes CDKN2A/B and RB1 (16%). No correlation between the presence of specific CNA and the clinical-biologic features or the response to therapy was found. The high frequency of CNA in the 14q32.33 region, CDKN2A/B and RB1 found in our study could contribute to the aggressiveness and invasiveness of mature B-ALL. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.
Lin, F; Chen, X M
2007-05-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values
Hasnain, S; Thomas, C M
1986-07-01
Low copy number vector plasmid pCT571 was constructed to clone Bacillus subtilis genomic fragments in Escherichia coli. pCT571 confers KmR, TcR and CmR in E. coli and CmR in B. subtilis. It has unique restriction sites within the KmR and TcR markers to allow screening for recombinant plasmids by insertional inactivation of these genes. It contains the pSC101 replicon and replicates normally at six to eight copies per chromosome equivalent in E. coli. It also contains oriVRK2, which when supplied with the product of the trfA gene of RK2 in trans, allows pCT571 to replicate at 35-40 copies per chromosome equivalent. A B. subtilis gene bank was created by cloning partially Sau3A-digested and size-fractionated fragments of B. subtilis chromosomal DNA into the BamHI site of pCT571. DNA from 1097 KmR TcS transformants was extracted and analysed electrophoretically as supercoiled DNA and after digesting with EcoRI or EcoRI and SalI. Approximately 1000 hybrid plasmids were found with reasonably sized B. subtilis fragments. The mean size of the inserts in pCT571 is 8 kb, ranging from 4 to 20 kb in different plasmids. The gene bank covers most of the B. subtilis chromosome, as demonstrated by the results of screening the gene bank for selectable nutritional markers in E. coli and B. subtilis. Hybrid plasmids which complement E. coli mutants for arg, his, lys, met, pdx, pyr and thr markers were identified from the gene bank. In B. subtilis the presence of argC, cysA, dal, hisA, ilvA, leuA, lys, metB, metC, phe, purA, purB, thr and trpC was established by transformation experiments. The effects of copy number on cloning and long-term maintenance in the bacterial strains were also investigated. At high copy number some hybrid plasmids cannot be maintained at all, while others show an increased rate of structural deletions and rearrangements.
Newton, Richard; Wernisch, Lorenz
2014-01-01
Inferring gene regulatory relationships from observational data is challenging. Manipulation and intervention is often required to unravel causal relationships unambiguously. However, gene copy number changes, as they frequently occur in cancer cells, might be considered natural manipulation experiments on gene expression. An increasing number of data sets on matched array comparative genomic hybridisation and transcriptomics experiments from a variety of cancer pathologies are becoming publicly available. Here we explore the potential of a meta-analysis of thirty such data sets. The aim of our analysis was to assess the potential of in silico inference of trans-acting gene regulatory relationships from this type of data. We found sufficient correlation signal in the data to infer gene regulatory relationships, with interesting similarities between data sets. A number of genes had highly correlated copy number and expression changes in many of the data sets and we present predicted potential trans-acted regulatory relationships for each of these genes. The study also investigates to what extent heterogeneity between cell types and between pathologies determines the number of statistically significant predictions available from a meta-analysis of experiments. PMID:25148247
Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M.; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A.A.; Yang, Fengtang; Thomas, Mark G.; Armour, John A.L.
2015-01-01
The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. PMID:25788522
Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L
2015-06-15
The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. © The Author 2015. Published by Oxford University Press.
Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent
2012-01-01
Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126
Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao
2016-12-20
Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.
Raychaudhuri, Soumya; Korn, Joshua M.; McCarroll, Steven A.; Altshuler, David; Sklar, Pamela; Purcell, Shaun; Daly, Mark J.
2010-01-01
Investigators have linked rare copy number variation (CNVs) to neuropsychiatric diseases, such as schizophrenia. One hypothesis is that CNV events cause disease by affecting genes with specific brain functions. Under these circumstances, we expect that CNV events in cases should impact brain-function genes more frequently than those events in controls. Previous publications have applied “pathway” analyses to genes within neuropsychiatric case CNVs to show enrichment for brain-functions. While such analyses have been suggestive, they often have not rigorously compared the rates of CNVs impacting genes with brain function in cases to controls, and therefore do not address important confounders such as the large size of brain genes and overall differences in rates and sizes of CNVs. To demonstrate the potential impact of confounders, we genotyped rare CNV events in 2,415 unaffected controls with Affymetrix 6.0; we then applied standard pathway analyses using four sets of brain-function genes and observed an apparently highly significant enrichment for each set. The enrichment is simply driven by the large size of brain-function genes. Instead, we propose a case-control statistical test, cnv-enrichment-test, to compare the rate of CNVs impacting specific gene sets in cases versus controls. With simulations, we demonstrate that cnv-enrichment-test is robust to case-control differences in CNV size, CNV rate, and systematic differences in gene size. Finally, we apply cnv-enrichment-test to rare CNV events published by the International Schizophrenia Consortium (ISC). This approach reveals nominal evidence of case-association in neuronal-activity and the learning gene sets, but not the other two examined gene sets. The neuronal-activity genes have been associated in a separate set of schizophrenia cases and controls; however, testing in independent samples is necessary to definitively confirm this association. Our method is implemented in the PLINK software package
Hacking DNA copy number for circuit engineering.
Wu, Feilun; You, Lingchong
2017-07-27
DNA copy number represents an essential parameter in the dynamics of synthetic gene circuits but typically is not explicitly considered. A new study demonstrates how dynamic control of DNA copy number can serve as an effective strategy to program robust oscillations in gene expression circuits.
Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.
Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B
1990-01-01
Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563
Assessing the impact of copy number variants on miRNA genes in autism by Monte Carlo simulation.
Marrale, Maurizio; Albanese, Nadia Ninfa; Calì, Francesco; Romano, Valentino
2014-01-01
Autism Spectrum Disorders (ASDs) are childhood neurodevelopmental disorders with complex genetic origins. Previous studies have investigated the role of de novo Copy Number Variants (CNVs) and microRNAs as important but distinct etiological factors in ASD. We developed a novel computational procedure to assess the potential pathogenic role of microRNA genes overlapping de novo CNVs in ASD patients. Here we show that for chromosomes # 1, 2 and 22 the actual number of miRNA loci affected by de novo CNVs in patients was found significantly higher than that estimated by Monte Carlo simulation of random CNV events. Out of 24 miRNA genes over-represented in CNVs from these three chromosomes only hsa-mir-4436b-1 and hsa-mir-4436b-2 have not been detected in CNVs from non-autistic subjects as reported in the Database of Genomic Variants. Altogether the results reported in this study represent a first step towards a full understanding of how a dysregulated expression of the 24 miRNAs genes affect neurodevelopment in autism. We also propose that the procedure used in this study can be effectively applied to CNVs/miRNA genes association data in other genomic disorders beyond autism.
Mitchelson, K R
1996-01-01
The small single-copy region (SSCR) of the chloroplast genome of many higher plants typically contain ndh genes encoding proteins that share homology with subunits of the respiratory-chain reduced nicotinamide adenine dinucleotide (NADH) dehydrogenase complex of mitochondria. A map of the lettuce chloroplast SSCR has been determined by Southern cross-hybridization, taking advantage of the high degree of homology between a tobacco small single-copy fragment and a corresponding lettuce chloroplast fragment. The gene order of the SSCR of lettuce and tobacco chloroplasts is similar. The cross-hybridization method can rapidly create a primary gene map of unknown chloroplast fragments, thus providing detailed information of the localization and arrangement of genes and conserved open reading frame regions.
Kumari, Anju; Yadav, Sandeep Kumar; Misro, Man Mohan; Ahmad, Jamal; Ali, Sher
2015-12-07
We analyzed 34 azoospermic (AZ), 43 oligospermic (OS), and 40 infertile males with normal spermiogram (INS) together with 55 normal fertile males (NFM) from the Indian population. AZ showed more microdeletions in the AZFa and AZFb regions whereas oligospermic ones showed more microdeletions in the AZFc region. Frequency of the AZF partial deletions was higher in males with spermatogenic impairments than in INS. Significantly, SRY, DAZ and BPY2 genes showed copy number variation across different categories of the patients and much reduced copies of the DYZ1 repeat arrays compared to that in normal fertile males. Likewise, INS showed microdeletions, sequence and copy number variation of several Y linked genes and loci. In the context of infertility, STS deletions and copy number variations both were statistically significant (p = 0.001). Thus, semen samples used during in vitro fertilization (IVF) and assisted reproductive technology (ART) must be assessed for the microdeletions of AZFa, b and c regions in addition to the affected genes reported herein. Present study is envisaged to be useful for DNA based diagnosis of different categories of the infertile males lending support to genetic counseling to the couples aspiring to avail assisted reproductive technologies.
Sacta, Maria A; Tharmalingam, Bowranigan; Coppo, Maddalena; Rollins, David A; Deochand, Dinesh K; Benjamin, Bradley; Yu, Li; Zhang, Bin; Hu, Xiaoyu; Li, Rong; Chinenov, Yurii
2018-01-01
The glucocorticoid receptor (GR) potently represses macrophage-elicited inflammation, however, the underlying mechanisms remain obscure. Our genome-wide analysis in mouse macrophages reveals that pro-inflammatory paused genes, activated via global negative elongation factor (NELF) dissociation and RNA Polymerase (Pol)2 release from early elongation arrest, and non-paused genes, induced by de novo Pol2 recruitment, are equally susceptible to acute glucocorticoid repression. Moreover, in both cases the dominant mechanism involves rapid GR tethering to p65 at NF-kB-binding sites. Yet, specifically at paused genes, GR activation triggers widespread promoter accumulation of NELF, with myeloid cell-specific NELF deletion conferring glucocorticoid resistance. Conversely, at non-paused genes, GR attenuates the recruitment of p300 and histone acetylation, leading to a failure to assemble BRD4 and Mediator at promoters and enhancers, ultimately blocking Pol2 initiation. Thus, GR displays no preference for a specific pro-inflammatory gene class; however, it effects repression by targeting distinct temporal events and components of transcriptional machinery. PMID:29424686
Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum
Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes
2012-01-01
The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: http://dx.doi.org/10.7554/eLife.00093.001 PMID:23251784
Flores, Raquel; González, Juan R.; Argente, Jesús; Pérez-Jurado, Luis A.
2017-01-01
Obesity is a multifactorial disorder with high heritability (50–75%), which is probably higher in early-onset and severe cases. Although rare monogenic forms and several genes and regions of susceptibility, including copy number variants (CNVs), have been described, the genetic causes underlying the disease still remain largely unknown. We searched for rare CNVs (>100kb in size, altering genes and present in <1/2000 population controls) in 157 Spanish children with non-syndromic early-onset obesity (EOO: body mass index >3 standard deviations above the mean at <3 years of age) using SNP array molecular karyotypes. We then performed case control studies (480 EOO cases/480 non-obese controls) with the validated CNVs and rare sequence variants (RSVs) detected by targeted resequencing of selected CNV genes (n = 14), and also studied the inheritance patterns in available first-degree relatives. A higher burden of gain-type CNVs was detected in EOO cases versus controls (OR = 1.71, p-value = 0.0358). In addition to a gain of the NPY gene in a familial case with EOO and attention deficit hyperactivity disorder, likely pathogenic CNVs included gains of glutamate receptors (GRIK1, GRM7) and the X-linked gastrin-peptide receptor (GRPR), all inherited from obese parents. Putatively functional RSVs absent in controls were also identified in EOO cases at NPY, GRIK1 and GRPR. A patient with a heterozygous deletion disrupting two contiguous and related genes, SLCO4C1 and SLCO6A1, also had a missense RSV at SLCO4C1 on the other allele, suggestive of a recessive model. The genes identified showed a clear enrichment of shared co-expression partners with known genes strongly related to obesity, reinforcing their role in the pathophysiology of the disease. Our data reveal a higher burden of rare CNVs and RSVs in several related genes in patients with EOO compared to controls, and implicate NPY, GRPR, two glutamate receptors and SLCO4C1 in highly penetrant forms of familial obesity
Serra-Juhé, Clara; Martos-Moreno, Gabriel Á; Bou de Pieri, Francesc; Flores, Raquel; González, Juan R; Rodríguez-Santiago, Benjamín; Argente, Jesús; Pérez-Jurado, Luis A
2017-05-01
Obesity is a multifactorial disorder with high heritability (50-75%), which is probably higher in early-onset and severe cases. Although rare monogenic forms and several genes and regions of susceptibility, including copy number variants (CNVs), have been described, the genetic causes underlying the disease still remain largely unknown. We searched for rare CNVs (>100kb in size, altering genes and present in <1/2000 population controls) in 157 Spanish children with non-syndromic early-onset obesity (EOO: body mass index >3 standard deviations above the mean at <3 years of age) using SNP array molecular karyotypes. We then performed case control studies (480 EOO cases/480 non-obese controls) with the validated CNVs and rare sequence variants (RSVs) detected by targeted resequencing of selected CNV genes (n = 14), and also studied the inheritance patterns in available first-degree relatives. A higher burden of gain-type CNVs was detected in EOO cases versus controls (OR = 1.71, p-value = 0.0358). In addition to a gain of the NPY gene in a familial case with EOO and attention deficit hyperactivity disorder, likely pathogenic CNVs included gains of glutamate receptors (GRIK1, GRM7) and the X-linked gastrin-peptide receptor (GRPR), all inherited from obese parents. Putatively functional RSVs absent in controls were also identified in EOO cases at NPY, GRIK1 and GRPR. A patient with a heterozygous deletion disrupting two contiguous and related genes, SLCO4C1 and SLCO6A1, also had a missense RSV at SLCO4C1 on the other allele, suggestive of a recessive model. The genes identified showed a clear enrichment of shared co-expression partners with known genes strongly related to obesity, reinforcing their role in the pathophysiology of the disease. Our data reveal a higher burden of rare CNVs and RSVs in several related genes in patients with EOO compared to controls, and implicate NPY, GRPR, two glutamate receptors and SLCO4C1 in highly penetrant forms of familial obesity.
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.
2001-01-01
The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085
Phylogeny and Divergence Times of Gymnosperms Inferred from Single-Copy Nuclear Genes
Guo, Dong-Mei; Yang, Zu-Yu; Wang, Xiao-Quan
2014-01-01
Phylogenetic reconstruction is fundamental to study evolutionary biology and historical biogeography. However, there was not a molecular phylogeny of gymnosperms represented by extensive sampling at the genus level, and most published phylogenies of this group were constructed based on cytoplasmic DNA markers and/or the multi-copy nuclear ribosomal DNA. In this study, we use LFY and NLY, two single-copy nuclear genes that originated from an ancient gene duplication in the ancestor of seed plants, to reconstruct the phylogeny and estimate divergence times of gymnosperms based on a complete sampling of extant genera. The results indicate that the combined LFY and NLY coding sequences can resolve interfamilial relationships of gymnosperms and intergeneric relationships of most families. Moreover, the addition of intron sequences can improve the resolution in Podocarpaceae but not in cycads, although divergence times of the cycad genera are similar to or longer than those of the Podocarpaceae genera. Our study strongly supports cycads as the basal-most lineage of gymnosperms rather than sister to Ginkgoaceae, and a sister relationship between Podocarpaceae and Araucariaceae and between Cephalotaxaceae-Taxaceae and Cupressaceae. In addition, intergeneric relationships of some families that were controversial, and the relationships between Taxaceae and Cephalotaxaceae and between conifers and Gnetales are discussed based on the nuclear gene evidence. The molecular dating analysis suggests that drastic extinctions occurred in the early evolution of gymnosperms, and extant coniferous genera in the Northern Hemisphere are older than those in the Southern Hemisphere on average. This study provides an evolutionary framework for future studies on gymnosperms. PMID:25222863
A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia
Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric
2014-01-01
In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163
Development of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae.
Liu, Hailan; Guo, Xiaoqin; Wu, Jiasheng; Chen, Guo-Bo; Ying, Yeqing
2013-03-01
KEY MESSAGE : We develop a set of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae. Being evolutionary conserved, single-copy orthologous (COSII) genes are particularly useful in comparative mapping and phylogenetic investigation among species. In this study, we identified 2,684 COSII genes based on five sequenced Poaceae genomes including rice, maize, sorghum, foxtail millet, and brachypodium, and then developed 1,072 COSII markers whose transferability and polymorphism among five bamboo species were further evaluated with 46 pairs of randomly selected primers. 91.3 % of the 46 primers obtained clear amplification in at least one bamboo species, and 65.2 % of them produced polymorphism in more than one species. We also used 42 of them to construct the phylogeny for the five bamboo species, and it might reflect more precise evolutionary relationship than the one based on the vegetative morphology. The results indicated a promising prospect of applying these markers to the investigation of genetic diversity and the classification of Poaceae. To ease and facilitate access of the information of common interest to readers, a web-based database of the COSII markers is provided ( http://www.sicau.edu.cn/web/yms/PCOSWeb/PCOS.html ).
Copy number variations in the amylase gene (AMY2B) in Japanese native dog breeds.
Tonoike, A; Hori, Y; Inoue-Murayama, M; Konno, A; Fujita, K; Miyado, M; Fukami, M; Nagasawa, M; Mogi, K; Kikusui, T
2015-10-01
A recent study suggested that increased copy numbers of the AMY2B gene might be a crucial genetic change that occurred during the domestication of dogs. To investigate AMY2B expansion in ancient breeds, which are highly divergent from modern breeds of presumed European origins, we analysed copy numbers in native Japanese dog breeds. Copy numbers in the Akita and Shiba, two ancient breeds in Japan, were higher than those in wolves. However, compared to a group of various modern breeds, Akitas had fewer copy numbers, whereas Shibas exhibited the same level of expansion as modern breeds. Interestingly, average AMY2B copy numbers in the Jomon-Shiba, a unique line of the Shiba that has been bred to maintain their appearance resembling ancestors of native Japanese dogs and that originated in the same region as the Akita, were lower than those in the Shiba. These differences may have arisen from the earlier introduction of rice farming to the region in which the Shiba originated compared to the region in which the Akita and the Jomon-Shiba originated. Thus, our data provide insights into the relationship between the introduction of agriculture and AMY2B expansion in dogs. © 2015 Stichting International Foundation for Animal Genetics.
Lin, Ching-Hung; Liu, Jacqueline M; Lu, Yen-Shen; Lan, Chieh; Lee, Wei-Chung; Kuo, Kuan-Ting; Wang, Chung-Chieh; Chang, Dwan-Ying; Huang, Chiun-Sheng; Cheng, Ann-Lii
2013-02-01
The ESR1 gene encodes for oestrogen receptor (ER) α, which plays a crucial role in mammary carcinogenesis and clinical outcome in patients with breast cancer. However, the clinical significance of the ESR1 gene copy number change for breast cancer has not been clarified. ESR1 gene copy number was determined by fluorescence in situ hybridisation (FISH) on tissue sections. A minimum of 20 tumour cells were counted per section, and a FISH ratio of ESR1 gene to CEP6 ≥ 2.0 was considered ESR1 amplification. A ratio >1.2 but <2.0 was considered ESR1 gain. The ESR1 copy number was further measured by quantitative real-time PCR (Q-PCR) with ASXL2 as a reference. FISH revealed ESR1 amplification in six cases (4.0%) and ESR1 gain in 13 cases (8.7%) from a total of 150 cases. ESR1 gain and amplification were more common in older patients (p<0.001), and correlated well with ER protein expression (p=0.03) measured by immunohistochemistry, and ESR1 copy number (p<0.001) measured by Q-PCR. Furthermore, the multivariate analysis revealed that ESR1 amplification was associated with a shorter disease-free survival (HR=5.56, p=0.03) and a shorter overall survival (HR=5.11, p=0.04). In general, the frequency of ESR1 amplification in breast cancer is low when measured by FISH in large sections. ESR1 gain and amplification in breast cancer may be associated with older age and poorer outcomes.
Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao
2015-10-08
Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and
eap Gene as novel target for specific identification of Staphylococcus aureus.
Hussain, Muzaffar; von Eiff, Christof; Sinha, Bhanu; Joost, Insa; Herrmann, Mathias; Peters, Georg; Becker, Karsten
2008-02-01
The cell surface-associated extracellular adherence protein (Eap) mediates adherence of Staphylococcus aureus to host extracellular matrix components and inhibits inflammation, wound healing, and angiogenesis. A well-characterized collection of S. aureus and non-S. aureus staphylococcal isolates (n = 813) was tested for the presence of the Eap-encoding gene (eap) by PCR to investigate the use of the eap gene as a specific diagnostic tool for identification of S. aureus. Whereas all 597 S. aureus isolates were eap positive, this gene was not detectable in 216 non-S. aureus staphylococcal isolates comprising 47 different species and subspecies of coagulase-negative staphylococci and non-S. aureus coagulase-positive or coagulase-variable staphylococci. Furthermore, non-S. aureus isolates did not express Eap homologs, as verified on the transcriptional and protein levels. Based on these data, the sensitivity and specificity of the newly developed PCR targeting the eap gene were both 100%. Thus, the unique occurrence of Eap in S. aureus offers a promising tool particularly suitable for molecular diagnostics of this pathogen.
Kondrashova, Olga; Love, Clare J.; Lunke, Sebastian; Hsu, Arthur L.; Waring, Paul M.; Taylor, Graham R.
2015-01-01
Whilst next generation sequencing can report point mutations in fixed tissue tumour samples reliably, the accurate determination of copy number is more challenging. The conventional Multiplex Ligation-dependent Probe Amplification (MLPA) assay is an effective tool for measurement of gene dosage, but is restricted to around 50 targets due to size resolution of the MLPA probes. By switching from a size-resolved format, to a sequence-resolved format we developed a scalable, high-throughput, quantitative assay. MLPA-seq is capable of detecting deletions, duplications, and amplifications in as little as 5ng of genomic DNA, including from formalin-fixed paraffin-embedded (FFPE) tumour samples. We show that this method can detect BRCA1, BRCA2, ERBB2 and CCNE1 copy number changes in DNA extracted from snap-frozen and FFPE tumour tissue, with 100% sensitivity and >99.5% specificity. PMID:26569395
Poniah, Prevathe; Mohd Zain, Shamsul; Abdul Razack, Azad Hassan; Kuppusamy, Shanggar; Karuppayah, Shankar; Sian Eng, Hooi; Mohamed, Zahurin
2017-09-01
Two key issues in prostate cancer (PCa) that demand attention currently are the need for a more precise and minimally invasive screening test owing to the inaccuracy of prostate-specific antigen and differential diagnosis to distinguish advanced vs. indolent cancers. This continues to pose a tremendous challenge in diagnosis and prognosis of PCa and could potentially lead to overdiagnosis and overtreatment complications. Copy number variations (CNVs) in the human genome have been linked to various carcinomas including PCa. Detection of these variants may improve clinical treatment as well as an understanding of the pathobiology underlying this complex disease. To this end, we undertook a pilot genome-wide CNV analysis approach in 36 subjects (18 patients with high-grade PCa and 18 controls that were matched by age and ethnicity) in search of more accurate biomarkers that could potentially explain susceptibility toward high-grade PCa. We conducted this study using the array comparative genomic hybridization technique. Array results were validated in 92 independent samples (46 high-grade PCa, 23 benign prostatic hyperplasia, and 23 healthy controls) using polymerase chain reaction-based copy number counting method. A total of 314 CNV regions were found to be unique to PCa subjects in this cohort (P<0.05). A log 2 ratio-based copy number analysis revealed 5 putative rare or novel CNV loci or both associated with susceptibility to PCa. The CNV gain regions were 1q21.3, 15q15, 7p12.1, and a novel CNV in PCa 12q23.1, harboring ARNT, THBS1, SLC5A8, and DDC genes that are crucial in the p53 and cancer pathways. A CNV loss and deletion event was observed at 8p11.21, which contains the SFRP1 gene from the Wnt signaling pathway. Cross-comparison analysis with genes associated to PCa revealed significant CNVs involved in biological processes that elicit cancer pathogenesis via cytokine production and endothelial cell proliferation. In conclusion, we postulated that the CNVs
Son, Ji Woong; Jeong, Kang Jin; Jean, Woo-Sean; Park, Soon Young; Jheon, Sanghoon; Cho, Hyun Min; Park, Chang Gyo; Lee, Hoi Young; Kang, Jaeku
2011-12-01
Early detection of lung cancer provides the highest potential for saving lives. To date, no routine screening method enabling early detection is available, which is a key factor in the disease's high mortality rate. Copy number changes and DNA methylation alterations are good indicators of carcinogenesis and cancer prognosis. In this study, we attempted to combine profiles of DNA copy number and methylation patterns in 20 paired cancerous and noncancerous tissue samples from non-small cell lung cancer (NSCLC) patients, and we detected several clinically important genes with genetic and epigenetic relationships. Using array comparative genomic hybridization (aCGH), statistically significant differences were observed across the histological subtypes for gains at 1p31.1, 3q26.1, and 3q26.31-3q29 as well as for losses at 1p21.1, 2q33.3, 2q37.3, 3p12.3, 4q35.2, and 13q34 in squamous cell carcinoma (SQ) patients, and losses at 12q24.33 were measured in adenocarcinoma (AD) patients (p < 0.05). In an analysis of DNA methylation at 1505 autosomal CpG loci that are associated with 807 cancer-related genes, we identified six and nine loci with higher and lower DNA methylation levels, respectively, in tumor tissue compared to non-tumor lung tissues from AD patients. In addition, three loci with higher and seven loci with lower DNA methylation levels were identified in tumor tissue from SQ patients compared to non-tumor lung tissue. Subsequently, we searched for regions exhibiting concomitant hypermethylation and genomic loss in both ADs and SQs. One clone representing 7p15.2 (which includes candidate genes such as HOXA9 and HOXA11) and one target ID representing HOXA9_E252_R were detected. Quantitative real-time PCR identified the potential candidate gene HOXA9 as being down-regulated in the majority of NSCLC patients. Moreover, following HOXA9 over-expression, the invasion of representative cell lines, A549 and HCC95, were significantly inhibited. Taken together, our results
Jin, Yan; Sun, Ping-Li; Kim, Hyojin; Seo, An Na; Jheon, Sanghoon; Lee, Choon-Taek; Chung, Jin-Haeng
2014-02-01
MET gene copy number gain (CNG) and protein overexpression have been reported in lung cancer, but the clinical implications in early stage adenocarcinoma remain unclear. We investigated MET gene copy number and protein expression in 141 cases of surgically resected stage I pulmonary adenocarcinoma. MET gene CNG was determined by silver in situ hybridization, and MET protein expression was assessed by immunohistochemistry. The correlation between MET gene CNG/protein expression and clinicopathologic parameters and prognostic significance was analyzed. MET gene CNG was found in 24.1% (34 of 141) of the cases and was associated with larger tumor size, pleural invasion, and lymphatic vessel invasion. MET gene CNG was inversely correlated with the presence of lepidic subtype (r = -0.17, p = 0.045) and was not associated with EGFR, KRAS mutation, or ALK gene rearrangement. In addition, MET gene CNG was significantly associated with shorter disease-free survival (DFS) (49 vs. 75 months; p < 0.001) and shorter overall survival (OS) (65 vs. 78 months; p = 0.01). Multivariate analysis confirmed that MET gene CNG was significantly associated with poorer DFS [p < 0.001; hazard ratio (HR) 5.5; 95% confidence interval (CI) 2.2-13.9] but was not significantly associated with OS. MET overexpression was observed in 71.3% of cases (97 of 136), but it was not correlated with gene CNG. MET gene CNG is an independent poor prognostic factor in patients with stage I lung adenocarcinoma. It is associated with aggressive pathologic features and is inversely correlated with the presence of lepidic subtype.
Laish, Ido; Katz, Hila; Sulayev, Yael; Liberman, Meytal; Naftali, Timna; Benjaminov, Fabiana; Stein, Assaf; Kitay-Cohen, Yona; Biron-Shental, Tal; Konikoff, Fred; Amiel, Aliza
2013-10-25
Primary sclerosing cholangitis (PSC) is a chronic cholestatic disorder that involves inflammatory and fibrotic changes in the bile ducts. Up to 80% of patients have concomitant inflammatory bowel disease (IBD) with colitis. PSC patients are predisposed to develop hepatobiliary, colonic and other extrahepatic malignancies, probably related to inflammatory processes that might promote carcinogenesis. Telomerase is an enzyme complex that lengthens telomeres and has enhanced expression in numerous malignancies. In this study, we evaluated the TERC gene copy number, the proportion of cells in senescence and the amount of fragmentation in the senescent state. Fluorescence in situ hybridization (FISH) for the TERC gene was applied to lymphocytes retrieved from PSC (N=19), colitis (N=20) and healthy control patients (N=20) to determine the TERC copy number. On the same FISH slides, cells stained with DAPI were also analyzed for senescence-associated heterochromatin foci (SAHF) status, including the number of cells with fragments and the number of SAHF fragments in each cell. A higher TERC gene copy number was observed in cells from PSC patients compared to colitis and control group patients. It was also higher in the colitis than in the control group. Significantly more cells in the senescent state and more fragmentation in each cell were observed in the PSC group compared to colitis and control groups. The TERC gene copy number and the number of cells in the senescent state were increased in PSC patients compared to the colitis and control groups. These findings are probably related to the genetic instability parameters that reflect the higher tendency of this patient group to develop malignancies. © 2013.
Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes.
Honda, Shinnosuke; Miki, Yuka; Miyamoto, Yuya; Kawahara, Yu; Tsukamoto, Satoshi; Imai, Hiroshi; Minami, Naojiro
2018-05-03
Oog1, an oocyte-specific gene that encodes a protein of 425 amino acids, is present in five copies on mouse chromosomes 4 and 12. In mouse oocytes, Oog1 mRNA expression begins at embryonic day 15.5 and almost disappears by the late two-cell stage. Meanwhile, OOG1 protein is detectable in oocytes in ovarian cysts and disappears by the four-cell stage; the protein is transported to the nucleus in late one-cell to early two-cell stage embryos. In this study, we examined the role of Oog1 during oogenesis in mice. Oog1 RNAi-transgenic mice were generated by expressing double-stranded hairpin Oog1 RNA, which is processed into siRNAs targeting Oog1 mRNA. Quantitative RT-PCR revealed that the amount of Oog1 mRNA was dramatically reduced in oocytes obtained from Oog1-knockdown mice, whereas the abundance of spermatogenesis-associated transcripts (Klhl10, Tekt2, Tdrd6, and Tnp2) was increased in Oog1 knockdown ovaries. Tdrd6 is involved in the formation of the chromatoid body, Tnp2 contributes to the formation of sperm heads, Tekt2 is required for the formation of ciliary and flagellar microtubules, and Klhl10 plays a key role in the elongated sperm differentiation. These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes.
Frankel, Adam; Armour, Nicola; Nancarrow, Derek; Krause, Lutz; Hayward, Nicholas; Lampe, Guy; Smithers, B Mark; Barbour, Andrew
2014-04-01
The incidence of esophageal adenocarcinoma (EAC) has been increasing rapidly for the past 3 decades in Western (Caucasian) populations. Curative treatment is based around esophagectomy, which has a major impact on quality of life. For those suitable for treatment with curative intent, 5-year survival is ∼30%. More accurate prognostic tools are therefore needed, and copy number aberrations (CNAs) may offer the ability to act as prospective biomarkers in this regard. We performed a genome-wide examination of CNAs in 54 samples of EAC using single-nucleotide polymorphism (SNP) arrays. Our aims were to describe frequent regions of CNA, to define driver CNAs, and to identify CNAs that correlated with survival. Regions of frequent amplification included oncogenes such as EGFR, MYC, KLF12, and ERBB2, while frequently deleted regions included tumor suppressor genes such as CDKN2A/B, PTPRD, FHIT, and SMAD4. The genomic identification of significant targets in cancer (GISTIC) algorithm identified 24 regions of gain and 28 regions of loss that were likely to contain driver changes. We discovered 61 genes in five regions that, when stratified by CNA type (gain or loss), correlated with a statistically significant difference in survival. Pathway analysis of the genes residing in both the GISTIC and prognostic regions showed they were significantly enriched for cancer-related networks. Finally, we discovered that copy-neutral loss of heterozygosity is a frequent mechanism of CNA in genes currently targetable by chemotherapy, potentially leading to under-reporting of cases suitable for such treatment. Copyright © 2014 Wiley Periodicals, Inc.
Mokhtar, Siti Shuhada; Marshall, Christian R.; Phipps, Maude E.; Thiruvahindrapuram, Bhooma; Lionel, Anath C.; Scherer, Stephen W.; Peng, Hoh Boon
2014-01-01
Copy number variation (CNV) has been recognized as a major contributor to human genome diversity. It plays an important role in determining phenotypes and has been associated with a number of common and complex diseases. However CNV data from diverse populations is still limited. Here we report the first investigation of CNV in the indigenous populations from Peninsular Malaysia. We genotyped 34 Negrito genomes from Peninsular Malaysia using the Affymetrix SNP 6.0 microarray and identified 48 putative novel CNVs, consisting of 24 gains and 24 losses, of which 5 were identified in at least 2 unrelated samples. These CNVs appear unique to the Negrito population and were absent in the DGV, HapMap3 and Singapore Genome Variation Project (SGVP) datasets. Analysis of gene ontology revealed that genes within these CNVs were enriched in the immune system (GO:0002376), response to stimulus mechanisms (GO:0050896), the metabolic pathways (GO:0001852), as well as regulation of transcription (GO:0006355). Copy number gains in CNV regions (CNVRs) enriched with genes were significantly higher than the losses (P value <0.001). In view of the small population size, relative isolation and semi-nomadic lifestyles of this community, we speculate that these CNVs may be attributed to recent local adaptation of Negritos from Peninsular Malaysia. PMID:24956385
Mokhtar, Siti Shuhada; Marshall, Christian R; Phipps, Maude E; Thiruvahindrapuram, Bhooma; Lionel, Anath C; Scherer, Stephen W; Peng, Hoh Boon
2014-01-01
Copy number variation (CNV) has been recognized as a major contributor to human genome diversity. It plays an important role in determining phenotypes and has been associated with a number of common and complex diseases. However CNV data from diverse populations is still limited. Here we report the first investigation of CNV in the indigenous populations from Peninsular Malaysia. We genotyped 34 Negrito genomes from Peninsular Malaysia using the Affymetrix SNP 6.0 microarray and identified 48 putative novel CNVs, consisting of 24 gains and 24 losses, of which 5 were identified in at least 2 unrelated samples. These CNVs appear unique to the Negrito population and were absent in the DGV, HapMap3 and Singapore Genome Variation Project (SGVP) datasets. Analysis of gene ontology revealed that genes within these CNVs were enriched in the immune system (GO:0002376), response to stimulus mechanisms (GO:0050896), the metabolic pathways (GO:0001852), as well as regulation of transcription (GO:0006355). Copy number gains in CNV regions (CNVRs) enriched with genes were significantly higher than the losses (P value <0.001). In view of the small population size, relative isolation and semi-nomadic lifestyles of this community, we speculate that these CNVs may be attributed to recent local adaptation of Negritos from Peninsular Malaysia.
Non-specific activities of the major herbicide-resistance gene BAR.
Christ, Bastien; Hochstrasser, Ramon; Guyer, Luzia; Francisco, Rita; Aubry, Sylvain; Hörtensteiner, Stefan; Weng, Jing-Ke
2017-12-01
Bialaphos resistance (BAR) and phosphinothricin acetyltransferase (PAT) genes, which convey resistance to the broad-spectrum herbicide phosphinothricin (also known as glufosinate) via N-acetylation, have been globally used in basic plant research and genetically engineered crops 1-4 . Although early in vitro enzyme assays showed that recombinant BAR and PAT exhibit substrate preference toward phosphinothricin over the 20 proteinogenic amino acids 1 , indirect effects of BAR-containing transgenes in planta, including modified amino acid levels, have been seen but without the identification of their direct causes 5,6 . Combining metabolomics, plant genetics and biochemical approaches, we show that transgenic BAR indeed converts two plant endogenous amino acids, aminoadipate and tryptophan, to their respective N-acetylated products in several plant species. We report the crystal structures of BAR, and further delineate structural basis for its substrate selectivity and catalytic mechanism. Through structure-guided protein engineering, we generated several BAR variants that display significantly reduced non-specific activities compared with its wild-type counterpart in vivo. The transgenic expression of enzymes can result in unintended off-target metabolism arising from enzyme promiscuity. Understanding such phenomena at the mechanistic level can facilitate the design of maximally insulated systems featuring heterologously expressed enzymes.
Kim, Seon-Hee; Bae, Young-An
2017-09-01
Tyrosinase provides an essential activity during egg production in diverse platyhelminths by mediating sclerotization of eggshells. In this study, we investigated the genomic and evolutionary features of tyrosinases in parasitic platyhelminths whose genomic information is available. A pair of paralogous tyrosinases was detected in most trematodes, whereas they were lost in cyclophyllidean cestodes. A pseudophyllidean cestode displaying egg biology similar to that of trematodes possessed an orthologous gene. Interestingly, one of the paralogous tyrosinases appeared to have been multiplied into three copies in Clonorchis sinensis and Opisthorchis viverrini. In addition, a fifth tyrosinase gene that was minimally transcribed through all developmental stages was further detected in these opisthorchiid genomes. Phylogenetic analyses demonstrated that the tyrosinase gene has undergone duplication at least three times in platyhelminths. The additional opisthorchiid gene arose from the first duplication. A paralogous copy generated from these gene duplications, except for the last one, seemed to be lost in the major neodermatans lineages. In C. sinensis, tyrosinase gene expressions were initiated following sexual maturation and the levels were significantly enhanced by the presence of O2 and bile. Taken together, our data suggest that tyrosinase has evolved lineage-specifically across platyhelminths related to its copy number and induction mechanism.
A promiscuous intermediate underlies the evolution of LEAFY DNA binding specificity.
Sayou, Camille; Monniaux, Marie; Nanao, Max H; Moyroud, Edwige; Brockington, Samuel F; Thévenon, Emmanuel; Chahtane, Hicham; Warthmann, Norman; Melkonian, Michael; Zhang, Yong; Wong, Gane Ka-Shu; Weigel, Detlef; Parcy, François; Dumas, Renaud
2014-02-07
Transcription factors (TFs) are key players in evolution. Changes affecting their function can yield novel life forms but may also have deleterious effects. Consequently, gene duplication events that release one gene copy from selective pressure are thought to be the common mechanism by which TFs acquire new activities. Here, we show that LEAFY, a major regulator of flower development and cell division in land plants, underwent changes to its DNA binding specificity, even though plant genomes generally contain a single copy of the LEAFY gene. We examined how these changes occurred at the structural level and identify an intermediate LEAFY form in hornworts that appears to adopt all different specificities. This promiscuous intermediate could have smoothed the evolutionary transitions, thereby allowing LEAFY to evolve new binding specificities while remaining a single-copy gene.
Teasdale, Luisa C; Köhler, Frank; Murray, Kevin D; O'Hara, Tim; Moussalli, Adnan
2016-09-01
The qualification of orthology is a significant challenge when developing large, multiloci phylogenetic data sets from assembled transcripts. Transcriptome assemblies have various attributes, such as fragmentation, frameshifts and mis-indexing, which pose problems to automated methods of orthology assessment. Here, we identify a set of orthologous single-copy genes from transcriptome assemblies for the land snails and slugs (Eupulmonata) using a thorough approach to orthology determination involving manual alignment curation, gene tree assessment and sequencing from genomic DNA. We qualified the orthology of 500 nuclear, protein-coding genes from the transcriptome assemblies of 21 eupulmonate species to produce the most complete phylogenetic data matrix for a major molluscan lineage to date, both in terms of taxon and character completeness. Exon capture targeting 490 of the 500 genes (those with at least one exon >120 bp) from 22 species of Australian Camaenidae successfully captured sequences of 2825 exons (representing all targeted genes), with only a 3.7% reduction in the data matrix due to the presence of putative paralogs or pseudogenes. The automated pipeline Agalma retrieved the majority of the manually qualified 500 single-copy gene set and identified a further 375 putative single-copy genes, although it failed to account for fragmented transcripts resulting in lower data matrix completeness when considering the original 500 genes. This could potentially explain the minor inconsistencies we observed in the supported topologies for the 21 eupulmonate species between the manually curated and 'Agalma-equivalent' data set (sharing 458 genes). Overall, our study confirms the utility of the 500 gene set to resolve phylogenetic relationships at a range of evolutionary depths and highlights the importance of addressing fragmentation at the homolog alignment stage for probe design. © 2016 John Wiley & Sons Ltd.
Copy Number Variation Is a Fundamental Aspect of the Placental Genome
Hannibal, Roberta L.; Chuong, Edward B.; Rivera-Mulia, Juan Carlos; Gilbert, David M.; Valouev, Anton; Baker, Julie C.
2014-01-01
Discovery of lineage-specific somatic copy number variation (CNV) in mammals has led to debate over whether CNVs are mutations that propagate disease or whether they are a normal, and even essential, aspect of cell biology. We show that 1,000N polyploid trophoblast giant cells (TGCs) of the mouse placenta contain 47 regions, totaling 138 Megabases, where genomic copies are underrepresented (UR). UR domains originate from a subset of late-replicating heterochromatic regions containing gene deserts and genes involved in cell adhesion and neurogenesis. While lineage-specific CNVs have been identified in mammalian cells, classically in the immune system where V(D)J recombination occurs, we demonstrate that CNVs form during gestation in the placenta by an underreplication mechanism, not by recombination nor deletion. Our results reveal that large scale CNVs are a normal feature of the mammalian placental genome, which are regulated systematically during embryogenesis and are propagated by a mechanism of underreplication. PMID:24785991
Copy number variation is a fundamental aspect of the placental genome.
Hannibal, Roberta L; Chuong, Edward B; Rivera-Mulia, Juan Carlos; Gilbert, David M; Valouev, Anton; Baker, Julie C
2014-05-01
Discovery of lineage-specific somatic copy number variation (CNV) in mammals has led to debate over whether CNVs are mutations that propagate disease or whether they are a normal, and even essential, aspect of cell biology. We show that 1,000 N polyploid trophoblast giant cells (TGCs) of the mouse placenta contain 47 regions, totaling 138 Megabases, where genomic copies are underrepresented (UR). UR domains originate from a subset of late-replicating heterochromatic regions containing gene deserts and genes involved in cell adhesion and neurogenesis. While lineage-specific CNVs have been identified in mammalian cells, classically in the immune system where V(D)J recombination occurs, we demonstrate that CNVs form during gestation in the placenta by an underreplication mechanism, not by recombination nor deletion. Our results reveal that large scale CNVs are a normal feature of the mammalian placental genome, which are regulated systematically during embryogenesis and are propagated by a mechanism of underreplication.
Krsticevic, Flavia J.; Schrago, Carlos G.; Carvalho, A. Bernardo
2015-01-01
The autosomal gene Mst77F of Drosophila melanogaster is essential for male fertility. In 2010, Krsticevic et al. (Genetics 184: 295−307) found 18 Y-linked copies of Mst77F (“Mst77Y”), which collectively account for 20% of the functional Mst77F-like mRNA. The Mst77Y genes were severely misassembled in the then-available genome assembly and were identified by cloning and sequencing polymerase chain reaction products. The genomic structure of the Mst77Y region and the possible existence of additional copies remained unknown. The recent publication of two long-read assemblies of D. melanogaster prompted us to reinvestigate this challenging region of the Y chromosome. We found that the Illumina Synthetic Long Reads assembly failed in the Mst77Y region, most likely because of its tandem duplication structure. The PacBio MHAP assembly of the Mst77Y region seems to be very accurate, as revealed by comparisons with the previously found Mst77Y genes, a bacterial artificial chromosome sequence, and Illumina reads of the same strain. We found that the Mst77Y region spans 96 kb and originated from a 3.4-kb transposition from chromosome 3L to the Y chromosome, followed by tandem duplications inside the Y chromosome and invasion of transposable elements, which account for 48% of its length. Twelve of the 18 Mst77Y genes found in 2010 were confirmed in the PacBio assembly, the remaining six being polymerase chain reaction−induced artifacts. There are several identical copies of some Mst77Y genes, coincidentally bringing the total copy number to 18. Besides providing a detailed picture of the Mst77Y region, our results highlight the utility of PacBio technology in assembling difficult genomic regions such as tandemly repeated genes. PMID:25858959
Dietz-Pfeilstetter, Antje; Arndt, Nicola; Manske, Ulrike
2016-04-01
Transgenes in genetically modified plants are often not reliably expressed during development or in subsequent generations. Transcriptional gene silencing (TGS) as well as post-transcriptional gene silencing (PTGS) have been shown to occur in transgenic plants depending on integration pattern, copy number and integration site. In an effort to reduce position effects, to prevent read-through transcription and to provide a more accessible chromatin structure, a P35S-ß-glucuronidase (P35S-gus) transgene flanked by a scaffold/matrix attachment region from petunia (Petun-SAR), was introduced in Nicotiana tabacum plants by Agrobacterium tumefaciens mediated transformation. It was found that Petun-SAR mediates enhanced expression and copy number dependency up to 2 gene copies, but did not prevent gene silencing in transformants with multiple and rearranged gene copies. However, in contrast to the non-SAR transformants where silencing was irreversible and proceeded during long-term vegetative propagation and in progeny plants, gus expression in Petun-SAR plants was re-established in the course of development. Gene silencing was not necessarily accompanied by DNA methylation, while the gus transgene could still be expressed despite considerable CG methylation within the coding region.
Isaac, Peter; Laurie, David A.
2012-01-01
The timing of flowering during the year is an important adaptive character affecting reproductive success in plants and is critical to crop yield. Flowering time has been extensively manipulated in crops such as wheat (Triticum aestivum L.) during domestication, and this enables them to grow productively in a wide range of environments. Several major genes controlling flowering time have been identified in wheat with mutant alleles having sequence changes such as insertions, deletions or point mutations. We investigated genetic variants in commercial varieties of wheat that regulate flowering by altering photoperiod response (Ppd-B1 alleles) or vernalization requirement (Vrn-A1 alleles) and for which no candidate mutation was found within the gene sequence. Genetic and genomic approaches showed that in both cases alleles conferring altered flowering time had an increased copy number of the gene and altered gene expression. Alleles with an increased copy number of Ppd-B1 confer an early flowering day neutral phenotype and have arisen independently at least twice. Plants with an increased copy number of Vrn-A1 have an increased requirement for vernalization so that longer periods of cold are required to potentiate flowering. The results suggest that copy number variation (CNV) plays a significant role in wheat adaptation. PMID:22457747
The relationship between mitochondrial DNA copy number and stallion sperm function.
Darr, Christa R; Moraes, Luis E; Connon, Richard E; Love, Charles C; Teague, Sheila; Varner, Dickson D; Meyers, Stuart A
2017-05-01
Mitochondrial DNA (mtDNA) copy number has been utilized as a measure of sperm quality in several species including mice, dogs, and humans, and has been suggested as a potential biomarker of fertility in stallion sperm. The results of the present study extend this recent discovery using sperm samples from American Quarter Horse stallions of varying age. By determining copy number of three mitochondrial genes, cytochrome b (CYTB), NADH dehydrogenase 1 (ND1) and NADH dehydrogenase 4 (ND4), instead of a single gene, we demonstrate an improved understanding of mtDNA fate in stallion sperm mitochondria following spermatogenesis. Sperm samples from 37 stallions ranging from 3 to 24 years old were collected at four breeding ranches in north and central Texas during the 2015 breeding season. Samples were analyzed for sperm motion characteristics, nuclear DNA denaturability and mtDNA copy number. Mitochondrial DNA content in individual sperm was determined by real-time qPCR and normalized with a single copy nuclear gene, Beta actin. Exploratory correlation analysis revealed that total motility was negatively correlated with CYTB copy number and sperm chromatin structure. Stallion age did not have a significant effect on copy number for any of the genes. Copy number differences existed between the three genes with CYTB having the greatest number of copies (20.6 ± 1.2 copies, range: 6.0 to 41.1) followed by ND4 (15.5 ± 0.8 copies, range: 6.7 to 27.8) and finally ND1 (12.0 ± 1.0 copies, range: 0.4 to 26.6) (P < 0.05). Varying copy number across mitochondrial genes is likely to be a result of mtDNA fragmentation and degradation since downregulation of sperm mtDNA occurs during spermatogenesis and may be important for normal sperm function. Beta regression analysis suggested that for every unit increase in mtDNA copy number of CYTB, there was a 4% decrease in the odds of sperm movement (P = 0.001). Influential analysis suggested that results are robust and not highly
Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M
2014-06-01
It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to
Lineage-specific expansion of IFIT gene family: an insight into coevolution with IFN gene family.
Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang
2013-01-01
In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system.
DLH1 is a functional Candida albicans homologue of the meiosis-specific gene DMC1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Diener, A.C.; Fink, G.R.
1996-06-01
DMC1/LIM15 homologue 1 (DLH1), a gene related to meiosis-specific genes, has been isolated from Candida albicans, a fungus thought not to undergo meiosis. The deduced protein sequence of DLH1 contains 74% amino acid identity with Dmc1p from Saccharomyces cerevisiae and 63% with Lim15p from the plant Lilium longiflorum, meiosis-specific homologous of Escherichia coli RecA. Candida DLH1 complements a dmc1/dmc1 null mutant in S. cerevisiae. High copy expression of DLH1 restores both sporulation and meiotic recombination to a Saccharomyces dmc1/{Delta}/dmc1{Delta} strain. Unlike the DMC1 gene, which is transcribed only in meiotic cells, the heterologous Candida DLH1 gene is transcribed in bothmore » vegetative and meiotic cells of S. cerevisiae. Transcription of DLH1 is not detected or induced in C. albicans under conditions that induce DMC1 and meiosis in S. cerevisiae. The presence of an intact homologue of a meiosis-specific gene in C. albicans raises the possibility that this organism has a cryptic meiotic pathway. 25 refs., 6 figs., 3 tabs.« less
Normal exon copy number of the GLI2 and GLI3 genes in patients with esophageal atresia.
Bednarczyk, D; Smigiel, R; Patkowski, D; Laczmanska, I; Lebioda, A; Laczmanski, L; Sasiadek, M M
2013-01-01
Esophageal atresia (EA) is a congenital developmental defect of the alimentary tract concerning the interruption of the esophagus with or without connection to the trachea. The incidence of EA is 1 in 3000-3500 of live-born infants, and occurs in both isolated and syndromic (in combination with abnormalities in other organ systems) forms. The molecular mechanisms underlying the development of EA are poorly understood. Knockout studies in mice indicate that genes like Sonic hedgehog, Gli2, and Gli3 play a role in the etiology of EA. These facts led us to hypothesize that Sonic hedgehog-GLI gene rearrangements are associated with EA in humans. To test this hypothesis, we screened patients with isolated and syndromic EA for GLI2 and/or GLI3 microrearrangements using methods to estimate the copy number (Multiplex Ligation-dependent Probe Amplification, real-time polymerase chain reaction). To our best knowledge this is the first study assessing copy number of GLI2 and GLI3 genes in patients with EA. © 2013 Wiley Periodicals, Inc. and the International Society for Diseases of the Esophagus.
Javierre, Biola M; Burren, Oliver S; Wilder, Steven P; Kreuzhuber, Roman; Hill, Steven M; Sewitz, Sven; Cairns, Jonathan; Wingett, Steven W; Várnai, Csilla; Thiecke, Michiel J; Burden, Frances; Farrow, Samantha; Cutler, Antony J; Rehnström, Karola; Downes, Kate; Grassi, Luigi; Kostadima, Myrto; Freire-Pritchett, Paula; Wang, Fan; Stunnenberg, Hendrik G; Todd, John A; Zerbino, Daniel R; Stegle, Oliver; Ouwehand, Willem H; Frontini, Mattia; Wallace, Chris; Spivakov, Mikhail; Fraser, Peter
2016-11-17
Long-range interactions between regulatory elements and gene promoters play key roles in transcriptional regulation. The vast majority of interactions are uncharted, constituting a major missing link in understanding genome control. Here, we use promoter capture Hi-C to identify interacting regions of 31,253 promoters in 17 human primary hematopoietic cell types. We show that promoter interactions are highly cell type specific and enriched for links between active promoters and epigenetically marked enhancers. Promoter interactomes reflect lineage relationships of the hematopoietic tree, consistent with dynamic remodeling of nuclear architecture during differentiation. Interacting regions are enriched in genetic variants linked with altered expression of genes they contact, highlighting their functional role. We exploit this rich resource to connect non-coding disease variants to putative target promoters, prioritizing thousands of disease-candidate genes and implicating disease pathways. Our results demonstrate the power of primary cell promoter interactomes to reveal insights into genomic regulatory mechanisms underlying common diseases. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Emergence of a Homo sapiens-specific gene family and chromosome 16p11.2 CNV susceptibility.
Nuttle, Xander; Giannuzzi, Giuliana; Duyzend, Michael H; Schraiber, Joshua G; Narvaiza, Iñigo; Sudmant, Peter H; Penn, Osnat; Chiatante, Giorgia; Malig, Maika; Huddleston, John; Benner, Chris; Camponeschi, Francesca; Ciofi-Baffoni, Simone; Stessman, Holly A F; Marchetto, Maria C N; Denman, Laura; Harshman, Lana; Baker, Carl; Raja, Archana; Penewit, Kelsi; Janke, Nicolette; Tang, W Joyce; Ventura, Mario; Banci, Lucia; Antonacci, Francesca; Akey, Joshua M; Amemiya, Chris T; Gage, Fred H; Reymond, Alexandre; Eichler, Evan E
2016-08-11
Genetic differences that specify unique aspects of human evolution have typically been identified by comparative analyses between the genomes of humans and closely related primates, including more recently the genomes of archaic hominins. Not all regions of the genome, however, are equally amenable to such study. Recurrent copy number variation (CNV) at chromosome 16p11.2 accounts for approximately 1% of cases of autism and is mediated by a complex set of segmental duplications, many of which arose recently during human evolution. Here we reconstruct the evolutionary history of the locus and identify bolA family member 2 (BOLA2) as a gene duplicated exclusively in Homo sapiens. We estimate that a 95-kilobase-pair segment containing BOLA2 duplicated across the critical region approximately 282 thousand years ago (ka), one of the latest among a series of genomic changes that dramatically restructured the locus during hominid evolution. All humans examined carried one or more copies of the duplication, which nearly fixed early in the human lineage--a pattern unlikely to have arisen so rapidly in the absence of selection (P < 0.0097). We show that the duplication of BOLA2 led to a novel, human-specific in-frame fusion transcript and that BOLA2 copy number correlates with both RNA expression (r = 0.36) and protein level (r = 0.65), with the greatest expression difference between human and chimpanzee in experimentally derived stem cells. Analyses of 152 patients carrying a chromosome 16p11. rearrangement show that more than 96% of breakpoints occur within the H. sapiens-specific duplication. In summary, the duplicative transposition of BOLA2 at the root of the H. sapiens lineage about 282 ka simultaneously increased copy number of a gene associated with iron homeostasis and predisposed our species to recurrent rearrangements associated with disease.
Kid cleaves specific mRNAs at UUACU sites to rescue the copy number of plasmid R1
Pimentel, Belén; Madine, Mark A; de la Cueva-Méndez, Guillermo
2005-01-01
Stability and copy number of extra-chromosomal elements are tightly regulated in prokaryotes and eukaryotes. Toxin Kid and antitoxin Kis are the components of the parD stability system of prokaryotic plasmid R1 and they can also function in eukaryotes. In bacteria, Kid was thought to become active only in cells that lose plasmid R1 and to cleave exclusively host mRNAs at UA(A/C/U) trinucleotide sites to eliminate plasmid-free cells. Instead, we demonstrate here that Kid becomes active in plasmid-containing cells when plasmid copy number decreases, cleaving not only host- but also a specific plasmid-encoded mRNA at the longer and more specific target sequence UUACU. This specific cleavage by Kid inhibits bacterial growth and, at the same time, helps to restore the plasmid copy number. Kid targets a plasmid RNA that encodes a repressor of the synthesis of an R1 replication protein, resulting in increased plasmid DNA replication. This mechanism resembles that employed by some human herpesviruses to regulate viral amplification during infection. PMID:16163387
The CRISPR-Cas9 system has revolutionized gene editing both at single genes and in multiplexed loss-of-function screens, thus enabling precise genome-scale identification of genes essential for proliferation and survival of cancer cells. However, previous studies have reported that a gene-independent antiproliferative effect of Cas9-mediated DNA cleavage confounds such measurement of genetic dependency, thereby leading to false-positive results in copy number-amplified regions.
Rukh, Gull; Ericson, Ulrika; Andersson-Assarsson, Johanna; Orho-Melander, Marju; Sonestedt, Emily
2017-07-01
Background: Studies have shown conflicting associations between the salivary amylase gene ( AMY1 ) copy number and obesity. Salivary amylase initiates starch digestion in the oral cavity; starch is a major source of energy in the diet. Objective: We investigated the association between AMY1 copy number and obesity traits, and the effect of the interaction between AMY1 copy number and starch intake on these obesity traits. Design: We first assessed the association between AMY1 copy number (genotyped by digital droplet polymerase chain reaction) and obesity traits in 4800 individuals without diabetes (mean age: 57 y; 60% female) from the Malmö Diet and Cancer Cohort. Then we analyzed interactions between AMY1 copy number and energy-adjusted starch intake (obtained by a modified diet history method) on body mass index (BMI) and body fat percentage. Results: AMY1 copy number was not associated with BMI ( P = 0.80) or body fat percentage ( P = 0.38). We observed a significant effect of the interaction between AMY1 copy number and starch intake on BMI ( P -interaction = 0.007) and body fat percentage ( P -interaction = 0.03). Upon stratification by dietary starch intake, BMI tended to decrease with increasing AMY1 copy numbers in the low-starch intake group ( P = 0.07) and tended to increase with increasing AMY1 copy numbers in the high-starch intake group ( P = 0.08). The lowest mean BMI was observed in the group of participants with a low AMY1 copy number and a high dietary intake of starch. Conclusions: Our findings suggest an effect of the interaction between starch intake and AMY1 copy number on obesity. Individuals with high starch intake but low genetic capacity to digest starch had the lowest BMI, potentially because larger amounts of undigested starch are transported through the gastrointestinal tract, contributing to fewer calories extracted from ingested starch. © 2017 American Society for Nutrition.
Impact of constitutional copy number variants on biological pathway evolution.
Poptsova, Maria; Banerjee, Samprit; Gokcumen, Omer; Rubin, Mark A; Demichelis, Francesca
2013-01-23
Inherited Copy Number Variants (CNVs) can modulate the expression levels of individual genes. However, little is known about how CNVs alter biological pathways and how this varies across different populations. To trace potential evolutionary changes of well-described biological pathways, we jointly queried the genomes and the transcriptomes of a collection of individuals with Caucasian, Asian or Yoruban descent combining high-resolution array and sequencing data. We implemented an enrichment analysis of pathways accounting for CNVs and genes sizes and detected significant enrichment not only in signal transduction and extracellular biological processes, but also in metabolism pathways. Upon the estimation of CNV population differentiation (CNVs with different polymorphism frequencies across populations), we evaluated that 22% of the pathways contain at least one gene that is proximal to a CNV (CNV-gene pair) that shows significant population differentiation. The majority of these CNV-gene pairs belong to signal transduction pathways and 6% of the CNV-gene pairs show statistical association between the copy number states and the transcript levels. The analysis suggested possible examples of positive selection within individual populations including NF-kB, MAPK signaling pathways, and Alu/L1 retrotransposition factors. Altogether, our results suggest that constitutional CNVs may modulate subtle pathway changes through specific pathway enzymes, which may become fixed in some populations.
Chau, John H; Rahfeldt, Wolfgang A; Olmstead, Richard G
2018-03-01
Targeted sequence capture can be used to efficiently gather sequence data for large numbers of loci, such as single-copy nuclear loci. Most published studies in plants have used taxon-specific locus sets developed individually for a clade using multiple genomic and transcriptomic resources. General locus sets can also be developed from loci that have been identified as single-copy and have orthologs in large clades of plants. We identify and compare a taxon-specific locus set and three general locus sets (conserved ortholog set [COSII], shared single-copy nuclear [APVO SSC] genes, and pentatricopeptide repeat [PPR] genes) for targeted sequence capture in Buddleja (Scrophulariaceae) and outgroups. We evaluate their performance in terms of assembly success, sequence variability, and resolution and support of inferred phylogenetic trees. The taxon-specific locus set had the most target loci. Assembly success was high for all locus sets in Buddleja samples. For outgroups, general locus sets had greater assembly success. Taxon-specific and PPR loci had the highest average variability. The taxon-specific data set produced the best-supported tree, but all data sets showed improved resolution over previous non-sequence capture data sets. General locus sets can be a useful source of sequence capture targets, especially if multiple genomic resources are not available for a taxon.
Gene delivery to the lungs: pulmonary gene therapy for cystic fibrosis.
Villate-Beitia, Ilia; Zarate, Jon; Puras, Gustavo; Pedraz, José Luis
2017-07-01
Cystic fibrosis (CF) is a monogenic autosomal recessive disorder where the defective gene, the cystic fibrosis transmembrane conductance regulator (CFTR), is well identified. Moreover, the respiratory tract can be targeted through noninvasive aerosolized formulations for inhalation. Therefore, gene therapy is considered a plausible strategy to address this disease. Conventional gene therapy strategies rely on the addition of a correct copy of the CFTR gene into affected cells in order to restore the channel activity. In recent years, genome correction strategies have emerged, such as zinc-finger nucleases, transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats associated to Cas9 nucleases. These gene editing tools aim to repair the mutated gene at its original genomic locus with high specificity. Besides, the success of gene therapy critically depends on the nucleic acids carriers. To date, several clinical studies have been carried out to add corrected copies of the CFTR gene into target cells using viral and non-viral vectors, some of them with encouraging results. Regarding genome editing systems, preliminary in vitro studies have been performed in order to repair the CFTR gene. In this review, after briefly introducing the basis of CF, we discuss the up-to-date gene therapy strategies to address the disease. The review focuses on the main factors to take into consideration when developing gene delivery strategies, such as the design of vectors and plasmid DNA, in vitro/in vivo tests, translation to human use, administration methods, manufacturing conditions and regulatory issues.
Gene-specific cell labeling using MiMIC transposons
Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.
2015-01-01
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101
Papain-like cysteine proteases in Carica papaya: lineage-specific gene duplication and expansion.
Liu, Juan; Sharma, Anupma; Niewiara, Marie Jamille; Singh, Ratnesh; Ming, Ray; Yu, Qingyi
2018-01-06
Papain-like cysteine proteases (PLCPs), a large group of cysteine proteases structurally related to papain, play important roles in plant development, senescence, and defense responses. Papain, the first cysteine protease whose structure was determined by X-ray crystallography, plays a crucial role in protecting papaya from herbivorous insects. Except the four major PLCPs purified and characterized in papaya latex, the rest of the PLCPs in papaya genome are largely unknown. We identified 33 PLCP genes in papaya genome. Phylogenetic analysis clearly separated plant PLCP genes into nine subfamilies. PLCP genes are not equally distributed among the nine subfamilies and the number of PLCPs in each subfamily does not increase or decrease proportionally among the seven selected plant species. Papaya showed clear lineage-specific gene expansion in the subfamily III. Interestingly, all four major PLCPs purified from papaya latex, including papain, chymopapain, glycyl endopeptidase and caricain, were grouped into the lineage-specific expansion branch in the subfamily III. Mapping PLCP genes on chromosomes of five plant species revealed that lineage-specific expansions of PLCP genes were mostly derived from tandem duplications. We estimated divergence time of papaya PLCP genes of subfamily III. The major duplication events leading to lineage-specific expansion of papaya PLCP genes in subfamily III were estimated at 48 MYA, 34 MYA, and 16 MYA. The gene expression patterns of the papaya PLCP genes in different tissues were assessed by transcriptome sequencing and qRT-PCR. Most of the papaya PLCP genes of subfamily III expressed at high levels in leaf and green fruit tissues. Tandem duplications played the dominant role in affecting copy number of PLCPs in plants. Significant variations in size of the PLCP subfamilies among species may reflect genetic adaptation of plant species to different environments. The lineage-specific expansion of papaya PLCPs of subfamily III might
Universal and specific quantitative detection of botulinum neurotoxin genes
2010-01-01
Background Clostridium botulinum, an obligate anaerobic spore-forming bacterium, produces seven antigenic variants of botulinum toxin that are distinguished serologically and termed "serotypes". Botulinum toxin blocks the release of acetylcholine at neuromuscular junctions resulting in flaccid paralysis. The potential lethality of the disease warrants a fast and accurate means of diagnosing suspected instances of food contamination or human intoxication. Currently, the Food and Drug Administration (FDA)-accepted assay to detect and type botulinum neurotoxins (BoNTs) is the mouse protection bioassay. While specific and sensitive, this assay requires the use of laboratory animals, may take up to four days to achieve a diagnosis, and is unsuitable for high-throughput analysis. We report here a two-step PCR assay that identifies all toxin types, that achieves the specificity of the mouse bioassay while surpassing it in equivalent sensitivity, that has capability for high-throughput analysis, and that provides quantitative results within hours. The first step of our assay consists of a conventional PCR that detects the presence of C. botulinum regardless of the neurotoxin type. The second step uses quantitative PCR (qPCR) technology to determine the specific serotype of the neurotoxin. Results We assayed purified C. botulinum DNA and crude toxin preparations, as well as food and stool from healthy individuals spiked with purified BoNT DNA, and one stool sample from a case of infant botulism for the presence of the NTNH gene, which is part of the BoNT gene cluster, and for the presence of serotype-specific BoNT genes. The PCR surpassed the mouse bioassay both in specificity and sensitivity, detecting positive signals in BoNT preparations containing well below the 1 LD50 required for detection via the mouse bioassay. These results were type-specific and we were reliably able to quantify as few as 10 genomic copies. Conclusions While other studies have reported
La-Touche, Susannah; Lemetre, Christophe; Lambros, Maryou; Stankiewicz, Elzbieta; Ng, Charlotte K Y; Weigelt, Britta; Rajab, Ramzi; Tinwell, Brendan; Corbishley, Cathy; Watkin, Nick; Berney, Dan; Reis-Filho, Jorge S
2016-01-01
Penile squamous cell carcinoma is a rare disease, in which somatic genetic aberrations have yet to be characterized. We hypothesized that gene copy aberrations might correlate with human papillomavirus status and clinico-pathological features. We sought to determine the spectrum of gene copy number aberrations in a large series of PSCCs and to define their correlations with human papillomavirus, histopathological subtype, and tumor grade, stage and lymph node status. Seventy formalin-fixed, paraffin embedded penile squamous cell carcinomas were centrally reviewed by expert uropathologists. DNA was extracted from micro-dissected samples, subjected to PCR-based human papillomavirus assessment and genotyping (INNO-LiPA human papillomavirus Genotyping Extra Assay) and microarray-based comparative genomic hybridization using a 32K Bacterial Artificial Chromosome array platform. Sixty-four samples yielded interpretable results. Recurrent gains were observed in chromosomes 1p13.3-q44 (88%), 3p12.3-q29 (86%), 5p15.33-p11 (67%) and 8p12-q24.3 (84%). Amplifications of 5p15.33-p11 and 11p14.1-p12 were found in seven (11%) and four (6%) cases, respectively. Losses were observed in chromosomes 2q33-q37.3 (86%), 3p26.3-q11.1 (83%) and 11q12.2-q25 (81%). Although many losses and gains were similar throughout the cohort, there were small significant differences observed at specific loci, between human papillomavirus positive and negative tumors, between tumor types, and tumor grade and nodal status. These results demonstrate that despite the diversity of genetic aberrations in penile squamous cell carcinomas, there are significant correlations between the clinico-pathological data and the genetic changes that may play a role in disease natural history and progression and highlight potential driver genes, which may feature in molecular pathways for existing therapeutic agents.
Lambros, Maryou; Stankiewicz, Elzbieta; Ng, Charlotte K. Y.; Weigelt, Britta; Rajab, Ramzi; Tinwell, Brendan; Corbishley, Cathy; Watkin, Nick; Berney, Dan; Reis-Filho, Jorge S.
2016-01-01
Penile squamous cell carcinoma is a rare disease, in which somatic genetic aberrations have yet to be characterized. We hypothesized that gene copy aberrations might correlate with human papillomavirus status and clinico-pathological features. We sought to determine the spectrum of gene copy number aberrations in a large series of PSCCs and to define their correlations with human papillomavirus, histopathological subtype, and tumor grade, stage and lymph node status. Seventy formalin-fixed, paraffin embedded penile squamous cell carcinomas were centrally reviewed by expert uropathologists. DNA was extracted from micro-dissected samples, subjected to PCR-based human papillomavirus assessment and genotyping (INNO-LiPA human papillomavirus Genotyping Extra Assay) and microarray-based comparative genomic hybridization using a 32K Bacterial Artificial Chromosome array platform. Sixty-four samples yielded interpretable results. Recurrent gains were observed in chromosomes 1p13.3-q44 (88%), 3p12.3-q29 (86%), 5p15.33-p11 (67%) and 8p12-q24.3 (84%). Amplifications of 5p15.33-p11 and 11p14.1-p12 were found in seven (11%) and four (6%) cases, respectively. Losses were observed in chromosomes 2q33-q37.3 (86%), 3p26.3-q11.1 (83%) and 11q12.2-q25 (81%). Although many losses and gains were similar throughout the cohort, there were small significant differences observed at specific loci, between human papillomavirus positive and negative tumors, between tumor types, and tumor grade and nodal status. These results demonstrate that despite the diversity of genetic aberrations in penile squamous cell carcinomas, there are significant correlations between the clinico-pathological data and the genetic changes that may play a role in disease natural history and progression and highlight potential driver genes, which may feature in molecular pathways for existing therapeutic agents. PMID:26901676
DOE Office of Scientific and Technical Information (OSTI.GOV)
Devor, E.J.; Dill-Devor, R.M.
1994-09-01
We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCRmore » assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.« less
Genomic DNA Copy-Number Alterations of the let-7 Family in Human Cancers
Greshock, Joel; Shen, Liang; Yang, Xiaojun; Shao, Zhongjun; Liang, Shun; Tanyi, Janos L.; Sood, Anil K.; Zhang, Lin
2012-01-01
In human cancer, expression of the let-7 family is significantly reduced, and this is associated with shorter survival times in patients. However, the mechanisms leading to let-7 downregulation in cancer are still largely unclear. Since an alteration in copy-number is one of the causes of gene deregulation in cancer, we examined copy number alterations of the let-7 family in 2,969 cancer specimens from a high-resolution SNP array dataset. We found that there was a reduction in the copy number of let-7 genes in a cancer-type specific manner. Importantly, focal deletion of four let-7 family members was found in three cancer types: medulloblastoma (let-7a-2 and let-7e), breast cancer (let-7a-2), and ovarian cancer (let-7a-3/let-7b). For example, the genomic locus harboring let-7a-3/let-7b was deleted in 44% of the specimens from ovarian cancer patients. We also found a positive correlation between the copy number of let-7b and mature let-7b expression in ovarian cancer. Finally, we showed that restoration of let-7b expression dramatically reduced ovarian tumor growth in vitro and in vivo. Our results indicate that copy number deletion is an important mechanism leading to the downregulation of expression of specific let-7 family members in medulloblastoma, breast, and ovarian cancers. Restoration of let-7 expression in tumor cells could provide a novel therapeutic strategy for the treatment of cancer. PMID:22970210
Minson, A C; Darby, G K; Wildy, P
1979-11-01
Two independently derived cell lines which carry the herpes simplex type 2 thymidine kinase gene have been examined for the presence of HSV-2-specific DNA sequences. Both cell lines contained 1 to 3 copies per cell of a sequence lying within map co-ordinates 0.2 to 0.4 of the HSV-2 genome. Revertant cells, which contained no detectable thymidine kinase, did not contain this DNA sequence. The failure of EcoR1-restricted HSV-2 DNA to act as a donor of the thymidine kinase gene in transformation experiments suggests that the gene lies close to the EcoR1 restriction site within this sequence at a map position of approx. 0.3. The HSV-2 kinase gene is therefore approximately co-linear with the HSV-1 gene.
Nephron segment-specific gene expression using AAV vectors.
Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R
2018-02-26
AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Stambuk, Boris U; Dunn, Barbara; Alves, Sergio L; Duval, Eduarda H; Sherlock, Gavin
2009-12-01
Fuel ethanol is now a global energy commodity that is competitive with gasoline. Using microarray-based comparative genome hybridization (aCGH), we have determined gene copy number variations (CNVs) common to five industrially important fuel ethanol Saccharomyces cerevisiae strains responsible for the production of billions of gallons of fuel ethanol per year from sugarcane. These strains have significant amplifications of the telomeric SNO and SNZ genes, which are involved in the biosynthesis of vitamins B6 (pyridoxine) and B1 (thiamin). We show that increased copy number of these genes confers the ability to grow more efficiently under the repressing effects of thiamin, especially in medium lacking pyridoxine and with high sugar concentrations. These genetic changes have likely been adaptive and selected for in the industrial environment, and may be required for the efficient utilization of biomass-derived sugars from other renewable feedstocks.
Manzanilla, Vincent; Bruneau, Anne
2012-10-01
The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. Copyright © 2012 Elsevier Inc. All rights reserved.
2013-01-01
Background Amplification of MYCN oncogene is an established marker indicating aggressive tumor progression of neuroblastoma (NBL). But copy number analyses of MYCN gene in ganglioneuroblastoma (GNBL) and ganglioneuroma(GN) is poorly described in the literature. In the study, we evaluated the copy number aberrations of MYCN gene in clinical samples of NBLs, GNBLs and GNs and analyzed their association with clinical outcome of the patients. Methods In this study, we analyzed MYCN gene and chromosome 2 aneusomy by using fluorescence in situ hybridization (FISH) method in a total of 220 patients with NBL, GNBL and GN cases. Kaplan-Meier curves were generated by using SPSS 12.0 software. Results Of 220 patients, 178 (81.0%) were NBLs, 32 (14.5%) were GNBLs and 10 (4.5%) were GNs. MYCN gain is a recurrent genetic aberration of neuroblastic tumors (71.8%, 158/220), which was found in 129 NBLs (58.6%, 129/220), 25 GNBLs (11.4%, 25/220) and 4 GN cases (1.8%, 4/220). However, MYCN amplification was only present in 24 NBL tumors (13.5%, 24/178) and 1 GNBL case (3.1%, 1/32). Kaplan-Meier survival analysis indicated that MYCN amplification is significantly correlated with decreased overall survival in NBLs (P=0.017). Furthermore, a better prognosis trend was observed in patients with MYCN gain tumors compared with those with MYCN gene normal copy number tumors and MYCN amplification tumors (P=0.012). Conclusions In summary, the frequency of MYCN amplification in NBLs is high and is rarely observed in GNBLs and GNs, which suggest MYCN plays an important role in neuroblastic tumors differentiation. MYCN gain appeared to define a subgroup of NBLs with much better outcome and classification of MYCN gene copy number alteration as three groups (amplification, gain and normal) can provide a powerful prognostic indicator in NBLs. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/6417541528559124 PMID:23320395
Bartos, Jeremy D.; Gaile, Daniel P.; McQuaid, Devin E.; Conroy, Jeffrey M.; Darbary, Huferesh; Nowak, Norma J.; Block, Annemarie; Petrelli, Nicholas J.; Mittelman, Arnold; Stoler, Daniel L.; Anderson, Garth R.
2007-01-01
In order to identify small regions of the genome whose specific copy number alteration is associated with high genomic instability in the form of overall genome-wide copy number aberrations, we have analyzed array-based comparative genomic hybridization (aCGH) data from 33 sporadic colorectal carcinomas. Copy number changes of a small number of specific regions were significantly correlated with elevated overall amplifications and deletions scattered throughout the entire genome. One significant region at 9q34 includes the c-ABL gene Another region spanning 22q11–13 includes the breakpoint cluster region (BCR) of the Philadelphia chromosome Coordinate 22q11–13 alterations were observed in nine of eleven tumors with the 9q34 alteration Additional regions on 1q and 14q were associated with overall genome-wide copy number changes, while copy number aberrations on chromosome 7p, 7q, and 13q21.1–31.3 were found associated with this instability only in tumors from patients with a smoking history Our analysis demonstrates there are a small number of regions of the genome where gain or loss is commonly associated with a tumor’s overall level of copy number aberrations Our finding BCR and ABL located within two of the instability-associated regions, and the involvement of these two regions occurring coordinately, suggests a system akin to the BCR-ABL translocation of CML may be involved in genomic instability in about one-third of human colorectal carcinomas. PMID:17196995
Gene-specific cell labeling using MiMIC transposons.
Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A
2015-04-30
Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pereira, Jorge F; Araújo, Elza F; Brommonschenkel, Sérgio H; Queiroz, Casley B; Costa, Gustavo G L; Carazzolle, Marcelo F; Pereira, Gonçalo A G; Queiroz, Marisa V
2015-05-01
Transposons are an important source of genetic variation. The phytopathogen Moniliophthora perniciosa shows high level of variability but little is known about the role of class I elements in shaping its genome. In this work, we aimed the characterization of a new gypsy/Ty3 retrotransposon species, named MpSaci, in the M. perniciosa genome. These elements are largely variable in size, ranging from 4 to 15 kb, and harbor direct long terminal repeats (LTRs) with varying degrees of similarity. Approximately, all of the copies are non-autonomous as shifts in the reading frame and stop codons were detected. Only two elements (MpSaci6 and MpSaci9) code for GAG and POL proteins that possess functional domains. Conserved domains that are typically not found in retrotransposons were detected and could potentially impact the expression of neighbor genes. Solo LTRs and several LARDs (large retrotransposon derivative) were detected. Unusual elements containing small sequences with or without interruptions that are similar to gag or different pol domains and presenting LTRs with different levels of similarities were identified. Methylation was observed in MpSaci reverse transcriptase sequences. Distribution analysis indicates that MpSaci elements are present in high copy number in the genomes of C-, S- and L-biotypes of M. perniciosa. In addition, C-biotype isolates originating from the state of Bahia have fragments in common with isolates from the Amazon region and two hybridization profiles related to two chromosomal groups. RT-PCR analysis reveals that the gag gene is constitutively expressed and that the expression is increased at least three-fold with nutrient depravation even though no new insertion were observed. These findings point out that MpSaci collaborated and, even though is primarily represented by non-autonomous elements, still might contribute to the generation of genetic variability in the most important cacao pathogen in Brazil.
Integrated analysis of chromosome copy number variation and gene expression in cervical carcinoma
Yan, Deng; Yi, Song; Chiu, Wang Chi; Qin, Liu Gui; Kin, Wong Hoi; Kwok Hung, Chung Tony; Linxiao, Han; Wai, Choy Kwong; Yi, Sui; Tao, Yang; Tao, Tang
2017-01-01
Objective This study was conducted to explore chromosomal copy number variations (CNV) and transcript expression and to examine pathways in cervical pathogenesis using genome-wide high resolution microarrays. Methods Genome-wide chromosomal CNVs were investigated in 6 cervical cancer cell lines by Human Genome CGH Microarray Kit (4x44K). Gene expression profiles in cervical cancer cell lines, primary cervical carcinoma and normal cervical epithelium tissues were also studied using the Whole Human Genome Microarray Kit (4x44K). Results Fifty common chromosomal CNVs were identified in the cervical cancer cell lines. Correlation analysis revealed that gene up-regulation or down-regulation is significantly correlated with genomic amplification (P=0.009) or deletion (P=0.006) events. Expression profiles were identified through cluster analysis. Gene annotation analysis pinpointed cell cycle pathways was significantly (P=1.15E-08) affected in cervical cancer. Common CNVs were associated with cervical cancer. Conclusion Chromosomal CNVs may contribute to their transcript expression in cervical cancer. PMID:29312578
Integrated analysis of chromosome copy number variation and gene expression in cervical carcinoma.
Yan, Deng; Yi, Song; Chiu, Wang Chi; Qin, Liu Gui; Kin, Wong Hoi; Kwok Hung, Chung Tony; Linxiao, Han; Wai, Choy Kwong; Yi, Sui; Tao, Yang; Tao, Tang
2017-12-12
This study was conducted to explore chromosomal copy number variations (CNV) and transcript expression and to examine pathways in cervical pathogenesis using genome-wide high resolution microarrays. Genome-wide chromosomal CNVs were investigated in 6 cervical cancer cell lines by Human Genome CGH Microarray Kit (4x44K). Gene expression profiles in cervical cancer cell lines, primary cervical carcinoma and normal cervical epithelium tissues were also studied using the Whole Human Genome Microarray Kit (4x44K). Fifty common chromosomal CNVs were identified in the cervical cancer cell lines. Correlation analysis revealed that gene up-regulation or down-regulation is significantly correlated with genomic amplification ( P =0.009) or deletion ( P =0.006) events. Expression profiles were identified through cluster analysis. Gene annotation analysis pinpointed cell cycle pathways was significantly ( P =1.15E-08) affected in cervical cancer. Common CNVs were associated with cervical cancer. Chromosomal CNVs may contribute to their transcript expression in cervical cancer.
Identification of copy number variation-driven genes for liver cancer via bioinformatics analysis.
Lu, Xiaojie; Ye, Kun; Zou, Kailin; Chen, Jinlian
2014-11-01
To screen out copy number variation (CNV)-driven differentially expressed genes (DEGs) in liver cancer and advance our understanding of the pathogenesis, an integrated analysis of liver cancer-related CNV data from The Cancer Genome Atlas (TCGA) and gene expression data from EBI Array Express database were performed. The DEGs were identified by package limma based on the cut-off of |log2 (fold-change)|>0.585 and adjusted p-value<0.05. Using hg19 annotation information provided by UCSC, liver cancer-related CNVs were then screened out. TF-target gene interactions were also predicted with information from UCSC using DAVID online tools. As a result, 25 CNV-driven genes were obtained, including tripartite motif containing 28 (TRIM28) and RanBP-type and C3HC4-type zinc finger containing 1 (RBCK1). In the transcriptional regulatory network, 8 known cancer-related transcription factors (TFs) interacted with 21 CNV-driven genes, suggesting that the other 8 TFs may be involved in liver cancer. These genes may be potential biomarkers for early detection and prevention of liver cancer. These findings may improve our knowledge of the pathogenesis of liver cancer. Nevertheless, further experiments are still needed to confirm our findings.
Thiesen, H.-J.; Steinbeck, F.; Maruschke, M.; Koczan, D.; Ziems, B.; Hakenberg, O. W.
2017-01-01
Tumorigenic processes are understood to be driven by epi-/genetic and genomic alterations from single point mutations to chromosomal alterations such as insertions and deletions of nucleotides up to gains and losses of large chromosomal fragments including products of chromosomal rearrangements e.g. fusion genes and proteins. Overall comparisons of copy number alterations (CNAs) presented in 48 clear cell renal cell carcinoma (ccRCC) genomes resulted in ratios of gene losses versus gene gains between 26 ccRCC Fuhrman malignancy grades G1 (ratio 1.25) and 20 G3 (ratio 0.58). Gene losses and gains of 15762 CNA genes were mapped to 795 chromosomal cytoband loci including 280 KEGG pathways. CNAs were classified according to their contribution to Fuhrman tumour gradings G1 and G3. Gene gains and losses turned out to be highly structured processes in ccRCC genomes enabling the subclassification and stratification of ccRCC tumours in a genome-wide manner. CNAs of ccRCC seem to start with common tumour related gene losses flanked by CNAs specifying Fuhrman grade G1 losses and CNA gains favouring grade G3 tumours. The appearance of recurrent CNA signatures implies the presence of causal mechanisms most likely implicated in the pathogenesis and disease-outcome of ccRCC tumours distinguishing lower from higher malignant tumours. The diagnostic quality of initial 201 genes (108 genes supporting G1 and 93 genes G3 phenotypes) has been successfully validated on published Swiss data (GSE19949) leading to a restricted CNA gene set of 171 CNA genes of which 85 genes favour Fuhrman grade G1 and 86 genes Fuhrman grade G3. Regarding these gene sets overall survival decreased with the number of G3 related gene losses plus G3 related gene gains. CNA gene sets presented define an entry to a gene-directed and pathway-related functional understanding of ongoing copy number alterations within and between individual ccRCC tumours leading to CNA genes of prognostic and predictive value. PMID
Thiesen, H-J; Steinbeck, F; Maruschke, M; Koczan, D; Ziems, B; Hakenberg, O W
2017-01-01
Tumorigenic processes are understood to be driven by epi-/genetic and genomic alterations from single point mutations to chromosomal alterations such as insertions and deletions of nucleotides up to gains and losses of large chromosomal fragments including products of chromosomal rearrangements e.g. fusion genes and proteins. Overall comparisons of copy number alterations (CNAs) presented in 48 clear cell renal cell carcinoma (ccRCC) genomes resulted in ratios of gene losses versus gene gains between 26 ccRCC Fuhrman malignancy grades G1 (ratio 1.25) and 20 G3 (ratio 0.58). Gene losses and gains of 15762 CNA genes were mapped to 795 chromosomal cytoband loci including 280 KEGG pathways. CNAs were classified according to their contribution to Fuhrman tumour gradings G1 and G3. Gene gains and losses turned out to be highly structured processes in ccRCC genomes enabling the subclassification and stratification of ccRCC tumours in a genome-wide manner. CNAs of ccRCC seem to start with common tumour related gene losses flanked by CNAs specifying Fuhrman grade G1 losses and CNA gains favouring grade G3 tumours. The appearance of recurrent CNA signatures implies the presence of causal mechanisms most likely implicated in the pathogenesis and disease-outcome of ccRCC tumours distinguishing lower from higher malignant tumours. The diagnostic quality of initial 201 genes (108 genes supporting G1 and 93 genes G3 phenotypes) has been successfully validated on published Swiss data (GSE19949) leading to a restricted CNA gene set of 171 CNA genes of which 85 genes favour Fuhrman grade G1 and 86 genes Fuhrman grade G3. Regarding these gene sets overall survival decreased with the number of G3 related gene losses plus G3 related gene gains. CNA gene sets presented define an entry to a gene-directed and pathway-related functional understanding of ongoing copy number alterations within and between individual ccRCC tumours leading to CNA genes of prognostic and predictive value.
Mejía-Benítez, María A; Bonnefond, Amélie; Yengo, Loïc; Huyvaert, Marlène; Dechaume, Aurélie; Peralta-Romero, Jesús; Klünder-Klünder, Miguel; García Mena, Jaime; El-Sayed Moustafa, Julia S; Falchi, Mario; Cruz, Miguel; Froguel, Philippe
2015-02-01
Childhood obesity is a major public health problem in Mexico, affecting one in every three children. Genome-wide association studies identified genetic variants associated with childhood obesity, but a large missing heritability remains to be elucidated. We have recently shown a strong association between a highly polymorphic copy number variant encompassing the salivary amylase gene (AMY1 also known as AMY1A) and obesity in European and Asian adults. In the present study, we aimed to evaluate the association between AMY1 copy number and obesity in Mexican children. We evaluated the number of AMY1 copies in 597 Mexican children (293 obese children and 304 normal weight controls) through highly sensitive digital PCR. The effect of AMY1 copy number on obesity status was assessed using a logistic regression model adjusted for age and sex. We identified a marked effect of AMY1 copy number on reduced risk of obesity (OR per estimated copy 0.84, with the number of copies ranging from one to 16 in this population; p = 4.25 × 10(-6)). The global association between AMY1 copy number and reduced risk of obesity seemed to be mostly driven by the contribution of the highest AMY1 copy number. Strikingly, all children with >10 AMY1 copies were normal weight controls. Salivary amylase initiates the digestion of dietary starch, which is highly consumed in Mexico. Our current study suggests putative benefits of high number of AMY1 copies (and related production of salivary amylase) on energy metabolism in Mexican children.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamilton, A T; Huntley, S; Tran-Gyamfi, M
Although most genes are conserved as one-to-one orthologs in different mammalian orders, certain gene families have evolved to comprise different numbers and types of protein-coding genes through independent series of gene duplications, divergence and gene loss in each evolutionary lineage. One such family encodes KRAB-zinc finger (KRAB-ZNF) genes, which are likely to function as transcriptional repressors. One KRAB-ZNF subfamily, the ZNF91 clade, has expanded specifically in primates to comprise more than 110 loci in the human genome, yielding large gene clusters in human chromosomes 19 and 7 and smaller clusters or isolated copies at other chromosomal locations. Although phylogenetic analysismore » indicates that many of these genes arose before the split between old world monkeys and new world monkeys, the ZNF91 subfamily has continued to expand and diversify throughout the evolution of apes and humans. The paralogous loci are distinguished by sequence divergence within their zinc finger arrays indicating a selection for proteins with different DNA binding specificities. RT-PCR and in situ hybridization data show that some of these ZNF genes can have tissue-specific expression patterns, however many KRAB-ZNFs that are near-ubiquitous could also be playing very specific roles in halting target pathways in all tissues except for a few, where the target is released by the absence of its repressor. The number of variant KRAB-ZNF proteins is increased not only because of the large number of loci, but also because many loci can produce multiple splice variants, which because of the modular structure of these genes may have separate and perhaps even conflicting regulatory roles. The lineage-specific duplication and rapid divergence of this family of transcription factor genes suggests a role in determining species-specific biological differences and the evolution of novel primate traits.« less
Stambuk, Boris U.; Dunn, Barbara; Alves, Sergio L.; Duval, Eduarda H.; Sherlock, Gavin
2009-01-01
Fuel ethanol is now a global energy commodity that is competitive with gasoline. Using microarray-based comparative genome hybridization (aCGH), we have determined gene copy number variations (CNVs) common to five industrially important fuel ethanol Saccharomyces cerevisiae strains responsible for the production of billions of gallons of fuel ethanol per year from sugarcane. These strains have significant amplifications of the telomeric SNO and SNZ genes, which are involved in the biosynthesis of vitamins B6 (pyridoxine) and B1 (thiamin). We show that increased copy number of these genes confers the ability to grow more efficiently under the repressing effects of thiamin, especially in medium lacking pyridoxine and with high sugar concentrations. These genetic changes have likely been adaptive and selected for in the industrial environment, and may be required for the efficient utilization of biomass-derived sugars from other renewable feedstocks. PMID:19897511
Cree, Lynsey M; Hammond, Elizabeth R; Shelling, Andrew N; Berg, Martin C; Peek, John C; Green, Mark P
2015-06-01
Does maternal ageing and ovarian stimulation alter mitochondrial DNA (mtDNA) copy number and gene expression of oocytes and cumulus cells from a novel bovine model for human IVF? Oocytes collected from females with identical nuclear genetics show decreased mtDNA copy number and increased expression of an endoplasmic reticulum (ER) stress gene with repect to ovarian stimulation, whilst differences in the expression of genes involved in mitochondrial function, antioxidant protection and apoptosis were evident in relation to maternal ageing and the degree of ovarian stimulation in cumulus cells. Oocyte quality declines with advancing maternal age; however, the underlying mechanism, as well as the effects of ovarian stimulation are poorly understood. Human studies investigating these effects are often limited by differences in age and ovarian stimulation regimens within a patient cohort, as well as genetic and environmental variability. A novel bovine cross-sectional maternal age model for human IVF was undertaken. Follicles were aspirated from young (3 years of age; n = 7 females) and old (10 years of age; n = 5 females) Holstein Freisian clones following multiple unstimulated, mild and standard ovarian stimulation cycles. These bovine cloned females were generated by the process of somatic cell nuclear transfer (SCNT) from the same founder and represent a homogeneous population with reduced genetic and environmental variability. Maternal age and ovarian stimulation effects were investigated in relation to mtDNA copy number, and the expression of 19 genes involved in mitochondrial function, antioxidant protection, oocyte-cumulus cell signalling and follicle development in both oocytes and cumulus cells. Young (3 years of age; n = 7 females) and old (10 years of age; n = 5 females) Holstein Freisian bovine clones were maintained as one herd. Stimulation cycles were based on the long GnRH agonist down-regulation regimen used in human fertility clinics. Follicle growth
Impact of constitutional copy number variants on biological pathway evolution
2013-01-01
Background Inherited Copy Number Variants (CNVs) can modulate the expression levels of individual genes. However, little is known about how CNVs alter biological pathways and how this varies across different populations. To trace potential evolutionary changes of well-described biological pathways, we jointly queried the genomes and the transcriptomes of a collection of individuals with Caucasian, Asian or Yoruban descent combining high-resolution array and sequencing data. Results We implemented an enrichment analysis of pathways accounting for CNVs and genes sizes and detected significant enrichment not only in signal transduction and extracellular biological processes, but also in metabolism pathways. Upon the estimation of CNV population differentiation (CNVs with different polymorphism frequencies across populations), we evaluated that 22% of the pathways contain at least one gene that is proximal to a CNV (CNV-gene pair) that shows significant population differentiation. The majority of these CNV-gene pairs belong to signal transduction pathways and 6% of the CNV-gene pairs show statistical association between the copy number states and the transcript levels. Conclusions The analysis suggested possible examples of positive selection within individual populations including NF-kB, MAPK signaling pathways, and Alu/L1 retrotransposition factors. Altogether, our results suggest that constitutional CNVs may modulate subtle pathway changes through specific pathway enzymes, which may become fixed in some populations. PMID:23342974
Creating single-copy genetic circuits
Lee, Jeong Wook; Gyorgy, Andras; Cameron, D. Ewen; Pyenson, Nora; Choi, Kyeong Rok; Way, Jeffrey C.; Silver, Pamela A.; Del Vecchio, Domitilla; Collins, James J.
2017-01-01
SUMMARY Synthetic biology is increasingly used to develop sophisticated living devices for basic and applied research. Many of these genetic devices are engineered using multi-copy plasmids, but as the field progresses from proof-of-principle demonstrations to practical applications, it is important to develop single-copy synthetic modules that minimize consumption of cellular resources and can be stably maintained as genomic integrants. Here we use empirical design, mathematical modeling and iterative construction and testing to build single-copy, bistable toggle switches with improved performance and reduced metabolic load that can be stably integrated into the host genome. Deterministic and stochastic models led us to focus on basal transcription to optimize circuit performance and helped to explain the resulting circuit robustness across a large range of component expression levels. The design parameters developed here provide important guidance for future efforts to convert functional multi-copy gene circuits into optimized single-copy circuits for practical, real-world use. PMID:27425413
Low frequency of endospore-specific genes in subseafloor sedimentary metagenomes.
Kawai, Mikihiko; Uchiyama, Ikuo; Takami, Hideto; Inagaki, Fumio
2015-04-01
Spore formation is considered to be one of the microbial strategies for long-term survival in subseafloor sedimentary habitats. However, our knowledge of the genetic and physiological characteristics of subseafloor microbes is limited. Here, we studied the distribution and frequency of genes that are related to endospore formation in 10 subseafloor sedimentary metagenomes from Site C9001 off Japan and Site 1229 off Peru. None or very low frequencies of endospore-specific genes (e.g. dpaA, dpaB, sspA, spo0A, spoIIGA, spoIIM, spoIIIAB, spoIVA, spoIVB, yabP, yunB, spoVM) were observed in the subseafloor metagenomes. Based on the number of universally conserved single copy genes, the frequency ratio of putative endospore-formers was estimated to be < 10%, which is consistent with the frequency of Clostridia-derived genomes (2-4%) but is lower than previous estimates based on the concentration of dipicolinic acid. Conceivable explanations for this discrepancy are as follows: the efficiency of lysis and DNA extraction of subseafloor endospore cells may have been lower than those of vegetative cells, conversion factor of dipicolinic acid content per cell may differ, and/or sporulation-related genes and other functional strategies for long-term survival in the deep subseafloor biosphere are evolutionarily distinct from known spore-forming gene repertoires. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Conservative site-specific and single-copy transgenesis in human LINE-1 elements
Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter
2016-01-01
Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, termed attH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis through attH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional in LINE1-targeted hESCs and differentiated progenies. Furthermore, LINE-1 targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes. PMID:26673710
Deoxynucleoside salvage enzymes and tissue specific mitochondrial DNA depletion.
Wang, L
2010-06-01
Adequate mitochondrial DNA (mtDNA) copies are required for normal mitochondria function and reductions in mtDNA copy number due to genetic alterations cause tissue-specific mtDNA depletion syndrome (MDS). There are eight nuclear genes, directly or indirectly involved in mtDNA replication and mtDNA precursor synthesis, which have been identified as the cause of MDS. However, the tissue specific pathology of these nuclear gene mutations is not well understood. Here, mtDNA synthesis, mtDNA copy number control, and mtDNA turnover, as well as the synthesis of mtDNA precursors in relation to the levels of salvage enzymes are discussed. The question why MDS caused by TK2 and p53R2 mutations are predominantly muscle specific while dGK deficiency affected mainly liver will be addressed.
Edelmann, Lisa; Stankiewicz, Pavel; Spiteri, Elizabeth; Pandita, Raj K.; Shaffer, Lisa; Lupski, James; Morrow, Bernice E.
2001-01-01
The DGCR6 (DiGeorge critical region) gene encodes a putative protein with sequence similarity to gonadal (gdl), a Drosophila melanogaster gene of unknown function. We mapped the DGCR6 gene to chromosome 22q11 within a low copy repeat, termed sc11.1a, and identified a second copy of the gene, DGCR6L, within the duplicate locus, termed sc11.1b. Both sc11.1 repeats are deleted in most persons with velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), and they map immediately adjacent and internal to the low copy repeats, termed LCR22, that mediate the deletions associated with VCFS/DGS. We sequenced genomic clones from both loci and determined that the putative initiator methionine is located further upstream than originally described, but in a position similar to the mouse and chicken orthologs. DGCR6L encodes a highly homologous, functional copy of DGCR6, with some base changes rendering amino acid differences. Expression studies of the two genes indicate that both genes are widely expressed in fetal and adult tissues. Evolutionary studies using FISH mapping in several different species of ape combined with sequence analysis of DGCR6 in a number of different primate species indicate that the duplication is at least 12 million years old and may date back to before the divergence of Catarrhines from Platyrrhines, 35 mya. These data suggest that there has been selective evolutionary pressure toward the functional maintenance of both paralogs. Interestingly, a full-length HERV-K provirus integrated into the sc11.1a locus after the divergence of chimpanzees and humans. PMID:11157784
Phylomemetics—Evolutionary Analysis beyond the Gene
Howe, Christopher J.; Windram, Heather F.
2011-01-01
Genes are propagated by error-prone copying, and the resulting variation provides the basis for phylogenetic reconstruction of evolutionary relationships. Horizontal gene transfer may be superimposed on a tree-like evolutionary pattern, with some relationships better depicted as networks. The copying of manuscripts by scribes is very similar to the replication of genes, and phylogenetic inference programs can be used directly for reconstructing the copying history of different versions of a manuscript text. Phylogenetic methods have also been used for some time to analyse the evolution of languages and the development of physical cultural artefacts. These studies can help to answer a range of anthropological questions. We propose the adoption of the term “phylomemetics” for phylogenetic analysis of reproducing non-genetic elements. PMID:21655311
Loo, Lenora WM; Tiirikainen, Maarit; Cheng, Iona; Lum-Jones, Annette; Seifried, Ann; Church, James M; Gryfe, Robert; Weisenberger, Daniel J; Lindor, Noralane M; Gallinger, Steven; Haile, Robert W; Duggan, David J; Thibodeau, Stephen N; Casey, Graham; Le Marchand, Loïc
2014-01-01
Microsatellite stable (MSS), CpG island methylator phenotype (CIMP)-negative colorectal tumors, the most prevalent molecular subtype of colorectal cancer, are associated with extensive copy number alteration (CNA) events and aneuploidy. We report on the identification of characteristic recurrent CNA (with frequency >25%) events and associated gene expression profiles for a total of 40 paired tumor and adjacent normal colon tissues using genome-wide microarrays. We observed recurrent CNAs, namely gains at 1q, 7p, 7q, 8p12-11, 8q, 12p13, 13q, 20p, 20q, Xp, and Xq and losses at 1p36, 1p31, 1p21, 4p15-12, 4q12-35, 5q21-22, 6q26, 8p, 14q, 15q11-12, 17p, 18p, 18q, 21q21-22, and 22q. Within these genomic regions we identified 356 genes with significant differential expression (P<0.0001 and ±1.5 fold change) in the tumor compared to adjacent normal tissue. Gene ontology and pathway analyses indicated that many of these genes were involved in functional mechanisms that regulate cell cycle, cell death, and metabolism. An amplicon present in >70% of the tumor samples at 20q11-20q13 contained several cancer-related genes (AHCY, POFUT1, RPN2, TH1L and PRPF6) that were up-regulated and demonstrated a significant linear correlation (P<0.05) for gene dosage and gene expression. Copy number loss at 8p, a CNA associated with adenocarcinoma and poor prognosis, was observed in >50% of the tumor samples and demonstrated a significant linear correlation for gene dosage and gene expression for two potential tumor suppressor genes, MTUS1 (8p22) and PPP2CB (8p12). The results from our integration analysis illustrate the complex relationship between genomic alterations and gene expression in colon cancer. PMID:23341073
Copy Number Variation of KIR Genes Influences HIV-1 Control
Shianna, Kevin V.; Feng, Sheng; Urban, Thomas J.; Ge, Dongliang; De Luca, Andrea; Martinez-Picado, Javier; Wolinsky, Steven M.; Martinson, Jeremy J.; Jamieson, Beth D.; Bream, Jay H.; Martin, Maureen P.; Borrow, Persephone; Letvin, Norman L.; McMichael, Andrew J.; Haynes, Barton F.; Telenti, Amalio; Carrington, Mary; Goldstein, David B.; Alter, Galit
2011-01-01
A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses the KIR3DL1-KIR3DS1 locus, encoding receptors that interact with specific HLA-Bw4 molecules to regulate the activation of lymphocyte subsets including natural killer (NK) cells. We quantified the number of copies of KIR3DS1 and KIR3DL1 in a large HIV-1 positive cohort, and showed that an increase in KIR3DS1 count associates with a lower viral set point if its putative ligand is present (p = 0.00028), as does an increase in KIR3DL1 count in the presence of KIR3DS1 and appropriate ligands for both receptors (p = 0.0015). We further provide functional data that demonstrate that NK cells from individuals with multiple copies of KIR3DL1, in the presence of KIR3DS1 and the appropriate ligands, inhibit HIV-1 replication more robustly, and associated with a significant expansion in the frequency of KIR3DS1+, but not KIR3DL1+, NK cells in their peripheral blood. Our results suggest that the relative amounts of these activating and inhibitory KIR play a role in regulating the peripheral expansion of highly antiviral KIR3DS1+ NK cells, which may determine differences in HIV-1 control following infection. PMID:22140359
Hypoxia as a target for tissue specific gene therapy.
Rhim, Taiyoun; Lee, Dong Yun; Lee, Minhyung
2013-12-10
Hypoxia is a hallmark of various ischemic diseases such as ischemic heart disease, ischemic limb, ischemic stroke, and solid tumors. Gene therapies for these diseases have been developed with various therapeutic genes including growth factors, anti-apoptotic genes, and toxins. However, non-specific expression of these therapeutic genes may induce dangerous side effects in the normal tissues. To avoid the side effects, gene expression should be tightly regulated in an oxygen concentration dependent manner. The hypoxia inducible promoters and enhancers have been evaluated as a transcriptional regulation tool for hypoxia inducible gene therapy. The hypoxia inducible UTRs were also used in gene therapy for spinal cord injury as a translational regulation strategy. In addition to transcriptional and translational regulations, post-translational regulation strategies have been developed using the HIF-1α ODD domain. Hypoxia inducible transcriptional, translational, and post-translational regulations are useful for tissue specific gene therapy of ischemic diseases. In this review, hypoxia inducible gene expression systems are discussed and their applications are introduced. Copyright © 2013 Elsevier B.V. All rights reserved.
Non-invasive prenatal diagnosis.
Meaney, Cathy; Norbury, Gail
2011-01-01
The discovery of cell-free fetal DNA in the maternal plasma of pregnant women has facilitated the development of non-invasive prenatal diagnosis (NIPD). This has been successfully implemented in diagnostic laboratories for Rhesus typing and fetal sex determination for X-linked disorders and congenital adrenal hyperplasia (CAH) from 7 weeks gestation. Using real-time PCR, fluorescently labelled target gene specific probes can identify and quantify low copy number fetal-specific sequences in a high background of maternal DNA in the cell-free DNA extracted from maternal plasma.NIPD to detect specific fetal mutations in single gene disorders, currently by standard PCR techniques, can only be undertaken for paternally derived or de novo mutations because of the background maternal DNA. For routine use, this testing is limited by the large amounts of cell-free maternal DNA in the sample, the lack of universal fetal markers, and appropriate reference materials.
DNA copy number changes define spatial patterns of heterogeneity in colorectal cancer
Mamlouk, Soulafa; Childs, Liam Harold; Aust, Daniela; Heim, Daniel; Melching, Friederike; Oliveira, Cristiano; Wolf, Thomas; Durek, Pawel; Schumacher, Dirk; Bläker, Hendrik; von Winterfeld, Moritz; Gastl, Bastian; Möhr, Kerstin; Menne, Andrea; Zeugner, Silke; Redmer, Torben; Lenze, Dido; Tierling, Sascha; Möbs, Markus; Weichert, Wilko; Folprecht, Gunnar; Blanc, Eric; Beule, Dieter; Schäfer, Reinhold; Morkel, Markus; Klauschen, Frederick; Leser, Ulf; Sers, Christine
2017-01-01
Genetic heterogeneity between and within tumours is a major factor determining cancer progression and therapy response. Here we examined DNA sequence and DNA copy-number heterogeneity in colorectal cancer (CRC) by targeted high-depth sequencing of 100 most frequently altered genes. In 97 samples, with primary tumours and matched metastases from 27 patients, we observe inter-tumour concordance for coding mutations; in contrast, gene copy numbers are highly discordant between primary tumours and metastases as validated by fluorescent in situ hybridization. To further investigate intra-tumour heterogeneity, we dissected a single tumour into 68 spatially defined samples and sequenced them separately. We identify evenly distributed coding mutations in APC and TP53 in all tumour areas, yet highly variable gene copy numbers in numerous genes. 3D morpho-molecular reconstruction reveals two clusters with divergent copy number aberrations along the proximal–distal axis indicating that DNA copy number variations are a major source of tumour heterogeneity in CRC. PMID:28120820
EGFR mutant allelic-specific imbalance assessment in routine samples of non-small cell lung cancer.
Malapelle, Umberto; Vatrano, Simona; Russo, Stefania; Bellevicine, Claudio; de Luca, Caterina; Sgariglia, Roberta; Rocco, Danilo; de Pietro, Livia; Riccardi, Fernando; Gobbini, Elisa; Righi, Luisella; Troncone, Giancarlo
2015-09-01
In non-small cell lung cancer (NSCLC), the epidermal growth factor receptor (EGFR) gene may undergo both mutations and copy number gains. EGFR mutant allele-specific imbalance (MASI) occurs when the ratio of mutant-to-wild-type alleles increases significantly. In this study, by using a previously validated microfluidic-chip-based technology, EGFR-MASI occurred in 25/67 mutant cases (37%), being more frequently associated with EGFR exon 19 deletions (p=0.033). In a subset of 49 treated patients, we assessed whether MASI is a modifier of anti-EGFR treatment benefit. The difference in progression-free survival and overall survival between EGFR-MASI-positive and EGFR-MASI-negative groups of patients did not show a statistical significance. In conclusion, EGFR-MASI is a significant event in NSCLC, specifically associated with EGFR exon 19 deletions. However, EGFR-MASI does not seem to play a role in predicting the response to first-generation EGFR small molecules inhibitors. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
A Likelihood-Based Framework for Association Analysis of Allele-Specific Copy Numbers.
Hu, Y J; Lin, D Y; Sun, W; Zeng, D
2014-10-01
Copy number variants (CNVs) and single nucleotide polymorphisms (SNPs) co-exist throughout the human genome and jointly contribute to phenotypic variations. Thus, it is desirable to consider both types of variants, as characterized by allele-specific copy numbers (ASCNs), in association studies of complex human diseases. Current SNP genotyping technologies capture the CNV and SNP information simultaneously via fluorescent intensity measurements. The common practice of calling ASCNs from the intensity measurements and then using the ASCN calls in downstream association analysis has important limitations. First, the association tests are prone to false-positive findings when differential measurement errors between cases and controls arise from differences in DNA quality or handling. Second, the uncertainties in the ASCN calls are ignored. We present a general framework for the integrated analysis of CNVs and SNPs, including the analysis of total copy numbers as a special case. Our approach combines the ASCN calling and the association analysis into a single step while allowing for differential measurement errors. We construct likelihood functions that properly account for case-control sampling and measurement errors. We establish the asymptotic properties of the maximum likelihood estimators and develop EM algorithms to implement the corresponding inference procedures. The advantages of the proposed methods over the existing ones are demonstrated through realistic simulation studies and an application to a genome-wide association study of schizophrenia. Extensions to next-generation sequencing data are discussed.
2013-01-01
Background DNA barcoding of land plants has relied traditionally on a small number of markers from the plastid genome. In contrast, low-copy nuclear genes have received little attention as DNA barcodes because of the absence of universal primers for PCR amplification. Results From pooled-species 454 transcriptome data we identified two variable intron-less nuclear loci for each of two species-rich genera of the Hawaiian flora: Clermontia (Campanulaceae) and Cyrtandra (Gesneriaceae) and compared their utility as DNA barcodes with that of plastid genes. We found that nuclear genes showed an overall greater variability, but also displayed a high level of heterozygosity, intraspecific variation, and retention of ancient alleles. Thus, nuclear genes displayed fewer species-diagnostic haplotypes compared to plastid genes and no interspecies gaps. Conclusions The apparently greater coalescence times of nuclear genes are likely to limit their utility as barcodes, as only a small proportion of their alleles were fixed and unique to individual species. In both groups, species-diagnostic markers from either genome were scarce on the youngest island; a minimum age of ca. two million years may be needed for a species flock to be barcoded. For young plant groups, nuclear genes may not be a superior alternative to slowly evolving plastid genes. PMID:23394592
Bevins, Charles L.; Hollox, Edward J.; Bakaletz, Lauren O.
2014-01-01
As there is increasing evidence that aberrant defensin expression is related to susceptibility for infectious disease and inflammatory disorders, we sought to determine if copy number of the beta-defensin gene cluster located on chromosome 8p23.1 (DEFB107, 106, 105, 104, 103, DEFB4 and SPAG11), that shows copy number variation as a block, was associated with susceptibility to otitis media (OM). The gene DEFB103 within this complex encodes human beta defensin-3 (hBD-3), an antimicrobial peptide (AP) expressed by epithelial cells that line the mammalian airway, important for defense of mucosal surfaces and previously shown to have bactericidal activity in vitro against multiple human pathogens, including the three that predominate in OM. To this end, we conducted a retrospective case-control study of 113 OM prone children and 267 controls aged five to sixty months. We identified the copy number of the above defined beta-defensin gene cluster (DEFB-CN) in each study subject by paralogue ratio assays. The mean DEFB-CN was indistinguishable between subjects classified as OM prone based on a recent history of multiple episodes of OM and control subjects who had no history of OM (4.4±0.96 versus 4.4±1.08, respectively: Odds Ratio [OR]: 1.16 (95% CI: 0.61, 2.20). Despite a lack of direct association, we observed a statistically significant correlation between DEFB-CN and nasopharyngeal bacterial colonization patterns. Collectively, our findings suggested that susceptibility to OM might be mediated by genetic variation among individuals, wherein a DEFB-CN less than 4 exerts a marked influence on the microbiota of the nasopharynx, specifically with regard to colonization by the three predominant bacterial pathogens of OM. PMID:24867293
Dong, Yufeng; Jin, Xi; Tang, Qiaoling; Zhang, Xin; Yang, Jiangtao; Liu, Xiaojing; Cai, Junfeng; Zhang, Xiaobing; Wang, Xujing; Wang, Zhixing
2017-01-01
Glyphosate is a widely used herbicide, due to its broad spectrum, low cost, low toxicity, high efficiency, and non-selective characteristics. Rice farmers rarely use glyphosate as a herbicide, because the crop is sensitive to this chemical. The development of transgenic glyphosate-tolerant rice could greatly improve the economics of rice production. Here, we transformed the Pseudomonas fluorescens G2 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) gene G2-EPSPS, which conferred tolerance to glyphosate herbicide into a widely used japonica rice cultivar, Zhonghua 11 (ZH11), to develop two highly glyphosate-tolerant transgenic rice lines, G2-6 and G2-7, with one exogenous gene integration. Seed germination tests and glyphosate-tolerance assays of plants grown in a greenhouse showed that the two transgenic lines could greatly improve glyphosate-tolerance compared with the wild-type; The glyphosate-tolerance field test indicated that both transgenic lines could grow at concentrations of 20,000 ppm glyphosate, which is more than 20-times the recommended concentration in the field. Isolation of the flanking sequence of transgenic rice G2-6 indicated that the 5′-terminal of T-DNA was inserted into chromosome 8 of the rice genome. An event-specific PCR test system was established and the limit of detection of the primers reached five copies. Overall, the G2-EPSPS gene significantly improved glyphosate-tolerance in transgenic rice; furthermore, it is a useful candidate gene for the future development of commercial transgenic rice. PMID:28611804
Drews, Anna; Strandh, Maria; Råberg, Lars; Westerdahl, Helena
2017-06-26
The Major Histocompatibility Complex (MHC) plays a central role in immunity and has been given considerable attention by evolutionary ecologists due to its associations with fitness-related traits. Songbirds have unusually high numbers of MHC class I (MHC-I) genes, but it is not known whether all are expressed and equally important for immune function. Classical MHC-I genes are highly expressed, polymorphic and present peptides to T-cells whereas non-classical MHC-I genes have lower expression, are more monomorphic and do not present peptides to T-cells. To get a better understanding of the highly duplicated MHC genes in songbirds, we studied gene expression in a phylogenetic framework in three species of sparrows (house sparrow, tree sparrow and Spanish sparrow), using high-throughput sequencing. We hypothesize that sparrows could have classical and non-classical genes, as previously indicated though never tested using gene expression. The phylogenetic analyses reveal two distinct types of MHC-I alleles among the three sparrow species, one with high and one with low level of polymorphism, thus resembling classical and non-classical genes, respectively. All individuals had both types of alleles, but there was copy number variation both within and among the sparrow species. However, the number of highly polymorphic alleles that were expressed did not vary between species, suggesting that the structural genomic variation is counterbalanced by conserved gene expression. Overall, 50% of the MHC-I alleles were expressed in sparrows. Expression of the highly polymorphic alleles was very variable, whereas the alleles with low polymorphism had uniformly low expression. Interestingly, within an individual only one or two alleles from the polymorphic genes were highly expressed, indicating that only a single copy of these is highly expressed. Taken together, the phylogenetic reconstruction and the analyses of expression suggest that sparrows have both classical and non
8q24 allelic imbalance and MYC gene copy number in primary prostate cancer.
Chen, H; Liu, W; Roberts, W; Hooker, S; Fedor, H; DeMarzo, A; Isaacs, W; Kittles, R A
2010-09-01
Four independent regions within 8q24 near the MYC gene are associated with risk for prostate cancer (Pca). Here, we investigated allelic imbalance (AI) at 8q24 risk variants and MYC gene DNA copy number (CN) in 27 primary Pcas. Heterozygotes were observed in 24 of 27 patients at one or more 8q24 markers and 27% of the loci exhibited AI in tumor DNA. The 8q24 risk alleles were preferentially favored in the tumors. Increased MYC gene CN was observed in 33% of tumors, and the co-existence of increased MYC gene CN with AI at risk loci was observed in 86% (P<0.004 exact binomial test) of the informative tumors. No AI was observed in tumors, which did not reveal increased MYC gene CN. Higher Gleason score was associated with tumors exhibiting AI (P=0.04) and also with increased MYC gene CN (P=0.02). Our results suggest that AI at 8q24 and increased MYC gene CN may both be related to high Gleason score in Pca. Our findings also suggest that these two somatic alterations may be due to the same preferential chromosomal duplication event during prostate tumorigenesis.
Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe
Duhig, Trevor; Nam, Miyoung; Palmer, Georgia; Han, Sangjo; Jeffery, Linda; Baek, Seung-Tae; Lee, Hyemi; Shim, Young Sam; Lee, Minho; Kim, Lila; Heo, Kyung-Sun; Noh, Eun Joo; Lee, Ah-Reum; Jang, Young-Joo; Chung, Kyung-Sook; Choi, Shin-Jung; Park, Jo-Young; Park, Youngwoo; Kim, Hwan Mook; Park, Song-Kyu; Park, Hae-Joon; Kang, Eun-Jung; Kim, Hyong Bai; Kang, Hyun-Sam; Park, Hee-Moon; Kim, Kyunghoon; Song, Kiwon; Song, Kyung Bin; Nurse, Paul; Hoe, Kwang-Lae
2014-01-01
SUMMARY We report the construction and analysis of 4,836 heterozygous diploid deletion mutants covering 98.4% of the fission yeast genome. This resource provides a powerful tool for biotechnological and eukaryotic cell biology research. Comprehensive gene dispensability comparisons with budding yeast, the first time such studies have been possible between two eukaryotes, revealed that 83% of single copy orthologues in the two yeasts had conserved dispensability. Gene dispensability differed for certain pathways between the two yeasts, including mitochondrial translation and cell cycle checkpoint control. We show that fission yeast has more essential genes than budding yeast and that essential genes are more likely than non-essential genes to be single copy, broadly conserved and to contain introns. Growth fitness analyses determined sets of haploinsufficient and haploproficient genes for fission yeast, and comparisons with budding yeast identified specific ribosomal proteins and RNA polymerase subunits, which may act more generally to regulate eukaryotic cell growth. PMID:20473289
2018-01-01
FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722
Specific and quantitative detection of human polyomaviruses BKV, JCV, and SV40 by real time PCR.
McNees, Adrienne L; White, Zoe S; Zanwar, Preeti; Vilchez, Regis A; Butel, Janet S
2005-09-01
The polyomaviruses that infect humans, BK virus (BKV), JC virus (JCV), and simian virus 40 (SV40), typically establish subclinical persistent infections. However, reactivation of these viruses in immunocompromised hosts is associated with renal nephropathy and hemorrhagic cystitis (HC) caused by BKV and with progressive multifocal leukoencephalopathy (PML) caused by JCV. Additionally, SV40 is associated with several types of human cancers including primary brain and bone cancers, mesotheliomas, and non-Hodgkin's lymphoma. Advancements in detection of these viruses may contribute to improved diagnosis and treatment of affected patients. To develop sensitive and specific real time quantitative polymerase chain reaction (RQ-PCR) assays for the detection of T-antigen DNA sequences of the human polyomaviruses BKV, JCV, and SV40 using the ABI Prism 7000 Sequence Detection System. Assays for absolute quantification of the viral T-ag sequences were designed and the sensitivity and specificity were evaluated. A quantitative assay to measure the single copy human RNAse P gene was also developed and evaluated in order to normalize viral gene copy numbers to cell numbers. Quantification of the target genes is sensitive and specific over a 7 log dynamic range. Ten copies each of the viral and cellular genes are reproducibly and accurately detected. The sensitivity of detection of the RQ-PCR assays is increased 10- to 100-fold compared to conventional PCR and agarose gel protocols. The primers and probes used to detect the viral genes are specific for each virus and there is no cross reactivity within the dynamic range of the standard dilutions. The sensitivity of detection for these assays is not reduced in human cellular extracts; however, different DNA extraction protocols may affect quantification. These assays provide a technique for rapid and specific quantification of polyomavirus genomes per cell in human samples.
Kawakami, Shuji; Hasegawa, Takuya; Imachi, Hiroyuki; Yamaguchi, Takashi; Harada, Hideki; Ohashi, Akiyoshi; Kubota, Kengo
2012-02-01
In situ detection of functional genes with single-cell resolution is currently of interest to microbiologists. Here, we developed a two-pass tyramide signal amplification (TSA)-fluorescence in situ hybridization (FISH) protocol with PCR-derived polynucleotide probes for the detection of single-copy genes in prokaryotic cells. The mcrA gene and the apsA gene in methanogens and sulfate-reducing bacteria, respectively, were targeted. The protocol showed bright fluorescence with a good signal-to-noise ratio and achieved a high efficiency of detection (>98%). The discrimination threshold was approximately 82-89% sequence identity. Microorganisms possessing the mcrA or apsA gene in anaerobic sludge samples were successfully detected by two-pass TSA-FISH with polynucleotide probes. The developed protocol is useful for identifying single microbial cells based on functional gene sequences. Copyright © 2011 Elsevier B.V. All rights reserved.
Paço, Ana; Brígido, Clarisse; Alexandre, Ana; Mateos, Pedro F; Oliveira, Solange
2016-01-01
The ClpB chaperone is known to be involved in bacterial stress response. Moreover, recent studies suggest that this protein has also a role in the chickpea-rhizobia symbiosis. In order to improve both stress tolerance and symbiotic performance of a chickpea microsymbiont, the Mesorhizobium mediterraneum UPM-Ca36T strain was genetically transformed with pPHU231 containing an extra-copy of the clpB gene. To investigate if the clpB-transformed strain displays an improved stress tolerance, bacterial growth was evaluated under heat and acid stress conditions. In addition, the effect of the extra-copies of the clpB gene in the symbiotic performance was evaluated using plant growth assays (hydroponic and pot trials). The clpB-transformed strain is more tolerant to heat shock than the strain transformed with pPHU231, supporting the involvement of ClpB in rhizobia heat shock tolerance. Both plant growth assays showed that ClpB has an important role in chickpea-rhizobia symbiosis. The nodulation kinetics analysis showed a higher rate of nodule appearance with the clpB-transformed strain. This strain also induced a greater number of nodules and, more notably, its symbiotic effectiveness increased ~60% at pH5 and 83% at pH7, compared to the wild-type strain. Furthermore, a higher frequency of root hair curling was also observed in plants inoculated with the clpB-transformed strain, compared to the wild-type strain. The superior root hair curling induction, nodulation ability and symbiotic effectiveness of the clpB-transformed strain may be explained by an increased expression of symbiosis genes. Indeed, higher transcript levels of the nodulation genes nodA and nodC (~3 folds) were detected in the clpB-transformed strain. The improvement of rhizobia by addition of extra-copies of the clpB gene may be a promising strategy to obtain strains with enhanced stress tolerance and symbiotic effectiveness, thus contributing to their success as crop inoculants, particularly under
Paço, Ana; Brígido, Clarisse; Alexandre, Ana; Mateos, Pedro F.; Oliveira, Solange
2016-01-01
The ClpB chaperone is known to be involved in bacterial stress response. Moreover, recent studies suggest that this protein has also a role in the chickpea-rhizobia symbiosis. In order to improve both stress tolerance and symbiotic performance of a chickpea microsymbiont, the Mesorhizobium mediterraneum UPM-Ca36T strain was genetically transformed with pPHU231 containing an extra-copy of the clpB gene. To investigate if the clpB-transformed strain displays an improved stress tolerance, bacterial growth was evaluated under heat and acid stress conditions. In addition, the effect of the extra-copies of the clpB gene in the symbiotic performance was evaluated using plant growth assays (hydroponic and pot trials). The clpB-transformed strain is more tolerant to heat shock than the strain transformed with pPHU231, supporting the involvement of ClpB in rhizobia heat shock tolerance. Both plant growth assays showed that ClpB has an important role in chickpea-rhizobia symbiosis. The nodulation kinetics analysis showed a higher rate of nodule appearance with the clpB-transformed strain. This strain also induced a greater number of nodules and, more notably, its symbiotic effectiveness increased ~60% at pH5 and 83% at pH7, compared to the wild-type strain. Furthermore, a higher frequency of root hair curling was also observed in plants inoculated with the clpB-transformed strain, compared to the wild-type strain. The superior root hair curling induction, nodulation ability and symbiotic effectiveness of the clpB-transformed strain may be explained by an increased expression of symbiosis genes. Indeed, higher transcript levels of the nodulation genes nodA and nodC (~3 folds) were detected in the clpB-transformed strain. The improvement of rhizobia by addition of extra-copies of the clpB gene may be a promising strategy to obtain strains with enhanced stress tolerance and symbiotic effectiveness, thus contributing to their success as crop inoculants, particularly under
Dueñas, Marta; Martínez-Fernández, Mónica; García-Escudero, Ramón; Villacampa, Felipe; Marqués, Miriam; Saiz-Ladera, Cristina; Duarte, José; Martínez, Victor; Gómez, M José; Martín, M Luisa; Fernández, Manoli; Castellano, Daniel; Real, Francisco X; Rodriguez-Peralto, Jose L; De La Rosa, Federico; Paramio, Jesús M
2015-07-01
Bladder cancer (BC) is the fifth most common cancer in the world, being the non-muscle invasive tumors (NMIBC) the most frequent. NMIBC shows a very high frequency of recurrence and, in certain cases, tumor progression. The phosphatidylinositol 3-kinase (PI3K) pathway, which controls cell growth, tumorigenesis, cell invasion and drug response, is frequently activated in numerous human cancers, including BC, in part through alterations of PIK3CA gene. However, the significance of PIK3CA gene alterations with respect to clinicopathological characteristics, and in particular tumor recurrence and progression, remains elusive. Here, we analyzed the presence of mutations in FGFR3 and PIK3CA genes and copy number alterations of PIK3CA gene in bladder tumor and their correspondent paired normal samples from 87 patients. We observed an extremely high frequency of PIK3CA gene alterations (mutations, copy gains, or both) in tumor samples, affecting primarily T1 and T2 tumors. A significant number of normal tissues also showed mutations and copy gains, being coincident with those found in the corresponding tumor sample. In low-grade tumors PIK3CA mutations associated with FGFR3 mutations. Alterations in PIK3CA gene resulted in increased Akt activity in tumors. Interestingly, the presence of PIK3CA gene alterations, and in particular gene mutations, is significantly associated with reduced recurrence of NMIBC patients. Importantly, the presence of FGFR3 mutations may influence the clinical outcome of patients bearing alterations in PIK3CA gene, and increased recurrence was associated to FGFR3 mutated, PIK3CA wt tumors. These findings may have high relevance in terms of using PI3K-targeted therapies for BC treatment. © 2013 Wiley Periodicals, Inc.
Tan, Ling; Hu, Yerong; Tao, Yongguang; Wang, Bin; Xiao, Jun; Tang, Zhenjie; Lu, Ting
2018-01-01
Background To identify whether RET is a potential target for NSCLC treatment, we examined the status of the RET gene in 631 early and mid stage NSCLC cases from south central China. Methods RET expression was identified by Western blot. RET‐positive expression samples were verified by immunohistochemistry. RET gene mutation, copy number variation, and rearrangement were analyzed by DNA Sanger sequencing, TaqMan copy number assays, and reverse transcription‐PCR. ALK and ROS1 expression levels were tested by Western blot and EGFR mutation using Sanger sequencing. Results The RET‐positive rate was 2.5% (16/631). RET‐positive expression was related to poorer tumor differentiation (P < 0.05). In the 16 RET‐positive samples, only two samples of moderately and poorly differentiated lung adenocarcinomas displayed RET rearrangement, both in RET‐KIF5B fusion partners. Neither ALK nor ROS1 translocation was found. The EGFR mutation rate in RET‐positive samples was significantly lower than in RET‐negative samples (P < 0.05). Conclusion RET‐positive expression in early and mid stage NSCLC cases from south central China is relatively low and is related to poorer tumor differentiation. RET gene alterations (copy number gain and rearrangement) exist in all RET‐positive samples. RET‐positive expression is a relatively independent factor in NSCLC patients, which indicates that the RET gene may be a novel target site for personalized treatment of NSCLC. PMID:29473341
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard
2013-05-30
Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.
Copy Number Variation in Patients with Disorders of Sex Development Due to 46,XY Gonadal Dysgenesis
White, Stefan; Ohnesorg, Thomas; Notini, Amanda; Roeszler, Kelly; Hewitt, Jacqueline; Daggag, Hinda; Smith, Craig; Turbitt, Erin; Gustin, Sonja; van den Bergen, Jocelyn; Miles, Denise; Western, Patrick; Arboleda, Valerie; Schumacher, Valerie; Gordon, Lavinia; Bell, Katrina; Bengtsson, Henrik; Speed, Terry; Hutson, John; Warne, Garry; Harley, Vincent; Koopman, Peter; Vilain, Eric; Sinclair, Andrew
2011-01-01
Disorders of sex development (DSD), ranging in severity from mild genital abnormalities to complete sex reversal, represent a major concern for patients and their families. DSD are often due to disruption of the genetic programs that regulate gonad development. Although some genes have been identified in these developmental pathways, the causative mutations have not been identified in more than 50% 46,XY DSD cases. We used the Affymetrix Genome-Wide Human SNP Array 6.0 to analyse copy number variation in 23 individuals with unexplained 46,XY DSD due to gonadal dysgenesis (GD). Here we describe three discrete changes in copy number that are the likely cause of the GD. Firstly, we identified a large duplication on the X chromosome that included DAX1 (NR0B1). Secondly, we identified a rearrangement that appears to affect a novel gonad-specific regulatory region in a known testis gene, SOX9. Surprisingly this patient lacked any signs of campomelic dysplasia, suggesting that the deletion affected expression of SOX9 only in the gonad. Functional analysis of potential SRY binding sites within this deleted region identified five putative enhancers, suggesting that sequences additional to the known SRY-binding TES enhancer influence human testis-specific SOX9 expression. Thirdly, we identified a small deletion immediately downstream of GATA4, supporting a role for GATA4 in gonad development in humans. These CNV analyses give new insights into the pathways involved in human gonad development and dysfunction, and suggest that rearrangements of non-coding sequences disturbing gene regulation may account for significant proportion of DSD cases. PMID:21408189
Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian
2013-01-01
In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.
Gene delivery to the neurulating embryo during culture
Modulating expression of specific genes during embryogenesis will help elucidate their role in development. Transient overexpression of specific genes can be accomplished by adding additional copies, or else antisense transcripts can be used to block expression. Manipulation of g...
GAB2 Amplification in Squamous Cell Lung Cancer of Non-Smokers
2017-01-01
Lung squamous cell cancer (SCC) is typically found in smokers and has a very low incidence in non-smokers, indicating differences in the tumor biology of lung SCC in smokers and non-smokers. However, the specific mutations that drive tumor growth in non-smokers have not been identified. To identify mutations in lung SCC of non-smokers, we performed a genetic analysis using arrays comparative genomic hybridization (ArrayCGH). We analyzed 19 patients with lung SCC who underwent surgical treatment between April 2005 and April 2015. Clinical characteristics were reviewed, and DNA was extracted from fresh frozen lung cancer specimens. All of copy number alterations from ArrayCGH were validated using The Cancer Genome Atlas (TCGA) copy number variation (CNV) data of lung SCC. We examined the frequency of copy number changes according to the smoking status (non-smoker [n = 8] or smoker [n = 11]). We identified 16 significantly altered regions from ArrayCGH data, three gain and four loss regions overlapped with the TCGA lung squamous cell carcinoma (LUSC) patients. Within these overlapped significant regions, we detected 15 genes that have been reported in the Cancer Gene census. We also found that the proto-oncogene GAB2 (11q14.1) was significantly amplified in non-smokers patients and vice versa in both ArrayCGH and TCGA data. Immunohistochemical analyses showed that GAB2 protein was relatively upregulated in non-smoker than smoker tissues (37.5% vs. 9.0%, P = 0.007). GAB2 amplification may have an important role in the development of lung SCC in non-smokers. GAB2 may represent a potential biomarker for lung SCC in non-smokers. PMID:28960030
Pacheco, Guillermo Valencia; Cruz, Darig Cámara; González Herrera, Lizbeth J; Pérez Mendoza, Gerardo J; Adrián Amaro, Guadalupe I; Nakazawa Ueji, Yumi E; Angulo Ramírez, Angélica V
2014-01-01
Systemic lupus erythematosus (SLE) is a systemic autoimmune disease characterized by the production of autoantibodies against self-antigens, which occurs most often in women between 15 and 40 years of age. The innate immunity is involved in the pathogenesis of SLE through TLR- 7. Genetic factors such as copy number variation (CNV) of target genes may contribute to disease development, but this possible risk has not yet been studied in SLE patients from Yucatan, Mexico. The CNV of TLR-7 gene was determined by quantitative polymerase chain reaction assay using TaqMan probes in 80 SLE women and 150 control subjects. The results showed that 10% of SLE patients exhibited more than two copies of TLR-7 gene, whereas no mRNA overexpression was detected. These data suggested that increased CNV of the TLR-7 gene in Yucatan SLE women can be a risk factor for this disease. PMID:25512712
Transcriptional insulation of the human keratin 18 gene in transgenic mice.
Neznanov, N; Thorey, I S; Ceceña, G; Oshima, R G
1993-01-01
Expression of the 10-kb human keratin 18 (K18) gene in transgenic mice results in efficient and appropriate tissue-specific expression in a variety of internal epithelial organs, including liver, lung, intestine, kidney, and the ependymal epithelium of brain, but not in spleen, heart, or skeletal muscle. Expression at the RNA level is directly proportional to the number of integrated K18 transgenes. These results indicate that the K18 gene is able to insulate itself both from the commonly observed cis-acting effects of the sites of integration and from the potential complications of duplicated copies of the gene arranged in head-to-tail fashion. To begin to identify the K18 gene sequences responsible for this property of transcriptional insulation, additional transgenic mouse lines containing deletions of either the 5' or 3' distal end of the K18 gene have been characterized. Deletion of 1.5 kb of the distal 5' flanking sequence has no effect upon either the tissue specificity or the copy number-dependent behavior of the transgene. In contrast, deletion of the 3.5-kb 3' flanking sequence of the gene results in the loss of the copy number-dependent behavior of the gene in liver and intestine. However, expression in kidney, lung, and brain remains efficient and copy number dependent in these transgenic mice. Furthermore, herpes simplex virus thymidine kinase gene expression is copy number dependent in transgenic mice when the gene is located between the distal 5'- and 3'-flanking sequences of the K18 gene. Each adult transgenic male expressed the thymidine kinase gene in testes and brain and proportionally to the number of integrated transgenes. We conclude that the characteristic of copy number-dependent expression of the K18 gene is tissue specific because the sequence requirements for transcriptional insulation in adult liver and intestine are different from those for lung and kidney. In addition, the behavior of the transgenic thymidine kinase gene in testes and
A large-scale survey of genetic copy number variations among Han Chinese residing in Taiwan
Lin, Chien-Hsing; Li, Ling-Hui; Ho, Sheng-Feng; Chuang, Tzu-Po; Wu, Jer-Yuarn; Chen, Yuan-Tsong; Fann, Cathy SJ
2008-01-01
Background Copy number variations (CNVs) have recently been recognized as important structural variations in the human genome. CNVs can affect gene expression and thus may contribute to phenotypic differences. The copy number inferring tool (CNIT) is an effective hidden Markov model-based algorithm for estimating allele-specific copy number and predicting chromosomal alterations from single nucleotide polymorphism microarrays. The CNIT algorithm, which was constructed using data from 270 HapMap multi-ethnic individuals, was applied to identify CNVs from 300 unrelated Han Chinese individuals in Taiwan. Results Using stringent selection criteria, 230 regions with variable copy numbers were identified in the Han Chinese population; 133 (57.83%) had been reported previously, 64 displayed greater than 1% CNV allele frequency. The average size of the CNV regions was 322 kb (ranging from 1.48 kb to 5.68 Mb) and covered a total of 2.47% of the human genome. A total of 196 of the CNV regions were simple deletions and 27 were simple amplifications. There were 449 genes and 5 microRNAs within these CNV regions; some of these genes are known to be associated with diseases. Conclusion The identified CNVs are characteristic of the Han Chinese population and should be considered when genetic studies are conducted. The CNV distribution in the human genome is still poorly characterized, and there is much diversity among different ethnic populations. PMID:19108714
Pittet, Vanessa; Phister, Trevor G.; Ziola, Barry
2013-01-01
Growth of specific lactic acid bacteria in beer leads to spoiled product and economic loss for the brewing industry. Microbial growth is typically inhibited by the combined stresses found in beer (e.g., ethanol, hops, low pH, minimal nutrients); however, certain bacteria have adapted to grow in this harsh environment. Considering little is known about the mechanisms used by bacteria to grow in and spoil beer, transcriptome sequencing was performed on a variant of the beer-spoilage organism Pediococcus claussenii ATCC BAA-344T (Pc344-358). Illumina sequencing was used to compare the transcript levels in Pc344-358 growing mid-exponentially in beer to those in nutrient-rich MRS broth. Various operons demonstrated high gene expression in beer, several of which are involved in nutrient acquisition and overcoming the inhibitory effects of hop compounds. As well, genes functioning in cell membrane modification and biosynthesis demonstrated significantly higher transcript levels in Pc344-358 growing in beer. Three plasmids had the majority of their genes showing increased transcript levels in beer, whereas the two cryptic plasmids showed slightly decreased gene expression. Follow-up analysis of plasmid copy number in both growth environments revealed similar trends, where more copies of the three non-cryptic plasmids were found in Pc344-358 growing in beer. Transcriptome sequencing also enabled the addition of several genes to the P . claussenii ATCC BAA-344T genome annotation, some of which are putatively transcribed as non-coding RNAs. The sequencing results not only provide the first transcriptome description of a beer-spoilage organism while growing in beer, but they also highlight several targets for future exploration, including genes that may have a role in the general stress response of lactic acid bacteria. PMID:24040005
Comparative analyses of gene copy number and mRNA expression in GBM tumors and GBM xenografts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hodgson, J. Graeme; Yeh, Ru-Fang; Ray, Amrita
2009-04-03
Development of model systems that recapitulate the molecular heterogeneity observed among glioblastoma multiforme (GBM) tumors will expedite the testing of targeted molecular therapeutic strategies for GBM treatment. In this study, we profiled DNA copy number and mRNA expression in 21 independent GBM tumor lines maintained as subcutaneous xenografts (GBMX), and compared GBMX molecular signatures to those observed in GBM clinical specimens derived from the Cancer Genome Atlas (TCGA). The predominant copy number signature in both tumor groups was defined by chromosome-7 gain/chromosome-10 loss, a poor-prognosis genetic signature. We also observed, at frequencies similar to that detected in TCGA GBM tumors,more » genomic amplification and overexpression of known GBM oncogenes, such as EGFR, MDM2, CDK6, and MYCN, and novel genes, including NUP107, SLC35E3, MMP1, MMP13, and DDX1. The transcriptional signature of GBMX tumors, which was stable over multiple subcutaneous passages, was defined by overexpression of genes involved in M phase, DNA replication, and chromosome organization (MRC) and was highly similar to the poor-prognosis mitosis and cell-cycle module (MCM) in GBM. Assessment of gene expression in TCGA-derived GBMs revealed overexpression of MRC cancer genes AURKB, BIRC5, CCNB1, CCNB2, CDC2, CDK2, and FOXM1, which form a transcriptional network important for G2/M progression and/or checkpoint activation. Our study supports propagation of GBM tumors as subcutaneous xenografts as a useful approach for sustaining key molecular characteristics of patient tumors, and highlights therapeutic opportunities conferred by this GBMX tumor panel for testing targeted therapeutic strategies for GBM treatment.« less
ERIC Educational Resources Information Center
Pescosolido, Matthew F.; Gamsiz, Ece D.; Nagpal, Shailender; Morrow, Eric M.
2013-01-01
Objective: The purpose of the present study was to discover the extent to which distinct "DSM" disorders share large, highly recurrent copy number variants (CNVs) as susceptibility factors. We also sought to identify gene mechanisms common to groups of diagnoses and/or specific to a given diagnosis based on associations with CNVs. Method:…
The human clinical phenotypes of altered CHRNA7 copy number.
Gillentine, Madelyn A; Schaaf, Christian P
2015-10-15
Copy number variants (CNVs) have been implicated in multiple neuropsychiatric conditions, including autism spectrum disorder (ASD), schizophrenia, and intellectual disability (ID). Chromosome 15q13 is a hotspot for such CNVs due to the presence of low copy repeat (LCR) elements, which facilitate non-allelic homologous recombination (NAHR). Several of these CNVs have been overrepresented in individuals with neuropsychiatric disorders; yet variable expressivity and incomplete penetrance are commonly seen. Dosage sensitivity of the CHRNA7 gene, which encodes for the α7 nicotinic acetylcholine receptor in the human brain, has been proposed to have a major contribution to the observed cognitive and behavioral phenotypes, as it represents the smallest region of overlap to all the 15q13.3 deletions and duplications. Individuals with zero to four copies of CHRNA7 have been reported in the literature, and represent a range of clinical severity, with deletions causing generally more severe and more highly penetrant phenotypes. Potential mechanisms to account for the variable expressivity within each group of 15q13.3 CNVs will be discussed. Copyright © 2015 Elsevier Inc. All rights reserved.
Wang, Yaqiong; Ma, Hong
2015-09-01
Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Iakoubov, Leonid; Mossakowska, Malgorzata; Szwed, Malgorzata; Puzianowska-Kuznicka, Monika
2015-01-01
New therapeutic targets are needed to fight aging-related diseases and increase life span. A new female-specific association with diseases and limited survival past 80 years was recently reported for a copy number variation (CNV) in the CNTNAP4 gene from the neurexin superfamily. We asked whether there are CNVs that are associated with aging phenotypes within other genes from the neurexin superfamily and whether this association is sex specific. Select CNV polymorphisms were genotyped with proprietary TaqMan qPCR assays. A case/control study, in which a group of 81- to 90-year-old community-dwelling Caucasians with no chronic diseases (case) was compared to a similar control group of 65- to 75-year-olds, revealed a negative association with healthy aging for the ins allele of common esv11910 CNV in the CNTNAP2 gene (n = 388; OR = 0.29, 95% CI: 0.14-0.59, p = 0.0004 for males, and OR = 0.82, 95% CI: 0.42-1.57, p = 0.625 for females). This male-specific association was validated in a study of an independent group of 76- to 80-year-olds. To look for a corresponding positive association of the allele with aging-related diseases, two case subgroups of 81- to 90-year-olds, one composed of individuals with cognitive impairment and the other with various diseases not directly related to the nervous system, such as cardiovascular diseases, etc., were compared to a healthy control subgroup of the same age. A positive male-specific association was found for both cases (OR = 2.75, p = 0.008 for association with cognitive impairment, and OR = 3.18, p = 0.002 for other diseases combined). A new male-specific association with aging is reported for a CNV in the CNTNAP2 gene. The polymorphism might be useful for diagnosing individual genetic predispositions to healthy aging versus aging complicated by chronic diseases. © 2014 S. Karger AG, Basel.
Guo, Jinchao; Yang, Litao; Liu, Xin; Zhang, Haibo; Qian, Bingjun; Zhang, Dabing
2009-08-12
The virus-resistant papaya (Carica papaya L.), Huanong no. 1, was the genetically modified (GM) fruit approved for growing in China in 2006. To implement the labeling regulation of GM papaya and its derivates, the development of papaya endogenous reference gene is very necessary for GM papaya detection. Herein, we reported one papaya specific gene, Chymopapain (CHY), as one suitable endogenous reference gene, used for GM papaya identification. Thereafter, we established the conventional and real-time quantitative PCR assays of the CHY gene. In the CHY conventional PCR assay, the limit of detection (LOD) was 25 copies of haploid papaya genome. In the CHY real-time quantitative PCR assay, both the LOD and the limit of quantification (LOQ) were as low as 12.5 copies of haploid papaya genome. Furthermore, we revealed the construct-specific sequence of Chinese GM papaya Huanong no. 1 and developed its conventional and quantitative PCR systems employing the CHY gene as endogenous reference gene. This work is useful for papaya specific identification and GM papaya detection.
Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression
Camps, Manel
2010-01-01
ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961
2014-01-01
Background Deciphering of the information content of eukaryotic promoters has remained confined to universal landmarks and conserved sequence elements such as enhancers and transcription factor binding motifs, which are considered sufficient for gene activation and regulation. Gene-specific sequences, interspersed between the canonical transacting factor binding sites or adjoining them within a promoter, are generally taken to be devoid of any regulatory information and have therefore been largely ignored. An unanswered question therefore is, do gene-specific sequences within a eukaryotic promoter have a role in gene activation? Here, we present an exhaustive experimental analysis of a gene-specific sequence adjoining the heat shock element (HSE) in the proximal promoter of the small heat shock protein gene, αB-crystallin (cryab). These sequences are highly conserved between the rodents and the humans. Results Using human retinal pigment epithelial cells in culture as the host, we have identified a 10-bp gene-specific promoter sequence (GPS), which, unlike an enhancer, controls expression from the promoter of this gene, only when in appropriate position and orientation. Notably, the data suggests that GPS in comparison with the HSE works in a context-independent fashion. Additionally, when moved upstream, about a nucleosome length of DNA (−154 bp) from the transcription start site (TSS), the activity of the promoter is markedly inhibited, suggesting its involvement in local promoter access. Importantly, we demonstrate that deletion of the GPS results in complete loss of cryab promoter activity in transgenic mice. Conclusions These data suggest that gene-specific sequences such as the GPS, identified here, may have critical roles in regulating gene-specific activity from eukaryotic promoters. PMID:24589182
Copy Number Variation across European Populations
Chen, Wanting; Hayward, Caroline; Wright, Alan F.; Hicks, Andrew A.; Vitart, Veronique; Knott, Sara; Wild, Sarah H.; Pramstaller, Peter P.; Wilson, James F.; Rudan, Igor; Porteous, David J.
2011-01-01
Genome analysis provides a powerful approach to test for evidence of genetic variation within and between geographical regions and local populations. Copy number variants which comprise insertions, deletions and duplications of genomic sequence provide one such convenient and informative source. Here, we investigate copy number variants from genome wide scans of single nucleotide polymorphisms in three European population isolates, the island of Vis in Croatia, the islands of Orkney in Scotland and the South Tyrol in Italy. We show that whereas the overall copy number variant frequencies are similar between populations, their distribution is highly specific to the population of origin, a finding which is supported by evidence for increased kinship correlation for specific copy number variants within populations. PMID:21829696
Pruimboom, Leo; Fox, Tom; Muskiet, Frits A J
2014-03-01
Various positively selected adaptations to new nutrients have been identified. Lactase persistence is among the best known, conferring the ability for drinking milk at post weaning age. An augmented number of amylase gene (AMY1) copies, giving rise to higher salivary amylase activity, has been implicated in the consumption of starch-rich foods. Higher AMY1 copy numbers have been demonstrated in populations with recent histories of starchy-rich diets. It is however questionable whether the resulting polymorphisms have exerted positive selection only by providing easily available sources of macro and micronutrients. Humans have explored new environments more than any other animal. Novel environments challenge the host, but especially its immune system with new climatic conditions, food and especially pathogens. With the advent of the agricultural revolution and the concurrent domestication of cattle came new pathogens. We contend that specific new food ingredients (e.g., gluten) and novel pathogens drove selection for lactase persistence and higher AMY gene copy numbers. Both adaptations provide ample glucose for activating the sodium glucose-dependent co-transporter 1 (SGLT1), which is the principal glucose, sodium and water transporter in the gastro-intestinal tract. Their rapid uptake confers protection against potentially lethal dehydration, hyponatremia and ultimately multiple organ failure. Oral rehydration therapy aims at SGLT1 activity and is the current treatment of choice for chronic diarrhoea and vomiting. We hypothesize that lifelong lactase activity and rapid starch digestion should be looked at as the evolutionary covalent of oral rehydration therapy. Copyright © 2014 Elsevier Ltd. All rights reserved.
Advances in Non-Viral DNA Vectors for Gene Therapy
Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn
2017-01-01
Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less
Law, Dennis K S; Tsang, Raymond S W
2013-05-01
A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.
Clinical features associated with copy number variations of the 14q32 imprinted gene cluster.
Rosenfeld, Jill A; Fox, Joyce E; Descartes, Maria; Brewer, Fallon; Stroud, Tracy; Gorski, Jerome L; Upton, Sheila J; Moeschler, John B; Monteleone, Berrin; Neill, Nicholas J; Lamb, Allen N; Ballif, Blake C; Shaffer, Lisa G; Ravnan, J Britt
2015-02-01
Uniparental disomy (UPD) for imprinted chromosomes can cause abnormal phenotypes due to absent or overexpression of imprinted genes. UPD(14)pat causes a unique constellation of features including thoracic skeletal anomalies, polyhydramnios, placentomegaly, and limited survival; its hypothesized cause is overexpression of paternally expressed RTL1, due to absent regulatory effects of maternally expressed RTL1as. UPD(14)mat causes a milder condition with hypotonia, growth failure, and precocious puberty; its hypothesized cause is absence of paternally expressed DLK1. To more clearly establish how gains and losses of imprinted genes can cause disease, we report six individuals with copy number variations of the imprinted 14q32 region identified through clinical microarray-based comparative genomic hybridization. Three individuals presented with UPD(14)mat-like phenotypes (Temple syndrome) and had apparently de novo deletions spanning the imprinted region, including DLK1. One of these deletions was shown to be on the paternal chromosome. Two individuals with UPD(14)pat-like phenotypes had 122-154kb deletions on their maternal chromosomes that included RTL1as but not the differentially methylated regions that regulate imprinted gene expression, providing further support for RTL1 overexpression as a cause for the UPD(14)pat phenotype. The sixth individual is tetrasomic for a 1.7Mb segment, including the imprinted region, and presents with intellectual disability and seizures but lacks significant phenotypic overlap with either UPD(14) syndrome. Therefore, the 14q32 imprinted region is dosage sensitive, with deletions of different critical regions causing UPD(14)mat- and UPD(14)pat-like phenotypes, while copy gains are likely insufficient to recapitulate these phenotypes.
MulRF: a software package for phylogenetic analysis using multi-copy gene trees.
Chaudhary, Ruchi; Fernández-Baca, David; Burleigh, John Gordon
2015-02-01
MulRF is a platform-independent software package for phylogenetic analysis using multi-copy gene trees. It seeks the species tree that minimizes the Robinson-Foulds (RF) distance to the input trees using a generalization of the RF distance to multi-labeled trees. The underlying generic tree distance measure and fast running time make MulRF useful for inferring phylogenies from large collections of gene trees, in which multiple evolutionary processes as well as phylogenetic error may contribute to gene tree discord. MulRF implements several features for customizing the species tree search and assessing the results, and it provides a user-friendly graphical user interface (GUI) with tree visualization. The species tree search is implemented in C++ and the GUI in Java Swing. MulRF's executable as well as sample datasets and manual are available at http://genome.cs.iastate.edu/CBL/MulRF/, and the source code is available at https://github.com/ruchiherself/MulRFRepo. ruchic@ufl.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Powell, J. Elijah; Ratnayeke, Nalin; Moran, Nancy A.
2017-01-01
High throughput rRNA amplicon surveys of bacterial communities provide a rapid snapshot of taxonomic composition. But strains with nearly identical rRNA sequences often differ in gene repertoires and metabolic capabilities. To assess strain-level variation within Snodgrassella alvi, a gut symbiont of corbiculate bees, we performed deep sequencing on amplicons of a single copy coding gene (minD) as well as the 16S rDNA V4 region. We surveyed honey bees (Apis mellifera) sampled globally and 12 bumble bee species (Bombus) sampled from two regions of the USA. The minD analyses reveal that S. alvi contains far more strain diversity than is evident from 16S rDNA analysis. Many taxa inferred on the basis of 16S rDNA are shared between A. mellifera and Bombus species, but taxa inferred on the basis of minD are never shared and often are restricted to particular Bombus species. Clustering based on minD revealed that gut communities often reflect host species and geographic location. Both minD and 16S rDNA analyses indicate that strain diversity is higher in A. mellifera than in Bombus species. The minD locus flanks a 16S gene, enabling development of strain-specific 16S fluorescent probes to illuminate the spatial relationship of strains within the bee gut. PMID:27482856
Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian
2012-05-01
To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, P<0.05). Nested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, P<0.01). The detection sensitivity of Sanger sequencing varied with the viral loads, especially in samples with low viral copies (HBV DNA ≤3log10 copies/ml), where the sensitivity was 78%, significantly lower than that of pyrosequencing (100%, P<0.01). Neither of the two methods yielded positive results for the negative control samples, suggesting their good specificity. Compared with nested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.
Di Gregorio, E; Riberi, E; Belligni, E F; Biamino, E; Spielmann, M; Ala, U; Calcia, A; Bagnasco, I; Carli, D; Gai, G; Giordano, M; Guala, A; Keller, R; Mandrile, G; Arduino, C; Maffè, A; Naretto, V G; Sirchia, F; Sorasio, L; Ungari, S; Zonta, A; Zacchetti, G; Talarico, F; Pappi, P; Cavalieri, S; Giorgio, E; Mancini, C; Ferrero, M; Brussino, A; Savin, E; Gandione, M; Pelle, A; Giachino, D F; De Marchi, M; Restagno, G; Provero, P; Cirillo Silengo, M; Grosso, E; Buxbaum, J D; Pasini, B; De Rubeis, S; Brusco, A; Ferrero, G B
2017-10-01
Array-comparative genomic hybridization (array-CGH) is a widely used technique to detect copy number variants (CNVs) associated with developmental delay/intellectual disability (DD/ID). Identification of genomic disorders in DD/ID. We performed a comprehensive array-CGH investigation of 1,015 consecutive cases with DD/ID and combined literature mining, genetic evidence, evolutionary constraint scores, and functional information in order to assess the pathogenicity of the CNVs. We identified non-benign CNVs in 29% of patients. Amongst the pathogenic variants (11%), detected with a yield consistent with the literature, we found rare genomic disorders and CNVs spanning known disease genes. We further identified and discussed 51 cases with likely pathogenic CNVs spanning novel candidate genes, including genes encoding synaptic components and/or proteins involved in corticogenesis. Additionally, we identified two deletions spanning potential Topological Associated Domain (TAD) boundaries probably affecting the regulatory landscape. We show how phenotypic and genetic analyses of array-CGH data allow unraveling complex cases, identifying rare disease genes, and revealing unexpected position effects. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Ren, Ren; Sun, Yazhou; Zhao, Yue; Geiser, David
2016-01-01
Abstract A comprehensive and reliable eukaryotic tree of life is important for many aspects of biological studies from comparative developmental and physiological analyses to translational medicine and agriculture. Both gene-rich and taxon-rich approaches are effective strategies to improve phylogenetic accuracy and are greatly facilitated by marker genes that are universally distributed, well conserved, and orthologous among divergent eukaryotes. In this article, we report the identification of 943 low-copy eukaryotic genes and we show that many of these genes are promising tools in resolving eukaryotic phylogenies, despite the challenges of determining deep eukaryotic relationships. As a case study, we demonstrate that smaller subsets of ∼20 and 52 genes could resolve controversial relationships among widely divergent taxa and provide strong support for deep relationships such as the monophyly and branching order of several eukaryotic supergroups. In addition, the use of these genes resulted in fungal phylogenies that are congruent with previous phylogenomic studies that used much larger datasets, and successfully resolved several difficult relationships (e.g., forming a highly supported clade with Microsporidia, Mitosporidium and Rozella sister to other fungi). We propose that these genes are excellent for both gene-rich and taxon-rich analyses and can be applied at multiple taxonomic levels and facilitate a more complete understanding of the eukaryotic tree of life. PMID:27604879
Micro-Scale Genomic DNA Copy Number Aberrations as Another Means of Mutagenesis in Breast Cancer
Chao, Hann-Hsiang; He, Xiaping; Parker, Joel S.; Zhao, Wei; Perou, Charles M.
2012-01-01
Introduction In breast cancer, the basal-like subtype has high levels of genomic instability relative to other breast cancer subtypes with many basal-like-specific regions of aberration. There is evidence that this genomic instability extends to smaller scale genomic aberrations, as shown by a previously described micro-deletion event in the PTEN gene in the Basal-like SUM149 breast cancer cell line. Methods We sought to identify if small regions of genomic DNA copy number changes exist by using a high density, gene-centric Comparative Genomic Hybridizations (CGH) array on cell lines and primary tumors. A custom tiling array for CGH (244,000 probes, 200 bp tiling resolution) was created to identify small regions of genomic change, which was focused on previously identified basal-like-specific, and general cancer genes. Tumor genomic DNA from 94 patients and 2 breast cancer cell lines was labeled and hybridized to these arrays. Aberrations were called using SWITCHdna and the smallest 25% of SWITCHdna-defined genomic segments were called micro-aberrations (<64 contiguous probes, ∼ 15 kb). Results Our data showed that primary tumor breast cancer genomes frequently contained many small-scale copy number gains and losses, termed micro-aberrations, most of which are undetectable using typical-density genome-wide aCGH arrays. The basal-like subtype exhibited the highest incidence of these events. These micro-aberrations sometimes altered expression of the involved gene. We confirmed the presence of the PTEN micro-amplification in SUM149 and by mRNA-seq showed that this resulted in loss of expression of all exons downstream of this event. Micro-aberrations disproportionately affected the 5′ regions of the affected genes, including the promoter region, and high frequency of micro-aberrations was associated with poor survival. Conclusion Using a high-probe-density, gene-centric aCGH microarray, we present evidence of small-scale genomic aberrations that can contribute to
Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.
Kordi, Misagh; Bansal, Mukul S
2017-06-01
Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.
Tsai, Yu-Shuen; Aguan, Kripamoy; Pal, Nikhil R.; Chung, I-Fang
2011-01-01
Informative genes from microarray data can be used to construct prediction model and investigate biological mechanisms. Differentially expressed genes, the main targets of most gene selection methods, can be classified as single- and multiple-class specific signature genes. Here, we present a novel gene selection algorithm based on a Group Marker Index (GMI), which is intuitive, of low-computational complexity, and efficient in identification of both types of genes. Most gene selection methods identify only single-class specific signature genes and cannot identify multiple-class specific signature genes easily. Our algorithm can detect de novo certain conditions of multiple-class specificity of a gene and makes use of a novel non-parametric indicator to assess the discrimination ability between classes. Our method is effective even when the sample size is small as well as when the class sizes are significantly different. To compare the effectiveness and robustness we formulate an intuitive template-based method and use four well-known datasets. We demonstrate that our algorithm outperforms the template-based method in difficult cases with unbalanced distribution. Moreover, the multiple-class specific genes are good biomarkers and play important roles in biological pathways. Our literature survey supports that the proposed method identifies unique multiple-class specific marker genes (not reported earlier to be related to cancer) in the Central Nervous System data. It also discovers unique biomarkers indicating the intrinsic difference between subtypes of lung cancer. We also associate the pathway information with the multiple-class specific signature genes and cross-reference to published studies. We find that the identified genes participate in the pathways directly involved in cancer development in leukemia data. Our method gives a promising way to find genes that can involve in pathways of multiple diseases and hence opens up the possibility of using an existing
Single-copy gene detection using branched DNA (bDNA) in situ hybridization.
Player, A N; Shen, L P; Kenny, D; Antao, V P; Kolberg, J A
2001-05-01
We have developed a branched DNA in situ hybridization (bDNA ISH) method for detection of human papillomavirus (HPV) DNA in whole cells. Using human cervical cancer cell lines with known copies of HPV DNA, we show that the bDNA ISH method is highly sensitive, detecting as few as one or two copies of HPV DNA per cell. By modifying sample pretreatment, viral mRNA or DNA sequences can be detected using the same set of oligonucleotide probes. In experiments performed on mixed populations of cells, the bDNA ISH method is highly specific and can distinguish cells with HPV-16 from cells with HPV-18 DNA. Furthermore, we demonstrate that the bDNA ISH method provides precise localization, yielding positive signals retained within the subcellular compartments in which the target nucleic acid sequences are localized. As an effective and convenient means for nucleic acid detection, the bDNA ISH method is applicable to the detection of cancers and infectious agents. (J Histochem Cytochem 49:603-611, 2001)
GAB2 Amplification in Squamous Cell Lung Cancer of Non-Smokers.
Park, Yu Rang; Bae, Soo Hyeon; Ji, Wonjun; Seo, Eul Ju; Lee, Jae Cheol; Kim, Hyeong Ryul; Jang, Se Jin; Choi, Chang Min
2017-11-01
Lung squamous cell cancer (SCC) is typically found in smokers and has a very low incidence in non-smokers, indicating differences in the tumor biology of lung SCC in smokers and non-smokers. However, the specific mutations that drive tumor growth in non-smokers have not been identified. To identify mutations in lung SCC of non-smokers, we performed a genetic analysis using arrays comparative genomic hybridization (ArrayCGH). We analyzed 19 patients with lung SCC who underwent surgical treatment between April 2005 and April 2015. Clinical characteristics were reviewed, and DNA was extracted from fresh frozen lung cancer specimens. All of copy number alterations from ArrayCGH were validated using The Cancer Genome Atlas (TCGA) copy number variation (CNV) data of lung SCC. We examined the frequency of copy number changes according to the smoking status (non-smoker [n = 8] or smoker [n = 11]). We identified 16 significantly altered regions from ArrayCGH data, three gain and four loss regions overlapped with the TCGA lung squamous cell carcinoma (LUSC) patients. Within these overlapped significant regions, we detected 15 genes that have been reported in the Cancer Gene census. We also found that the proto-oncogene GAB2 (11q14.1) was significantly amplified in non-smokers patients and vice versa in both ArrayCGH and TCGA data. Immunohistochemical analyses showed that GAB2 protein was relatively upregulated in non-smoker than smoker tissues (37.5% vs. 9.0%, P = 0.007). GAB2 amplification may have an important role in the development of lung SCC in non-smokers. GAB2 may represent a potential biomarker for lung SCC in non-smokers. © 2017 The Korean Academy of Medical Sciences.
Site-specific selfish genes as tools for the control and genetic engineering of natural populations.
Burt, Austin
2003-05-07
Site-specific selfish genes exploit host functions to copy themselves into a defined target DNA sequence, and include homing endonuclease genes, group II introns and some LINE-like transposable elements. If such genes can be engineered to target new host sequences, then they can be used to manipulate natural populations, even if the number of individuals released is a small fraction of the entire population. For example, a genetic load sufficient to eradicate a population can be imposed in fewer than 20 generations, if the target is an essential host gene, the knockout is recessive and the selfish gene has an appropriate promoter. There will be selection for resistance, but several strategies are available for reducing the likelihood of it evolving. These genes may also be used to genetically engineer natural populations, by means of population-wide gene knockouts, gene replacements and genetic transformations. By targeting sex-linked loci just prior to meiosis one may skew the population sex ratio, and by changing the promoter one may limit the spread of the gene to neighbouring populations. The proposed constructs are evolutionarily stable in the face of the mutations most likely to arise during their spread, and strategies are also available for reversing the manipulations.
MYC and Human Telomerase Gene (TERC) Copy Number Gain in Early-stage Non–small Cell Lung Cancer
Flacco, Antonella; Ludovini, Vienna; Bianconi, Fortunato; Ragusa, Mark; Bellezza, Guido; Tofanetti, Francesca R.; Pistola, Lorenza; Siggillino, Annamaria; Vannucci, Jacopo; Cagini, Lucio; Sidoni, Angelo; Puma, Francesco; Varella-Garcia, Marileila; Crinò, Lucio
2015-01-01
Objectives We investigated the frequency of MYC and TERC increased gene copy number (GCN) in early-stage non–small cell lung cancer (NSCLC) and evaluated the correlation of these genomic imbalances with clinicopathologic parameters and outcome. Materials and Methods Tumor tissues were obtained from 113 resected NSCLCs. MYC and TERC GCNs were tested by fluorescence in situ hybridization (FISH) according to the University of Colorado Cancer Center (UCCC) criteria and based on the receiver operating characteristic (ROC) classification. Results When UCCC criteria were applied, 41 (36%) cases for MYC and 41 (36%) cases for TERC were considered FISH-positive. MYC and TERC concurrent FISH-positive was observed in 12 cases (11%): 2 (17%) cases with gene amplification and 10 (83%) with high polysomy. By using the ROC analysis, high MYC (mean ≥2.83 copies/cell) and TERC (mean ≥2.65 copies/cell) GCNs were observed in 60 (53.1%) cases and 58 (51.3%) cases, respectively. High TERC GCN was associated with squamous cell carcinoma (SCC) histology (P = 0.001). In univariate analysis, increased MYC GCN was associated with shorter overall survival (P = 0.032 [UCCC criteria] or P = 0.02 [ROC classification]), whereas high TERC GCN showed no association. In multivariate analysis including stage and age, high MYC GCN remained significantly associated with worse overall survival using both the UCCC criteria (P = 0.02) and the ROC classification (P = 0.008). Conclusions Our results confirm MYC as frequently amplified in early-stage NSCLC and increased MYC GCN as a strong predictor of worse survival. Increased TERC GCN does not have prognostic impact but has strong association with squamous histology. PMID:25806711
Frech, Christian; Chen, Nansheng
2011-01-01
Genes underlying important phenotypic differences between Plasmodium species, the causative agents of malaria, are frequently found in only a subset of species and cluster at dynamically evolving subtelomeric regions of chromosomes. We hypothesized that chromosome-internal regions of Plasmodium genomes harbour additional species subset-specific genes that underlie differences in human pathogenicity, human-to-human transmissibility, and human virulence. We combined sequence similarity searches with synteny block analyses to identify species subset-specific genes in chromosome-internal regions of six published Plasmodium genomes, including Plasmodium falciparum, Plasmodium vivax, Plasmodium knowlesi, Plasmodium yoelii, Plasmodium berghei, and Plasmodium chabaudi. To improve comparative analysis, we first revised incorrectly annotated gene models using homology-based gene finders and examined putative subset-specific genes within syntenic contexts. Confirmed subset-specific genes were then analyzed for their role in biological pathways and examined for molecular functions using publicly available databases. We identified 16 genes that are well conserved in the three primate parasites but not found in rodent parasites, including three key enzymes of the thiamine (vitamin B1) biosynthesis pathway. Thirteen genes were found to be present in both human parasites but absent in the monkey parasite P. knowlesi, including genes specifically upregulated in sporozoites or gametocytes that could be linked to parasite transmission success between humans. Furthermore, we propose 15 chromosome-internal P. falciparum-specific genes as new candidate genes underlying increased human virulence and detected a currently uncharacterized cluster of P. vivax-specific genes on chromosome 6 likely involved in erythrocyte invasion. In conclusion, Plasmodium species harbour many chromosome-internal differences in the form of protein-coding genes, some of which are potentially linked to human
SG-ADVISER CNV: copy-number variant annotation and interpretation.
Erikson, Galina A; Deshpande, Neha; Kesavan, Balachandar G; Torkamani, Ali
2015-09-01
Copy-number variants have been associated with a variety of diseases, especially cancer, autism, schizophrenia, and developmental delay. The majority of clinically relevant events occur de novo, necessitating the interpretation of novel events. In this light, we present the Scripps Genome ADVISER CNV annotation pipeline and Web server, which aims to fill the gap between copy number variant detection and interpretation by performing in-depth annotations and functional predictions for copy number variants. The Scripps Genome ADVISER CNV suite includes a Web server interface to a high-performance computing environment for calculations of annotations and a table-based user interface that allows for the execution of numerous annotation-based variant filtration strategies and statistics. The annotation results include details regarding location, impact on the coding portion of genes, allele frequency information (including allele frequencies from the Scripps Wellderly cohort), and overlap information with other reference data sets (including ClinVar, DGV, DECIPHER). A summary variant classification is produced (ADVISER score) based on the American College of Medical Genetics and Genomics scoring guidelines. We demonstrate >90% sensitivity/specificity for detection of pathogenic events. Scripps Genome ADVISER CNV is designed to allow users with no prior bioinformatics expertise to manipulate large volumes of copy-number variant data. Scripps Genome ADVISER CNV is available at http://genomics.scripps.edu/ADVISER/.
Copy Number Variations of TBK1 in Australian Patients With Primary Open-Angle Glaucoma
AWADALLA, MONA S.; FINGERT, JOHN H.; ROOS, BENJAMIN E.; CHEN, SIMON; HOLMES, RICHARD; GRAHAM, STUART L.; CHEHADE, MARK; GALANOPOLOUS, ANNA; RIDGE, BRONWYN; SOUZEAU, EMMANUELLE; ZHOU, TIGER; SIGGS, OWEN M.; HEWITT, ALEX W.; MACKEY, DAVID A.; BURDON, KATHRYN P.; CRAIG, JAMIE E.
2015-01-01
PURPOSE To investigate the presence of TBK1 copy number variations in a large, well-characterized Australian cohort of patients with glaucoma comprising both normal-tension glaucoma and high-tension glaucoma cases. DESIGN A retrospective cohort study. METHODS DNA samples from patients with normal-tension glaucoma and high-tension glaucoma and unaffected controls were screened for TBK1 copy number variations using real-time quantitative polymerase chain reaction. Samples with additional copies of the TBK1 gene were further tested using custom comparative genomic hybridization arrays. RESULTS Four out of 334 normal-tension glaucoma cases (1.2%) were found to carry TBK1 copy number variations using quantitative polymerase chain reaction. One extra dose of the TBK1 gene (duplication) was detected in 3 normal-tension glaucoma patients, while 2 extra doses of the gene (triplication) were detected in a fourth normal-tension glaucoma patient. The results were further confirmed by custom comparative genomic hybridization arrays. Further, the TBK1 copy number variation segregated with normal-tension glaucoma in the family members of the probands, showing an autosomal dominant pattern of inheritance. No TBK1 copy number variations were detected in 1045 Australian patients with high-tension glaucoma or in 254 unaffected controls. CONCLUSION We report the presence of TBK1 copy number variations in our Australian normal-tension glaucoma cohort, including the first example of more than 1 extra copy of this gene in glaucoma patients (gene triplication). These results confirm TBK1 to be an important cause of normal-tension glaucoma, but do not suggest common involvement in high-tension glaucoma. PMID:25284765
Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles
2008-01-01
So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.
Kim, Min Hwan; Lee, Soohyeon; Koo, Ja Seung; Jung, Kyung Hae; Park, In Hae; Jeong, Joon; Kim, Seung Il; Park, Seho; Park, Hyung Seok; Park, Byeong-Woo; Kim, Joo-Hang; Sohn, Joohyuk
2015-01-01
Background Inflammatory breast cancer (IBC) is the most aggressive form of breast cancer, and its molecular pathogenesis still remains to be elucidated. This study aimed to evaluate the prevalence and implication of anaplastic lymphoma kinase (ALK) copy number change in IBC patients. Methods We retrospectively collected formalin-fixed, paraffin-embedded tumor tissues and medical records of IBC patients from several institutes in Korea. ALK gene copy number change and rearrangement were assessed by fluorescence in situ hybridization (FISH) assay, and ALK expression status was evaluated by immunohistochemical (IHC) staining. Results Thirty-six IBC patients including those with HER2 (+) breast cancer (16/36, 44.4%) and triple-negative breast cancer (13/36, 36.1%) were enrolled in this study. ALK copy number gain (CNG) was observed in 47.2% (17/36) of patients, including one patient who harbored ALK gene amplification. ALK CNG (+) patients showed significantly worse overall survival compared to ALK CNG (-) patients in univariate analysis (24.9 months vs. 38.1 months, p = 0.033). Recurrence free survival (RFS) after curative mastectomy was also significantly shorter in ALK CNG (+) patients than in ALK CNG (-) patients (n = 22, 12.7 months vs. 43.3 months, p = 0.016). Multivariate Cox regression analysis with adjustment for HER2 and ER statuses showed significantly poorer RFS for ALK CNG (+) patients (HR 5.63, 95% CI 1.11–28.44, p = 0.037). Conclusion This study shows a significant presence of ALK CNG in IBC patients, and ALK CNG was associated with significantly poorer RFS. PMID:25803816
Kim, Min Hwan; Lee, Soohyeon; Koo, Ja Seung; Jung, Kyung Hae; Park, In Hae; Jeong, Joon; Kim, Seung Il; Park, Seho; Park, Hyung Seok; Park, Byeong-Woo; Kim, Joo-Hang; Sohn, Joohyuk
2015-01-01
Inflammatory breast cancer (IBC) is the most aggressive form of breast cancer, and its molecular pathogenesis still remains to be elucidated. This study aimed to evaluate the prevalence and implication of anaplastic lymphoma kinase (ALK) copy number change in IBC patients. We retrospectively collected formalin-fixed, paraffin-embedded tumor tissues and medical records of IBC patients from several institutes in Korea. ALK gene copy number change and rearrangement were assessed by fluorescence in situ hybridization (FISH) assay, and ALK expression status was evaluated by immunohistochemical (IHC) staining. Thirty-six IBC patients including those with HER2 (+) breast cancer (16/36, 44.4%) and triple-negative breast cancer (13/36, 36.1%) were enrolled in this study. ALK copy number gain (CNG) was observed in 47.2% (17/36) of patients, including one patient who harbored ALK gene amplification. ALK CNG (+) patients showed significantly worse overall survival compared to ALK CNG (-) patients in univariate analysis (24.9 months vs. 38.1 months, p = 0.033). Recurrence free survival (RFS) after curative mastectomy was also significantly shorter in ALK CNG (+) patients than in ALK CNG (-) patients (n = 22, 12.7 months vs. 43.3 months, p = 0.016). Multivariate Cox regression analysis with adjustment for HER2 and ER statuses showed significantly poorer RFS for ALK CNG (+) patients (HR 5.63, 95% CI 1.11-28.44, p = 0.037). This study shows a significant presence of ALK CNG in IBC patients, and ALK CNG was associated with significantly poorer RFS.
Screen for mitochondrial DNA copy number maintenance genes reveals essential role for ATP synthase
Fukuoh, Atsushi; Cannino, Giuseppe; Gerards, Mike; Buckley, Suzanne; Kazancioglu, Selena; Scialo, Filippo; Lihavainen, Eero; Ribeiro, Andre; Dufour, Eric; Jacobs, Howard T
2014-01-01
The machinery of mitochondrial DNA (mtDNA) maintenance is only partially characterized and is of wide interest due to its involvement in disease. To identify novel components of this machinery, plus other cellular pathways required for mtDNA viability, we implemented a genome-wide RNAi screen in Drosophila S2 cells, assaying for loss of fluorescence of mtDNA nucleoids stained with the DNA-intercalating agent PicoGreen. In addition to previously characterized components of the mtDNA replication and transcription machineries, positives included many proteins of the cytosolic proteasome and ribosome (but not the mitoribosome), three proteins involved in vesicle transport, some other factors involved in mitochondrial biogenesis or nuclear gene expression, > 30 mainly uncharacterized proteins and most subunits of ATP synthase (but no other OXPHOS complex). ATP synthase knockdown precipitated a burst of mitochondrial ROS production, followed by copy number depletion involving increased mitochondrial turnover, not dependent on the canonical autophagy machinery. Our findings will inform future studies of the apparatus and regulation of mtDNA maintenance, and the role of mitochondrial bioenergetics and signaling in modulating mtDNA copy number. PMID:24952591
A diffusion model for the fate of tandem gene duplicates in diploids.
O'Hely, Martin
2007-06-01
Suppose one chromosome in one member of a population somehow acquires a duplicate copy of the gene, fully linked to the original gene's locus. Preservation is the event that eventually every chromosome in the population is a descendant of the one which initially carried the duplicate. For a haploid population in which the absence of all copies of the gene is lethal, the probability of preservation has recently been estimated via a diffusion approximation. That approximation is shown to carry over to the case of diploids and arbitrary strong selection against the absence of the gene. The techniques used lead to some new results. In the large population limit, it is shown that the relative probability that descendants of a small number of individuals carrying multiple copies of the gene fix in the population is proportional to the number of copies carried. The probability of preservation is approximated when chromosomes carrying two copies of the gene are subject to additional, fully non-functionalizing mutations, thereby modelling either an additional cost of replicating a longer genome, or a partial duplication of the gene. In the latter case the preservation probability depends only on the mutation rate to null for the duplicated portion of the gene.
iCopyDAV: Integrated platform for copy number variations—Detection, annotation and visualization
Vogeti, Sriharsha
2018-01-01
Discovery of copy number variations (CNVs), a major category of structural variations, have dramatically changed our understanding of differences between individuals and provide an alternate paradigm for the genetic basis of human diseases. CNVs include both copy gain and copy loss events and their detection genome-wide is now possible using high-throughput, low-cost next generation sequencing (NGS) methods. However, accurate detection of CNVs from NGS data is not straightforward due to non-uniform coverage of reads resulting from various systemic biases. We have developed an integrated platform, iCopyDAV, to handle some of these issues in CNV detection in whole genome NGS data. It has a modular framework comprising five major modules: data pre-treatment, segmentation, variant calling, annotation and visualization. An important feature of iCopyDAV is the functional annotation module that enables the user to identify and prioritize CNVs encompassing various functional elements, genomic features and disease-associations. Parallelization of the segmentation algorithms makes the iCopyDAV platform even accessible on a desktop. Here we show the effect of sequencing coverage, read length, bin size, data pre-treatment and segmentation approaches on accurate detection of the complete spectrum of CNVs. Performance of iCopyDAV is evaluated on both simulated data and real data for different sequencing depths. It is an open-source integrated pipeline available at https://github.com/vogetihrsh/icopydav and as Docker’s image at http://bioinf.iiit.ac.in/icopydav/. PMID:29621297
New digital anti-copy/scan and verification technologies
NASA Astrophysics Data System (ADS)
Phillips, George K.
2004-06-01
This white paper reviews the method for making bearer printed information indistinguishable on a non-copyable substrate when a copied attempt is made on either an analog or digital electrostatic photocopier device. In 1995 we received patent number 5,704,651 for a non-copyable technology trademarked MetallicSafe. In this patent the abstract describes the usage of a reflective layer, formed on a complex pattern region and having graphic or font size shapes and type coordinating to particular patterns in the complex pattern region. The technology used in this patent has now been improved and evolved to new methods of creating a non-copyable substrate trademarked CopySafe+. CopySafe+ is formed of a metallic specular light reflector, a white camouflaged diffused light reflector, and the content information 'light absorption' layer. The synthesizing of these layers on a substrate creates dynamic camouflaged interference patterns and the phenomena of image chaos on a copy. In short, the orientation of a plurality of spectral and diffused light reflection camouflaged layers, mixed and coordinated with light absorption printed information, inhibits the copying device from reproducing the printed content.
CCL3L1 copy number and susceptibility to malaria
Carpenter, Danielle; Färnert, Anna; Rooth, Ingegerd; Armour, John A.L.; Shaw, Marie-Anne
2012-01-01
Copy number variation can contribute to the variation observed in susceptibility to complex diseases. Here we present the first study to investigate copy number variation of the chemokine gene CCL3L1 with susceptibility to malaria. We present a family-based genetic analysis of a Tanzanian population (n = 922), using parasite load, mean number of clinical infections of malaria and haemoglobin levels as phenotypes. Copy number of CCL3L1 was measured using the paralogue ratio test (PRT) and the dataset exhibited copy numbers ranging between 1 and 10 copies per diploid genome (pdg). Association between copy number and phenotypes was assessed. Furthermore, we were able to identify copy number haplotypes in some families, using microsatellites within the copy variable region, for transmission disequilibrium testing. We identified a high level of copy number haplotype diversity and find some evidence for an association of low CCL3L1 copy number with protection from anaemia. PMID:22484763
CCL3L1 copy number and susceptibility to malaria.
Carpenter, Danielle; Färnert, Anna; Rooth, Ingegerd; Armour, John A L; Shaw, Marie-Anne
2012-07-01
Copy number variation can contribute to the variation observed in susceptibility to complex diseases. Here we present the first study to investigate copy number variation of the chemokine gene CCL3L1 with susceptibility to malaria. We present a family-based genetic analysis of a Tanzanian population (n=922), using parasite load, mean number of clinical infections of malaria and haemoglobin levels as phenotypes. Copy number of CCL3L1 was measured using the paralogue ratio test (PRT) and the dataset exhibited copy numbers ranging between 1 and 10 copies per diploid genome (pdg). Association between copy number and phenotypes was assessed. Furthermore, we were able to identify copy number haplotypes in some families, using microsatellites within the copy variable region, for transmission disequilibrium testing. We identified a high level of copy number haplotype diversity and find some evidence for an association of low CCL3L1 copy number with protection from anaemia. Copyright © 2012 Elsevier B.V. All rights reserved.
Environmental change drives accelerated adaptation through stimulated copy number variation
Hull, Ryan M.; Cruz, Cristina; Jack, Carmen V.
2017-01-01
Copy number variation (CNV) is rife in eukaryotic genomes and has been implicated in many human disorders, particularly cancer, in which CNV promotes both tumorigenesis and chemotherapy resistance. CNVs are considered random mutations but often arise through replication defects; transcription can interfere with replication fork progression and stability, leading to increased mutation rates at highly transcribed loci. Here we investigate whether inducible promoters can stimulate CNV to yield reproducible, environment-specific genetic changes. We propose a general mechanism for environmentally-stimulated CNV and validate this mechanism for the emergence of copper resistance in budding yeast. By analysing a large cohort of individual cells, we directly demonstrate that CNV of the copper-resistance gene CUP1 is stimulated by environmental copper. CNV stimulation accelerates the formation of novel alleles conferring enhanced copper resistance, such that copper exposure actively drives adaptation to copper-rich environments. Furthermore, quantification of CNV in individual cells reveals remarkable allele selectivity in the rate at which specific environments stimulate CNV. We define the key mechanistic elements underlying this selectivity, demonstrating that CNV is regulated by both promoter activity and acetylation of histone H3 lysine 56 (H3K56ac) and that H3K56ac is required for CUP1 CNV and efficient copper adaptation. Stimulated CNV is not limited to high-copy CUP1 repeat arrays, as we find that H3K56ac also regulates CNV in 3 copy arrays of CUP1 or SFA1 genes. The impact of transcription on DNA damage is well understood, but our research reveals that this apparently problematic association forms a pathway by which mutations can be directed to particular loci in particular environments and furthermore that this mutagenic process can be regulated through histone acetylation. Stimulated CNV therefore represents an unanticipated and remarkably controllable pathway
Soneson, Charlotte; Lilljebjörn, Henrik; Fioretos, Thoas; Fontes, Magnus
2010-04-15
With the rapid development of new genetic measurement methods, several types of genetic alterations can be quantified in a high-throughput manner. While the initial focus has been on investigating each data set separately, there is an increasing interest in studying the correlation structure between two or more data sets. Multivariate methods based on Canonical Correlation Analysis (CCA) have been proposed for integrating paired genetic data sets. The high dimensionality of microarray data imposes computational difficulties, which have been addressed for instance by studying the covariance structure of the data, or by reducing the number of variables prior to applying the CCA. In this work, we propose a new method for analyzing high-dimensional paired genetic data sets, which mainly emphasizes the correlation structure and still permits efficient application to very large data sets. The method is implemented by translating a regularized CCA to its dual form, where the computational complexity depends mainly on the number of samples instead of the number of variables. The optimal regularization parameters are chosen by cross-validation. We apply the regularized dual CCA, as well as a classical CCA preceded by a dimension-reducing Principal Components Analysis (PCA), to a paired data set of gene expression changes and copy number alterations in leukemia. Using the correlation-maximizing methods, regularized dual CCA and PCA+CCA, we show that without pre-selection of known disease-relevant genes, and without using information about clinical class membership, an exploratory analysis singles out two patient groups, corresponding to well-known leukemia subtypes. Furthermore, the variables showing the highest relevance to the extracted features agree with previous biological knowledge concerning copy number alterations and gene expression changes in these subtypes. Finally, the correlation-maximizing methods are shown to yield results which are more biologically
GEAR: genomic enrichment analysis of regional DNA copy number changes.
Kim, Tae-Min; Jung, Yu-Chae; Rhyu, Mun-Gan; Jung, Myeong Ho; Chung, Yeun-Jun
2008-02-01
We developed an algorithm named GEAR (genomic enrichment analysis of regional DNA copy number changes) for functional interpretation of genome-wide DNA copy number changes identified by array-based comparative genomic hybridization. GEAR selects two types of chromosomal alterations with potential biological relevance, i.e. recurrent and phenotype-specific alterations. Then it performs functional enrichment analysis using a priori selected functional gene sets to identify primary and clinical genomic signatures. The genomic signatures identified by GEAR represent functionally coordinated genomic changes, which can provide clues on the underlying molecular mechanisms related to the phenotypes of interest. GEAR can help the identification of key molecular functions that are activated or repressed in the tumor genomes leading to the improved understanding on the tumor biology. GEAR software is available with online manual in the website, http://www.systemsbiology.co.kr/GEAR/.
Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi
2007-05-01
The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.
Schmouth, Jean-François; Castellarin, Mauro; Laprise, Stéphanie; Banks, Kathleen G; Bonaguro, Russell J; McInerny, Simone C; Borretta, Lisa; Amirabbasi, Mahsa; Korecki, Andrea J; Portales-Casamar, Elodie; Wilson, Gary; Dreolini, Lisa; Jones, Steven J M; Wasserman, Wyeth W; Goldowitz, Daniel; Holt, Robert A; Simpson, Elizabeth M
2013-10-14
The next big challenge in human genetics is understanding the 98% of the genome that comprises non-coding DNA. Hidden in this DNA are sequences critical for gene regulation, and new experimental strategies are needed to understand the functional role of gene-regulation sequences in health and disease. In this study, we build upon our HuGX ('high-throughput human genes on the X chromosome') strategy to expand our understanding of human gene regulation in vivo. In all, ten human genes known to express in therapeutically important brain regions were chosen for study. For eight of these genes, human bacterial artificial chromosome clones were identified, retrofitted with a reporter, knocked single-copy into the Hprt locus in mouse embryonic stem cells, and mouse strains derived. Five of these human genes expressed in mouse, and all expressed in the adult brain region for which they were chosen. This defined the boundaries of the genomic DNA sufficient for brain expression, and refined our knowledge regarding the complexity of gene regulation. We also characterized for the first time the expression of human MAOA and NR2F2, two genes for which the mouse homologs have been extensively studied in the central nervous system (CNS), and AMOTL1 and NOV, for which roles in CNS have been unclear. We have demonstrated the use of the HuGX strategy to functionally delineate non-coding-regulatory regions of therapeutically important human brain genes. Our results also show that a careful investigation, using publicly available resources and bioinformatics, can lead to accurate predictions of gene expression.
Safari, Roghieh; Hoseinifar, Seyed Hossein; Nejadmoghadam, Shabnam; Jafar, Ali
2016-08-01
A 8-weeks feeding trial was conducted to examine the effects of different levels (0, 0.5, 1 and 2%) of dietary Ferula (Ferula assafoetida) on expression of antioxidant enzymes (GSR, GPX and GSTA), immune (TNF-alpha, IL1B, IL- 8 and LYZ) and growth (GH, IGF1 and Ghrl) genes as well as cutaneous mucus and serum non-specific immune response in common carp. The results revealed Ferula significantly increased antioxidant gene expression (GSR and GSTA) in a dose dependent manner (P < 0.05). The expression of immune growth related genes were significantly higher in Ferula fed fish compared control group (P < 0.05). The effects of Ferula on expression of genes was more pronounced in higher doses. Feeding on Ferula supplemented diet remarkably increased skin mucus lysozyme activity (P < 0.05). However, evaluation of mucus total Ig and protease activity revealed no significant difference between control and treated groups (P > 0.05). Regarding non-specific humoral response, serum total Ig, lysozyme and ACH50 showed no remarkable variation between Ferula fed carps and control group (P > 0.05). These results indicated up-regulation of growth and health related genes in Ferula fed common carp. Further studies using pathogen or stress challenge is required to conclude that transcriptional modulation is beneficial in common carp. Copyright © 2016 Elsevier Ltd. All rights reserved.
Accurate measurement of transgene copy number in crop plants using droplet digital PCR.
Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger
2017-06-01
Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
Boutrot, Freddy; Meynard, Donaldo; Guiderdoni, Emmanuel; Joudrier, Philippe; Gautier, Marie-Françoise
2007-03-01
Plant non-specific lipid transfer proteins (nsLTPs) are encoded by a multigene family and support physiological functions, which remain unclear. We adapted an efficient ligation-mediated polymerase chain reaction (LM-PCR) procedure that enabled isolation of 22 novel Triticum aestivum nsLtp (TaLtp) genes encoding types 1 and 2 nsLTPs. A phylogenetic tree clustered the wheat nsLTPs into ten subfamilies comprising 1-7 members. We also studied the activity of four type 1 and two type 2 TaLtp gene promoters in transgenic rice using the 1-Glucuronidase reporter gene. The activities of the six promoters displayed both overlapping and distinct features in rice. In vegetative organs, these promoters were active in leaves and root vascular tissues while no beta-Glucuronidase (GUS) activity was detected in stems. In flowers, the GUS activity driven by the TaLtp7.2a, TaLtp9.1a, TaLtp9.2d, and TaLtp9.3e gene promoters was associated with vascular tissues in glumes and in the extremities of anther filaments whereas only the TaLtp9.4a gene promoter was active in anther epidermal cells. In developing grains, GUS activity and GUS immunolocalization data evidenced complex patterns of activity of the TaLtp7.1a, TaLtp9.2d, and TaLtp9.4a gene promoters in embryo scutellum and in the grain epicarp cell layer. In contrast, GUS activity driven by TaLtp7.2a, TaLtp9.1a, and TaLtp9.3e promoters was restricted to the vascular bundle of the embryo scutellum. This diversity of TaLtp gene promoter activity supports the hypothesis that the encoded TaLTPs possess distinct functions in planta.
Homology-dependent Gene Silencing in Paramecium
Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa
1998-01-01
Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389
Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L
2009-07-01
Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (
Shin, Dong-Ho; Webb, Barbara M.; Nakao, Miki; Smith, Sylvia L.
2009-01-01
Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and –d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (≤) amino acid identities with each other, 35.4 ~ 39.6% and 62.8 ~ 65.9% with factor I of mammals and banded houndshark (Triakis scyllium), respectively. The modular structure of the GcIf is similar to that of mammals with one notable exception, the presence of a novel shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1, 2 and 3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082 bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent. PMID:19423168
Diniz, Marina Gonçalves; Duarte, Alessandra Pires; Villacis, Rolando A; Guimarães, Bruna V A; Duarte, Luiz Cláudio Pires; Rogatto, Sílvia R; Gomez, Ricardo Santiago; Gomes, Carolina Cavaliéri
2017-05-01
Ameloblastoma (unicystic, UA, or multicystic, MA) is a rare tumor associated with bone destruction and facial deformity. Its malignant counterpart is the ameloblastic carcinoma (AC). The BRAFV600E mutation is highly prevalent in all these tumors subtypes and cannot account for their different clinical behaviors. We assessed copy number alterations (CNAs) and copy-neutral loss of heterozygosity (cnLOH) in UA (n = 2), MA (n = 3), and AC (n = 1) using the CytoScan HD Array (Affymetrix) and the BRAFV600E status. RT-qPCR was applied in four selected genes (B4GALT1, BAG1, PKD1L2, and PPP2R5A) covered by rare alterations, also including three MA and four normal oral tissues. Fifty-seven CNAs and cnLOH were observed in the ameloblastomas and six CNAs in the AC. Seven of the CNAs were rare (six in UA and one in MA), four of them encompassing genes (gains of 7q11.21, 1q32.3, and 9p21.1 and loss of 16q23.2). We found positive correlation between rare CNA gene dosage and the expression of B4GALT1, BAG1, PKD1L2, and PPP2R5A. The AC and 1 UA were BRAF wild-type; however, this UA showed rare genomic alterations encompassing genes associated with RAF/MAPK activation. Ameloblastomas show rare CNAs and cnLOH, presenting a specific genomic profile with no overlapping of the rare alterations among UA, MA, and AC. These genomic changes might play a role in tumor evolution and in BRAFV600E-negative tumors. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Specific non-monotonous interactions increase persistence of ecological networks.
Yan, Chuan; Zhang, Zhibin
2014-03-22
The relationship between stability and biodiversity has long been debated in ecology due to opposing empirical observations and theoretical predictions. Species interaction strength is often assumed to be monotonically related to population density, but the effects on stability of ecological networks of non-monotonous interactions that change signs have not been investigated previously. We demonstrate that for four kinds of non-monotonous interactions, shifting signs to negative or neutral interactions at high population density increases persistence (a measure of stability) of ecological networks, while for the other two kinds of non-monotonous interactions shifting signs to positive interactions at high population density decreases persistence of networks. Our results reveal a novel mechanism of network stabilization caused by specific non-monotonous interaction types through either increasing stable equilibrium points or reducing unstable equilibrium points (or both). These specific non-monotonous interactions may be important in maintaining stable and complex ecological networks, as well as other networks such as genes, neurons, the internet and human societies.
Goay, Yuan Xin; Chin, Kai Ling; Tan, Clarissa Ling Ling; Yeoh, Chiann Ying; Ja'afar, Ja'afar Nuhu; Zaidah, Abdul Rahman; Chinni, Suresh Venkata; Phua, Kia Kien
2016-01-01
Salmonella Typhi ( S . Typhi) causes typhoid fever which is a disease characterised by high mortality and morbidity worldwide. In order to curtail the transmission of this highly infectious disease, identification of new markers that can detect the pathogen is needed for development of sensitive and specific diagnostic tests. In this study, genomic comparison of S . Typhi with other enteric pathogens was performed, and 6 S . Typhi genes, that is, STY0201, STY0307, STY0322, STY0326, STY2020, and STY2021, were found to be specific in silico . Six PCR assays each targeting a unique gene were developed to test the specificity of these genes in vitro . The diagnostic sensitivities and specificities of each assay were determined using 39 S . Typhi, 62 non-Typhi Salmonella , and 10 non- Salmonella clinical isolates. The results showed that 5 of these genes, that is, STY0307, STY0322, STY0326, STY2020, and STY2021, demonstrated 100% sensitivity (39/39) and 100% specificity (0/72). The detection limit of the 5 PCR assays was 32 pg for STY0322, 6.4 pg for STY0326, STY2020, and STY2021, and 1.28 pg for STY0307. In conclusion, 5 PCR assays using STY0307, STY0322, STY0326, STY2020, and STY2021 were developed and found to be highly specific at single-gene target resolution for diagnosis of typhoid fever.
Inheritance-mode specific pathogenicity prioritization (ISPP) for human protein coding genes.
Hsu, Jacob Shujui; Kwan, Johnny S H; Pan, Zhicheng; Garcia-Barcelo, Maria-Mercè; Sham, Pak Chung; Li, Miaoxin
2016-10-15
Exome sequencing studies have facilitated the detection of causal genetic variants in yet-unsolved Mendelian diseases. However, the identification of disease causal genes among a list of candidates in an exome sequencing study is still not fully settled, and it is often difficult to prioritize candidate genes for follow-up studies. The inheritance mode provides crucial information for understanding Mendelian diseases, but none of the existing gene prioritization tools fully utilize this information. We examined the characteristics of Mendelian disease genes under different inheritance modes. The results suggest that Mendelian disease genes with autosomal dominant (AD) inheritance mode are more haploinsufficiency and de novo mutation sensitive, whereas those autosomal recessive (AR) genes have significantly more non-synonymous variants and regulatory transcript isoforms. In addition, the X-linked (XL) Mendelian disease genes have fewer non-synonymous and synonymous variants. As a result, we derived a new scoring system for prioritizing candidate genes for Mendelian diseases according to the inheritance mode. Our scoring system assigned to each annotated protein-coding gene (N = 18 859) three pathogenic scores according to the inheritance mode (AD, AR and XL). This inheritance mode-specific framework achieved higher accuracy (area under curve = 0.84) in XL mode. The inheritance-mode specific pathogenicity prioritization (ISPP) outperformed other well-known methods including Haploinsufficiency, Recessive, Network centrality, Genic Intolerance, Gene Damage Index and Gene Constraint scores. This systematic study suggests that genes manifesting disease inheritance modes tend to have unique characteristics. ISPP is included in KGGSeq v1.0 (http://grass.cgs.hku.hk/limx/kggseq/), and source code is available from (https://github.com/jacobhsu35/ISPP.git). mxli@hku.hkSupplementary information: Supplementary data are available at Bioinformatics online. © The Author
Whitney, LeAnn P.; Lins, Jeremy J.; Hughes, Margaret P.; Wells, Mark L.; Chappell, P. Dreux; Jenkins, Bethany D.
2011-01-01
Iron (Fe) availability restricts diatom growth and primary production in large areas of the oceans. It is a challenge to assess the bulk Fe nutritional health of natural diatom populations, since species can differ in their physiological and molecular responses to Fe limitation. We assayed expression of selected genes in diatoms from the Thalassiosira genus to assess their potential utility as species-specific molecular markers to indicate Fe status in natural diatom assemblages. In this study, we compared the expression of the photosynthetic genes encoding ferredoxin (a Fe-requiring protein) and flavodoxin (a Fe-free protein) in culture experiments with Fe replete and Fe stressed Thalassiosira pseudonana (CCMP 1335) isolated from coastal waters and Thalassiosira weissflogii (CCMP 1010) isolated from the open ocean. In T. pseudonana, expression of flavodoxin and ferredoxin genes were not sensitive to Fe status but were found to display diel periodicities. In T. weissflogii, expression of flavodoxin was highly responsive to iron levels and was only detectable when cultures were Fe limited. Flavodoxin genes have been duplicated in most diatoms with available genome data and we show that T. pseudonana has lost its copy related to the Fe-responsive copy in T. weissflogii. We also examined the expression of genes for a putative high affinity, copper (Cu)-dependent Fe uptake system in T. pseudonana. Our results indicate that genes encoding putative Cu transporters, a multi-Cu oxidase, and a Fe reductase are not linked to Fe status. The expression of a second putative Fe reductase increased in Fe limited cultures, but this gene was also highly expressed in Fe replete cultures, indicating it may not be a useful marker in the field. Our findings highlight that Fe metabolism may differ among diatoms even within a genus and show a need to validate responses in different species as part of the development pipeline for genetic markers of Fe status in field populations. PMID
Stagni, Camilla; Zamuner, Carolina; Elefanti, Lisa; Zanin, Tiziana; Bianco, Paola Del; Sommariva, Antonio; Fabozzi, Alessio; Pigozzo, Jacopo; Mocellin, Simone; Montesco, Maria Cristina; Chiarion-Sileni, Vanna; De Nicolo, Arcangela; Menin, Chiara
2018-06-01
Metastatic melanoma is characterized by complex genomic alterations, including a high rate of mutations in driver genes and widespread deletions and amplifications encompassing various chromosome regions. Among them, chromosome 7 is frequently gained in BRAF -mutant melanoma, inducing a mutant allele-specific imbalance. Although BRAF amplification is a known mechanism of acquired resistance to therapy with MAPK inhibitors, it is still unclear if BRAF copy-number variation and BRAF mutant allele imbalance at baseline can be associated with response to treatment. In this study, we used a multimodal approach to assess BRAF copy number and mutant allele frequency in pretreatment melanoma samples from 46 patients who received MAPK inhibitor-based therapy, and we analyzed the association with progression-free survival. We found that 65% patients displayed BRAF gains, often supported by chromosome 7 polysomy. In addition, we observed that 64% patients had a balanced BRAF -mutant/wild-type allele ratio, whereas 14% and 23% patients had low and high BRAF mutant allele frequency, respectively. Notably, a significantly higher risk of progression was observed in patients with a diploid BRAF status versus those with BRAF gains [HR, 2.86; 95% confidence interval (CI), 1.29-6.35; P = 0.01] and in patients with low percentage versus those with a balanced BRAF mutant allele percentage (HR, 4.54; 95% CI, 1.33-15.53; P = 0.016). Our data suggest that quantitative analysis of the BRAF gene could be useful to select the melanoma patients who are most likely to benefit from therapy with MAPK inhibitors. Mol Cancer Ther; 17(6); 1332-40. ©2018 AACR . ©2018 American Association for Cancer Research.
Du, Meng-Ze; Wei, Wen; Qin, Lei; Liu, Shuo; Zhang, An-Ying; Zhang, Yong; Zhou, Hong; Guo, Feng-Biao
2017-12-01
Although more and more entangled participants of translation process were realized, how they cooperate and co-determine the final translation efficiency still lacks details. Here, we reasoned that the basic translation components, tRNAs and amino acids should be consistent to maximize the efficiency and minimize the cost. We firstly revealed that 310 out of 410 investigated genomes of three domains had significant co-adaptions between the tRNA gene copy numbers and amino acid compositions, indicating that maximum efficiency constitutes ubiquitous selection pressure on protein translation. Furthermore, fast-growing and larger bacteria are found to have significantly better co-adaption and confirmed the effect of this pressure. Within organism, highly expressed proteins and those connected to acute responses have higher co-adaption intensity. Thus, the better co-adaption probably speeds up the growing of cells through accelerating the translation of special proteins. Experimentally, manipulating the tRNA gene copy number to optimize co-adaption between enhanced green fluorescent protein (EGFP) and tRNA gene set of Escherichia coli indeed lifted the translation rate (speed). Finally, as a newly confirmed translation rate regulating mechanism, the co-adaption reflecting translation rate not only deepens our understanding on translation process but also provides an easy and practicable method to improve protein translation rates and productivity. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Du, Meng-Ze; Wei, Wen; Qin, Lei; Liu, Shuo; Zhang, An-Ying; Zhang, Yong; Zhou, Hong
2017-01-01
Abstract Although more and more entangled participants of translation process were realized, how they cooperate and co-determine the final translation efficiency still lacks details. Here, we reasoned that the basic translation components, tRNAs and amino acids should be consistent to maximize the efficiency and minimize the cost. We firstly revealed that 310 out of 410 investigated genomes of three domains had significant co-adaptions between the tRNA gene copy numbers and amino acid compositions, indicating that maximum efficiency constitutes ubiquitous selection pressure on protein translation. Furthermore, fast-growing and larger bacteria are found to have significantly better co-adaption and confirmed the effect of this pressure. Within organism, highly expressed proteins and those connected to acute responses have higher co-adaption intensity. Thus, the better co-adaption probably speeds up the growing of cells through accelerating the translation of special proteins. Experimentally, manipulating the tRNA gene copy number to optimize co-adaption between enhanced green fluorescent protein (EGFP) and tRNA gene set of Escherichia coli indeed lifted the translation rate (speed). Finally, as a newly confirmed translation rate regulating mechanism, the co-adaption reflecting translation rate not only deepens our understanding on translation process but also provides an easy and practicable method to improve protein translation rates and productivity. PMID:28992099
1976-01-01
Lymphocytic choriomeningitis virus (LCMV) and ectromelia virus-specific T-cell-mediated cytotoxicity was assayed in various strain combinations using as targets peritoneal macrophages which have been shown to express Ia antigens. Virus-specific cytotoxicity was found only in H-2K- or D-region compatible combinations. I-region compatibility was not necessary nor alone sufficient for lysis. Six different I-region specificities had no obvious effect on the capacity to generate in vivo specific cytotoxicity (expressed in vitro) associated with Dd. Low LCMV- specific cytotoxic activity generated in DBA/2 mice was caused by the non-H-2 genetic background. This trait was inversely related to the infectious virus dose and recessive. Non-H-2 genes, possibly involved in controlling initial spread and multiplication of virus, seem to be, at least in the examples tested, more important in determining virus- specific cytotoxic T-cell activity in spleens than are Ir genes coded in H-2. PMID:1085331
The transcription factor titration effect dictates level of gene expression.
Brewster, Robert C; Weinert, Franz M; Garcia, Hernan G; Song, Dan; Rydenfelt, Mattias; Phillips, Rob
2014-03-13
Models of transcription are often built around a picture of RNA polymerase and transcription factors (TFs) acting on a single copy of a promoter. However, most TFs are shared between multiple genes with varying binding affinities. Beyond that, genes often exist at high copy number-in multiple identical copies on the chromosome or on plasmids or viral vectors with copy numbers in the hundreds. Using a thermodynamic model, we characterize the interplay between TF copy number and the demand for that TF. We demonstrate the parameter-free predictive power of this model as a function of the copy number of the TF and the number and affinities of the available specific binding sites; such predictive control is important for the understanding of transcription and the desire to quantitatively design the output of genetic circuits. Finally, we use these experiments to dynamically measure plasmid copy number through the cell cycle. Copyright © 2014 Elsevier Inc. All rights reserved.
Quadruplex MAPH: improvement of throughput in high-resolution copy number screening.
Tyson, Jess; Majerus, Tamsin Mo; Walker, Susan; Armour, John Al
2009-09-28
Copy number variation (CNV) in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Multiplex Amplifiable Probe Hybridisation (MAPH) is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH") that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC) samples. QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms.
Maruyama, Fumito; Kenzaka, Takehiko; Yamaguchi, Nobuyasu; Tani, Katsuji; Nasu, Masao
2005-01-01
Rolling circle amplification (RCA) generates large single-stranded and tandem repeats of target DNA as amplicons. This technique was applied to in situ nucleic acid amplification (in situ RCA) to visualize and count single Escherichia coli cells carrying a specific gene sequence. The method features (i) one short target sequence (35 to 39 bp) that allows specific detection; (ii) maintaining constant fluorescent intensity of positive cells permeabilized extensively after amplicon detection by fluorescence in situ hybridization, which facilitates the detection of target bacteria in various physiological states; and (iii) reliable enumeration of target bacteria by concentration on a gelatin-coated membrane filter. To test our approach, the presence of the following genes were visualized by in situ RCA: green fluorescent protein gene, the ampicillin resistance gene and the replication origin region on multicopy pUC19 plasmid, as well as the single-copy Shiga-like toxin gene on chromosomes inside E. coli cells. Fluorescent antibody staining after in situ RCA also simultaneously identified cells harboring target genes and determined the specificity of in situ RCA. E. coli cells in a nonculturable state from a prolonged incubation were periodically sampled and used for plasmid uptake study. The numbers of cells taking up plasmids determined by in situ RCA was up to 106-fold higher than that measured by selective plating. In addition, in situ RCA allowed the detection of cells taking up plasmids even when colony-forming cells were not detected during the incubation period. By optimizing the cell permeabilization condition for in situ RCA, this method can become a valuable tool for studying free DNA uptake, especially in nonculturable bacteria. PMID:16332770
Lu, Y; Li, H; Fu, J
2000-04-01
To establish a suitable model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells. The NIH3T3 cells were transfected with the linearized pMCLacI/Neo DNAs by liposome-mediated transfection, and grew in the presence of G418. One drug resistant cell clone was selected to proliferate and to be analyzed with Southern blot and RT-PCR analyses on its genomic DNAs. (1) Multiple copies of pMCLacI/Neo plasmid DNA were intactly integrated in the genomic DNAs of the cell clone. (2) One of lac I target genes in the integrated plasmid could be transcribed in the NIH3T3 cells while the other could not. (3) The pMCLacI/Neo plasmid DNA could be efficiently rescued from the genomic DNAs of the cell clone with the average rescue efficiency of 410 cfu/microg DNA. The NIH3T3 cell line containing copies of a stably integrated pMCLacI/Neo has been established. The two lacI target genes in the cell line could imitate the functional states of expressed and non-expressed genes in mammalian cells respectively. The cell line will be a useful model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells.
Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein
2015-10-01
Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.
Avraham, Karen B.
2016-01-01
The vertebrate inner ear houses highly specialized sensory organs, tuned to detect and encode sound, head motion and gravity. Gene expression programs under the control of transcription factors orchestrate the formation and specialization of the non-sensory inner ear labyrinth and its sensory constituents. More recently, epigenetic factors and non-coding RNAs emerged as an additional layer of gene regulation, both in inner ear development and disease. In this review, we provide an overview on how epigenetic modifications and non-coding RNAs, in particular microRNAs (miRNAs), influence gene expression and summarize recent discoveries that highlight their critical role in the proper formation of the inner ear labyrinth and its sensory organs. In contrast to non-mammalian vertebrates, adult mammals lack the ability to regenerate inner ear mechano-sensory hair cells. Finally, we discuss recent insights into how epigenetic factors and miRNAs may facilitate, or in the case of mammals, restrict sensory hair cell regeneration. PMID:27836639
Spielmann, A; Stutz, E
1983-10-25
The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.
Yi, Guoqiang; Qu, Lujiang; Liu, Jianfeng; Yan, Yiyuan; Xu, Guiyun; Yang, Ning
2014-11-07
Copy number variation (CNV) is important and widespread in the genome, and is a major cause of disease and phenotypic diversity. Herein, we performed a genome-wide CNV analysis in 12 diversified chicken genomes based on whole genome sequencing. A total of 8,840 CNV regions (CNVRs) covering 98.2 Mb and representing 9.4% of the chicken genome were identified, ranging in size from 1.1 to 268.8 kb with an average of 11.1 kb. Sequencing-based predictions were confirmed at a high validation rate by two independent approaches, including array comparative genomic hybridization (aCGH) and quantitative PCR (qPCR). The Pearson's correlation coefficients between sequencing and aCGH results ranged from 0.435 to 0.755, and qPCR experiments revealed a positive validation rate of 91.71% and a false negative rate of 22.43%. In total, 2,214 (25.0%) predicted CNVRs span 2,216 (36.4%) RefSeq genes associated with specific biological functions. Besides two previously reported copy number variable genes EDN3 and PRLR, we also found some promising genes with potential in phenotypic variation. Two genes, FZD6 and LIMS1, related to disease susceptibility/resistance are covered by CNVRs. The highly duplicated SOCS2 may lead to higher bone mineral density. Entire or partial duplication of some genes like POPDC3 may have great economic importance in poultry breeding. Our results based on extensive genetic diversity provide a more refined chicken CNV map and genome-wide gene copy number estimates, and warrant future CNV association studies for important traits in chickens.
Copy-number analysis and inference of subclonal populations in cancer genomes using Sclust.
Cun, Yupeng; Yang, Tsun-Po; Achter, Viktor; Lang, Ulrich; Peifer, Martin
2018-06-01
The genomes of cancer cells constantly change during pathogenesis. This evolutionary process can lead to the emergence of drug-resistant mutations in subclonal populations, which can hinder therapeutic intervention in patients. Data derived from massively parallel sequencing can be used to infer these subclonal populations using tumor-specific point mutations. The accurate determination of copy-number changes and tumor impurity is necessary to reliably infer subclonal populations by mutational clustering. This protocol describes how to use Sclust, a copy-number analysis method with a recently developed mutational clustering approach. In a series of simulations and comparisons with alternative methods, we have previously shown that Sclust accurately determines copy-number states and subclonal populations. Performance tests show that the method is computationally efficient, with copy-number analysis and mutational clustering taking <10 min. Sclust is designed such that even non-experts in computational biology or bioinformatics with basic knowledge of the Linux/Unix command-line syntax should be able to carry out analyses of subclonal populations.
Falola, Michael I; Wiener, Howard W; Wineinger, Nathan E; Cutter, Gary R; Kimberly, Robert P; Edberg, Jeffrey C; Arnett, Donna K; Kaslow, Richard A; Tang, Jianming; Shrestha, Sadeep
2013-01-01
Anthrax and its etiologic agent remain a biological threat. Anthrax vaccine is highly effective, but vaccine-induced IgG antibody responses vary widely following required doses of vaccinations. Such variation can be related to genetic factors, especially genomic copy number variants (CNVs) that are known to be enriched among genes with immunologic function. We have tested this hypothesis in two study populations from a clinical trial of anthrax vaccination. We performed CNV-based genome-wide association analyses separately on 794 European Americans and 200 African-Americans. Antibodies to protective antigen were measured at week 8 (early response) and week 30 (peak response) using an enzyme-linked immunosorbent assay. We used DNA microarray data (Affymetrix 6.0) and two CNV detection algorithms, hidden markov model (PennCNV) and circular binary segmentation (GeneSpring) to determine CNVs in all individuals. Multivariable regression analyses were used to identify CNV-specific associations after adjusting for relevant non-genetic covariates. Within the 22 autosomal chromosomes, 2,943 non-overlapping CNV regions were detected by both algorithms. Genomic insertions containing HLA-DRB5, DRB1 and DQA1/DRA genes in the major histocompatibility complex (MHC) region (chromosome 6p21.3) were moderately associated with elevated early antibody response (β = 0.14, p = 1.78×10(-3)) among European Americans, and the strongest association was observed between peak antibody response and a segmental insertion on chromosome 1, containing NBPF4, NBPF5, STXMP3, CLCC1, and GPSM2 genes (β = 1.66, p = 6.06×10(-5)). For African-Americans, segmental deletions spanning PRR20, PCDH17 and PCH68 genes on chromosome 13 were associated with elevated early antibody production (β = 0.18, p = 4.47×10(-5)). Population-specific findings aside, one genomic insertion on chromosome 17 (containing NSF, ARL17 and LRRC37A genes) was associated with elevated peak antibody
Sadakata, Tetsushi; Shinoda, Yo; Oka, Megumi; Sekine, Yukiko; Furuichi, Teiichi
2013-01-04
Ca²⁺-dependent activator protein for secretion 2 (CAPS2 or CADPS2) facilitates secretion and trafficking of dense-core vesicles. Recent genome-wide association studies of autism have identified several microdeletions due to copy number variation (CNV) in one of the chromosome 7q31.32 alleles on which the locus for CAPS2 is located in autistic patients. To evaluate the biological significance of reducing CAPS2 copy number, we analyzed CAPS2 heterozygous mice. Our present findings suggest that adequate levels of CAPS2 protein are critical for normal brain development and behavior, and that allelic changes due to CNV may contribute to autistic symptoms in combination with deficits in other autism-associated genes. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Amy2B copy number variation reveals starch diet adaptations in ancient European dogs.
Ollivier, Morgane; Tresset, Anne; Bastian, Fabiola; Lagoutte, Laetitia; Axelsson, Erik; Arendt, Maja-Louise; Bălăşescu, Adrian; Marshour, Marjan; Sablin, Mikhail V; Salanova, Laure; Vigne, Jean-Denis; Hitte, Christophe; Hänni, Catherine
2016-11-01
Extant dog and wolf DNA indicates that dog domestication was accompanied by the selection of a series of duplications on the Amy2B gene coding for pancreatic amylase. In this study, we used a palaeogenetic approach to investigate the timing and expansion of the Amy2B gene in the ancient dog populations of Western and Eastern Europe and Southwest Asia. Quantitative polymerase chain reaction was used to estimate the copy numbers of this gene for 13 ancient dog samples, dated to between 15 000 and 4000 years before present (cal. BP). This evidenced an increase of Amy2B copies in ancient dogs from as early as the 7th millennium cal. BP in Southeastern Europe. We found that the gene expansion was not fixed across all dogs within this early farming context, with ancient dogs bearing between 2 and 20 diploid copies of the gene. The results also suggested that selection for the increased Amy2B copy number started 7000 years cal. BP, at the latest. This expansion reflects a local adaptation that allowed dogs to thrive on a starch rich diet, especially within early farming societies, and suggests a biocultural coevolution of dog genes and human culture.
Amy2B copy number variation reveals starch diet adaptations in ancient European dogs
Tresset, Anne; Bastian, Fabiola; Lagoutte, Laetitia; Arendt, Maja-Louise; Bălăşescu, Adrian; Marshour, Marjan; Sablin, Mikhail V.; Salanova, Laure; Vigne, Jean-Denis; Hitte, Christophe; Hänni, Catherine
2016-01-01
Extant dog and wolf DNA indicates that dog domestication was accompanied by the selection of a series of duplications on the Amy2B gene coding for pancreatic amylase. In this study, we used a palaeogenetic approach to investigate the timing and expansion of the Amy2B gene in the ancient dog populations of Western and Eastern Europe and Southwest Asia. Quantitative polymerase chain reaction was used to estimate the copy numbers of this gene for 13 ancient dog samples, dated to between 15 000 and 4000 years before present (cal. BP). This evidenced an increase of Amy2B copies in ancient dogs from as early as the 7th millennium cal. BP in Southeastern Europe. We found that the gene expansion was not fixed across all dogs within this early farming context, with ancient dogs bearing between 2 and 20 diploid copies of the gene. The results also suggested that selection for the increased Amy2B copy number started 7000 years cal. BP, at the latest. This expansion reflects a local adaptation that allowed dogs to thrive on a starch rich diet, especially within early farming societies, and suggests a biocultural coevolution of dog genes and human culture. PMID:28018628
Specific c-Jun target genes in malignant melanoma.
Schummer, Patrick; Kuphal, Silke; Vardimon, Lily; Bosserhoff, Anja K; Kappelmann, Melanie
2016-05-03
A fundamental event in the development and progression of malignant melanoma is the de-regulation of cancer-relevant transcription factors. We recently showed that c-Jun is a main regulator of melanoma progression and, thus, is the most important member of the AP-1 transcription factor family in this disease. Surprisingly, no cancer-related specific c-Jun target genes in melanoma were described in the literature, so far. Therefore, we focused on pre-existing ChIP-Seq data (Encyclopedia of DNA Elements) of 3 different non-melanoma cell lines to screen direct c-Jun target genes. Here, a specific c-Jun antibody to immunoprecipitate the associated promoter DNA was used. Consequently, we identified 44 direct c-Jun targets and a detailed analysis of 6 selected genes confirmed their deregulation in malignant melanoma. The identified genes were differentially regulated comparing 4 melanoma cell lines and normal human melanocytes and we confirmed their c-Jun dependency. Direct interaction between c-Jun and the promoter/enhancer regions of the identified genes was confirmed by us via ChIP experiments. Interestingly, we revealed that the direct regulation of target gene expression via c-Jun can be independent of the existence of the classical AP-1 (5´-TGA(C/G)TCA-3´) consensus sequence allowing for the subsequent down- or up-regulation of the expression of these cancer-relevant genes. In summary, the results of this study indicate that c-Jun plays a crucial role in the development and progression of malignant melanoma via direct regulation of cancer-relevant target genes and that inhibition of direct c-Jun targets through inhibition of c-Jun is a potential novel therapeutic option for treatment of malignant melanoma.
Minaya, Miguel; Díaz-Pérez, Antonio; Mason-Gamer, Roberta; Pimentel, Manuel; Catalán, Pilar
2015-10-01
Low-copy nuclear genes (LCNGs) have complex genetic architectures and evolutionary dynamics. However, unlike multicopy nuclear genes, LCNGs are rarely subject to gene conversion or concerted evolution, and they have higher mutation rates than organellar or nuclear ribosomal DNA markers, so they have great potential for improving the robustness of phylogenetic reconstructions at all taxonomic levels. In this study, our first objective is to evaluate the evolutionary dynamics of the LCNG β-amylase by testing for potential pseudogenization, paralogy, homeology, recombination, and phylogenetic incongruence within a broad representation of the main Pooideae lineages. Our second objective is to determine whether β-amylase shows sufficient phylogenetic signal to reconstruct the evolutionary history of the Pooid grasses. A multigenic (ITS, matK, ndhF, trnTL, and trnLF) tree of the study group provided a framework for assessing the β-amylase phylogeny. Eight accessions showed complete absence of selection, suggesting putative pseudogenic copies or other relaxed selection pressures; resolution of Vulpia alopecuros 2x clones indicated its potential (semi) paralogy; and homeologous copies of allopolyploid species Festuca simensis, F. fenas, and F. arundinacea tracked their Mediterranean origin. Two recombination events were found within early-diverged Pooideae lineages, and five within the PACCMAD clade. The unexpected phylogenetic relationships of 37 grass species (26% of the sampled species) highlight the frequent occurrence of non-treelike evolutionary events, so this LCNG should be used with caution as a phylogenetic marker. However, once the pitfalls are identified and removed, the phylogenetic reconstruction of the grasses based on the β-amylase exon+intron positions is optimal at all taxonomic levels. Copyright © 2015 Elsevier Inc. All rights reserved.
Vyas, Meenal; Raza, Amir; Ali, Muhammad Yousaf; Ashraf, Muhammad Aleem; Mansoor, Shahid; Shahid, Ahmad Ali; Brown, Judith K
2017-01-01
Control of the whitefly Bemisia tabaci (Genn.) agricultural pest and plant virus vector relies on the use of chemical insecticides. RNA-interference (RNAi) is a homology-dependent innate immune response in eukaryotes, including insects, which results in degradation of the corresponding transcript following its recognition by a double-stranded RNA (dsRNA) that shares 100% sequence homology. In this study, six whitefly 'gut' genes were selected from an in silico-annotated transcriptome library constructed from the whitefly alimentary canal or 'gut' of the B biotype of B. tabaci, and tested for knock down efficacy, post-ingestion of dsRNAs that share 100% sequence homology to each respective gene target. Candidate genes were: Acetylcholine receptor subunit α, Alpha glucosidase 1, Aquaporin 1, Heat shock protein 70, Trehalase1, and Trehalose transporter1. The efficacy of RNAi knock down was further tested in a gene-specific functional bioassay, and mortality was recorded in 24 hr intervals, six days, post-treatment. Based on qPCR analysis, all six genes tested showed significantly reduced gene expression. Moderate-to-high whitefly mortality was associated with the down-regulation of osmoregulation, sugar metabolism and sugar transport-associated genes, demonstrating that whitefly survivability was linked with RNAi results. Silenced Acetylcholine receptor subunit α and Heat shock protein 70 genes showed an initial low whitefly mortality, however, following insecticide or high temperature treatments, respectively, significantly increased knockdown efficacy and death was observed, indicating enhanced post-knockdown sensitivity perhaps related to systemic silencing. The oral delivery of gut-specific dsRNAs, when combined with qPCR analysis of gene expression and a corresponding gene-specific bioassay that relates knockdown and mortality, offers a viable approach for functional genomics analysis and the discovery of prospective dsRNA biopesticide targets. The approach can
Kurscheid, Sebastian; Bady, Pierre; Sciuscio, Davide; Samarzija, Ivana; Shay, Tal; Vassallo, Irene; Van Criekinge, Wim; Domany, Eytan; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika
2014-01-01
We previously reported a stem cell related HOX gene signature associated with resistance to chemo-radiotherapy (TMZ/RT- > TMZ) in glioblastoma. However, underlying mechanisms triggering overexpression remain mostly elusive. Interestingly, HOX genes are neither involved in the developing brain, nor expressed in normal brain, suggestive of an acquired gene expression signature during gliomagenesis. HOXA genes are located on CHR 7 that displays trisomy in most glioblastoma which strongly impacts gene expression on this chromosome, modulated by local regulatory elements. Furthermore we observed more pronounced DNA methylation across the HOXA locus as compared to non-tumoral brain (Human methylation 450K BeadChip Illumina; 59 glioblastoma, 5 non-tumoral brain sampes). CpG probes annotated for HOX-signature genes, contributing most to the variability, served as input into the analysis of DNA methylation and expression to identify key regulatory regions. The structural similarity of the observed correlation matrices between DNA methylation and gene expression in our cohort and an independent data-set from TCGA (106 glioblastoma) was remarkable (RV-coefficient, 0.84; p-value < 0.0001). We identified a CpG located in the promoter region of the HOXA10 locus exerting the strongest mean negative correlation between methylation and expression of the whole HOX-signature. Applying this analysis the same CpG emerged in the external set. We then determined the contribution of both, gene copy aberration (CNA) and methylation at the selected probe to explain expression of the HOX-signature using a linear model. Statistically significant results suggested an additive effect between gene dosage and methylation at the key CpG identified. Similarly, such an additive effect was also observed in the external data-set. Taken together, we hypothesize that overexpression of the stem-cell related HOX signature is triggered by gain of trisomy 7 and escape from compensatory DNA methylation at
Application of Nexus copy number software for CNV detection and analysis.
Darvishi, Katayoon
2010-04-01
Among human structural genomic variation, copy number variants (CNVs) are the most frequently known component, comprised of gains/losses of DNA segments that are generally 1 kb in length or longer. Array-based comparative genomic hybridization (aCGH) has emerged as a powerful tool for detecting genomic copy number variants (CNVs). With the rapid increase in the density of array technology and with the adaptation of new high-throughput technology, a reliable and computationally scalable method for accurate mapping of recurring DNA copy number aberrations has become a main focus in research. Here we introduce Nexus Copy Number software, a platform-independent tool, to analyze the output files of all types of commercial and custom-made comparative genomic hybridization (CGH) and single-nucleotide polymorphism (SNP) arrays, such as those manufactured by Affymetrix, Agilent Technologies, Illumina, and Roche NimbleGen. It also supports data generated by various array image-analysis software tools such as GenePix, ImaGene, and BlueFuse. (c) 2010 by John Wiley & Sons, Inc.
Camps, Jordi; Nguyen, Quang Tri; Padilla-Nash, Hesed M.; Knutsen, Turid; McNeil, Nicole E.; Wangsa, Danny; Hummon, Amanda B.; Grade, Marian; Ried, Thomas; Difilippantonio, Michael J.
2016-01-01
To evaluate the mechanisms and consequences of chromosomal aberrations in colorectal cancer (CRC), we used a combination of spectral karyotyping, array comparative genomic hybridization (aCGH), and array-based global gene expression profiling on 31 primary carcinomas and 15 established cell lines. Importantly, aCGH showed that the genomic profiles of primary tumors are recapitulated in the cell lines. We revealed a preponderance of chromosome breakpoints at sites of copy number variants (CNVs) in the CRC cell lines, a novel mechanism of DNA breakage in cancer. The integration of gene expression and aCGH led to the identification of 157 genes localized within high-level copy number changes whose transcriptional deregulation was significantly affected across all of the samples, thereby suggesting that these genes play a functional role in CRC. Genomic amplification at 8q24 was the most recurrent event and led to the overexpression of MYC and FAM84B. Copy number dependent gene expression resulted in deregulation of known cancer genes such as APC, FGFR2, and ERBB2. The identification of only 36 genes whose localization near a breakpoint could account for their observed deregulated expression demonstrates that the major mechanism for transcriptional deregulation in CRC is genomic copy number changes resulting from chromosomal aberrations. PMID:19691111
Bakar, Suhaili Abu; Hollox, Edward J.; Armour, John A. L.
2009-01-01
β-Defensins are small secreted antimicrobial and signaling peptides involved in the innate immune response of vertebrates. In humans, a cluster of at least 7 of these genes shows extensive copy number variation, with a diploid copy number commonly ranging between 2 and 7. Using a genetic mapping approach, we show that this cluster is at not 1 but 2 distinct genomic loci ≈5 Mb apart on chromosome band 8p23.1, contradicting the most recent genome assembly. We also demonstrate that the predominant mechanism of change in β-defensin copy number is simple allelic recombination occurring in the interval between the 2 distinct genomic loci for these genes. In 416 meiotic transmissions, we observe 3 events creating a haplotype copy number not found in the parent, equivalent to a germ-line rate of copy number change of ≈0.7% per gamete. This places it among the fastest-changing copy number variants currently known. PMID:19131514
Tissue-specific epigenetics in gene neighborhoods: myogenic transcription factor genes
Chandra, Sruti; Terragni, Jolyon; Zhang, Guoqiang; Pradhan, Sriharsa; Haushka, Stephen; Johnston, Douglas; Baribault, Carl; Lacey, Michelle; Ehrlich, Melanie
2015-01-01
Myogenic regulatory factor (MRF) genes, MYOD1, MYOG, MYF6 and MYF5, are critical for the skeletal muscle lineage. Here, we used various epigenome profiles from human myoblasts (Mb), myotubes (Mt), muscle and diverse non-muscle samples to elucidate the involvement of multigene neighborhoods in the regulation of MRF genes. We found more far-distal enhancer chromatin associated with MRF genes in Mb and Mt than previously reported from studies in mice. For the MYF5/MYF6 gene-pair, regions of Mb-associated enhancer chromatin were located throughout the adjacent 236-kb PTPRQ gene even though Mb expressed negligible amounts of PTPRQ mRNA. Some enhancer chromatin regions inside PTPRQ in Mb were also seen in PTPRQ mRNA-expressing non-myogenic cells. This suggests dual-purpose PTPRQ enhancers that upregulate expression of PTPRQ in non-myogenic cells and MYF5/MYF6 in myogenic cells. In contrast, the myogenic enhancer chromatin regions distal to MYOD1 were intergenic and up to 19 kb long. Two of them contain small, known MYOD1 enhancers, and one displayed an unusually high level of 5-hydroxymethylcytosine in a quantitative DNA hydroxymethylation assay. Unexpectedly, three regions of MYOD1-distal enhancer chromatin in Mb and Mt overlapped enhancer chromatin in umbilical vein endothelial cells, which might upregulate a distant gene (PIK3C2A). Lastly, genes surrounding MYOG were preferentially transcribed in Mt, like MYOG itself, and exhibited nearby myogenic enhancer chromatin. These neighboring chromatin regions may be enhancers acting in concert to regulate myogenic expression of multiple adjacent genes. Our findings reveal the very different and complex organization of gene neighborhoods containing closely related transcription factor genes. PMID:26041816
Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin
2014-01-01
Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and
Biotype-specific tcpA genes in Vibrio cholerae.
Iredell, J R; Manning, P A
1994-08-01
The tcpA gene, encoding the structural subunit of the toxin-coregulated pilus, has been isolated from a variety of clinical isolates of Vibrio cholerae, and the nucleotide sequence determined. Strict biotype-specific conservation within both the coding and putative regulatory regions was observed, with important differences between the El Tor and classical biotypes. V. cholerae O139 Bengal strains appear to have El Tor-type tcpA genes. Environmental O1 and non-O1 isolates have sequences that bind an El Tor-specific tcpA DNA probe and that are weakly and variably amplified by tcpA-specific polymerase chain reaction primers, under conditions of reduced stringency. The data presented allow the selection of primer pairs to help distinguish between clinical and environmental isolates, and to distinguish El Tor (and Bengal) biotypes from classical biotypes of V. cholerae. While the role of TcpA in cholera vaccine preparations remains unclear, the data strongly suggest that TcpA-containing vaccines directed at O1 strains need include only the two forms of TcpA, and that such vaccines directed at (O139) Bengal strains should include the TcpA of El Tor biotype.
Winn, Mary E.; Barnes, Cynthia Carter; Li, Hai-Ri; Weiss, Lauren; Fan, Jian-Bing; Murray, Sarah; April, Craig; Belinson, Haim; Fu, Xiang-Dong; Wynshaw-Boris, Anthony; Schork, Nicholas J.; Courchesne, Eric
2012-01-01
Autism is a highly heritable neurodevelopmental disorder, yet the genetic underpinnings of the disorder are largely unknown. Aberrant brain overgrowth is a well-replicated observation in the autism literature; but association, linkage, and expression studies have not identified genetic factors that explain this trajectory. Few studies have had sufficient statistical power to investigate whole-genome gene expression and genotypic variation in the autistic brain, especially in regions that display the greatest growth abnormality. Previous functional genomic studies have identified possible alterations in transcript levels of genes related to neurodevelopment and immune function. Thus, there is a need for genetic studies involving key brain regions to replicate these findings and solidify the role of particular functional pathways in autism pathogenesis. We therefore sought to identify abnormal brain gene expression patterns via whole-genome analysis of mRNA levels and copy number variations (CNVs) in autistic and control postmortem brain samples. We focused on prefrontal cortex tissue where excess neuron numbers and cortical overgrowth are pronounced in the majority of autism cases. We found evidence for dysregulation in pathways governing cell number, cortical patterning, and differentiation in young autistic prefrontal cortex. In contrast, adult autistic prefrontal cortex showed dysregulation of signaling and repair pathways. Genes regulating cell cycle also exhibited autism-specific CNVs in DNA derived from prefrontal cortex, and these genes were significantly associated with autism in genome-wide association study datasets. Our results suggest that CNVs and age-dependent gene expression changes in autism may reflect distinct pathological processes in the developing versus the mature autistic prefrontal cortex. Our results raise the hypothesis that genetic dysregulation in the developing brain leads to abnormal regional patterning, excess prefrontal neurons
Chow, Maggie L; Pramparo, Tiziano; Winn, Mary E; Barnes, Cynthia Carter; Li, Hai-Ri; Weiss, Lauren; Fan, Jian-Bing; Murray, Sarah; April, Craig; Belinson, Haim; Fu, Xiang-Dong; Wynshaw-Boris, Anthony; Schork, Nicholas J; Courchesne, Eric
2012-01-01
Autism is a highly heritable neurodevelopmental disorder, yet the genetic underpinnings of the disorder are largely unknown. Aberrant brain overgrowth is a well-replicated observation in the autism literature; but association, linkage, and expression studies have not identified genetic factors that explain this trajectory. Few studies have had sufficient statistical power to investigate whole-genome gene expression and genotypic variation in the autistic brain, especially in regions that display the greatest growth abnormality. Previous functional genomic studies have identified possible alterations in transcript levels of genes related to neurodevelopment and immune function. Thus, there is a need for genetic studies involving key brain regions to replicate these findings and solidify the role of particular functional pathways in autism pathogenesis. We therefore sought to identify abnormal brain gene expression patterns via whole-genome analysis of mRNA levels and copy number variations (CNVs) in autistic and control postmortem brain samples. We focused on prefrontal cortex tissue where excess neuron numbers and cortical overgrowth are pronounced in the majority of autism cases. We found evidence for dysregulation in pathways governing cell number, cortical patterning, and differentiation in young autistic prefrontal cortex. In contrast, adult autistic prefrontal cortex showed dysregulation of signaling and repair pathways. Genes regulating cell cycle also exhibited autism-specific CNVs in DNA derived from prefrontal cortex, and these genes were significantly associated with autism in genome-wide association study datasets. Our results suggest that CNVs and age-dependent gene expression changes in autism may reflect distinct pathological processes in the developing versus the mature autistic prefrontal cortex. Our results raise the hypothesis that genetic dysregulation in the developing brain leads to abnormal regional patterning, excess prefrontal neurons
Ujino-Ihara, Tokuko; Kanamori, Hiroyuki; Yamane, Hiroko; Taguchi, Yuriko; Namiki, Nobukazu; Mukai, Yuzuru; Yoshimura, Kensuke; Tsumura, Yoshihiko
2005-12-01
To identify and characterize lineage-specific genes of conifers, two sets of ESTs (with 12791 and 5902 ESTs, representing 5373 and 3018 gene transcripts, respectively) were generated from the Cupressaceae species Cryptomeria japonica and Chamaecyparis obtusa. These transcripts were compared with non-redundant sets of genes generated from Pinaceae species, other gymnosperms and angiosperms. About 6% of tentative unique genes (Unigenes) of C. japonica and C. obtusa had homologs in other conifers but not angiosperms, and about 70% had apparent homologs in angiosperms. The calculated GC contents of orthologous genes showed that GC contents of coniferous genes are likely to be lower than those of angiosperms. Comparisons of the numbers of homologous genes in each species suggest that copy numbers of genes may be correlated between diverse seed plants. This correlation suggests that the multiplicity of such genes may have arisen before the divergence of gymnosperms and angiosperms.
Wang-Renault, Shu-Fang; Letouzé, Eric; Imbeaud, Sandrine; Zucman-Rossi, Jessica; Deleuze, Jean-François; How-Kit, Alexandre
2017-01-01
Motivation Copy number variations (CNV) include net gains or losses of part or whole chromosomal regions. They differ from copy neutral loss of heterozygosity (cn-LOH) events which do not induce any net change in the copy number and are often associated with uniparental disomy. These phenomena have long been reported to be associated with diseases and particularly in cancer. Losses/gains of genomic regions are often correlated with lower/higher gene expression. On the other hand, loss of heterozygosity (LOH) and cn-LOH are common events in cancer and may be associated with the loss of a functional tumor suppressor gene. Therefore, identifying recurrent CNV and cn-LOH events can be important as they may highlight common biological components and give insights into the development or mechanisms of a disease. However, no currently available tools allow a comprehensive whole-genome visualization of recurrent CNVs and cn-LOH in groups of samples providing absolute quantification of the aberrations leading to the loss of potentially important information. Results To overcome these limitations, we developed aCNViewer (Absolute CNV Viewer), a visualization tool for absolute CNVs and cn-LOH across a group of samples. aCNViewer proposes three graphical representations: dendrograms, bi-dimensional heatmaps showing chromosomal regions sharing similar abnormality patterns, and quantitative stacked histograms facilitating the identification of recurrent absolute CNVs and cn-LOH. We illustrated aCNViewer using publically available hepatocellular carcinomas (HCCs) Affymetrix SNP Array data (Fig 1A). Regions 1q and 8q present a similar percentage of total gains but significantly different copy number gain categories (p-value of 0.0103 with a Fisher exact test), validated by another cohort of HCCs (p-value of 5.6e-7) (Fig 2B). Availability and implementation aCNViewer is implemented in python and R and is available with a GNU GPLv3 license on GitHub https
Renault, Victor; Tost, Jörg; Pichon, Fabien; Wang-Renault, Shu-Fang; Letouzé, Eric; Imbeaud, Sandrine; Zucman-Rossi, Jessica; Deleuze, Jean-François; How-Kit, Alexandre
2017-01-01
Copy number variations (CNV) include net gains or losses of part or whole chromosomal regions. They differ from copy neutral loss of heterozygosity (cn-LOH) events which do not induce any net change in the copy number and are often associated with uniparental disomy. These phenomena have long been reported to be associated with diseases and particularly in cancer. Losses/gains of genomic regions are often correlated with lower/higher gene expression. On the other hand, loss of heterozygosity (LOH) and cn-LOH are common events in cancer and may be associated with the loss of a functional tumor suppressor gene. Therefore, identifying recurrent CNV and cn-LOH events can be important as they may highlight common biological components and give insights into the development or mechanisms of a disease. However, no currently available tools allow a comprehensive whole-genome visualization of recurrent CNVs and cn-LOH in groups of samples providing absolute quantification of the aberrations leading to the loss of potentially important information. To overcome these limitations, we developed aCNViewer (Absolute CNV Viewer), a visualization tool for absolute CNVs and cn-LOH across a group of samples. aCNViewer proposes three graphical representations: dendrograms, bi-dimensional heatmaps showing chromosomal regions sharing similar abnormality patterns, and quantitative stacked histograms facilitating the identification of recurrent absolute CNVs and cn-LOH. We illustrated aCNViewer using publically available hepatocellular carcinomas (HCCs) Affymetrix SNP Array data (Fig 1A). Regions 1q and 8q present a similar percentage of total gains but significantly different copy number gain categories (p-value of 0.0103 with a Fisher exact test), validated by another cohort of HCCs (p-value of 5.6e-7) (Fig 2B). aCNViewer is implemented in python and R and is available with a GNU GPLv3 license on GitHub https://github.com/FJD-CEPH/aCNViewer and Docker https
Steenwyk, Jacob; Rokas, Antonis
2017-05-05
Due to the importance of Saccharomyces cerevisiae in wine-making, the genomic variation of wine yeast strains has been extensively studied. One of the major insights stemming from these studies is that wine yeast strains harbor low levels of genetic diversity in the form of single nucleotide polymorphisms (SNPs). Genomic structural variants, such as copy number (CN) variants, are another major type of variation segregating in natural populations. To test whether genetic diversity in CN variation is also low across wine yeast strains, we examined genome-wide levels of CN variation in 132 whole-genome sequences of S. cerevisiae wine strains. We found an average of 97.8 CN variable regions (CNVRs) affecting ∼4% of the genome per strain. Using two different measures of CN diversity, we found that gene families involved in fermentation-related processes such as copper resistance ( CUP ), flocculation ( FLO ), and glucose metabolism ( HXT ), as well as the SNO gene family whose members are expressed before or during the diauxic shift, showed substantial CN diversity across the 132 strains examined. Importantly, these same gene families have been shown, through comparative transcriptomic and functional assays, to be associated with adaptation to the wine fermentation environment. Our results suggest that CN variation is a substantial contributor to the genomic diversity of wine yeast strains, and identify several candidate loci whose levels of CN variation may affect the adaptation and performance of wine yeast strains during fermentation. Copyright © 2017 Steenwyk and Rokas.
Li, Lu; Douville, Christopher; Wang, Yuxuan; Cohen, Joshua David; Taheri, Diana; Silliman, Natalie; Schaefer, Joy; Ptak, Janine; Dobbyn, Lisa; Papoli, Maria; Kinde, Isaac; Afsari, Bahman; Tregnago, Aline C; Bezerra, Stephania M; VandenBussche, Christopher; Fujita, Kazutoshi; Ertoy, Dilek; Cunha, Isabela W; Yu, Lijia; Bivalacqua, Trinity J; Grollman, Arthur P; Diaz, Luis A; Karchin, Rachel; Danilova, Ludmila; Huang, Chao-Yuan; Shun, Chia-Tung; Turesky, Robert J; Yun, Byeong Hwa; Rosenquist, Thomas A; Pu, Yeong-Shiau; Hruban, Ralph H; Tomasetti, Cristian; Papadopoulos, Nickolas; Kinzler, Ken W
2018-01-01
Current non-invasive approaches for detection of urothelial cancers are suboptimal. We developed a test to detect urothelial neoplasms using DNA recovered from cells shed into urine. UroSEEK incorporates massive parallel sequencing assays for mutations in 11 genes and copy number changes on 39 chromosome arms. In 570 patients at risk for bladder cancer (BC), UroSEEK was positive in 83% of those who developed BC. Combined with cytology, UroSEEK detected 95% of patients who developed BC. Of 56 patients with upper tract urothelial cancer, 75% tested positive by UroSEEK, including 79% of those with non-invasive tumors. UroSEEK detected genetic abnormalities in 68% of urines obtained from BC patients under surveillance who demonstrated clinical evidence of recurrence. The advantages of UroSEEK over cytology were evident in low-grade BCs; UroSEEK detected 67% of cases whereas cytology detected none. These results establish the foundation for a new non-invasive approach for detection of urothelial cancer. PMID:29557778
Novel origins of copy number variation in the dog genome
2012-01-01
Background Copy number variants (CNVs) account for substantial variation between genomes and are a major source of normal and pathogenic phenotypic differences. The dog is an ideal model to investigate mutational mechanisms that generate CNVs as its genome lacks a functional ortholog of the PRDM9 gene implicated in recombination and CNV formation in humans. Here we comprehensively assay CNVs using high-density array comparative genomic hybridization in 50 dogs from 17 dog breeds and 3 gray wolves. Results We use a stringent new method to identify a total of 430 high-confidence CNV loci, which range in size from 9 kb to 1.6 Mb and span 26.4 Mb, or 1.08%, of the assayed dog genome, overlapping 413 annotated genes. Of CNVs observed in each breed, 98% are also observed in multiple breeds. CNVs predicted to disrupt gene function are significantly less common than expected by chance. We identify a significant overrepresentation of peaks of GC content, previously shown to be enriched in dog recombination hotspots, in the vicinity of CNV breakpoints. Conclusions A number of the CNVs identified by this study are candidates for generating breed-specific phenotypes. Purifying selection seems to be a major factor shaping structural variation in the dog genome, suggesting that many CNVs are deleterious. Localized peaks of GC content appear to be novel sites of CNV formation in the dog genome by non-allelic homologous recombination, potentially activated by the loss of PRDM9. These sequence features may have driven genome instability and chromosomal rearrangements throughout canid evolution. PMID:22916802
Transient, Inducible, Placenta-Specific Gene Expression in Mice
Fan, Xiujun; Petitt, Matthew; Gamboa, Matthew; Huang, Mei; Dhal, Sabita; Druzin, Maurice L.; Wu, Joseph C.
2012-01-01
Molecular understanding of placental functions and pregnancy disorders is limited by the absence of methods for placenta-specific gene manipulation. Although persistent placenta-specific gene expression has been achieved by lentivirus-based gene delivery methods, developmentally and physiologically important placental genes have highly stage-specific functions, requiring controllable, transient expression systems for functional analysis. Here, we describe an inducible, placenta-specific gene expression system that enables high-level, transient transgene expression and monitoring of gene expression by live bioluminescence imaging in mouse placenta at different stages of pregnancy. We used the third generation tetracycline-responsive tranactivator protein Tet-On 3G, with 10- to 100-fold increased sensitivity to doxycycline (Dox) compared with previous versions, enabling unusually sensitive on-off control of gene expression in vivo. Transgenic mice expressing Tet-On 3G were created using a new integrase-based, site-specific approach, yielding high-level transgene expression driven by a ubiquitous promoter. Blastocysts from these mice were transduced with the Tet-On 3G-response element promoter-driving firefly luciferase using lentivirus-mediated placenta-specific gene delivery and transferred into wild-type pseudopregnant recipients for placenta-specific, Dox-inducible gene expression. Systemic Dox administration at various time points during pregnancy led to transient, placenta-specific firefly luciferase expression as early as d 5 of pregnancy in a Dox dose-dependent manner. This system enables, for the first time, reliable pregnancy stage-specific induction of gene expression in the placenta and live monitoring of gene expression during pregnancy. It will be widely applicable to studies of both placental development and pregnancy, and the site-specific Tet-On G3 mouse will be valuable for studies in a broad range of tissues. PMID:23011919
Spielmann, A; Stutz, E
1983-01-01
The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2. PMID:6314279
Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini
2013-01-01
GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is ‘the use of genes as medicine’. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone. PMID:23869119
Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini
2013-03-01
GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is 'the use of genes as medicine'. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Al-Salman, Fadheela; Plant, Nick, E-mail: N.Plant@Surrey.ac.uk
The polychlorinated biphenyl group possesses high environmental persistence, leading to bioaccumulation and a number of adverse effects in mammals. Whilst coplanar PCBs elicit their toxic effects through agonism of the aryl hydrocarbon receptor; however, non-coplanar PCBs are not ligands for AhR, but may be ligands for members of the nuclear receptor family of proteins. To better understand the biological actions of non-coplanar PCBs, we have undertaken a systematic analysis of their ability to activate PXR and CAR-mediated effects. Cells were exposed to a range of non-coplanar PCBs (99, 138, 153, 180 and 194), or the coplanar PCB77: Direct activation ofmore » PXR and CAR was measured using a mammalian receptor activation assay in human liver cells, with rifampicin and CITCO used as positive controls ligands for PXR and CAR, respectively; activation of target gene expression was examined using reporter gene plasmids for CYP3A4 and MDR1 transfected into liver, intestine and lung cell lines. Several of the non-coplanar PCBs directly activated PXR and CAR, whilst the coplanar PCB77 did not. Non-coplanar PCBs were also able to activate PXR/CAR target gene expression in a substitution- and tissue-specific manner. Non-coplanar PCBs act as direct activators for the nuclear receptors PXR and CAR, and are able to elicit transcriptional activation of target genes in a substitution- and tissue-dependent manner. Chronic activation of PXR/CAR is linked to adverse effects and must be included in any risk assessment of PCBs. -- Highlights: ► Several Non-coplanar PCBs are able to directly activate both PXR and CAR in vitro. ► PCB153 is the most potent direct activator of PXR and CAR nuclear receptors. ► Non-coplanar PCB activation of CYP3A4/MDR1 reporter genes is structure-dependent. ► Non-coplanar PCB activate CYP3A4/MDR1 reporter genes in a tissue-dependent. ► PCB153 is the most potent activator of PXR/CAR target gene in all tissues.« less
Statistical tools for transgene copy number estimation based on real-time PCR.
Yuan, Joshua S; Burris, Jason; Stewart, Nathan R; Mentewab, Ayalew; Stewart, C Neal
2007-11-01
As compared with traditional transgene copy number detection technologies such as Southern blot analysis, real-time PCR provides a fast, inexpensive and high-throughput alternative. However, the real-time PCR based transgene copy number estimation tends to be ambiguous and subjective stemming from the lack of proper statistical analysis and data quality control to render a reliable estimation of copy number with a prediction value. Despite the recent progresses in statistical analysis of real-time PCR, few publications have integrated these advancements in real-time PCR based transgene copy number determination. Three experimental designs and four data quality control integrated statistical models are presented. For the first method, external calibration curves are established for the transgene based on serially-diluted templates. The Ct number from a control transgenic event and putative transgenic event are compared to derive the transgene copy number or zygosity estimation. Simple linear regression and two group T-test procedures were combined to model the data from this design. For the second experimental design, standard curves were generated for both an internal reference gene and the transgene, and the copy number of transgene was compared with that of internal reference gene. Multiple regression models and ANOVA models can be employed to analyze the data and perform quality control for this approach. In the third experimental design, transgene copy number is compared with reference gene without a standard curve, but rather, is based directly on fluorescence data. Two different multiple regression models were proposed to analyze the data based on two different approaches of amplification efficiency integration. Our results highlight the importance of proper statistical treatment and quality control integration in real-time PCR-based transgene copy number determination. These statistical methods allow the real-time PCR-based transgene copy number estimation
Aldhous, Marian C; Abu Bakar, Suhaili; Prescott, Natalie J; Palla, Raquel; Soo, Kimberley; Mansfield, John C; Mathew, Christopher G; Satsangi, Jack; Armour, John A L
2010-12-15
The copy number variation in beta-defensin genes on human chromosome 8 has been proposed to underlie susceptibility to inflammatory disorders, but presents considerable challenges for accurate typing on the scale required for adequately powered case-control studies. In this work, we have used accurate methods of copy number typing based on the paralogue ratio test (PRT) to assess beta-defensin copy number in more than 1500 UK DNA samples including more than 1000 cases of Crohn's disease. A subset of 625 samples was typed using both PRT-based methods and standard real-time PCR methods, from which direct comparisons highlight potentially serious shortcomings of a real-time PCR assay for typing this variant. Comparing our PRT-based results with two previous studies based only on real-time PCR, we find no evidence to support the reported association of Crohn's disease with either low or high beta-defensin copy number; furthermore, it is noteworthy that there are disagreements between different studies on the observed frequency distribution of copy number states among European controls. We suggest safeguards to be adopted in assessing and reporting the accuracy of copy number measurement, with particular emphasis on integer clustering of results, to avoid reporting of spurious associations in future case-control studies.
Aldhous, Marian C.; Abu Bakar, Suhaili; Prescott, Natalie J.; Palla, Raquel; Soo, Kimberley; Mansfield, John C.; Mathew, Christopher G.; Satsangi, Jack; Armour, John A.L.
2010-01-01
The copy number variation in beta-defensin genes on human chromosome 8 has been proposed to underlie susceptibility to inflammatory disorders, but presents considerable challenges for accurate typing on the scale required for adequately powered case–control studies. In this work, we have used accurate methods of copy number typing based on the paralogue ratio test (PRT) to assess beta-defensin copy number in more than 1500 UK DNA samples including more than 1000 cases of Crohn's disease. A subset of 625 samples was typed using both PRT-based methods and standard real-time PCR methods, from which direct comparisons highlight potentially serious shortcomings of a real-time PCR assay for typing this variant. Comparing our PRT-based results with two previous studies based only on real-time PCR, we find no evidence to support the reported association of Crohn's disease with either low or high beta-defensin copy number; furthermore, it is noteworthy that there are disagreements between different studies on the observed frequency distribution of copy number states among European controls. We suggest safeguards to be adopted in assessing and reporting the accuracy of copy number measurement, with particular emphasis on integer clustering of results, to avoid reporting of spurious associations in future case–control studies. PMID:20858604
Quadruplex MAPH: improvement of throughput in high-resolution copy number screening
Tyson, Jess; Majerus, Tamsin MO; Walker, Susan; Armour, John AL
2009-01-01
Background Copy number variation (CNV) in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Results Multiplex Amplifiable Probe Hybridisation (MAPH) is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH") that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC) samples. Conclusion QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms. PMID:19785739
Yang, Zemin; Lin, Jing; Chen, Longhui; Zhang, Min; Yang, Xiaorong; Chen, Weiwen
2015-06-01
To compare the correlations between salivary alpha-amylase (sAA) activity and amylase, alpha 1 (salivary) gene (AMYl) copy number or its gene expression between splenic asthenia and healthy children, and investigate the reasons of attenuated sAA activity ratio before and after citric acid stimulation in splenic asthenia children. Saliva samples from 20 splenic asthenia children and 29 healthy children were collected before and after citric acid stimulation. AMYl copy number, sAA activity, and total sAA and glycosylated sAA contents were determined, and their correlations were analyzed. Although splenic asthenia and healthy children had no differences in AMY1 copy number, splenic asthenia children had positive correlations between AMY1 copy number and sAA activity before or after citric acid stimulation. Splenic asthenia children had a higher sAA glycosylated proportion ratio and glycosylated sAA content ratio, while their total sAA content ratio and sAA activity ratio were lower compared with healthy children. The glycosylated sAA content ratio was higher than the total sAA content ratio in both groups. Splenic asthenia and healthy children had positive correlations between total sAA or glycosylated sAA content and sAA activity. However, the role played by glycosylated sAA content in sAA activity in healthy children increased after citric acid stimulation, while it decreased in splenic asthenia children. Genetic factors like AMY1 copy number variations, and more importantly, sAA glycosylation abnormalities leading to attenuated sAA activity after citric acid stimulation, which were the main reasons of the attenuated sAA activity ratio in splenic asthenia children compared with healthy children.
Site-Specific Gene Editing of Human Hematopoietic Stem Cells for X-Linked Hyper-IgM Syndrome.
Kuo, Caroline Y; Long, Joseph D; Campo-Fernandez, Beatriz; de Oliveira, Satiro; Cooper, Aaron R; Romero, Zulema; Hoban, Megan D; Joglekar, Alok V; Lill, Georgia R; Kaufman, Michael L; Fitz-Gibbon, Sorel; Wang, Xiaoyan; Hollis, Roger P; Kohn, Donald B
2018-05-29
X-linked hyper-immunoglobulin M (hyper-IgM) syndrome (XHIM) is a primary immunodeficiency due to mutations in CD40 ligand that affect immunoglobulin class-switch recombination and somatic hypermutation. The disease is amenable to gene therapy using retroviral vectors, but dysregulated gene expression results in abnormal lymphoproliferation in mouse models, highlighting the need for alternative strategies. Here, we demonstrate the ability of both the transcription activator-like effector nuclease (TALEN) and clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR/Cas9) platforms to efficiently drive integration of a normal copy of the CD40L cDNA delivered by Adeno-Associated Virus. Site-specific insertion of the donor sequence downstream of the endogenous CD40L promoter maintained physiologic expression of CD40L while overriding all reported downstream mutations. High levels of gene modification were achieved in primary human hematopoietic stem cells (HSCs), as well as in cell lines and XHIM-patient-derived T cells. Notably, gene-corrected HSCs engrafted in immunodeficient mice at clinically relevant frequencies. These studies provide the foundation for a permanent curative therapy in XHIM. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Identification of copy number variants in horses.
Doan, Ryan; Cohen, Noah; Harrington, Jessica; Veazey, Kylee; Veazy, Kylee; Juras, Rytis; Cothran, Gus; McCue, Molly E; Skow, Loren; Dindot, Scott V
2012-05-01
Copy number variants (CNVs) represent a substantial source of genetic variation in mammals. However, the occurrence of CNVs in horses and their subsequent impact on phenotypic variation is unknown. We performed a study to identify CNVs in 16 horses representing 15 distinct breeds (Equus caballus) and an individual gray donkey (Equus asinus) using a whole-exome tiling array and the array comparative genomic hybridization methodology. We identified 2368 CNVs ranging in size from 197 bp to 3.5 Mb. Merging identical CNVs from each animal yielded 775 CNV regions (CNVRs), involving 1707 protein- and RNA-coding genes. The number of CNVs per animal ranged from 55 to 347, with median and mean sizes of CNVs of 5.3 kb and 99.4 kb, respectively. Approximately 6% of the genes investigated were affected by a CNV. Biological process enrichment analysis indicated CNVs primarily affected genes involved in sensory perception, signal transduction, and metabolism. CNVs also were identified in genes regulating blood group antigens, coat color, fecundity, lactation, keratin formation, neuronal homeostasis, and height in other species. Collectively, these data are the first report of copy number variation in horses and suggest that CNVs are common in the horse genome and may modulate biological processes underlying different traits observed among horses and horse breeds.
Familial cases of Norrie disease detected by copy number analysis.
Arai, Eisuke; Fujimaki, Takuro; Yanagawa, Ai; Fujiki, Keiko; Yokoyama, Toshiyuki; Okumura, Akihisa; Shimizu, Toshiaki; Murakami, Akira
2014-09-01
Norrie disease (ND, MIM#310600) is an X-linked disorder characterized by severe vitreoretinal dysplasia at birth. We report the results of causative NDP gene analysis in three male siblings with Norrie disease and describe the associated phenotypes. Three brothers with suspected Norrie disease and their mother presented for clinical examination. After obtaining informed consent, DNA was extracted from the peripheral blood of the proband, one of his brothers and his unaffected mother. Exons 1-3 of the NDP gene were amplified by polymerase chain reaction (PCR), and direct sequencing was performed. Multiplex ligation-dependent probe amplification (MLPA) was also performed to search for copy number variants in the NDP gene. The clinical findings of the three brothers included no light perception, corneal opacity, shallow anterior chamber, leukocoria, total retinal detachment and mental retardation. Exon 2 of the NDP gene was not amplified in the proband and one brother, even when the PCR primers for exon 2 were changed, whereas the other two exons showed no mutations by direct sequencing. MLPA analysis showed deletion of exon 2 of the NDP gene in the proband and one brother, while there was only one copy of exon 2 in the mother. Norrie disease was diagnosed in three patients from a Japanese family by clinical examination and was confirmed by genetic analysis. To localize the defect, confirmation of copy number variation by the MLPA method was useful in the present study.
Elia, Josephine; Glessner, Joseph T; Wang, Kai; Takahashi, Nagahide; Shtir, Corina J; Hadley, Dexter; Sleiman, Patrick M A; Zhang, Haitao; Kim, Cecilia E; Robison, Reid; Lyon, Gholson J; Flory, James H; Bradfield, Jonathan P; Imielinski, Marcin; Hou, Cuiping; Frackelton, Edward C; Chiavacci, Rosetta M; Sakurai, Takeshi; Rabin, Cara; Middleton, Frank A; Thomas, Kelly A; Garris, Maria; Mentch, Frank; Freitag, Christine M; Steinhausen, Hans-Christoph; Todorov, Alexandre A; Reif, Andreas; Rothenberger, Aribert; Franke, Barbara; Mick, Eric O; Roeyers, Herbert; Buitelaar, Jan; Lesch, Klaus-Peter; Banaschewski, Tobias; Ebstein, Richard P; Mulas, Fernando; Oades, Robert D; Sergeant, Joseph; Sonuga-Barke, Edmund; Renner, Tobias J; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Meyer, Jobst; Pálmason, Haukur; Seitz, Christiane; Loo, Sandra K; Smalley, Susan L; Biederman, Joseph; Kent, Lindsey; Asherson, Philip; Anney, Richard J L; Gaynor, J William; Shaw, Philip; Devoto, Marcella; White, Peter S; Grant, Struan F A; Buxbaum, Joseph D; Rapoport, Judith L; Williams, Nigel M; Nelson, Stanley F; Faraone, Stephen V; Hakonarson, Hakon
2014-01-01
Attention deficit hyperactivity disorder (ADHD) is a common, heritable neuropsychiatric disorder of unknown etiology. We performed a whole-genome copy number variation (CNV) study on 1,013 cases with ADHD and 4,105 healthy children of European ancestry using 550,000 SNPs. We evaluated statistically significant findings in multiple independent cohorts, with a total of 2,493 cases with ADHD and 9,222 controls of European ancestry, using matched platforms. CNVs affecting metabotropic glutamate receptor genes were enriched across all cohorts (P = 2.1 × 10−9). We saw GRM5 (encoding glutamate receptor, metabotropic 5) deletions in ten cases and one control (P = 1.36 × 10−6). We saw GRM7 deletions in six cases, and we saw GRM8 deletions in eight cases and no controls. GRM1 was duplicated in eight cases. We experimentally validated the observed variants using quantitative RT-PCR. A gene network analysis showed that genes interacting with the genes in the GRM family are enriched for CNVs in ~10% of the cases (P = 4.38 × 10−10) after correction for occurrence in the controls. We identified rare recurrent CNVs affecting glutamatergic neurotransmission genes that were overrepresented in multiple ADHD cohorts. PMID:22138692
Aluminum tolerance is associated with higher MATE1 gene copy-number in maize
USDA-ARS?s Scientific Manuscript database
Genome structure variation, including copy-number (CNV) and presence/absence variation (PAV), comprise a large extent of maize genetic diversity but their effect on phenotypes remains largely unexplored. Here we describe how copy-number variation in a major aluminum (Al) tolerance locus contributes ...
Eye drop delivery of nano-polymeric micelle formulated genes with cornea-specific promoters.
Tong, Yaw-Chong; Chang, Shwu-Fen; Liu, Chia-Yang; Kao, Winston W-Y; Huang, Chong Heng; Liaw, Jiahorng
2007-11-01
This study evaluates the eye drop delivery of genes with cornea-specific promoters, i.e., keratin 12 (K12) and keratocan (Kera3.2) promoters, by non-ionic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) polymeric micelles (PM) to mouse and rabbit eyes, and investigates the underlying mechanisms. Three PM-formulated plasmids (pCMV-Lac Z, pK12-Lac Z and pKera3.2-Lac Z) containing the Lac Z gene for beta-galactosidase (beta-Gal) whose expression was driven by the promoter of either the cytomegalovirus early gene, the keratin 12 gene or the keratocan gene, were characterized by critical micelle concentration (CMC), dynamic light scattering (DLS), and atomic force microscopy (AFM). Transgene expression in ocular tissue after gene delivery was analyzed by 5-bromo-4-chloro-3-indolyl-beta-D-galactoside (X-Gal) color staining, 1,2-dioxetane beta-Gal enzymatic activity measurement, and real-time polymerase chain reaction (PCR) analysis. The delivery mechanisms of plasmid-PM on mouse and rabbit corneas were evaluated by EDTA and RGD (arginine-glycine-aspartic acid) peptide. The sizes of the three plasmid-PM complexes were around 150-200 nm with unimodal distribution. Enhanced stability was found for three plasmid-PM formulations after DNase I treatment. After six doses of eye drop delivery of pK12-Lac Z-PM three times a day, beta-Gal activity was significantly increased in both mouse and rabbit corneas. Stroma-specific Lac Z expression was only found in pKera3.2-Lac Z-PM-treated animals with pretreatment by 5 mM EDTA, an opener of junctions. Lac Z gene expression in both pK12-Lac Z-PM and pKera3.2-Lac Z-PM delivery groups was decreased by RGD peptide pretreatment. Cornea epithelium- and stroma-specific gene expression could be achieved using cornea-specific promoters of keratin 12 and keratocan genes, and the gene was delivered with PM formulation through non-invasive, eye drop in mice and rabbits. The transfection mechanism of plasmid-PM may
Sex bias in copy number variation of olfactory receptor gene family depends on ethnicity.
Shadravan, Farideh
2013-01-01
Gender plays a pivotal role in the human genetic identity and is also manifested in many genetic disorders particularly mental retardation. In this study its effect on copy number variation (CNV), known to cause genetic disorders was explored. As the olfactory receptor (OR) repertoire comprises the largest human gene family, it was selected for this study, which was carried out within and between three populations, derived from 150 individuals from the 1000 Genome Project. Analysis of 3872 CNVs detected among 791 OR loci, in which 307 loci showed CNV, revealed the following novel findings: Sex bias in CNV was significantly more prevalent in uncommon than common CNV variants of OR pseudogenes, in which the male genome showed more CNVs; and in one-copy number loss compared to complete deletion of OR pseudogenes; both findings implying a more recent evolutionary role for gender. Sex bias in copy number gain was also detected. Another novel finding was that the observed sex bias was largely dependent on ethnicity and was in general absent in East Asians. Using a CNV public database for sick children (International Standard Cytogenomic Array Consortium) the application of these findings for improving clinical molecular diagnostics is discussed by showing an example of sex bias in CNV among kids with autism. Additional clinical relevance is discussed, as the most polymorphic CNV-enriched OR cluster in the human genome, located on chr 15q11.2, is found near the Prader-Willi syndrome/Angelman syndrome bi-directionally imprinted region associated with two well-known mental retardation syndromes. As olfaction represents the primitive cognition in most mammals, arguably in competition with the development of a larger brain, the extensive retention of OR pseudogenes in females of this study, might point to a parent-of-origin indirect regulatory role for OR pseudogenes in the embryonic development of human brain. Thus any perturbation in the temporal regulation of olfactory
Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V
2007-06-15
A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.
Etemadmoghadam, Dariush; deFazio, Anna; Beroukhim, Rameen; Mermel, Craig; George, Joshy; Getz, Gad; Tothill, Richard; Okamoto, Aikou; Raeder, Maria B; Harnett, Paul; Lade, Stephen; Akslen, Lars A; Tinker, Anna V; Locandro, Bianca; Alsop, Kathryn; Chiew, Yoke-Eng; Traficante, Nadia; Fereday, Sian; Johnson, Daryl; Fox, Stephen; Sellers, William; Urashima, Mitsuyoshi; Salvesen, Helga B; Meyerson, Matthew; Bowtell, David
2009-02-15
A significant number of women with serous ovarian cancer are intrinsically refractory to platinum-based treatment. We analyzed somatic DNA copy number variation and gene expression data to identify key mechanisms associated with primary resistance in advanced-stage serous cancers. Genome-wide copy number variation was measured in 118 ovarian tumors using high-resolution oligonucleotide microarrays. A well-defined subset of 85 advanced-stage serous tumors was then used to relate copy number variation to primary resistance to treatment. The discovery-based approach was complemented by quantitative-PCR copy number analysis of 12 candidate genes as independent validation of previously reported associations with clinical outcome. Likely copy number variation targets and tumor molecular subtypes were further characterized by gene expression profiling. Amplification of 19q12, containing cyclin E (CCNE1), and 20q11.22-q13.12, mapping immediately adjacent to the steroid receptor coactivator NCOA3, was significantly associated with poor response to primary treatment. Other genes previously associated with copy number variation and clinical outcome in ovarian cancer were not associated with primary treatment resistance. Chemoresistant tumors with high CCNE1 copy number and protein expression were associated with increased cellular proliferation but so too was a subset of treatment-responsive patients, suggesting a cell-cycle independent role for CCNE1 in modulating chemoresponse. Patients with a poor clinical outcome without CCNE1 amplification overexpressed genes involved in extracellular matrix deposition. We have identified two distinct mechanisms of primary treatment failure in serous ovarian cancer, involving CCNE1 amplification and enhanced extracellular matrix deposition. CCNE1 copy number is validated as a dominant marker of patient outcome in ovarian cancer.
Deonovic, Benjamin; Wang, Yunhao; Weirather, Jason; Wang, Xiu-Jie; Au, Kin Fai
2017-01-01
Abstract Allele-specific expression (ASE) is a fundamental problem in studying gene regulation and diploid transcriptome profiles, with two key challenges: (i) haplotyping and (ii) estimation of ASE at the gene isoform level. Existing ASE analysis methods are limited by a dependence on haplotyping from laborious experiments or extra genome/family trio data. In addition, there is a lack of methods for gene isoform level ASE analysis. We developed a tool, IDP-ASE, for full ASE analysis. By innovative integration of Third Generation Sequencing (TGS) long reads with Second Generation Sequencing (SGS) short reads, the accuracy of haplotyping and ASE quantification at the gene and gene isoform level was greatly improved as demonstrated by the gold standard data GM12878 data and semi-simulation data. In addition to methodology development, applications of IDP-ASE to human embryonic stem cells and breast cancer cells indicate that the imbalance of ASE and non-uniformity of gene isoform ASE is widespread, including tumorigenesis relevant genes and pluripotency markers. These results show that gene isoform expression and allele-specific expression cooperate to provide high diversity and complexity of gene regulation and expression, highlighting the importance of studying ASE at the gene isoform level. Our study provides a robust bioinformatics solution to understand ASE using RNA sequencing data only. PMID:27899656
Zhang, Hui; Wang, Zhen; Cao, Xudong; Wang, Zhengrong; Sheng, Jinliang; Wang, Yong; Zhang, Jing; Li, Zhiqiang; Gu, Xinli; Chen, Chuangfu
2016-11-01
Loop-mediated isothermal amplification (LAMP) is a highly sensitive, rapid, cost-effective nucleic acid amplification method. Tuberculosis (TB) is widely popular in the world and it is difficult to cure. The fundamental treatment is to clear the types of TB pathogens such as Mycobacterium bovis (M. bovis), Mycobacterium tuberculosis (M. tuberculosis). In order to detect and diagnose TB early, we constructed the differential diagnostic method of TB. In this study, we used LAMP for detection of M. bovis, based on amplification of the mpb70 gene which is a unique gene in M. bovis strain. The LAMP assay was able to detect only seven copies of the gene per reaction, whereas for the conventional PCR, it was 70 copies. The LAMP was evaluated for its specificity using six strains of five Mycobacterium species and 18 related non-Mycobacterium microorganism strains as controls. The target three Mycobacterium strains were all amplified, and no cross-reaction was found with 18 non-Mycobacterium microorganism strains. TB was detected by two methods, LAMP and conventional PCR (based on mpb70 gene); the positive rates of the two methods were 9.55 and 7.01 %, respectively. Our results indicate that the LAMP method should be a potential tool with high convenience, rapidity, sensitivity and specificity for the diagnosis of TB caused by M. bovis. Most importance is that the use of LAMP as diagnostic method in association with diagnostic tests based on mpb70 gene would allow the differentiation between M. bovis and other Mycobacterium in humans or animals. The LAMP method is actually in order to detect human TB, and it can be used for differential diagnosis in this paper.
Mesarch, Matthew B.; Nakatsu, Cindy H.; Nies, Loring
2000-01-01
Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primers that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 102 to 103 gene copies, which was lowered to 100 to 101 gene copies by hybridization. Using the dioxygenase-specific primers, an increase in catechol 2,3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR with a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2,3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation. PMID:10653735
Mesarch, M B; Nakatsu, C H; Nies, L
2000-02-01
Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primers that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 10(2) to 10(3) gene copies, which was lowered to 10(0) to 10(1) gene copies by hybridization. Using the dioxygenase-specific primers, an increase in catechol 2, 3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR with a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2, 3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation.
Onsongo, Getiria; Baughn, Linda B; Bower, Matthew; Henzler, Christine; Schomaker, Matthew; Silverstein, Kevin A T; Thyagarajan, Bharat
2016-11-01
Simultaneous detection of small copy number variations (CNVs) (<0.5 kb) and single-nucleotide variants in clinically significant genes is of great interest for clinical laboratories. The analytical variability in next-generation sequencing (NGS) and artifacts in coverage data because of issues with mappability along with lack of robust bioinformatics tools for CNV detection have limited the utility of targeted NGS data to identify CNVs. We describe the development and implementation of a bioinformatics algorithm, copy number variation-random forest (CNV-RF), that incorporates a machine learning component to identify CNVs from targeted NGS data. Using CNV-RF, we identified 12 of 13 deletions in samples with known CNVs, two cases with duplications, and identified novel deletions in 22 additional cases. Furthermore, no CNVs were identified among 60 genes in 14 cases with normal copy number and no CNVs were identified in another 104 patients with clinical suspicion of CNVs. All positive deletions and duplications were confirmed using a quantitative PCR method. CNV-RF also detected heterozygous deletions and duplications with a specificity of 50% across 4813 genes. The ability of CNV-RF to detect clinically relevant CNVs with a high degree of sensitivity along with confirmation using a low-cost quantitative PCR method provides a framework for providing comprehensive NGS-based CNV/single-nucleotide variant detection in a clinical molecular diagnostics laboratory. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An
2017-09-11
The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.
Gladyshev, Eugene A; Arkhipova, Irina R
2009-12-15
Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.
Global characterization of copy number variants in epilepsy patients from whole genome sequencing
Meloche, Caroline; Andrade, Danielle M.; Lafreniere, Ron G.; Gravel, Micheline; Spiegelman, Dan; Dionne-Laporte, Alexandre; Boelman, Cyrus; Hamdan, Fadi F.; Michaud, Jacques L.; Rouleau, Guy; Minassian, Berge A.; Bourque, Guillaume; Cossette, Patrick
2018-01-01
Epilepsy will affect nearly 3% of people at some point during their lifetime. Previous copy number variants (CNVs) studies of epilepsy have used array-based technology and were restricted to the detection of large or exonic events. In contrast, whole-genome sequencing (WGS) has the potential to more comprehensively profile CNVs but existing analytic methods suffer from limited accuracy. We show that this is in part due to the non-uniformity of read coverage, even after intra-sample normalization. To improve on this, we developed PopSV, an algorithm that uses multiple samples to control for technical variation and enables the robust detection of CNVs. Using WGS and PopSV, we performed a comprehensive characterization of CNVs in 198 individuals affected with epilepsy and 301 controls. For both large and small variants, we found an enrichment of rare exonic events in epilepsy patients, especially in genes with predicted loss-of-function intolerance. Notably, this genome-wide survey also revealed an enrichment of rare non-coding CNVs near previously known epilepsy genes. This enrichment was strongest for non-coding CNVs located within 100 Kbp of an epilepsy gene and in regions associated with changes in the gene expression, such as expression QTLs or DNase I hypersensitive sites. Finally, we report on 21 potentially damaging events that could be associated with known or new candidate epilepsy genes. Our results suggest that comprehensive sequence-based profiling of CNVs could help explain a larger fraction of epilepsy cases. PMID:29649218
NASA Technical Reports Server (NTRS)
Burleigh, Scott C.
2011-01-01
Zero-Copy Objects System software enables application data to be encapsulated in layers of communication protocol without being copied. Indirect referencing enables application source data, either in memory or in a file, to be encapsulated in place within an unlimited number of protocol headers and/or trailers. Zero-copy objects (ZCOs) are abstract data access representations designed to minimize I/O (input/output) in the encapsulation of application source data within one or more layers of communication protocol structure. They are constructed within the heap space of a Simple Data Recorder (SDR) data store to which all participating layers of the stack must have access. Each ZCO contains general information enabling access to the core source data object (an item of application data), together with (a) a linked list of zero or more specific extents that reference portions of this source data object, and (b) linked lists of protocol header and trailer capsules. The concatenation of the headers (in ascending stack sequence), the source data object extents, and the trailers (in descending stack sequence) constitute the transmitted data object constructed from the ZCO. This scheme enables a source data object to be encapsulated in a succession of protocol layers without ever having to be copied from a buffer at one layer of the protocol stack to an encapsulating buffer at a lower layer of the stack. For large source data objects, the savings in copy time and reduction in memory consumption may be considerable.
High bacterial loads of Ureaplasma may be associated with non-specific cervicitis.
Liu, Lu; Cao, Guojun; Zhao, Zhen; Zhao, Fang; Huang, Yanqun
2014-09-01
Ureaplasma parvum and Ureaplasma urealyticum are commonly found in the cervix of women with non-chlamydial and non-gonococcal cervicitis or non-specific cervicitis (NSC). However their contribution to the aetiology of NSC is controversial. U. parvum and U. urealyticum were identified and quantified in cervical swabs collected from 155 women with NSC and 312 controls without NSC, using real-time PCR. The relative bacterial quantification was then calculated using the Ureaplasma copy number divided by the number of host cells; this is important for the correction of bias linked to the number of cells harvested in different swabs. Ureaplasma was detected in 58.7% (91/155) of NSC patients: U. parvum in 30.3%, U. urealyticum in 16.1%, and mixed infection in 12.3%. It was also detected in 54.5% (170/312) of controls: U. parvum in 33.0%, U. urealyticum in 11.5%, and mixed infection in 9.9%. There were no significant differences for U. parvum, U. urealyticum, or mixed infection between the 2 groups (p > 0.05). However, both biovars were present at higher concentrations in NSC patients than in controls (p < 0.05). Using >10 copies/1000 cells as a reference, the positive rate of U. parvum in NSC patients was 16.1%, significantly higher than that in controls at 5.1% (relative risk 3.145, p < 0.05); positive rates of U. urealyticum in NSC patients and controls were 28.4% and 8.7%, respectively, with a statistically significant difference (relative risk 3.131, p < 0.05). Ureaplasma can adhere to host cells, colonize, internalize, and subsequently produce pathological lesions. A high density of Ureaplasma in the cervix may be associated with the aetiology of NSC.
Liu, Yanhong; Zhou, Renke; Baumbusch, Lars O.; Tsavachidis, Spyros; Brewster, Abenaa M.; Do, Kim-Anh; Sahin, Aysegul; Hortobagyi, Gabriel N.; Taube, Joseph H.; Mani, Sendurai A.; Aarøe, Jørgen; Wärnberg, Fredrik; Børresen-Dale, Anne-Lise; Mills, Gordon B.; Thompson, Patricia A.; Bondy, Melissa L.
2014-01-01
Purpose To identify and validate copy number aberrations in early-stage primary breast tumors associated with bone or non-bone metastasis. Patients and Methods Whole-genome molecular inversion probe arrays were used to evaluate copy number imbalances (CNIs) in breast tumors from 960 early-stage patients with information about site of metastasis. The CoxBoost algorithm was used to select metastasis site-related CNIs and to fit a Cox proportional hazards model. Results Gains at 1q41 and 1q42.12 and losses at 1p13.3, 8p22, and Xp11.3 were significantly associated with bone metastasis. Gains at 2p11.2, 3q21.3–22.2, 3q27.1, 10q23.1, and 14q13.2–3 and loss at 7q21.11 were associated with non-bone metastasis. To examine the joint effect of CNIs and clinical predictors, patients were stratified into three risk groups (low, intermediate, and high) based on the sum of predicted linear hazard ratios (HRs). For bone metastasis, the hazard (95% confidence interval) for the low-risk group was 0.32 (0.11–0.92) compared to the intermediate-risk group and 2.99 (1.74–5.11) for the high-risk group. For non-bone metastasis, the hazard for the low-risk group was 0.34 (0.17–0.66) and 2.33 (1.59–3.43) for the high-risk group. The prognostic value of loss at 8p22 for bone metastasis and gains at 10q23.1 for non-bone metastasis, and gain at 11q13.5 for both bone and non-bone metastases were externally validated in 335 breast tumors pooled from four independent cohorts. Conclusions Distinct CNIs are independently associated with bone and non-bone metastasis for early-stage breast cancer patients across cohorts. These data warrant consideration for tailoring surveillance and management of metastasis risk. PMID:24305980
Xiong, Y; Eickbush, T H
1988-01-01
Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482
Psoriasis is associated with increased beta-defensin genomic copy number
Hollox, Edward J.; Huffmeier, Ulrike; Zeeuwen, Patrick L.J.M.; Palla, Raquel; Lascorz, Jesús; Rodijk-Olthuis, Diana; van de Kerkhof, Peter C.M.; Traupe, Heiko; de Jongh, Gys; den Heijer, Martin; Reis, André; Armour, John A.L.; Schalkwijk, Joost
2008-01-01
Psoriasis is a common inflammatory skin disease with a strong genetic component. We have analysed the genomic copy number polymorphism of the beta-defensin region on human chromosome 8 in 179 Dutch psoriasis patients and 272 controls, and in 319 German psoriasis patients and 305 controls. Comparisons in both cohorts show a significant association between higher genomic copy number for beta-defensin genes and the risk of psoriasis. PMID:18059266
Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F
2015-10-01
The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.
Conserved Non-Coding Regulatory Signatures in Arabidopsis Co-Expressed Gene Modules
Spangler, Jacob B.; Ficklin, Stephen P.; Luo, Feng; Freeling, Michael; Feltus, F. Alex
2012-01-01
Complex traits and other polygenic processes require coordinated gene expression. Co-expression networks model mRNA co-expression: the product of gene regulatory networks. To identify regulatory mechanisms underlying coordinated gene expression in a tissue-enriched context, ten Arabidopsis thaliana co-expression networks were constructed after manually sorting 4,566 RNA profiling datasets into aerial, flower, leaf, root, rosette, seedling, seed, shoot, whole plant, and global (all samples combined) groups. Collectively, the ten networks contained 30% of the measurable genes of Arabidopsis and were circumscribed into 5,491 modules. Modules were scrutinized for cis regulatory mechanisms putatively encoded in conserved non-coding sequences (CNSs) previously identified as remnants of a whole genome duplication event. We determined the non-random association of 1,361 unique CNSs to 1,904 co-expression network gene modules. Furthermore, the CNS elements were placed in the context of known gene regulatory networks (GRNs) by connecting 250 CNS motifs with known GRN cis elements. Our results provide support for a regulatory role of some CNS elements and suggest the functional consequences of CNS activation of co-expression in specific gene sets dispersed throughout the genome. PMID:23024789
Conserved non-coding regulatory signatures in Arabidopsis co-expressed gene modules.
Spangler, Jacob B; Ficklin, Stephen P; Luo, Feng; Freeling, Michael; Feltus, F Alex
2012-01-01
Complex traits and other polygenic processes require coordinated gene expression. Co-expression networks model mRNA co-expression: the product of gene regulatory networks. To identify regulatory mechanisms underlying coordinated gene expression in a tissue-enriched context, ten Arabidopsis thaliana co-expression networks were constructed after manually sorting 4,566 RNA profiling datasets into aerial, flower, leaf, root, rosette, seedling, seed, shoot, whole plant, and global (all samples combined) groups. Collectively, the ten networks contained 30% of the measurable genes of Arabidopsis and were circumscribed into 5,491 modules. Modules were scrutinized for cis regulatory mechanisms putatively encoded in conserved non-coding sequences (CNSs) previously identified as remnants of a whole genome duplication event. We determined the non-random association of 1,361 unique CNSs to 1,904 co-expression network gene modules. Furthermore, the CNS elements were placed in the context of known gene regulatory networks (GRNs) by connecting 250 CNS motifs with known GRN cis elements. Our results provide support for a regulatory role of some CNS elements and suggest the functional consequences of CNS activation of co-expression in specific gene sets dispersed throughout the genome.
Jiang, Shu-Ye; Sevugan, Mayalagu; Ramachandran, Srinivasan
2018-05-09
Valine-glutamine (VQ) motif containing proteins play important roles in abiotic and biotic stress responses in plants. However, little is known about the origin and evolution as well as comprehensive expression regulation of the VQ gene family. In this study, we systematically surveyed this gene family in 50 plant genomes from algae, moss, gymnosperm and angiosperm and explored their presence in other species from animals, bacteria, fungi and viruses. No VQs were detected in all tested algae genomes and all genomes from moss, gymnosperm and angiosperm encode varying numbers of VQs. Interestingly, some of fungi, lower animals and bacteria also encode single to a few VQs. Thus, they are not plant-specific and should be regarded as an ancient family. Their family expansion was mainly due to segmental duplication followed by tandem duplication and mobile elements. Limited contribution of gene conversion was detected to the family evolution. Generally, VQs were very much conserved in their motif coding region and were under purifying selection. However, positive selection was also observed during species divergence. Many VQs were up- or down-regulated by various abiotic / biotic stresses and phytohormones in rice and Arabidopsis. They were also co-expressed with some of other stress-related genes. All of the expression data suggest a comprehensive expression regulation of the VQ gene family. We provide new insights into gene expansion, divergence, evolution and their expression regulation of this VQ family. VQs were detectable not only in plants but also in some of fungi, lower animals and bacteria, suggesting the evolutionary conservation and the ancient origin. Overall, VQs are non-plant-specific and play roles in abiotic / biotic responses or other biological processes through comprehensive expression regulation.
2013-01-01
Background Most eukaryotic species represent stable karyotypes with a particular diploid number. B chromosomes are additional to standard karyotypes and may vary in size, number and morphology even between cells of the same individual. For many years it was generally believed that B chromosomes found in some plant, animal and fungi species lacked active genes. Recently, molecular cytogenetic studies showed the presence of additional copies of protein-coding genes on B chromosomes. However, the transcriptional activity of these genes remained elusive. We studied karyotypes of the Siberian roe deer (Capreolus pygargus) that possess up to 14 B chromosomes to investigate the presence and expression of genes on supernumerary chromosomes. Results Here, we describe a 2 Mbp region homologous to cattle chromosome 3 and containing TNNI3K (partial), FPGT, LRRIQ3 and a large gene-sparse segment on B chromosomes of the Siberian roe deer. The presence of the copy of the autosomal region was demonstrated by B-specific cDNA analysis, PCR assisted mapping, cattle bacterial artificial chromosome (BAC) clone localization and quantitative polymerase chain reaction (qPCR). By comparative analysis of B-specific and non-B chromosomal sequences we discovered some B chromosome-specific mutations in protein-coding genes, which further enabled the detection of a FPGT-TNNI3K transcript expressed from duplicated genes located on B chromosomes in roe deer fibroblasts. Conclusions Discovery of a large autosomal segment in all B chromosomes of the Siberian roe deer further corroborates the view of an autosomal origin for these elements. Detection of a B-derived transcript in fibroblasts implies that the protein coding sequences located on Bs are not fully inactivated. The origin, evolution and effect on host of B chromosomal genes seem to be similar to autosomal segmental duplications, which reinforces the view that supernumerary chromosomal elements might play an important role in genome
Effective normalization for copy number variation detection from whole genome sequencing.
Janevski, Angel; Varadan, Vinay; Kamalakaran, Sitharthan; Banerjee, Nilanjana; Dimitrova, Nevenka
2012-01-01
Whole genome sequencing enables a high resolution view of the human genome and provides unique insights into genome structure at an unprecedented scale. There have been a number of tools to infer copy number variation in the genome. These tools, while validated, also include a number of parameters that are configurable to genome data being analyzed. These algorithms allow for normalization to account for individual and population-specific effects on individual genome CNV estimates but the impact of these changes on the estimated CNVs is not well characterized. We evaluate in detail the effect of normalization methodologies in two CNV algorithms FREEC and CNV-seq using whole genome sequencing data from 8 individuals spanning four populations. We apply FREEC and CNV-seq to a sequencing data set consisting of 8 genomes. We use multiple configurations corresponding to different read-count normalization methodologies in FREEC, and statistically characterize the concordance of the CNV calls between FREEC configurations and the analogous output from CNV-seq. The normalization methodologies evaluated in FREEC are: GC content, mappability and control genome. We further stratify the concordance analysis within genic, non-genic, and a collection of validated variant regions. The GC content normalization methodology generates the highest number of altered copy number regions. Both mappability and control genome normalization reduce the total number and length of copy number regions. Mappability normalization yields Jaccard indices in the 0.07 - 0.3 range, whereas using a control genome normalization yields Jaccard index values around 0.4 with normalization based on GC content. The most critical impact of using mappability as a normalization factor is substantial reduction of deletion CNV calls. The output of another method based on control genome normalization, CNV-seq, resulted in comparable CNV call profiles, and substantial agreement in variable gene and CNV region calls
The drug target genes show higher evolutionary conservation than non-target genes.
Lv, Wenhua; Xu, Yongdeng; Guo, Yiying; Yu, Ziqi; Feng, Guanglong; Liu, Panpan; Luan, Meiwei; Zhu, Hongjie; Liu, Guiyou; Zhang, Mingming; Lv, Hongchao; Duan, Lian; Shang, Zhenwei; Li, Jin; Jiang, Yongshuai; Zhang, Ruijie
2016-01-26
Although evidence indicates that drug target genes share some common evolutionary features, there have been few studies analyzing evolutionary features of drug targets from an overall level. Therefore, we conducted an analysis which aimed to investigate the evolutionary characteristics of drug target genes. We compared the evolutionary conservation between human drug target genes and non-target genes by combining both the evolutionary features and network topological properties in human protein-protein interaction network. The evolution rate, conservation score and the percentage of orthologous genes of 21 species were included in our study. Meanwhile, four topological features including the average shortest path length, betweenness centrality, clustering coefficient and degree were considered for comparison analysis. Then we got four results as following: compared with non-drug target genes, 1) drug target genes had lower evolutionary rates; 2) drug target genes had higher conservation scores; 3) drug target genes had higher percentages of orthologous genes and 4) drug target genes had a tighter network structure including higher degrees, betweenness centrality, clustering coefficients and lower average shortest path lengths. These results demonstrate that drug target genes are more evolutionarily conserved than non-drug target genes. We hope that our study will provide valuable information for other researchers who are interested in evolutionary conservation of drug targets.
Schnable, James C; Pedersen, Brent S; Subramaniam, Sabarinath; Freeling, Michael
2011-01-01
Whole genome duplications, or tetraploidies, are an important source of increased gene content. Following whole genome duplication, duplicate copies of many genes are lost from the genome. This loss of genes is biased both in the classes of genes deleted and the subgenome from which they are lost. Many or all classes are genes preferentially retained as duplicate copies are engaged in dose sensitive protein-protein interactions, such that deletion of any one duplicate upsets the status quo of subunit concentrations, and presumably lowers fitness as a result. Transcription factors are also preferentially retained following every whole genome duplications studied. This has been explained as a consequence of protein-protein interactions, just as for other highly retained classes of genes. We show that the quantity of conserved noncoding sequences (CNSs) associated with genes predicts the likelihood of their retention as duplicate pairs following whole genome duplication. As many CNSs likely represent binding sites for transcriptional regulators, we propose that the likelihood of gene retention following tetraploidy may also be influenced by dose-sensitive protein-DNA interactions between the regulatory regions of CNS-rich genes - nicknamed bigfoot genes - and the proteins that bind to them. Using grass genomes, we show that differential loss of CNSs from one member of a pair following the pre-grass tetraploidy reduces its chance of retention in the subsequent maize lineage tetraploidy.
Schnable, James C.; Pedersen, Brent S.; Subramaniam, Sabarinath; Freeling, Michael
2011-01-01
Whole genome duplications, or tetraploidies, are an important source of increased gene content. Following whole genome duplication, duplicate copies of many genes are lost from the genome. This loss of genes is biased both in the classes of genes deleted and the subgenome from which they are lost. Many or all classes are genes preferentially retained as duplicate copies are engaged in dose sensitive protein–protein interactions, such that deletion of any one duplicate upsets the status quo of subunit concentrations, and presumably lowers fitness as a result. Transcription factors are also preferentially retained following every whole genome duplications studied. This has been explained as a consequence of protein–protein interactions, just as for other highly retained classes of genes. We show that the quantity of conserved noncoding sequences (CNSs) associated with genes predicts the likelihood of their retention as duplicate pairs following whole genome duplication. As many CNSs likely represent binding sites for transcriptional regulators, we propose that the likelihood of gene retention following tetraploidy may also be influenced by dose–sensitive protein–DNA interactions between the regulatory regions of CNS-rich genes – nicknamed bigfoot genes – and the proteins that bind to them. Using grass genomes, we show that differential loss of CNSs from one member of a pair following the pre-grass tetraploidy reduces its chance of retention in the subsequent maize lineage tetraploidy. PMID:22645525
Xue, Mingzhan; Shafie, Alaa; Qaiser, Talha; Rajpoot, Nasir M.; Kaltsas, Gregory; James, Sean; Gopalakrishnan, Kishore; Fisk, Adrian; Dimitriadis, Georgios K.; Grammatopoulos, Dimitris K.; Rabbani, Naila; Thornalley, Paul J.; Weickert, Martin O.
2017-01-01
Background The glyoxalase-1 gene (GLO1) is a hotspot for copy-number variation (CNV) in human genomes. Increased GLO1 copy-number is associated with multidrug resistance in tumour chemotherapy, but prevalence of GLO1 CNV in gastro-entero-pancreatic neuroendocrine tumours (GEP-NET) is unknown. Methods GLO1 copy-number variation was measured in 39 patients with GEP-NET (midgut NET, n = 25; pancreatic NET, n = 14) after curative or debulking surgical treatment. Primary tumour tissue, surrounding healthy tissue and, where applicable, additional metastatic tumour tissue were analysed, using real time qPCR. Progression and survival following surgical treatment were monitored over 4.2 ± 0.5 years. Results In the pooled GEP-NET cohort, GLO1 copy-number in healthy tissue was 2.0 in all samples but significantly increased in primary tumour tissue in 43% of patients with pancreatic NET and in 72% of patients with midgut NET, mainly driven by significantly higher GLO1 copy-number in midgut NET. In tissue from additional metastases resection (18 midgut NET and one pancreatic NET), GLO1 copy number was also increased, compared with healthy tissue; but was not significantly different compared with primary tumour tissue. During mean 3 - 5 years follow-up, 8 patients died and 16 patients showed radiological progression. In midgut NET, a high GLO1 copy-number was associated with earlier progression. In NETs with increased GLO1 copy number, there was increased Glo1 protein expression compared to non-malignant tissue. Conclusions GLO1 copy-number was increased in a large percentage of patients with GEP-NET and correlated positively with increased Glo1 protein in tumour tissue. Analysis of GLO1 copy-number variation particularly in patients with midgut NET could be a novel prognostic marker for tumour progression. PMID:29100361
Genomic Pangea: coordinate gene regulation and cell-specific chromosomal topologies.
Laster, Kyle; Kosak, Steven T
2010-06-01
The eukaryotic nucleus is functionally organized. Gene loci, for example, often reveal altered localization patterns according to their developmental regulation. Whole chromosomes also demonstrate non-random nuclear positions, correlated with inherent characteristics such as gene density or size. Given that hundreds to thousands of genes are coordinately regulated in any given cell type, interest has grown in whether chromosomes may be specifically localized according to gene regulation. A synthesis of the evidence for preferential chromosomal organization suggests that, beyond basic characteristics, chromosomes can assume positions functionally related to gene expression. Moreover, analysis of total chromosome organization during cellular differentiation indicates that unique chromosome topologies, albeit probabilistic, in effect define a cell lineage. Future work with new techniques, including the advanced forms of the chromosome conformation capture (3C), and the development of next-generation whole-genome imaging approaches, will help to refine our view of chromosomal organization. We suggest that genomic organization during cellular differentiation should be viewed as a dynamic process, with gene expression patterns leading to chromosome associations that feed back on themselves, leading to the self-organization of the genome according to coordinate gene regulation. Copyright 2010 Elsevier Ltd. All rights reserved.
Computation and application of tissue-specific gene set weights.
Frost, H Robert
2018-04-06
Gene set testing, or pathway analysis, has become a critical tool for the analysis of highdimensional genomic data. Although the function and activity of many genes and higher-level processes is tissue-specific, gene set testing is typically performed in a tissue agnostic fashion, which impacts statistical power and the interpretation and replication of results. To address this challenge, we have developed a bioinformatics approach to compute tissuespecific weights for individual gene sets using information on tissue-specific gene activity from the Human Protein Atlas (HPA). We used this approach to create a public repository of tissue-specific gene set weights for 37 different human tissue types from the HPA and all collections in the Molecular Signatures Database (MSigDB). To demonstrate the validity and utility of these weights, we explored three different applications: the functional characterization of human tissues, multi-tissue analysis for systemic diseases and tissue-specific gene set testing. All data used in the reported analyses is publicly available. An R implementation of the method and tissue-specific weights for MSigDB gene set collections can be downloaded at http://www.dartmouth.edu/∼hrfrost/TissueSpecificGeneSets. rob.frost@dartmouth.edu.
Zinc-finger protein-targeted gene regulation: Genomewide single-gene specificity
Tan, Siyuan; Guschin, Dmitry; Davalos, Albert; Lee, Ya-Li; Snowden, Andrew W.; Jouvenot, Yann; Zhang, H. Steven; Howes, Katherine; McNamara, Andrew R.; Lai, Albert; Ullman, Chris; Reynolds, Lindsey; Moore, Michael; Isalan, Mark; Berg, Lutz-Peter; Campos, Bradley; Qi, Hong; Spratt, S. Kaye; Case, Casey C.; Pabo, Carl O.; Campisi, Judith; Gregory, Philip D.
2003-01-01
Zinc-finger protein transcription factors (ZFP TFs) can be designed to control the expression of any desired target gene, and thus provide potential therapeutic tools for the study and treatment of disease. Here we report that a ZFP TF can repress target gene expression with single-gene specificity within the human genome. A ZFP TF repressor that binds an 18-bp recognition sequence within the promoter of the endogenous CHK2 gene gives a >10-fold reduction in CHK2 mRNA and protein. This level of repression was sufficient to generate a functional phenotype, as demonstrated by the loss of DNA damage-induced CHK2-dependent p53 phosphorylation. We determined the specificity of repression by using DNA microarrays and found that the ZFP TF repressed a single gene (CHK2) within the monitored genome in two different cell types. These data demonstrate the utility of ZFP TFs as precise tools for target validation, and highlight their potential as clinical therapeutics. PMID:14514889
Estimating the Probability of Traditional Copying, Conditional on Answer-Copying Statistics.
Allen, Jeff; Ghattas, Andrew
2016-06-01
Statistics for detecting copying on multiple-choice tests produce p values measuring the probability of a value at least as large as that observed, under the null hypothesis of no copying. The posterior probability of copying is arguably more relevant than the p value, but cannot be derived from Bayes' theorem unless the population probability of copying and probability distribution of the answer-copying statistic under copying are known. In this article, the authors develop an estimator for the posterior probability of copying that is based on estimable quantities and can be used with any answer-copying statistic. The performance of the estimator is evaluated via simulation, and the authors demonstrate how to apply the formula using actual data. Potential uses, generalizability to other types of cheating, and limitations of the approach are discussed.
Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.
Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien
2017-08-01
RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.
A novel, tissue-specific, Drosophila homeobox gene.
Barad, M; Jack, T; Chadwick, R; McGinnis, W
1988-07-01
The homeobox gene family of Drosophila appears to control a variety of position-specific patterning decisions during embryonic and imaginal development. Most of these patterning decisions determine groups of cells on the anterior-posterior axis of the Drosophila germ band. We have isolated a novel homeobox gene from Drosophila, designated H2.0. H2.0 has the most diverged homeobox so far characterized in metazoa, and, in contrast to all previously isolated homeobox genes, H2.0 exhibits a tissue-specific pattern of expression. The cells that accumulate transcripts for this novel gene correspond to the visceral musculature and its anlagen.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a
Bergmann, D J; Arciero, D M; Hooper, A B
1994-06-01
The organization of genes for three proteins involved in ammonia oxidation in Nitrosomonas europaea has been investigated. The amino acid sequence of the N-terminal region and four heme-containing peptides produced by proteolysis of the tetraheme cytochrome c554 of N. europaea were determined by Edman degradation. The gene (cycA) encoding this cytochrome is present in three copies per genome (H. McTavish, F. LaQuier, D. Arciero, M. Logan, G. Mundfrom, J.A. Fuchs, and A. B. Hooper, J. Bacteriol. 175:2445-2447, 1993). Three clones, representing at least two copies of cycA, were isolated and sequenced by the dideoxy-chain termination procedure. In both copies, the sequences of 211 amino acids derived from the gene sequence are identical and include all amino acids predicted by the proteolytic peptides. In two copies, the cycA open reading frame (ORF) is followed closely (three bases in one copy) by a second ORF predicted to encode a 28-kDa tetraheme c cytochrome not previously characterized but similar to the nirT gene product of Pseudomonas stutzeri. In one copy of the cycA gene cluster, the second ORF is absent.
Guimond, A; Moss, T
1999-02-01
We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.
Rice Ribosomal Protein Large Subunit Genes and Their Spatio-temporal and Stress Regulation
Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Dutta, Mouboni; Madhav, Sheshu M.; Kirti, P. B.
2016-01-01
Ribosomal proteins (RPs) are well-known for their role in mediating protein synthesis and maintaining the stability of the ribosomal complex, which includes small and large subunits. In the present investigation, in a genome-wide survey, we predicted that the large subunit of rice ribosomes is encoded by at least 123 genes including individual gene copies, distributed throughout the 12 chromosomes. We selected 34 candidate genes, each having 2–3 identical copies, for a detailed characterization of their gene structures, protein properties, cis-regulatory elements and comprehensive expression analysis. RPL proteins appear to be involved in interactions with other RP and non-RP proteins and their encoded RNAs have a higher content of alpha-helices in their predicted secondary structures. The majority of RPs have binding sites for metal and non-metal ligands. Native expression profiling of 34 ribosomal protein large (RPL) subunit genes in tissues covering the major stages of rice growth shows that they are predominantly expressed in vegetative tissues and seedlings followed by meiotically active tissues like flowers. The putative promoter regions of these genes also carry cis-elements that respond specifically to stress and signaling molecules. All the 34 genes responded differentially to the abiotic stress treatments. Phytohormone and cold treatments induced significant up-regulation of several RPL genes, while heat and H2O2 treatments down-regulated a majority of them. Furthermore, infection with a bacterial pathogen, Xanthomonas oryzae, which causes leaf blight also induced the expression of 80% of the RPL genes in leaves. Although the expression of RPL genes was detected in all the tissues studied, they are highly responsive to stress and signaling molecules indicating that their encoded proteins appear to have roles in stress amelioration besides house-keeping. This shows that the RPL gene family is a valuable resource for manipulation of stress tolerance in
Scattering on plane waves and the double copy
NASA Astrophysics Data System (ADS)
Adamo, Tim; Casali, Eduardo; Mason, Lionel; Nekovar, Stefan
2018-01-01
Perturbatively around flat space, the scattering amplitudes of gravity are related to those of Yang–Mills by colour-kinematic duality, under which gravitational amplitudes are obtained as the ‘double copy’ of the corresponding gauge theory amplitudes. We consider the question of how to extend this relationship to curved scattering backgrounds, focusing on certain ‘sandwich’ plane waves. We calculate the 3-point amplitudes on these backgrounds and find that a notion of double copy remains in the presence of background curvature: graviton amplitudes on a gravitational plane wave are the double copy of gluon amplitudes on a gauge field plane wave. This is non-trivial in that it requires a non-local replacement rule for the background fields and the momenta and polarization vectors of the fields scattering on the backgrounds. It must also account for new ‘tail’ terms arising from scattering off the background. These encode a memory effect in the scattering amplitudes, which naturally double copies as well.
Distilling perfect GHZ states from two copies of non-GHZ-diagonal mixed states
NASA Astrophysics Data System (ADS)
Wang, Xin-Wen; Tang, Shi-Qing; Yuan, Ji-Bing; Zhang, Deng-Yu
2017-06-01
It has been shown that a nearly pure Greenberger-Horne-Zeilinger (GHZ) state could be distilled from a large (even infinite) number of GHZ-diagonal states that can be obtained by depolarizing general multipartite mixed states (non-GHZ-diagonal states) through sequences of (probabilistic) local operations and classical communications. We here demonstrate that perfect GHZ states can be extracted, with certain probabilities, from two copies of non-GHZ-diagonal mixed states when some conditions are satisfied. This result implies that it is not necessary to depolarize these entangled mixed states to the GHZ-diagonal type, and that they are better than GHZ-diagonal states for distillation of pure GHZ states. We find a wide class of multipartite entangled mixed states that fulfill the requirements. Moreover, we display that the obtained result can be applied to practical noisy environments, e.g., amplitude-damping channels. Our findings provide an important complementarity to conventional GHZ-state distillation protocols (designed for GHZ-diagonal states) in theory, as well as having practical applications.
Shi, Xingjie; Zhao, Qing; Huang, Jian; Xie, Yang; Ma, Shuangge
2015-01-01
Motivation: Both gene expression levels (GEs) and copy number alterations (CNAs) have important biological implications. GEs are partly regulated by CNAs, and much effort has been devoted to understanding their relations. The regulation analysis is challenging with one gene expression possibly regulated by multiple CNAs and one CNA potentially regulating the expressions of multiple genes. The correlations among GEs and among CNAs make the analysis even more complicated. The existing methods have limitations and cannot comprehensively describe the regulation. Results: A sparse double Laplacian shrinkage method is developed. It jointly models the effects of multiple CNAs on multiple GEs. Penalization is adopted to achieve sparsity and identify the regulation relationships. Network adjacency is computed to describe the interconnections among GEs and among CNAs. Two Laplacian shrinkage penalties are imposed to accommodate the network adjacency measures. Simulation shows that the proposed method outperforms the competing alternatives with more accurate marker identification. The Cancer Genome Atlas data are analysed to further demonstrate advantages of the proposed method. Availability and implementation: R code is available at http://works.bepress.com/shuangge/49/ Contact: shuangge.ma@yale.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26342102
Complex Copy Number Variation of AMY1 does not Associate with Obesity in two East Asian Cohorts.
Yong, Rita Y Y; Mustaffa, Su'Aidah B; Wasan, Pavandip S; Sheng, Liang; Marshall, Christian R; Scherer, Stephen W; Teo, Yik-Ying; Yap, Eric P H
2016-07-01
The human amylase gene locus at chromosome 1p21.1 is structurally complex. This region contains two pancreatic amylase genes, AMY2B, AMY2A, and a salivary gene AMY1. The AMY1 gene harbors extensive copy number variation (CNV), and recent studies have implicated this variation in adaptation to starch-rich diets and in association to obesity for European and Asian populations. In this study, we showed that by combining quantitative PCR and digital PCR, coupled with careful experimental design and calibration, we can improve the resolution of genotyping CNV with high copy numbers (CNs). In two East Asian populations of Chinese and Malay ethnicity studied, we observed a unique non-normal distribution of AMY1 diploid CN genotypes with even:odd CNs ratio of 4.5 (3.3-4.7), and an association between the common AMY2A CN = 2 genotype and odd CNs of AMY1, that could be explained by the underlying haplotypic structure. In two further case-control cohorts (n = 932 and 145, for Chinese and Malays, respectively), we did not observe the previously reported association between AMY1 and obesity or body mass index. Improved methods for accurately genotyping multiallelic CNV loci and understanding the haplotype complexity at the AMY1 locus are necessary for population genetics and association studies. © 2016 WILEY PERIODICALS, INC.
Mosca, Stephen J; Langevin, Lisa Marie; Dewey, Deborah; Innes, A Micheil; Lionel, Anath C; Marshall, Christian C; Scherer, Stephen W; Parboosingh, Jillian S; Bernier, Francois P
2016-12-01
Developmental coordination disorder is a common neurodevelopment disorder that frequently co-occurs with other neurodevelopmental disorders including attention-deficit hyperactivity disorder (ADHD). Copy-number variations (CNVs) have been implicated in a number of neurodevelopmental and psychiatric disorders; however, the proportion of heritability in developmental coordination disorder (DCD) attributed to CNVs has not been explored. This study aims to investigate how CNVs may contribute to the genetic architecture of DCD. CNV analysis was performed on 82 extensively phenotyped Canadian children with DCD, with or without co-occurring ADHD and/or reading disorder, and 2988 healthy European controls using identical genome-wide SNP microarrays and CNV calling algorithms. An increased rate of large and rare genic CNVs (p=0.009) was detected, and there was an enrichment of duplications spanning brain-expressed genes (p=0.039) and genes previously implicated in other neurodevelopmental disorders (p=0.043). Genes and loci of particular interest in this group included: GAP43, RBFOX1, PTPRN2, SHANK3, 16p11.2 and distal 22q11.2. Although no recurrent CNVs were identified, 26% of DCD cases, where sample availability permitted segregation analysis, were found to have a de novo rare CNV. Of the inherited CNVs, 64% were from a parent who also had a neurodevelopmental disorder. These findings suggest that there may be shared susceptibility genes for DCD and other neurodevelopmental disorders and highlight the need for thorough phenotyping when investigating the genetics of neurodevelopmental disorders. Furthermore, these data provide compelling evidence supporting a genetic basis for DCD, and further implicate rare CNVs in the aetiology of neurodevelopmental disorders. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Dalkmann, Philipp; Broszat, Melanie; Siebe, Christina; Willaschek, Elisha; Sakinc, Tuerkan; Huebner, Johannes; Amelung, Wulf; Grohmann, Elisabeth; Siemens, Jan
2012-01-01
Irrigation with wastewater releases pharmaceuticals, pathogenic bacteria, and resistance genes, but little is known about the accumulation of these contaminants in the environment when wastewater is applied for decades. We sampled a chronosequence of soils that were variously irrigated with wastewater from zero up to 100 years in the Mezquital Valley, Mexico, and investigated the accumulation of ciprofloxacin, enrofloxacin, sulfamethoxazole, trimethoprim, clarithromycin, carbamazepine, bezafibrate, naproxen, diclofenac, as well as the occurrence of Enterococcus spp., and sul and qnr resistance genes. Total concentrations of ciprofloxacin, sulfamethoxazole, and carbamazepine increased with irrigation duration reaching 95% of their upper limit of 1.4 µg/kg (ciprofloxacin), 4.3 µg/kg (sulfamethoxazole), and 5.4 µg/kg (carbamazepine) in soils irrigated for 19-28 years. Accumulation was soil-type-specific, with largest accumulation rates in Leptosols and no time-trend in Vertisols. Acidic pharmaceuticals (diclofenac, naproxen, bezafibrate) were not retained and thus did not accumulate in soils. We did not detect qnrA genes, but qnrS and qnrB genes were found in two of the irrigated soils. Relative concentrations of sul1 genes in irrigated soils were two orders of magnitude larger (3.15 × 10(-3) ± 0.22 × 10(-3) copies/16S rDNA) than in non-irrigated soils (4.35 × 10(-5)± 1.00 × 10(-5) copies/16S rDNA), while those of sul2 exceeded the ones in non-irrigated soils still by a factor of 22 (6.61 × 10(-4) ± 0.59 × 10(-4) versus 2.99 × 10(-5) ± 0.26 × 10(-5) copies/16S rDNA). Absolute numbers of sul genes continued to increase with prolonging irrigation together with Enterococcus spp. 23S rDNA and total 16S rDNA contents. Increasing total concentrations of antibiotics in soil are not accompanied by increasing relative abundances of resistance genes. Nevertheless, wastewater irrigation enlarges the absolute concentration of resistance genes in soils due to a long
Grüntzig, Verónica; Nold, Stephen C.; Zhou, Jizhong; Tiedje, James M.
2001-01-01
We used real-time PCR to quantify the denitrifying nitrite reductase gene (nirS), a functional gene of biogeochemical significance. The assay was tested in vitro and applied to environmental samples. The primer-probe set selected was specific for nirS sequences that corresponded approximately to the Pseudomonas stutzeri species. The assay was linear from 1 to 106 gene copies (r2 = 0.999). Variability at low gene concentrations did not allow detection of twofold differences in gene copy number at less than 100 copies. DNA spiking and cell-addition experiments gave predicted results, suggesting that this assay provides an accurate measure of P. stutzeri nirS abundance in environmental samples. Although P. stutzeri abundance was high in lake sediment and groundwater samples, we detected low or no abundance of this species in marine sediment samples from Puget Sound (Wash.) and from the Washington ocean margin. These results suggest that P. stutzeri may not be a dominant marine denitrifier. PMID:11157241
Selective sweep on human amylase genes postdates the split with Neanderthals.
Inchley, Charlotte E; Larbey, Cynthia D A; Shwan, Nzar A A; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq; Ricaut, François-Xavier; Mormina, Maru; Mägi, Reedik; Villems, Richard; Metspalu, Mait; Jones, Martin K; Armour, John A L; Kivisild, Toomas
2016-11-17
Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early selective sweep in the human lineage after the split of humans from Neanderthals which led to the fixation of multiple copies of AMY1 in place of a single copy. We find evidence of multiple secondary losses of copy number with the highest frequency (52%) of a deletion of AMY2A and associated low copy number of AMY1 in Northeast Siberian populations whose diet has been low in starch content.
van Mastrigt, Oscar; Lommers, Marcel M A N; de Vries, Yorick C; Abee, Tjakko; Smid, Eddy J
2018-03-23
Lactic acid bacteria can carry multiple plasmids affecting their performance in dairy fermentations. The expression of plasmid-encoded genes and the activity of the corresponding proteins is severely affected by changes in the number of plasmid copies. We studied the impact of growth rate on dynamics of plasmid copy numbers at high growth rates in chemostat cultures and down to near-zero growth rates in retentostat cultures. Five plasmids of the dairy strain Lactococcus lactis FM03-V1 were selected which varied in size (3 to 39 kb), in replication mechanism (theta or rolling-circle) and in putative (dairy-associated) functions. Copy numbers ranged from 1.5 to 40.5 and the copy number of theta-type replicating plasmids were negatively correlated to the plasmid size. Despite the extremely wide range of growth rates (0.0003 h -1 to 0.6 h -1 ), copy numbers of the five plasmids were stable and only slightly increased at near-zero growth rates showing that the plasmid replication rate was strictly controlled. One low-copy number plasmid, carrying a large exopolysaccharide gene cluster, was segregationally unstable during retentostat cultivations reflected in complete loss of the plasmid in one of the retentostat cultures. The copy number of the five plasmids was also hardly affected by varying the pH value, nutrient limitation or presence of citrate (maximum 2.2-fold) signifying the stability in copy number of the plasmids. Importance Lactococcus lactis is extensively used in starter cultures for dairy fermentations. Important traits for growth and survival of L. lactis in dairy fermentations are encoded by genes located on plasmids, such as genes involved in lactose and citrate metabolism, protein degradation and oligopeptide uptake and bacteriophage resistance. Because the number of plasmid copies could affect the expression of plasmid-encoded genes, it is important to know the factors that influence the plasmid copy numbers. We monitored plasmid copy numbers of L
Copy Number Alterations and Methylation in Ewing's Sarcoma
Jahromi, Mona S.; Jones, Kevin B.; Schiffman, Joshua D.
2011-01-01
Ewing's sarcoma is the second most common bone malignancy affecting children and young adults. The prognosis is especially poor in metastatic or relapsed disease. The cell of origin remains elusive, but the EWS-FLI1 fusion oncoprotein is present in the majority of cases. The understanding of the molecular basis of Ewing's sarcoma continues to progress slowly. EWS-FLI1 affects gene expression, but other factors must also be at work such as mutations, gene copy number alterations, and promoter methylation. This paper explores in depth two molecular aspects of Ewing's sarcoma: copy number alterations (CNAs) and methylation. While CNAs consistently have been reported in Ewing's sarcoma, their clinical significance has been variable, most likely due to small sample size and tumor heterogeneity. Methylation is thought to be important in oncogenesis and balanced karyotype cancers such as Ewing's, yet it has received only minimal attention in prior studies. Future CNA and methylation studies will help to understand the molecular basis of this disease. PMID:21437220
ROKU: a novel method for identification of tissue-specific genes.
Kadota, Koji; Ye, Jiazhen; Nakai, Yuji; Terada, Tohru; Shimizu, Kentaro
2006-06-12
One of the important goals of microarray research is the identification of genes whose expression is considerably higher or lower in some tissues than in others. We would like to have ways of identifying such tissue-specific genes. We describe a method, ROKU, which selects tissue-specific patterns from gene expression data for many tissues and thousands of genes. ROKU ranks genes according to their overall tissue specificity using Shannon entropy and detects tissues specific to each gene if any exist using an outlier detection method. We evaluated the capacity for the detection of various specific expression patterns using synthetic and real data. We observed that ROKU was superior to a conventional entropy-based method in its ability to rank genes according to overall tissue specificity and to detect genes whose expression pattern are specific only to objective tissues. ROKU is useful for the detection of various tissue-specific expression patterns. The framework is also directly applicable to the selection of diagnostic markers for molecular classification of multiple classes.
ROKU: a novel method for identification of tissue-specific genes
Kadota, Koji; Ye, Jiazhen; Nakai, Yuji; Terada, Tohru; Shimizu, Kentaro
2006-01-01
Background One of the important goals of microarray research is the identification of genes whose expression is considerably higher or lower in some tissues than in others. We would like to have ways of identifying such tissue-specific genes. Results We describe a method, ROKU, which selects tissue-specific patterns from gene expression data for many tissues and thousands of genes. ROKU ranks genes according to their overall tissue specificity using Shannon entropy and detects tissues specific to each gene if any exist using an outlier detection method. We evaluated the capacity for the detection of various specific expression patterns using synthetic and real data. We observed that ROKU was superior to a conventional entropy-based method in its ability to rank genes according to overall tissue specificity and to detect genes whose expression pattern are specific only to objective tissues. Conclusion ROKU is useful for the detection of various tissue-specific expression patterns. The framework is also directly applicable to the selection of diagnostic markers for molecular classification of multiple classes. PMID:16764735
Genetic Control of L-a and L-(Bc) Dsrna Copy Number in Killer Systems of SACCHAROMYCES CEREVISIAE
Ball, Steven G.; Tirtiaux, Catherine; Wickner, Reed B.
1984-01-01
M dsRNA in yeast encodes a toxin precursor and immunity protein, whereas L-A dsRNA encodes the 81,000-dalton major protein of the intracellular particles in which both L-A and M are found. L-(BC) dsRNA(s) are found in particles with different coat proteins. We find that M dsRNA lowers the copy number of L-A, but not L-(BC). The SKI gene products lower the copy number of L-(BC), L-A, M1 and M2. This is the first known interaction of L-(BC) with any element of the killer systems. The MAK3, MAK10 and PET18 gene products are necessary for L-A maintenance and replication, but mutations in these genes do not affect L-(BC) copy number. Mutations in MAK1, MAK4, MAK7, MAK17 and MAK24 do not detectably affect copy number of L-(BC) or L-A. PMID:17246214
Therapeutic Gene Editing Safety and Specificity.
Lux, Christopher T; Scharenberg, Andrew M
2017-10-01
Therapeutic gene editing is significant for medical advancement. Safety is intricately linked to the specificity of the editing tools used to cut at precise genomic targets. Improvements can be achieved by thoughtful design of nucleases and repair templates, analysis of off-target editing, and careful utilization of viral vectors. Advancements in DNA repair mechanisms and development of new generations of tools improve targeting of specific sequences while minimizing risks. It is important to plot a safe course for future clinical trials. This article reviews safety and specificity for therapeutic gene editing to spur dialogue and advancement. Copyright © 2017 Elsevier Inc. All rights reserved.
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (p<2.2e-16) than HK gene promoters. The entropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
Real-Time PCR for the Detection of Precise Transgene Copy Number in Wheat.
Giancaspro, Angelica; Gadaleta, Agata; Blanco, Antonio
2017-01-01
Despite the unceasing advances in genetic transformation techniques, the success of common delivery methods still lies on the behavior of the integrated transgenes in the host genome. Stability and expression of the introduced genes are influenced by several factors such as chromosomal location, transgene copy number and interaction with the host genotype. Such factors are traditionally characterized by Southern blot analysis, which can be time-consuming, laborious, and often unable to detect the exact copy number of rearranged transgenes. Recent research in crop field suggests real-time PCR as an effective and reliable tool for the precise quantification and characterization of transgene loci. This technique overcomes most problems linked to phenotypic segregation analysis and can analyze hundreds of samples in a day, making it an efficient method for estimating a gene copy number integrated in a transgenic line. This protocol describes the use of real-time PCR for the detection of transgene copy number in durum wheat transgenic lines by means of two different chemistries (SYBR ® Green I dye and TaqMan ® probes).
Weischenfeldt, Joachim; Dubash, Taronish; Drainas, Alexandros P.; Mardin, Balca R.; Chen, Yuanyuan; Stütz, Adrian M.; Waszak, Sebastian M.; Bosco, Graziella; Halvorsen, Ann Rita; Raeder, Benjamin; Efthymiopoulos, Theocharis; Erkek, Serap; Siegl, Christine; Brenner, Hermann; Brustugun, Odd Terje; Dieter, Sebastian M.; Northcott, Paul A.; Petersen, Iver; Pfister, Stefan M.; Schneider, Martin; Solberg, Steinar K.; Thunissen, Erik; Weichert, Wilko; Zichner, Thomas; Thomas, Roman; Peifer, Martin; Helland, Aslaug; Ball, Claudia R.; Jechlinger, Martin; Sotillo, Rocio; Glimm, Hanno; Korbel, Jan O.
2018-01-01
Extensive prior research has focused on somatic copy-number alterations (SCNAs) affecting cancer genes, yet the extent to which recurrent SCNAs exert their influence through rearranging cis-regulatory elements remains unclear. Here, we present a framework for inferring cancer-related gene overexpression resulting from cis-regulatory element reorganization (e.g., enhancer hijacking), by integrating SCNAs, gene expression data, and information on chromatin interaction domains. Analysis of 7,416 cancer genomes uncovered several pan-cancer candidate genes, including IRS4, SMARCA1 and TERT. We demonstrate that IRS4 overexpression in lung cancer associates with recurrent deletions in cis, and present evidence supporting a tumor-promoting role. We additionally pursued cancer type-specific analyses, uncovering IGF2 as a target for enhancer hijacking in colorectal cancer. IGF2-containing tandem duplications result in the de novo formation of a 3D contact domain comprising IGF2 and a lineage-specific super-enhancer, which mediates high-level gene activation. Our framework enables systematic inference of cis-regulatory element rearrangements mediating dysregulation in cancer. PMID:27869826
Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome
2013-01-01
Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in
Sczyrba, Alex
2018-02-13
DOE JGI's Alex Sczyrba on "Evaluation of the Cow Rumen Metagenome" and "Assembly by Single Copy Gene Analysis and Single Cell Genome Assemblies" at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sczyrba, Alex
2011-10-13
DOE JGI's Alex Sczyrba on "Evaluation of the Cow Rumen Metagenome" and "Assembly by Single Copy Gene Analysis and Single Cell Genome Assemblies" at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.
Talke, Ina N; Hanikenne, Marc; Krämer, Ute
2006-09-01
The metal hyperaccumulator Arabidopsis halleri exhibits naturally selected zinc (Zn) and cadmium (Cd) hypertolerance and accumulates extraordinarily high Zn concentrations in its leaves. With these extreme physiological traits, A. halleri phylogenetically belongs to the sister clade of Arabidopsis thaliana. Using a combination of genome-wide cross species microarray analysis and real-time reverse transcription-PCR, a set of candidate genes is identified for Zn hyperaccumulation, Zn and Cd hypertolerance, and the adjustment of micronutrient homeostasis in A. halleri. Eighteen putative metal homeostasis genes are newly identified to be more highly expressed in A. halleri than in A. thaliana, and 11 previously identified candidate genes are confirmed. The encoded proteins include HMA4, known to contribute to root-shoot transport of Zn in A. thaliana. Expression of either AtHMA4 or AhHMA4 confers cellular Zn and Cd tolerance to yeast (Saccharomyces cerevisiae). Among further newly implicated proteins are IRT3 and ZIP10, which have been proposed to contribute to cytoplasmic Zn influx, and FRD3 required for iron partitioning in A. thaliana. In A. halleri, the presence of more than a single genomic copy is a hallmark of several highly expressed candidate genes with possible roles in metal hyperaccumulation and metal hypertolerance. Both A. halleri and A. thaliana exert tight regulatory control over Zn homeostasis at the transcript level. Zn hyperaccumulation in A. halleri involves enhanced partitioning of Zn from roots into shoots. The transcriptional regulation of marker genes suggests that in the steady state, A. halleri roots, but not the shoots, act as physiologically Zn deficient under conditions of moderate Zn supply.
Turner, Peter C; Yomano, Lorraine P; Jarboe, Laura R; York, Sean W; Baggett, Christy L; Moritz, Brélan E; Zentz, Emily B; Shanmugam, K T; Ingram, Lonnie O
2012-04-01
Escherichia coli KO11 (ATCC 55124) was engineered in 1990 to produce ethanol by chromosomal insertion of the Zymomonas mobilis pdc and adhB genes into E. coli W (ATCC 9637). KO11FL, our current laboratory version of KO11, and its parent E. coli W were sequenced, and contigs assembled into genomic sequences using optical NcoI restriction maps as templates. E. coli W contained plasmids pRK1 (102.5 kb) and pRK2 (5.4 kb), but KO11FL only contained pRK2. KO11FL optical maps made with AflII and with BamHI showed a tandem repeat region, consisting of at least 20 copies of a 10-kb unit. The repeat region was located at the insertion site for the pdc, adhB, and chloramphenicol-resistance genes. Sequence coverage of these genes was about 25-fold higher than average, consistent with amplification of the foreign genes that were inserted as circularized DNA. Selection for higher levels of chloramphenicol resistance originally produced strains with higher pdc and adhB expression, and hence improved fermentation performance, by increasing the gene copy number. Sequence data for an earlier version of KO11, ATCC 55124, indicated that multiple copies of pdc adhB were present. Comparison of the W and KO11FL genomes showed large inversions and deletions in KO11FL, mostly enabled by IS10, which is absent from W but present at 30 sites in KO11FL. The early KO11 strain ATCC 55124 had no rearrangements, contained only one IS10, and lacked most accumulated single nucleotide polymorphisms (SNPs) present in KO11FL. Despite rearrangements and SNPs in KO11FL, fermentation performance was equal to that of ATCC 55124.
Whole-genome copy number variation analysis in anophthalmia and microphthalmia.
Schilter, K F; Reis, L M; Schneider, A; Bardakjian, T M; Abdul-Rahman, O; Kozel, B A; Zimmerman, H H; Broeckel, U; Semina, E V
2013-11-01
Anophthalmia/microphthalmia (A/M) represent severe developmental ocular malformations. Currently, mutations in known genes explain less than 40% of A/M cases. We performed whole-genome copy number variation analysis in 60 patients affected with isolated or syndromic A/M. Pathogenic deletions of 3q26 (SOX2) were identified in four independent patients with syndromic microphthalmia. Other variants of interest included regions with a known role in human disease (likely pathogenic) as well as novel rearrangements (uncertain significance). A 2.2-Mb duplication of 3q29 in a patient with non-syndromic anophthalmia and an 877-kb duplication of 11p13 (PAX6) and a 1.4-Mb deletion of 17q11.2 (NF1) in two independent probands with syndromic microphthalmia and other ocular defects were identified; while ocular anomalies have been previously associated with 3q29 duplications, PAX6 duplications, and NF1 mutations in some cases, the ocular phenotypes observed here are more severe than previously reported. Three novel regions of possible interest included a 2q14.2 duplication which cosegregated with microphthalmia/microcornea and congenital cataracts in one family, and 2q21 and 15q26 duplications in two additional cases; each of these regions contains genes that are active during vertebrate ocular development. Overall, this study identified causative copy number mutations and regions with a possible role in ocular disease in 17% of A/M cases. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling; Wang, Xianhui; Kang, Le
2017-06-01
The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain-containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. © The Authors 2017. Published by Oxford University Press.
Jiang, Feng; Liu, Qing; Wang, Yanli; Zhang, Jie; Wang, Huimin; Song, Tianqi; Yang, Meiling
2017-01-01
Abstract The SET domain is an evolutionarily conserved motif present in histone lysine methyltransferases, which are important in the regulation of chromatin and gene expression in animals. In this study, we searched for SET domain–containing genes (SET genes) in all of the 147 arthropod genomes sequenced at the time of carrying out this experiment to understand the evolutionary history by which SET domains have evolved in insects. Phylogenetic and ancestral state reconstruction analysis revealed an arthropod-specific SET gene family, named SmydA, that is ancestral to arthropod animals and specifically diversified during insect evolution. Considering that pseudogenization is the most probable fate of the new emerging gene copies, we provided experimental and evolutionary evidence to demonstrate their essential functions. Fluorescence in situ hybridization analysis and in vitro methyltransferase activity assays showed that the SmydA-2 gene was transcriptionally active and retained the original histone methylation activity. Expression knockdown by RNA interference significantly increased mortality, implying that the SmydA genes may be essential for insect survival. We further showed predominantly strong purifying selection on the SmydA gene family and a potential association between the regulation of gene expression and insect phenotypic plasticity by transcriptome analysis. Overall, these data suggest that the SmydA gene family retains essential functions that may possibly define novel regulatory pathways in insects. This work provides insights into the roles of lineage-specific domain duplication in insect evolution. PMID:28444351
Rakocevic, Alexandra; Mondy, Samuel; Tirichine, Leïla; Cosson, Viviane; Brocard, Lysiane; Iantcheva, Anelia; Cayrel, Anne; Devier, Benjamin; Abu El-Heba, Ghada Ahmed; Ratet, Pascal
2009-11-01
We have identified an active Medicago truncatula copia-like retroelement called Medicago RetroElement1-1 (MERE1-1) as an insertion in the symbiotic NSP2 gene. MERE1-1 belongs to a low-copy-number family in the sequenced Medicago genome. These copies are highly related, but only three of them have a complete coding region and polymorphism exists between the long terminal repeats of these different copies. This retroelement family is present in all M. truncatula ecotypes tested but also in other legume species like Lotus japonicus. It is active only during tissue culture in both R108 and Jemalong Medicago accessions and inserts preferentially in genes.
Inferring Gene Family Histories in Yeast Identifies Lineage Specific Expansions
Ames, Ryan M.; Money, Daniel; Lovell, Simon C.
2014-01-01
The complement of genes found in the genome is a balance between gene gain and gene loss. Knowledge of the specific genes that are gained and lost over evolutionary time allows an understanding of the evolution of biological functions. Here we use new evolutionary models to infer gene family histories across complete yeast genomes; these models allow us to estimate the relative genome-wide rates of gene birth, death, innovation and extinction (loss of an entire family) for the first time. We show that the rates of gene family evolution vary both between gene families and between species. We are also able to identify those families that have experienced rapid lineage specific expansion/contraction and show that these families are enriched for specific functions. Moreover, we find that families with specific functions are repeatedly expanded in multiple species, suggesting the presence of common adaptations and that these family expansions/contractions are not random. Additionally, we identify potential specialisations, unique to specific species, in the functions of lineage specific expanded families. These results suggest that an important mechanism in the evolution of genome content is the presence of lineage-specific gene family changes. PMID:24921666
Prabhanjan, Manasa; Suresh, Raviraj V; Murthy, Megha N; Ramachandra, Nallur B
2016-03-01
To identify the role of copy number variations (CNVs) on disease risk genes and its effect on disease phenotypes in type 2 diabetes mellitus (T2DM) in 12 random populations using high throughput arrays. CNV analysis was carried out on a total of 1715 individuals from 12 populations, from ArrayExpress Archive of the European Bioinformatics Institute along with our subjects using Affymetrix Genome Wide SNP 6.0 array. CNV effect on T2DM genes were analyzed using several bioinformatics tools and a molecular protein interaction network was constructed to identify the disease mechanism altered by the CNVs. Analysis showed 34.4% of the total population to be under CNV burden for T2DM, with 83 disease causal and associated genes being under CNV influence. Hotspots were identified on chromosomes 22, 12, 6, 19 and 11.Overlap studies with case cohorts revealed significant disease risk genes such as EGFR, E2F1, PPP1R3A, HLA and TSPAN8. CNVs play a significant role in predisposing T2DM in normal cohorts and contribute to the phenotypic effects. Thus, CNVs should be considered as one of the major contributors in predisposition of the disease. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Lintner, Katherine E.; Patwardhan, Anjali; Rider, Lisa G.; Abdul-Aziz, Rabheh; Wu, Yee Ling; Lundström, Emeli; Padyukov, Leonid; Zhou, Bi; Alhomosh, Alaaedin; Newsom, David; White, Peter; Jones, Karla B.; O’Hanlon, Terrance P.; Miller, Frederick W.; Spencer, Charles H.; Yu, C. Yung
2017-01-01
Objective Complement-mediated vasculopathy of muscle and skin are clinical features of juvenile dermatomyositis (JDM). We assess gene copy-number variations (CNVs) for complement C4 and its isotypes, C4A and C4B, in genetic risks and pathogenesis of JDM. Methods The study population included 105 JDM patients and 500 healthy European Americans. Gene copy-numbers (GCNs) for total C4, C4A, C4B and HLA-DRB1 genotypes were determined by Southern blots and PCRs. Processed activation product C4d bound to erythrocytes (E-C4d) was measured by flow cytometry. Global gene-expression microarrays were performed in 19 JDM and 7 controls using PAXgene-blood RNA. Differential expression levels for selected genes were validated by qPCR. Results Significantly lower GCNs and differences in distribution of GCN groups for total C4 and C4A were observed between JDM and controls. Lower GCN of C4A in JDM remained among HLA DR3-positive subjects (p=0.015). Homozygous or heterozygous C4A-deficiency was present in 40.0% of JDM compared to 18.2% of controls [odds ratio (OR)=3.00 (1.87–4.79), p=8.2x10−6]. JDM had higher levels of E-C4d than controls (p=0.004). In JDM, C4A-deficient subjects had higher levels of E-C4d (p=0.0003) and higher frequency of elevated levels of multiple serum muscle enzymes at diagnosis (p=0.004). Microarray profiling of blood RNA revealed upregulation of type I Interferon-stimulated genes and lower abundance of transcripts for T-cell and chemokine function genes in JDM, but this was less prominent among C4A-deficient or DR3-positive patients. Conclusions Complement C4A-deficiency appears to be an important factor for the genetic risk and pathogenesis of JDM, particularly in patients with a DR3-positive background. PMID:26493816
Gao, Shiwu; Yang, Yingying; Wang, Chunfeng; Guo, Jinlong; Zhou, Dinggang; Wu, Qibin; Su, Yachun; Xu, Liping
2016-01-01
We developed sugarcane plants with improved resistance to the sugarcane borer, Diatraea saccharalis (F). An expression vector pGcry1Ac0229, harboring the cry1Ac gene and the selectable marker gene, bar, was constructed. This construct was introduced into the sugarcane cultivar FN15 by particle bombardment. Transformed plantlets were identified after selection with Phosphinothricin (PPT) and Basta. Plantlets were then screened by PCR based on the presence of cry1Ac and 14 cry1Ac positive plantlets were identified. Real-time quantitative PCR (RT-qPCR) revealed that the copy number of cry1Ac gene in the transgenic lines varied from 1 to 148. ELISA analysis showed that Cry1Ac protein levels in 7 transgenic lines ranged from 0.85 μg/FWg to 70.92 μg/FWg in leaves and 0.04 μg/FWg to 7.22 μg/FWg in stems, and negatively correlated to the rate of insect damage that ranged from 36.67% to 13.33%, respectively. Agronomic traits of six transgenic sugarcane lines with medium copy numbers were similar to the non-transgenic parental line. However, phenotype was poor in lines with high or low copy numbers. Compared to the non-transgenic control plants, all transgenic lines with medium copy numbers had relatively equal or lower sucrose yield and significantly improved sugarcane borer resistance, which lowered susceptibility to damage by insects. This suggests that the transgenic sugarcane lines harboring medium copy numbers of the cry1Ac gene may have significantly higher resistance to sugarcane borer but the sugarcane yield in these lines is similar to the non-transgenic control thus making them superior to the control lines. PMID:27093437
Shah, Nameeta; Lankerovich, Michael; Lee, Hwahyung; Yoon, Jae-Geun; Schroeder, Brett; Foltz, Greg
2013-11-22
RNA-seq has spurred important gene fusion discoveries in a number of different cancers, including lung, prostate, breast, brain, thyroid and bladder carcinomas. Gene fusion discovery can potentially lead to the development of novel treatments that target the underlying genetic abnormalities. In this study, we provide comprehensive view of gene fusion landscape in 185 glioblastoma multiforme patients from two independent cohorts. Fusions occur in approximately 30-50% of GBM patient samples. In the Ivy Center cohort of 24 patients, 33% of samples harbored fusions that were validated by qPCR and Sanger sequencing. We were able to identify high-confidence gene fusions from RNA-seq data in 53% of the samples in a TCGA cohort of 161 patients. We identified 13 cases (8%) with fusions retaining a tyrosine kinase domain in the TCGA cohort and one case in the Ivy Center cohort. Ours is the first study to describe recurrent fusions involving non-coding genes. Genomic locations 7p11 and 12q14-15 harbor majority of the fusions. Fusions on 7p11 are formed in focally amplified EGFR locus whereas 12q14-15 fusions are formed by complex genomic rearrangements. All the fusions detected in this study can be further visualized and analyzed using our website: http://ivygap.swedish.org/fusions. Our study highlights the prevalence of gene fusions as one of the major genomic abnormalities in GBM. The majority of the fusions are private fusions, and a minority of these recur with low frequency. A small subset of patients with fusions of receptor tyrosine kinases can benefit from existing FDA approved drugs and drugs available in various clinical trials. Due to the low frequency and rarity of clinically relevant fusions, RNA-seq of GBM patient samples will be a vital tool for the identification of patient-specific fusions that can drive personalized therapy.
Characterizing partial AZFc deletions of the Y chromosome with amplicon-specific sequence markers
Navarro-Costa, Paulo; Pereira, Luísa; Alves, Cíntia; Gusmão, Leonor; Proença, Carmen; Marques-Vidal, Pedro; Rocha, Tiago; Correia, Sónia C; Jorge, Sónia; Neves, António; Soares, Ana P; Nunes, Joaquim; Calhaz-Jorge, Carlos; Amorim, António; Plancha, Carlos E; Gonçalves, João
2007-01-01
Background The AZFc region of the human Y chromosome is a highly recombinogenic locus containing multi-copy male fertility genes located in repeated DNA blocks (amplicons). These AZFc gene families exhibit slight sequence variations between copies which are considered to have functional relevance. Yet, partial AZFc deletions yield phenotypes ranging from normospermia to azoospermia, thwarting definite conclusions on their real impact on fertility. Results The amplicon content of partial AZFc deletion products was characterized with novel amplicon-specific sequence markers. Data indicate that partial AZFc deletions are a male infertility risk [odds ratio: 5.6 (95% CI: 1.6–30.1)] and although high diversity of partial deletion products and sequence conversion profiles were recorded, the AZFc marker profiles detected in fertile men were also observed in infertile men. Additionally, the assessment of rearrangement recurrence by Y-lineage analysis indicated that while partial AZFc deletions occurred in highly diverse samples, haplotype diversity was minimal in fertile men sharing identical marker profiles. Conclusion Although partial AZFc deletion products are highly heterogeneous in terms of amplicon content, this plasticity is not sufficient to account for the observed phenotypical variance. The lack of causative association between the deletion of specific gene copies and infertility suggests that AZFc gene content might be part of a multifactorial network, with Y-lineage evolution emerging as a possible phenotype modulator. PMID:17903263
Juul, Malene; Bertl, Johanna; Guo, Qianyun; Nielsen, Morten Muhlig; Świtnicki, Michał; Hornshøj, Henrik; Madsen, Tobias; Hobolth, Asger; Pedersen, Jakob Skou
2017-01-01
Non-coding mutations may drive cancer development. Statistical detection of non-coding driver regions is challenged by a varying mutation rate and uncertainty of functional impact. Here, we develop a statistically founded non-coding driver-detection method, ncdDetect, which includes sample-specific mutational signatures, long-range mutation rate variation, and position-specific impact measures. Using ncdDetect, we screened non-coding regulatory regions of protein-coding genes across a pan-cancer set of whole-genomes (n = 505), which top-ranked known drivers and identified new candidates. For individual candidates, presence of non-coding mutations associates with altered expression or decreased patient survival across an independent pan-cancer sample set (n = 5454). This includes an antigen-presenting gene (CD1A), where 5’UTR mutations correlate significantly with decreased survival in melanoma. Additionally, mutations in a base-excision-repair gene (SMUG1) correlate with a C-to-T mutational-signature. Overall, we find that a rich model of mutational heterogeneity facilitates non-coding driver identification and integrative analysis points to candidates of potential clinical relevance. DOI: http://dx.doi.org/10.7554/eLife.21778.001 PMID:28362259
Different Facets of Copy Number Changes: Permanent, Transient, and Adaptive
Mishra, Sweta
2016-01-01
Chromosomal copy number changes are frequently associated with harmful consequences and are thought of as an underlying mechanism for the development of diseases. However, changes in copy number are observed during development and occur during normal biological processes. In this review, we highlight the causes and consequences of copy number changes in normal physiologic processes as well as cover their associations with cancer and acquired drug resistance. We discuss the permanent and transient nature of copy number gains and relate these observations to a new mechanism driving transient site-specific copy gains (TSSGs). Finally, we discuss implications of TSSGs in generating intratumoral heterogeneity and tumor evolution and how TSSGs can influence the therapeutic response in cancer. PMID:26755558
Selective sweep on human amylase genes postdates the split with Neanderthals
Inchley, Charlotte E.; Larbey, Cynthia D. A.; Shwan, Nzar A. A.; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A.; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq; Ricaut, François-Xavier; Mormina, Maru; Mägi, Reedik; Villems, Richard; Metspalu, Mait; Jones, Martin K.; Armour, John A. L.; Kivisild, Toomas
2016-01-01
Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early selective sweep in the human lineage after the split of humans from Neanderthals which led to the fixation of multiple copies of AMY1 in place of a single copy. We find evidence of multiple secondary losses of copy number with the highest frequency (52%) of a deletion of AMY2A and associated low copy number of AMY1 in Northeast Siberian populations whose diet has been low in starch content. PMID:27853181
Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress
Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica
2015-01-01
Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes’ transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions. PMID:26275223
Lu, Hong; Patil, Prabhu; Van Sluys, Marie-Anne; White, Frank F; Ryan, Robert P; Dow, J Maxwell; Rabinowicz, Pablo; Salzberg, Steven L; Leach, Jan E; Sonti, Ramesh; Brendel, Volker; Bogdanove, Adam J
2008-01-01
Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown. To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors) cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage. Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small number of genes or
Yang, Jing-Hua; Zhang, Ming-Fang; Yu, Jing-Quan
2009-02-01
The transcriptional patterns of mitochondrial respiratory related genes were investigated in cytoplasmic male-sterile and fertile maintainer lines of stem mustard, Brassica juncea. There were numerous differences in nad2 (subunit 2 of NADH dehydrogenase) between stem mustard CMS and its maintainer line. One novel open reading frame, hereafter named orfB gene, was located at the downstream of mitochondrial nad2 gene in the CMS. The novel orfB gene had high similarity with YMF19 family protein, orfB in Raphanus sativus, Helianthus annuus, Nicotiana tabacum and Beta vulgaris, orfB-CMS in Daucus carota, atp8 gene in Arabidopsis thaliana, 5' flanking of orf224 in B. napus (nap CMS) and 5' flanking of orf220 gene in CMS Brassica juncea. Three copies probed by specific fragment (amplified by primers of nad2F and nad2R from CMS) were found in the CMS line following Southern blotting digested with HindIII, but only a single copy in its maintainer line. Meanwhile, two transcripts were shown in the CMS line following Northern blotting while only one transcript was detected in the maintainer line, which were probed by specific fragment (amplified by primers of nad2F and nad2R from CMS). Meanwhile, the expression of nad2 gene was reduced in CMS bud compared to that in its maintainer line. We thus suggested that nad2 gene may be co-transcripted with CMS-associated orfB gene in the CMS. In addition, the specific fragment that was amplified by primers of nad2F and nad2R just spanned partial sequences of nad2 gene and orfB gene. Such alterations in the nad2 gene would impact the activity of NADH dehydrogenase, and subsequently signaling, inducing the expression of nuclear genes involved in male sterility in this type of cytoplasmic male sterility.
Yuen, Garmen; Khan, Fehad J.; Gao, Shaojian; Stommel, Jayne M.; Batchelor, Eric; Wu, Xiaolin
2017-01-01
Abstract CRISPR/Cas9 is a powerful gene editing tool for gene knockout studies and functional genomic screens. Successful implementation of CRISPR often requires Cas9 to elicit efficient target knockout in a population of cells. In this study, we investigated the role of several key factors, including variation in target copy number, inherent potency of sgRNA guides, and expression level of Cas9 and sgRNA, in determining CRISPR knockout efficiency. Using isogenic, clonal cell lines with variable copy numbers of an EGFP transgene, we discovered that CRISPR knockout is relatively insensitive to target copy number, but is highly dependent on the potency of the sgRNA guide sequence. Kinetic analysis revealed that most target mutation occurs between 5 and 10 days following Cas9/sgRNA transduction, while sgRNAs with different potencies differ by their knockout time course and by their terminal-phase knockout efficiency. We showed that prolonged, low level expression of Cas9 and sgRNA often fails to elicit target mutation, particularly if the potency of the sgRNA is also low. Our findings provide new insights into the behavior of CRISPR/Cas9 in mammalian cells that could be used for future improvement of this platform. PMID:29036671
Yuen, Garmen; Khan, Fehad J; Gao, Shaojian; Stommel, Jayne M; Batchelor, Eric; Wu, Xiaolin; Luo, Ji
2017-11-16
CRISPR/Cas9 is a powerful gene editing tool for gene knockout studies and functional genomic screens. Successful implementation of CRISPR often requires Cas9 to elicit efficient target knockout in a population of cells. In this study, we investigated the role of several key factors, including variation in target copy number, inherent potency of sgRNA guides, and expression level of Cas9 and sgRNA, in determining CRISPR knockout efficiency. Using isogenic, clonal cell lines with variable copy numbers of an EGFP transgene, we discovered that CRISPR knockout is relatively insensitive to target copy number, but is highly dependent on the potency of the sgRNA guide sequence. Kinetic analysis revealed that most target mutation occurs between 5 and 10 days following Cas9/sgRNA transduction, while sgRNAs with different potencies differ by their knockout time course and by their terminal-phase knockout efficiency. We showed that prolonged, low level expression of Cas9 and sgRNA often fails to elicit target mutation, particularly if the potency of the sgRNA is also low. Our findings provide new insights into the behavior of CRISPR/Cas9 in mammalian cells that could be used for future improvement of this platform. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Menezes, C N; Duarte, R; Dickens, C; Dix-Peek, T; Van Amsterdam, D; John, M-A; Ive, P; Maskew, M; Macphail, P; Fox, M P; Raal, F; Sanne, I; Crowther, N J
2013-04-01
Stavudine is being phased out because of its mitochondrial toxicity and tenofovir (TDF) is recommended as part of first-line highly active antiretroviral therapy (HAART) in South Africa. A prospective, open-label, randomized controlled trial comparing standard- and low-dose stavudine with TDF was performed to assess early differences in adipocyte mtDNA copy number, gene expression and metabolic parameters in Black South African HIV-infected patients. Sixty patients were randomized 1:1:1 to either standard-dose (30-40 mg) or low-dose (20-30 mg) stavudine or TDF (300 mg) each combined with lamivudine and efavirenz. Subcutaneous fat biopsies were obtained at weeks 0 and 4. Adipocyte mtDNA copies/cell and gene expression were measured using quantitative polymerase chain reaction (qPCR). Markers of inflammation and lipid and glucose metabolism were also assessed. A 29% and 32% decrease in the mean mtDNA copies/cell was noted in the standard-dose (P < 0.05) and low-dose stavudine (P < 0.005) arms, respectively, when compared with TDF at 4 weeks. Nuclear respiratory factor-1 (NRF1) and mitochondrial cytochrome B (MTCYB) gene expression levels were affected by stavudine, with a significantly (P < 0.05) greater fall in expression observed with the standard, but not the low dose compared with TDF. No significant differences were observed in markers of inflammation and lipid and glucose metabolism. These results demonstrate early mitochondrial depletion among Black South African patients receiving low and standard doses of stavudine, with preservation of gene expression levels, except for NRF1 and MTCYB, when compared with patients on TDF. © 2012 British HIV Association.
Noncoding copy-number variations are associated with congenital limb malformation.
Flöttmann, Ricarda; Kragesteen, Bjørt K; Geuer, Sinje; Socha, Magdalena; Allou, Lila; Sowińska-Seidler, Anna; Bosquillon de Jarcy, Laure; Wagner, Johannes; Jamsheer, Aleksander; Oehl-Jaschkowitz, Barbara; Wittler, Lars; de Silva, Deepthi; Kurth, Ingo; Maya, Idit; Santos-Simarro, Fernando; Hülsemann, Wiebke; Klopocki, Eva; Mountford, Roger; Fryer, Alan; Borck, Guntram; Horn, Denise; Lapunzina, Pablo; Wilson, Meredith; Mascrez, Bénédicte; Duboule, Denis; Mundlos, Stefan; Spielmann, Malte
2017-10-12
PurposeCopy-number variants (CNVs) are generally interpreted by linking the effects of gene dosage with phenotypes. The clinical interpretation of noncoding CNVs remains challenging. We investigated the percentage of disease-associated CNVs in patients with congenital limb malformations that affect noncoding cis-regulatory sequences versus genes sensitive to gene dosage effects.MethodsWe applied high-resolution copy-number analysis to 340 unrelated individuals with isolated limb malformation. To investigate novel candidate CNVs, we re-engineered human CNVs in mice using clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing.ResultsOf the individuals studied, 10% harbored CNVs segregating with the phenotype in the affected families. We identified 31 CNVs previously associated with congenital limb malformations and four novel candidate CNVs. Most of the disease-associated CNVs (57%) affected the noncoding cis-regulatory genome, while only 43% included a known disease gene and were likely to result from gene dosage effects. In transgenic mice harboring four novel candidate CNVs, we observed altered gene expression in all cases, indicating that the CNVs had a regulatory effect either by changing the enhancer dosage or altering the topological associating domain architecture of the genome.ConclusionOur findings suggest that CNVs affecting noncoding regulatory elements are a major cause of congenital limb malformations.Genetics in Medicine advance online publication, 12 October 2017; doi:10.1038/gim.2017.154.
Kaltenegger, Elisabeth; Eich, Eckart; Ober, Dietrich
2013-01-01
Homospermidine synthase (HSS), the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, is known to have its origin in the duplication of a gene encoding deoxyhypusine synthase. To study the processes that followed this gene duplication event and gave rise to HSS, we identified sequences encoding HSS and deoxyhypusine synthase from various species of the Convolvulaceae. We show that HSS evolved only once in this lineage. This duplication event was followed by several losses of a functional gene copy attributable to gene loss or pseudogenization. Statistical analyses of sequence data suggest that, in those lineages in which the gene copy was successfully recruited as HSS, the gene duplication event was followed by phases of various selection pressures, including purifying selection, relaxed functional constraints, and possibly positive Darwinian selection. Site-specific mutagenesis experiments have confirmed that the substitution of sites predicted to be under positive Darwinian selection is sufficient to convert a deoxyhypusine synthase into a HSS. In addition, analyses of transcript levels have shown that HSS and deoxyhypusine synthase have also diverged with respect to their regulation. The impact of protein–protein interaction on the evolution of HSS is discussed with respect to current models of enzyme evolution. PMID:23572540
Digital gene expression for non-model organisms
Hong, Lewis Z.; Li, Jun; Schmidt-Küntzel, Anne; Warren, Wesley C.; Barsh, Gregory S.
2011-01-01
Next-generation sequencing technologies offer new approaches for global measurements of gene expression but are mostly limited to organisms for which a high-quality assembled reference genome sequence is available. We present a method for gene expression profiling called EDGE, or EcoP15I-tagged Digital Gene Expression, based on ultra-high-throughput sequencing of 27-bp cDNA fragments that uniquely tag the corresponding gene, thereby allowing direct quantification of transcript abundance. We show that EDGE is capable of assaying for expression in >99% of genes in the genome and achieves saturation after 6–8 million reads. EDGE exhibits very little technical noise, reveals a large (106) dynamic range of gene expression, and is particularly suited for quantification of transcript abundance in non-model organisms where a high-quality annotated genome is not available. In a direct comparison with RNA-seq, both methods provide similar assessments of relative transcript abundance, but EDGE does better at detecting gene expression differences for poorly expressed genes and does not exhibit transcript length bias. Applying EDGE to laboratory mice, we show that a loss-of-function mutation in the melanocortin 1 receptor (Mc1r), recognized as a Mendelian determinant of yellow hair color in many different mammals, also causes reduced expression of genes involved in the interferon response. To illustrate the application of EDGE to a non-model organism, we examine skin biopsy samples from a cheetah (Acinonyx jubatus) and identify genes likely to control differences in the color of spotted versus non-spotted regions. PMID:21844123
Pajewski, Nicholas M.; Kabagambe, Edmond K.; Gu, Charles C.; Pankow, Jim; North, Kari E.; Wilk, Jemma B.; Freedman, Barry I.; Franceschini, Nora; Broeckel, Uli; Tiwari, Hemant K.; Arnett, Donna K.
2011-01-01
African Americans have been understudied in genome wide association studies of diabetes and related traits. In the current study, we examined the joint association of single nucleotide polymorphisms (SNPs) and copy number variants (CNVs) with fasting insulin and an index of insulin resistance (HOMA-IR) in the HyperGEN study, a family based study with proband ascertainment for hypertension. This analysis is restricted to 1,040 African Americans without diabetes. We generated allele specific CNV genotypes at 872,243 autosomal loci using Birdsuite, a freely available multi-stage program. Joint tests of association for SNPs and CNVs were performed using linear mixed models adjusting for covariates and familial relationships. Our results highlight SNPs associated with fasting insulin and HOMA-IR (rs6576507 and rs8026527, 3.7*10−7≤P≤1.1*10−5) near ATPase, class V, type 10A (ATP10A), and the L Type voltage dependent calcium channel (CACNA1D, rs1401492, P≤5.2*10−6). ATP10A belongs to a family of aminophospholipid-transporting ATPases and has been associated with type 2 diabetes in mice. CACNA1D has been linked to pancreatic beta cell generation in mice. The two most significant copy variable markers (rs10277702 and rs361367; P<2.0*10−4) were in the beta variable region of the T-cell receptor gene (TCRVB). Human and mouse TCR has been shown to mimic insulin and its receptor and could contribute to insulin resistance. Our findings differ from genome wide association studies of fasting insulin and other diabetes related traits in European populations, highlighting the continued need to investigate unique genetic influences for understudied populations such as African Americans. PMID:21901158
Irvin, Marguerite R; Wineinger, Nathan E; Rice, Treva K; Pajewski, Nicholas M; Kabagambe, Edmond K; Gu, Charles C; Pankow, Jim; North, Kari E; Wilk, Jemma B; Freedman, Barry I; Franceschini, Nora; Broeckel, Uli; Tiwari, Hemant K; Arnett, Donna K
2011-01-01
African Americans have been understudied in genome wide association studies of diabetes and related traits. In the current study, we examined the joint association of single nucleotide polymorphisms (SNPs) and copy number variants (CNVs) with fasting insulin and an index of insulin resistance (HOMA-IR) in the HyperGEN study, a family based study with proband ascertainment for hypertension. This analysis is restricted to 1,040 African Americans without diabetes. We generated allele specific CNV genotypes at 872,243 autosomal loci using Birdsuite, a freely available multi-stage program. Joint tests of association for SNPs and CNVs were performed using linear mixed models adjusting for covariates and familial relationships. Our results highlight SNPs associated with fasting insulin and HOMA-IR (rs6576507 and rs8026527, 3.7*10(-7)≤P≤1.1*10(-5)) near ATPase, class V, type 10A (ATP10A), and the L Type voltage dependent calcium channel (CACNA1D, rs1401492, P≤5.2*10(-6)). ATP10A belongs to a family of aminophospholipid-transporting ATPases and has been associated with type 2 diabetes in mice. CACNA1D has been linked to pancreatic beta cell generation in mice. The two most significant copy variable markers (rs10277702 and rs361367; P<2.0*10(-4)) were in the beta variable region of the T-cell receptor gene (TCRVB). Human and mouse TCR has been shown to mimic insulin and its receptor and could contribute to insulin resistance. Our findings differ from genome wide association studies of fasting insulin and other diabetes related traits in European populations, highlighting the continued need to investigate unique genetic influences for understudied populations such as African Americans.
2013-01-01
Background Many large-scale studies analyzed high-throughput genomic data to identify altered pathways essential to the development and progression of specific types of cancer. However, no previous study has been extended to provide a comprehensive analysis of pathways disrupted by copy number alterations across different human cancers. Towards this goal, we propose a network-based method to integrate copy number alteration data with human protein-protein interaction networks and pathway databases to identify pathways that are commonly disrupted in many different types of cancer. Results We applied our approach to a data set of 2,172 cancer patients across 16 different types of cancers, and discovered a set of commonly disrupted pathways, which are likely essential for tumor formation in majority of the cancers. We also identified pathways that are only disrupted in specific cancer types, providing molecular markers for different human cancers. Analysis with independent microarray gene expression datasets confirms that the commonly disrupted pathways can be used to identify patient subgroups with significantly different survival outcomes. We also provide a network view of disrupted pathways to explain how copy number alterations affect pathways that regulate cell growth, cycle, and differentiation for tumorigenesis. Conclusions In this work, we demonstrated that the network-based integrative analysis can help to identify pathways disrupted by copy number alterations across 16 types of human cancers, which are not readily identifiable by conventional overrepresentation-based and other pathway-based methods. All the results and source code are available at http://compbio.cs.umn.edu/NetPathID/. PMID:23822816
Urantowka, Adam Dawid; Hajduk, Kacper; Kosowska, Barbara
2013-08-01
Amazona barbadensis is an endangered species of parrot living in northern coastal Venezuela and in several Caribbean islands. In this study, we sequenced full mitochondrial genome of the considered species. The total length of the mitogenome was 18,983 bp and contained 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, duplicated control region, and degenerate copies of ND6 and tRNA (Glu) genes. High degree of identity between two copies of control region suggests their coincident evolution and functionality. Comparative analysis of both the control region sequences from four Amazona species revealed their 89.1% identity over a region of 1300 bp and indicates the presence of distinctive parts of two control region copies.
Fontanesi, L; Beretti, F; Riggio, V; Gómez González, E; Dall'Olio, S; Davoli, R; Russo, V; Portolano, B
2009-01-01
In goats, classical genetic studies reported a large number of alleles at the Agouti locus with effects on coat color and pattern distribution. From these early studies, the dominant A(Wt) (white/tan) allele was suggested to cause the white color of the Saanen breed. Here, we sequenced the coding region of the goat ASIP gene in 6 goat breeds (Girgentana, Maltese, Derivata di Siria, Murciano-Granadina, Camosciata delle Alpi, and Saanen), with different coat colors and patterns. Five single nucleotide polymorphisms (SNPs) were identified, 3 of which caused missense mutations in conserved positions of the cysteine-rich carboxy-terminal domain of the protein (p.Ala96Gly, p.Cys126Gly, and p.Val128Gly). Allele and genotype frequencies suggested that these mutations are not associated or not completely associated with coat color in the investigated goat breeds. Moreover, genotyping and sequencing results, deviation from Hardy-Weinberg equilibrium, as well as allele copy number evaluation from semiquantitative fluorescent multiplex PCR, indicated the presence of copy number variation (CNV) in all investigated breeds. To confirm the presence of CNV and evaluate its extension, we applied a bovine-goat cross-species array comparative genome hybridization (aCGH) experiment using a custom tiling array based on bovine chromosome 13. aCGH results obtained for 8 goat DNA samples confirmed the presence of CNV affecting a region of less that 100 kb including the ASIP and AHCY genes. In Girgentana and Saanen breeds, this CNV might cause the A(Wt) allele, as already suggested for a similar structural mutation in sheep affecting the ASIP and AHCY genes, providing evidence for a recurrent interspecies CNV. However, other mechanisms may also be involved in determining coat color in these 2 breeds. Copyright 2009 S. Karger AG, Basel.
Mutator gene and hereditary non-polyposis colorectal cancer
de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD
2008-02-05
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
Kakinuma, Hiroaki; Ozaki, Mamoru; Sato, Hitoshi; Takahashi, Hiroaki
2008-09-05
Autism has been associated with chromosomal aberrations, including duplications at chromosome 4, and the identification of genetic factors contributing to the etiology of this disease is the focus of much research. Here we report a Japanese girl with mosaic of chromosome 4p duplication, mos 46,XX,dup(4)(p12p16)[54]/46,XX[6], who was diagnosed with autism at 3 years of age. Fluorescence in situ hybridization (FISH) with probes covering the region spanning a cluster of the gamma aminobutyric acid A (GABA-A) receptor subunit genes in the proximal short arm of chromosome 4 demonstrated total three signals for the GABRG1, GABRA4, and GABRA2 genes, but only two signals for GABRB1. This suggests that aberrant copy number of the GABA-A receptor subunit genes may contribute to the etiology of autism in this patient. 2007 Wiley-Liss, Inc.
Platinum coat color in red fox (Vulpes vulpes) is caused by a mutation in an autosomal copy of KIT.
Johnson, J L; Kozysa, A; Kharlamova, A V; Gulevich, R G; Perelman, P L; Fong, H W F; Vladimirova, A V; Oskina, I N; Trut, L N; Kukekova, A V
2015-04-01
The red fox (Vulpes vulpes) demonstrates a variety of coat colors including platinum, a common phenotype maintained in farm-bred fox populations. Foxes heterozygous for the platinum allele have a light silver coat and extensive white spotting, whereas homozygosity is embryonic lethal. Two KIT transcripts were identified in skin cDNA from platinum foxes. The long transcript was identical to the KIT transcript of silver foxes, whereas the short transcript, which lacks exon 17, was specific to platinum. The KIT gene has several copies in the fox genome: an autosomal copy on chromosome 2 and additional copies on the B chromosomes. To identify the platinum-specific KIT sequence, the genomes of one platinum and one silver fox were sequenced. A single nucleotide polymorphism (SNP) was identified at the first nucleotide of KIT intron 17 in the platinum fox. In platinum foxes, the A allele of the SNP disrupts the donor splice site and causes exon 17, which is part of a segment that encodes a conserved tyrosine kinase domain, to be skipped. Complete cosegregation of the A allele with the platinum phenotype was confirmed by linkage mapping (LOD 25.59). All genotyped farm-bred platinum foxes from Russia and the US were heterozygous for the SNP (A/G), whereas foxes with different coat colors were homozygous for the G allele. Identification of the platinum mutation suggests that other fox white-spotting phenotypes, which are allelic to platinum, would also be caused by mutations in the KIT gene. © 2015 Stichting International Foundation for Animal Genetics.
Copy-number variations associated with autism spectrum disorder.
Kakinuma, Hiroaki; Sato, Hitoshi
2008-08-01
Autism spectrum disorder (ASD) is a clinically heterogeneous developmental disorder with a strong genetic component. Rare genetic disorders and various chromosomal abnormalities are thought to account for approximately 10% of people with ASD. The etiology of the remaining cases remains unknown. Recent advances in array-based technology have increased the resolution in detecting submicroscopic deletions and duplications, referred to as copy-number variations. ASD-associated copy-number variations, which are considered to be present in individuals with ASD but not in unaffected individuals, have been extensively investigated. These data will provide us with an opportunity not only to search for genes causing or contributing to ASDs but also to understand the genetics of ASD.
Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu
2010-05-06
Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.
Rare copy number variants in patients with congenital conotruncal heart defects.
Xie, Hongbo M; Werner, Petra; Stambolian, Dwight; Bailey-Wilson, Joan E; Hakonarson, Hakon; White, Peter S; Taylor, Deanne M; Goldmuntz, Elizabeth
2017-03-01
Previous studies using different cardiac phenotypes, technologies and designs suggest a burden of large, rare or de novo copy number variants (CNVs) in subjects with congenital heart defects. We sought to identify disease-related CNVs, candidate genes, and functional pathways in a large number of cases with conotruncal and related defects that carried no known genetic syndrome. Cases and control samples were divided into two cohorts and genotyped to assess each subject's CNV content. Analyses were performed to ascertain differences in overall CNV prevalence and to identify enrichment of specific genes and functional pathways in conotruncal cases relative to healthy controls. Only findings present in both cohorts are presented. From 973 total conotruncal cases, a burden of rare CNVs was detected in both cohorts. Candidate genes from rare CNVs found in both cohorts were identified based on their association with cardiac development or disease, and/or their reported disruption in published studies. Functional and pathway analyses revealed significant enrichment of terms involved in either heart or early embryonic development. Our study tested one of the largest cohorts specifically with cardiac conotruncal and related defects. These results confirm and extend previous findings that CNVs contribute to disease risk for congenital heart defects in general and conotruncal defects in particular. As disease heterogeneity renders identification of single recurrent genes or loci difficult, functional pathway and gene regulation network analyses appear to be more informative. Birth Defects Research 109:271-295, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira
2016-10-13
PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.
Kang, Eun-Hye; Song, Eun-Jung; Kook, Jun Ho; Lee, Hwan-Hee; Jeong, Bo-Ri; Park, Hee-Moon
2015-03-01
We have previously isolated ε-COP, the α-COP interactor in COPI of Aspergillus nidulans, by yeast two-hybrid screening. To understand the function of ε-COP, the aneA (+) gene for ε-COP/AneA was deleted by homologous recombination using a gene-specific disruption cassette. Deletion of the ε-COP gene showed no detectable changes in vegetative growth or asexual development, but resulted in decrease in the production of the fruiting body, cleistothecium, under conditions favorable for sexual development. Unlike in the budding yeast Saccharomyces cerevisiae, in A. nidulans, over-expression of ε-COP did not rescue the thermo-sensitive growth defect of the α-COP mutant at 42℃. Together, these data show that ε-COP is not essential for viability, but it plays a role in fruiting body formation in A. nidulans.
Genome-wide copy number variation (CNV) in patients with autoimmune Addison's disease
2011-01-01
Background Addison's disease (AD) is caused by an autoimmune destruction of the adrenal cortex. The pathogenesis is multi-factorial, involving genetic components and hitherto unknown environmental factors. The aim of the present study was to investigate if gene dosage in the form of copy number variation (CNV) could add to the repertoire of genetic susceptibility to autoimmune AD. Methods A genome-wide study using the Affymetrix GeneChip® Genome-Wide Human SNP Array 6.0 was conducted in 26 patients with AD. CNVs in selected genes were further investigated in a larger material of patients with autoimmune AD (n = 352) and healthy controls (n = 353) by duplex Taqman real-time polymerase chain reaction assays. Results We found that low copy number of UGT2B28 was significantly more frequent in AD patients compared to controls; conversely high copy number of ADAM3A was associated with AD. Conclusions We have identified two novel CNV associations to ADAM3A and UGT2B28 in AD. The mechanism by which this susceptibility is conferred is at present unclear, but may involve steroid inactivation (UGT2B28) and T cell maturation (ADAM3A). Characterization of these proteins may unravel novel information on the pathogenesis of autoimmunity. PMID:21851588
Applying horizontal gene transfer phenomena to enhance non-viral gene therapy
Elmer, Jacob J.; Christensen, Matthew D.; Rege, Kaushal
2014-01-01
Horizontal gene transfer (HGT) is widespread amongst prokaryotes, but eukaryotes tend to be far less promiscuous with their genetic information. However, several examples of HGT from pathogens into eukaryotic cells have been discovered and mimicked to improve non-viral gene delivery techniques. For example, several viral proteins and DNA sequences have been used to significantly increase cytoplasmic and nuclear gene delivery. Plant genetic engineering is routinely performed with the pathogenic bacterium Agrobacterium tumefaciens and similar pathogens (e.g. Bartonella henselae) may also be able to transform human cells. Intracellular parasites like Trypanosoma cruzi may also provide new insights into overcoming cellular barriers to gene delivery. Finally, intercellular nucleic acid transfer between host cells will also be briefly discussed. This article will review the unique characteristics of several different viruses and microbes and discuss how their traits have been successfully applied to improve non-viral gene delivery techniques. Consequently, pathogenic traits that originally caused diseases may eventually be used to treat many genetic diseases. PMID:23994344
Chen, Wuyan; Xu, Zhi; Nishitani, Miki; Van Ryzin, Carol; McDonnell, Nazli B; Merke, Deborah P
2012-12-01
Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency (21-OHD) is an autosomal recessive disorder of cortisol biosynthesis caused by CYP21A2 mutations. An increase in gene copy number variation (CNV) exists at the CYP21A2 locus. CNV of C4, a neighboring gene that encodes complement component 4, is associated with autoimmune disease susceptibility. In this study, we performed comprehensive genetic analysis of the RP-C4-CYP21-TNX (RCCX) region in 127 unrelated 21-OHD patients (100 classic, 27 nonclassic). C4 copy number was determined by Southern blot. C4 CNV and serum C4 levels were evaluated in relation to CYP21A2 mutations and relevant phenotypes. We found that the most common CYP21A2 mutation associated with the nonclassic form of CAH, V281L, was associated with high C4 copy number (p = 7.13 × 10(-16)). Large CYP21A2 deletion, a common mutation associated with the classic form of CAH, was associated with low C4 copy number (p = 1.61 × 10(-14)). Monomodular RCCX with a short C4 gene, a risk factor for autoimmune disease, was significantly less frequent in CAH patients compared to population estimates (2.8 vs. 10.6 %; p = 1.08 × 10(-4)). In conclusion, CAH patients have increased C4 CNV, with mutation-specific associations that may be protective for autoimmune disease. The study of CYP21A2 in relation to neighboring genes provides insight into the genetics of CNV hotspots, an important determinant of human health.
Casa, Valentina; Runfola, Valeria; Micheloni, Stefano; Aziz, Arif; Dilworth, F Jeffrey; Gabellini, Davide
2017-02-15
Repression of repetitive elements is crucial to preserve genome integrity and has been traditionally ascribed to constitutive heterochromatin pathways. FacioScapuloHumeral Muscular Dystrophy (FSHD), one of the most common myopathies, is characterized by a complex interplay of genetic and epigenetic events. The main FSHD form is linked to a reduced copy number of the D4Z4 macrosatellite repeat on 4q35, causing loss of silencing and aberrant expression of the D4Z4-embedded DUX4 gene leading to disease. By an unknown mechanism, D4Z4 copy-number correlates with FSHD phenotype. Here we show that the DUX4 proximal promoter (DUX4p) is sufficient to nucleate the enrichment of both constitutive and facultative heterochromatin components and to mediate a copy-number dependent gene silencing. We found that both the CpG/GC dense DNA content and the repetitive nature of DUX4p arrays are important for their repressive ability. We showed that DUX4p mediates a copy number-dependent Polycomb Repressive Complex 1 (PRC1) recruitment, which is responsible for the copy-number dependent gene repression. Overall, we directly link genetic and epigenetic defects in FSHD by proposing a novel molecular explanation for the copy number-dependency in FSHD pathogenesis, and offer insight into the molecular functions of repeats in chromatin regulation. © The Author 2016. Published by Oxford University Press.
CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool.
Yang, Fayu; Liu, Changbao; Chen, Ding; Tu, Mengjun; Xie, Haihua; Sun, Huihui; Ge, Xianglian; Tang, Lianchao; Li, Jin; Zheng, Jiayong; Song, Zongming; Qu, Jia; Gu, Feng
2017-06-16
Cre-loxP, as one of the site-specific genetic manipulation tools, offers a method to study the spatial and temporal regulation of gene expression/inactivation in order to decipher gene function. CRISPR/Cas9-mediated targeted genome engineering technologies are sparking a new revolution in biological research. Whether the traditional site-specific genetic manipulation tool and CRISPR/Cas9 could be combined to create a novel genetic tool for highly specific gene editing is not clear. Here, we successfully generated a CRISPR/Cas9-loxP system to perform gene editing in human cells, providing the proof of principle that these two technologies can be used together for the first time. We also showed that distinct non-homologous end-joining (NHEJ) patterns from CRISPR/Cas9-mediated gene editing of the targeting sequence locates at the level of plasmids (episomal) and chromosomes. Specially, the CRISPR/Cas9-mediated NHEJ pattern in the nuclear genome favors deletions (64%-68% at the human AAVS1 locus versus 4%-28% plasmid DNA). CRISPR/Cas9-loxP, a novel site-specific genetic manipulation tool, offers a platform for the dissection of gene function and molecular insights into DNA-repair pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Vocal copying of individually distinctive signature whistles in bottlenose dolphins
King, Stephanie L.; Sayigh, Laela S.; Wells, Randall S.; Fellner, Wendi; Janik, Vincent M.
2013-01-01
Vocal learning is relatively common in birds but less so in mammals. Sexual selection and individual or group recognition have been identified as major forces in its evolution. While important in the development of vocal displays, vocal learning also allows signal copying in social interactions. Such copying can function in addressing or labelling selected conspecifics. Most examples of addressing in non-humans come from bird song, where matching occurs in an aggressive context. However, in other animals, addressing with learned signals is very much an affiliative signal. We studied the function of vocal copying in a mammal that shows vocal learning as well as complex cognitive and social behaviour, the bottlenose dolphin (Tursiops truncatus). Copying occurred almost exclusively between close associates such as mother–calf pairs and male alliances during separation and was not followed by aggression. All copies were clearly recognizable as such because copiers consistently modified some acoustic parameters of a signal when copying it. We found no evidence for the use of copying in aggression or deception. This use of vocal copying is similar to its use in human language, where the maintenance of social bonds appears to be more important than the immediate defence of resources. PMID:23427174
Association of Higher Defensin β-4 Genomic Copy Numbers with Behçet's Disease in Iraqi Patients.
Hameed, Ammar F; Jaradat, Sameh; Al-Musawi, Bassam M; Sharquie, Khalifa; Ibrahim, Mazin J; Hayani, Raafa K; Norgauer, Johannes
2015-11-01
Behçet's disease (BD) is an immune-mediated small vessel systemic vasculitis. Human β-defensins are antimicrobial peptides associated with many inflammatory diseases and are encoded by the β-defensin family of multiple-copy genes. However, their role in BD necessitates further investigation. The aim of the present study was to investigate the possible association of BD in its various clinical forms with defensin β-4 (DEFB4) genomic copy numbers. This case-control study was conducted from January to September 2011 and included 50 control subjects and 27 unrelated Iraqi BD patients registered at Baghdad Teaching Hospital, Bagdad, Iraq. Copy numbers of the DEFB4 gene were determined using the comparative cycle threshold method by duplex real-time polymerase chain reaction technology at the Department of Dermatology of Jena University Hospital, Jena, Germany. DEFB4 genomic copy numbers were significantly higher in the BD group compared to the control group (P = 0.010). However, no statistically significant association was found between copy numbers and clinical variables within the BD group. The DEFB4 copy number polymorphism may be associated with BD; however, it is not associated with different clinical manifestations of the disease.
Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki
2015-01-01
Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions. PMID:26544948
Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki
2015-01-01
Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.
da Silva, Joaquim Manoel; Giachetto, Poliana Fernanda; da Silva, Luiz Otávio; Cintra, Leandro Carrijo; Paiva, Samuel Rezende; Yamagishi, Michel Eduardo Beleza; Caetano, Alexandre Rodrigues
2016-06-13
Copy number variations (CNVs) have been shown to account for substantial portions of observed genomic variation and have been associated with qualitative and quantitative traits and the onset of disease in a number of species. Information from high-resolution studies to detect, characterize and estimate population-specific variant frequencies will facilitate the incorporation of CNVs in genomic studies to identify genes affecting traits of importance. Genome-wide CNVs were detected in high-density single nucleotide polymorphism (SNP) genotyping data from 1,717 Nelore (Bos indicus) cattle, and in NGS data from eight key ancestral bulls. A total of 68,007 and 12,786 distinct CNVs were observed, respectively. Cross-comparisons of results obtained for the eight resequenced animals revealed that 92 % of the CNVs were observed in both datasets, while 62 % of all detected CNVs were observed to overlap with previously validated cattle copy number variant regions (CNVRs). Observed CNVs were used for obtaining breed-specific CNV frequencies and identification of CNVRs, which were subsequently used for gene annotation. A total of 688 of the detected CNVRs were observed to overlap with 286 non-redundant QTLs associated with important production traits in cattle. All of 34 CNVs previously reported to be associated with milk production traits in Holsteins were also observed in Nelore cattle. Comparisons of estimated frequencies of these CNVs in the two breeds revealed 14, 13, 6 and 14 regions in high (>20 %), low (<20 %) and divergent (NEL > HOL, NEL < HOL) frequencies, respectively. Obtained results significantly enriched the bovine CNV map and enabled the identification of variants that are potentially associated with traits under selection in Nelore cattle, particularly in genome regions harboring QTLs affecting production traits.
Beta-defensin genomic copy number is not a modifier locus for cystic fibrosis
Hollox, Edward J; Davies, Jane; Griesenbach, Uta; Burgess, Juliana; Alton, Eric WFW; Armour, John AL
2005-01-01
Human beta-defensin 2 (DEFB4, also known as DEFB2 or hBD-2) is a salt-sensitive antimicrobial protein that is expressed in lung epithelia. Previous work has shown that it is encoded in a cluster of beta-defensin genes at 8p23.1, which varies in copy number between 2 and 12 in different individuals. We determined the copy number of this locus in 355 patients with cystic fibrosis (CF), and tested for correlation between beta-defensin cluster genomic copy number and lung disease associated with CF. No significant association was found. PMID:16336654
Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard
2017-03-06
Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.
La Cognata, Valentina; Morello, Giovanna; D'Agata, Velia; Cavallaro, Sebastiano
2017-01-01
Parkinson's disease (PD), the second most common progressive neurodegenerative disorder of aging, was long believed to be a non-genetic sporadic origin syndrome. The proof that several genetic loci are responsible for rare Mendelian forms has represented a revolutionary breakthrough, enabling to reveal molecular mechanisms underlying this debilitating still incurable condition. While single nucleotide polymorphisms (SNPs) and small indels constitute the most commonly investigated DNA variations accounting for only a limited number of PD cases, larger genomic molecular rearrangements have emerged as significant PD-causing mutations, including submicroscopic Copy Number Variations (CNVs). CNVs constitute a prevalent source of genomic variations and substantially participate in each individual's genomic makeup and phenotypic outcome. However, the majority of genetic studies have focused their attention on single candidate-gene mutations or on common variants reaching a significant statistical level of acceptance. This gene-centric approach is insufficient to uncover the genetic background of polygenic multifactorial disorders like PD, and potentially masks rare individual CNVs that all together might contribute to disease development or progression. In this review, we will discuss literature and bioinformatic data describing the involvement of CNVs on PD pathobiology. We will analyze the most frequent copy number changes in familiar PD genes and provide a "systems biology" overview of rare individual rearrangements that could functionally act on commonly deregulated molecular pathways. Assessing the global genome-wide burden of CNVs in PD patients may reveal new disease-related molecular mechanisms, and open the window to a new possible genetic scenario in the unsolved PD puzzle.
Qian, Jiang; Esumi, Noriko; Chen, Yangjian; Wang, Qingliang; Chowers, Itay; Zack, Donald J.
2005-01-01
Identification of tissue-specific gene regulatory networks can yield insights into the molecular basis of a tissue's development, function and pathology. Here, we present a computational approach designed to identify potential regulatory target genes of photoreceptor cell-specific transcription factors (TFs). The approach is based on the hypothesis that genes related to the retina in terms of expression, disease and/or function are more likely to be the targets of retina-specific TFs than other genes. A list of genes that are preferentially expressed in retina was obtained by integrating expressed sequence tag, SAGE and microarray datasets. The regulatory targets of retina-specific TFs are enriched in this set of retina-related genes. A Bayesian approach was employed to integrate information about binding site location relative to a gene's transcription start site. Our method was applied to three retina-specific TFs, CRX, NRL and NR2E3, and a number of potential targets were predicted. To experimentally assess the validity of the bioinformatic predictions, mobility shift, transient transfection and chromatin immunoprecipitation assays were performed with five predicted CRX targets, and the results were suggestive of CRX regulation in 5/5, 3/5 and 4/5 cases, respectively. Together, these experiments strongly suggest that RP1, GUCY2D, ABCA4 are novel targets of CRX. PMID:15967807
Son, Yeon Jeong; Ryu, Ae Jin; Li, Ling; Han, Nam Soo; Jeong, Ki Jun
2016-01-15
Leuconostoc is a hetero-fermentative lactic acid bacteria, and its importance is widely recognized in the dairy industry. However, due to limited genetic tools including plasmids for Leuconostoc, there has not been much extensive research on the genetics and engineering of Leuconostoc yet. Thus, there is a big demand for high-copy-number plasmids for useful gene manipulation and overproduction of recombinant proteins in Leuconostoc. Using an existing low-copy plasmid, the copy number of plasmid was increased by random mutagenesis followed by FACS-based high-throughput screening. First, a random library of plasmids was constructed by randomizing the region responsible for replication in Leuconostoc citreum; additionally, a superfolder green fluorescent protein (sfGFP) was used as a reporter protein. With a high-speed FACS sorter, highly fluorescent cells were enriched, and after two rounds of sorting, single clone exhibiting the highest level of sfGFP was isolated. The copy number of the isolated plasmid (pCB4270) was determined by quantitative PCR (qPCR). It was found that the isolated plasmid has approximately a 30-fold higher copy number (approx. 70 copies per cell) than that of the original plasmid. From the sequence analysis, a single mutation (C→T) at position 4690 was found, and we confirmed that this single mutation was responsible for the increased plasmid copy number. The effectiveness of the isolated high-copy-number plasmid for the overproduction of recombinant proteins was successfully demonstrated with two protein models Glutathione-S-transferase (GST) and α-amylase. The high-copy number plasmid was successfully isolated by FACS-based high-throughput screening of a plasmid library in L. citreum. The isolated plasmid could be a useful genetic tool for high-level gene expression in Leuconostoc, and for extending the applications of this useful bacteria to various areas in the dairy and pharmaceutical industries.
Duah, Nancy O; Matrevi, Sena A; de Souza, Dziedzom K; Binnah, Daniel D; Tamakloe, Mary M; Opoku, Vera S; Onwona, Christiana O; Narh, Charles A; Quashie, Neils B; Abuaku, Benjamin; Duplessis, Christopher; Kronmann, Karl C; Koram, Kwadwo A
2013-10-30
With the introduction of artemisinin-based combination therapy (ACT) in 2005, monitoring of anti-malarial drug efficacy, which includes the use of molecular tools to detect known genetic markers of parasite resistance, is important for first-hand information on the changes in parasite susceptibility to drugs in Ghana. This study investigated the Plasmodium falciparum multidrug resistance gene (pfmdr1) copy number, mutations and the chloroquine resistance transporter gene (pfcrt) mutations in Ghanaian isolates collected in seven years to detect the trends in prevalence of mutations. Archived filter paper blood blots collected from children aged below five years with uncomplicated malaria in 2003-2010 at sentinel sites were used. Using quantitative real-time polymerase chain reaction (qRT-PCR), 756 samples were assessed for pfmdr1 gene copy number. PCR and restriction fragment length polymorphism (RFLP) were used to detect alleles of pfmdr1 86 in 1,102 samples, pfmdr1 184, 1034, 1042 and 1246 in 832 samples and pfcrt 76 in 1,063 samples. Merozoite surface protein 2 (msp2) genotyping was done to select monoclonal infections for copy number analysis. The percentage of isolates with increased pfmdr1 copy number were 4, 27, 9, and 18% for 2003-04, 2005-06, 2007-08 and 2010, respectively. Significant increasing trends for prevalence of pfmdr1 N86 (×(2) = 96.31, p <0.001) and pfcrt K76 (×(2) = 64.50, p <0.001) and decreasing trends in pfmdr1 Y86 (x(2) = 38.52, p <0.001) and pfcrt T76 (x(2) = 43.49, p <0.001) were observed from 2003-2010. The pfmdr1 F184 and Y184 prevalence showed an increasing and decreasing trends respectively but were not significant (×(2) = 7.39,p=0.060; ×(2) = 7.49, p = 0.057 respectively). The pfmdr1 N86-F184-D1246 haplotype, which is alleged to be selected by artemether-lumefantrine showed a significant increasing trend (×(2) = 20.75, p < 0.001). Increased pfmdr1 gene copy number was observed in the isolates analysed and this finding has
Abruzzi, Katharine Compton; Rodriguez, Joseph; Menet, Jerome S.; Desrochers, Jennifer; Zadina, Abigail; Luo, Weifei; Tkachev, Sasha; Rosbash, Michael
2011-01-01
CLOCK (CLK) is a master transcriptional regulator of the circadian clock in Drosophila. To identify CLK direct target genes and address circadian transcriptional regulation in Drosophila, we performed chromatin immunoprecipitation (ChIP) tiling array assays (ChIP–chip) with a number of circadian proteins. CLK binding cycles on at least 800 sites with maximal binding in the early night. The CLK partner protein CYCLE (CYC) is on most of these sites. The CLK/CYC heterodimer is joined 4–6 h later by the transcriptional repressor PERIOD (PER), indicating that the majority of CLK targets are regulated similarly to core circadian genes. About 30% of target genes also show cycling RNA polymerase II (Pol II) binding. Many of these generate cycling RNAs despite not being documented in prior RNA cycling studies. This is due in part to different RNA isoforms and to fly head tissue heterogeneity. CLK has specific targets in different tissues, implying that important CLK partner proteins and/or mechanisms contribute to gene-specific and tissue-specific regulation. PMID:22085964
Copy Number Variations in Tilapia Genomes.
Li, Bi Jun; Li, Hong Lian; Meng, Zining; Zhang, Yong; Lin, Haoran; Yue, Gen Hua; Xia, Jun Hong
2017-02-01
Discovering the nature and pattern of genome variation is fundamental in understanding phenotypic diversity among populations. Although several millions of single nucleotide polymorphisms (SNPs) have been discovered in tilapia, the genome-wide characterization of larger structural variants, such as copy number variation (CNV) regions has not been carried out yet. We conducted a genome-wide scan for CNVs in 47 individuals from three tilapia populations. Based on 254 Gb of high-quality paired-end sequencing reads, we identified 4642 distinct high-confidence CNVs. These CNVs account for 1.9% (12.411 Mb) of the used Nile tilapia reference genome. A total of 1100 predicted CNVs were found overlapping with exon regions of protein genes. Further association analysis based on linear model regression found 85 CNVs ranging between 300 and 27,000 base pairs significantly associated to population types (R 2 > 0.9 and P > 0.001). Our study sheds first insights on genome-wide CNVs in tilapia. These CNVs among and within tilapia populations may have functional effects on phenotypes and specific adaptation to particular environments.
Ariyarathna, H A Chandima K; Oldach, Klaus H; Francki, Michael G
2016-01-19
Although the HKT transporter genes ascertain some of the key determinants of crop salt tolerance mechanisms, the diversity and functional role of group II HKT genes are not clearly understood in bread wheat. The advanced knowledge on rice HKT and whole genome sequence was, therefore, used in comparative gene analysis to identify orthologous wheat group II HKT genes and their role in trait variation under different saline environments. The four group II HKTs in rice identified two orthologous gene families from bread wheat, including the known TaHKT2;1 gene family and a new distinctly different gene family designated as TaHKT2;2. A single copy of TaHKT2;2 was found on each homeologous chromosome arm 7AL, 7BL and 7DL and each gene was expressed in leaf blade, sheath and root tissues under non-stressed and at 200 mM salt stressed conditions. The proteins encoded by genes of the TaHKT2;2 family revealed more than 93% amino acid sequence identity but ≤52% amino acid identity compared to the proteins encoded by TaHKT2;1 family. Specifically, variations in known critical domains predicted functional differences between the two protein families. Similar to orthologous rice genes on chromosome 6L, TaHKT2;1 and TaHKT2;2 genes were located approximately 3 kb apart on wheat chromosomes 7AL, 7BL and 7DL, forming a static syntenic block in the two species. The chromosomal region on 7AL containing TaHKT2;1 7AL-1 co-located with QTL for shoot Na(+) concentration and yield in some saline environments. The differences in copy number, genes sequences and encoded proteins between TaHKT2;2 homeologous genes and other group II HKT gene families within and across species likely reflect functional diversity for ion selectivity and transport in plants. Evidence indicated that neither TaHKT2;2 nor TaHKT2;1 were associated with primary root Na(+) uptake but TaHKT2;1 may be associated with trait variation for Na(+) exclusion and yield in some but not all saline environments.
Alexandrov, Boian S.; Phipps, M. Lisa; Alexandrov, Ludmil B.; ...
2013-01-31
In this paper, we report that terahertz (THz) irradiation of mouse mesenchymal stem cells (mMSCs) with a single-frequency (SF) 2.52 THz laser or pulsed broadband (centered at 10 THz) source results in irradiation specific heterogenic changes in gene expression. The THz effect depends on irradiation parameters such as the duration and type of THz source, and on the degree of stem cell differentiation. Our microarray survey and RT-PCR experiments demonstrate that prolonged broadband THz irradiation drives mMSCs toward differentiation, while 2-hour irradiation (regardless of THz sources) affects genes transcriptionally active in pluripotent stem cells. The strictly controlled experimental environment indicatesmore » minimal temperature changes and the absence of any discernable response to heat shock and cellular stress genes imply a non-thermal response. Computer simulations of the core promoters of two pluripotency markers reveal association between gene upregulation and propensity for DNA breathing. Finally, we propose that THz radiation has potential for non-contact control of cellular gene expression.« less
Imitation in Young Children: When Who Gets Copied Is More Important than What Gets Copied
ERIC Educational Resources Information Center
Nielsen, Mark; Blank, Cornelia
2011-01-01
Unlike other animals, human children will copy all of an adult's goal-directed actions, including ones that are clearly unnecessary for achieving the demonstrated goal. Here we highlight how social affiliation is key to this species-specific behavior. Preschoolers watched 2 adults retrieve a toy from a novel apparatus. One adult included…
Gene regulation mediates host specificity of a bacterial pathogen.
Killiny, Nabil; Almeida, Rodrigo P P
2011-12-01
Many bacterial plant pathogens have a gene-for-gene relationship that determines host specificity. However, there are pathogens such as the xylem-limited bacterium Xylella fastidiosa that do not carry genes considered essential for the gene-for-gene model, such as those coding for a type III secretion system and effector molecules. Nevertheless, X. fastidiosa subspecies are host specific. A comparison of symptom development and host colonization after infection of plants with several mutant strains in two hosts, grapevines and almonds, indicated that X. fastidiosa virulence mechanisms are similar in those plants. Thus, we tested if modification of gene regulation patterns, by affecting the production of a cell-cell signalling molecule (DSF), impacted host specificity in X. fastidiosa. Results show that disruption of the rpfF locus, required for DSF synthesis, in a strain incapable of causing disease in grapevines, leads to symptom development in that host. These data are indicative that the core machinery required for the colonization of grapevines is present in that strain, and that changes in gene regulation alone can lead X. fastidiosa to exploit a novel host. The study of the evolution and mechanisms of host specificity mediated by gene regulation at the genome level could lead to important insights on the emergence of new diseases. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Russell, Prudence A; Yu, Yong; Do, Hongdo; Clay, Timothy D; Moore, Melissa M; Wright, Gavin M; Conron, Matthew; Wainer, Zoe; Dobrovic, Alexander; McLachlan, Sue-Anne
2014-01-01
We investigated if gene copy number (GCN) alterations of the epidermal growth factor receptor (EGFR), as detected by silver enhanced in situ hybridisation (SISH), could be used to select patients for EGFR mutation testing. Resected lung adenocarcinoma specimens with adequate tumour were identified. EGFR SISH was performed using the Ventana Benchmark Ultra platform. EGFR GCN was classified according to the Colorado Classification System. EGFR mutations were scanned by high resolution melting and confirmed by Sanger sequencing. Thirty-four of 96 tumours were EGFR SISH positive (35%), and 31 of 96 tumours harboured one or more EGFR mutations (32%). Of 31 EGFR-mutant tumours, 18 were EGFR SISH positive (58%). There was a statistically significant relationship between the presence of an EGFR mutation and EGFR GCN (p = 0.003). Thirteen of 31 EGFR-mutant tumours were EGFR SISH negative (42%), and 16 of 65 EGFR-wild type tumours were EGFR SISH positive (24%). The sensitivity, specificity, positive predictive value and negative predictive value were 58%, 75%, 52.9% and 79%, respectively. Despite a significant relationship between EGFR GCN alterations and EGFR mutations, our results indicate that EGFR GCN as detected by SISH is not a suitable way to select patients for EGFR mutation testing.
Zhao, Ni; Wilkerson, Matthew D; Shah, Usman; Yin, Xiaoying; Wang, Anyou; Hayward, Michele C; Roberts, Patrick; Lee, Carrie B; Parsons, Alden M; Thorne, Leigh B; Haithcock, Benjamin E; Grilley-Olson, Juneko E; Stinchcombe, Thomas E; Funkhouser, William K; Wong, Kwok-Kin; Sharpless, Norman E; Hayes, D Neil
2014-11-01
Brain metastases are one of the most malignant complications of lung cancer and constitute a significant cause of cancer related morbidity and mortality worldwide. Recent years of investigation suggested a role of LKB1 in NSCLC development and progression, in synergy with KRAS alteration. In this study, we systematically analyzed how LKB1 and KRAS alteration, measured by mutation, gene expression (GE) and copy number (CN), are associated with brain metastasis in NSCLC. Patients treated at University of North Carolina Hospital from 1990 to 2009 with NSCLC provided frozen, surgically extracted tumors for analysis. GE was measured using Agilent 44,000 custom-designed arrays, CN was assessed by Affymetrix GeneChip Human Mapping 250K Sty Array or the Genome-Wide Human SNP Array 6.0 and gene mutation was detected using ABI sequencing. Integrated analysis was conducted to assess the relationship between these genetic markers and brain metastasis. A model was proposed for brain metastasis prediction using these genetic measurements. 17 of the 174 patients developed brain metastasis. LKB1 wild type tumors had significantly higher LKB1 CN (p<0.001) and GE (p=0.002) than the LKB1 mutant group. KRAS wild type tumors had significantly lower KRAS GE (p<0.001) and lower CN, although the latter failed to be significant (p=0.295). Lower LKB1 CN (p=0.039) and KRAS mutation (p=0.007) were significantly associated with more brain metastasis. The predictive model based on nodal (N) stage, patient age, LKB1 CN and KRAS mutation had a good prediction accuracy, with area under the ROC curve of 0.832 (p<0.001). LKB1 CN in combination with KRAS mutation predicted brain metastasis in NSCLC. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Ficklin, Stephen P; Luo, Feng; Feltus, F Alex
2010-09-01
Discovering gene sets underlying the expression of a given phenotype is of great importance, as many phenotypes are the result of complex gene-gene interactions. Gene coexpression networks, built using a set of microarray samples as input, can help elucidate tightly coexpressed gene sets (modules) that are mixed with genes of known and unknown function. Functional enrichment analysis of modules further subdivides the coexpressed gene set into cofunctional gene clusters that may coexist in the module with other functionally related gene clusters. In this study, 45 coexpressed gene modules and 76 cofunctional gene clusters were discovered for rice (Oryza sativa) using a global, knowledge-independent paradigm and the combination of two network construction methodologies. Some clusters were enriched for previously characterized mutant phenotypes, providing evidence for specific gene sets (and their annotated molecular functions) that underlie specific phenotypes.
Wei, Guang-hui; Zhao, Bo; Wang, Zhen-jun
2008-09-01
To compare the sensibility and specificity between single-stranded conformation polymorphism (SSCP) and denaturing high-performance liquid chromatography (DHPLC) in screening hMSH2 and hMLH1 gene mutations for the diagnosis of hereditary non-polyposis colorectal cancer (HNPCC). Seven Chinese HNPCC kindreds were collected. PCR-SSCP and DHPLC were used to screen the coding regions of hMSH2 and hMLH1 genes and the abnormal profiles were sequenced by a 377 DNA sequencer. Seven gene sequence variations of hMSH2 or hMLH1 were found. Among them, 4 variations were not found by SSCP, but by DHPLC. The sensibility of SSCP and DHPLC were 51.6% and 100% respectively, and the specificity were 66.6% and 93.3% respectively. DHPLC has better sensibility and specificity in screening hMSH2 and hMLH1 gene mutation as compared to SSCP. DHPLC is an ideal method in the diagnosis of HNPCC.
Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M
2015-12-01
Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.
Davies, Kalina T J; Tsagkogeorga, Georgia; Rossiter, Stephen J
2014-12-19
The majority of DNA contained within vertebrate genomes is non-coding, with a certain proportion of this thought to play regulatory roles during development. Conserved Non-coding Elements (CNEs) are an abundant group of putative regulatory sequences that are highly conserved across divergent groups and thus assumed to be under strong selective constraint. Many CNEs may contain regulatory factor binding sites, and their frequent spatial association with key developmental genes - such as those regulating sensory system development - suggests crucial roles in regulating gene expression and cellular patterning. Yet surprisingly little is known about the molecular evolution of CNEs across diverse mammalian taxa or their role in specific phenotypic adaptations. We examined 3,110 vertebrate-specific and ~82,000 mammalian-specific CNEs across 19 and 9 mammalian orders respectively, and tested for changes in the rate of evolution of CNEs located in the proximity of genes underlying the development or functioning of auditory systems. As we focused on CNEs putatively associated with genes underlying the development/functioning of auditory systems, we incorporated echolocating taxa in our dataset because of their highly specialised and derived auditory systems. Phylogenetic reconstructions of concatenated CNEs broadly recovered accepted mammal relationships despite high levels of sequence conservation. We found that CNE substitution rates were highest in rodents and lowest in primates, consistent with previous findings. Comparisons of CNE substitution rates from several genomic regions containing genes linked to auditory system development and hearing revealed differences between echolocating and non-echolocating taxa. Wider taxonomic sampling of four CNEs associated with the homeobox genes Hmx2 and Hmx3 - which are required for inner ear development - revealed family-wise variation across diverse bat species. Specifically within one family of echolocating bats that utilise