Sample records for noncoding dna elements

  1. Humans and chimpanzees differ in their cellular response to DNA damage and non-coding sequence elements of DNA repair-associated genes.


    Weis, E; Galetzka, D; Herlyn, H; Schneider, E; Haaf, T


    both species. Genetic differences in non-coding sequence elements may affect gene regulation in the DNA repair network and thus contribute to species differences in DNA repair and cancer susceptibility.

  2. Scaling features of noncoding DNA

    NASA Technical Reports Server (NTRS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.


    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  3. Noncoding chloroplast DNA variation in Mexican pines.


    Perez de la Rosa, J; Harris, S A; Farjon, A


    Universal primers were used for PCR amplification of three noncoding regions of chloroplast DNA in order to study restriction site variation in 12 Mexican pine species. Two length mutations were identified that are of diagnostic value for two subgenera or sections of the genus. Phylogenetic analysis of the restriction site and length variation showed patterns of variation largely consistent with previous arrangements of these pines, except for the position of Pinus nelsonii, indicating that Pinus section Parraya Mayr, as circumscribed by Little and Critchfield (1969) and later authors, is not a monophyletic group.

  4. Noncoding DNA and the teem theory of inheritance, emotions and innate behaviour.


    Vendramini, Danny


    The evolutionary function of noncoding 'junk' DNA remains one of the most challenging mysteries of genetics. Here a new model of DNA is proposed to explain this function. The hypothesis asserts the DNA molecule contains not one, but two separate modes of inheritance. In addition to exons that code for proteins and physical traits, it is argued noncoding repetitive elements code for the inheritance of emotions and innate behaviour in metazoans. That is to say, noncoding DNA functions as the medium of a second, hitherto unknown evolutionary process that genetically archives adaptive information, configured as emotions and acquired during the life of an organism, into an inheritable form. This second evolutionary process, here called 'Teemosis', is a selectionist process, but paradoxically, because it does not affect physical traits, it has no maladaptive Lamarckian consequences. The medical implications of the hypothesis are discussed.

  5. Nonextensive statistical approach to non-coding human DNA

    NASA Astrophysics Data System (ADS)

    Oikonomou, Th.; Provata, A.; Tirnakli, U.


    We use q-exponential distributions, which maximize the nonextensive entropy Sq (defined as Sq≡(1-∑ipiq)/(q-1)), to study the size distributions of non-coding DNA (including introns and intergenic regions) in all human chromosomes. We show that the value of the exponent q describing the non-coding size distributions is similar for all chromosomes and varies between 2≤q≤2.3 with the exception of chromosomes X and Y.

  6. Protection of the genome and central protein-coding sequences by non-coding DNA against DNA damage from radiation.


    Qiu, Guo-Hua


    frequently and may be removed by repetitive elements in non-coding DNA through the formation of eccDNAs and expelled out of the nucleus to the cytoplasm via the NPC. Therefore, this review proposes that the genome and central protein-coding sequences are doubly protected by non-coding DNA in peripheral heterochromatin against DNA damage from radiation, which may be a novel protective role of non-coding DNA in genome defense.

  7. An inducible long noncoding RNA amplifies DNA damage signaling

    PubMed Central

    Schmitt, Adam M.; Garcia, Julia T.; Hung, Tiffany; Flynn, Ryan A.; Shen, Ying; Qu, Kun; Payumo, Alexander Y.; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K.; Attardi, Laura D.; Chang, Howard Y.


    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently exquisite regulation but mostly unknown functions. Here we demonstrate a role of lncRNAs in guiding organismal DNA damage response. DNA damage activates transcription of DINO (Damage Induced NOncoding) via p53. DINO is required for p53-dependent gene expression, cell cycle arrest, and apoptosis in response to DNA damage, and DINO expression suffice to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO binds to and promotes p53 protein stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampens p53 signaling and ameliorates acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks. PMID:27668660

  8. Polyphyletism of Celastrales deduced from a chloroplast noncoding DNA region.


    Savolainen, V; Spichiger, R; Manen, J F


    In a previous study we examined the phylogeny of four families related to the angiosperm order Celastrales based on chloroplast rbcL 5' flanking sequences. We have added here several additional dicots, sampled from 6 of the 7 families of Celastrales sensu Cronquist and 19 putatively related genera. Based on a cladistic analysis of these DNA sequences, the order Celastrales appears polyphyletic: it is here restricted to Celastraceae (including Hippocrateaceae and Brexia) with Parnassia as sister; Aquifoliaceae plus Helwingia are included in Asteridae. Neither Salvadoraceae nor Geissolomataceae, Icacinaceae, Phellinaceae, Aextoxicaceae, Corynocarpaceae, Dichapetalaceae, Stackhousiaceae, or Goupiaceae are related to Celastrales. The usefulness of this noncoding region is discussed and the influence of the A + T content of neighboring bases on the increase of transversions is also observed as previously shown in chloroplast noncoding regions of monocots.

  9. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro


    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  10. Junk DNA and the long non-coding RNA twist in cancer genetics

    PubMed Central

    Ling, Hui; Vincent, Kimberly; Pichler, Martin; Fodde, Riccardo; Berindan-Neagoe, Ioana; Slack, Frank J.; Calin, George A


    The central dogma of molecular biology states that the flow of genetic information moves from DNA to RNA to protein. However, in the last decade this dogma has been challenged by new findings on non-coding RNAs (ncRNAs) such as microRNAs (miRNAs). More recently, long non-coding RNAs (lncRNAs) have attracted much attention due to their large number and biological significance. Many lncRNAs have been identified as mapping to regulatory elements including gene promoters and enhancers, ultraconserved regions, and intergenic regions of protein-coding genes. Yet, the biological function and molecular mechanisms of lncRNA in human diseases in general and cancer in particular remain largely unknown. Data from the literature suggest that lncRNA, often via interaction with proteins, functions in specific genomic loci or use their own transcription loci for regulatory activity. In this review, we summarize recent findings supporting the importance of DNA loci in lncRNA function, and the underlying molecular mechanisms via cis or trans regulation, and discuss their implications in cancer. In addition, we use the 8q24 genomic locus, a region containing interactive SNPs, DNA regulatory elements and lncRNAs, as an example to illustrate how single nucleotide polymorphism (SNP) located within lncRNAs may be functionally associated with the individual’s susceptibility to cancer. PMID:25619839

  11. High-resolution interrogation of functional elements in the noncoding genome

    PubMed Central

    Sanjana, Neville E.; Wright, Jason; Zheng, Kaijie; Shalem, Ophir; Fontanillas, Pierre; Joung, Julia; Cheng, Christine; Regev, Aviv; Zhang, Feng


    The noncoding genome affects gene regulation and disease, yet we lack tools for rapid identification and manipulation of noncoding elements. We develop a CRISPR screen employing ~18,000 sgRNAs targeting >700 kb surrounding the genes NF1, NF2, and CUL3, which are involved in BRAF inhibitor resistance in melanoma. We find that noncoding locations that modulate drug resistance also harbor predictive hallmarks of noncoding function. With a subset of regions at the CUL3 locus, we demonstrate that engineered mutations alter transcription factor occupancy and long-range and local epigenetic environments, implicating these sites in gene regulation and chemotherapeutic resistance. Though our expansion of the potential of pooled CRISPR screens we provide tools for genomic discovery and for elucidating biologically relevant mechanisms of gene regulation. Pooled CRISPR mutagenesis identifies functional elements in the noncoding genome. PMID:27708104

  12. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    PubMed Central

    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, Tijana; Goodwin, Lynne; Kyrpides, Nikos C.; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20–25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. We use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% of the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual “inflation” of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle. PMID:25831533

  13. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    SciTech Connect

    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, Tijana; Goodwin, Lynne; Kyrpides, Nikos C.; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20–25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. In this paper, we use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% of the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Finally, our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual “inflation” of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  14. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle.


    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C; Mincer, Tracy; Heidelberg, John F; Fu, Feixue; Waterbury, John B; Glavina del Rio, Tijana; Goodwin, Lynne; Kyrpides, Nikos C; Land, Miriam L; Woyke, Tanja; Hutchins, David A; Hess, Wolfgang R; Webb, Eric A


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20-25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. We use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% of the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual "inflation" of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  15. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle


    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C.; ...


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20–25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. In this paper, we use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% ofmore » the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Finally, our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual “inflation” of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.« less

  16. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    SciTech Connect

    Walworth, Nathan G.; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, T.; Goodwin, Lynne A.; Kyrpides, Nikos; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance due to its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20-25% less than the average for other cyanobacteria and non-pathogenic, free-living bacteria. We use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus both in culture and in situ. Transcriptome analysis indicates that 86% of the non-coding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and two fold higher than that found in the gene dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium ncRNA secondary structures were predicted between most culture and metagenomic sequences lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Our data suggest that transposition of selfish DNA, low effective population size, and high fidelity replication allowed the unusual ‘inflation’ of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  17. In search of coding and non-coding regions of DNA sequences based on balanced estimation of diffusion entropy.


    Zhang, Jin; Zhang, Wenqing; Yang, Huijie


    Identification of coding regions in DNA sequences remains challenging. Various methods have been proposed, but these are limited by species-dependence and the need for adequate training sets. The elements in DNA coding regions are known to be distributed in a quasi-random way, while those in non-coding regions have typical similar structures. For short sequences, these statistical characteristics cannot be extracted correctly and cannot even be detected. This paper introduces a new way to solve the problem: balanced estimation of diffusion entropy (BEDE).

  18. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.


    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  19. Natural Selection and Functional Potentials of Human Noncoding Elements Revealed by Analysis of Next Generation Sequencing Data.


    Jha, Pankaj; Lu, Dongsheng; Xu, Shuhua


    Noncoding DNA sequences (NCS) have attracted much attention recently due to their functional potentials. Here we attempted to reveal the functional roles of noncoding sequences from the point of view of natural selection that typically indicates the functional potentials of certain genomic elements. We analyzed nearly 37 million single nucleotide polymorphisms (SNPs) of Phase I data of the 1000 Genomes Project. We estimated a series of key parameters of population genetics and molecular evolution to characterize sequence variations of the noncoding genome within and between populations, and identified the natural selection footprints in NCS in worldwide human populations. Our results showed that purifying selection is prevalent and there is substantial constraint of variations in NCS, while positive selectionis more likely to be specific to some particular genomic regions and regional populations. Intriguingly, we observed larger fraction of non-conserved NCS variants with lower derived allele frequency in the genome, indicating possible functional gain of non-conserved NCS. Notably, NCS elements are enriched for potentially functional markers such as eQTLs, TF motif, and DNase I footprints in the genome. More interestingly, some NCS variants associated with diseases such as Alzheimer's disease, Type 1 diabetes, and immune-related bowel disorder (IBD) showed signatures of positive selection, although the majority of NCS variants, reported as risk alleles by genome-wide association studies, showed signatures of negative selection. Our analyses provided compelling evidence of natural selection forces on noncoding sequences in the human genome and advanced our understanding of their functional potentials that play important roles in disease etiology and human evolution.

  20. Origin of noncoding DNA sequences: molecular fossils of genome evolution.


    Naora, H; Miyahara, K; Curnow, R N


    The total amount of noncoding sequences on chromosomes of contemporary organisms varies significantly from species to species. We propose a hypothesis for the origin of these noncoding sequences that assumes that (i) an approximately equal to 0.55-kilobase (kb)-long reading frame composed the primordial gene and (ii) a 20-kb-long single-stranded polynucleotide is the longest molecule (as a genome) that was polymerized at random and without a specific template in the primordial soup/cell. The statistical distribution of stop codons allows examination of the probability of generating reading frames of approximately equal to 0.55 kb in this primordial polynucleotide. This analysis reveals that with three stop codons, a run of at least 0.55-kb equivalent length of nonstop codons would occur in 4.6% of 20-kb-long polynucleotide molecules. We attempt to estimate the total amount of noncoding sequences that would be present on the chromosomes of contemporary species assuming that present-day chromosomes retain the prototype primordial genome structure. Theoretical estimates thus obtained for most eukaryotes do not differ significantly from those reported for these specific organisms, with only a few exceptions. Furthermore, analysis of possible stop-codon distributions suggests that life on earth would not exist, at least in its present form, had two or four stop codons been selected early in evolution.

  1. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle

    PubMed Central

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W.; Kozmik, Zbynek; Putnam, Nicholas H.; Yu, Jr-Kai; Holland, Linda Z.


    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120–160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  2. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    NASA Technical Reports Server (NTRS)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.


    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  3. Correia Repeat Enclosed Elements and Non-Coding RNAs in the Neisseria Species

    PubMed Central

    Roberts, Sabrina B.; Spencer-Smith, Russell; Shah, Mahwish; Nebel, Jean-Christophe; Cook, Richard T.; Snyder, Lori A. S.


    Neisseria gonorrhoeae is capable of causing gonorrhoea and more complex diseases in the human host. Neisseria meningitidis is a closely related pathogen that shares many of the same genomic features and virulence factors, but causes the life threatening diseases meningococcal meningitis and septicaemia. The importance of non-coding RNAs in gene regulation has become increasingly evident having been demonstrated to be involved in regulons responsible for iron acquisition, antigenic variation, and virulence. Neisseria spp. contain an IS-like element, the Correia Repeat Enclosed Element, which has been predicted to be mobile within the genomes or to have been in the past. This repeat, present in over 100 copies in the genome, has the ability to alter gene expression and regulation in several ways. We reveal here that Correia Repeat Enclosed Elements tend to be near non-coding RNAs in the Neisseria spp., especially N. gonorrhoeae. These results suggest that Correia Repeat Enclosed Elements may have disrupted ancestral regulatory networks not just through their influence on regulatory proteins but also for non-coding RNAs. PMID:27681925

  4. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.


    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  5. Genome defense against exogenous nucleic acids in eukaryotes by non-coding DNA occurs through CRISPR-like mechanisms in the cytosol and the bodyguard protection in the nucleus.


    Qiu, Guo-Hua


    In this review, the protective function of the abundant non-coding DNA in the eukaryotic genome is discussed from the perspective of genome defense against exogenous nucleic acids. Peripheral non-coding DNA has been proposed to act as a bodyguard that protects the genome and the central protein-coding sequences from ionizing radiation-induced DNA damage. In the proposed mechanism of protection, the radicals generated by water radiolysis in the cytosol and IR energy are absorbed, blocked and/or reduced by peripheral heterochromatin; then, the DNA damage sites in the heterochromatin are removed and expelled from the nucleus to the cytoplasm through nuclear pore complexes, most likely through the formation of extrachromosomal circular DNA. To strengthen this hypothesis, this review summarizes the experimental evidence supporting the protective function of non-coding DNA against exogenous nucleic acids. Based on these data, I hypothesize herein about the presence of an additional line of defense formed by small RNAs in the cytosol in addition to their bodyguard protection mechanism in the nucleus. Therefore, exogenous nucleic acids may be initially inactivated in the cytosol by small RNAs generated from non-coding DNA via mechanisms similar to the prokaryotic CRISPR-Cas system. Exogenous nucleic acids may enter the nucleus, where some are absorbed and/or blocked by heterochromatin and others integrate into chromosomes. The integrated fragments and the sites of DNA damage are removed by repetitive non-coding DNA elements in the heterochromatin and excluded from the nucleus. Therefore, the normal eukaryotic genome and the central protein-coding sequences are triply protected by non-coding DNA against invasion by exogenous nucleic acids. This review provides evidence supporting the protective role of non-coding DNA in genome defense.

  6. Life-history traits drive the evolutionary rates of mammalian coding and noncoding genomic elements

    PubMed Central

    Nikolaev, Sergey I.; Montoya-Burgos, Juan I.; Popadin, Konstantin; Parand, Leila; Margulies, Elliott H.; Antonarakis, Stylianos E.


    A comprehensive phylogenetic framework is indispensable for investigating the evolution of genomic features in mammals as a whole, and particularly in humans. Using the ENCODE sequence data, we estimated mammalian neutral evolutionary rates and selective pressures acting on conserved coding and noncoding elements. We show that neutral evolutionary rates can be explained by the generation time (GT) hypothesis. Accordingly, primates (especially humans), having longer GTs than other mammals, display slower rates of neutral evolution. The evolution of constrained elements, particularly of nonsynonymous sites, is in agreement with the expectations of the nearly neutral theory of molecular evolution. We show that rates of nonsynonymous substitutions (dN) depend on the population size of a species. The results are robust to the exclusion of hypermutable CpG prone sites. The average rate of evolution in conserved noncoding sequences (CNCs) is 1.7 times higher than in nonsynonymous sites. Despite this, CNCs evolve at similar or even lower rates than nonsynonymous sites in the majority of basal branches of the eutherian tree. This observation could be the result of an overall gradual or, alternatively, lineage-specific relaxation of CNCs. The latter hypothesis was supported by the finding that 3 of the 20 longest CNCs displayed significant relaxation of individual branches. This observation may explain why the evolution of CNCs fits the expectations of the nearly neutral theory less well than the evolution of nonsynonymous sites. PMID:18077382

  7. Long noncoding RNA LINP1 regulates double strand DNA break repair in triple negative breast cancer

    PubMed Central

    Zhang, Youyou; He, Qun; Hu, Zhongyi; Feng, Yi; Fan, Lingling; Tang, Zhaoqing; Yuan, Jiao; Shan, Weiwei; Li, Chunsheng; Hu, Xiaowen; Tanyi, Janos L; Fan, Yi; Huang, Qihong; Montone, Kathleen; Dang, Chi V; Zhang, Lin


    Long noncoding RNAs (lncRNAs), which are transcripts that are larger than 200 nucleotides but do not appear to have protein-coding potential, play critical roles during tumorigenesis by functioning as scaffolds to regulate protein-protein, protein-DNA or protein-RNA interactions. Using a clinically guided genetic screening approach, we identified (lncRNA in Non-homologous end joining [NHEJ] pathway 1) as a lncRNA that is overexpressed in human triple-negative breast cancer. We found that LINP1 enhances double-strand DNA break repair by serving as a scaffold that links Ku80 and DNA-PKcs, thereby coordinating the NHEJ pathway. Importantly, blocking LINP1, which is regulated by the p53 and epidermal growth factor receptor (EGFR) signaling, increases sensitivity of tumor cell response to radiotherapy in breast cancer. PMID:27111890

  8. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin


    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  9. Noncoding RNAs of trithorax response elements recruit Drosophila Ash1 to Ultrabithorax.


    Sanchez-Elsner, Tilman; Gou, Dawei; Kremmer, Elisabeth; Sauer, Frank


    Homeotic genes contain cis-regulatory trithorax response elements (TREs) that are targeted by epigenetic activators and transcribed in a tissue-specific manner. We show that the transcripts of three TREs located in the Drosophila homeotic gene Ultrabithorax (Ubx) mediate transcription activation by recruiting the epigenetic regulator Ash1 to the template TREs. TRE transcription coincides with Ubx transcription and recruitment of Ash1 to TREs in Drosophila. The SET domain of Ash1 binds all three TRE transcripts, with each TRE transcript hybridizing with and recruiting Ash1 only to the corresponding TRE in chromatin. Transgenic transcription of TRE transcripts restores recruitment of Ash1 to Ubx TREs and restores Ubx expression in Drosophila cells and tissues that lack endogenous TRE transcripts. Small interfering RNA-induced degradation of TRE transcripts attenuates Ash1 recruitment to TREs and Ubx expression, which suggests that noncoding TRE transcripts play an important role in epigenetic activation of gene expression.

  10. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis.


    Shaw, Joey; Lickey, Edgar B; Beck, John T; Farmer, Susan B; Liu, Wusheng; Miller, Jermey; Siripun, Kunsiri C; Winder, Charles T; Schilling, Edward E; Small, Randall L


    Chloroplast DNA sequences are a primary source of data for plant molecular systematic studies. A few key papers have provided the molecular systematics community with universal primer pairs for noncoding regions that have dominated the field, namely trnL-trnF and trnK/matK. These two regions have provided adequate information to resolve species relationships in some taxa, but often provide little resolution at low taxonomic levels. To obtain better phylogenetic resolution, sequence data from these regions are often coupled with other sequence data. Choosing an appropriate cpDNA region for phylogenetic investigation is difficult because of the scarcity of information about the tempo of evolutionary rates among different noncoding cpDNA regions. The focus of this investigation was to determine whether there is any predictable rate heterogeneity among 21 noncoding cpDNA regions identified as phylogenetically useful at low levels. To test for rate heterogeneity among the different cpDNA regions, we used three species from each of 10 groups representing eight major phylogenetic lineages of phanerogams. The results of this study clearly show that a survey using as few as three representative taxa can be predictive of the amount of phylogenetic information offered by a cpDNA region and that rate heterogeneity exists among noncoding cpDNA regions.

  11. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silencing in the C. elegans Germline.


    Frøkjær-Jensen, Christian; Jain, Nimit; Hansen, Loren; Davis, M Wayne; Li, Yongbin; Zhao, Di; Rebora, Karine; Millet, Jonathan R M; Liu, Xiao; Kim, Stuart K; Dupuy, Denis; Jorgensen, Erik M; Fire, Andrew Z


    Cells benefit from silencing foreign genetic elements but must simultaneously avoid inactivating endogenous genes. Although chromatin modifications and RNAs contribute to maintenance of silenced states, the establishment of silenced regions will inevitably reflect underlying DNA sequence and/or structure. Here, we demonstrate that a pervasive non-coding DNA feature in Caenorhabditis elegans, characterized by 10-base pair periodic An/Tn-clusters (PATCs), can license transgenes for germline expression within repressive chromatin domains. Transgenes containing natural or synthetic PATCs are resistant to position effect variegation and stochastic silencing in the germline. Among endogenous genes, intron length and PATC-character undergo dramatic changes as orthologs move from active to repressive chromatin over evolutionary time, indicating a dynamic character to the An/Tn periodicity. We propose that PATCs form the basis of a cellular immune system, identifying certain endogenous genes in heterochromatic contexts as privileged while foreign DNA can be suppressed with no requirement for a cellular memory of prior exposure.

  12. The non-coding B2 RNA binds to the DNA cleft and active site region of RNA polymerase II

    PubMed Central

    Ponicsan, Steven L.; Houel, Stephane; Old, William M.; Ahn, Natalie G.; Goodrich, James A.; Kugel, Jennifer F.


    The B2 family of short interspersed elements is transcribed into non-coding RNA by RNA polymerase III. The ~180 nt B2 RNA has been shown to potently repress mRNA transcription by binding tightly to RNA polymerase II (Pol II) and assembling with it into complexes on promoter DNA, where it keeps the polymerase from properly engaging the promoter DNA. Mammalian Pol II is a ~500 kD complex that contains 12 different protein subunits, providing many possible surfaces for interaction with B2 RNA. We found that the carboxy-terminal domain of the largest Pol II subunit was not required for B2 RNA to bind Pol II and repress transcription in vitro. To identify the surface on Pol II to which the minimal functional region of B2 RNA binds, we coupled multi-step affinity purification, reversible formaldehyde crosslinking, peptide sequencing by mass spectrometry, and analysis of peptide enrichment. The Pol II peptides most highly recovered after crosslinking to B2 RNA mapped to the DNA binding cleft and active site region of Pol II. These studies determine the location of a defined nucleic acid binding site on a large, native, multi-subunit complex and provide insight into the mechanism of transcriptional repression by B2 RNA. PMID:23416138

  13. Multifractal detrended cross-correlation analysis of coding and non-coding DNA sequences through chaos-game representation

    NASA Astrophysics Data System (ADS)

    Pal, Mayukha; Satish, B.; Srinivas, K.; Rao, P. Madhusudana; Manimaran, P.


    We propose a new approach combining the chaos game representation and the two dimensional multifractal detrended cross correlation analysis methods to examine multifractal behavior in power law cross correlation between any pair of nucleotide sequences of unequal lengths. In this work, we analyzed the characteristic behavior of coding and non-coding DNA sequences of eight prokaryotes. The results show the presence of strong multifractal nature between coding and non-coding sequences of all data sets. We found that this integrative approach helps us to consider complete DNA sequences for characterization, and further it may be useful for classification, clustering, identification of class affiliation of nucleotide sequences etc. with high precision.

  14. Transposable Elements: From DNA Parasites to Architects of Metazoan Evolution

    PubMed Central

    Piskurek, Oliver; Jackson, Daniel J.


    One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs). Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty. PMID:24704977

  15. Transposable elements: from DNA parasites to architects of metazoan evolution.


    Piskurek, Oliver; Jackson, Daniel J


    One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs). Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty.

  16. Small Open Reading Frames, Non-Coding RNAs and Repetitive Elements in Bradyrhizobium japonicum USDA 110

    PubMed Central

    Hahn, Julia; Tsoy, Olga V.; Thalmann, Sebastian; Čuklina, Jelena; Gelfand, Mikhail S.


    Small open reading frames (sORFs) and genes for non-coding RNAs are poorly investigated components of most genomes. Our analysis of 1391 ORFs recently annotated in the soybean symbiont Bradyrhizobium japonicum USDA 110 revealed that 78% of them contain less than 80 codons. Twenty-one of these sORFs are conserved in or outside Alphaproteobacteria and most of them are similar to genes found in transposable elements, in line with their broad distribution. Stabilizing selection was demonstrated for sORFs with proteomic evidence and bll1319_ISGA which is conserved at the nucleotide level in 16 alphaproteobacterial species, 79 species from other taxa and 49 other Proteobacteria. Further we used Northern blot hybridization to validate ten small RNAs (BjsR1 to BjsR10) belonging to new RNA families. We found that BjsR1 and BjsR3 have homologs outside the genus Bradyrhizobium, and BjsR5, BjsR6, BjsR7, and BjsR10 have up to four imperfect copies in Bradyrhizobium genomes. BjsR8, BjsR9, and BjsR10 are present exclusively in nodules, while the other sRNAs are also expressed in liquid cultures. We also found that the level of BjsR4 decreases after exposure to tellurite and iron, and this down-regulation contributes to survival under high iron conditions. Analysis of additional small RNAs overlapping with 3’-UTRs revealed two new repetitive elements named Br-REP1 and Br-REP2. These REP elements may play roles in the genomic plasticity and gene regulation and could be useful for strain identification by PCR-fingerprinting. Furthermore, we studied two potential toxin genes in the symbiotic island and confirmed toxicity of the yhaV homolog bll1687 but not of the newly annotated higB homolog blr0229_ISGA in E. coli. Finally, we revealed transcription interference resulting in an antisense RNA complementary to blr1853, a gene induced in symbiosis. The presented results expand our knowledge on sORFs, non-coding RNAs and repetitive elements in B. japonicum and related bacteria. PMID

  17. Sequence polymorphism in a novel noncoding region of Pacific oyster mitochondrial DNA.


    Aranishi, Futoshi; Okimoto, Takane


    Nucleotide sequence polymorphism in a 641-bp novel major noncoding region of mitochondrial DNA (mtDNA-NC) of the Pacific oyster Crassostrea gigas was analysed for 29 cultured individuals within the Goseong population. A total of 30 variable sites were detected, and the relative frequency of nucleotide alteration was determined to be 4.68. Alterations were mostly single nucleotide substitutions. Transition, transversion, both transition and transversion, and both transversion and nucleotide deletion were observed at 18, 9, 2 and 1 sites, respectively. Among 29 specimens, 22 haplotypes were identified, and pairwise genetic diversity of haplotypes was calculated to be 0.988 from multiple sequence substitutions using the two-parameter model. A phylogenetic tree, obtained for haplotypes by the neighbor-joining method, showed a single cluster of linkages. The cluster comprised 11 haplotypes associating with 14 specimens, while the other 11 haplotypes associating with 15 specimens were scattered. This mtDNA-NC presenting a high nucleotide sequence polymorphism is a potential mtDNA control region. It therefore can serve as a genetic marker for intraspecies phylogenetic analysis of the Pacific oyster and is more useful than the less polymorphic mtDNA coding genes.

  18. Non-extensive trends in the size distribution of coding and non-coding DNA sequences in the human genome

    NASA Astrophysics Data System (ADS)

    Oikonomou, Th.; Provata, A.


    We study the primary DNA structure of four of the most completely sequenced human chromosomes (including chromosome 19 which is the most dense in coding), using non-extensive statistics. We show that the exponents governing the spatial decay of the coding size distributions vary between 5.2 ≤r ≤5.7 for the short scales and 1.45 ≤q ≤1.50 for the large scales. On the contrary, the exponents governing the spatial decay of the non-coding size distributions in these four chromosomes, take the values 2.4 ≤r ≤3.2 for the short scales and 1.50 ≤q ≤1.72 for the large scales. These results, in particular the values of the tail exponent q, indicate the existence of correlations in the coding and non-coding size distributions with tendency for higher correlations in the non-coding DNA.

  19. EBV noncoding RNA binds nascent RNA to drive host PAX5 to viral DNA

    PubMed Central

    Lee, Nara; Moss, Walter N.; Yario, Therese A.; Steitz, Joan A.


    Summary EBER2 is an abundant nuclear noncoding RNA expressed by Epstein-Barr virus (EBV). Probing its possible chromatin localization by CHART revealed EBER2’s presence at the terminal repeats (TRs) of the latent EBV genome, overlapping previously identified binding sites for the B-cell transcription factor PAX5. EBER2 interacts with and is required for PAX5 localization to the TRs. EBER2 knockdown phenocopies PAX5 depletion in upregulating the expression of LMP2A/B and LMP1, genes nearest the TRs. Knockdown of EBER2 also decreases EBV lytic replication, underscoring the essential role of the TRs in viral replication. Recruitment of the EBER2-PAX5 complex is mediated by base-pairing between EBER2 and nascent transcripts from the TR locus. The interaction is evolutionarily conserved in the related primate herpesvirus CeHV15 despite great sequence divergence. Using base-pairing with nascent RNA to guide an interacting transcription factor to its DNA target site is a previously undescribed function for a trans-acting noncoding RNA. PMID:25662012

  20. Genetic evidence for conserved non-coding element function across species–the ears have it

    PubMed Central

    Turner, Eric E.; Cox, Timothy C.


    Comparison of genomic sequences from diverse vertebrate species has revealed numerous highly conserved regions that do not appear to encode proteins or functional RNAs. Often these “conserved non-coding elements,” or CNEs, can direct gene expression to specific tissues in transgenic models, demonstrating they have regulatory function. CNEs are frequently found near “developmental” genes, particularly transcription factors, implying that these elements have essential regulatory roles in development. However, actual examples demonstrating CNE regulatory functions across species have been few, and recent loss-of-function studies of several CNEs in mice have shown relatively minor effects. In this Perspectives article, we discuss new findings in “fancy” rats and Highland cattle demonstrating that function of a CNE near the Hmx1 gene is crucial for normal external ear development and when disrupted can mimic loss-of function Hmx1 coding mutations in mice and humans. These findings provide important support for conserved developmental roles of CNEs in divergent species, and reinforce the concept that CNEs should be examined systematically in the ongoing search for genetic causes of human developmental disorders in the era of genome-scale sequencing. PMID:24478720

  1. Low mitochondrial DNA variation among American alligators and a novel non-coding region in crocodilians.


    Glenn, Travis C; Staton, Joseph L; Vu, Alex T; Davis, Lisa M; Bremer, Jaime R Alvarado; Rhodes, Walter E; Brisbin, I Lehr; Sawyer, Roger H


    We analyzed 1317-1823 base pairs (bp) of mitochondrial DNA sequence beginning in the 5' end of cytochrome b (cyt b) and ending in the central domain of the control region for 25 American alligators (Alligator mississippiensis) and compared these to a homologous sequence from a Chinese alligator (A. sinensis). Both species share a non-coding spacer between cyt b and tRNA(Thr). Chinese alligator cyt b differs from that of the American alligator by 17.5% at the nucleotide level and 13.8% for inferred amino acids, which is consistent with their presumed ancient divergence. Only two cyt b haplotypes were detected among the 25 American alligators (693-1199 bp surveyed), with one haplotype shared among 24 individuals. One alligator from Mississippi differed from all other alligators by a single silent substitution. The control region contained only slightly more variation among the 25 American alligators, with two variable positions (624 bp surveyed), yielding three haplotypes with 22, two, and one individuals in each of these groups. Previous genetic studies examining allozymes and the proportion of variable microsatellite DNA loci also found low levels of genetic diversity in American alligators. However, in contrast with allozymes, microsatellites, and morphology, the mtDNA data shows no evidence of differentiation among populations from the extremes of the species range. These results suggest that American alligators underwent a severe population bottleneck in the late Pleistocene, resulting in nearly homogenous mtDNA among all American alligators today.

  2. Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA.

    PubMed Central

    Horai, S; Hayasaka, K


    Nucleotide sequences of the major noncoding region of human mitochondrial DNA (mtDNA) from 95 human placentas have been determined. These sequences include at least a 482-bp-long region encompassing most of the D-loop-forming region. Comparisons of these sequences with those previously determined have revealed remarkable features of nucleotide substitutions and insertion/deletion events. The nucleotide diversity among the sequences is estimated as 1.45%, which is three- to fourfold higher than the corresponding value estimated from restriction-enzyme analysis of whole mtDNA genome. A hypervariable region has also been defined. In this 14-bp region, 17 different sequences were detected. More than 97% of the base changes are transitions. A significantly nonrandom distribution of nucleotide substitutions and sequence length variations were also noted. The phylogenetic analysis indicates that diversity among the negroids is much larger than that among the caucasoids or the mongoloids. In fact, part of the negroids first diverged from other humans in the phylogenetic tree. A striking finding in the phylogenetic analysis is that the mongoloids can be separated into two distinct groups. Divergence of part of the mongoloids follows the earliest divergence of part of the negroids. The remainder of the mongoloids subsequently diverged together with the caucasoids. This observation confirmed our earlier study, which clearly demonstrated, by the restriction-enzyme analysis, existence of two distinct groups in the Japanese. Images Figure 3 PMID:2316527

  3. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio


    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  4. An Oncogenic Super-Enhancer Formed Through Somatic Mutation of a Noncoding Intergenic Element

    PubMed Central

    Mansour, Marc R.; Abraham, Brian J; Anders, Lars; Berezovskaya, Alla; Gutierrez, Alejandro; Durbin, Adam D; Etchin, Julia; Lawton, Lee; Sallan, Stephen E.; Silverman, Lewis B.; Loh, Mignon L.; Hunger, Stephen P.; Sanda, Takaomi; Young, Richard A.; Look, A. Thomas


    In certain human cancers, the expression of critical oncogenes is driven from large regulatory elements, called super-enhancers, which recruit much of the cell’s transcriptional apparatus and are defined by extensive acetylation of histone H3 lysine 27 (H3K27ac). In a subset of T-cell acute lymphoblastic leukemia (T-ALL) cases, we found that heterozygous somatic mutations are acquired that introduce binding motifs for the MYB transcription factor in a precise noncoding site, which creates a super-enhancer upstream of the TAL1 oncogene. MYB binds to this new site and recruits it’s H3K27 acetylase binding partner CBP, as well as core components of a major leukemogenic transcriptional complex that contains RUNX1, GATA-3, and TAL1 itself. Additionally, most endogenous super-enhancers found in T-ALL cells are occupied by MYB and CBP, suggesting a general role for MYB in super-enhancer initiation. Thus, this study identifies a genetic mechanism responsible for the generation of oncogenic super-enhancers in malignant cells. PMID:25394790

  5. Transposable Element Insertions in Long Intergenic Non-Coding RNA Genes

    PubMed Central

    Kannan, Sivakumar; Chernikova, Diana; Rogozin, Igor B.; Poliakov, Eugenia; Managadze, David; Koonin, Eugene V.; Milanesi, Luciano


    Transposable elements (TEs) are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA) genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences (TES), followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TES in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the repeat insertion domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and, in particular, fast functional diversification, of lincRNA genes. PMID:26106594

  6. DNA methylation patterns of protein coding genes and long noncoding RNAs in female schizophrenic patients.


    Liao, Qi; Wang, Yunliang; Cheng, Jia; Dai, Dongjun; Zhou, Xingyu; Zhang, Yuzheng; Gao, Shugui; Duan, Shiwei


    Schizophrenia (SCZ) is a complex mental disorder contributed by both genetic and epigenetic factors. Long noncoding RNAs (lncRNAs) was recently found playing an important regulatory role in mental disorders. However, little was known about the DNA methylation of lncRNAs, although numerous SCZ studies have been performed on genetic polymorphisms or epigenetic marks in protein coding genes. We presented a comprehensive genome wide DNA methylation study of both protein coding genes and lncRNAs in female patients with paranoid and undifferentiated SCZ. Using the methyl-CpG binding domain (MBD) protein-enriched genome sequencing (MBD-seq), 8,163 and 764 peaks were identified in paranoid and undifferentiated SCZ, respectively (p < 1 × 10-5). Gene ontology analysis showed that the hypermethylated regions were enriched in the genes related to neuron system and brain for both paranoid and undifferentiated SCZ (p < 0.05). Among these peaks, 121 peaks were located in gene promoter regions that might affect gene expression and influence the SCZ related pathways. Interestingly, DNA methylation of 136 and 23 known lncRNAs in Refseq database were identified in paranoid and undifferentiated SCZ, respectively. In addition, ∼20% of intergenic peaks annotated based on Refseq genes were overlapped with lncRNAs in UCSC and gencode databases. In order to show the results well for most biological researchers, we created an online database to display and visualize the information of DNA methyation peaks in both types of SCZ ( Our results showed that the aberrant DNA methylation of lncRNAs might be another important epigenetic factor for SCZ.

  7. Ancient vertebrate conserved noncoding elements have been evolving rapidly in teleost fishes.


    Lee, Alison P; Kerk, Sze Yen; Tan, Yue Ying; Brenner, Sydney; Venkatesh, Byrappa


    Vertebrate genomes contain thousands of conserved noncoding elements (CNEs) that often function as tissue-specific enhancers. In this study, we have identified CNEs in human, dog, chicken, Xenopus, and four teleost fishes (zebrafish, stickleback, medaka, and fugu) using elephant shark, a cartilaginous vertebrate, as the base genome and investigated the evolution of these ancient vertebrate CNEs (aCNEs) in bony vertebrate lineages. Our analysis shows that aCNEs have been evolving at different rates in different bony vertebrate lineages. Although 78-83% of CNEs have diverged beyond recognition ("lost") in different teleost fishes, only 24% and 40% have been lost in the chicken and mammalian lineages, respectively. Relative rate tests of substitution rates in CNEs revealed that the teleost fish CNEs have been evolving at a significantly higher rate than those in other bony vertebrates. In the ray-finned fish lineage, 68% of aCNEs were lost before the divergence of the four teleosts. This implicates the "fish-specific" whole-genome duplication in the accelerated evolution and the loss of a large number of both copies of duplicated CNEs in teleost fishes. The aCNEs are rich in tissue-specific enhancers and thus many of them are likely to be evolutionarily constrained cis-regulatory elements. The rapid evolution of aCNEs might have affected the expression patterns driven by them. Transgenic zebrafish assay of some human CNE enhancers that have been lost in teleosts has indicated instances of conservation or changes in trans-acting factors between mammals and fishes.

  8. Identification of Putative Noncoding RNAs Among the RIKEN Mouse Full-Length cDNA Collection

    PubMed Central

    Numata, Koji; Kanai, Akio; Saito, Rintaro; Kondo, Shinji; Adachi, Jun; Wilming, Laurens G.; Hume, David A.; Hayashizaki, Yoshihide; Tomita, Masaru


    With the sequencing and annotation of genomes and transcriptomes of several eukaryotes, the importance of noncoding RNA (ncRNA)—RNA molecules that are not translated to protein products—has become more evident. A subclass of ncRNA transcripts are encoded by highly regulated, multi-exon, transcriptional units, are processed like typical protein-coding mRNAs and are increasingly implicated in regulation of many cellular functions in eukaryotes. This study describes the identification of candidate functional ncRNAs from among the RIKEN mouse full-length cDNA collection, which contains 60,770 sequences, by using a systematic computational filtering approach. We initially searched for previously reported ncRNAs and found nine murine ncRNAs and homologs of several previously described nonmouse ncRNAs. Through our computational approach to filter artifact-free clones that lack protein coding potential, we extracted 4280 transcripts as the largest-candidate set. Many clones in the set had EST hits, potential CpG islands surrounding the transcription start sites, and homologies with the human genome. This implies that many candidates are indeed transcribed in a regulated manner. Our results demonstrate that ncRNAs are a major functional subclass of processed transcripts in mammals. PMID:12819127

  9. Widespread selection across coding and noncoding DNA in the pea aphid genome.


    Bickel, Ryan D; Dunham, Joseph P; Brisson, Jennifer A


    Genome-wide patterns of diversity and selection are critical measures for understanding how evolution has shaped the genome. Yet, these population genomic estimates are available for only a limited number of model organisms. Here we focus on the population genomics of the pea aphid (Acyrthosiphon pisum). The pea aphid is an emerging model system that exhibits a range of intriguing biological traits not present in classic model systems. We performed low-coverage genome resequencing of 21 clonal pea aphid lines collected from alfalfa host plants in North America to characterize genome-wide patterns of diversity and selection. We observed an excess of low-frequency polymorphisms throughout coding and noncoding DNA, which we suggest is the result of a founding event and subsequent population expansion in North America. Most gene regions showed lower levels of Tajima's D than synonymous sites, suggesting that the majority of the genome is not evolving neutrally but rather exhibits significant constraint. Furthermore, we used the pea aphid's unique manner of X-chromosome inheritance to assign genomic scaffolds to either autosomes or the X chromosome. Comparing autosomal vs. X-linked sequence variation, we discovered that autosomal genes show an excess of low frequency variants indicating that purifying selection acts more efficiently on the X chromosome. Overall, our results provide a critical first step in characterizing the genetic diversity and evolutionary pressures on an aphid genome.

  10. Defining functional DNA elements in the human genome.


    Kellis, Manolis; Wold, Barbara; Snyder, Michael P; Bernstein, Bradley E; Kundaje, Anshul; Marinov, Georgi K; Ward, Lucas D; Birney, Ewan; Crawford, Gregory E; Dekker, Job; Dunham, Ian; Elnitski, Laura L; Farnham, Peggy J; Feingold, Elise A; Gerstein, Mark; Giddings, Morgan C; Gilbert, David M; Gingeras, Thomas R; Green, Eric D; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D; Myers, Richard M; Pazin, Michael J; Ren, Bing; Stamatoyannopoulos, John A; Weng, Zhiping; White, Kevin P; Hardison, Ross C


    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease.

  11. Defining functional DNA elements in the human genome

    PubMed Central

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.


    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  12. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.


    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  13. Translating the ENCyclopedia Of DNA Elements Project findings to the clinic: ENCODE's implications for eye disease.


    Sanfilippo, Paul G; Hewitt, Alex W


    Approximately 10 years after the Human Genome Project unravelled the sequence of our DNA, the ENCyclopedia Of DNA Elements (ENCODE) Project sought to interpret it. Data from the recently completed project have shed new light on the proportion of biologically active human DNA, assigning a biochemical role to much of the sequence previously considered to be 'junk'. Many of these newly catalogued functional elements represent epigenetic mechanisms involved in regulation of gene expression. Analogous to an Ishihara plate, a gene-coding region of DNA (target dots) only comes into context when the non-coding DNA (surrounding dots) is appreciated. In this review we provide an overview of the ENCODE project, discussing the significance of these data for ophthalmic research and eye disease. The novel insights afforded by the ENCODE project will in time allow for the development of new therapeutic strategies in the management of common blinding disorders.

  14. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De


    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  15. Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region

    SciTech Connect

    Pelletier, J.; Kaplan, G.; Racaniello, V.R.; Sonenberg, N.


    Poliovirus polysomal RNA is naturally uncapped, and as such, its translation must bypass any 5' cap-dependent ribosome recognition event. To elucidate the manner by which poliovirus mRNA is translated, the authors determined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. They found striking differences in translatability among the altered mRNAs when assayed in mock-infected and poliovirus-infected HeLa cell extracts. The results identify a functional cis-acting element within the 5' noncoding region of the poliovirus mRNA which enables it to translate in a cap-independent fashion. The major determinant of this element maps between nucleotides 320 and 631 of the 5' end of the poliovirus mRNA. They also show that this region (320 to 631), when fused to a heterologous mRNA, can function in cis to render the mRNA cap independent in translation.

  16. BioCode: Two biologically compatible Algorithms for embedding data in non-coding and coding regions of DNA

    PubMed Central


    Background In recent times, the application of deoxyribonucleic acid (DNA) has diversified with the emergence of fields such as DNA computing and DNA data embedding. DNA data embedding, also known as DNA watermarking or DNA steganography, aims to develop robust algorithms for encoding non-genetic information in DNA. Inherently DNA is a digital medium whereby the nucleotide bases act as digital symbols, a fact which underpins all bioinformatics techniques, and which also makes trivial information encoding using DNA straightforward. However, the situation is more complex in methods which aim at embedding information in the genomes of living organisms. DNA is susceptible to mutations, which act as a noisy channel from the point of view of information encoded using DNA. This means that the DNA data embedding field is closely related to digital communications. Moreover it is a particularly unique digital communications area, because important biological constraints must be observed by all methods. Many DNA data embedding algorithms have been presented to date, all of which operate in one of two regions: non-coding DNA (ncDNA) or protein-coding DNA (pcDNA). Results This paper proposes two novel DNA data embedding algorithms jointly called BioCode, which operate in ncDNA and pcDNA, respectively, and which comply fully with stricter biological restrictions. Existing methods comply with some elementary biological constraints, such as preserving protein translation in pcDNA. However there exist further biological restrictions which no DNA data embedding methods to date account for. Observing these constraints is key to increasing the biocompatibility and in turn, the robustness of information encoded in DNA. Conclusion The algorithms encode information in near optimal ways from a coding point of view, as we demonstrate by means of theoretical and empirical (in silico) analyses. Also, they are shown to encode information in a robust way, such that mutations have isolated

  17. DNA methylation patterns of protein-coding genes and long non-coding RNAs in males with schizophrenia.


    Liao, Qi; Wang, Yunliang; Cheng, Jia; Dai, Dongjun; Zhou, Xingyu; Zhang, Yuzheng; Li, Jinfeng; Yin, Honglei; Gao, Shugui; Duan, Shiwei


    Schizophrenia (SCZ) is one of the most complex mental illnesses affecting ~1% of the population worldwide. SCZ pathogenesis is considered to be a result of genetic as well as epigenetic alterations. Previous studies have aimed to identify the causative genes of SCZ. However, DNA methylation of long non-coding RNAs (lncRNAs) involved in SCZ has not been fully elucidated. In the present study, a comprehensive genome-wide analysis of DNA methylation was conducted using samples from two male patients with paranoid and undifferentiated SCZ, respectively. Methyl-CpG binding domain protein-enriched genome sequencing was used. In the two patients with paranoid and undifferentiated SCZ, 1,397 and 1,437 peaks were identified, respectively. Bioinformatic analysis demonstrated that peaks were enriched in protein-coding genes, which exhibited nervous system and brain functions. A number of these peaks in gene promoter regions may affect gene expression and, therefore, influence SCZ-associated pathways. Furthermore, 7 and 20 lncRNAs, respectively, in the Refseq database were hypermethylated. According to the lncRNA dataset in the NONCODE database, ~30% of intergenic peaks overlapped with novel lncRNA loci. The results of the present study demonstrated that aberrant hypermethylation of lncRNA genes may be an important epigenetic factor associated with SCZ. However, further studies using larger sample sizes are required.

  18. The ENCODE (ENCyclopedia Of DNA Elements) Project.



    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  19. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    PubMed Central

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong


    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity. PMID:26472689

  20. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    NASA Astrophysics Data System (ADS)

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong


    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity.

  1. The effect of non-coding DNA variations on P53 and cMYC competitive inhibition at cis-overlapping motifs.


    Kin, Katherine; Chen, Xi; Gonzalez-Garay, Manuel; Fakhouri, Walid D


    Non-coding DNA variations play a critical role in increasing the risk for development of common complex diseases, and account for the majority of SNPs highly associated with cancer. However, it remains a challenge to identify etiologic variants and to predict their pathological effects on target gene expression for clinical purposes. Cis-overlapping motifs (COMs) are elements of enhancer regions that impact gene expression by enabling competitive binding and switching between transcription factors. Mutations within COMs are especially important when the involved transcription factors have opposing effects on gene regulation, like P53 tumor suppressor and cMYC proto-oncogene. In this study, genome-wide analysis of ChIP-seq data from human cancer and mouse embryonic cells identified a significant number of putative regulatory elements with signals for both P53 and cMYC. Each co-occupied element contains, on average, two COMs, and one common SNP every two COMs. Gene ontology of predicted target genes for COMs showed that the majority are involved in DNA damage, apoptosis, cell cycle regulation, and RNA processing. EMSA results showed that both cMYC and P53 bind to cis-overlapping motifs within a ChIP-seq co-occupied region in Chr12. In vitro functional analysis of selected co-occupied elements verified enhancer activity, and also showed that the occurrence of SNPs within three COMs significantly altered enhancer activity. We identified a list of COM-associated functional SNPs that are in close proximity to SNPs associated with common diseases in large population studies. These results suggest a potential molecular mechanism to identify etiologic regulatory mutations associated with common diseases.

  2. A novel non-coding RNA lncRNA-JADE connects DNA damage signalling to histone H4 acetylation.


    Wan, Guohui; Hu, Xiaoxiao; Liu, Yunhua; Han, Cecil; Sood, Anil K; Calin, George A; Zhang, Xinna; Lu, Xiongbin


    A prompt and efficient DNA damage response (DDR) eliminates the detrimental effects of DNA lesions in eukaryotic cells. Basic and preclinical studies suggest that the DDR is one of the primary anti-cancer barriers during tumorigenesis. The DDR involves a complex network of processes that detect and repair DNA damage, in which long non-coding RNAs (lncRNAs), a new class of regulatory RNAs, may play an important role. In the current study, we identified a novel lncRNA, lncRNA-JADE, that is induced after DNA damage in an ataxia-telangiectasia mutated (ATM)-dependent manner. LncRNA-JADE transcriptionally activates Jade1, a key component in the HBO1 (human acetylase binding to ORC1) histone acetylation complex. Consequently, lncRNA-JADE induces histone H4 acetylation in the DDR. Markedly higher levels of lncRNA-JADE were observed in human breast tumours in comparison with normal breast tissues. Knockdown of lncRNA-JADE significantly inhibited breast tumour growth in vivo. On the basis of these results, we propose that lncRNA-JADE is a key functional link that connects the DDR to histone H4 acetylation, and that dysregulation of lncRNA-JADE may contribute to breast tumorigenesis.

  3. A strand-specific switch in noncoding transcription switches the function of a Polycomb/Trithorax response element

    PubMed Central

    Trupke, Johanna; Okulski, Helena; Altmutter, Christina; Ruge, Frank; Boidol, Bernd; Kubicek, Stefan; Schmauss, Gerald; Aumayr, Karin; Ruf, Marius; Pospisilik, Andrew; Dimond, Andrew; Senergin, Hasene Basak; Vargas, Marcus L.; Simon, Jeffrey A.; Ringrose, Leonie


    Polycomb/Trithorax response elements (PRE/TREs) can switch their function reversibly between silencing and activation, by mechanisms that are poorly understood. Here we show that a switch in forward and reverse noncoding transcription from the Drosophila vestigial (vg) PRE/TRE switches the status of the element between silencing (induced by the forward strand) and activation (induced by the reverse strand). In vitro, both ncRNAs inhibit PRC2 histone methyltransferase activity, but in vivo only the reverse strand binds PRC2. Over-expression of the reverse strand evicts PRC2 from chromatin and inhibits its enzymatic activity. We propose that interactions of RNAs with PRC2 are differentially regulated in vivo, allowing regulated inhibition of local PRC2 activity. Genome-wide analysis shows that strand switching of ncRNAs occurs at several hundred PcG binding sites in fly and vertebrate genomes. This work identifies a novel and potentially widespread class of PRE/TREs that switch function by switching the direction of ncRNA transcription. PMID:25108384

  4. Transposable Elements: No More 'Junk DNA'.


    Kim, Yun-Ji; Lee, Jungnam; Han, Kyudong


    Since the advent of whole-genome sequencing, transposable elements (TEs), just thought to be 'junk' DNA, have been noticed because of their numerous copies in various eukaryotic genomes. Many studies about TEs have been conducted to discover their functions in their host genomes. Based on the results of those studies, it has been generally accepted that they have a function to cause genomic and genetic variations. However, their infinite functions are not fully elucidated. Through various mechanisms, including de novo TE insertions, TE insertion-mediated deletions, and recombination events, they manipulate their host genomes. In this review, we focus on Alu, L1, human endogenous retrovirus, and short interspersed element/variable number of tandem repeats/Alu (SVA) elements and discuss how they have affected primate genomes, especially the human and chimpanzee genomes, since their divergence.

  5. Natural selection on coding and noncoding DNA sequences is associated with virulence genes in a plant pathogenic fungus.


    Rech, Gabriel E; Sanz-Martín, José M; Anisimova, Maria; Sukno, Serenella A; Thon, Michael R


    Natural selection leaves imprints on DNA, offering the opportunity to identify functionally important regions of the genome. Identifying the genomic regions affected by natural selection within pathogens can aid in the pursuit of effective strategies to control diseases. In this study, we analyzed genome-wide patterns of selection acting on different classes of sequences in a worldwide sample of eight strains of the model plant-pathogenic fungus Colletotrichum graminicola. We found evidence of selective sweeps, balancing selection, and positive selection affecting both protein-coding and noncoding DNA of pathogenicity-related sequences. Genes encoding putative effector proteins and secondary metabolite biosynthetic enzymes show evidence of positive selection acting on the coding sequence, consistent with an Arms Race model of evolution. The 5' untranslated regions (UTRs) of genes coding for effector proteins and genes upregulated during infection show an excess of high-frequency polymorphisms likely the consequence of balancing selection and consistent with the Red Queen hypothesis of evolution acting on these putative regulatory sequences. Based on the findings of this work, we propose that even though adaptive substitutions on coding sequences are important for proteins that interact directly with the host, polymorphisms in the regulatory sequences may confer flexibility of gene expression in the virulence processes of this important plant pathogen.

  6. Fact or fiction: updates on how protein-coding genes might emerge de novo from previously non-coding DNA.


    Schmitz, Jonathan F; Bornberg-Bauer, Erich


    Over the last few years, there has been an increasing amount of evidence for the de novo emergence of protein-coding genes, i.e. out of non-coding DNA. Here, we review the current literature and summarize the state of the field. We focus specifically on open questions and challenges in the study of de novo protein-coding genes such as the identification and verification of de novo-emerged genes. The greatest obstacle to date is the lack of high-quality genomic data with very short divergence times which could help precisely pin down the location of origin of a de novo gene. We conclude that, while there is plenty of evidence from a genetics perspective, there is a lack of functional studies of bona fide de novo genes and almost no knowledge about protein structures and how they come about during the emergence of de novo protein-coding genes. We suggest that future studies should concentrate on the functional and structural characterization of de novo protein-coding genes as well as the detailed study of the emergence of functional de novo protein-coding genes.

  7. A non-coding plastid DNA phylogeny of Asian Begonia (Begoniaceae): evidence for morphological homoplasy and sectional polyphyly.


    Thomas, D C; Hughes, M; Phutthai, T; Rajbhandary, S; Rubite, R; Ardi, W H; Richardson, J E


    Maximum likelihood and Bayesian analyses of non-coding plastid DNA sequence data based on a broad sampling of all major Asian Begonia sections (ndhA intron, ndhF-rpl32 spacer, rpl32-trnL spacer, 3977 aligned characters, 84 species) were used to reconstruct the phylogeny of Asian Begonia and to test the monophyly of major Asian Begonia sections. Ovary and fruit characters which are crucial in current sectional circumscriptions were mapped on the phylogeny to assess their utility in infrageneric classifications. The results indicate that the strong systematic emphasis placed on single, homoplasious characters such as undivided placenta lamellae (section Reichenheimia) and fleshy pericarps (section Sphenanthera), and the recognition of sections primarily based on a suite of plesiomorphic characters including three-locular ovaries with axillary, bilamellate placentae and dry, dehiscent pericarps (section Diploclinium), has resulted in the circumscription of several polyphyletic sections. Moreover, sections Platycentrum and Petermannia were recovered as paraphyletic. Because of the homoplasy of systematically important characters, current classifications have a certain diagnostic, but only poor predictive value. The presented phylogeny provides for the first time a reasonably resolved and supported phylogenetic framework for Asian Begonia which has the power to inform future taxonomic, biogeographic and evolutionary studies.

  8. Fact or fiction: updates on how protein-coding genes might emerge de novo from previously non-coding DNA

    PubMed Central

    Schmitz, Jonathan F; Bornberg-Bauer, Erich


    Over the last few years, there has been an increasing amount of evidence for the de novo emergence of protein-coding genes, i.e. out of non-coding DNA. Here, we review the current literature and summarize the state of the field. We focus specifically on open questions and challenges in the study of de novo protein-coding genes such as the identification and verification of de novo-emerged genes. The greatest obstacle to date is the lack of high-quality genomic data with very short divergence times which could help precisely pin down the location of origin of a de novo gene. We conclude that, while there is plenty of evidence from a genetics perspective, there is a lack of functional studies of bona fide de novo genes and almost no knowledge about protein structures and how they come about during the emergence of de novo protein-coding genes. We suggest that future studies should concentrate on the functional and structural characterization of de novo protein-coding genes as well as the detailed study of the emergence of functional de novo protein-coding genes. PMID:28163910

  9. A Note on Zipf’s Law, Natural Languages, and Noncoding DNA Regions.

    DTIC Science & Technology


    the lower 1 Indeed, as N. Chomsky points out (p.c.), if we take a col- lection of English sentences and define "words" by taking the strings...words in written English . American Journal of Psychology, 71, 209-218. [6] Mandelbrot, B. 1961. Word frequencies and Marko- vian models of discourse...similarity between DNA’s " gramar " and natural language grammars, just as the observation of exact Zipf-like behavior cannot distinguish between the

  10. Small RNAs, DNA methylation and transposable elements in wheat

    PubMed Central


    Background More than 80% of the wheat genome is composed of transposable elements (TEs). Since active TEs can move to different locations and potentially impose a significant mutational load, their expression is suppressed in the genome via small non-coding RNAs (sRNAs). sRNAs guide silencing of TEs at the transcriptional (mainly 24-nt sRNAs) and post-transcriptional (mainly 21-nt sRNAs) levels. In this study, we report the distribution of these two types of sRNAs among the different classes of wheat TEs, the regions targeted within the TEs, and their impact on the methylation patterns of the targeted regions. Results We constructed an sRNA library from hexaploid wheat and developed a database that included our library and three other publicly available sRNA libraries from wheat. For five completely-sequenced wheat BAC contigs, most perfectly matching sRNAs represented TE sequences, suggesting that a large fraction of the wheat sRNAs originated from TEs. An analysis of all wheat TEs present in the Triticeae Repeat Sequence database showed that sRNA abundance was correlated with the estimated number of TEs within each class. Most of the sRNAs perfectly matching miniature inverted repeat transposable elements (MITEs) belonged to the 21-nt class and were mainly targeted to the terminal inverted repeats (TIRs). In contrast, most of the sRNAs matching class I and class II TEs belonged to the 24-nt class and were mainly targeted to the long terminal repeats (LTRs) in the class I TEs and to the terminal repeats in CACTA transposons. An analysis of the mutation frequency in potentially methylated sites revealed a three-fold increase in TE mutation frequency relative to intron and untranslated genic regions. This increase is consistent with wheat TEs being preferentially methylated, likely by sRNA targeting. Conclusions Our study examines the wheat epigenome in relation to known TEs. sRNA-directed transcriptional and post-transcriptional silencing plays important roles in

  11. Regulation of immunoglobulin class-switch recombination: choreography of noncoding transcription, targeted DNA deamination, and long-range DNA repair.


    Matthews, Allysia J; Zheng, Simin; DiMenna, Lauren J; Chaudhuri, Jayanta


    Upon encountering antigens, mature IgM-positive B lymphocytes undergo class-switch recombination (CSR) wherein exons encoding the default Cμ constant coding gene segment of the immunoglobulin (Ig) heavy-chain (Igh) locus are excised and replaced with a new constant gene segment (referred to as "Ch genes", e.g., Cγ, Cɛ, or Cα). The B cell thereby changes from expressing IgM to one producing IgG, IgE, or IgA, with each antibody isotype having a different effector function during an immune reaction. CSR is a DNA deletional-recombination reaction that proceeds through the generation of DNA double-strand breaks (DSBs) in repetitive switch (S) sequences preceding each Ch gene and is completed by end-joining between donor Sμ and acceptor S regions. CSR is a multistep reaction requiring transcription through S regions, the DNA cytidine deaminase AID, and the participation of several general DNA repair pathways including base excision repair, mismatch repair, and classical nonhomologous end-joining. In this review, we discuss our current understanding of how transcription through S regions generates substrates for AID-mediated deamination and how AID participates not only in the initiation of CSR but also in the conversion of deaminated residues into DSBs. Additionally, we review the multiple processes that regulate AID expression and facilitate its recruitment specifically to the Ig loci, and how deregulation of AID specificity leads to oncogenic translocations. Finally, we summarize recent data on the potential role of AID in the maintenance of the pluripotent stem cell state during epigenetic reprogramming.

  12. Regulation of Immunoglobulin Class-Switch Recombination: Choreography of Noncoding Transcription, Targeted DNA Deamination, and Long-Range DNA Repair

    PubMed Central

    Matthews, Allysia J.; Zheng, Simin; DiMenna, Lauren J.; Chaudhuri, Jayanta


    Upon encountering antigens, mature IgM-positive B lymphocytes undergo class-switch recombination (CSR) wherein exons encoding the default Cμ constant coding gene segment of the immunoglobulin (Ig) heavy-chain (Igh) locus are excised and replaced with a new constant gene segment (referred to as “Ch genes”, e.g., Cγ, Cε, or Cα). The B cell thereby changes from expressing IgM to one producing IgG, IgE, or IgA, with each antibody isotype having a different effector function during an immune reaction. CSR is a DNA deletional-recombination reaction that proceeds through the generation of DNA double-strand breaks (DSBs) in repetitive switch (S) sequences preceding each Ch gene and is completed by end-joining between donor Sμ and acceptor S regions. CSR is a multistep reaction requiring transcription through S regions, the DNA cytidine deaminase AID, and the participation of several general DNA repair pathways including base excision repair, mismatch repair, and classical nonhomologous end-joining. In this review, we discuss our current understanding of how transcription through S regions generates substrates for AID-mediated deamination and how AID participates not only in the initiation of CSR but also in the conversion of deaminated residues into DSBs. Additionally, we review the multiple processes that regulate AID expression and facilitate its recruitment specifically to the Ig loci, and how deregulation of AID specificity leads to oncogenic translocations. Finally, we summarize recent data on the potential role of AID in the maintenance of the pluripotent stem cell state during epigenetic reprogramming. PMID:24507154

  13. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA

    PubMed Central

    Turner, Tychele N.; Hormozdiari, Fereydoun; Duyzend, Michael H.; McClymont, Sarah A.; Hook, Paul W.; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A.; Zody, Michael C.; Nelson, Bradley J.; Huddleston, John; Sandstrom, Richard; Smith, Joshua D.; Hanna, David; Swanson, James M.; Faustman, Elaine M.; Bamshad, Michael J.; Stamatoyannopoulos, John; Nickerson, Deborah A.; McCallion, Andrew S.; Darnell, Robert; Eichler, Evan E.


    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  14. Detecting non-coding selective pressure in coding regions

    PubMed Central

    Chen, Hui; Blanchette, Mathieu


    Background Comparative genomics approaches, where orthologous DNA regions are compared and inter-species conserved regions are identified, have proven extremely powerful for identifying non-coding regulatory regions located in intergenic or intronic regions. However, non-coding functional elements can also be located within coding region, as is common for exonic splicing enhancers, some transcription factor binding sites, and RNA secondary structure elements affecting mRNA stability, localization, or translation. Since these functional elements are located in regions that are themselves highly conserved because they are coding for a protein, they generally escaped detection by comparative genomics approaches. Results We introduce a comparative genomics approach for detecting non-coding functional elements located within coding regions. Codon evolution is modeled as a mixture of codon substitution models, where each component of the mixture describes the evolution of codons under a specific type of coding selective pressure. We show how to compute the posterior distribution of the entropy and parsimony scores under this null model of codon evolution. The method is applied to a set of growth hormone 1 orthologous mRNA sequences and a known exonic splicing elements is detected. The analysis of a set of CORTBP2 orthologous genes reveals a region of several hundred base pairs under strong non-coding selective pressure whose function remains unknown. Conclusion Non-coding functional elements, in particular those involved in post-transcriptional regulation, are likely to be much more prevalent than is currently known. With the numerous genome sequencing projects underway, comparative genomics approaches like that proposed here are likely to become increasingly powerful at detecting such elements. PMID:17288582

  15. An encyclopedia of mouse DNA elements (Mouse ENCODE).


    Stamatoyannopoulos, John A; Snyder, Michael; Hardison, Ross; Ren, Bing; Gingeras, Thomas; Gilbert, David M; Groudine, Mark; Bender, Michael; Kaul, Rajinder; Canfield, Theresa; Giste, Erica; Johnson, Audra; Zhang, Mia; Balasundaram, Gayathri; Byron, Rachel; Roach, Vaughan; Sabo, Peter J; Sandstrom, Richard; Stehling, A Sandra; Thurman, Robert E; Weissman, Sherman M; Cayting, Philip; Hariharan, Manoj; Lian, Jin; Cheng, Yong; Landt, Stephen G; Ma, Zhihai; Wold, Barbara J; Dekker, Job; Crawford, Gregory E; Keller, Cheryl A; Wu, Weisheng; Morrissey, Christopher; Kumar, Swathi A; Mishra, Tejaswini; Jain, Deepti; Byrska-Bishop, Marta; Blankenberg, Daniel; Lajoie, Bryan R; Jain, Gaurav; Sanyal, Amartya; Chen, Kaun-Bei; Denas, Olgert; Taylor, James; Blobel, Gerd A; Weiss, Mitchell J; Pimkin, Max; Deng, Wulan; Marinov, Georgi K; Williams, Brian A; Fisher-Aylor, Katherine I; Desalvo, Gilberto; Kiralusha, Anthony; Trout, Diane; Amrhein, Henry; Mortazavi, Ali; Edsall, Lee; McCleary, David; Kuan, Samantha; Shen, Yin; Yue, Feng; Ye, Zhen; Davis, Carrie A; Zaleski, Chris; Jha, Sonali; Xue, Chenghai; Dobin, Alex; Lin, Wei; Fastuca, Meagan; Wang, Huaien; Guigo, Roderic; Djebali, Sarah; Lagarde, Julien; Ryba, Tyrone; Sasaki, Takayo; Malladi, Venkat S; Cline, Melissa S; Kirkup, Vanessa M; Learned, Katrina; Rosenbloom, Kate R; Kent, W James; Feingold, Elise A; Good, Peter J; Pazin, Michael; Lowdon, Rebecca F; Adams, Leslie B


    To complement the human Encyclopedia of DNA Elements (ENCODE) project and to enable a broad range of mouse genomics efforts, the Mouse ENCODE Consortium is applying the same experimental pipelines developed for human ENCODE to annotate the mouse genome.

  16. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    PubMed Central

    Lozano, Gloria; Trenado, Helena P.; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W.; Navas-Castillo, Jesús


    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem–loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem–loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  17. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) - Definition of a Distinct Class of Begomovirus-Associated Satellites.


    Lozano, Gloria; Trenado, Helena P; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W; Navas-Castillo, Jesús


    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem-loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed.

  18. RNA Helicase Associated with AU-rich Element (RHAU/DHX36) Interacts with the 3′-Tail of the Long Non-coding RNA BC200 (BCYRN1)*

    PubMed Central

    Booy, Evan P.; McRae, Ewan K. S.; Howard, Ryan; Deo, Soumya R.; Ariyo, Emmanuel O.; Dzananovic, Edis; Meier, Markus; Stetefeld, Jörg; McKenna, Sean A.


    RNA helicase associated with AU-rich element (RHAU) is an ATP-dependent RNA helicase that demonstrates high affinity for quadruplex structures in DNA and RNA. To elucidate the significance of these quadruplex-RHAU interactions, we have performed RNA co-immunoprecipitation screens to identify novel RNAs bound to RHAU and characterize their function. In the course of this study, we have identified the non-coding RNA BC200 (BCYRN1) as specifically enriched upon RHAU immunoprecipitation. Although BC200 does not adopt a quadruplex structure and does not bind the quadruplex-interacting motif of RHAU, it has direct affinity for RHAU in vitro. Specifically designed BC200 truncations and RNase footprinting assays demonstrate that RHAU binds to an adenosine-rich region near the 3′-end of the RNA. RHAU truncations support binding that is dependent upon a region within the C terminus and is specific to RHAU isoform 1. Tests performed to assess whether BC200 interferes with RHAU helicase activity have demonstrated the ability of BC200 to act as an acceptor of unwound quadruplexes via a cytosine-rich region near the 3′-end of the RNA. Furthermore, an interaction between BC200 and the quadruplex-containing telomerase RNA was confirmed by pull-down assays of the endogenous RNAs. This leads to the possibility that RHAU may direct BC200 to bind and exert regulatory functions at quadruplex-containing RNA or DNA sequences. PMID:26740632

  19. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L


    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  20. Transcriptional regulation by activation and repression elements located at the 5'-noncoding region of the human alpha9 nicotinic receptor subunit gene.


    Valor, Luis M; Castillo, Mar; Ortiz, José A; Criado, Manuel


    The alpha9 subunit is a component of the neuronal nicotinic acetylcholine receptor gene superfamily that is expressed in very restricted locations. The promoter of the human gene has been analyzed in the human neuroblastoma SH-SY5Y, where alpha9 subunit expression was detected, and in C2C12 cells that do not express alpha9. A proximal promoter region (from -322 to +113) showed maximal transcriptional activity in SH-SY5Y cells, whereas its activity in C1C12 cells was much lower. Two elements unusually located at the 5'-noncoding region exhibited opposite roles. A negative element located between +15 and +48 appears to be cell-specific because it was effective in C2C12 but not in SH-SY5Y cells, where it was counterbalanced by the presence of the promoter region 5' to the initiation site. An activating element located between +66 and +79 and formed by two adjacent Sox boxes increased the activity of the alpha9 promoter about 4-fold and was even able to activate other promoters. This element interacts with Sox proteins, probably through a cooperative mechanism in which the two Sox boxes are necessary. We propose that the Sox complex provides an initial scaffold that facilitates the recruiting of the transcriptional machinery responsible for alpha9 subunit expression.

  1. Profiling DNA Methylation and Hydroxymethylation at Retrotransposable Elements.


    de la Rica, Lorenzo; Stanley, Jatinder S; Branco, Miguel R


    DNA methylation is a key epigenetic modification controlling the transcriptional activity of mammalian retrotransposable elements. Its oxidation to DNA hydroxymethylation has been linked to DNA demethylation and reactivation of retrotransposons. Here we describe in detail protocols for three methods to measure DNA methylation and hydroxymethylation at specific genomic targets: glucMS-qPCR, and two sequencing approaches (pyrosequencing and high-throughput sequencing) for analyzing bisulfite- and oxidative bisulfite-modified DNA. All three techniques provide absolute measurements of methylation and hydroxymethylation levels at single-base resolution. Differences between the methods are discussed, mainly with respect to throughput and target coverage. These constitute the core techniques that are used in our laboratory for accurately surveying the epigenetics of retrotransposable elements.

  2. Rapid proliferation of repetitive palindromic elements in mtDNA of the endemic Baikalian sponge Lubomirskia baicalensis.


    Lavrov, Dennis V


    Animal mitochondrial DNA (mtDNA) is a remarkably compact molecule largely because of the scarcity of noncoding "selfish" DNA. Recently, however, we found that mitochondrial genomes of several phylogenetically diverse species of demosponges contain small repetitive palindromic sequences, interspersed within intergenic regions and fused in protein and ribosomal RNA genes. Here, I report and analyze the proliferation of such elements in the mitochondrial genome of the endemic sponge of Lake Baikal Lubomirskia baicalensis. Because Baikal sponges are closely related to the circumglobally distributed freshwater sponge Ephydatia muelleri with which they shared a common ancestor approximately 3-10 Ma, both the rate of single nucleotide substitutions and the rate of palindromic repeat insertions can be calculated in this system. I found the rate of nucleotide substitutions in mtDNA of freshwater sponges to be extremely low (0.5-1.6 x 10(-9) per site per year), more similar to that in plants than bilaterian animals. By contrast, the per/nucleotide rate of insertions of repetitive elements is at least four times higher. This rapid rate of proliferation combined with the broad phylogenetic distribution of hairpin elements can make them a defining force in the evolution of mitochondrial genomes of demosponges.

  3. A DNA element in the slo gene modulates ethanol tolerance.


    Krishnan, Harish R; Li, Xiaolei; Ghezzi, Alfredo; Atkinson, Nigel S


    In Drosophila, the slo gene encodes BK-type Ca(2+)-activated K(+) channels and is involved in producing rapid functional tolerance to sedation with ethanol. Drosophila are ideal for the study of functional ethanol tolerance because the adult does not acquire metabolic ethanol tolerance (Scholz, Ramond, Singh, & Heberlein, 2000). It has been shown that mutations in slo block the capacity to acquire tolerance, that sedation with ethanol vapor induces slo gene expression in the nervous system, and that transgenic induction of slo can phenocopy tolerance (Cowmeadow, Krishnan, & Atkinson, 2005; Cowmeadow et al., 2006). Here we use ethanol-induced histone acetylation to map a DNA regulatory element in the slo transcriptional control region and functionally test the element for a role in producing ethanol tolerance. Histone acetylation is commonly associated with activating transcription factors. We used the chromatin immunoprecipitation assay to map histone acetylation changes following ethanol sedation to identify an ethanol-responsive DNA element. Ethanol sedation induced an increase in histone acetylation over a 60 n DNA element called 6b, which is situated between the two ethanol-responsive neural promoters of the slo gene. Removal of the 6b element from the endogenous slo gene affected the production of functional ethanol tolerance as assayed in an ethanol-vapor recovery from sedation assay. Removal of element 6b extended the period of functional ethanol tolerance from ∼10 days to more than 21 days after a single ethanol-vapor sedation. This study demonstrates that mapping the position of ethanol-induced histone acetylation is an effective way to identify DNA regulatory elements that help to mediate the response of a gene to ethanol. Using this approach, we identified a DNA element, which is conserved among Drosophila species, and which is important for producing a behaviorally relevant ethanol response.

  4. Long interspersed nuclear elements (LINEs) show tissue-specific, mosaic genome and methylation-unrestricted, widespread expression of noncoding RNAs in somatic tissues of the rat

    PubMed Central

    Singh, Deepak K.; Rath, Pramod C.


    We report strong somatic and germ line expression of LINE RNAs in eight different tissues of rat by using a novel ~2.8 kb genomic PstI-LINE DNA (P1-LINE) isolated from the rat brain. P1-LINE is present in a 93 kb LINE-SINE-cluster in sub-telomeric region of chromosome 12 (12p12) and as multiple truncated copies interspersed in all rat chromosomes. P1-LINEs occur as inverted repeats at multiple genomic loci in tissue-specific and mosaic patterns. P1-LINE RNAs are strongly expressed in brain, liver, lungs, heart, kidney, testes, spleen and thymus into large to small heterogeneous RNAs (~5.0 to 0.2 kb) in tissue-specific and dynamic patterns in individual rats. P1-LINE DNA is strongly methylated at CpG-dinucleotides in most genomic copies in all the tissues and weakly hypomethylated in few copies in some tissues. Small (700–75 nt) P1-LINE RNAs expressed in all tissues may be possible precursors for small regulatory RNAs (PIWI-interacting/piRNAs) bioinformatically derived from P1-LINE. The strong and dynamic expression of LINE RNAs from multiple chromosomal loci and the putative piRNAs in somatic tissues of rat under normal physiological conditions may define functional chromosomal domains marked by LINE RNAs as long noncoding RNAs (lncRNAs) unrestricted by DNA methylation. The tissue-specific, dynamic RNA expression and mosaic genomic distribution of LINEs representing a steady-state genomic flux of retrotransposon RNAs suggest for biological role of LINE RNAs as long ncRNAs and small piRNAs in mammalian tissues independent of their cellular fate for translation, reverse-transcription and retrotransposition. This may provide evolutionary advantages to LINEs and mammalian genomes. PMID:23064113

  5. Unique alterations of an ultraconserved non-coding element in the 3'UTR of ZIC2 in holoprosencephaly.


    Roessler, Erich; Hu, Ping; Hong, Sung-Kook; Srivastava, Kshitij; Carrington, Blake; Sood, Raman; Petrykowska, Hanna; Elnitski, Laura; Ribeiro, Lucilene A; Richieri-Costa, Antonio; Feldman, Benjamin; Odenwald, Ward F; Muenke, Maximilian


    Coding region alterations of ZIC2 are the second most common type of mutation in holoprosencephaly (HPE). Here we use several complementary bioinformatic approaches to identify ultraconserved cis-regulatory sequences potentially driving the expression of human ZIC2. We demonstrate that an 804 bp element in the 3' untranslated region (3'UTR) is highly conserved across the evolutionary history of vertebrates from fish to humans. Furthermore, we show that while genetic variation of this element is unexpectedly common among holoprosencephaly subjects (6/528 or >1%), it is not present in control individuals. Two of six proband-unique variants are de novo, supporting their pathogenic involvement in HPE outcomes. These findings support a general recommendation that the identification and analysis of key ultraconserved elements should be incorporated into the genetic risk assessment of holoprosencephaly cases.

  6. Replication of a pathogenic non-coding RNA increases DNA methylation in plants associated with a bromodomain-containing viroid-binding protein

    PubMed Central

    Lv, Dian-Qiu; Liu, Shang-Wu; Zhao, Jian-Hua; Zhou, Bang-Jun; Wang, Shao-Peng; Guo, Hui-Shan; Fang, Yuan-Yuan


    Viroids are plant-pathogenic molecules made up of single-stranded circular non-coding RNAs. How replicating viroids interfere with host silencing remains largely unknown. In this study, we investigated the effects of a nuclear-replicating Potato spindle tuber viroid (PSTVd) on interference with plant RNA silencing. Using transient induction of silencing in GFP transgenic Nicotiana benthamiana plants (line 16c), we found that PSTVd replication accelerated GFP silencing and increased Virp1 mRNA, which encodes bromodomain-containing viroid-binding protein 1 and is required for PSTVd replication. DNA methylation was increased in the GFP transgene promoter of PSTVd-replicating plants, indicating involvement of transcriptional gene silencing. Consistently, accelerated GFP silencing and increased DNA methylation in the of GFP transgene promoter were detected in plants transiently expressing Virp1. Virp1 mRNA was also increased upon PSTVd infection in natural host potato plants. Reduced transcript levels of certain endogenous genes were also consistent with increases in DNA methylation in related gene promoters in PSTVd-infected potato plants. Together, our data demonstrate that PSTVd replication interferes with the nuclear silencing pathway in that host plant, and this is at least partially attributable to Virp1. This study provides new insights into the plant-viroid interaction on viroid pathogenicity by subverting the plant cell silencing machinery. PMID:27767195

  7. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  8. Cross-Regulation between Transposable Elements and Host DNA Replication

    PubMed Central

    Zaratiegui, Mikel


    Transposable elements subvert host cellular functions to ensure their survival. Their interaction with the host DNA replication machinery indicates that selective pressures lead them to develop ancestral and convergent evolutionary adaptations aimed at conserved features of this fundamental process. These interactions can shape the co-evolution of the transposons and their hosts. PMID:28335567

  9. Differential nuclease sensitivity profiling of chromatin reveals biochemical footprints coupled to gene expression and functional DNA elements in maize.


    Vera, Daniel L; Madzima, Thelma F; Labonne, Jonathan D; Alam, Mohammad P; Hoffman, Gregg G; Girimurugan, S B; Zhang, Jinfeng; McGinnis, Karen M; Dennis, Jonathan H; Bass, Hank W


    The eukaryotic genome is organized into nucleosomes, the fundamental units of chromatin. The positions of nucleosomes on DNA regulate protein-DNA interactions and in turn influence DNA-templated events. Despite the increasing number of genome-wide maps of nucleosome position, how global changes in gene expression relate to changes in nucleosome position is poorly understood. We show that in nucleosome occupancy mapping experiments in maize (Zea mays), particular genomic regions are highly susceptible to variation introduced by differences in the extent to which chromatin is digested with micrococcal nuclease (MNase). We exploited this digestion-linked variation to identify protein footprints that are hypersensitive to MNase digestion, an approach we term differential nuclease sensitivity profiling (DNS-chip). Hypersensitive footprints were enriched at the 5' and 3' ends of genes, associated with gene expression levels, and significantly overlapped with conserved noncoding sequences and the binding sites of the transcription factor KNOTTED1. We also found that the tissue-specific regulation of gene expression was linked to tissue-specific hypersensitive footprints. These results reveal biochemical features of nucleosome organization that correlate with gene expression levels and colocalize with functional DNA elements. This approach to chromatin profiling should be broadly applicable to other species and should shed light on the relationships among chromatin organization, protein-DNA interactions, and genome regulation.

  10. Alu elements and DNA double-strand break repair.


    White, Travis B; Morales, Maria E; Deininger, Prescott L


    Alu elements represent one of the most common sources of homology and homeology in the human genome. Homeologous recombination between Alu elements represents a major form of genetic instability leading to deletions and duplications. Although these types of events have been studied extensively through genomic sequencing to assess the impact of Alu elements on disease mutations and genome evolution, the overall abundance of Alu elements in the genome often makes it difficult to assess the relevance of the Alu elements to specific recombination events. We recently reported a powerful new reporter gene system that allows the assessment of various cis and trans factors on the contribution of Alu elements to various forms of genetic instability. This allowed a quantitative measurement of the influence of mismatches on Alu elements and instability. It also confirmed that homeologous Alu elements are able to stimulate non-homologous end joining events in their vicinity. This appears to be dependent on portions of the mismatch repair pathway. We are now in a position to begin to unravel the complex influences of Alu density, mismatch and location with alterations of DNA repair processes in various tissues and tumors.

  11. A DNA Element Regulates Drug Tolerance and Withdrawal in Drosophila

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.


    Drug tolerance and withdrawal are insidious responses to drugs of abuse; the first increases drug consumption while the second punishes abstention. Drosophila generate functional tolerance to benzyl alcohol sedation by increasing neural expression of the slo BK-type Ca2+ activated K+ channel gene. After drug clearance this change produces a withdrawal phenotype—increased seizure susceptibility. The drug-induced histone modification profile identified the 6b element (60 nt) as a drug responsive element. Genomic deletion of 6b produces the allele, sloΔ6b, that reacts more strongly to the drug with increased induction, a massive increase in the duration of tolerance, and an increase in the withdrawal phenotype yet does not alter other slo-dependent behaviors. The 6b element is a homeostatic regulator of BK channel gene expression and is the first cis-acting DNA element shown to specifically affect the duration of a drug action. PMID:24086565

  12. Phylogeography and conservation genetics of Hygrophila pogonocalyx (Acanthaceae) based on atpB-rbcL noncoding spacer cpDNA.


    Huang, Jao-Ching; Wang, Wei-Kuang; Peng, Ching-I; Chiang, Tzen-Yuh


    Genetic variation in the atpB-rbcL intergenic spacer region of chloroplast DNA (cpDNA) was investigated in Hygrophila pogonocalyx Hayata (Acanthaceae), an endangered and endemic species in Taiwan. In this aquatic species, seed dispersal from capsules via elasticity is constrained by gravity and is thereby confined within populations, resulting in limited gene flow between populations. In this study, a total of 849 bp of the cpDNA atpB-rbcL spacer were sequenced from eight populations of H. pogonocalyx. Nucleotide diversity in the cpDNA is low (theta = 0.00343+/-0.00041). The distribution of genetic variation among populations agrees with an "isolation-by-distance" model. Two geographically correlated groups, the western and eastern regions, were identified in a neighbor-joining tree and a minimum-spanning network. Phylogeographical analyses based on the cpDNA network suggest that the present-day differentiation between western and eastern groups of H. pogonocalyx resulted from past fragmentation. The differentiation between eastern and western populations may be ascribed to isolation since the formation of the Central Mountain Range about 5 million years ago, which is consistent with the rate estimates based on a molecular clock of cpDNA.

  13. Computational identification of transcriptional regulatory elements in DNA sequence

    PubMed Central

    GuhaThakurta, Debraj


    Identification and annotation of all the functional elements in the genome, including genes and the regulatory sequences, is a fundamental challenge in genomics and computational biology. Since regulatory elements are frequently short and variable, their identification and discovery using computational algorithms is difficult. However, significant advances have been made in the computational methods for modeling and detection of DNA regulatory elements. The availability of complete genome sequence from multiple organisms, as well as mRNA profiling and high-throughput experimental methods for mapping protein-binding sites in DNA, have contributed to the development of methods that utilize these auxiliary data to inform the detection of transcriptional regulatory elements. Progress is also being made in the identification of cis-regulatory modules and higher order structures of the regulatory sequences, which is essential to the understanding of transcription regulation in the metazoan genomes. This article reviews the computational approaches for modeling and identification of genomic regulatory elements, with an emphasis on the recent developments, and current challenges. PMID:16855295

  14. A user's guide to the encyclopedia of DNA elements (ENCODE).



    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome.

  15. A User's Guide to the Encyclopedia of DNA Elements (ENCODE)

    PubMed Central


    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome. PMID:21526222

  16. Mobile DNA Elements: The Seeds of Organic Complexity on Earth.


    Habibi, Laleh; Pedram, Mehrdad; AmirPhirozy, Akbar; Bonyadi, Khadijeh


    Mobile DNA or transposable elements (TEs) are genomic sequences capable of moving themselves independently into different parts of the genome. Viral invasion of eukaryotic genomes is assumed to be the main source of TEs. Selfish transposition of these elements could be a serious threat to the host cell, as they can insert themselves into the middle of coding genes and/or induce genomic instability. In response, through millions of years of evolution, cells have come up with various mechanisms such as genomic imprinting, DNA methylation, heterochromatin formation, and RNA interference to deactivate them. Interestingly, these processes have also greatly contributed to important cellular functions involved in cell differentiation, development, and differential gene expression. Propagation of TE copies during the course of evolution have resulted in increasing the genome size and providing proper space and flexibility in shaping the genome by creating new genes and establishing essential cellular structures such as heterochromatin, centromere, and telomeres. Yet, these elements are mostly labeled for playing a role in pathogenesis of human diseases. Here, we attempt to introduce TEs as factors necessary for making us human rather than just selfish sequences or obligatory guests invading our DNA.

  17. Transposable DNA elements and life history traits: II. Transposition of P DNA elements in somatic cells reduces fitness, mating activity, and locomotion of Drosophila melanogaster.


    Woodruff, R C; Thompson, J N; Barker, J S; Huai, H


    Some transposable DNA elements in higher organisms are active in somatic cells, as well as in germinal cells. What effect does the movement of DNA elements in somatic cells have on life history traits? It has previously been reported that somatically active P and mariner elements in Drosophila induce genetic damage and significantly reduce lifespan. In this study, we report that the movement of P elements in somatic cells also significantly reduces fitness, mating activity, and locomotion of Drosophila melanogaster. If other elements cause similar changes in life history traits, it is doubtful if transposable DNA elements remain active for long in somatic cells in natural populations.

  18. An Integrated Encyclopedia of DNA Elements in the Human Genome

    PubMed Central


    Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall the project provides new insights into the organization and regulation of our genes and genome, and an expansive resource of functional annotations for biomedical research. PMID:22955616

  19. An integrated encyclopedia of DNA elements in the human genome.



    The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.

  20. Association between hypermethylation of DNA repetitive elements in white blood cell DNA and pancreatic cancer.


    Neale, Rachel E; Clark, Paul J; Fawcett, Jonathan; Fritschi, Lin; Nagler, Belinda N; Risch, Harvey A; Walters, Rhiannon J; Crawford, William J; Webb, Penelope M; Whiteman, David C; Buchanan, Daniel D


    Pancreatic cancer is a leading cause of cancer-related deaths worldwide. Methylation of DNA may influence risk or be a marker of early disease. The aim of this study was to measure the association between methylation of three DNA repetitive elements in white blood cell (WBC) DNA and pancreatic cancer. DNA from WBCs of pancreatic cancer cases (n=559) and healthy unrelated controls (n=603) were tested for methylation of the LINE-1, Alu and Sat2 DNA repetitive elements using MethyLight quantitative PCR assays. Odds ratios (ORs) and 95% confidence intervals (95%CI) between both continuous measures of percent of methylated sample compared to a reference (PMR) or quintiles of PMR and pancreatic cancer, adjusted for age, sex, smoking, BMI, alcohol and higher education, were estimated. The PMR for each of the three markers was higher in cases than in controls, although only LINE-1 was significantly associated with pancreatic cancer (OR per log unit=1.37, 95%CI=1.16-1.63). The marker methylation score for all three markers combined was significantly associated with pancreatic cancer (p-trend=0.0006). There were no associations between measures of PMR and either presence of metastases, or timing of blood collection in relation to diagnosis, surgery, chemotherapy or death (all p>0.1). We observed an association between methylation of LINE-1 in WBC DNA and risk of pancreatic cancer. Further studies are needed to confirm this association.

  1. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.


    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G


    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  2. Long non-coding RNA produced by RNA polymerase V determines boundaries of heterochromatin.


    Böhmdorfer, Gudrun; Sethuraman, Shriya; Rowley, M Jordan; Krzyszton, Michal; Rothi, M Hafiz; Bouzit, Lilia; Wierzbicki, Andrzej T


    RNA-mediated transcriptional gene silencing is a conserved process where small RNAs target transposons and other sequences for repression by establishing chromatin modifications. A central element of this process are long non-coding RNAs (lncRNA), which in Arabidopsis thaliana are produced by a specialized RNA polymerase known as Pol V. Here we show that non-coding transcription by Pol V is controlled by preexisting chromatin modifications located within the transcribed regions. Most Pol V transcripts are associated with AGO4 but are not sliced by AGO4. Pol V-dependent DNA methylation is established on both strands of DNA and is tightly restricted to Pol V-transcribed regions. This indicates that chromatin modifications are established in close proximity to Pol V. Finally, Pol V transcription is preferentially enriched on edges of silenced transposable elements, where Pol V transcribes into TEs. We propose that Pol V may play an important role in the determination of heterochromatin boundaries.

  3. Chromatin landscape dictates HSF binding to target DNA elements.


    Guertin, Michael J; Lis, John T


    Sequence-specific transcription factors (TFs) are critical for specifying patterns and levels of gene expression, but target DNA elements are not sufficient to specify TF binding in vivo. In eukaryotes, the binding of a TF is in competition with a constellation of other proteins, including histones, which package DNA into nucleosomes. We used the ChIP-seq assay to examine the genome-wide distribution of Drosophila Heat Shock Factor (HSF), a TF whose binding activity is mediated by heat shock-induced trimerization. HSF binds to 464 sites after heat shock, the vast majority of which contain HSF Sequence-binding Elements (HSEs). HSF-bound sequence motifs represent only a small fraction of the total HSEs present in the genome. ModENCODE ChIP-chip datasets, generated during non-heat shock conditions, were used to show that inducibly bound HSE motifs are associated with histone acetylation, H3K4 trimethylation, RNA Polymerase II, and coactivators, compared to HSE motifs that remain HSF-free. Furthermore, directly changing the chromatin landscape, from an inactive to an active state, permits inducible HSF binding. There is a strong correlation of bound HSEs to active chromatin marks present prior to induced HSF binding, indicating that an HSE's residence in "active" chromatin is a primary determinant of whether HSF can bind following heat shock.

  4. DNA methylation in repetitive elements and Alzheimer disease.


    Bollati, V; Galimberti, D; Pergoli, L; Dalla Valle, E; Barretta, F; Cortini, F; Scarpini, E; Bertazzi, P A; Baccarelli, A


    Epigenetics is believed to play a role in Alzheimer's disease (AD). DNA methylation, the most investigated epigenetic hallmark, is a reversible mechanism that modifies genome function and chromosomal stability through the addition of methyl groups to cytosine located in CpG dinucleotides to form 5 methylcytosine (5mC). Methylation status of repetitive elements (i.e. Alu, LINE-1 and SAT-α) is a major contributor of global DNA methylation patterns and has been investigated in relation to a variety of human diseases. However, the role of methylation of repetitive elements in blood of AD patients has never been investigated so far. In the present study, a quantitative bisulfite-PCR pyrosequencing method was used to evaluate methylation of Alu, LINE-1 and SAT-α sequences in 43 AD patients and 38 healthy donors. In multivariate analysis adjusting for age and gender, LINE-1 was increased in AD patients compared with healthy volunteers (ADs: 83.6%5mC, volunteers: 83.1%5mC, p-value: 0.05). The group with best performances in mini mental state examination (MMSE) showed higher levels of LINE-1 methylation compared to the group with worst performances (MMSE>22: 83.9%5mC; MMSE≤22: 83.2%5mC; p=0.05). Our data suggest that LINE-1 methylation may lead to a better understanding of AD pathogenesis and course, and may contribute to identify novel markers useful to assess risk stratification. Further prospective investigations are warranted to evaluate the dynamics of DNA methylation from early-stage AD to advanced phases of the disease.

  5. Mobile DNA elements in T4 and related phages

    PubMed Central


    Mobile genetic elements are common inhabitants of virtually every genome where they can exert profound influences on genome structure and function in addition to promoting their own spread within and between genomes. Phage T4 and related phage have long served as a model system for understanding the molecular mechanisms by which a certain class of mobile DNA, homing endonucleases, promote their spread. Homing endonucleases are site-specific DNA endonucleases that initiate mobility by introducing double-strand breaks at defined positions in genomes lacking the endonuclease gene, stimulating repair and recombination pathways that mobilize the endonuclease coding region. In phage T4, homing endonucleases were first discovered as encoded within the self-splicing td, nrdB and nrdD introns of T4. Genomic data has revealed that homing endonucleases are extremely widespread in T-even-like phage, as evidenced by the astounding fact that ~11% of the T4 genome encodes homing endonuclease genes, with most of them located outside of self-splicing introns. Detailed studies of the mobile td intron and its encoded endonuclease, I-TevI, have laid the foundation for genetic, biochemical and structural aspects that regulate the mobility process, and more recently have provided insights into regulation of homing endonuclease function. Here, we summarize the current state of knowledge regarding T4-encoded homing endonucleases, with particular emphasis on the td/I-TevI model system. We also discuss recent progress in the biology of free-standing endonucleases, and present areas of future research for this fascinating class of mobile genetic elements. PMID:21029434

  6. A Transposable Element within the Non-canonical Telomerase RNA of Arabidopsis thaliana Modulates Telomerase in Response to DNA Damage

    PubMed Central

    Xu, Hengyi; Nelson, Andrew D. L.; Shippen, Dorothy E.


    Long noncoding RNAs (lncRNAs) have emerged as critical factors in many biological processes, but little is known about how their regulatory functions evolved. One of the best-studied lncRNAs is TER, the essential RNA template for telomerase reverse transcriptase. We previously showed that Arabidopsis thaliana harbors three TER isoforms: TER1, TER2 and TER2S. TER1 serves as a canonical telomere template, while TER2 is a novel negative regulator of telomerase activity, induced in response to double-strand breaks (DSBs). TER2 contains a 529 nt intervening sequence that is removed along with 36 nt at the RNA 3’ terminus to generate TER2S, an RNA of unknown function. Here we investigate how A. thaliana TER2 acquired its regulatory function. Using data from the 1,001 Arabidopsis genomes project, we report that the intervening sequence within TER2 is derived from a transposable element termed DSB responsive element (DRE). DRE is found in the TER2 loci of most but not all A. thaliana accessions. By analyzing accessions with (TER2) and without DRE (TER2Δ) we demonstrate that this element is responsible for many of the unique properties of TER2, including its enhanced binding to TERT and telomerase inhibitory function. We show that DRE destabilizes TER2, and further that TER2 induction by DNA damage reflects increased RNA stability and not increased transcription. DRE-mediated changes in TER2 stability thus provide a rapid and sensitive switch to fine-tune telomerase enzyme activity. Altogether, our data shows that invasion of the TER2 locus by a small transposon converted this lncRNA into a DNA damage sensor that modulates telomerase enzyme activity in response to genome assault. PMID:26075395

  7. Viral noncoding RNAs: more surprises

    PubMed Central

    Tycowski, Kazimierz T.; Guo, Yang Eric; Lee, Nara; Moss, Walter N.; Vallery, Tenaya K.; Xie, Mingyi


    Eukaryotic cells produce several classes of long and small noncoding RNA (ncRNA). Many DNA and RNA viruses synthesize their own ncRNAs. Like their host counterparts, viral ncRNAs associate with proteins that are essential for their stability, function, or both. Diverse biological roles—including the regulation of viral replication, viral persistence, host immune evasion, and cellular transformation—have been ascribed to viral ncRNAs. In this review, we focus on the multitude of functions played by ncRNAs produced by animal viruses. We also discuss their biogenesis and mechanisms of action. PMID:25792595

  8. Mobile DNA elements in the generation of diversity and complexity in the brain.


    Erwin, Jennifer A; Marchetto, Maria C; Gage, Fred H


    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia.

  9. Mobile DNA elements in the generation of diversity and complexity in the brain

    PubMed Central

    Erwin, Jennifer A.; Marchetto, Maria C.; Gage, Fred H.


    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia. PMID:25005482

  10. DNA preservation in skeletal elements from the World Trade Center disaster: recommendations for mass fatality management.


    Mundorff, Amy Z; Bartelink, Eric J; Mar-Cash, Elaine


    The World Trade Center (WTC) victim identification effort highlights taphonomic influences on the degradation of DNA from victims of mass fatality incidents. This study uses a subset of the WTC-Human Remains Database to evaluate differential preservation of DNA by skeletal element. Recovery location, sex, and victim type (civilian, firefighter, or plane passenger) do not appear to influence DNA preservation. Results indicate that more intact elements, as well as elements encased in soft tissue, produced slightly higher identification rates than more fragmented remains. DNA identification rates by element type conform to previous findings, with higher rates generally found in denser, weight-bearing bones. However, smaller bones including patellae, metatarsals, and foot phalanges yielded rates comparable to both femora and tibiae. These elements can be easily sampled with a disposable scalpel, and thus reduce potential DNA contamination. These findings have implications for DNA sampling guidelines in future mass fatality incidents.

  11. Movable Genetic Elements: Detection of Changes in Maize DNA at the Shrunken Locus Due to the Intervention of Ds Elements

    DOE R&D Accomplishments Database

    Burr, B.; Burr, F.A.


    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  12. Movable genetic elements: detection of changes in maize DNA at the Shrunken locus due to the intervention of Ds elements

    SciTech Connect

    Burr, B.; Burr, F.A.


    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  13. In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences

    SciTech Connect

    Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.


    The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.

  14. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    SciTech Connect

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng; Kurz,Thorsten; Dubchak, Inna; Frazer, Kelly A.; Ober, Carole


    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs each inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.

  15. cis-acting translational effects of the 5' noncoding region of c-myc mRNA

    SciTech Connect

    Parkin, N.; Darveau, A.; Nicholson, R.; Sonenberg, N.


    The authors previously shown that the 5' noncoding region of mouse c-myc mRNA has a negative effect on translational efficiency in a rabbit reticulocyte Iysate. They wanted to localize and characterize the inhibitory translational element(s) in the mRNA and to study its effect in other in vitro and in vivo systems. There they report that the restrictive element is confined to a 240-nucleotide sequence of the 5' noncoding region of mouse c-myc mRNA and that this sequence acts in cis to inhibit the translation of a heterologous mRNA. In addition, they report that the cis-inhibitory effect is also exhibited in microinjected Xenopus ooctyes and wheat-germ extracts but not in HeLa cell extracts. Transfection of corresponding plasmid DNA constructs into several established cell lines did not produce the cis-inhibitory effect. A model to explain these results is presented.

  16. Mapping Fifteen Trace Elements in Human Seminal Plasma and Sperm DNA.


    Ali, Sazan; Chaspoul, Florence; Anderson, Loundou; Bergé-Lefranc, David; Achard, Vincent; Perrin, Jeanne; Gallice, Philippe; Guichaoua, Marie


    Studies suggest a relationship between semen quality and the concentration of trace elements in serum or seminal plasma. However, trace elements may be linked to DNA and capable of altering the gene expression patterns. Thus, trace element interactions with DNA may contribute to the mechanisms for a trans-generational reproductive effect. We developed an analytical method to determine the amount of trace elements bound to the sperm DNA, and to estimate their affinity for the sperm DNA by the ratio: R = Log [metal concentration in the sperm DNA/metal concentration in seminal plasma]. We then analyzed the concentrations of 15 trace elements (Al, Cd, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Ti, V, Zn, As, Sb, and Se) in the seminal plasma and the sperm DNA in 64 normal and 30 abnormal semen specimens with Inductively Coupled Plasma/Mass Spectrometry (ICP-MS). This study showed all trace elements were detected in the seminal plasma and only metals were detected in the sperm DNA. There was no correlation between the metals' concentrations in the seminal plasma and the sperm DNA. Al had the highest affinity for DNA followed by Pb and Cd. This strong affinity is consistent with the known mutagenic effects of these metals. The lowest affinity was observed for Zn and Ti. We observed a significant increase of Al linked to the sperm DNA of patients with oligozoospermia and teratozoospermia. Al's reproductive toxicity might be due to Al linked to DNA, by altering spermatogenesis and expression patterns of genes involved in the function of reproduction.

  17. Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

    SciTech Connect

    Tully, D.B.; Cidlowski, J.A. )


    Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins prior to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.

  18. A 5' Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo.


    Lu, Jiamiao; Williams, James A; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A


    We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5' UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo.

  19. Magnetic particle-based sandwich sensor with DNA-modified carbon nanotubes as recognition elements for detection of DNA hybridization.


    Hu, Po; Huang, Cheng Zhi; Li, Yuan Fang; Ling, Jian; Liu, Yu Ling; Fei, Liang Run; Xie, Jian Ping


    In this contribution, we design a visual sensor for DNA hybridization with DNA probe-modified magnetic particles (MPs) and multiwalled carbon nanotubes (MWNTs) without involving a visual recognition element such as fluorescent/chemiluminescent reagents. It was found that DNA probe-modified MWNTs, which could be dispersed in aqueous medium and have strong light scattering signals under the excitation of a light beam in the UV-vis region, could connect with DNA probe-modified MPs together in the presence of perfectly complementary target DNA and form a sandwich structure. In a magnetic field, the formed MP-MWNT species can easily be removed from the solution, resulting in a decrease of light scattering signals. Thus, a magnetic particle-based sandwich sensor could be developed to detect DNA hybridization by measuring the light scattering signals with DNA-modified MWNTs as recognition elements. Experiments showed that the DNA-modified MPs sensor could be reused at least 17 times and was stable for more than 6 months.

  20. Intrinsic characteristics of neighboring DNA modulate transposable element activity in Drosophila melanogaster.


    Esnault, Caroline; Palavesam, Azhahianambi; Pilitt, Kristina; O'Brochta, David A


    Identifying factors influencing transposable element activity is essential for understanding how these elements impact genomes and their evolution as well as for fully exploiting them as functional genomics tools and gene-therapy vectors. Using a genetics-based approach, the influence of genomic position on piggyBac mobility in Drosophila melanogaster was assessed while controlling for element structure, genetic background, and transposase concentration. The mobility of piggyBac elements varied over more than two orders of magnitude solely as a result of their locations within the genome. The influence of genomic position on element activities was independent of factors resulting in position-dependent transgene expression ("position effects"). Elements could be relocated to new genomic locations without altering their activity if ≥ 500 bp of genomic DNA originally flanking the element was also relocated. Local intrinsic factors within the neighboring DNA that determined the activity of piggyBac elements were portable not only within the genome but also when elements were moved to plasmids. The predicted bendability of the first 50 bp flanking the 5' and 3' termini of piggyBac elements could account for 60% of the variance in position-dependent activity observed among elements. These results are significant because positional influences on transposable element activities will impact patterns of accumulation of elements within genomes. Manipulating and controlling the local sequence context of piggyBac elements could be a powerful, novel way of optimizing gene vector activity.

  1. Noncoding RNAs and epigenetic mechanisms during X-chromosome inactivation.


    Gendrel, Anne-Valerie; Heard, Edith


    In mammals, the process of X-chromosome inactivation ensures equivalent levels of X-linked gene expression between males and females through the silencing of one of the two X chromosomes in female cells. The process is established early in development and is initiated by a unique locus, which produces a long noncoding RNA, Xist. The Xist transcript triggers gene silencing in cis by coating the future inactive X chromosome. It also induces a cascade of chromatin changes, including posttranslational histone modifications and DNA methylation, and leads to the stable repression of all X-linked genes throughout development and adult life. We review here recent progress in our understanding of the molecular mechanisms involved in the initiation of Xist expression, the propagation of the Xist RNA along the chromosome, and the cis-elements and trans-acting factors involved in the maintenance of the repressed state. We also describe the diverse strategies used by nonplacental mammals for X-chromosome dosage compensation and highlight the common features and differences between eutherians and metatherians, in particular regarding the involvement of long noncoding RNAs.

  2. Non-coding RNAs: An Introduction.


    Yang, Jennifer X; Rastetter, Raphael H; Wilhelm, Dagmar


    For many years the main role of RNA, it addition to the housekeeping functions of for example tRNAs and rRNAs, was believed to be a messenger between the genes encoded on the DNA and the functional units of the cell, the proteins. This changed drastically with the identification of the first small non-coding RNA, termed microRNA, some 20 years ago. This discovery opened the field of regulatory RNAs with no or little protein-coding potential. Since then many new classes of regulatory non-coding RNAs, including endogenous small interfering RNAs (endo-siRNAs), PIWI-associated RNAs (piRNAs), and long non-coding RNAs, have been identified and we have made amazing progress in elucidating their expression, biogenesis, mechanisms and mode of action, and function in many, if not all, biological processes. In this chapter we provide an introduction about the current knowledge of the main classes of non-coding RNAs, what is know about their biogenesis and mechanism of function.

  3. Structure of a Thyroid Hormone Receptor DNA-Binding Domain Homodimer Bound to an Inverted Palindrome DNA Response Element

    SciTech Connect

    Chen, Yi; Young, Matthew A.


    Thyroid hormone receptor (TR), as a member of the nuclear hormone receptor family, can recognize and bind different classes of DNA response element targets as either a monomer, a homooligomer, or a heterooligomer. We report here the first crystal structure of a homodimer TR DNA-binding domain (DBD) in complex with an inverted repeat class of thyroid response element (TRE). The structure shows a nearly symmetric structure of the TR DBD assembled on the F2 TRE where the base recognition contacts in the homodimer DNA complex are conserved relative to the previously published structure of a TR-9-cis-retinoic acid receptor heterodimer DNA complex. The new structure also reveals that the T-box region of the DBD can function as a structural hinge that enables a large degree of flexibility in the position of the C-terminal extension helix that connects the DBD to the ligand-binding domain. Although the isolated TR DBDs exist as monomers in solution, we have measured highly cooperative binding of the two TR DBD subunits onto the inverted repeat DNA sequence. This suggests that elements of the DBD can influence the specific TR oligomerization at target genes, and it is not just interactions between the ligand-binding domains that are responsible for TR oligomerization at target genes. Mutational analysis shows that intersubunit contacts at the DBD C terminus account for some, but not all, of the cooperative homodimer TR binding to the inverted repeat class TRE.

  4. Identification of a Soybean Protein That Interacts with GAGA Element Dinucleotide Repeat DNA1

    PubMed Central

    Sangwan, Indu; O'Brian, Mark R.


    Dinucleotide repeat DNA with the pattern (GA)n/(TC)n, so-called GAGA elements, control gene expression in animals, and are recognized by a specific regulatory protein. Here, a yeast one-hybrid screen was used to isolate soybean (Glycine max) cDNA encoding a GAGA-binding protein (GBP) that binds to (GA)n/(CT)n DNA. Soybean GBP was dissimilar from the GAGA factor of Drosophila melanogaster. Recombinant GBP protein did not bind to dinucleotide repeat sequences other than (GA)n/(CT)n. GBP bound to the promoter of the heme and chlorophyll synthesis gene Gsa1, which contains a GAGA element. Removal of that GAGA element abrogated binding of GBP to the promoter. Furthermore, insertion of the GAGA element to a nonspecific DNA conferred GBP-binding activity on that DNA. Thus, the GAGA element of the Gsa1 promoter is both necessary and sufficient for GBP binding. Gbp mRNA was expressed in leaves and was induced in symbiotic root nodules elicited by the bacterium Bradyrhizobium japonicum. In addition, Gbp transcripts were much higher in leaves of dark-treated etiolated plantlets than in those exposed to light for 24 h. Homologs of GBP were found in other dicots and in the monocot rice (Oryza sativa), as well. We suggest that interaction between GAGA elements and GBP-like proteins is a regulatory feature in plants. PMID:12177492

  5. BOX DNA: a novel regulatory element related to embryonal carcinoma cell differentiation.

    PubMed Central

    Kihara-Negishi, F; Tsujita, R; Negishi, Y; Ariga, H


    BOX DNA was previously isolated from the DNA sequence inserted in the enhancer B domain of mutant polyomavirus (fPyF9) DNA. We also reported that BOX DNA functioned negatively on DNA replication and transcription of another polyomavirus mutant (PyhrN2) in F9-28 cells, a subclone of mouse F9 embryonal carcinoma (EC) cells expressing the polyomavirus large T antigen. In this study, we demonstrate that BOX DNA enhances transcription from the thymidine kinase (TK) promoter in various EC cells. One or three copies of BOX DNA, linked to the bacterial chloramphenicol acetyltransferase gene under the control of the herpes simplex virus TK promoter, activated promoter activity in F9, P19, and ECA2 cells. Band shift assays using BOX DNA as a probe revealed that specific binding proteins were present in all EC cells examined; the patterns of BOX DNA-protein complexes were the same among them. A mutation introduced within BOX DNA abolished enhancer activity as well as the formation of specific DNA-protein complexes. In non-EC cells, including L and BALB/3T3 cells, the enhancer activity of BOX DNA on the TK promoter was not observed, although binding proteins specific to the sequence exist. In band shift assays, the patterns of the DNA-protein complexes of either L or BALB/3T3 cells were different from those of EC cells. Furthermore, the enhancer activity of BOX DNA decreased upon differentiation induction in all EC cells examined, of different origins and distinct differentiation ability. In parallel with the loss of enhancer activity, the binding proteins specific for BOX DNA decreased in these cells. Moreover, we cloned a genomic DNA of F9, termed BOXF1, containing BOX DNA sequence approximately 400 bp upstream from the RNA start site of the gene. BOXF1, containing a TATA-like motif and the binding elements for Sp1 and Oct in addition to BOX DNA, possessed promoter activity deduced by a BOXF1-chloramphenicol acetyltransferase construct. Deletion analyses of the construct

  6. C.U.R.R.F. (Codon Usage regarding Restriction Finder): a free Java(®)-based tool to detect potential restriction sites in both coding and non-coding DNA sequences.


    Gatter, Michael; Gatter, Thomas; Matthäus, Falk


    The synthesis of complete genes is becoming a more and more popular approach in heterologous gene expression. Reasons for this are the decreasing prices and the numerous advantages in comparison to classic molecular cloning methods. Two of these advantages are the possibility to adapt the codon usage to the host organism and the option to introduce restriction enzyme target sites of choice. C.U.R.R.F. (Codon Usage regarding Restriction Finder) is a free Java(®)-based software program which is able to detect possible restriction sites in both coding and non-coding DNA sequences by introducing multiple silent or non-silent mutations, respectively. The deviation of an alternative sequence containing a desired restriction motive from the sequence with the optimal codon usage is considered during the search of potential restriction sites in coding DNA and mRNA sequences as well as protein sequences. C.U.R.R.F is available at

  7. Evolutionary age of repetitive element subfamilies and sensitivity of DNA methylation to airborne pollutants

    PubMed Central


    Background Repetitive elements take up >40% of the human genome and can change distribution through transposition, thus generating subfamilies. Repetitive element DNA methylation has associated with several diseases and environmental exposures, including exposure to airborne pollutants. No systematic analysis has yet been conducted to examine the effects of exposures across different repetitive element subfamilies. The purpose of the study is to evaluate sensitivity of DNA methylation in differentially‒evolved LINE, Alu, and HERV subfamilies to different types of airborne pollutants. Methods We sampled a total of 120 male participants from three studies (20 high-, 20 low-exposure in each study) of steel workers exposed to metal-rich particulate matter (measured as PM10) (Study 1); gas-station attendants exposed to air benzene (Study 2); and truck drivers exposed to traffic-derived elemental carbon (Study 3). We measured methylation by bisulfite-PCR-pyrosequencing in 10 differentially‒evolved repetitive element subfamilies. Results High-exposure groups exhibited subfamily-specific methylation differences compared to low-exposure groups: L1PA2 showed lower DNA methylation in steel workers (P=0.04) and gas station attendants (P=0.03); L1Ta showed lower DNA methylation in steel workers (P=0.02); AluYb8 showed higher DNA methylation in truck drivers (P=0.05). Within each study, dose–response analyses showed subfamily-specific correlations of methylation with exposure levels. Interaction models showed that the effects of the exposures on DNA methylation were dependent on the subfamily evolutionary age, with stronger effects on older LINEs from PM10 (p‒interaction=0.003) and benzene (p‒interaction=0.04), and on younger Alus from PM10 (p-interaction=0.02). Conclusions The evolutionary age of repetitive element subfamilies determines differential susceptibility of DNA methylation to airborne pollutants. PMID:23855992

  8. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.


    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  9. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  10. A Coxiella burnetti repeated DNA element resembling a bacterial insertion sequence.

    PubMed Central

    Hoover, T A; Vodkin, M H; Williams, J C


    A DNA fragment located on the 3' side of the Coxiella burnetii htpAB operon was determined by Southern blotting to exist in approximately 19 copies in the Nine Mile I genome. The DNA sequences of this htpAB-associated repetitive element and two other independent copies were analyzed to determine the size and nature of the element. The three copies of the element were 1,450, 1,452, and 1,458 bp long, with less than 2% divergence among the three sequences. Several features characteristic of bacterial insertion sequences were discovered. These included a single significant open reading frame that would encode a 367-amino-acid polypeptide which was predicted to be highly basic, to have a DNA-binding helix-turn-helix motif, to have a leucine zipper motif, and to have homology to polypeptides found in several other bacterial insertion sequences. Identical 7-bp inverted repeats were found at the ends of all three copies of the element. However, duplications generated by many bacterial mobile elements in the recipient DNA during insertion events did not flank the inverted repeats of any of the three C. burnetii elements examined. A second pair of inverted repeats that flanked the open reading frame was also found in all three copies of the element. Most of the divergence among the three copies of the element occurred in the region between the two inverted repeat sequences in the 3' end of the element. Despite the sequence changes, all three copies of the element have retained significant dyad symmetry in this region. Images PMID:1324903

  11. Invertrons, a class of structurally and functionally related genetic elements that includes linear DNA plasmids, transposable elements, and genomes of adeno-type viruses.

    PubMed Central

    Sakaguchi, K


    Invertrons are genetic elements composed of DNA with inverted terminal repeats at both ends, covalently bonded to terminal proteins involved in the initiation of DNA replication at both their 5' termini when they exist in the cytoplasm of their host in free form. They function as viruses, linear DNA plasmids, transposable elements, and sometimes combinations of two of these properties. They differ from retroviruses and related retro-type transposons which have direct repeats on both their genomic ends and exploit RNA intermediates for replication of their DNA. A model for replication and integration of invertrons is presented, as well as a model for transposition of transposable elements. PMID:2157134

  12. TFIIIC Bound DNA Elements in Nuclear Organization and Insulation

    PubMed Central

    Kirkland, Jacob G.; Raab, Jesse R.


    tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short Interspersed Nuclear Elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer -blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vise versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. \\ PMID:23000638

  13. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    PubMed Central

    Williams, Ryan M.; Kulick, Amanda R.; Yedlapalli, Srilakshmi; Battistella, Louisa; Hajiran, Cyrus J.; Sooter, Letha J.


    Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE) specific for bromacil. We have identified one MRE with high affinity (Kd = 9.6 nM) and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device. PMID:25400940

  14. Long noncoding RNA turnover

    PubMed Central

    Yoon, Je-Hyun; Kim, Jiyoung; Gorospe, Myriam


    Most RNAs transcribed in mammalian cells lack protein-coding sequences. Among them is a vast family of long (>200 nt) noncoding (lnc)RNAs. LncRNAs can modulate cellular protein expression patterns by influencing the transcription of many genes, the post-transcriptional fate of mRNAs and ncRNAs, and the turnover and localization of proteins. Given the broad impact of lncRNAs on gene regulation, there is escalating interest in elucidating the mechanisms that govern the steady-state levels of lncRNAs. In this review, we summarize our current knowledge of the factors and mechanisms that modulate mammalian lncRNA stability. PMID:25769416

  15. DNA capture elements for rapid detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva


    DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

  16. Long non-coding RNA produced by RNA polymerase V determines boundaries of heterochromatin

    PubMed Central

    Böhmdorfer, Gudrun; Sethuraman, Shriya; Rowley, M Jordan; Krzyszton, Michal; Rothi, M Hafiz; Bouzit, Lilia; Wierzbicki, Andrzej T


    RNA-mediated transcriptional gene silencing is a conserved process where small RNAs target transposons and other sequences for repression by establishing chromatin modifications. A central element of this process are long non-coding RNAs (lncRNA), which in Arabidopsis thaliana are produced by a specialized RNA polymerase known as Pol V. Here we show that non-coding transcription by Pol V is controlled by preexisting chromatin modifications located within the transcribed regions. Most Pol V transcripts are associated with AGO4 but are not sliced by AGO4. Pol V-dependent DNA methylation is established on both strands of DNA and is tightly restricted to Pol V-transcribed regions. This indicates that chromatin modifications are established in close proximity to Pol V. Finally, Pol V transcription is preferentially enriched on edges of silenced transposable elements, where Pol V transcribes into TEs. We propose that Pol V may play an important role in the determination of heterochromatin boundaries. DOI: PMID:27779094

  17. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.


    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  18. Functional roles of non-coding Y RNAs.


    Kowalski, Madzia P; Krude, Torsten


    Non-coding RNAs are involved in a multitude of cellular processes but the biochemical function of many small non-coding RNAs remains unclear. The family of small non-coding Y RNAs is conserved in vertebrates and related RNAs are present in some prokaryotic species. Y RNAs are also homologous to the newly identified family of non-coding stem-bulge RNAs (sbRNAs) in nematodes, for which potential physiological functions are only now emerging. Y RNAs are essential for the initiation of chromosomal DNA replication in vertebrates and, when bound to the Ro60 protein, they are involved in RNA stability and cellular responses to stress in several eukaryotic and prokaryotic species. Additionally, short fragments of Y RNAs have recently been identified as abundant components in the blood and tissues of humans and other mammals, with potential diagnostic value. While the number of functional roles of Y RNAs is growing, it is becoming increasingly clear that the conserved structural domains of Y RNAs are essential for distinct cellular functions. Here, we review the biochemical functions associated with these structural RNA domains, as well as the functional conservation of Y RNAs in different species. The existing biochemical and structural evidence supports a domain model for these small non-coding RNAs that has direct implications for the modular evolution of functional non-coding RNAs.

  19. Satellite DNA-Like Elements Associated With Genes Within Euchromatin of the Beetle Tribolium castaneum

    PubMed Central

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Đurđica


    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5′ untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  20. Identification of the functional elements in the promoter region of human DNA topoisomerase IIIbeta gene.


    Cho, Young Hoon; Park, Jee Young; Han, Sang Youp; Chung, In Kwon


    In this study, we have isolated and characterized the promoter region of the human DNA topoisomerase IIIbeta (hTOP3beta) gene. The 5' RACE assay showed a short exon 1 encoding only the 35-bp untranslated region and suggested the presence of multiple transcription initiation sites. The hTOP3beta gene promoter lacks a canonical TATA box or initiation element and is moderately high in GC content. Transient expression of a luciferase reporter gene under the control of serially deleted 5'-flanking sequence identified an activator element between -141 and -119 upstream of the transcription initiation site and a second regulatory element between -91 and -71. On the basis of scanning mutations of triple nucleotides, we demonstrated that a 5'GGAACC3' element between -117 and -112 plays a critical role in the up-regulation of the basal transcription activity. Changing the 5'GGAACC3' sequence leads to markedly reduced promoter activity. Gel mobility shift assays revealed that the 5'GGAACC3' element is required for DNA binding by the transcription factor complex. These observations lead to the conclusion that the positive regulatory region including the 5'GGAACC3' core element is essential for efficient expression of the hTOP3beta gene as well as for the binding of as yet unidentified regulatory factor(s).

  1. A histone modification identifies a DNA element controlling slo BK channel gene expression in muscle

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Krishnan, Harish R.; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.


    The slo gene encodes BK type Ca2+-activated K+ channels. In Drosophila, expression of slo is induced by organic solvent sedation (benzyl alcohol and ethanol) and this increase in neural slo expression contributes to the production of functional behavioral tolerance (inducible resistance) to these drugs. Within the slo promoter region, we observed that benzyl alcohol sedation produces a localized spike of histone acetylation over a 65 n conserved DNA element called 55b. Changes in histone acetylation are commonly the consequence of transcription factor activity and previously, a localized histone acetylation spike was used to successfully map a DNA element involved in benzyl alcohol-induced slo expression. To determine whether the 55b element was also involved in benzyl alcohol-induced neural expression of slo we deleted it from the endogenous slo gene by homologous recombination. Flies lacking the 55b element were normal with respect to basal and benzyl alcohol-induced neural slo expression, the capacity to acquire and maintain functional tolerance, their threshold for electrically-induced seizures and most slo-related behaviors. Removal of the 55b element did however increase the level of basal expression from the muscle/tracheal cell-specific slo core promoter and produced a slight increase in overall locomotor activity. We conclude that the 55b element is involved in control of slo expression from the muscle and tracheal-cell promoter but is not involved in the production of functional benzyl alcohol tolerance. PMID:25967280

  2. DNA Elements Reducing Transcriptional Gene Silencing Revealed by a Novel Screening Strategy

    PubMed Central

    Ueno, Keiichiro; Ohashi, Yuko; Mitsuhara, Ichiro


    Transcriptional gene silencing (TGS)–a phenomenon observed in endogenous genes/transgenes in eukaryotes–is a huge hindrance to transgenic technology and occurs mainly when the genes involved share sequence homology in their promoter regions. TGS depends on chromosomal position, suggesting the existence of genomic elements that suppress TGS. However, no systematic approach to identify such DNA elements has yet been reported. Here, we developed a successful novel screening strategy to identify such elements (anti-silencing regions–ASRs), based on their ability to protect a flanked transgene from TGS. A silenced transgenic tobacco plant in which a subsequently introduced transgene undergoes obligatory promoter-homology dependent TGS in trans allowed the ability of DNA elements to prevent TGS to be used as the screening criterion. We also identified ASRs in a genomic library from a different plant species (Lotus japonicus: a perennial legume); the ASRs include portions of Ty1/copia retrotransposon-like and pararetrovirus-like sequences; the retrotransposon-like sequences also showed interspecies anti-TGS activity in a TGS-induction system in Arabidopsis. Anti-TGS elements could provide effective tools to reduce TGS and ensure proper regulation of transgene expression. Furthermore, the screening strategy described here will also facilitate the efficient identification of new classes of anti-TGS elements. PMID:23382937

  3. A DNA unwinding element and an ARS consensus comprise a replication origin within a yeast chromosome.

    PubMed Central

    Huang, R Y; Kowalski, D


    We have defined a replication origin, ORI305, within chromosome III of Saccharomyces cerevisiae by means of mutational analysis. cis-acting elements required for origin activity in the chromosome, as assayed by two-dimensional gel electrophoresis of replication intermediates, are the same as those required for the function of an autonomously replicating sequence, ARS305, in a plasmid. Essential elements include (i) an 11 bp sequence that is a near match to the ARS consensus and (ii) a broad sequence directly 3' to the consensus near match. Origin function is inactivated by point mutations in the essential near match sequence, suggesting that the sequence contributes to specifying the origin in the chromosome. Other consensus near matches with different sequences are present but are not required. The essential 3'-flanking sequence exhibits DNA helical instability and is sensitive to deletion mutations that stabilize the DNA helix. The wild-type 3'-flanking sequence can be functionally substituted by dissimilar sequences that also exhibit helical instability. The requirement for DNA helical instability indicates that the essential 3'-flanking sequence serves as a DNA unwinding element in the chromosome. Images PMID:8223462

  4. Hypoxic regulation of the noncoding genome and NEAT1

    PubMed Central

    Choudhry, Hani


    Activation of hypoxia pathways is both associated with and contributes to an aggressive phenotype across multiple types of solid cancers. The regulation of gene transcription by hypoxia-inducible factor (HIF) is a key element in this response. HIF directly upregulates the expression of many hundreds of protein-coding genes, which act to both improve oxygen delivery and to reduce oxygen demand. However, it is now becoming apparent that many classes of noncoding RNAs are also regulated by hypoxia, with several (e.g. micro RNAs, long noncoding RNAs and antisense RNAs) under direct transcriptional regulation by HIF. These hypoxia-regulated, noncoding RNAs may act as effectors of the indirect response to HIF by acting on specific coding transcripts or by affecting generic RNA-processing pathways. In addition, noncoding RNAs may also act as modulators of the HIF pathway, either by integrating other physiological responses or, in the case of HIF-regulated, noncoding RNAs, by providing negative or positive feedback and feedforward loops that affect upstream or downstream components of the HIF cascade. These hypoxia-regulated, noncoding transcripts play important roles in the aggressive hypoxic phenotype observed in cancer. PMID:26590207

  5. Noncoding RNAs in Cancer Immunology.


    Li, Qian; Liu, Qiang


    Cancer immunology is the study of interaction between cancer cells and immune system by the application of immunology principle and theory. With the recent approval of several new drugs targeting immune checkpoints in cancer, cancer immunology has become a very attractive field of research and is thought to be the new hope to conquer cancer. This chapter introduces the aberrant expression and function of noncoding RNAs, mainly microRNAs and long noncoding RNAs, in tumor-infiltrating immune cells, and their significance in tumor immunity. It also illustrates how noncoding RNAs are shuttled between tumor cells and immune cells in tumor microenvironments via exosomes or other microvesicles to modulate tumor immunity.

  6. Phylogenetic footprinting of non-coding RNA: hammerhead ribozyme sequences in a satellite DNA family of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae)

    PubMed Central


    Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH) ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH) region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead. PMID:20047671

  7. A brief review on the Human Encyclopedia of DNA Elements (ENCODE) project.


    Qu, Hongzhu; Fang, Xiangdong


    The ENCyclopedia Of DNA Elements (ENCODE) project is an international research consortium that aims to identify all functional elements in the human genome sequence. The second phase of the project comprised 1640 datasets from 147 different cell types, yielding a set of 30 publications across several journals. These data revealed that 80.4% of the human genome displays some functionality in at least one cell type. Many of these regulatory elements are physically associated with one another and further form a network or three-dimensional conformation to affect gene expression. These elements are also related to sequence variants associated with diseases or traits. All these findings provide us new insights into the organization and regulation of genes and genome, and serve as an expansive resource for understanding human health and disease.

  8. Selective Constraint on Noncoding Regions of Hominid Genomes

    PubMed Central


    An important challenge for human evolutionary biology is to understand the genetic basis of human–chimpanzee differences. One influential idea holds that such differences depend, to a large extent, on adaptive changes in gene expression. An important step in assessing this hypothesis involves gaining a better understanding of selective constraint on noncoding regions of hominid genomes. In noncoding sequence, functional elements are frequently small and can be separated by large nonfunctional regions. For this reason, constraint in hominid genomes is likely to be patchy. Here we use conservation in more distantly related mammals and amniotes as a way of identifying small sequence windows that are likely to be functional. We find that putatively functional noncoding elements defined in this manner are subject to significant selective constraint in hominids. PMID:16362073

  9. Selective constraint on noncoding regions of hominid genomes.


    Bush, Eliot C; Lahn, Bruce T


    An important challenge for human evolutionary biology is to understand the genetic basis of human-chimpanzee differences. One influential idea holds that such differences depend, to a large extent, on adaptive changes in gene expression. An important step in assessing this hypothesis involves gaining a better understanding of selective constraint on noncoding regions of hominid genomes. In noncoding sequence, functional elements are frequently small and can be separated by large nonfunctional regions. For this reason, constraint in hominid genomes is likely to be patchy. Here we use conservation in more distantly related mammals and amniotes as a way of identifying small sequence windows that are likely to be functional. We find that putatively functional noncoding elements defined in this manner are subject to significant selective constraint in hominids.

  10. A Land Plant-Specific Transcription Factor Directly Enhances Transcription of a Pathogenic Noncoding RNA Template by DNA-Dependent RNA Polymerase II[OPEN

    PubMed Central

    Qu, Jie; Ji, Shaoyi; Wallace, Andrew J.; Wu, Jian; Li, Yi; Gopalan, Venkat; Ding, Biao


    Some DNA-dependent RNA polymerases (DdRPs) possess RNA-dependent RNA polymerase activity, as was first discovered in the replication of Potato spindle tuber viroid (PSTVd) RNA genome in tomato (Solanum lycopersicum). Recent studies revealed that this activity in bacteria and mammals is important for transcriptional and posttranscriptional regulatory mechanisms. Here, we used PSTVd as a model to uncover auxiliary factors essential for RNA-templated transcription by DdRP. PSTVd replication in the nucleoplasm generates (−)-PSTVd intermediates and (+)-PSTVd copies. We found that the Nicotiana benthamiana canonical 9-zinc finger (ZF) Transcription Factor IIIA (TFIIIA-9ZF) as well as its variant TFIIIA-7ZF interacted with (+)-PSTVd, but only TFIIIA-7ZF interacted with (−)-PSTVd. Suppression of TFIIIA-7ZF reduced PSTVd replication, and overexpression of TFIIIA-7ZF enhanced PSTVd replication in planta. Consistent with the locale of PSTVd replication, TFIIIA-7ZF was found in the nucleoplasm and nucleolus, in contrast to the strictly nucleolar localization of TFIIIA-9ZF. Footprinting assays revealed that only TFIIIA-7ZF bound to a region of PSTVd critical for initiating transcription. Furthermore, TFIIIA-7ZF strongly enhanced the in vitro transcription of circular (+)-PSTVd by partially purified Pol II. Together, our results identify TFIIIA-7ZF as a dedicated cellular transcription factor that acts in DdRP-catalyzed RNA-templated transcription, highlighting both the extraordinary evolutionary adaptation of viroids and the potential of DdRPs for a broader role in cellular processes. PMID:27113774

  11. Long noncoding RNA and epigenomics.


    Kanduri, Chandrasekhar


    Accumulating evidence over the last decade has presented us with the intriguing observation that the majority of eukaryotic genomes are pervasively transcribed to encode a complex network of small and long noncoding RNAs. Long noncoding RNAs are of particular interest, as they were once thought to be restricted to housekeeping functions and are now linked to a wide variety of biological functions related to physiology, embryology and development. Emerging evidence indicates that a subset of long noncoding RNAs mediate their biological functions by using chromatin as a substrate, to index the genetic information encoded in the genome. This chapter will discuss how noncoding RNAs and the processes underlying their transcription mediate transcriptional regulation, by epigenetically regulating the structure of chromatin in various biological contexts.

  12. Long noncoding RNAs in hematopoiesis

    PubMed Central

    Zhang, Xu; Hu, Wenqian


    Mammalian development is under tight control to ensure precise gene expression. Recent studies reveal a new layer of regulation of gene expression mediated by long noncoding RNAs. These transcripts are longer than 200nt that do not have functional protein coding capacity. Interestingly, many of these long noncoding RNAs are expressed with high specificity in different types of cells, tissues, and developmental stages in mammals, suggesting that they may have functional roles in diverse biological processes. Here, we summarize recent findings of long noncoding RNAs in hematopoiesis, which is one of the best-characterized mammalian cell differentiation processes. Then we provide our own perspectives on future studies of long noncoding RNAs in this field. PMID:27508063

  13. Chilean Pitavia more closely related to Oceania and Old World Rutaceae than to Neotropical groups: evidence from two cpDNA non-coding regions, with a new subfamilial classification of the family

    PubMed Central

    Groppo, Milton; Kallunki, Jacquelyn A.; Pirani, José Rubens; Antonelli, Alexandre


    Abstract The position of the plant genus Pitavia within an infrafamilial phylogeny of Rutaceae (rue, or orange family) was investigated with the use of two non-coding regions from cpDNA, the trnL-trnF region and the rps16 intron. The only species of the genus, Pitavia punctata Molina, is restricted to the temperate forests of the Coastal Cordillera of Central-Southern Chile and threatened by loss of habitat. The genus traditionally has been treated as part of tribe Zanthoxyleae (subfamily Rutoideae) where it constitutes the monogeneric tribe Pitaviinae. This tribe and genus are characterized by fruits of 1 to 4 fleshy drupelets, unlike the dehiscent fruits typical of the subfamily. Fifty-five taxa of Rutaceae, representing 53 genera (nearly one-third of those in the family) and all subfamilies, tribes, and almost all subtribes of the family were included. Parsimony and Bayesian inference were used to infer the phylogeny; six taxa of Meliaceae, Sapindaceae, and Simaroubaceae, all members of Sapindales, were also used as out-groups. Results from both analyses were congruent and showed Pitavia as sister to Flindersia and Lunasia, both genera with species scattered through Australia, Philippines, Moluccas, New Guinea and the Malayan region, and phylogenetically far from other Neotropical Rutaceae, such as the Galipeinae (Galipeeae, Rutoideae) and Pteleinae (Toddalieae, former Toddalioideae). Additionally, a new circumscription of the subfamilies of Rutaceae is presented and discussed. Only two subfamilies (both monophyletic) are recognized: Cneoroideae (including Dictyolomatoideae, Spathelioideae, Cneoraceae, and Ptaeroxylaceae) and Rutoideae (including not only traditional Rutoideae but also Aurantioideae, Flindersioideae, and Toddalioideae). As a consequence, Aurantioideae (Citrus and allies) is reduced to tribal rank as Aurantieae. PMID:23717188

  14. The Contribution of Alu Elements to Mutagenic DNA Double-Strand Break Repair

    PubMed Central

    Streva, Vincent A.; DeFreece, Cecily B.; Hedges, Dale J.; Deininger, Prescott L.


    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both

  15. Prenatal exposure to mixtures of xenoestrogens and repetitive element DNA methylation changes in human placenta

    PubMed Central

    Vilahur, Nadia; Bustamante, Mariona; Byun, Hyang-Min; Fernandez, Mariana F.; Marina, Loreto Santa; Basterrechea, Mikel; Ballester, Ferran; Murcia, Mario; Tardón, Adonina; Fernández-Somoano, Ana; Estivill, Xavier; Olea, Nicolas; Sunyer, Jordi; Baccarelli, Andrea A.


    Background Prenatal exposure to endocrine disrupting compounds (EDCs) has previously shown to alter epigenetic marks. Objectives In this work we explore whether prenatal exposure to mixtures of xenoestrogens has the potential to alter the placenta epigenome, by studying DNA methylation in retrotransposons as a surrogate of global DNA methylation. Methods The biomarker Total Effective Xenoestrogen Burden (TEXB) was measured in 192 placentas from participants in the longitudinal INMA Project. DNA methylation was quantitatively assessed by bisulfite pyrosequencing on 10 different retrotransposons including 3 different long interspersed nuclear elements (LINEs), 4 short interspersed nuclear elements (SINEs) and 3 human endogenous retrovirus (HERVs). Associations were tested using linear mixed-effects regression models and sex interaction was evaluated. Results A significant sex interaction was observed for AluYb8 (p value for interaction <0.001, significant at Bonferroni corrected p-value threshold of 0.0025). Boys with the highest TEXB-alpha levels of exposure (third tertile) presented on average a decrease of 0.84% in methylation compared to those in the first tertile (p value<0.001), while no significant effects were found in girls (p value= 0.134). Conclusions Our findings suggest that boys may be more susceptible to the effect of exposure to xenoestrogens during prenatal development, producing shifts in DNA methylation of certain sensitive genomic repetitive sequences in a tissue important for fetal growth and development. PMID:24980756

  16. Nanoparticle-labeled DNA capture elements for detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Holwitt, Eric A.; Parker, Jill E.; Vivekananda, Jeevalatha; Franz, Veronica


    Aptamers, synthetic DNA capture elements (DCEs), can be made chemically or in genetically engineered bacteria. DNA capture elements are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare or terrorism agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. The probes can then be conjugated to Quantum Dots and super paramagnetic nanoparticles. The former provide intense, bleach-resistant fluorescent detection of bioagent and the latter provide a means to collect the bioagents with a magnet. The fluorescence can be detected in a flow cytometer, in a fluorescence plate reader, or with a fluorescence microscope. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. DCEs can easily distinguish Bacillus anthracis from its nearest relatives, Bacillus cereus and Bacillus thuringiensis. Development of a high through-put process is currently being investigated.

  17. The fission yeast CENP-B protein Abp1 prevents pervasive transcription of repetitive DNA elements.


    Daulny, Anne; Mejía-Ramírez, Eva; Reina, Oscar; Rosado-Lugo, Jesus; Aguilar-Arnal, Lorena; Auer, Herbert; Zaratiegui, Mikel; Azorin, Fernando


    It is well established that eukaryotic genomes are pervasively transcribed producing cryptic unstable transcripts (CUTs). However, the mechanisms regulating pervasive transcription are not well understood. Here, we report that the fission yeast CENP-B homolog Abp1 plays an important role in preventing pervasive transcription. We show that loss of abp1 results in the accumulation of CUTs, which are targeted for degradation by the exosome pathway. These CUTs originate from different types of genomic features, but the highest increase corresponds to Tf2 retrotransposons and rDNA repeats, where they map along the entire elements. In the absence of abp1, increased RNAPII-Ser5P occupancy is observed throughout the Tf2 coding region and, unexpectedly, RNAPII-Ser5P is enriched at rDNA repeats. Loss of abp1 also results in Tf2 derepression and increased nucleolus size. Altogether these results suggest that Abp1 prevents pervasive RNAPII transcription of repetitive DNA elements (i.e., Tf2 and rDNA repeats) from internal cryptic sites.

  18. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P


    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  19. LINE-1 Retrotransposable Element DNA Accumulates in HIV-1-Infected Cells

    PubMed Central

    Song, Haihan; Xu, Yang; Garrison, Keith E.; Buzdin, Anton A.; Anwar, Naveed; Hunter, Diana V.; Mujib, Shariq; Mihajlovic, Vesna; Martin, Eric; Lee, Erika; Kuciak, Monika; Raposo, Rui André Saraiva; Bozorgzad, Ardalan; Meiklejohn, Duncan A.; Ndhlovu, Lishomwa C.; Nixon, Douglas F.; Ostrowski, Mario A.


    Type 1 long-interspersed nuclear elements (L1s) are autonomous retrotransposable elements that retain the potential for activity in the human genome but are suppressed by host factors. Retrotransposition of L1s into chromosomal DNA can lead to genomic instability, whereas reverse transcription of L1 in the cytosol has the potential to activate innate immune sensors. We hypothesized that HIV-1 infection would compromise cellular control of L1 elements, resulting in the induction of retrotransposition events. Here, we show that HIV-1 infection enhances L1 retrotransposition in Jurkat cells in a Vif- and Vpr-dependent manner. In primary CD4+ cells, HIV-1 infection results in the accumulation of L1 DNA, at least the majority of which is extrachromosomal. These data expose an unrecognized interaction between HIV-1 and endogenous retrotransposable elements, which may have implications for the innate immune response to HIV-1 infection, as well as for HIV-1-induced genomic instability and cytopathicity. PMID:24089548

  20. LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells.


    Jones, R Brad; Song, Haihan; Xu, Yang; Garrison, Keith E; Buzdin, Anton A; Anwar, Naveed; Hunter, Diana V; Mujib, Shariq; Mihajlovic, Vesna; Martin, Eric; Lee, Erika; Kuciak, Monika; Raposo, Rui André Saraiva; Bozorgzad, Ardalan; Meiklejohn, Duncan A; Ndhlovu, Lishomwa C; Nixon, Douglas F; Ostrowski, Mario A


    Type 1 long-interspersed nuclear elements (L1s) are autonomous retrotransposable elements that retain the potential for activity in the human genome but are suppressed by host factors. Retrotransposition of L1s into chromosomal DNA can lead to genomic instability, whereas reverse transcription of L1 in the cytosol has the potential to activate innate immune sensors. We hypothesized that HIV-1 infection would compromise cellular control of L1 elements, resulting in the induction of retrotransposition events. Here, we show that HIV-1 infection enhances L1 retrotransposition in Jurkat cells in a Vif- and Vpr-dependent manner. In primary CD4(+) cells, HIV-1 infection results in the accumulation of L1 DNA, at least the majority of which is extrachromosomal. These data expose an unrecognized interaction between HIV-1 and endogenous retrotransposable elements, which may have implications for the innate immune response to HIV-1 infection, as well as for HIV-1-induced genomic instability and cytopathicity.

  1. Epigenomic annotation of noncoding mutations identifies mutated pathways in primary liver cancer

    PubMed Central

    Lowdon, Rebecca F.


    Evidence that noncoding mutation can result in cancer driver events is mounting. However, it is more difficult to assign molecular biological consequences to noncoding mutations than to coding mutations, and a typical cancer genome contains many more noncoding mutations than protein-coding mutations. Accordingly, parsing functional noncoding mutation signal from noise remains an important challenge. Here we use an empirical approach to identify putatively functional noncoding somatic single nucleotide variants (SNVs) from liver cancer genomes. Annotation of candidate variants by publicly available epigenome datasets finds that 40.5% of SNVs fall in regulatory elements. When assigned to specific regulatory elements, we find that the distribution of regulatory element mutation mirrors that of nonsynonymous coding mutation, where few regulatory elements are recurrently mutated in a patient population but many are singly mutated. We find potential gain-of-binding site events among candidate SNVs, suggesting a mechanism of action for these variants. When aggregating noncoding somatic mutation in promoters, we find that genes in the ERBB signaling and MAPK signaling pathways are significantly enriched for promoter mutations. Altogether, our results suggest that functional somatic SNVs in cancer are sporadic, but occasionally occur in regulatory elements and may affect phenotype by creating binding sites for transcriptional regulators. Accordingly, we propose that noncoding mutation should be formally accounted for when determining gene- and pathway-mutation burden in cancer. PMID:28333948

  2. Identification of sequence elements contributing to the intrinsic curvature of the mouse satellite DNA repeat.

    PubMed Central

    Carrera, P; Martínez-Balbás, M A; Portugal, J; Azorín, F


    In this paper, the contribution of different sequence elements to the intrisic curvature of the mouse satellite DNA repeat was investigated. This DNA fragment contains nineteen groups of three or more consecutive adenines which are only poorly phased with respect to the helical repeat. The mouse satellite DNA repeat shows a sinusoidal pattern of cleavage by the hydroxyl radical; the waves of reactivity are phased with respect to the A-tracts. Some interesting observations arise from a detailed analysis of these cleavage patterns: a) the maxima of hydroxyl radical cleavage are more periodically spaced along the DNA sequence than the A-tracts themselves. As a consequence, the position of each maximum with respect to the A-tract is variable; b) the sequence 5' TGGAATATG/AA 3' shows a sinusoidal pattern of hydroxyl radical cleavage. This sequence shows a retarded migration in polyacrylamide gels indicating that it is actually intrinsically curved. These results are discussed in view of the current models for DNA curvature. Images PMID:1658737

  3. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    SciTech Connect

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.


    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  4. Effects of trace elements and pesticides on dephosphorylation of RNA and DNA added to soils

    SciTech Connect

    Frankenberger, W.T. Jr.; Johanson, J.B.; Lund L.J.


    This study was carried out to assess the effects of 14 trace elements, 12 herbicides, and two fungicides on dephosphorylation of yeast ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) added to soils (Xerollic Calciorthids and Typic Haploxeralfs). The cumulative amount of ortho phosphate (Pi) released from nucleic acids increased linearly with time of incubation (up to 72 h), decreased with profile depth, and was highly influenced by soil pH. When trace elements were applied and compared by using 2.5 mmol kg/sup -1/ of soil, the average inhibition in dephosphorylation of RNA and DNA in two soils ranged from 17% with Co(II) to 52% with Cu(II). The most effective inhibitors of nucleic acid dephosphorylation were Ag(I), Cu(I), Cd(II), Cu(II), Mn(II), Ni(II), and Pb(II) (avg inhibition greater than or equal to 35%). Other elements that inhibited dephosphorylation of RNA and DNA added to soils included Ba(II), Co(II), Hg(II), Zn(II), Ti(IV), V(IV), and W(VI). When the pesticides were compared by using 5 mg of active ingredient kg/sup -1/ of soil, the average inhibition in nucleic acid dephosphorylation ranged from 14% with butylate to 39% with chloramben. The most effective inhibitors (> 25%) were atrazine, naptalam, chloramben, dicamba, trifluralin, and maneb. Other pesticides that inhibited RNA and DNA dephosphorylation in soils included cyanazine, 2,4-D, dinitroamine, EPTC plus R-25788, alachlor, paraquat, butylate, and captan.

  5. The development of non-coding RNA ontology

    PubMed Central

    Eilbeck, Karen; Smith, Barry; Blake, Judith A.; Dou, Dejing; Huang, Weili; Natale, Darren A.; Ruttenberg, Alan; Huan, Jun; Zimmermann, Michael T.; Jiang, Guoqian; Lin, Yu; Wu, Bin; Strachan, Harrison J.; de Silva, Nisansa; Kasukurthi, Mohan Vamsi; Jha, Vikash Kumar; He, Yongqun; Zhang, Shaojie; Wang, Xiaowei; Liu, Zixing; Borchert, Glen M.; Tan, Ming


    Identification of non-coding RNAs (ncRNAs) has been significantly improved over the past decade. On the other hand, semantic annotation of ncRNA data is facing critical challenges due to the lack of a comprehensive ontology to serve as common data elements and data exchange standards in the field. We developed the Non-Coding RNA Ontology (NCRO) to handle this situation. By providing a formally defined ncRNA controlled vocabulary, the NCRO aims to fill a specific and highly needed niche in semantic annotation of large amounts of ncRNA biological and clinical data. PMID:27990175

  6. Menin and JunD regulate gastrin gene expression through proximal DNA elements.


    Mensah-Osman, Edith J; Veniaminova, Natalia A; Merchant, Juanita L


    Mutations in the MEN1 gene correlate with multiple endocrine neoplasia I (MEN1). Gastrinomas are the most malignant of the neuroendocrine tumors associated with MEN1. Because menin and JunD proteins interact, we examined whether JunD binds to and regulates the gastrin gene promoter. Both menin and JunD are ubiquitous nuclear proteins that we showed colocalize in the gastrin-expressing G cells of the mouse antrum. Transfection with a JunD expression vector alone induced endogenous gastrin mRNA in AGS human gastric cells, and the induction was blocked by menin overexpression. We mapped repression by menin to both a nonconsensus AP-1 site and proximal GC-rich elements within the human gastrin promoter. Chromatin immunoprecipitation assays, EMSAs, and DNA affinity precipitation assays documented that JunD and Sp1 proteins bind these two elements and are both targets for menin regulation. Consistent with menin forming a complex with histone deacetylases, we found that repression of gastrin gene expression by menin was reversed by trichostatin A. In conclusion, proximal DNA elements within the human gastrin gene promoter mediate interactions between JunD, which induces gastrin gene expression and menin, which suppresses JunD-mediated activation.

  7. Nucleosomal signatures impose nucleosome positioning in coding and noncoding sequences in the genome

    PubMed Central

    González, Sara; García, Alicia; Vázquez, Enrique; Serrano, Rebeca; Sánchez, Mar; Quintales, Luis; Antequera, Francisco


    In the yeast genome, a large proportion of nucleosomes occupy well-defined and stable positions. While the contribution of chromatin remodelers and DNA binding proteins to maintain this organization is well established, the relevance of the DNA sequence to nucleosome positioning in the genome remains controversial. Through quantitative analysis of nucleosome positioning, we show that sequence changes distort the nucleosomal pattern at the level of individual nucleosomes in three species of Schizosaccharomyces and in Saccharomyces cerevisiae. This effect is equally detected in transcribed and nontranscribed regions, suggesting the existence of sequence elements that contribute to positioning. To identify such elements, we incorporated information from nucleosomal signatures into artificial synthetic DNA molecules and found that they generated regular nucleosomal arrays indistinguishable from those of endogenous sequences. Strikingly, this information is species-specific and can be combined with coding information through the use of synonymous codons such that genes from one species can be engineered to adopt the nucleosomal organization of another. These findings open the possibility of designing coding and noncoding DNA molecules capable of directing their own nucleosomal organization. PMID:27662899

  8. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine

    PubMed Central

    Williams, Ryan M.; Crihfield, Cassandra L.; Gattu, Srikanth; Holland, Lisa A.; Sooter, Letha J.


    Widespread use of the chlorotriazine herbicide, atrazine, has led to serious environmental and human health consequences. Current methods of detecting atrazine contamination are neither rapid nor cost-effective. In this work, atrazine-specific single-stranded DNA (ssDNA) molecular recognition elements (MRE) were isolated. We utilized a stringent Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology that placed the greatest emphasis on what the MRE should not bind to. After twelve rounds of SELEX, an atrazine-specific MRE with high affinity was obtained. The equilibrium dissociation constant (Kd) of the ssDNA sequence is 0.62 ± 0.21 nM. It also has significant selectivity for atrazine over atrazine metabolites and other pesticides found in environmentally similar locations and concentrations. Furthermore, we have detected environmentally relevant atrazine concentrations in river water using this MRE. The strong affinity and selectivity of the selected atrazine-specific ssDNA validated the stringent SELEX methodology and identified a MRE that will be useful for rapid atrazine detection in environmental samples. PMID:25196435

  9. Gene regulation by noncoding RNAs

    PubMed Central

    Patil, Veena S.; Zhou, Rui; Rana, Tariq M.


    The past two decades have seen an explosion in research on noncoding RNAs and their physiological and pathological functions. Several classes of small (20–30 nucleotides) and long (>200 nucleotides) noncoding RNAs have been firmly established as key regulators of gene expression in myriad processes ranging from embryonic development to innate immunity. In this review, we focus on our current understanding of the molecular mechanisms underlying the biogenesis and function of small interfering RNAs (siRNAs), microRNAs (miRNAs), and Piwi-interacting RNAs (piRNAs). In addition, we briefly review the relevance of small and long noncoding RNAs to human physiology and pathology and their potential to be exploited as therapeutic agents. PMID:24164576

  10. DANIO-CODE: Toward an Encyclopedia of DNA Elements in Zebrafish.


    Tan, Haihan; Onichtchouk, Daria; Winata, Cecilia


    The zebrafish has emerged as a model organism for genomics studies. The symposium "Toward an encyclopedia of DNA elements in zebrafish" held in London in December 2014, was coorganized by Ferenc Müller and Fiona Wardle. This meeting is a follow-up of a similar previous workshop held 2 years earlier and represents a push toward the formalization of a community effort to annotate functional elements in the zebrafish genome. The meeting brought together zebrafish researchers, bioinformaticians, as well as members of established consortia, to exchange scientific findings and experience, as well as to discuss the initial steps toward the formation of a DANIO-CODE consortium. In this study, we provide the latest updates on the current progress of the consortium's efforts, opening up a broad invitation to researchers to join in and contribute to DANIO-CODE.

  11. DANIO-CODE: Toward an Encyclopedia of DNA Elements in Zebrafish

    PubMed Central


    Abstract The zebrafish has emerged as a model organism for genomics studies. The symposium “Toward an encyclopedia of DNA elements in zebrafish” held in London in December 2014, was coorganized by Ferenc Müller and Fiona Wardle. This meeting is a follow-up of a similar previous workshop held 2 years earlier and represents a push toward the formalization of a community effort to annotate functional elements in the zebrafish genome. The meeting brought together zebrafish researchers, bioinformaticians, as well as members of established consortia, to exchange scientific findings and experience, as well as to discuss the initial steps toward the formation of a DANIO-CODE consortium. In this study, we provide the latest updates on the current progress of the consortium's efforts, opening up a broad invitation to researchers to join in and contribute to DANIO-CODE. PMID:26671609

  12. Using FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) to isolate active regulatory DNA

    PubMed Central

    Simon, Jeremy M.; Giresi, Paul G.; Davis, Ian J.; Lieb, Jason D.


    Eviction or destabilization of nucleosomes from chromatin is a hallmark of functional regulatory elements of the eukaryotic genome. Historically identified by nuclease hypersensitivity, these regulatory elements are typically bound by transcription factors or other regulatory proteins. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) is an alternative approach to identify these genomic regions and has proven successful in a multitude of eukaryotic cell and tissue types. Cells or dissociated tissues are crosslinked briefly with formaldehyde, lysed, and sonicated. Sheared chromatin is subjected to phenol-chloroform extraction and the isolated DNA, typically encompassing 1–3% of the human genome, is purified. We provide guidelines for quantitative analysis by PCR, microarrays, or next-generation sequencing. Regulatory elements enriched by FAIRE display high concordance with those identified by nuclease hypersensitivity or ChIP, and the entire procedure can be completed in three days. FAIRE exhibits low technical variability, which allows its use in large-scale studies of chromatin from normal or diseased tissues. PMID:22262007

  13. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.


    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  14. Noncoding RNAs in endocrine malignancy.


    Kentwell, Jessica; Gundara, Justin S; Sidhu, Stan B


    Only recently has it been uncovered that the mammalian transcriptome includes a large number of noncoding RNAs (ncRNAs) that play a variety of important regulatory roles in gene expression and other biological processes. Among numerous kinds of ncRNAs, short noncoding RNAs, such as microRNAs, have been extensively investigated with regard to their biogenesis, function, and importance in carcinogenesis. Long noncoding RNAs (lncRNAs) have only recently been implicated in playing a key regulatory role in cancer biology. The deregulation of ncRNAs has been demonstrated to have important roles in the regulation and progression of cancer development. In this review, we describe the roles of both short noncoding RNAs (including microRNAs, small nuclear RNAs, and piwi-interacting RNAs) and lncRNAs in carcinogenesis and outline the possible underlying genetic mechanisms, with particular emphasis on clinical applications. The focus of our review includes studies from the literature on ncRNAs in traditional endocrine-related cancers, including thyroid, parathyroid, adrenal gland, and gastrointestinal neuroendocrine malignancies. The current and potential future applications of ncRNAs in clinical cancer research is also discussed, with emphasis on diagnosis and future treatment.

  15. Chemical Elemental Distribution and Soil DNA Fingerprints Provide the Critical Evidence in Murder Case Investigation

    PubMed Central

    Concheri, Giuseppe; Bertoldi, Daniela; Polone, Elisa; Otto, Stefan; Larcher, Roberto; Squartini, Andrea


    Background The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. Methodology/Principal Findings The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a) elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS) and optical emission spectrometry (ICP-OES) approaches, and b) amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA). Conclusions Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping. PMID:21674041

  16. Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.


    Kijima, T E; Innan, Hideki


    A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

  17. Integrated genome analysis suggests that most conserved non-coding sequences are regulatory factor binding sites

    PubMed Central

    Hemberg, Martin; Gray, Jesse M.; Cloonan, Nicole; Kuersten, Scott; Grimmond, Sean; Greenberg, Michael E.; Kreiman, Gabriel


    More than 98% of a typical vertebrate genome does not code for proteins. Although non-coding regions are sprinkled with short (<200 bp) islands of evolutionarily conserved sequences, the function of most of these unannotated conserved islands remains unknown. One possibility is that unannotated conserved islands could encode non-coding RNAs (ncRNAs); alternatively, unannotated conserved islands could serve as promoter-distal regulatory factor binding sites (RFBSs) like enhancers. Here we assess these possibilities by comparing unannotated conserved islands in the human and mouse genomes to transcribed regions and to RFBSs, relying on a detailed case study of one human and one mouse cell type. We define transcribed regions by applying a novel transcript-calling algorithm to RNA-Seq data obtained from total cellular RNA, and we define RFBSs using ChIP-Seq and DNAse-hypersensitivity assays. We find that unannotated conserved islands are four times more likely to coincide with RFBSs than with unannotated ncRNAs. Thousands of conserved RFBSs can be categorized as insulators based on the presence of CTCF or as enhancers based on the presence of p300/CBP and H3K4me1. While many unannotated conserved RFBSs are transcriptionally active to some extent, the transcripts produced tend to be unspliced, non-polyadenylated and expressed at levels 10 to 100-fold lower than annotated coding or ncRNAs. Extending these findings across multiple cell types and tissues, we propose that most conserved non-coding genomic DNA in vertebrate genomes corresponds to promoter-distal regulatory elements. PMID:22684627

  18. Structural optimization for heat detection of DNA thermosequencing platform using finite element analysis

    PubMed Central

    Esfandyarpour, Hesaam; Zheng, Bo; Pease, R. Fabian W.; Davis, Ronald W.


    For the past three decades, Sanger’s method has been the primary DNA sequencing technology; however, inherent limitations in cost and complexity have limited its usage in personalized medicine and ecological studies. A new technology called “thermosequencing” can potentially reduce both the cost and complexity of DNA sequencing by using a microfluidic platform [Esfandyarpour, Pease, and Davis, J. Vac. Sci. Technol. B26, 661 (2008)]. To optimize the efficiency of the technology, finite element analysis was used to model the thermosequencing system by simulating the DNA incorporation reaction series and the resulting product concentration and heat production. Different models of the thermosequencing platform were created to simulate the effects of the materials surrounding the system, to optimize the geometry of the system, and to concentrate reaction heat into specific regions for detection in the real system. The resulting concentrations of reaction products were used to calibrate the reaction speed and to design the heat sensors in the thermosequencing technology. We recommend a modified gated structure for the microfluidic detection platform by using control valves and show how this new platform could dramatically improve the detection efficiency. PMID:19693405

  19. Long noncoding RNA in hematopoiesis and immunity.


    Satpathy, Ansuman T; Chang, Howard Y


    Dynamic gene expression during cellular differentiation is tightly coordinated by transcriptional and post-transcriptional mechanisms. An emerging theme is the central role of long noncoding RNAs (lncRNAs) in the regulation of this specificity. Recent advances demonstrate that lncRNAs are expressed in a lineage-specific manner and control the development of several cell types in the hematopoietic system. Moreover, specific lncRNAs are induced to modulate innate and adaptive immune responses. lncRNAs can function via RNA-DNA, RNA-RNA, and RNA-protein target interactions. As a result, they affect several stages of gene regulation, including chromatin modification, mRNA biogenesis, and protein signaling. We discuss recent advances, future prospects, and challenges in understanding the roles of lncRNAs in immunity and immune-mediated diseases.

  20. Effect of Regulatory Element DNA Methylation on Tissue-Type Plasminogen Activator Gene Expression

    PubMed Central

    Rivier-Cordey, Anne-Sophie; Caetano, Carlos; Fish, Richard J.; Kruithof, Egbert K. O.


    Expression of the tissue-type plasminogen activator gene (t-PA; gene name PLAT) is regulated, in part, by epigenetic mechanisms. We investigated the relationship between PLAT methylation and PLAT expression in five primary human cell types and six transformed cell lines. CpG methylation was analyzed in the proximal PLAT gene promoter and near the multihormone responsive enhancer (MHRE) -7.3 kilobase pairs upstream of the PLAT transcriptional start site (TSS, -7.3 kb). In Bowes melanoma cells, the PLAT promoter and the MHRE were fully unmethylated and t-PA secretion was extremely high. In other cell types the region from -647 to -366 was fully methylated, whereas an unmethylated stretch of DNA from -121 to +94 was required but not sufficient for detectable t-PA mRNA and t-PA secretion. DNA methylation near the MHRE was not correlated with t-PA secretion. Specific methylation of the PLAT promoter region -151 to +151, inserted into a firefly luciferase reporter gene, abolished reporter gene activity. The region -121 to + 94 contains two well-described regulatory elements, a PMA-responsive element (CRE) near -106 and a GC-rich region containing an Sp1 binding site near +59. Methylation of double-stranded DNA oligonucleotides containing the CRE or the GC-rich region had little or no effect on transcription factor binding. Methylated CpGs may attract co-repressor complexes that contain histone deacetylases (HDAC). However, reporter gene activity of methylated plasmids was not restored by the HDAC inhibitor trichostatin. In conclusion, efficient PLAT gene expression requires a short stretch of unmethylated CpG sites in the proximal promoter. PMID:27973546

  1. The plasmid replicon of EBV consists of multiple cis-acting elements that facilitate DNA synthesis by the cell and a viral maintenance element.

    PubMed Central

    Aiyar, A; Tyree, C; Sugden, B


    Plasmids containing oriP, the plasmid origin of Epstein-Barr virus (EBV), are replicated stably in human cells that express a single viral trans-acting factor, EBNA-1. Unlike plasmids of other viruses, but akin to human chromosomes, oriP plasmids are synthesized once per cell cycle, and are partitioned faithfully to daughter cells during mitosis. Although EBNA-1 binds multiple sites within oriP, its role in DNA synthesis and partitioning has been obscure. EBNA-1 lacks enzymatic activities that are present in the origin-binding proteins of other mammalian viruses, and does not interact with human cellular proteins that provide equivalent enzymatic functions. We demonstrate that plasmids with oriP or its constituent elements are synthesized efficiently in human cells in the absence of EBNA-1. Further, we show that human cells rapidly eliminate or destroy newly synthesized plasmids, and that both EBNA-1 and the family of repeats of oriP are required for oriP plasmids to escape this catastrophic loss. These findings indicate that EBV's plasmid replicon consists of genetic elements with distinct functions, multiple cis-acting elements that facilitate DNA synthesis and viral cis/trans elements that permit retention of replicated DNA in daughter cells. They also explain historical failures to identify mammalian origins of DNA synthesis as autonomously replicating sequences. PMID:9799247

  2. GAGA factor binding to DNA via a single trinucleotide sequence element.

    PubMed Central

    Wilkins, R C; Lis, J T


    GAGA transcription factor (GAF) is an essential protein in Drosophila , important for the transcriptional regulation of numerous genes. GAF binds to GA repeats in the promoters of these genes via a DNA-binding domain containing a single zinc finger. While GAF binding sites are typically composed of 3.5 GA repeats, the Drosophila hsp70 gene contains much smaller elements, some of which are as little as three bases (GAG) in length. Interestingly, the binding of GAF to more distant trinucleotide elements is relatively strong and not appreciably affected by the removal of larger GA arrays in the promoter. Moreover, a simple synthetic GAG sequence is sufficient to bind GAF in vitro . Here we directly compare the affinity of GAF for different sequence elements by immunoprecipitation and gel mobility shift analysis. Furthermore, our measures of the concentration of GAF in vivo indicate that it is a highly abundant nuclear protein, prevalent enough to occupy a sizable fraction of correspondingly abundant trinucleotide sites. PMID:9592153

  3. Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes

    PubMed Central

    Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady


    Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. PMID:28057732

  4. Positive and negative regulatory elements in the dnaA-dnaN-recF operon of Escherichia coli.


    Pérez-Roger, I; García-Sogo, M; Navarro-Aviñó, J P; López-Acedo, C; Macián, F; Armengod, M E


    The recF gene of E coli lies within a cluster of genes which play essential roles in DNA replication; the gene order is dnaA dnaN recF gyrB. Each of these genes has its own promoters which, with the exception of dnaA promoters, reside entirely within the translated region of the respective preceding gene. In this report, we analyze the effect of the dnaA and dnaN promoters on recF expression by translational fusions between recF and the lacZ reporter gene. Our results indicate that recF is a distal gene of the dnaA operon, and support the previous proposal that dnaN and recF constitute a transcriptional unit under control of the dnaN promoters. They also suggest that dnaA, dnaN and recF are predominantly expressed from the same mRNA although transcriptional and/or post-transcriptional mechanisms should be specifically involved in lowering expression of the recF gene. Recently, we have localized 3 tandem transcription termination sites in the second half of the dnaN gene, downstream from the recF promoters. Neither of them shows the typical features of simple terminators and apparently they do not work in a minimal system of in vitro transcription. In this report, we present evidence that only one of them is dependent on the Rho protein. Although the operon structure allows coordinate expression of dnaA, dnaN and recF, the presence of internal promoters (the dnaN and recF promoters), which appear to be inducible by DNA damage, and intracistronic terminators, whose activity is inversely proportional to the efficiency of translation, permits expression of individual genes to be independently regulated in response to altered growth conditions.

  5. Noncoding RNA gas5 is a growth arrest- and starvation-associated repressor of the glucocorticoid receptor.


    Kino, Tomoshige; Hurt, Darrell E; Ichijo, Takamasa; Nader, Nancy; Chrousos, George P


    The availability of nutrients influences cellular growth and survival by affecting gene transcription. Glucocorticoids also influence gene transcription and have diverse activities on cell growth, energy expenditure, and survival. We found that the growth arrest-specific 5 (Gas5) noncoding RNA, which is abundant in cells whose growth has been arrested because of lack of nutrients or growth factors, sensitized cells to apoptosis by suppressing glucocorticoid-mediated induction of several responsive genes, including the one encoding cellular inhibitor of apoptosis 2. Gas5 bound to the DNA-binding domain of the glucocorticoid receptor (GR) by acting as a decoy glucocorticoid response element (GRE), thus competing with DNA GREs for binding to the GR. We conclude that Gas5 is a "riborepressor" of the GR, influencing cell survival and metabolic activities during starvation by modulating the transcriptional activity of the GR.

  6. Crystal structure of a DNA aptamer bound to PvLDH elucidates novel single-stranded DNA structural elements for folding and recognition

    PubMed Central

    Choi, Sung-Jin; Ban, Changill


    Structural elements are key elements for understanding single-stranded nucleic acid folding. Although various RNA structural elements have been documented, structural elements of single-stranded DNA (ssDNA) have rarely been reported. Herein, we determined a crystal structure of PvLDH in complex with a DNA aptamer called pL1. This aptamer folds into a hairpin-bulge contact by adopting three novel structural elements, viz, DNA T-loop-like motif, base–phosphate zipper, and DNA G·G metal ion zipper. Moreover, the pL1:PvLDH complex shows unique properties compared with other protein:nucleic acid complexes. Generally, extensive intermolecular hydrogen bonds occur between unpaired nucleotides and proteins for specific recognitions. Although most protein-interacting nucleotides of pL1 are unpaired nucleotides, pL1 recognizes PvLDH by predominant shape complementarity with many bridging water molecules owing to the combination of three novel structural elements making protein-binding unpaired nucleotides stable. Moreover, the additional set of Plasmodium LDH residues which were shown to form extensive hydrogen bonds with unpaired nucleotides of 2008s does not participate in the recognition of pL1. Superimposition of the pL1:PvLDH complex with hLDH reveals steric clashes between pL1 and hLDH in contrast with no steric clashes between 2008s and hLDH. Therefore, specific protein recognition mode of pL1 is totally different from that of 2008s. PMID:27725738

  7. The role of the largest RNA polymerase subunit lid element in preventing the formation of extended RNA-DNA hybrid.


    Naryshkina, Tatyana; Kuznedelov, Konstantin; Severinov, Konstantin


    Analysis of multi-subunit RNA polymerase (RNAP) structures revealed several distinct elements that may perform partial functions of the enzyme. One such element, the "lid", is formed by an evolutionarily conserved segment of the RNAP largest subunit (beta' in bacterial RNAP). The beta' lid contacts the nascent RNA at the upstream edge of the RNA-DNA hybrid, where the RNA gets separated from the DNA template-strand and double-stranded upstream DNA is formed. To test the beta' lid functions, we generated bacterial RNAP lacking the lid and studied the mutant enzyme's properties in vitro. Our results demonstrate that removal of the lid has minimal consequences on transcription elongation from double-stranded DNA. On single-stranded DNA, the mutant RNAP generates full-sized transcripts that remain annealed to the DNA throughout their length. In contrast, the wild-type enzyme produces short, 18-22 nucleotide transcripts that remain part of the transcription complex but cannot be further elongated. The cessation of transcription is apparently triggered by a clash between the lid and the nascent RNA 5' end. The results show that the lid's function is redundant in the presence of the non-template DNA strand, which alone can control the proper geometry of nucleic acids at the upstream edge of the transcription complex. Structural considerations suggest that in the absence of the non-template strand and the lid, a new channel opens within the RNAP molecule that allows continuous DNA-RNA hybrid to exit RNAP.

  8. A Collection of Conserved Noncoding Sequences to Study Gene Regulation in Flowering Plants1[OPEN

    PubMed Central


    Transcription factors (TFs) regulate gene expression by binding cis-regulatory elements, of which the identification remains an ongoing challenge owing to the prevalence of large numbers of nonfunctional TF binding sites. Powerful comparative genomics methods, such as phylogenetic footprinting, can be used for the detection of conserved noncoding sequences (CNSs), which are functionally constrained and can greatly help in reducing the number of false-positive elements. In this study, we applied a phylogenetic footprinting approach for the identification of CNSs in 10 dicot plants, yielding 1,032,291 CNSs associated with 243,187 genes. To annotate CNSs with TF binding sites, we made use of binding site information for 642 TFs originating from 35 TF families in Arabidopsis (Arabidopsis thaliana). In three species, the identified CNSs were evaluated using TF chromatin immunoprecipitation sequencing data, resulting in significant overlap for the majority of data sets. To identify ultraconserved CNSs, we included genomes of additional plant families and identified 715 binding sites for 501 genes conserved in dicots, monocots, mosses, and green algae. Additionally, we found that genes that are part of conserved mini-regulons have a higher coherence in their expression profile than other divergent gene pairs. All identified CNSs were integrated in the PLAZA 3.0 Dicots comparative genomics platform ( together with new functionalities facilitating the exploration of conserved cis-regulatory elements and their associated genes. The availability of this data set in a user-friendly platform enables the exploration of functional noncoding DNA to study gene regulation in a variety of plant species, including crops. PMID:27261064

  9. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  10. Repetitive genomic elements and overall DNA methylation changes in acute myeloid and childhood B-cell lymphoblastic leukemia patients.


    Bujko, Mateusz; Musialik, Ewa; Olbromski, Rafał; Przestrzelska, Marta; Libura, Marta; Pastwińska, Anna; Juszczyński, Przemysław; Zwierzchowski, Lech; Baranowski, Paweł; Siedlecki, Janusz Aleksander


    Aberrant epigenetic regulation is a hallmark of neoplastic cells. Increased DNA methylation of individual genes' promoter regions and decreases in overall DNA methylation level are both generally observed in cancer. In solid tumors, this global DNA hypomethylation is related to reduced methylation of repeated DNA elements (REs) and contributes to genome instability. The aim of the present study was to assess methylation level of LINE-1 and ALU REs and total 5-methylcytosine (5metC) content in adult acute myeloid leukemia (AML) (n = 58), childhood B-cell acute lymphoblastic leukemia (ALL) (n = 32), as the most frequent acute leukemias in two age categories and in normal adult bone marrow and children's blood samples. DNA pyrosequencing and ELISA assays were used, respectively. Global DNA hypomethylation was not observed in leukemia patients. Results revealed higher DNA methylation of LINE-1 in AML and ALL samples compared to corresponding normal controls. Elevated methylation of ALU and overall 5metC level were also observed in B-cell ALL patients. Differences of REs and global DNA methylation between AML cytogenetic-risk groups were observed, with the lowest methylation levels in intermediate-risk/cytogenetically normal patients. B-cell ALL is characterized by the highest DNA methylation level compared to AML and controls and overall DNA methylation is correlated with leukocyte count.

  11. Proteins and DNA elements essential for the CRISPR adaptation process in Escherichia coli.


    Yosef, Ido; Goren, Moran G; Qimron, Udi


    The clustered regularly interspaced short palindromic repeats and their associated proteins (CRISPR/Cas) constitute a recently identified prokaryotic defense mechanism against invading nucleic acids. Activity of the CRISPR/Cas system comprises of three steps: (i) insertion of alien DNA sequences into the CRISPR array to prevent future attacks, in a process called 'adaptation', (ii) expression of the relevant proteins, as well as expression and processing of the array, followed by (iii) RNA-mediated interference with the alien nucleic acid. Here we describe a robust assay in Escherichia coli to explore the hitherto least-studied process, adaptation. We identify essential genes and DNA elements in the leader sequence and in the array which are essential for the adaptation step. We also provide mechanistic insights on the insertion of the repeat-spacer unit by showing that the first repeat serves as the template for the newly inserted repeat. Taken together, our results elucidate fundamental steps in the adaptation process of the CRISPR/Cas system.

  12. A novel transcriptional element in circular DNA monomers of the duck hepatitis B virus.

    PubMed Central

    Beckel-Mitchener, A; Summers, J


    We report the presence of two elements, pet and net, that are required for proper transcription of the duck hepatitis B virus (DHBV). These regions were previously identified by using plasmid clones of the virus in transient expression assays (M. Huang and J. Summers, J. Virol. 68:1564-1572, 1994). In this study, we further analyzed these regions by using in vitro-synthesized circular DHBV DNA monomers to mimic the authentic transcriptional template. We observed that pet was required for pregenome transcription from circular viral monomers, and in the absence of pet-dependent transcription, expression of the viral envelope genes was increased. We found that deletion of net in circularized DNA monomers led to the production of abnormally long transcripts due to a failure to form 3' ends during transcription. In addition, we report the presence of a net-like region in the mammalian hepadnavirus woodchuck hepatitis virus. These results are consistent with a model that net is a region involved in transcription termination and that in DHBV, pet is required for transcription complexes to read through this region during the first pass through net. PMID:9311882

  13. Repetitive element DNA methylation levels in white blood cell DNA from sisters discordant for breast cancer from the New York site of the Breast Cancer Family Registry.


    Wu, Hui-Chen; Delgado-Cruzata, Lissette; Flom, Julie D; Perrin, Mary; Liao, Yuyan; Ferris, Jennifer S; Santella, Regina M; Terry, Mary Beth


    Global decreases in DNA methylation, particularly in repetitive elements, have been associated with genomic instability and human cancer. Emerging, though limited, data suggest that in white blood cell (WBC) DNA levels of methylation, overall or in repetitive elements, may be associated with cancer risk. We measured methylation levels of three repetitive elements [Satellite 2 (Sat2)], long interspersed nuclear element-1 (LINE-1) and Alu) by MethyLight, and LINE-1 by pyrosequencing in a total of 282 breast cancer cases and 347 unaffected sisters from the New York site of the Breast Cancer Family Registry (BCFR) using DNA from both granulocytes and total WBC. We found that methylation levels in all markers were correlated between sisters (Spearman correlation coefficients ranged from 0.17 to 0.55). Sat2 methylation was statistically significantly associated with increased breast cancer risk [odds ratio (OR) = 2.09, 95% confidence interval (CI) = 1.09-4.03; for each unit decrease in the natural log of the methylation level, OR = 2.12, 95% CI = 0.88-5.11 for the lowest quartile compared with the highest quartile]. These associations were only observed in total WBC but not granulocyte DNA. There was no association between breast cancer and LINE-1 and Alu methylation. If replicated in larger prospective studies, these findings support that selected markers of epigenetic changes measured in WBC, such as Sat2, may be potential biomarkers of breast cancer risk.

  14. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.


    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko


    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  15. Relaxase DNA binding and cleavage are two distinguishable steps in conjugative DNA processing that involve different sequence elements of the nic site.


    Lucas, María; González-Pérez, Blanca; Cabezas, Matilde; Moncalian, Gabriel; Rivas, Germán; de la Cruz, Fernando


    TrwC, the relaxase of plasmid R388, catalyzes a series of concerted DNA cleavage and strand transfer reactions on a specific site (nic) of its origin of transfer (oriT). nic contains the cleavage site and an adjacent inverted repeat (IR(2)). Mutation analysis in the nic region indicated that recognition of the IR(2) proximal arm and the nucleotides located between IR(2) and the cleavage site were essential for supercoiled DNA processing, as judged either by in vitro nic cleavage or by mobilization of a plasmid containing oriT. Formation of the IR(2) cruciform and recognition of the distal IR(2) arm and loop were not necessary for these reactions to take place. On the other hand, IR(2) was not involved in TrwC single-stranded DNA processing in vitro. For single-stranded DNA nic cleavage, TrwC recognized a sequence embracing six nucleotides upstream of the cleavage site and two nucleotides downstream. This suggests that TrwC DNA binding and cleavage are two distinguishable steps in conjugative DNA processing and that different sequence elements are recognized by TrwC in each step. IR(2)-proximal arm recognition was crucial for the initial supercoiled DNA binding. Subsequent recognition of the adjacent single-stranded DNA binding site was required to position the cleavage site in the active center of the protein so that the nic cleavage reaction could take place.

  16. A common element involved in transcriptional regulation of two DNA alkylation repair genes (MAG and MGT1) of Saccharomyces cerevisiae.

    PubMed Central

    Xiao, W; Singh, K K; Chen, B; Samson, L


    The Saccharomyces cerevisiae MAG gene encodes a 3-methyladenine DNA glycosylase that protects cells from killing by alkylating agents. MAG mRNA levels are induced not only by alkylating agents but also by DNA-damaging agents that do not produce alkylated DNA. We constructed a MAG-lacZ gene fusion to help identify the cis-acting promoter elements involved in regulating MAG expression. Deletion analysis defined the presence of one upstream activating sequence and one upstream repressing sequence (URS) and suggested the presence of a second URS. One of the MAG URS elements matches a decamer consensus sequence present in the promoters of 11 other S. cerevisiae DNA repair and metabolism genes, including the MGT1 gene, which encodes an O6-methylguanine DNA repair methyltransferase. Two proteins of 26 and 39 kDa bind specifically to the MAG and MGT1 URS elements. We suggest that the URS-binding proteins may play an important role in the coordinate regulation of these S. cerevisiae DNA repair genes. Images PMID:8246943

  17. A possible aid in targeted insertion of large DNA elements by CRISPR/Cas in mouse zygotes.


    Nakao, Harumi; Harada, Takeshi; Nakao, Kazuki; Kiyonari, Hiroshi; Inoue, Kenichi; Furuta, Yasuhide; Aiba, Atsu


    The CRISPR/Cas system has rapidly emerged recently as a new tool for genome engineering, and is expected to allow for controlled manipulation of specific genomic elements in a variety of species. A number of recent studies have reported the use of CRISPR/Cas for gene disruption (knockout) or targeted insertion of foreign DNA elements (knock-in). Despite the ease of simple gene knockout and small insertions or nucleotide substitutions in mouse zygotes by the CRISPR/Cas system, targeted insertion of large DNA elements remains an apparent challenge. Here the generation of knock-in mice with successful targeted insertion of large donor DNA elements ranged from 3.0 to 7.1 kb at the ROSA26 locus using the CRISPR/Cas system was achieved. Multiple independent knock-in founder mice were obtained by injection of hCas9 mRNA/sgRNA/donor vector mixtures into the cytoplasm of C57BL/6N zygotes when the injected zygotes were treated with an inhibitor of actin polymerization, cytochalasin. Successful germ line transmission of three of these knock-in alleles was also confirmed. The results suggested that treatment of zygotes with actin polymerization inhibitors following microinjection could be a viable method to facilitate targeted insertion of large DNA elements by the CRISPR/Cas system, enabling targeted knock-in readily attainable in zygotes.

  18. Dead element replicating: degenerate R2 element replication and rDNA genomic turnover in the Bacillus rossius stick insect (Insecta: Phasmida).


    Martoni, Francesco; Eickbush, Danna G; Scavariello, Claudia; Luchetti, Andrea; Mantovani, Barbara


    R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5' end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s). Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun) as well as a full-length but degenerate element (R2Brdeg). An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements) are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution.

  19. UpSETing chromatin during non-coding RNA production

    PubMed Central


    The packaging of eukaryotic DNA into nucleosomal arrays permits cells to tightly regulate and fine-tune gene expression. The ordered disassembly and reassembly of these nucleosomes allows RNA polymerase II (RNAPII) conditional access to the underlying DNA sequences. Disruption of nucleosome reassembly following RNAPII passage results in spurious transcription initiation events, leading to the production of non-coding RNA (ncRNA). We review the molecular mechanisms involved in the suppression of these cryptic initiation events and discuss the role played by ncRNAs in regulating gene expression. PMID:23738864

  20. A Molecular Chipper technology for CRISPR sgRNA library generation and functional mapping of noncoding regions

    PubMed Central

    Cheng, Jijun; Roden, Christine A.; Pan, Wen; Zhu, Shu; Baccei, Anna; Pan, Xinghua; Jiang, Tingting; Kluger, Yuval; Weissman, Sherman M.; Guo, Shangqin; Flavell, Richard A.; Ding, Ye; Lu, Jun


    Clustered regularly-interspaced palindromic repeats (CRISPR)-based genetic screens using single-guide-RNA (sgRNA) libraries have proven powerful to identify genetic regulators. Applying CRISPR screens to interrogate functional elements in noncoding regions requires generating sgRNA libraries that are densely covering, and ideally inexpensive, easy to implement and flexible for customization. Here we present a Molecular Chipper technology for generating dense sgRNA libraries for genomic regions of interest, and a proof-of-principle screen that identifies novel cis-regulatory domains for miR-142 biogenesis. The Molecular Chipper approach utilizes a combination of random fragmentation and a type III restriction enzyme to derive a densely covering sgRNA library from input DNA. Applying this approach to 17 microRNAs and their flanking regions and with a reporter for miR-142 activity, we identify both the pre-miR-142 region and two previously unrecognized cis-domains important for miR-142 biogenesis, with the latter regulating miR-142 processing. This strategy will be useful for identifying functional noncoding elements in mammalian genomes. PMID:27025950

  1. Long non-coding RNA CASC2 in human cancer.


    Palmieri, Giuseppe; Paliogiannis, Panagiotis; Sini, Maria Cristina; Manca, Antonella; Palomba, Grazia; Doneddu, Valentina; Tanda, Francesco; Pascale, Maria Rosa; Cossu, Antonio


    Long non-coding RNAs cover large part of the non-coding information of the human DNA, which represents more than 90% of the whole genome. They constitute a wide and complex group of molecules with more than 200 nucleotides, which generally lack an open reading frame, and are involved in various ways in the pathophysiology of cancer. Their roles in the regulation of gene expression, imprinting, transcription, and post-translational processing have been described in several types of cancer. CASC2 was discovered in 2004 in patients with endometrial carcinoma as a potential tumor suppressor. Since then, additional studies in other types of neoplasia have been carried out, and both mechanisms and interactions of CASC2 in cancer have been better elucidated. In this review, we summarize the current knowledge on the role of CASC2 in the genesis, progression, and clinical management of human cancer.

  2. Identification and analysis of mouse non-coding RNA using transcriptome data.


    Zhao, Yuhui; Liu, Wanfei; Zeng, Jingyao; Liu, Shoucheng; Tan, Xinyu; Aljohi, Hasanawad; Hu, Songnian


    Transcripts are expressed spatially and temporally and they are very complicated, precise and specific; however, most studies are focused on protein-coding related genes. Recently, massively parallel cDNA sequencing (RNA-seq) has emerged to be a new and promising tool for transcriptome research, and numbers of non-coding RNAs, especially lincRNAs, have been widely identified and well characterized as important regulators of diverse biological processes. In this study, we used ultra-deep RNA-seq data from 15 mouse tissues to study the diversity and dynamic of non-coding RNAs in mouse. Using our own criteria, we identified totally 16,249 non-coding genes (21,569 non-coding RNAs) in mouse. We annotated these non-coding RNAs by diverse properties and found non-coding RNAs are generally shorter, have fewer exons, express in lower level and are more strikingly tissue-specific compared with protein-coding genes. Moreover, these non-coding RNAs show significant enrichment with transcriptional initiation and elongation signals including histone modifications (H3K4me3, H3K27me3 and H3K36me3), RNAPII binding sites and CAGE tags. The gene set enrichment analysis (GSEA) result revealed several sets of lincRNAs associated with diverse biological processes such as immune effector process, muscle development and sexual reproduction. Taken together, this study provides a more comprehensive annotation of mouse non-coding RNAs and gives an opportunity for future functional and evolutionary study of mouse non-coding RNAs.

  3. Structure and function of the c-myc DNA-unwinding element-binding protein DUE-B.


    Kemp, Michael; Bae, Brian; Yu, John Paul; Ghosh, Maloy; Leffak, Michael; Nair, Satish K


    Local zones of easily unwound DNA are characteristic of prokaryotic and eukaryotic replication origins. The DNA-unwinding element of the human c-myc replication origin is essential for replicator activity and is a target of the DNA-unwinding element-binding protein DUE-B in vivo. We present here the 2.0A crystal structure of DUE-B and complementary biochemical characterization of its biological activity. The structure corresponds to a dimer of the N-terminal domain of the full-length protein and contains many of the structural elements of the nucleotide binding fold. A single magnesium ion resides in the putative active site cavity, which could serve to facilitate ATP hydrolytic activity of this protein. The structure also demonstrates a notable similarity to those of tRNA-editing enzymes. Consistent with this structural homology, the N-terminal core of DUE-B is shown to display both D-aminoacyl-tRNA deacylase activity and ATPase activity. We further demonstrate that the C-terminal portion of the enzyme is disordered and not essential for dimerization. However, this region is essential for DNA binding in vitro and becomes ordered in the presence of DNA.

  4. Novel classes of non-coding RNAs and cancer

    PubMed Central


    For the many years, the central dogma of molecular biology has been that RNA functions mainly as an informational intermediate between a DNA sequence and its encoded protein. But one of the great surprises of modern biology was the discovery that protein-coding genes represent less than 2% of the total genome sequence, and subsequently the fact that at least 90% of the human genome is actively transcribed. Thus, the human transcriptome was found to be more complex than a collection of protein-coding genes and their splice variants. Although initially argued to be spurious transcriptional noise or accumulated evolutionary debris arising from the early assembly of genes and/or the insertion of mobile genetic elements, recent evidence suggests that the non-coding RNAs (ncRNAs) may play major biological roles in cellular development, physiology and pathologies. NcRNAs could be grouped into two major classes based on the transcript size; small ncRNAs and long ncRNAs. Each of these classes can be further divided, whereas novel subclasses are still being discovered and characterized. Although, in the last years, small ncRNAs called microRNAs were studied most frequently with more than ten thousand hits at PubMed database, recently, evidence has begun to accumulate describing the molecular mechanisms by which a wide range of novel RNA species function, providing insight into their functional roles in cellular biology and in human disease. In this review, we summarize newly discovered classes of ncRNAs, and highlight their functioning in cancer biology and potential usage as biomarkers or therapeutic targets. PMID:22613733

  5. Long noncoding RNAs and atherosclerosis.


    Zhou, Tian; Ding, Jia-wang; Wang, Xin-an; Zheng, Xia-xia


    Atherosclerosis is universally recognized as a chronic lipid-induced inflammation of the vessel wall in response to dyslipidemia and haemodynamic stress involving dysfunction and activation of resident vascular cells as well as infiltration of leukocytes. As members of nonprotein-coding RNAs, the long noncoding RNAs (lncRNAs) are implicated in various biological processes. Accumulating evidences suggest that lncRNAs regulate the function of vascular wall, activation of macrophages, lipid metabolism and immune response. Here, we review the effects of lncRNAs on the progress of atherosclerosis.

  6. cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice.


    Sharif, K A; Li, C; Gudas, L J


    The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development. LAMB1 transgene expression is observed in a selective set of nephrons of the neonatal and adult kidneys. The cis-acting DNA regulatory elements responsible for LAMB1 transgene expression in ovaries and in juvenile kidneys are present between -'1.4 and -0.7 kb relative to the transcription start site, while those of adult kidneys are located between -2.5 and -1.4 kb. The LAMB1 transgene is also expressed in the epididymis of 1 week old transgenic mice. Mutation of the retinoic acid response element (RARE) in the context of the 3.9LAMB1betagal transgene results in loss of LAMB1 transgene expression in all tissues. Thus, sequences between -2.5 and -0.7 kb plus the RARE are required for appropriate expression of the LAMB1 transgene in mice.

  7. Capicua DNA-binding sites are general response elements for RTK signaling in Drosophila.


    Ajuria, Leiore; Nieva, Claudia; Winkler, Clint; Kuo, Dennis; Samper, Núria; Andreu, María José; Helman, Aharon; González-Crespo, Sergio; Paroush, Ze'ev; Courey, Albert J; Jiménez, Gerardo


    RTK/Ras/MAPK signaling pathways play key functions in metazoan development, but how they control expression of downstream genes is not well understood. In Drosophila, it is generally assumed that most transcriptional responses to RTK signal activation depend on binding of Ets-family proteins to specific cis-acting sites in target enhancers. Here, we show that several Drosophila RTK pathways control expression of downstream genes through common octameric elements that are binding sites for the HMG-box factor Capicua, a transcriptional repressor that is downregulated by RTK signaling in different contexts. We show that Torso RTK-dependent regulation of terminal gap gene expression in the early embryo critically depends on Capicua octameric sites, and that binding of Capicua to these sites is essential for recruitment of the Groucho co-repressor to the huckebein enhancer in vivo. We then show that subsequent activation of the EGFR RTK pathway in the neuroectodermal region of the embryo controls dorsal-ventral gene expression by downregulating the Capicua protein, and that this control also depends on Capicua octameric motifs. Thus, a similar mechanism of RTK regulation operates during subdivision of the anterior-posterior and dorsal-ventral embryonic axes. We also find that identical DNA octamers mediate Capicua-dependent regulation of another EGFR target in the developing wing. Remarkably, a simple combination of activator-binding sites and Capicua motifs is sufficient to establish complex patterns of gene expression in response to both Torso and EGFR activation in different tissues. We conclude that Capicua octamers are general response elements for RTK signaling in Drosophila.

  8. Identification of the DNA damage-responsive element of RNR2 and evidence that four distinct cellular factors bind it.

    PubMed Central

    Elledge, S J; Davis, R W


    The RNR2 gene encodes the small subunit of ribonucleotide reductase, the enzyme that catalyzes the first step in the pathway for the production of the deoxyribonucleotides needed for DNA synthesis. Transcription of this gene is induced approximately 20-fold in response to environmental stimuli that damage DNA or block DNA replication. Deletion and subcloning analysis identified two, and possibly three, upstream activating sequences (UAS) and one repressing (URS) element in the RNR2 regulatory region. A 42-base-pair (bp) fragment from this region was found to be necessary for proper regulation of RNR2 and to be capable of conferring DNA damage inducibility upon a heterologous promoter. This fragment contained both positively and negatively acting sequences. Four DNA-binding factors interacted with the RNR2 regulatory region. One factor was identified as the GRF1 protein, the product of the RAP1 gene. GRF1 bound to the UAS2 element of RNR2, which was found to be directly adjacent to the 42-bp fragment. UAS2 activity was repressed by the 42-bp fragment. Three other factors bound to the 42-bp fragment; one of these factors, RRF3, had a second binding site in the RNR2 promoter. These factors are likely to mediate the response of RNR2 to DNA damage. Images PMID:2685561

  9. Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans.

    PubMed Central

    Pérez-González, C E; Eickbush, T H


    The mobile elements R1 and R2 insert specifically into the rRNA gene locus (rDNA locus) of arthropods, a locus known to undergo concerted evolution, the recombinational processes that preserve the sequence homogeneity of all repeats. To monitor how rapidly individual R1 and R2 insertions are turned over in the rDNA locus by these processes, we have taken advantage of the many 5' truncation variants that are generated during the target-primed reverse transcription mechanism used by these non-LTR retrotransposons for their integration. A simple PCR assay was designed to reveal the pattern of the 5' variants present in the rDNA loci of individual X chromosomes in a population of Drosophila simulans. Each rDNA locus in this population was found to have a large, unique collection of 5' variants. Each variant was present at low copy number, usually one copy per chromosome, and was seldom distributed to other chromosomes in the population. The failure of these variants to spread to other units in the same rDNA locus suggests a strong recombinational bias against R1 and R2 that results in the individual copies of these elements being rapidly lost from the rDNA locus. This bias suggests a significantly higher frequency of R1 and R2 retrotransposition than we have previously suggested. PMID:11514447

  10. Noncoding RNAs and enhancers: complications of a long-distance relationship

    PubMed Central

    Ørom, Ulf Andersson; Shiekhattar, Ramin


    Spatial and temporal regulation of gene expression is achieved through instructions provided by the distal transcriptional regulatory elements known as enhancers. How enhancers transmit such information to their targets has been the subject of intense investigation. Recent advances in high throughput analysis of the mammalian transcriptome have revealed a surprising result indicating that a large number of enhancers are transcribed to noncoding RNAs. Although long noncoding RNAs were initially shown to confer epigenetic transcriptional repression, recent studies have uncovered a role for a class of such transcripts in gene-specific activation, often from distal genomic regions. In this review, we discuss recent findings on the role of long noncoding RNAs in transcriptional regulation, with an emphasis on new developments on the functional links between long noncoding RNAs and enhancers. PMID:21831473

  11. Fine-scale map of encyclopedia of DNA elements regions in the Korean population.


    Yoo, Yeon-Kyeong; Ke, Xiayi; Hong, Sungwoo; Jang, Hye-Yoon; Park, Kyunghee; Kim, Sook; Ahn, TaeJin; Lee, Yeun-Du; Song, Okryeol; Rho, Na-Young; Lee, Moon Sue; Lee, Yeon-Su; Kim, Jaeheup; Kim, Young J; Yang, Jun-Mo; Song, Kyuyoung; Kimm, Kyuchan; Weir, Bruce; Cardon, Lon R; Lee, Jong-Eun; Hwang, Jung-Joo


    The International HapMap Project aims to generate detailed human genome variation maps by densely genotyping single-nucleotide polymorphisms (SNPs) in CEPH, Chinese, Japanese, and Yoruba samples. This will undoubtedly become an important facility for genetic studies of diseases and complex traits in the four populations. To address how the genetic information contained in such variation maps is transferable to other populations, the Korean government, industries, and academics have launched the Korean HapMap project to genotype high-density Encyclopedia of DNA Elements (ENCODE) regions in 90 Korean individuals. Here we show that the LD pattern, block structure, haplotype diversity, and recombination rate are highly concordant between Korean and the two HapMap Asian samples, particularly Japanese. The availability of information from both Chinese and Japanese samples helps to predict more accurately the possible performance of HapMap markers in Korean disease-gene studies. Tagging SNPs selected from the two HapMap Asian maps, especially the Japanese map, were shown to be very effective for Korean samples. These results demonstrate that the HapMap variation maps are robust in related populations and will serve as an important resource for the studies of the Korean population in particular.

  12. Hundreds of Circular Novel Plasmids and DNA Elements Identified in a Rat Cecum Metamobilome

    PubMed Central

    Jørgensen, Tue Sparholt; Xu, Zhuofei; Hansen, Martin Asser; Sørensen, Søren Johannes; Hansen, Lars Hestbjerg


    Metagenomic approaches are widespread in microbiological research, but so far, the knowledge on extrachromosomal DNA diversity and composition has largely remained dependant on cultivating host organisms. Even with the emergence of metagenomics, complete circular sequences are rarely identified, and have required manual curation. We propose a robust in silico procedure for identifying complete small plasmids in metagenomic datasets from whole genome shotgun sequencing. From one very pure and exhaustively sequenced metamobilome from rat cecum, we identified a total of 616 circular sequences, 160 of which were carrying a gene with plasmid replication domain. Further homology analyses indicated that the majority of these plasmid sequences are novel. We confirmed the circularity of the complete plasmid candidates using an inverse-type PCR approach on a subset of sequences with 95% success, confirming the existence and length of discrete sequences. The implication of these findings is a broadened understanding of the traits of circular elements in nature and the possibility of massive data mining in existing metagenomic datasets to discover novel pools of complete plasmids thus vastly expanding the current plasmid database. PMID:24503942

  13. Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements.


    Telorac, Jonas; Prykhozhij, Sergey V; Schöne, Stefanie; Meierhofer, David; Sauer, Sascha; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H


    Out of the myriad of potential DNA binding sites of the glucocorticoid receptor (GR) found in the human genome, only a cell-type specific minority is actually bound, indicating that the presence of a recognition sequence alone is insufficient to specify where GR binds. Cooperative interactions with other transcription factors (TFs) are known to contribute to binding specificity. Here, we reasoned that sequence signals preventing GR recruitment to certain loci provide an alternative means to confer specificity. Motif analyses uncovered candidate Negative Regulatory Sequences (NRSs) that interfere with genomic GR binding. Subsequent functional analyses demonstrated that NRSs indeed prevent GR binding to nearby response elements. We show that NRS activity is conserved across species, found in most tissues and that they also interfere with the genomic binding of other TFs. Interestingly, the effects of NRSs appear not to be a simple consequence of changes in chromatin accessibility. Instead, we find that NRSs interact with proteins found at sub-nuclear structures called paraspeckles and that these proteins might mediate the repressive effects of NRSs. Together, our studies suggest that the joint influence of positive and negative sequence signals partition the genome into regions where GR can bind and those where it cannot.

  14. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    SciTech Connect

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng


    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage.

  15. Development of two highly sensitive forensic sex determination assays based on human DYZ1 and Alu repetitive DNA elements.


    Fazi, Amanda; Gobeski, Brianne; Foran, David


    Sex determination is a critical component of forensic identification, the standard genetic method for which is detection of the single copy amelogenin gene that has differing homologues on the X and Y chromosomes. However, this assay may not be sensitive enough when DNA samples are minute or highly compromised, thus other strategies for sex determination are needed. In the current research, two ultrasensitive sexing assays, based on real-time PCR and pyrosequencing, were developed targeting the highly repetitive elements DYZ1 on the Y chromosome and Alu on the autosomes. The DYZ1/Alu strategy was compared to amelogenin for overall sensitivity based on high molecular weight and degraded DNA, followed by assaying the sex of 34 touch DNA samples and DNA from 30 hair shafts. The real-time DYZ1/Alu assay proved to be approximately 1500 times more sensitive than its amelogenin counterpart based on high molecular weight DNA, and even more sensitive when sexing degraded DNA. The pyrosequencing DYZ1/Alu assay correctly sexed 26 of the touch DNAs, compared to six using amelogenin. Hair shaft DNAs showed equally improved sexing results using the DYZ1/Alu assays. Overall, both DYZ1/Alu assays were far more sensitive and accurate than was the amelogenin assay, and thus show great utility for sexing poor quality and low quantity DNA evidence.

  16. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.


    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  17. Plasticity in cell defence: access to and reactivity of critical protein residues and DNA response elements.


    Goldring, Chris; Kitteringham, Neil; Jenkins, Rosalind; Copple, Ian; Jeannin, Jean-Francois; Park, B Kevin


    Cellular and whole organ defence against pathogenic or chemical challenge is manifest as an adaptive response. Where appropriate, this may lead to induction of a cellular defence programme, thereby enhancing cell survival. When the challenge is overwhelming, the defence is breached and a switch is made to yield cell death, either by apoptosis or necrosis. Thus, a cell will defend itself where possible, but in extremis, it may recognise the futility of its resistance and allow itself to die. Transcription factor activation and access to the DNA regulatory elements that control a particular pattern of expression of defence genes is a major issue that may ultimately decide the fate of a cell in a changed environment. It is possible to visualise the access to the nucleus and to the genome, of paradigm gene loci or transcription factors, using a number of molecular techniques such as chromatin immunoprecipitation, in vivo footprinting and live/whole cell imaging. These methods are informative as to the array of transcription factors that may regulate a given gene, as well as the transitory nature of the transcriptional activation. The initial triggering of active transcription factor complexes typically occurs within the cytoplasm of the cell. Protein-protein interactions and signal transduction pathways, elucidated using a classical molecular genetics approach, have long been recognised as pivotal to the initial control of the levels and activity of transcription factors. We can now visualise modifications in critical residues of transcription factors and regulators during cellular response to chemical stress. These modifications may yield enhanced or repressed activity of transcription factors, they may be non-covalent or covalent, and they may occur in response to a variety of classes of chemicals. Such promiscuous signalling can provide plasticity in the cellular response to a wide array of chemical agents.

  18. The bcr1 DNA Repeat Element Is Specific to the Bacillus cereus Group and Exhibits Mobile Element Characteristics

    PubMed Central

    Økstad, Ole Andreas; Tourasse, Nicolas J.; Stabell, Fredrik B.; Sundfær, Cathrine K.; Egge-Jacobsen, Wolfgang; Risøen, Per Arne; Read, Timothy D.; Kolstø, Anne-Brit


    Bacillus cereus strains ATCC 10987 and ATCC 14579 harbor a ∼155-bp repeated element, bcr1, which is conserved in B. cereus, B. anthracis, B. thuringiensis, and B. mycoides but not in B. subtilis and B. licheniformis. In this study, we show by Southern blot hybridizations that bcr1 is present in all 54 B. cereus group strains tested but absent in 11 Bacillus strains outside the group, suggesting that bcr1 may be specific and ubiquitous to the B. cereus group. By comparative analysis of the complete genome sequences of B. cereus ATCC 10987, B. cereus ATCC 14579, and B. anthracis Ames, we show that bcr1 is exclusively present in the chromosome but absent from large plasmids carried by these strains and that the numbers of full-length bcr1 repeats for these strains are 79, 54, and 12, respectively. Numerous copies of partial bcr1 elements are also present in the three genomes (91, 128, and 53, respectively). Furthermore, the genomic localization of bcr1 is not conserved between strains with respect to chromosomal position or organization of gene neighbors, as only six full-length bcr1 loci are common to at least two of the three strains. However, the intergenic sequence surrounding a specific bcr1 repeat in one of the three strains is generally strongly conserved in the other two, even in loci where bcr1 is found exclusively in one strain. This finding indicates that bcr1 either has evolved by differential deletion from a very high number of repeats in a common ancestor to the B. cereus group or is moving around the chromosome. The identification of bcr1 repeats interrupting genes in B. cereus ATCC 10987 and ATCC 14579 and the presence of a flanking TTTAT motif in each end show that bcr1 exhibits features characteristic of a mobile element. PMID:15516586

  19. A view of an elemental naturalist at the DNA world (base composition, sequences, methylation).


    Vanyushin, B F


    The pioneering data on base composition and pyrimidine sequences in DNA of pro- and eukaryotes are considered, and their significance for the origin of genosystematics is discussed. The modern views on specificity and functional role of enzymatic DNA methylation in eukaryotes are described. DNA methylation controls all genetic functions and is a mechanism of cellular differentiation and gene silencing. A model of regulation of DNA replication by methylation is suggested. Adenine DNA methylation in higher eukaryotes (higher plants) was first observed, and it was established that one and the same gene can be methylated at both cytosine and adenine moieties. Thus, there are at least two different and seemingly interdependent DNA methylation systems present in eukaryotic cells. The first eukaryotic adenine DNA-methyltransferase is isolated from wheat seedlings and described: the enzyme methylates DNA with formation of N6-methyladenine in the sequence TGATCA-->TGm6ATCA. It is found that higher plants have endonucleases that are dependent on S-adenosyl-L-methionine (SAM) and sensitive to DNA methylation status. Therefore, as in bacteria, plants seem to have a restriction-modification (R-M) system. A system of conjugated up- and down-regulation of SAM-dependent endonucleases by SAM modulations is found in plants. Revelation of an essential role of DNA methylation in regulation of genetic processes is a fundament of materialization of epigenetics and epigenomics.

  20. Generalized Levy-walk model for DNA nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Simons, M.; Stanley, H. E.


    We propose a generalized Levy walk to model fractal landscapes observed in noncoding DNA sequences. We find that this model provides a very close approximation to the empirical data and explains a number of statistical properties of genomic DNA sequences such as the distribution of strand-biased regions (those with an excess of one type of nucleotide) as well as local changes in the slope of the correlation exponent alpha. The generalized Levy-walk model simultaneously accounts for the long-range correlations in noncoding DNA sequences and for the apparently paradoxical finding of long subregions of biased random walks (length lj) within these correlated sequences. In the generalized Levy-walk model, the lj are chosen from a power-law distribution P(lj) varies as lj(-mu). The correlation exponent alpha is related to mu through alpha = 2-mu/2 if 2 < mu < 3. The model is consistent with the finding of "repetitive elements" of variable length interspersed within noncoding DNA.

  1. Robust Identification of Noncoding RNA from Transcriptomes Requires Phylogenetically-Informed Sampling

    PubMed Central

    Lai, Alicia Sook-Wei; Eldai, Hisham; Liu, Wenting; McGimpsey, Stephanie; Wheeler, Nicole E.; Biggs, Patrick J.; Thomson, Nick R.; Barquist, Lars; Poole, Anthony M.; Gardner, Paul P.


    Noncoding RNAs are integral to a wide range of biological processes, including translation, gene regulation, host-pathogen interactions and environmental sensing. While genomics is now a mature field, our capacity to identify noncoding RNA elements in bacterial and archaeal genomes is hampered by the difficulty of de novo identification. The emergence of new technologies for characterizing transcriptome outputs, notably RNA-seq, are improving noncoding RNA identification and expression quantification. However, a major challenge is to robustly distinguish functional outputs from transcriptional noise. To establish whether annotation of existing transcriptome data has effectively captured all functional outputs, we analysed over 400 publicly available RNA-seq datasets spanning 37 different Archaea and Bacteria. Using comparative tools, we identify close to a thousand highly-expressed candidate noncoding RNAs. However, our analyses reveal that capacity to identify noncoding RNA outputs is strongly dependent on phylogenetic sampling. Surprisingly, and in stark contrast to protein-coding genes, the phylogenetic window for effective use of comparative methods is perversely narrow: aggregating public datasets only produced one phylogenetic cluster where these tools could be used to robustly separate unannotated noncoding RNAs from a null hypothesis of transcriptional noise. Our results show that for the full potential of transcriptomics data to be realized, a change in experimental design is paramount: effective transcriptomics requires phylogeny-aware sampling. PMID:25357249

  2. The long non-coding RNA Dali is an epigenetic regulator of neural differentiation.


    Chalei, Vladislava; Sansom, Stephen N; Kong, Lesheng; Lee, Sheena; Montiel, Juan F; Vance, Keith W; Ponting, Chris P


    Many intergenic long noncoding RNA (lncRNA) loci regulate the expression of adjacent protein coding genes. Less clear is whether intergenic lncRNAs commonly regulate transcription by modulating chromatin at genomically distant loci. Here, we report both genomically local and distal RNA-dependent roles of Dali, a conserved central nervous system expressed intergenic lncRNA. Dali is transcribed downstream of the Pou3f3 transcription factor gene and its depletion disrupts the differentiation of neuroblastoma cells. Locally, Dali transcript regulates transcription of the Pou3f3 locus. Distally, it preferentially targets active promoters and regulates expression of neural differentiation genes, in part through physical association with the POU3F3 protein. Dali interacts with the DNMT1 DNA methyltransferase in mouse and human and regulates DNA methylation status of CpG island-associated promoters in trans. These results demonstrate, for the first time, that a single intergenic lncRNA controls the activity and methylation of genomically distal regulatory elements to modulate large-scale transcriptional programmes.

  3. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio


    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  4. Hormone stimulation of androgen receptor mediates dynamic changes in DNA methylation patterns at regulatory elements

    PubMed Central

    Dhiman, Vineet K.; Attwood, Kristopher; Campbell, Moray J.; Smiraglia, Dominic J.


    DNA methylation is an epigenetic modification that contributes to stable gene silencing by interfering with the ability of transcriptional regulators to bind to DNA. Recent findings have revealed that hormone stimulation of certain nuclear receptors induces rapid, dynamic changes in DNA methylation patterns alongside transcriptional responses at a subset of target loci, over time. However, the ability of androgen receptor (AR) to dynamically regulate gene transcription is relatively under-studied and its role in the regulation of DNA methylation patterns remains to be elucidated. Here we demonstrate in normal prostate cells that hormone stimulated AR activity results in dynamic changes in the transcription rate and DNA methylation patterns at the AR target genes, TIPARP and SGK1. Time-resolved chromatin immunoprecipitation experiments on the SGK1 locus reveals dynamic recruitment of AR and RNA Polymerase II, as well as the recruitment of proteins involved in the DNA demethylation process, TET1 and TDG. Furthermore, the presence of DNA methylation at dynamic regions inhibits protein binding and transcriptional activity of SGK1. These findings establish AR activity as a contributing factor to the dynamic regulation of DNA methylation patterns at target genes in prostate biology and infer further complexity involved in nuclear receptor mediation of transcriptional regulation. PMID:26646795

  5. Differential distribution and association of repeat DNA sequences in the lateral element of the synaptonemal complex in rat spermatocytes.


    Hernández-Hernández, Abrahan; Rincón-Arano, Héctor; Recillas-Targa, Félix; Ortiz, Rosario; Valdes-Quezada, Christian; Echeverría, Olga M; Benavente, Ricardo; Vázquez-Nin, Gerardo H


    The synaptonemal complex (SC) is an evolutionarily conserved structure that mediates synapsis of homologous chromosomes during meiotic prophase I. Previous studies have established that the chromatin of homologous chromosomes is organized in loops that are attached to the lateral elements (LEs) of the SC. The characterization of the genomic sequences associated with LEs of the SC represents an important step toward understanding meiotic chromosome organization and function. To isolate these genomic sequences, we performed chromatin immunoprecipitation assays in rat spermatocytes using an antibody against SYCP3, a major structural component of the LEs of the SC. Our results demonstrated the reproducible and exclusive isolation of repeat deoxyribonucleic acid (DNA) sequences, in particular long interspersed elements, short interspersed elements, long terminal direct repeats, satellite, and simple repeats. The association of these repeat sequences to the LEs of the SC was confirmed by in situ hybridization of meiotic nuclei shown by both light and electron microscopy. Signals were also detected over the chromatin surrounding SCs and in small loops protruding from the lateral elements into the SC central region. We propose that genomic repeat DNA sequences play a key role in anchoring the chromosome to the protein scaffold of the SC.

  6. Surface Plasmon Resonance Study of Cooperative Interactions of Estrogen Receptor α and Specificity Protein 1 with Composite DNA Elements.


    Su, Xiaodi; Song, Hong Yan


    Estrogen receptor α (ERα) and Specificity protein 1 (Sp1) are transcription factors (TF) that are involved in regulating progesterone receptor (PR) gene expression through cooperative interactions with DNA. The natural composite DNA +571 ERE/Sp1 site in promoter A of the progesterone receptor contains a half-site of estrogen response elements (½ERE) upstream of two Sp1 binding sites (the proximal Sp1 (Sp1/P) and distal Sp1 (Sp1/D)) with a 4 bp spacer. Here, we have developed a protocol for studying the cooperative interaction of Sp1 and ERα with the composite DNA of +571 ERE/Sp1 site using Biacore T200, a high sensitivity surface plasmon resonance spectroscopy. With this protocol, we have concluded that Sp1 binding enhances the overall ERα binding to the composite DNA. We have also determined the optimal spacer distance between the ½ERE and Sp1/D for the best cooperative protein binding. This study is pivotal in guiding the bioinformatics simulation to yield an exact model of the spacer dependency of the transcription factor/cofactor-DNA interactions, which is important for understanding the nuclear receptor regulating activity through other coactivators.

  7. Heavy-ion radiation induces both activation of multiple endogenous transposable elements and alterations in DNA methylation in rice

    NASA Astrophysics Data System (ADS)

    Zhang, Meng; Sun, Yeqing; Li, Xishan; Xiaolin, Cui; Li, Xiang


    Space radiation represents a complex environmental condition in which several interacting factors such as electron, neutron, proton, heavy-ion are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic aswell as external perturbations, it is conceivable that epigenetic markers like DNA methylation and transposition may undergo alterations in response to space radiation. Cytosine DNA methylation plays important roles in maintaining genome stability and controlling gene expression. A predominant means for Transposable elements (TEs) to cause genetic instability is via their transpositional activation. To find the detailed molecular characterization of the nature of genomic changes induced by space radiation, the seeds of rice were exposed to 0.02, 0.2, 1, 2 and 20 Gy dose of ^{12}C heavy-ion radiation, respectively. We found that extensive alteration in both DNA methylation and gene expression occurred in rice plants after different dose of heavy-ion radiation. Here we shown that heavy-ion radiation has induced transposition of mPing and Tos17 in rice, which belong to distinct classes including the miniature inverted terminal repeat TEs (MITEs) and long-terminal repeat (LTR) retrotransposons, respectively. mPing and Tos17 mobility were found to correlate with cytosine methylation alteration detected by MSAP and genetic variation detected by AFLP. The result showed that at least in some cases transposition of TEs was associated with cytosine demethylation within the elements. Our results implicate that the heavy-ion radiation represents a potent mutagenic agent that can cause genomic instabilities by eliciting transposition of endogenous TEs in rice. Keywords: Heavy-ion radiation, DNA methylation, Transposable elements, mPing, Tos17

  8. LARVA: an integrative framework for large-scale analysis of recurrent variants in noncoding annotations

    PubMed Central

    Lochovsky, Lucas; Zhang, Jing; Fu, Yao; Khurana, Ekta; Gerstein, Mark


    In cancer research, background models for mutation rates have been extensively calibrated in coding regions, leading to the identification of many driver genes, recurrently mutated more than expected. Noncoding regions are also associated with disease; however, background models for them have not been investigated in as much detail. This is partially due to limited noncoding functional annotation. Also, great mutation heterogeneity and potential correlations between neighboring sites give rise to substantial overdispersion in mutation count, resulting in problematic background rate estimation. Here, we address these issues with a new computational framework called LARVA. It integrates variants with a comprehensive set of noncoding functional elements, modeling the mutation counts of the elements with a β-binomial distribution to handle overdispersion. LARVA, moreover, uses regional genomic features such as replication timing to better estimate local mutation rates and mutational hotspots. We demonstrate LARVA's effectiveness on 760 whole-genome tumor sequences, showing that it identifies well-known noncoding drivers, such as mutations in the TERT promoter. Furthermore, LARVA highlights several novel highly mutated regulatory sites that could potentially be noncoding drivers. We make LARVA available as a software tool and release our highly mutated annotations as an online resource ( PMID:26304545

  9. Long noncoding RNAs and neuroblastoma

    PubMed Central

    Pandey, Gaurav Kumar; Kanduri, Chandrasekhar


    Neuroblastoma is a disease that affects infants and despite intense multimodal therapy, high-risk patients have low survival rates (<50%). In recent years long noncoding RNAs (lncRNAs) have become the cutting edge of cancer research with inroads made in understanding their roles in multiple cancer types, including prostate and breast cancers. The roles of lncRNAs in neuroblastoma have just begun to be elucidated. This review summarises where we are with regards to lncRNAs in neuroblastoma. The known mechanistic roles of lncRNAs during neuroblastoma pathogenesis are discussed, as well as the relationship between lncRNA expression and the differentiation capacity of neuroblastoma cells. We speculate about the use of some of these lncRNAs, such as those mapping to the 6p22 hotspot, as biomarkers for neuroblastoma prognosis and treatment. This novel way of thinking about both neuroblastoma and lncRNAs brings a new perspective to the prognosis and treatment of high-risk patients. PMID:26087192

  10. Long noncoding RNAs and neuroblastoma.


    Pandey, Gaurav Kumar; Kanduri, Chandrasekhar


    Neuroblastoma is a disease that affects infants and despite intense multimodal therapy, high-risk patients have low survival rates (<50%). In recent years long noncoding RNAs (lncRNAs) have become the cutting edge of cancer research with inroads made in understanding their roles in multiple cancer types, including prostate and breast cancers. The roles of lncRNAs in neuroblastoma have just begun to be elucidated. This review summarises where we are with regards to lncRNAs in neuroblastoma. The known mechanistic roles of lncRNAs during neuroblastoma pathogenesis are discussed, as well as the relationship between lncRNA expression and the differentiation capacity of neuroblastoma cells. We speculate about the use of some of these lncRNAs, such as those mapping to the 6p22 hotspot, as biomarkers for neuroblastoma prognosis and treatment. This novel way of thinking about both neuroblastoma and lncRNAs brings a new perspective to the prognosis and treatment of high-risk patients.

  11. Non-coding RNAs in cardiac hypertrophy.


    Ottaviani, Lara; da Costa Martins, Paula A


    Heart Failure is one of the largest contributors to disease burden and healthcare outflow in the Western world. Despite significant progress in the treatment of heart failure, disease prognosis remains very poor with the only curative therapy still being heart transplantation. To counteract the current situation, efforts have been made to better understand the underlying molecular pathways in the progression of cardiac disease towards heart failure, and to link the disease to novel therapeutic targets such as non-coding RNAs. The non-coding part of the genome has gained prominence over the last couple of decades by opening a completely new research field and having established different non-coding RNAs species as fundamental regulators of cellular functions. Not surprisingly, their dysregulation is increasingly being linked to pathology, including to cardiac disease. Pre-clinically, non-coding RNAs have been shown to be of great value as therapeutic targets in pathological cardiac remodelling and also as diagnostic/prognostic biomarkers for heart failure. Therefore, it is to expect that non-coding RNA-based therapeutic strategies will reach the bedside in the future and provide new and more efficient treatments for heart failure. Here, we review recent discoveries linking the function and molecular interactions of non-coding RNAs with the pathophysiology of cardiac hypertrophy and heart failure. This article is protected by copyright. All rights reserved.

  12. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation.


    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J; Fox, Catherine A


    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  13. Distribution of Unlinked Transpositions of a Ds Element from a T-DNA Locus on Tomato Chromosome 4

    PubMed Central

    Briza, J.; Carroll, B. J.; Klimyuk, V. I.; Thomas, C. M.; Jones, D. A.; Jones, JDG.


    In maize, receptor sites for unlinked transpositions of Activator (Ac) elements are not distributed randomly. To test whether the same is true in tomato, the receptor sites for a Dissociation (Ds) element derived from Ac, were mapped for 26 transpositions unlinked to a donor T-DNA locus on chromosome 4. Four independent transposed Dss mapped to sites on chromosome 4 genetically unlinked to the donor T-DNA, consistent with a preference for transposition to unlinked sites on the same chromosome as opposed to sites on other chromosomes. There was little preference among the nondonor chromosomes, except perhaps for chromosome 2, which carried seven transposed Dss, but these could not be proven to be independent. However, these data, when combined with those from other studies in tomato examining the distribution of transposed Acs or Dss among nondonor chromosomes, suggest there may be absolute preferences for transposition irrespective of the chromosomal location of the donor site. If true, transposition to nondonor chromosomes in tomato would differ from that in maize, where the preference seems to be determined by the spatial arrangement of chromosomes in the interphase nucleus. The tomato lines carrying Ds elements at known locations are available for targeted transposon tagging experiments. PMID:8536985

  14. Mutation in a primate-conserved retrotransposon reveals a noncoding RNA as a mediator of infantile encephalopathy

    PubMed Central

    Cartault, François; Munier, Patrick; Benko, Edgar; Desguerre, Isabelle; Hanein, Sylvain; Boddaert, Nathalie; Bandiera, Simonetta; Vellayoudom, Jeanine; Krejbich-Trotot, Pascale; Bintner, Marc; Hoarau, Jean-Jacques; Girard, Muriel; Génin, Emmanuelle; de Lonlay, Pascale; Fourmaintraux, Alain; Naville, Magali; Rodriguez, Diana; Feingold, Josué; Renouil, Michel; Munnich, Arnold; Westhof, Eric; Fähling, Michael; Lyonnet, Stanislas; Henrion-Caude, Alexandra


    The human genome is densely populated with transposons and transposon-like repetitive elements. Although the impact of these transposons and elements on human genome evolution is recognized, the significance of subtle variations in their sequence remains mostly unexplored. Here we report homozygosity mapping of an infantile neurodegenerative disease locus in a genetic isolate. Complete DNA sequencing of the 400-kb linkage locus revealed a point mutation in a primate-specific retrotransposon that was transcribed as part of a unique noncoding RNA, which was expressed in the brain. In vitro knockdown of this RNA increased neuronal apoptosis, consistent with the inappropriate dosage of this RNA in vivo and with the phenotype. Moreover, structural analysis of the sequence revealed a small RNA-like hairpin that was consistent with the putative gain of a functional site when mutated. We show here that a mutation in a unique transposable element-containing RNA is associated with lethal encephalopathy, and we suggest that RNAs that harbor evolutionarily recent repetitive elements may play important roles in human brain development. PMID:22411793

  15. Distribution of ions around thymine dimer containing DNA: A possible recognition element for endonuclease V

    SciTech Connect

    Osman, R.; Luo, N.; Miaskiewicz, K.; Miller, J.


    The molecular link between sunlight exposure and skin cancer can be traced to the formation of cyclobutane pyrimidine dimers together with (6-4) photoadducts of pyrimidines in DNA upon exposure to UV radiation. The mutagenicity of these lesions is frequently explained by miscoding during DNA replication due to perturbations of base-pairing interactions. However the mutagenicity of UV photoproducts depends of their sequence context, suggesting that more global structural changes in DNA contribute to mutation induction. One of the most effective protections against the deleterious effects of cyclobutane pyrimidine dimers is the wide range of repair of this lesion by different enzymatic pathways. This paper presents the results of a 200 ps molecular dynamics simulation on the dodecarner d(CGCGAATTCGCG){sub 2} containing a cis, syn-cyclobutane thymine dimer, explicit water and counterions. The averaged structure calculated from the simulation shows good agreement with the available NMR data. The distribution of counterions around the damaged DNA is different from that around a non damaged DNA and suggests a possible mechanism of damage recognition by the enzyme.

  16. A role for non-coding variation in schizophrenia

    PubMed Central

    Roussos, Panos; Mitchell, Amanda C.; Voloudakis, Georgios; Fullard, John F.; Pothula, Venu M.; Tsang, Jonathan; Stahl, Eli A.; Georgakopoulos, Anastasios; Ruderfer, Douglas M.; Charney, Alexander; Okada, Yukinori; Siminovitch, Katherine A.; Worthington, Jane; Padyukov, Leonid; Klareskog, Lars; Gregersen, Peter K.; Plenge, Robert M.; Raychaudhuri, Soumya; Fromer, Menachem; Purcell, Shaun M.; Brennand, Kristen J.; Robakis, Nikolaos K.; Schadt, Eric E.; Akbarian, Schahram; Sklar, Pamela


    SUMMARY A large portion of common variant loci associated with genetic risk for schizophrenia reside within non-coding sequence of unknown function. Here, we demonstrate promoter and enhancer enrichment in schizophrenia variants associated with expression quantitative trait loci (eQTL). The enrichment is greater when functional annotations derived from human brain are used relative to peripheral tissues. Regulatory trait concordance analysis ranked genes within schizophrenia genome-wide significant loci for a potential functional role, based on co-localization of a risk SNP, eQTL and regulatory element sequence. We identified potential physical interactions of non-contiguous proximal and distal regulatory elements. This was verified in prefrontal cortex and induced pluripotent stem cell-derived neurons for the L-type calcium channel (CACNA1C) risk locus. Our findings point to a functional link between schizophrenia-associated non-coding SNPs and 3-dimensional genome architecture associated with chromosomal loopings and transcriptional regulation in the brain. PMID:25453756

  17. Cooperativity between DNA Methyltransferases in the Maintenance Methylation of Repetitive Elements

    PubMed Central

    Liang, Gangning; Chan, Matilda F.; Tomigahara, Yoshitaka; Tsai, Yvonne C.; Gonzales, Felicidad A.; Li, En; Laird, Peter W.; Jones, Peter A.


    We used mouse embryonic stem (ES) cells with systematic gene knockouts for DNA methyltransferases to delineate the roles of DNA methyltransferase 1 (Dnmt1) and Dnmt3a and -3b in maintaining methylation patterns in the mouse genome. Dnmt1 alone was able to maintain methylation of most CpG-poor regions analyzed. In contrast, both Dnmt1 and Dnmt3a and/or Dnmt3b were required for methylation of a select class of sequences which included abundant murine LINE-1 promoters. We used a novel hemimethylation assay to show that even in wild-type cells these sequences contain high levels of hemimethylated DNA, suggestive of poor maintenance methylation. We showed that Dnmt3a and/or -3b could restore methylation of these sequences to pretreatment levels following transient exposure of cells to 5-aza-CdR, whereas Dnmt1 by itself could not. We conclude that ongoing de novo methylation by Dnmt3a and/or Dnmt3b compensates for inefficient maintenance methylation by Dnmt1 of these endogenous repetitive sequences. Our results reveal a previously unrecognized degree of cooperativity among mammalian DNA methyltransferases in ES cells. PMID:11756544

  18. Elements that Regulate the DNA Damage Response of Proteins Defective in Cockayne Syndrome

    PubMed Central

    Iyama, Teruaki; Wilson, David M.


    Cockayne syndrome (CS) is a premature aging disorder characterized by developmental defects, multisystem progressive degeneration, and sensitivity to ultraviolet light. CS is divided into two primary complementation groups, A and B, with the CSA and CSB proteins presumably functioning in DNA repair and transcription. Using laser microirradiation and confocal microscopy, we characterized the nature and regulation of the CS protein response to oxidative DNA damage, double-strand breaks (DSBs), angelicin monoadducts, and trioxsalen interstrand crosslinks (ICLs). Our data indicate that CSB recruitment is influenced by the type of DNA damage, and is most rapid and robust as follows: ICLs > DSBs > monoadducts > oxidative lesions. Transcription inhibition reduced accumulation of CSB at sites of monoadducts and ICLs, but did not affect recruitment to (although slightly affected retention at) oxidative damage. Inhibition of histone deacetylation altered the dynamics of CSB assembly, suggesting a role for chromatin status in the response to DNA damage, whereas the proteasome inhibitor MG132 had no effect. The C-terminus of CSB, and in particular its ubiquitin-binding domain, were critical to recruitment, while the N-terminus and a functional ATPase domain played a minor role at best in facilitating protein accumulation. Although the absence of CSA had no effect on CSB recruitment, CSA itself localized at sites of ICLs, DSBs and monoadducts, but not oxidative lesions. Our results reveal molecular components of the CS protein response and point to a major involvement of complex lesions in the pathology of CS. PMID:26616585

  19. Molecular Cloning and Analysis of a DNA Repetitive Element from the Mouse Genome

    ERIC Educational Resources Information Center

    Geisinger, Adriana; Cossio, Gabriela; Wettstein, Rodolfo


    We report the development of a 3-week laboratory activity for an undergraduate molecular biology course. This activity introduces students to the practice of basic molecular techniques such as restriction enzyme digestion, agarose gel electrophoresis, cloning, plasmid DNA purification, Southern blotting, and sequencing. Students learn how to carry…

  20. The expanding universe of noncoding RNAs.


    Hannon, G J; Rivas, F V; Murchison, E P; Steitz, J A


    The 71st Cold Spring Harbor Symposium on Quantitative Biology celebrated the numerous and expanding roles of regulatory RNAs in systems ranging from bacteria to mammals. It was clearly evident that noncoding RNAs are undergoing a renaissance, with reports of their involvement in nearly every cellular process. Previously known classes of longer noncoding RNAs were shown to function by every possible means-acting catalytically, sensing physiological states through adoption of complex secondary and tertiary structures, or using their primary sequences for recognition of target sites. The many recently discovered classes of small noncoding RNAs, generally less than 35 nucleotides in length, most often exert their effects by guiding regulatory complexes to targets via base-pairing. With the ability to analyze the RNA products of the genome in ever greater depth, it has become clear that the universe of noncoding RNAs may extend far beyond the boundaries we had previously imagined. Thus, as much as the Symposium highlighted exciting progress in the field, it also revealed how much farther we must go to understand fully the biological impact of noncoding RNAs.

  1. Exploration of Noncoding Sequences in Metagenomes

    PubMed Central

    Tobar-Tosse, Fabián; Rodríguez, Adrián C.; Vélez, Patricia E.; Zambrano, María M.; Moreno, Pedro A.


    Environment-dependent genomic features have been defined for different metagenomes, whose genes and their associated processes are related to specific environments. Identification of ORFs and their functional categories are the most common methods for association between functional and environmental features. However, this analysis based on finding ORFs misses noncoding sequences and, therefore, some metagenome regulatory or structural information could be discarded. In this work we analyzed 23 whole metagenomes, including coding and noncoding sequences using the following sequence patterns: (G+C) content, Codon Usage (Cd), Trinucleotide Usage (Tn), and functional assignments for ORF prediction. Herein, we present evidence of a high proportion of noncoding sequences discarded in common similarity-based methods in metagenomics, and the kind of relevant information present in those. We found a high density of trinucleotide repeat sequences (TRS) in noncoding sequences, with a regulatory and adaptive function for metagenome communities. We present associations between trinucleotide values and gene function, where metagenome clustering correlate with microorganism adaptations and kinds of metagenomes. We propose here that noncoding sequences have relevant information to describe metagenomes that could be considered in a whole metagenome analysis in order to improve their organization, classification protocols, and their relation with the environment. PMID:23536879

  2. Survey of chimeric IStron elements in bacterial genomes: multiple molecular symbioses between group I intron ribozymes and DNA transposons

    PubMed Central

    Tourasse, Nicolas J.; Stabell, Fredrik B.; Kolstø, Anne-Brit


    IStrons are chimeric genetic elements composed of a group I intron associated with an insertion sequence (IS). The group I intron is a catalytic RNA providing the IStron with self-splicing ability, which renders IStron insertions harmless to the host genome. The IS element is a DNA transposon conferring mobility, and thus allowing the IStron to spread in genomes. IStrons are therefore a striking example of a molecular symbiosis between unrelated genetic elements endowed with different functions. In this study, we have conducted the first comprehensive survey of IStrons in sequenced genomes that provides insights into the distribution, diversity, origin and evolution of IStrons. We show that IStrons have a restricted phylogenetic distribution limited to two bacterial phyla, the Firmicutes and the Fusobacteria. Nevertheless, diverse IStrons representing two major groups targeting different insertion site motifs were identified. This taken with the finding that while the intron components of all IStrons belong to the same structural class, they are fused to different IS families, indicates that multiple intron–IS symbioses have occurred during evolution. In addition, introns and IS elements related to those that were at the origin of IStrons were also identified. PMID:25324310

  3. Exceptional structured noncoding RNAs revealed by bacterial metagenome analysis.


    Weinberg, Zasha; Perreault, Jonathan; Meyer, Michelle M; Breaker, Ronald R


    Estimates of the total number of bacterial species indicate that existing DNA sequence databases carry only a tiny fraction of the total amount of DNA sequence space represented by this division of life. Indeed, environmental DNA samples have been shown to encode many previously unknown classes of proteins and RNAs. Bioinformatics searches of genomic DNA from bacteria commonly identify new noncoding RNAs (ncRNAs) such as riboswitches. In rare instances, RNAs that exhibit more extensive sequence and structural conservation across a wide range of bacteria are encountered. Given that large structured RNAs are known to carry out complex biochemical functions such as protein synthesis and RNA processing reactions, identifying more RNAs of great size and intricate structure is likely to reveal additional biochemical functions that can be achieved by RNA. We applied an updated computational pipeline to discover ncRNAs that rival the known large ribozymes in size and structural complexity or that are among the most abundant RNAs in bacteria that encode them. These RNAs would have been difficult or impossible to detect without examining environmental DNA sequences, indicating that numerous RNAs with extraordinary size, structural complexity, or other exceptional characteristics remain to be discovered in unexplored sequence space.

  4. Promoter elements of the PHR1 gene of Saccharomyces cerevisiae and their roles in the response to DNA damage.

    PubMed Central

    Sancar, G B; Ferris, R; Smith, F W; Vandeberg, B


    The PHR1 gene of Saccharomyces cerevisiae encodes the apoenzyme for the DNA repair enzyme photolyase. PHR1 transcription is induced in response to 254 nm radiation and a variety of chemical damaging agents. We report here the identification of promoter elements required for PHR1 expression. Transcription is regulated primarily through three sequence elements clustered within a 120 bp region immediately upstream of the translational start site. A 20 bp interrupted palindrome comprises UASPHR1 and is responsible for 80-90% of basal and induced expression. UASPHR1 alone can activate transcription of a CYC1 minimal promoter but does not confer damage responsiveness. In the intact PHR1 promoter UAS function is dependent upon an upstream essential sequence (UES). URSPHR1 contains a binding site for the damage-responsive repressor Prp; consistent with this role, deletion or specific mutations of the URS increase basal level expression and decrease the induction ratio. Deletion of URSPHR1 also eliminates the requirement for UESPHR1 for promoter activation, indicating that the UES attenuates Prp-mediated repression. Sequences within UASPHR1 are similar to regulatory sequences found upstream of both damage responsive and nonresponsive genes involved in DNA repair and metabolism. PMID:7501452

  5. DNA sequences of Alu elements indicate a recent replacement of the human autosomal genetic complement

    SciTech Connect

    Knight, A.; Deininger, P.L.; Batzer, M.A.


    DNA sequences of neutral nuclear autosomal loci, compared across diverse human populations, provide a previously untapped perspective into the mode and tempo of the emergence of modern humans and a critical comparison with published clonally inherited mitochondrial DNA and Y chromosome measurements of human diversity. We obtained over 55 kilobases of sequence from three autosomal loci encompassing Alu repeats for representatives of diverse human populations as well as orthologous sequences for other hominoid species at one of these loci. Nucleotide diversity was exceedingly low. Most individuals and populations were identical. Only a single nucleotide difference distinguished presumed ancestral alleles from descendants. These results differ from those expected if alleles from divergent archaic populations were maintained through multiregional continuity. The observed virtual lack of sequence polymorphism is the signature of a recent single origin for modern humans, with general replacement of archaic populations. 47 refs., 2 figs., 1 tab.

  6. Transcription of Satellite III non-coding RNAs is a general stress response in human cells

    PubMed Central

    Valgardsdottir, Rut; Chiodi, Ilaria; Giordano, Manuela; Rossi, Antonio; Bazzini, Silvia; Ghigna, Claudia; Riva, Silvano; Biamonti, Giuseppe


    In heat-shocked human cells, heat shock factor 1 activates transcription of tandem arrays of repetitive Satellite III (SatIII) DNA in pericentromeric heterochromatin. Satellite III RNAs remain associated with sites of transcription in nuclear stress bodies (nSBs). Here we use real-time RT-PCR to study the expression of these genomic regions. Transcription is highly asymmetrical and most of the transcripts contain the G-rich strand of the repeat. A low level of G-rich RNAs is detectable in unstressed cells and a 104-fold induction occurs after heat shock. G-rich RNAs are induced by a wide range of stress treatments including heavy metals, UV-C, oxidative and hyper-osmotic stress. Differences exist among stressing agents both for the kinetics and the extent of induction (>100- to 80.000-fold). In all cases, G-rich transcripts are associated with nSBs. On the contrary, C-rich transcripts are almost undetectable in unstressed cells and modestly increase after stress. Production of SatIII RNAs after hyper-osmotic stress depends on the Tonicity Element Binding Protein indicating that activation of the arrays is triggered by different transcription factors. This is the first example of a non-coding RNA whose transcription is controlled by different transcription factors under different growth conditions. PMID:18039709

  7. Deep investigation of Arabidopsis thaliana junk DNA reveals a continuum between repetitive elements and genomic dark matter.


    Maumus, Florian; Quesneville, Hadi


    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant.

  8. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    NASA Astrophysics Data System (ADS)

    Štísová, Viktorie; Goffinont, Stephane; Spotheim-Maurizot, Melanie; Davídková, Marie


    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERα, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with γ rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  9. Deep Investigation of Arabidopsis thaliana Junk DNA Reveals a Continuum between Repetitive Elements and Genomic Dark Matter

    PubMed Central

    Maumus, Florian; Quesneville, Hadi


    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant. PMID:24709859

  10. The mouse albumin enhancer contains a negative regulatory element that interacts with a novel DNA-binding protein.

    PubMed Central

    Herbst, R S; Boczko, E M; Darnell, J E; Babiss, L E


    The far-upstream mouse albumin enhancer (-10.5 to -8.43 kilobases) has both positive and negative regulatory domains which contribute to the rate and tissue specificity of albumin gene transcription. (R. S. Herbst, N. Friedman, J. E. Darnell, Jr., and L. E. Babiss, Proc. Natl. Acad. Sci. USA 86:1553-1557). In this work, the negative regulatory region has been functionally localized to sequences -8.7 to -8.43 kilobases upstream of the albumin gene cap site. In the absence of the albumin-modulating region (in which there are binding sites for the transcription factor C/EBP), the negative region can suppress a neighboring positive-acting element, thereby interfering with albumin enhancer function. The negative region is also capable of negating the positive action of the heterologous transthyretin enhancer in an orientation-independent fashion. Within this negative-acting region we can detect two DNA-binding sites, both of which are recognized by a protein present in all cell types tested. This DNA-binding activity is not competed for by any of a series of known DNA-binding sites, and hence this new protein is a candidate for a role in suppressing the albumin gene in nonhepatic cells. Images PMID:2370857

  11. Comparative Analysis of Noncoding Regions of 77 Orthologous Mouse and Human Gene Pairs

    PubMed Central

    Jareborg, Niclas; Birney, Ewan; Durbin, Richard


    A data set of 77 genomic mouse/human gene pairs has been compiled from the EMBL nucleotide database, and their corresponding features determined. This set was used to analyze the degree of conservation of noncoding sequences between mouse and human. A new alignment algorithm was developed to cope with the fact that large parts of noncoding sequences are not alignable in a meaningful way because of genetic drift. This new algorithm, DNA Block Aligner (DBA), finds colinear-conserved blocks that are flanked by nonconserved sequences of varying lengths. The noncoding regions of the data set were aligned with DBA. The proportion of the noncoding regions covered by blocks >60% identical was 36% for upstream regions, 50% for 5′ UTRs, 23% for introns, and 56% for 3′ UTRs. These blocks of high identity were more or less evenly distributed across the length of the features, except for upstream regions in which the first 100 bp upstream of the transcription start site was covered in up to 70% of the gene pairs. This data set complements earlier sets on the basis of cDNA sequences and will be useful for further comparative studies. [This paper contains supplementary data that can be found at] PMID:10508839

  12. Non-coding RNAs as antibiotic targets.


    Colameco, Savannah; Elliot, Marie A


    Antibiotics inhibit a wide range of essential processes in the bacterial cell, including replication, transcription, translation and cell wall synthesis. In many instances, these antibiotics exert their effects through association with non-coding RNAs. This review highlights many classical antibiotic targets (e.g. rRNAs and the ribosome), explores a number of emerging targets (e.g. tRNAs, RNase P, riboswitches and small RNAs), and discusses the future directions and challenges associated with non-coding RNAs as antibiotic targets.

  13. Non-coding RNAs: the architects of eukaryotic complexity.


    Mattick, J S


    Around 98% of all transcriptional output in humans is non-coding RNA. RNA-mediated gene regulation is widespread in higher eukaryotes and complex genetic phenomena like RNA interference, co-suppression, transgene silencing, imprinting, methylation, and possibly position-effect variegation and transvection, all involve intersecting pathways based on or connected to RNA signaling. I suggest that the central dogma is incomplete, and that intronic and other non-coding RNAs have evolved to comprise a second tier of gene expression in eukaryotes, which enables the integration and networking of complex suites of gene activity. Although proteins are the fundamental effectors of cellular function, the basis of eukaryotic complexity and phenotypic variation may lie primarily in a control architecture composed of a highly parallel system of trans-acting RNAs that relay state information required for the coordination and modulation of gene expression, via chromatin remodeling, RNA-DNA, RNA-RNA and RNA-protein interactions. This system has interesting and perhaps informative analogies with small world networks and dataflow computing.

  14. From adjacent activation in Escherichia coli and DNA cyclization to eukaryotic enhancers: the elements of a puzzle

    PubMed Central

    Amouyal, Michèle


    Deoxyribonucleic acid cyclization, Escherichia coli lac repressor binding to two spaced lac operators and repression enhancement can be successfully used for a better understanding of the conditions required for interaction between eukaryotic enhancers and the machinery of transcription initiation. Chronologically, the DNA looping model has first accounted for the properties initially defining enhancers, i.e., independence of action with distance or orientation with respect to the start of transcription. It has also predicted enhancer activity or its disruption at short distance (site orientation, alignment between promoter and enhancer sites), with high-order complexes of protein, or with transcription factor concentrations close or different from the wild-type situation. In another step, histones have been introduced into the model to further adapt it to eukaryotes. They in fact favor DNA cyclization in vitro. The resulting DNA compaction might explain the difference counted in base pairs in the distance of action between eukaryotic transcription enhancers and prokaryotic repression enhancers. The lac looping system provides a potential tool for analysis of this discrepancy and of chromatin state directly in situ. Furthermore, as predicted by the model, the contribution of operators O2 and O3 to repression of the lac operon clearly depends on the lac repressor level in the cell and is prevented in strains overproducing lac repressor. By extension, gene regulation especially that linked to cell fate, should also depend on transcription factor levels, providing a potential tool for cellular therapy. In parallel, a new function of the O1–O3 loop completes the picture of lac repression. The O1–O3 loop would at the same time ensure high efficiency of repression, inducibility through the low-affinity sites and limitation of the level of repressor through self-repression of the lac repressor. Last, the DNA looping model can be successfully adapted to the enhancer

  15. The Hinge Region as a Key Regulatory Element of Androgen Receptor Dimerization, DNA Binding, and Transactivation

    DTIC Science & Technology


    led to a structure depicted in figure 1A. Two zinc coordinating modules that constitute the receptors DNA-binding domain, are involved in the...expression plasmid (reviewed in Claessens et al. 2001). This led first to the description of the PB-ARE-2 (Claessens et al. 1996), later of scARE and...constructs for specific mutants: has been done and is ongoing. This has led to most of the observations reported in section II of this report. iii.c

  16. Small polydispersed circular DNA contains strains of mobile genetic elements and occurs more frequently in permanent cell lines of malignant tumors than in normal lymphocytes.


    Schmidt, Hannelore; Taubert, Helge; Lange, Heidemarie; Kriese, Karen; Schmitt, Wolfgang Daniel; Hoffmann, Steve; Bartel, Frank; Hauptmann, Steffen


    Small polydispersed circular DNA (spcDNA) belongs to the extrachromosomal pool of DNA and is composed of heterogeneous DNA circles. Whether spcDNA has a special function is currently unclear but their occurrence was suggested to be linked to genetic instability. In this study we investigated as to whether human lymphocytes from healthy volunteers also harbour spcDNA and whether spcDNA is present in all permanent cell lines from human normal and malignant tissues. Moreover, we were interested to see whether spcDNA contains sequences of mobile genetic elements. Our results show that spcDNA is present in all samples investigated yet the amount is lower in normal lymphocytes when compared to cancer cell lines (5.4 vs. 17.8%). Alu sequences were present in 12/16 cancer cell lines whereas LINE-1 (L1) sequences were present in 15 of them. Six tumor cell lines also contained telomeric sequences. In contrast to that, spcDNA of normal lymphocytes contains Alu and L1 sequences only in 3/16 cases and no telomeric sequences at all. Our findings suggest a direct dependency of the amount of Alu and L1 sequences on that of spcDNA. Beside these repetitive sequences, sequencing of spcDNA revealed in most cases chromosomal sequences of almost all chromosomes without an increased frequency of single regions. We suggest that the whole spcDNA including retrotranspositional elements and telomeric sequences may play a role for chromosomal rearrangements and genomic instability.

  17. Linear amplification mediated PCR--localization of genetic elements and characterization of unknown flanking DNA.


    Gabriel, Richard; Kutschera, Ina; Bartholomae, Cynthia C; von Kalle, Christof; Schmidt, Manfred


    Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with integrating vector systems. Due to the stable integration of retroviral vectors, integration sites can be used to study the clonal fate of individual cells and their progeny. LAM- PCR for the first time provided evidence that leukemia in gene therapy treated patients originated from provirus induced overexpression of a neighboring proto-oncogene. The high sensitivity and specificity of LAM-PCR compared to existing methods like inverse PCR and ligation mediated (LM)-PCR is achieved by an initial preamplification step (linear PCR of 100 cycles) using biotinylated vector specific primers which allow subsequent reaction steps to be carried out on solid phase (magnetic beads). LAM-PCR is currently the most sensitive method available to identify unknown DNA which is located in the proximity of known DNA. Recently, a variant of LAM-PCR has been developed that circumvents restriction digest thus abrogating retrieval bias of integration sites and enables a comprehensive analysis of provirus locations in host genomes. The following protocol explains step-by-step the amplification of both 3'- and 5'- sequences adjacent to the integrated lentiviral vector.

  18. Key Structural Elements of Unsymmetrical Cyanine Dyes for Highly Sensitive Fluorescence Turn-On DNA Probes.


    Uno, Kakishi; Sasaki, Taeko; Sugimoto, Nagisa; Ito, Hideto; Nishihara, Taishi; Hagihara, Shinya; Higashiyama, Tetsuya; Sasaki, Narie; Sato, Yoshikatsu; Itami, Kenichiro


    Unsymmetrical cyanine dyes, such as thiazole orange, are useful for the detection of nucleic acids with fluorescence because they dramatically enhance the fluorescence upon binding to nucleic acids. Herein, we synthesized a series of unsymmetrical cyanine dyes and evaluated their fluorescence properties. A systematic structure-property relationship study has revealed that the dialkylamino group at the 2-position of quinoline in a series of unsymmetrical cyanine dyes plays a critical role in the fluorescence enhancement. Four newly designed unsymmetrical cyanine dyes showed negligible intrinsic fluorescence in the free state and strong fluorescence upon binding to double-stranded DNA (dsDNA) with a quantum yield of 0.53 to 0.90, which is 2 to 3 times higher than previous unsymmetrical cyanine dyes. A detailed analysis of the fluorescence lifetime revealed that the dialkylamino group at the 2-position of quinoline suppressed nonradiative decay in favor of increased fluorescence quantum yield. Moreover, these newly developed dyes were able to stain the nucleus specifically in fixed HeLa cells examined by using a confocal laser-scanning microscope.

  19. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.


    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  20. Non-coding genetic variants in human disease.


    Zhang, Feng; Lupski, James R


    Genetic variants, including single-nucleotide variants (SNVs) and copy number variants (CNVs), in the non-coding regions of the human genome can play an important role in human traits and complex diseases. Most of the genome-wide association study (GWAS) signals map to non-coding regions and potentially point to non-coding variants, whereas their functional interpretation is challenging. In this review, we discuss the human non-coding variants and their contributions to human diseases in the following four parts. (i) Functional annotations of non-coding SNPs mapped by GWAS: we discuss recent progress revealing some of the molecular mechanisms for GWAS signals affecting gene function. (ii) Technical progress in interpretation of non-coding variants: we briefly describe some of the technologies for functional annotations of non-coding variants, including the methods for genome-wide mapping of chromatin interaction, computational tools for functional predictions and the new genome editing technologies useful for dissecting potential functional consequences of non-coding variants. (iii) Non-coding CNVs in human diseases: we review our emerging understanding the role of non-coding CNVs in human disease. (iv) Compound inheritance of large genomic deletions and non-coding variants: compound inheritance at a locus consisting of coding variants plus non-coding ones is described.

  1. Non-coding genetic variants in human disease

    PubMed Central

    Zhang, Feng; Lupski, James R.


    Genetic variants, including single-nucleotide variants (SNVs) and copy number variants (CNVs), in the non-coding regions of the human genome can play an important role in human traits and complex diseases. Most of the genome-wide association study (GWAS) signals map to non-coding regions and potentially point to non-coding variants, whereas their functional interpretation is challenging. In this review, we discuss the human non-coding variants and their contributions to human diseases in the following four parts. (i) Functional annotations of non-coding SNPs mapped by GWAS: we discuss recent progress revealing some of the molecular mechanisms for GWAS signals affecting gene function. (ii) Technical progress in interpretation of non-coding variants: we briefly describe some of the technologies for functional annotations of non-coding variants, including the methods for genome-wide mapping of chromatin interaction, computational tools for functional predictions and the new genome editing technologies useful for dissecting potential functional consequences of non-coding variants. (iii) Non-coding CNVs in human diseases: we review our emerging understanding the role of non-coding CNVs in human disease. (iv) Compound inheritance of large genomic deletions and non-coding variants: compound inheritance at a locus consisting of coding variants plus non-coding ones is described. PMID:26152199

  2. Long noncoding RNAs in cardiovascular diseases.


    Uchida, Shizuka; Dimmeler, Stefanie


    In recent year, increasing evidence suggests that noncoding RNAs play important roles in the regulation of tissue homeostasis and pathophysiological conditions. Besides small noncoding RNAs (eg, microRNAs), >200-nucleotide long transcripts, namely long noncoding RNAs (lncRNAs), can interfere with gene expressions and signaling pathways at various stages. In the cardiovascular system, studies have detected and characterized the expression of lncRNAs under normal physiological condition and in disease states. Several lncRNAs are regulated during acute myocardial infarction (eg, Novlnc6) and heart failure (eg, Mhrt), whereas others control hypertrophy, mitochondrial function and apoptosis of cardiomyocytes. In the vascular system, the endothelial-expressed lncRNAs (eg, MALAT1 and Tie-1-AS) can regulate vessel growth and function, whereas the smooth-muscle-expressed lncRNA smooth muscle and endothelial cell-enriched migration/differentiation-associated long noncoding RNA was recently shown to control the contractile phenotype of smooth muscle cells. This review article summarizes the data on lncRNA expressions in mouse and human and highlights identified cardiovascular lncRNAs that might play a role in cardiovascular diseases. Although our understanding of lncRNAs is still in its infancy, these examples may provide helpful insights how lncRNAs interfere with cardiovascular diseases.

  3. A dispersed family of repetitive DNA sequences exhibits characteristics of a transposable element in the genus Lycopersicon.


    Young, R J; Francis, D M; St Clair, D A; Taylor, B H


    A segment of DNA 5' to the transcribed region of an auxin-regulated gene, ARPI, from Lycopersicon esculentum Mill. cv. VFN8 contains a sequence with the structural characteristics of a transposable element. The putative element (Lyt1) is 1340 bp long, has terminal inverted repeats of approximately 235 bp and is flanked by 9-bp direct repeats. Lyt1 has a structure similar to the Robertson's Mutator (Mu) family from maize. The terminal inverted repeats are 80% AT-rich, are 96.6% identical, and define a larger family of repetitive elements. Southern analysis and genomic dot-blot reconstructions detected at least 41 copies of Lyt1-hybridizing sequences in red-fruited Lycopersicon spp. (L. esculentum, L. pimpinellifolium and L. cheesmanii), and 2-8 copies in the green-fruited species (L. hirsutum, L. pennellii, L. peruvianum, L. chilense and L. chmielewskii). There were two to four copies in the Solanum spp. closely allied with the genus Lycopersicon (S. lycopersicoides, S. ochranthum and S. juglandifolium), while the more distantly related Solanum spp. showed little (one to two copies in S. tuberosum) to no (S. quitoense) detectable hybridization under stringent conditions. Linkage analysis in the F2 progeny of a cross between L. esculentum and L. cheesmanii indicated that at least six loci that hybridize to the Lyt1 sequence are dispersed in the genome. Polymerase chain reaction and Southern analyses revealed that some red-fruited accessions and L. chmielewskii lacked Lyt1 5' to the transcribed region of ARPI. Subsequent sequence analysis indicated that only one copy of the 9-bp direct repeat (target site) was present, suggesting that transposition of the element into the ARPI gene occurred after the divergence of the red-fruited and green-fruited Lycopersicon species.

  4. Making a long story short: noncoding RNAs and chromosome change

    PubMed Central

    Brown, J D; Mitchell, S E; O'Neill, R J


    As important as the events that influence selection for specific chromosome types in the derivation of novel karyotypes, are the events that initiate the changes in chromosome number and structure between species, and likewise polymorphisms, variants and disease states within species. Although once thought of as transcriptional ‘noise', noncoding RNAs (ncRNAs) are now recognized as important mediators of epigenetic regulation and chromosome stability. Here we highlight recent work that illustrates the influence short and long ncRNAs have as participants in the function and stability of chromosome regions such as centromeres, telomeres, evolutionary breakpoints and fragile sites. We summarize recent evidence that ncRNAs can facilitate chromosome change and present mechanisms by which ncRNAs create DNA breaks. Finally, we present hypotheses on how they may create novel karyotypes and thus affect chromosome evolution. PMID:22072070

  5. Exotic Archaeology:. Searching for Superheavy Elements in Nature and Dating Human DNA with the 14C Bomb Peak

    NASA Astrophysics Data System (ADS)

    Kutschera, Walter; Dellinger, Franz; Liebl, Jakob; Steier, Peter


    This contribution conveys the power of accelerator mass spectrometry (AMS) to measure ultra-low traces of long-lived radionuclides in two highly divers fields: Astrophysics and molecular biology. Our search for nuclides of superheavy elements (SHE) in several natural materials did not confirm the claims of positive evidence for SHEs reported by the group of Amnon Marinov from Jerusalem, even though the sensitivity of our AMS measurements were several orders of magnitude higher. We also report on the investigation by the group of Kirsty Spalding from Stockholm to date human DNA with the 14C bomb peak. This allows one to determine retrospectively the birth date of cells in sections of the human body. Ongoing efforts to miniaturize carbon samples down to the level of 10 μg C for AMS measurements will allow one to venture into ever smaller subsections of the human brain.

  6. Evidence that the large noncoding sequence is the main control region of maternally and paternally transmitted mitochondrial genomes of the marine mussel (Mytilus spp.).

    PubMed Central

    Cao, Liqin; Kenchington, Ellen; Zouros, Eleftherios; Rodakis, George C


    Both the maternal (F-type) and paternal (M-type) mitochondrial genomes of the Mytilus species complex M. edulis/galloprovincialis contain a noncoding sequence between the l-rRNA and the tRNA(Tyr) genes, here called the large unassigned region (LUR). The LUR, which is shorter in M genomes, is capable of forming secondary structures and contains motifs of significant sequence similarity with elements known to have specific functions in the sea urchin and the mammalian control region. Such features are not present in other noncoding regions of the F or M Mytilus mtDNA. The LUR can be divided on the basis of indels and nucleotide variation in three domains, which is reminiscent of the tripartite structure of the mammalian control region. These features suggest that the LUR is the main control region of the Mytilus mitochondrial genome. The middle domain has diverged by only 1.5% between F and M genomes, while the average divergence over the whole molecule is approximately 20%. In contrast, the first domain is among the most divergent parts of the genome. This suggests that different parts of the LUR are under different selection constraints that are also different from those acting on the coding parts of the molecule. PMID:15238532

  7. Monomethylated trivalent arsenic species disrupt steroid receptor interactions with their DNA response elements at non-cytotoxic cellular concentrations

    PubMed Central

    Gosse, Julie A.; Taylor, Vivien F.; Jackson, Brian P.; Hamilton, Joshua W.; Bodwell, Jack E.


    Arsenic (As) is considered a top environmental chemical of human health because it has been linked to adverse health effects including cancer, diabetes, cardiovascular disease, and reproductive and developmental problems. In several cell culture and animal models, As acts as an endocrine disruptor, which may underlie many of its health effects. Previous work showed that steroid receptor (SR)-driven gene expression is disrupted in cells treated with inorganic As (arsenite, iAs+3). In those studies, low iAs+3 concentrations (0.1–0.7 μM) stimulated hormone-inducible transcription, whereas somewhat higher but still non-cytotoxic levels (1–3 μM) inhibited transcription. This investigation focuses on the mechanisms underlying these inhibitory effects and evaluates the role of methylated trivalent As metabolites on SR function. Recent evidence suggests that, compared with iAs, methylated forms may have distinct biochemical effects. Here, fluorescence polarization (FP) experiments utilizing purified, hormone-bound human glucocorticoid (GR) and progesterone receptor (PR) have demonstrated that neither inorganic (iAs+3) nor dimethylated (DMA+3) species of trivalent As affect receptor interactions with glucocorticoid DNA response elements (GREs). However, monomethylated forms (monomethylarsenite, MMA+3 and monomethylarsonic diglutathione, MADG) strongly inhibit GR-GRE and PR-GRE binding. Additionally, speciation studies of iAs+3-treated H4IIE rat hepatoma cells show that, under treatment conditions that cause inhibition of hormone-inducible gene transcription, the intracellular concentration of MADG is sufficient to inhibit GR-GRE and PR-GRE interactions in vivo. These results indicate that arsenic’s inhibitory endocrine disruption effects are probably caused in part by methylated metabolites’ disruption of SR ability to bind DNA response elements that are crucial to hormone-driven gene transcription. PMID:23765520

  8. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary


    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  9. The DNA unwinding element binding protein DUE-B interacts with Cdc45 in preinitiation complex formation.


    Chowdhury, A; Liu, G; Kemp, M; Chen, X; Katrangi, N; Myers, S; Ghosh, M; Yao, J; Gao, Y; Bubulya, P; Leffak, M


    Template unwinding during DNA replication initiation requires the loading of the MCM helicase activator Cdc45 at replication origins. We show that Cdc45 interacts with the DNA unwinding element (DUE) binding protein DUE-B and that these proteins localize to the DUEs of active replication origins. DUE-B and Cdc45 are not bound at the inactive c-myc replicator in the absence of a functional DUE or at the recently identified ataxin 10 (ATX10) origin, which is silent before disease-related (ATTCT)(n) repeat length expansion of its DUE sequence, despite the presence of the origin recognition complex (ORC) and MCM proteins at these origins. Addition of a heterologous DUE to the ectopic c-myc origin, or expansion of the ATX10 DUE, leads to origin activation, DUE-B binding, and Cdc45 binding. DUE-B, Cdc45, and topoisomerase IIbeta binding protein 1 (TopBP1) form complexes in cell extracts and when expressed from baculovirus vectors. During replication in Xenopus egg extracts, DUE-B and Cdc45 bind to chromatin with similar kinetics, and DUE-B immunodepletion blocks replication and the loading of Cdc45 and a fraction of TopBP1. The coordinated binding of DUE-B and Cdc45 to origins and the physical interactions of DUE-B, Cdc45, and TopBP1 suggest that complexes of these proteins are necessary for replication initiation.

  10. Genomic Organization of Repetitive DNA Elements and Its Implications for the Chromosomal Evolution of Channid Fishes (Actinopterygii, Perciformes)

    PubMed Central

    Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Villa, Mateo Andres; de Oliveira, Ezequiel Aguiar; Tanomtong, Alongklod; Yano, Cassia Fernanda; Supiwong, Weerayuth; Chaveerach, Arunrat


    Channid fishes, commonly referred to as “snakeheads”, are currently very important in Asian fishery and aquaculture due to the substantial decline in natural populations because of overexploitation. A large degree of chromosomal variation has been found in this family, mainly through the use of conventional cytogenetic investigations. In this study, we analyzed the karyotype structure and the distribution of 7 repetitive DNA sequences in several Channa species from different Thailand river basins. The aim of this study was to investigate the chromosomal differentiation among species and populations to improve upon the knowledge of its biodiversity and evolutionary history. Rearrangements, such as pericentric inversions, fusions and polyploidization, appear to be important events during the karyotypic evolution of this genus, resulting in the chromosomal diversity observed among the distinct species and even among populations of the same species. In addition, such variability is also increased by the genomic dynamism of repetitive elements, particularly by the differential distribution and accumulation of rDNA sequences on chromosomes. This marked diversity is likely linked to the lifestyle of the snakehead fishes and their population fragmentation, as already identified for other fish species. The karyotypic features highlight the biodiversity of the channid fishes and justify a taxonomic revision of the genus Channa, as well as of the Channidae family as a whole, as some nominal species may actually constitute species complexes. PMID:26067030

  11. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.


    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W


    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  12. Structural polymorphism within a regulatory element of the human KRAS promoter: formation of G4-DNA recognized by nuclear proteins

    PubMed Central

    Cogoi, Susanna; Paramasivam, Manikandan; Spolaore, Barbara; Xodo, Luigi E.


    The human KRAS proto-oncogene contains a critical nuclease hypersensitive element (NHE) upstream of the major transcription initiation site. In this article, we demonstrate by primer-extension experiments, PAGE, chemical footprinting, CD, UV and FRET experiments that the G-rich strand of NHE (32R) folds into intra-molecular G-quadruplex structures. Fluorescence data show that 32R in 100 mM KCl melts with a biphasic profile, showing the formation of two distinct G-quadruplexes with Tm of ∼55°C (Q1) and ∼72°C (Q2). DMS-footprinting and CD suggest that Q1 can be a parallel and Q2 a mixed parallel/antiparallel G-quadruplex. When dsNHE (32R hybridized to its complementary) is incubated with a nuclear extract from Panc-1 cells, three DNA–protein complexes are observed by EMSA. The complex of slower mobility is competed by quadruplex 32R, but not by mutant oligonucleotides, which cannot form a quadruplex structure. Using paramagnetic beads coupled with 32R, we pulled down from the Panc-1 extract proteins with affinity for quadruplex 32R. One of these is the heterogeneous nuclear ribonucleoprotein A1, which was previously reported to unfold quadruplex DNA. Our study suggests a role of quadruplex DNA in KRAS transcription and provides the basis for the rationale design of molecular strategies to inhibit the expression of KRAS. PMID:18490377

  13. The decalog of long non-coding RNA involvement in cancer diagnosis and monitoring.


    Kunej, Tanja; Obsteter, Jana; Pogacar, Ziva; Horvat, Simon; Calin, George Adrian


    Long non-coding RNAs (lncRNAs) are transcripts without protein-coding capacity; initially regarded as "transcriptional noise", lately they have emerged as essential factors in both cell biology and mechanisms of disease. In this article, we present basic knowledge of lncRNA molecular mechanisms, associated physiological processes and cancer association, as well as their diagnostic and therapeutic value in the form of a decalog: (1) Non-coding RNAs (ncRNAs) are transcripts without protein-coding capacity divided by size (short and long ncRNAs), function (housekeeping RNA and regulatory RNA) and direction of transcription (sense/antisense, bidirectional, intronic and intergenic), containing a broad range of molecules with diverse properties and functions, such as messenger RNA, transfer RNA, microRNA and long non-coding RNAs. (2) Long non-coding RNAs are implicated in many molecular mechanisms, such as transcriptional regulation, post-transcriptional regulation and processing of other short ncRNAs. (3) Long non-coding RNAs play an important role in many physiological processes such as X-chromosome inactivation, cell differentiation, immune response and apoptosis. (4) Long non-coding RNAs have been linked to hallmarks of cancer: (a) sustaining proliferative signaling; (b) evading growth suppressors; (c) enabling replicative immortality; (d) activating invasion and metastasis; (e) inducing angiogenesis; (f) resisting cell death; and (g) reprogramming energy metabolism. (5) Regarding their impact on cancer cells, lncRNAs are divided into two groups: oncogenic and tumor-suppressor lncRNAs. (6) Studies of lncRNA involvement in cancer usually analyze deregulated expression patterns at the RNA level as well as the effects of single nucleotide polymorphisms and copy number variations at the DNA level. (7) Long non-coding RNAs have potential as novel biomarkers due to tissue-specific expression patterns, efficient detection in body fluids and high stability. (8) LncRNAs serve

  14. Origin recognition specificity in pT181 plasmids is determined by a functionally asymmetric palindromic DNA element.

    PubMed Central

    Wang, P Z; Projan, S J; Henriquez, V; Novick, R P


    The leading strand replication origin of pT181 plasmids consists of two adjacent inverted repeat elements (IR-II and IR-III), which are involved in origin recognition by the initiator (Rep) protein. The conserved core element, IR-II, which contains the initiation nick site, is induced by Rep to form a cruciform structure, probably the primary substrate for the initiation of rolling circle replication. The divergent repeat, IR-III, constitutes the determinant of origin recognition specificity. We show here that the distal arm of IR-III is not required for sequence-specific recognition, whereas the proximal arm and central region are required. Since the initiator is dimeric, we presume that it binds symmetrically to IR-III. A unique type of DNA-protein interaction is proposed, in which the lack of sequence requirement for the distal arm is a consequence of binding to the adjacent IR-II, which thereby polarizes the stringency of binding to the two arms of IR-III. In addition, genetic evidence indicates that both the spacing and the phasing of IR-II to IR-III are crucial for function and that the central segment of IR-III may serve to position the two flanking half-sites for optimal interaction of Rep with IR-III. Images PMID:8428593

  15. An amphipathic trans-acting phosphorothioate DNA element delivers uncharged PNA and PMO nucleic acid sequences in mammalian cells

    PubMed Central

    Jain, Harsh V.; Beaucage, Serge L.


    An innovative approach to the delivery of uncharged peptide nucleic acids (PNA) and phosphorodiamidate morpholino (PMO) oligomers in mammalian cells is described and consists of extending the sequence of those oligomers with a short PNA-polyA or PMO-polyA tail. Recognition of the polyA-tailed PNA or PMO oligomers by an amphipathic trans-acting polythymidylic thiophosphate triester element (dTtaPS) results in efficient internalization of those oligomers in several cell lines. Our findings indicate that cellular uptake of the oligomers occurs through an energy-dependent mechanism and macropinocytosis appears to be the predo-minant endocytic pathway used for internalization. The functionality of the internalized oligomers is demonstrated by alternate splicing of the pre-mRNA encoding luciferase in HeLa pLuc 705 cells. Amphipathic phosphorothioate DNA elements may represent a unique class of cellular transporters for robust delivery of uncharged nucleic acid sequences in live mammalian cells. PMID:27516815

  16. Open chromatin profiling of human postmortem brain infers functional roles for non-coding schizophrenia loci.


    Fullard, John F; Giambartolomei, Claudia; Hauberg, Mads E; Xu, Ke; Voloudakis, Georgios; Shao, Zhiping; Bare, Christopher; Dudley, Joel T; Mattheisen, Manuel; Robakis, Nikolaos K; Haroutunian, Vahram; Roussos, Panos


    Open chromatin provides access to DNA binding proteins for the correct spatiotemporal regulation of gene expression. Mapping chromatin accessibility has been widely used to identify the location of cis regulatory elements (CREs) including promoters and enhancers. CREs show tissue- and cell-type specificity and disease-associated variants are often enriched for CREs in the tissues and cells that pertain to a given disease. To better understand the role of CREs in neuropsychiatric disorders we applied the Assay for Transposase Accessible Chromatin followed by sequencing (ATAC-seq) to neuronal and non-neuronal nuclei isolated from frozen postmortem human brain by fluorescence-activated nuclear sorting (FANS). Most of the identified open chromatin regions (OCRs) are differentially accessible between neurons and non-neurons, and show enrichment with known cell type markers, promoters and enhancers. Relative to those of non-neurons, neuronal OCRs are more evolutionarily conserved and are enriched in distal regulatory elements. Transcription factor (TF) footprinting analysis identifies differences in the regulome between neuronal and non-neuronal cells and ascribes putative functional roles to a number of non-coding schizophrenia (SCZ) risk variants. Among the identified variants is a Single Nucleotide Polymorphism (SNP) proximal to the gene encoding SNX19. In vitro experiments reveal that this SNP leads to an increase in transcriptional activity. As elevated expression of SNX19 has been associated with SCZ, our data provides evidence that the identified SNP contributes to disease. These results represent the first analysis of OCRs and TF binding sites in distinct populations of postmortem human brain cells and further our understanding of the regulome and the impact of neuropsychiatric disease-associated genetic risk variants.

  17. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.


    Periz, G; Keller, L R


    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements.

  18. Characterization of sequence elements from Malvastrum yellow vein betasatellite regulating promoter activity and DNA replication

    PubMed Central


    Background Many monopartite begomoviruses are associated with betasatellites, but only several promoters from which were isolated and studied. In this study, the βC1 promoter from Malvastrum yellow vein betasatellite (MYVB) was characterized and important sequence elements were identified to modulate promoter activity and replication of MYVB. Results A 991 nucleotide (nt) fragment upstream of the translation start site of the βC1 open reading frame of MYVB and a series of deletions within this fragment were constructed and fused to the β-glucuronidase (GUS) and green fluorescent protein (GFP) reporter genes, respectively. Agrobacterium-mediated transient expression assays showed that the 991 nt fragment was functional and that a 28 nt region (between −390 nt and −418 nt), which includes a 5′UTR Py-rich stretch motif, was important for promoter activity. Replication assays using Nicotiana benthamiana leaf discs and whole plants showed that deletion of the 5′UTR Py-rich stretch impaired viral satellite replication in the presence of the helper virus. Transgenic assays demonstrated that the 991 nt fragment conferred a constitutive expression pattern in transgenic tobacco plants and that a 214 nt fragment at the 3'-end of this sequence was sufficient to drive this expression pattern. Conclusion Our results showed that the βC1 promoter of MYVB displayed a constitutive expression pattern and a 5′UTR Py-rich stretch motif regulated both βC1 promoter activity and MYVB replication. PMID:23057573

  19. Noncoding somatic and inherited single-nucleotide variants converge to promote ESR1 expression in breast cancer

    PubMed Central

    Bailey, Swneke D.; Desai, Kinjal; Kron, Ken J.; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A.; Treloar, Aislinn E.; Dowar, Mark; Thu, Kelsie L.; Cescon, David W.; Silvester, Jennifer; Yang, S. Y. Cindy; Wu, Xue; Pezo, Rossanna C.; Haibe-Kains, Benjamin; Mak, Tak W.; Bedard, Philippe L.; Pugh, Trevor J.; Sallari, Richard C.; Lupien, Mathieu


    Sustained expression of the oestrogen receptor alpha (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon oestrogen stimulation to establish an oncogenic expression program1. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers2–5, implying that other mechanisms underlie the persistent expression of ESR1. We report the significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by a functional inherited single nucleotide variant (SNV) rs9383590 that accounts for several breast cancer risk-loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer. PMID:27571262

  20. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy


    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  1. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules.


    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy


    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  2. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    SciTech Connect

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy


    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  3. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.


    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  4. Conserved Noncoding Sequences in the Grasses4

    PubMed Central

    Inada, Dan Choffnes; Bashir, Ali; Lee, Chunghau; Thomas, Brian C.; Ko, Cynthia; Goff, Stephen A.; Freeling, Michael


    As orthologous genes from related species diverge over time, some sequences are conserved in noncoding regions. In mammals, large phylogenetic footprints, or conserved noncoding sequences (CNSs), are known to be common features of genes. Here we present the first large-scale analysis of plant genes for CNSs. We used maize and rice, maximally diverged members of the grass family of monocots. Using a local sequence alignment set to deliver only significant alignments, we found one or more CNSs in the noncoding regions of the majority of genes studied. Grass genes have dramatically fewer and much smaller CNSs than mammalian genes. Twenty-seven percent of grass gene comparisons revealed no CNSs. Genes functioning in upstream regulatory roles, such as transcription factors, are greatly enriched for CNSs relative to genes encoding enzymes or structural proteins. Further, we show that a CNS cluster in an intron of the knotted1 homeobox gene serves as a site of negative regulation. We showthat CNSs in the adh1 gene do not correlate with known cis-acting sites. We discuss the potential meanings of CNSs and their value as analytical tools and evolutionary characters. We advance the idea that many CNSs function to lock-in gene regulatory decisions. PMID:12952874

  5. Protein phosphatase 2A and Cdc7 kinase regulate the DNA unwinding element-binding protein in replication initiation.


    Gao, Yanzhe; Yao, Jianhong; Poudel, Sumeet; Romer, Eric; Abu-Niaaj, Lubna; Leffak, Michael


    The DNA unwinding element (DUE)-binding protein (DUE-B) binds to replication origins coordinately with the minichromosome maintenance (MCM) helicase and the helicase activator Cdc45 in vivo, and loads Cdc45 onto chromatin in Xenopus egg extracts. Human DUE-B also retains the aminoacyl-tRNA proofreading function of its shorter orthologs in lower organisms. Here we report that phosphorylation of the DUE-B unstructured C-terminal domain unique to higher organisms regulates DUE-B intermolecular binding. Gel filtration analyses show that unphosphorylated DUE-B forms multiple high molecular weight (HMW) complexes. Several aminoacyl-tRNA synthetases and Mcm2-7 proteins were identified by mass spectrometry of the HMW complexes. Aminoacyl-tRNA synthetase binding is RNase A sensitive, whereas interaction with Mcm2-7 is nuclease resistant. Unphosphorylated DUE-B HMW complex formation is decreased by PP2A inhibition or direct DUE-B phosphorylation, and increased by inhibition of Cdc7. These results indicate that the state of DUE-B phosphorylation is maintained by the equilibrium between Cdc7-dependent phosphorylation and PP2A-dependent dephosphorylation, each previously shown to regulate replication initiation. Alanine mutation of the DUE-B C-terminal phosphorylation target sites increases MCM binding but blocks Cdc45 loading in vivo and inhibits cell division. In egg extracts alanine mutation of the DUE-B C-terminal phosphorylation sites blocks Cdc45 loading and inhibits DNA replication. The effects of DUE-B C-terminal phosphorylation reveal a novel S phase kinase regulatory mechanism for Cdc45 loading and MCM helicase activation.

  6. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element

    PubMed Central

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko


    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5′-NNCCAC-3′ and 5′-GCGMGN′N′-3′ (M:A or C; N and N′ form Watson–Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences. PMID:23709277

  7. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sha...

  8. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.


    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi


    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  9. Long Noncoding RNA Identification: Comparing Machine Learning Based Tools for Long Noncoding Transcripts Discrimination

    PubMed Central

    Liang, Yanchun


    Long noncoding RNA (lncRNA) is a kind of noncoding RNA with length more than 200 nucleotides, which aroused interest of people in recent years. Lots of studies have confirmed that human genome contains many thousands of lncRNAs which exert great influence over some critical regulators of cellular process. With the advent of high-throughput sequencing technologies, a great quantity of sequences is waiting for exploitation. Thus, many programs are developed to distinguish differences between coding and long noncoding transcripts. Different programs are generally designed to be utilised under different circumstances and it is sensible and practical to select an appropriate method according to a certain situation. In this review, several popular methods and their advantages, disadvantages, and application scopes are summarised to assist people in employing a suitable method and obtaining a more reliable result. PMID:28042575

  10. Long Noncoding RNA Identification: Comparing Machine Learning Based Tools for Long Noncoding Transcripts Discrimination.


    Han, Siyu; Liang, Yanchun; Li, Ying; Du, Wei


    Long noncoding RNA (lncRNA) is a kind of noncoding RNA with length more than 200 nucleotides, which aroused interest of people in recent years. Lots of studies have confirmed that human genome contains many thousands of lncRNAs which exert great influence over some critical regulators of cellular process. With the advent of high-throughput sequencing technologies, a great quantity of sequences is waiting for exploitation. Thus, many programs are developed to distinguish differences between coding and long noncoding transcripts. Different programs are generally designed to be utilised under different circumstances and it is sensible and practical to select an appropriate method according to a certain situation. In this review, several popular methods and their advantages, disadvantages, and application scopes are summarised to assist people in employing a suitable method and obtaining a more reliable result.

  11. A novel regulatory element (E77) isolated from CHO‐K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells

    PubMed Central

    Kang, Shin‐Young; Kim, Yeon‐Gu; Kang, Seunghee; Lee, Hong Weon


    Abstract Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO‐K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO‐K1 genomic DNA fragments with a CMV promoter‐driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  12. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.


    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo


    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study.

  13. The achaete-scute complex in Diptera: patterns of noncoding sequence evolution.


    Negre, B; Simpson, P


    The achaete-scute complex (AS-C) has been a useful paradigm for the study of pattern formation and its evolution. achaete-scute genes have duplicated and evolved distinct expression patterns during the evolution of cyclorraphous Diptera. Are the expression patterns in different species driven by conserved regulatory elements? If so, when did such regulatory elements arise? Here, we have sequenced most of the AS-C of the fly Calliphora vicina (including the genes achaete, scute and lethal of scute) to compare noncoding sequences with known cis-regulatory sequences in Drosophila. The organization of the complex is conserved with respect to Drosophila species. There are numerous small stretches of conserved noncoding sequence that, in spite of high sequence turnover, display binding sites for known transcription factors. Synteny of the blocks of conserved noncoding sequences is maintained suggesting not only conservation of the position of regulatory elements but also an origin prior to the divergence between these two species. We propose that some of these enhancers originated by duplication with their target genes.

  14. Non-Coding RNAs in Neural Networks, REST-Assured

    PubMed Central

    Rossbach, Michael


    In the nervous system, several key steps in cellular complexity and development are regulated by non-coding RNAs (ncRNAs) and the repressor element-1 silencing transcription factor/neuron-restrictive silencing factor (REST/NRSF). REST recruits gene regulatory complexes to regulatory sequences, among them the repressor element-1/neuron-restrictive silencer element, and mediates developmental stage-specific gene expression or repression, chromatin (re-)organization or silencing for protein-coding genes as well as for several ncRNAs like microRNAs, short interfering RNAs or long ncRNAs. NcRNAs are far from being just transcriptional noise and are involved in chromatin accessibility, transcription and post-transcriptional processing, trafficking, or RNA editing. REST and its cofactor CoREST are both highly regulated through various ncRNAs. The importance of the correct regulation within the ncRNA network, the ncRNAome, is demonstrated when it comes to a deregulation of REST and/or ncRNAs associated with molecular pathophysiology underlying diverse disorders including neurodegenerative diseases or brain tumors. PMID:22303307

  15. Kaposi's sarcoma-associated herpesvirus Rta tetramers make high-affinity interactions with repetitive DNA elements in the Mta promoter to stimulate DNA binding of RBP-Jk/CSL.


    Palmeri, Diana; Carroll, Kyla Driscoll; Gonzalez-Lopez, Olga; Lukac, David M


    Kaposi's sarcoma-associated herpesvirus (KSHV; also known as human herpesvirus 8 [HHV-8]) is the etiologic agent of Kaposi's sarcoma (KS) and lymphoproliferative diseases. We previously demonstrated that the KSHV lytic switch protein Rta stimulates DNA binding of the cellular RBP-Jk/CSL protein, the nuclear component of the Notch pathway, on Rta target promoters. In the current study, we define the promoter requirements for formation of transcriptionally productive Rta/RBP-Jk/DNA complexes. We show that highly pure Rta footprints 7 copies of a previously undescribed repetitive element in the promoter of the essential KSHV Mta gene. We have termed this element the "CANT repeat." CANT repeats are found on both strands of DNA and have a consensus sequence of ANTGTAACANT(A/T)(A/T)T. We demonstrate that Rta tetramers make high-affinity interactions (i.e., nM) with 64 bp of the Mta promoter but not single CANT units. The number of CANT repeats, their presence in palindromes, and their positions relative to the RBP-Jk binding site determine the optimal target for Rta stimulation of RBP-Jk DNA binding and formation of ternary Rta/RBP-Jk/DNA complexes. DNA binding and tetramerization mutants of Rta fail to stimulate RBP-Jk DNA binding. Our chromatin immunoprecipitation assays show that RBP-Jk DNA binding is broadly, but selectively, stimulated across the entire KSHV genome during reactivation. We propose a model in which tetramerization of Rta allows it to straddle RBP-Jk and contact repeat units on both sides of RBP-Jk. Our study integrates high-affinity Rta DNA binding with the requirement for a cellular transcription factor in Rta transactivation.

  16. Rational Design of Small Molecules Targeting Oncogenic Noncoding RNAs from Sequence.


    Disney, Matthew D; Angelbello, Alicia J


    The discovery of RNA catalysis in the 1980s and the dissemination of the human genome sequence at the start of this century inspired investigations of the regulatory roles of noncoding RNAs in biology. In fact, the Encyclopedia of DNA Elements (ENCODE) project has shown that only 1-2% of the human genome encodes protein, yet 75% is transcribed into RNA. Functional studies both preceding and following the ENCODE project have shown that these noncoding RNAs have important roles in regulating gene expression, developmental timing, and other critical functions. RNA's diverse roles are often a consequence of the various folds that it adopts. The single-stranded nature of the biopolymer enables it to adopt intramolecular folds with noncanonical pairings to lower its free energy. These folds can be scaffolds to bind proteins or to form frameworks to interact with other RNAs. Not surprisingly, dysregulation of certain noncoding RNAs has been shown to be causative of disease. Given this as the background, it is easy to see why it would be useful to develop methods that target RNA and manipulate its biology in rational and predictable ways. The antisense approach has afforded strategies to target RNAs via Watson-Crick base pairing and has typically focused on targeting partially unstructured regions of RNA. Small molecule strategies to target RNA would be desirable not only because compounds could be lead optimized via medicinal chemistry but also because structured regions within an RNA of interest could be targeted to directly interfere with RNA folds that contribute to disease. Additionally, small molecules have historically been the most successful drug candidates. Until recently, the ability to design small molecules that target non-ribosomal RNAs has been elusive, creating the perception that they are "undruggable". In this Account, approaches to demystify targeting RNA with small molecules are described. Rather than bulk screening for compounds that bind to singular

  17. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.


    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  18. Long Noncoding RNAs in Metabolic Syndrome Related Disorders

    PubMed Central


    Ribonucleic acids (RNAs) are very complex and their all functions have yet to be fully clarified. Noncoding genes (noncoding RNA, sequences, and pseudogenes) comprise 67% of all genes and they are represented by housekeeping noncoding RNAs (transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), and small nucleolar RNA (snoRNA)) that are engaged in basic cellular processes and by regulatory noncoding RNA (short and long noncoding RNA (ncRNA)) that are important for gene expression/transcript stability. In this review, we summarize data concerning the significance of long noncoding RNAs (lncRNAs) in metabolic syndrome related disorders, focusing on adipose tissue and pancreatic islands. PMID:27881904

  19. TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.


    Spaller, Thomas; Groth, Marco; Glöckner, Gernot; Winckler, Thomas


    The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr) integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III) transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.

  20. [The regularity of occurrence of single nucleotide polymorphisms in the hypervariability sites control region of the human mitochondrial DNA].


    Kornienko, I V; Vodolazhskiĭ, D I


    mtDNA D-loop is a non-coding locus actively used as an individualizing marker in molecular genetic research. Uneven distribution of SNP in D-loop suggests about irregular functional load within this region. The structural-functional role of various sites in D-loop of single individual's mtDNA and the degree of its (functional) importance from the point of phylogenetic conservatism are considered based on the analysis of nucleotide sequences. The role of duplication of various (functional) elements of the mtDNA D-loop (TAS, ETAS, CSB-elements) affecting the increase in functional reliability of the initiation and termination systems of the mtDNA replication is discussed.

  1. Evidence that a family of miniature inverted-repeat transposable elements (MITEs) from the Arabidopsis thaliana genome has arisen from a pogo-like DNA transposon.


    Feschotte, C; Mouchès, C


    Sequence similarities exist between terminal inverted repeats (TIRs) of some miniature inverted-repeat transposable element (MITE) families isolated from a wide range of organisms, including plants, insects, and humans, and TIRs of DNA transposons from the pogo family. We present here evidence that one of these MITE families, previously described for Arabidopsis thaliana, is derived from a larger element encoding a putative transposase. We have named this novel class II transposon Lemi1. We show that its putative product is related to transposases of the Tc1/mariner superfamily, being closer to the pogo family. A similar truncated element was found in a tomato DNA sequence, indicating an ancient origin and/or horizontal transfer for this family of elements. These results are reminiscent of those recently reported for the human genome, where other members of the pogo family, named Tiggers, are believed to be responsible for the generation of abundant MITE-like elements in an early primate ancestor. These results further suggest that some MITE families, which are highly reiterated in plant, insect, and human genomes, could have arisen from a similar mechanism, implicating pogo-like elements.

  2. Parvovirus Expresses a Small Noncoding RNA That Plays an Essential Role in Virus Replication.


    Wang, Zekun; Shen, Weiran; Cheng, Fang; Deng, Xuefeng; Engelhardt, John F; Yan, Ziying; Qiu, Jianming


    Human bocavirus 1 (HBoV1) belongs to the species Primate bocaparvovirus of the genus Bocaparvovirus of the Parvoviridae family. HBoV1 causes acute respiratory tract infections in young children and has a selective tropism for the apical surface of well-differentiated human airway epithelia (HAE). In this study, we identified an additional HBoV1 gene, bocavirus-transcribed small noncoding RNA (BocaSR), within the 3' noncoding region (nucleotides [nt] 5199 to 5338) of the viral genome of positive sense. BocaSR is transcribed by RNA polymerase III (Pol III) from an intragenic promoter at levels similar to that of the capsid protein-coding mRNA and is essential for replication of the viral DNA in both transfected HEK293 and infected HAE cells. Mechanistically, we showed that BocaSR regulates the expression of HBoV1-encoded nonstructural proteins NS1, NS2, NS3, and NP1 but not NS4. BocaSR is similar to the adenovirus-associated type I (VAI) RNA in terms of both nucleotide sequence and secondary structure but differs from it in that its regulation of viral protein expression is independent of RNA-activated protein kinase (PKR) regulation. Notably, BocaSR accumulates in the viral DNA replication centers within the nucleus and likely plays a direct role in replication of the viral DNA. Our findings reveal BocaSR to be a novel viral noncoding RNA that coordinates the expression of viral proteins and regulates replication of viral DNA within the nucleus. Thus, BocaSR may be a target for antiviral therapies for HBoV and may also have utility in the production of recombinant HBoV vectors.IMPORTANCE Human bocavirus 1 (HBoV1) is pathogenic to humans, causing acute respiratory tract infections in young children. In this study, we identified a novel HBoV1 gene that lies in the 3' noncoding region of the viral positive-sense genome and is transcribed by RNA polymerase III into a noncoding RNA of 140 nt. This bocavirus-transcribed small RNA (BocaSR) diverges from both adenovirus

  3. Long noncoding intronic RNAs are differentially expressed in primary and metastatic pancreatic cancer

    PubMed Central


    Background Pancreatic ductal adenocarcinoma (PDAC) is known by its aggressiveness and lack of effective therapeutic options. Thus, improvement in current knowledge of molecular changes associated with pancreatic cancer is urgently needed to explore novel venues of diagnostics and treatment of this dismal disease. While there is mounting evidence that long noncoding RNAs (lncRNAs) transcribed from intronic and intergenic regions of the human genome may play different roles in the regulation of gene expression in normal and cancer cells, their expression pattern and biological relevance in pancreatic cancer is currently unknown. In the present work we investigated the relative abundance of a collection of lncRNAs in patients' pancreatic tissue samples aiming at identifying gene expression profiles correlated to pancreatic cancer and metastasis. Methods Custom 3,355-element spotted cDNA microarray interrogating protein-coding genes and putative lncRNA were used to obtain expression profiles from 38 clinical samples of tumor and non-tumor pancreatic tissues. Bioinformatics analyses were performed to characterize structure and conservation of lncRNAs expressed in pancreatic tissues, as well as to identify expression signatures correlated to tissue histology. Strand-specific reverse transcription followed by PCR and qRT-PCR were employed to determine strandedness of lncRNAs and to validate microarray results, respectively. Results We show that subsets of intronic/intergenic lncRNAs are expressed across tumor and non-tumor pancreatic tissue samples. Enrichment of promoter-associated chromatin marks and over-representation of conserved DNA elements and stable secondary structure predictions suggest that these transcripts are generated from independent transcriptional units and that at least a fraction is under evolutionary selection, and thus potentially functional. Statistically significant expression signatures comprising protein-coding mRNAs and lncRNAs that correlate

  4. Delayed secondary glucocorticoid response elements. Unusual nucleotide motifs specify glucocorticoid receptor binding to transcribed regions of alpha 2u-globulin DNA.


    Chan, G C; Hess, P; Meenakshi, T; Carlstedt-Duke, J; Gustafsson, J A; Payvar, F


    Glucocorticoids stimulate the transcription of rat alpha 2u-globulin (RUG) genes. Because this induction occurs after a time lag of several hours and is blocked by inhibitors of protein synthesis, it exemplifies a delayed secondary response to steroid hormones. In this report, we show that a region of RUG-transcribed DNA (approximately +1800 to +2174) contains multiple footprint sites for glucocorticoid receptor that are, apparently, organized into at least three independent binding clusters. The DNA sequences bound by the receptor and the location of binding sites were determined. A family of sequences related to half-sites of the consensus primary glucocorticoid response element (GRE) is discernible at each cluster of sites. Compared to the consensus GRE, which contains two pseudo-palindromic hexanucleotides arranged in a tail-to-tail fashion and separated by three bases, the arrangements of hexanucleotides within this segment of RUG DNA are unusual and heterogeneous. Methylation interference of a binding cluster containing three receptor footprints demonstrates that certain guanines of the GRE-like hexanucleotides are essential for efficient receptor binding. A synthetic 29-base pair (bp) RUG element, containing one receptor footprint from this cluster, selectively binds the receptor. Within this 29-bp element, six nucleotides separate two directly repeated copies of GRE-like hexanucleotides. RUG DNA fragments containing all or part of the three binding clusters, including the 29-bp element, confer a delayed secondary hormone responsiveness upon a linked heterologous promoter and reporter gene in stably transfected cell lines. We speculate that the unusual DNA sequence motifs of the receptor-binding sites are crucial for the generation of certain delayed secondary responses.

  5. An expanding universe of noncoding RNAs.


    Storz, Gisela


    Noncoding RNAs (ncRNAs) have been found to have roles in a great variety of processes, including transcriptional regulation, chromosome replication, RNA processing and modification, messenger RNA stability and translation, and even protein degradation and translocation. Recent studies indicate that ncRNAs are far more abundant and important than initially imagined. These findings raise several fundamental questions: How many ncRNAs are encoded by a genome? Given the absence of a diagnostic open reading frame, how can these genes be identified? How can all the functions of ncRNAs be elucidated?

  6. A Dual Model for Prioritizing Cancer Mutations in the Non-coding Genome Based on Germline and Somatic Events

    PubMed Central

    Li, Jia; Poursat, Marie-Anne; Drubay, Damien; Motz, Arnaud; Saci, Zohra; Morillon, Antonin; Michiels, Stefan; Gautheret, Daniel


    We address here the issue of prioritizing non-coding mutations in the tumoral genome. To this aim, we created two independent computational models. The first (germline) model estimates purifying selection based on population SNP data. The second (somatic) model estimates tumor mutation density based on whole genome tumor sequencing. We show that each model reflects a different set of constraints acting either on the normal or tumor genome, and we identify the specific genome features that most contribute to these constraints. Importantly, we show that the somatic mutation model carries independent functional information that can be used to narrow down the non-coding regions that may be relevant to cancer progression. On this basis, we identify positions in non-coding RNAs and the non-coding parts of mRNAs that are both under purifying selection in the germline and protected from mutation in tumors, thus introducing a new strategy for future detection of cancer driver elements in the expressed non-coding genome. PMID:26588488

  7. A Dual Model for Prioritizing Cancer Mutations in the Non-coding Genome Based on Germline and Somatic Events.


    Li, Jia; Poursat, Marie-Anne; Drubay, Damien; Motz, Arnaud; Saci, Zohra; Morillon, Antonin; Michiels, Stefan; Gautheret, Daniel


    We address here the issue of prioritizing non-coding mutations in the tumoral genome. To this aim, we created two independent computational models. The first (germline) model estimates purifying selection based on population SNP data. The second (somatic) model estimates tumor mutation density based on whole genome tumor sequencing. We show that each model reflects a different set of constraints acting either on the normal or tumor genome, and we identify the specific genome features that most contribute to these constraints. Importantly, we show that the somatic mutation model carries independent functional information that can be used to narrow down the non-coding regions that may be relevant to cancer progression. On this basis, we identify positions in non-coding RNAs and the non-coding parts of mRNAs that are both under purifying selection in the germline and protected from mutation in tumors, thus introducing a new strategy for future detection of cancer driver elements in the expressed non-coding genome.

  8. A Repetitive DNA Element Regulates Expression of the Helicobacter pylori Sialic Acid Binding Adhesin by a Rheostat-like Mechanism

    PubMed Central

    Vallström, Anna; Olofsson, Annelie; Öhman, Carina; Rakhimova, Lena; Borén, Thomas; Engstrand, Lars; Brännström, Kristoffer; Arnqvist, Anna


    During persistent infection, optimal expression of bacterial factors is required to match the ever-changing host environment. The gastric pathogen Helicobacter pylori has a large set of simple sequence repeats (SSR), which constitute contingency loci. Through a slipped strand mispairing mechanism, the SSRs generate heterogeneous populations that facilitate adaptation. Here, we present a model that explains, in molecular terms, how an intergenically located T-tract, via slipped strand mispairing, operates with a rheostat-like function, to fine-tune activity of the promoter that drives expression of the sialic acid binding adhesin, SabA. Using T-tract variants, in an isogenic strain background, we show that the length of the T-tract generates multiphasic output from the sabA promoter. Consequently, this alters the H. pylori binding to sialyl-Lewis x receptors on gastric mucosa. Fragment length analysis of post-infection isolated clones shows that the T-tract length is a highly variable feature in H. pylori. This mirrors the host-pathogen interplay, where the bacterium generates a set of clones from which the best-fit phenotypes are selected in the host. In silico and functional in vitro analyzes revealed that the length of the T-tract affects the local DNA structure and thereby binding of the RNA polymerase, through shifting of the axial alignment between the core promoter and UP-like elements. We identified additional genes in H. pylori, with T- or A-tracts positioned similar to that of sabA, and show that variations in the tract length likewise acted as rheostats to modulate cognate promoter output. Thus, we propose that this generally applicable mechanism, mediated by promoter-proximal SSRs, provides an alternative mechanism for transcriptional regulation in bacteria, such as H. pylori, which possesses a limited repertoire of classical trans-acting regulatory factors. PMID:24991812

  9. Transcriptional induction of IFN-gamma-responsive genes is modulated by DNA surrounding the interferon stimulation response element.

    PubMed Central

    Strehlow, I; Decker, T


    The 9/27 and GBP mRNAs are both inducible by Interferon-gamma (IFN-gamma). The promoters of both genes contain an Interferon Stimulation Response Element (ISRE), but while the GBP gene is strongly induced transcriptionally by IFN-gamma the response of the 9/27 promoter is very weak. We investigated the molecular basis for this difference. The different IFN-gamma-responsiveness was found to have more than one reason. First, 9/27 promoter DNA was unable to bind the Gamma Interferon Activation Factor (GAF) with a single high affinity site. It efficiently competed for the association of the GAF with the GBP promoter but this competition was due to the presence of two low affinity sites, the ISRE and an ISRE-like sequence, suggesting that the GAS and ISRE, though both having clear preferences for specific proteins, may nevertheless share a certain degree of structural homology. Second, the 9/27 and GBP ISREs differed markedly in their affinities for regulatory proteins (ISGFs 1,2,3) and the GBP ISRE was more potent in mediating IFN-gamma-induced promoter activity in transient transfection. Third and most importantly, however, the strong difference between the IFN-gamma response of the two promoters was mainly due to the sequences surrounding the ISRE: the positive-acting GAS on one side and sequences with silencing properties 5' and 3' of the 9/27 ISRE on the other side. The data thus show mechanisms to both up- and down-regulate the activity of the ISRE. Images PMID:1508672

  10. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.


    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  11. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons

    SciTech Connect

    Xiong, Y.; Eickbush, T.H.


    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. The authors present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. The authors therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons.

  12. Coding DNA repeated throughout intergenic regions of the Arabidopsis thaliana genome: Evolutionary footprints of RNA silencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pyknons are non-random sequence patterns significantly repeated throughout non-coding genomic DNA that also appear at least once among genes. They are interesting because they portend an unforeseen connection between coding and non-coding DNA. Pyknons have only been discovered in the human genome,...

  13. Structure based approaches for targeting non-coding RNAs with small molecules

    PubMed Central

    Shortridge, Matthew D.; Varani, Gabriele


    The increasing appreciation of the central role of non-coding RNAs (miRNAs and long non coding RNAs) in chronic and degenerative human disease makes them attractive therapeutic targets. This would not be unprecedented: the bacterial ribosomal RNA is a mainstay for antibacterial treatment, while the conservation and functional importance of viral RNA regulatory elements has long suggested they would constitute attractive targets for new antivirals. Oligonucleotide-based chemistry has obvious appeals but also considerable pharmacological limitations that are yet to be addressed satisfactorily. Recent studies identifying small molecules targeting non-coding RNAs may provide an alternative approach to oligonucleotide methods. Here we review recent work investigating new structural and chemical principles for targeting RNA with small molecules. PMID:25687935

  14. DASHR: database of small human noncoding RNAs

    PubMed Central

    Leung, Yuk Yee; Kuksa, Pavel P.; Amlie-Wolf, Alexandre; Valladares, Otto; Ungar, Lyle H.; Kannan, Sampath; Gregory, Brian D.; Wang, Li-San


    Small non-coding RNAs (sncRNAs) are highly abundant RNAs, typically <100 nucleotides long, that act as key regulators of diverse cellular processes. Although thousands of sncRNA genes are known to exist in the human genome, no single database provides searchable, unified annotation, and expression information for full sncRNA transcripts and mature RNA products derived from these larger RNAs. Here, we present the Database of small human noncoding RNAs (DASHR). DASHR contains the most comprehensive information to date on human sncRNA genes and mature sncRNA products. DASHR provides a simple user interface for researchers to view sequence and secondary structure, compare expression levels, and evidence of specific processing across all sncRNA genes and mature sncRNA products in various human tissues. DASHR annotation and expression data covers all major classes of sncRNAs including microRNAs (miRNAs), Piwi-interacting (piRNAs), small nuclear, nucleolar, cytoplasmic (sn-, sno-, scRNAs, respectively), transfer (tRNAs), and ribosomal RNAs (rRNAs). Currently, DASHR (v1.0) integrates 187 smRNA high-throughput sequencing (smRNA-seq) datasets with over 2.5 billion reads and annotation data from multiple public sources. DASHR contains annotations for ∼48 000 human sncRNA genes and mature sncRNA products, 82% of which are expressed in one or more of the curated tissues. DASHR is available at PMID:26553799

  15. Long Noncoding RNAs: Past, Present, and Future

    PubMed Central

    Kung, Johnny T. Y.; Colognori, David; Lee, Jeannie T.


    Long noncoding RNAs (lncRNAs) have gained widespread attention in recent years as a potentially new and crucial layer of biological regulation. lncRNAs of all kinds have been implicated in a range of developmental processes and diseases, but knowledge of the mechanisms by which they act is still surprisingly limited, and claims that almost the entirety of the mammalian genome is transcribed into functional noncoding transcripts remain controversial. At the same time, a small number of well-studied lncRNAs have given us important clues about the biology of these molecules, and a few key functional and mechanistic themes have begun to emerge, although the robustness of these models and classification schemes remains to be seen. Here, we review the current state of knowledge of the lncRNA field, discussing what is known about the genomic contexts, biological functions, and mechanisms of action of lncRNAs. We also reflect on how the recent interest in lncRNAs is deeply rooted in biology’s longstanding concern with the evolution and function of genomes. PMID:23463798

  16. Non-coding RNAs and gastric cancer

    PubMed Central

    Li, Pei-Fei; Chen, Sheng-Can; Xia, Tian; Jiang, Xiao-Ming; Shao, Yong-Fu; Xiao, Bing-Xiu; Guo, Jun-Ming


    Non-coding RNAs (ncRNAs) play key roles in development, proliferation, differentiation and apoptosis. Altered ncRNA expression is associated with gastric cancer occurrence, invasion, and metastasis. Moreover, aberrant expression of microRNAs (miRNAs) is significantly related to gastric cancer tumor stage, size, differentiation and metastasis. MiRNAs interrupt cellular signaling pathways, inhibit the activity of tumor suppressor genes, and affect the cell cycle in gastric cancer cells. Some miRNAs, including miR-21, miR-106a and miR-421, could be potential markers for the diagnosis of gastric cancer. Long non-coding RNAs (lncRNAs), a new research hotspot among cancer-associated ncRNAs, play important roles in epigenetic, transcriptional and post-transcriptional regulation. Several gastric cancer-associated lncRNAs, such as CCAT1, GACAT1, H19, and SUMO1P3, have been explored. In addition, Piwi-interacting RNAs, another type of small ncRNA that is recognized by gastroenterologists, are involved in gastric carcinogenesis, and piR-651/823 represents an efficient diagnostic biomarker of gastric cancer that can be detected in the blood and gastric juice. Small interfering RNAs also function in post-transcriptional regulation in gastric cancer and might be useful in gastric cancer treatment. PMID:24833871

  17. An expanding universe of the non-coding genome in cancer biology.


    Xue, Bin; He, Lin


    Neoplastic transformation is caused by accumulation of genetic and epigenetic alterations that ultimately convert normal cells into tumor cells with uncontrolled proliferation and survival, unlimited replicative potential and invasive growth [Hanahan,D. et al. (2011) Hallmarks of cancer: the next generation. Cell, 144, 646-674]. Although the majority of the cancer studies have focused on the functions of protein-coding genes, emerging evidence has started to reveal the importance of the vast non-coding genome, which constitutes more than 98% of the human genome. A number of non-coding RNAs (ncRNAs) derived from the 'dark matter' of the human genome exhibit cancer-specific differential expression and/or genomic alterations, and it is increasingly clear that ncRNAs, including small ncRNAs and long ncRNAs (lncRNAs), play an important role in cancer development by regulating protein-coding gene expression through diverse mechanisms. In addition to ncRNAs, nearly half of the mammalian genomes consist of transposable elements, particularly retrotransposons. Once depicted as selfish genomic parasites that propagate at the expense of host fitness, retrotransposon elements could also confer regulatory complexity to the host genomes during development and disease. Reactivation of retrotransposons in cancer, while capable of causing insertional mutagenesis and genome rearrangements to promote oncogenesis, could also alter host gene expression networks to favor tumor development. Taken together, the functional significance of non-coding genome in tumorigenesis has been previously underestimated, and diverse transcripts derived from the non-coding genome could act as integral functional components of the oncogene and tumor suppressor network.

  18. Development and validation of InnoQuant™, a sensitive human DNA quantitation and degradation assessment method for forensic samples using high copy number mobile elements Alu and SVA.


    Pineda, Gina M; Montgomery, Anne H; Thompson, Robyn; Indest, Brooke; Carroll, Marion; Sinha, Sudhir K


    There is a constant need in forensic casework laboratories for an improved way to increase the first-pass success rate of forensic samples. The recent advances in mini STR analysis, SNP, and Alu marker systems have now made it possible to analyze highly compromised samples, yet few tools are available that can simultaneously provide an assessment of quantity, inhibition, and degradation in a sample prior to genotyping. Currently there are several different approaches used for fluorescence-based quantification assays which provide a measure of quantity and inhibition. However, a system which can also assess the extent of degradation in a forensic sample will be a useful tool for DNA analysts. Possessing this information prior to genotyping will allow an analyst to more informatively make downstream decisions for the successful typing of a forensic sample without unnecessarily consuming DNA extract. Real-time PCR provides a reliable method for determining the amount and quality of amplifiable DNA in a biological sample. Alu are Short Interspersed Elements (SINE), approximately 300bp insertions which are distributed throughout the human genome in large copy number. The use of an internal primer to amplify a segment of an Alu element allows for human specificity as well as high sensitivity when compared to a single copy target. The advantage of an Alu system is the presence of a large number (>1000) of fixed insertions in every human genome, which minimizes the individual specific variation possible when using a multi-copy target quantification system. This study utilizes two independent retrotransposon genomic targets to obtain quantification of an 80bp "short" DNA fragment and a 207bp "long" DNA fragment in a degraded DNA sample in the multiplex system InnoQuant™. The ratio of the two quantitation values provides a "Degradation Index", or a qualitative measure of a sample's extent of degradation. The Degradation Index was found to be predictive of the observed loss

  19. Hematopoietic gene promoters subjected to a group-combinatorial study of DNA samples: identification of a megakaryocytic selective DNA signature

    PubMed Central

    Hazony, Yehonathan; Lu, Jun; St. Hilaire, Cynthia; Ravid, Katya


    Identification of common sub-sequences for a group of functionally related DNA sequences can shed light on the role of such elements in cell-specific gene expression. In the megakaryocytic lineage, no one single unique transcription factor was described as linage specific, raising the possibility that a cluster of gene promoter sequences presents a unique signature. Here, the megakaryocytic gene promoter group, which consists of both human and mouse 5′ non-coding regions, served as a case study. A methodology for group-combinatorial search has been implemented as a customized software platform. It extracts the longest common sequences for a group of related DNA sequences and allows for single gaps of varying length, as well as double- and multiple-gap sequences. The results point to common DNA sequences in a group of genes that is selectively expressed in megakaryocytes, and which does not appear in a large group of control, random and specific sequences. This suggests a role for a combination of these sequences in cell-specific gene expression in the megakaryocytic lineage. The data also point to an intrinsic cross-species difference in the organization of 5′ non-coding sequences within the mammalian genomes. This methodology may be used for the identification of regulatory sequences in other lineages. PMID:16936310

  20. A panoramic view of yeast noncoding RNA processing.


    Peng, Wen Tao; Robinson, Mark D; Mnaimneh, Sanie; Krogan, Nevan J; Cagney, Gerard; Morris, Quaid; Davierwala, Armaity P; Grigull, Jörg; Yang, Xueqi; Zhang, Wen; Mitsakakis, Nicholas; Ryan, Owen W; Datta, Nira; Jojic, Vladimir; Pal, Chris; Canadien, Veronica; Richards, Dawn; Beattie, Bryan; Wu, Lani F; Altschuler, Steven J; Roweis, Sam; Frey, Brendan J; Emili, Andrew; Greenblatt, Jack F; Hughes, Timothy R


    Predictive analysis using publicly available yeast functional genomics and proteomics data suggests that many more proteins may be involved in biogenesis of ribonucleoproteins than are currently known. Using a microarray that monitors abundance and processing of noncoding RNAs, we analyzed 468 yeast strains carrying mutations in protein-coding genes, most of which have not previously been associated with RNA or RNP synthesis. Many strains mutated in uncharacterized genes displayed aberrant noncoding RNA profiles. Ten factors involved in noncoding RNA biogenesis were verified by further experimentation, including a protein required for 20S pre-rRNA processing (Tsr2p), a protein associated with the nuclear exosome (Lrp1p), and a factor required for box C/D snoRNA accumulation (Bcd1p). These data present a global view of yeast noncoding RNA processing and confirm that many currently uncharacterized yeast proteins are involved in biogenesis of noncoding RNA.

  1. Quantitative Trait Loci Identify Functional Noncoding Variation in Cancer.


    Heyn, Holger


    The interpretation of noncoding alterations in cancer genomes presents an unresolved problem in cancer studies. While the impact of somatic variations in protein-coding regions is widely accepted, noncoding aberrations are mostly considered as passenger events. However, with the advance of genome-wide profiling strategies, alterations outside the coding context entered the focus, and multiple examples highlight the role of gene deregulation as cancer-driving events. This review describes the implication of noncoding alterations in oncogenesis and provides a theoretical framework for the identification of causal somatic variants using quantitative trait loci (QTL) analysis. Assuming that functional noncoding alterations affect quantifiable regulatory processes, somatic QTL studies constitute a valuable strategy to pinpoint cancer gene deregulation. Eventually, the comprehensive identification and interpretation of coding and noncoding alterations will guide our future understanding of cancer biology.

  2. Cytogenetic variation of repetitive DNA elements in Hoplias malabaricus (Characiformes - Erythrinidae) from white, black and clear water rivers of the Amazon basin.


    Santos, Fabíola Araújo Dos; Marques, Diego Ferreira; Terencio, Maria Leandra; Feldberg, Eliana; Rodrigues, Luís Reginaldo R


    Hoplias malabaricus is a common fish species occurring in white, black and clear water rivers of the Amazon basin. Its large distribution across distinct aquatic environments can pose stressful conditions for dispersal and creates possibilities for the emergence of local adaptive profiles. We investigated the chromosomal localization of repetitive DNA markers (constitutive heterochromatin, rDNA and the transposable element REX-3) in populations from the Amazonas river (white water), the Negro river (black water) and the Tapajós river (clear water), in order to address the variation/association of cytogenomic features and environmental conditions. We found a conserved karyotypic macrostructure with a diploid number of 40 chromosomes (20 metacentrics + 20 submetacentrics) in all the samples. Heteromorphism in pair 14 was detected as evidence for the initial differentiation of an XX/XY system. Minor differences detected in the amount of repetitive DNA markers are interpreted as possible signatures of local adaptations to distinct aquatic environments.

  3. Cytogenetic variation of repetitive DNA elements in Hoplias malabaricus (Characiformes - Erythrinidae) from white, black and clear water rivers of the Amazon basin

    PubMed Central

    dos Santos, Fabíola Araújo; Marques, Diego Ferreira; Terencio, Maria Leandra; Feldberg, Eliana; Rodrigues, Luís Reginaldo R.


    Abstract Hoplias malabaricus is a common fish species occurring in white, black and clear water rivers of the Amazon basin. Its large distribution across distinct aquatic environments can pose stressful conditions for dispersal and creates possibilities for the emergence of local adaptive profiles. We investigated the chromosomal localization of repetitive DNA markers (constitutive heterochromatin, rDNA and the transposable element REX-3) in populations from the Amazonas river (white water), the Negro river (black water) and the Tapajós river (clear water), in order to address the variation/association of cytogenomic features and environmental conditions. We found a conserved karyotypic macrostructure with a diploid number of 40 chromosomes (20 metacentrics + 20 submetacentrics) in all the samples. Heteromorphism in pair 14 was detected as evidence for the initial differentiation of an XX/XY system. Minor differences detected in the amount of repetitive DNA markers are interpreted as possible signatures of local adaptations to distinct aquatic environments. PMID:27007897

  4. Monosomy 1p36 breakpoints indicate repetitive DNA sequence elements may be involved in generating and/or stabilizing some terminal deletions.


    Ballif, Blake C; Gajecka, Marzena; Shaffer, Lisa G


    Monosomy 1p36 is the most commonly observed terminal deletion syndrome in humans. Our previous molecular studies on a large cohort of subjects suggest that monosomy 1p36 can result from a variety of chromosomal rearrangements including terminal truncations, interstitial deletions, derivative chromosomes, inverted duplications, and complex rearrangements. However, the mechanism(s) by which rearrangements of 1p36 are generated and/or stabilized is not understood. Sequence analysis of breakpoint junctions may provide valuable clues to the underlying mechanisms of many chromosomal aberrations. In this report, we analyze the breakpoints at the DNA-sequence level in four subjects with variable-sized deletions of 1p36. All four breakpoints fall within repetitive DNA-sequence elements (LINEs, SINEs, etc). This suggests that repetitive DNA-sequence elements may play an important role in generating and/or stabilizing terminal deletions of 1p36. Mechanisms by which repetitive elements may be involved in the process of terminal deletion formation and stabilization are discussed.

  5. Cooperative binding of estrogen receptor to imperfect estrogen-responsive DNA elements correlates with their synergistic hormone-dependent enhancer activity.


    Martinez, E; Wahli, W


    The Xenopus vitellogenin (vit) gene B1 estrogen-inducible enhancer is formed by two closely adjacent 13 bp imperfect palindromic estrogen-responsive elements (EREs), i.e. ERE-2 and ERE-1, having one and two base substitutions respectively, when compared to the perfect palindromic consensus ERE (GGTCANNNTGACC). Gene transfer experiments indicate that these degenerated elements, on their own, have a low or no regulatory capacity at all, but in vivo act together synergistically to confer high receptor- and hormone-dependent transcription activation to the heterologous HSV thymidine kinase promoter. Thus, the DNA region upstream of the vitB1 gene comprising these two imperfect EREs separated by 7 bp, was called the vitB1 estrogen-responsive unit (vitB1 ERU). Using in vitro protein-DNA interaction techniques, we demonstrate that estrogen receptor dimers bind cooperatively to the imperfect EREs of the vitB1 ERU. Binding of a first receptor dimer to the more conserved ERE-2 increases approximately 4- to 8-fold the binding affinity of the receptor to the adjacent less conserved ERE-1. Thus, we suggest that the observed synergistic estrogen-dependent transcription activation conferred by the pair of hormone-responsive DNA elements of the vit B1 ERU is the result of cooperative binding of two estrogen receptor dimers to these two adjacent imperfect EREs.

  6. Comparative study on elemental composition and DNA damage in leaves of a weedy plant species, Cassia occidentalis, growing wild on weathered fly ash and soil.


    Love, Amit; Tandon, Rajesh; Banerjee, B D; Babu, C R


    Open dumping of fly ash in fly ash basins has significant adverse environmental impacts due to its elevated trace element content. In situ biomonitoring of genotoxicity is of practical value in realistic hazard identification of fly ash. Genotoxicity of openly disposed fly ash to natural plant populations inhabiting fly ash basins has not been investigated. DNA damage, and concentrations of As, Co, Cr, Cu and Ni in the leaves of natural populations of Cassia occidentalis growing at two contrasting sites-one having weathered fly ash (fly ash basin) and the other having soil (reference site) as plant growth substrates-were assessed. The foliar concentrations of As, Ni and Cr were two to eight fold higher in plants growing on fly ash as compared to the plants growing on soil, whereas foliar concentrations of Cu and Co were similar. We report, for the first time, based upon comet assay results, higher levels of DNA damage in leaf tissues of Cassia occidentalis growing wild on fly ash basin compared to C. occidentalis growing on soil. Correlation analysis between foliar DNA damage and foliar concentrations of trace elements suggests that DNA damage may perhaps be associated with foliar concentrations of As and Ni. Our observations suggest that (1) fly ash triggers genotoxic responses in plants growing naturally on fly ash basins; and (2) plant comet assay is useful for in situ biomonitoring of genotoxicity of fly ash.

  7. Downregulation of long non-coding RNA MEG3 in nasopharyngeal carcinoma.


    Chak, Wing-Po; Lung, Raymond Wai-Ming; Tong, Joanna Hung-Man; Chan, Sylvia Yat-Yee; Lun, Samantha Wei-Man; Tsao, Sai-Wah; Lo, Kwok-Wai; To, Ka-Fai


    In our previous whole-transcriptome sequencing analysis, downregulation of a long non-coding RNA, maternally expressed gene 3 (MEG3), was identified in NPC samples. This finding suggests the possible role of MEG3 as a tumor suppressor in this distinctive disease. In the present study, two MEG3 variants, AF119863 (MEG3-AF) and BX247998 (MEG3-BX), were found abundantly expressed in a normal nasopharyngeal epithelial cell line, NP69. Significant downregulation of MEG3-AF was further verified in a panel of NPC samples including xenografts and primary biopsies. MEG3 is an imprinted gene located within chromosome 14q32, a common deleted region in NPC. Both DNA copy number loss and aberrant promoter methylation contributed to MEG3 inactivation. Interestingly, MEG3 expression could successfully be rescued by the treatment of a demethylation agent. Besides, ectopic expression of MEG3 in NPC cell lines resulted in considerable repression of in vitro anchorage-independent growth and in vivo tumorigenicity, in addition to significant inhibition in cell proliferation, colony formation, and induction of cell cycle arrest. Finally, we revealed the association between MEG3 activity and the p53 signaling cascade. Our findings characterize MEG3 as a tumor suppressive long non-coding RNA in NPC and encourage the development of precise long non-coding RNA-targeted epigenetic therapy against this malignancy. © 2016 Wiley Periodicals, Inc.

  8. Neighboring gene regulation by antisense long non-coding RNAs.


    Villegas, Victoria E; Zaphiropoulos, Peter G


    Antisense transcription, considered until recently as transcriptional noise, is a very common phenomenon in human and eukaryotic transcriptomes, operating in two ways based on whether the antisense RNA acts in cis or in trans. This process can generate long non-coding RNAs (lncRNAs), one of the most diverse classes of cellular transcripts, which have demonstrated multifunctional roles in fundamental biological processes, including embryonic pluripotency, differentiation and development. Antisense lncRNAs have been shown to control nearly every level of gene regulation--pretranscriptional, transcriptional and posttranscriptional--through DNA-RNA, RNA-RNA or protein-RNA interactions. This review is centered on functional studies of antisense lncRNA-mediated regulation of neighboring gene expression. Specifically, it addresses how these transcripts interact with other biological molecules, nucleic acids and proteins, to regulate gene expression through chromatin remodeling at the pretranscriptional level and modulation of transcriptional and post-transcriptional processes by altering the sense mRNA structure or the cellular compartmental distribution, either in the nucleus or the cytoplasm.

  9. Evaluating the Stability of mRNAs and Noncoding RNAs.


    Ayupe, Ana Carolina; Reis, Eduardo M


    Changes in RNA stability have an important impact in the gene expression regulation. Different methods based on the transcription blockage with RNA polymerase inhibitors or metabolic labeling of newly synthesized RNAs have been developed to evaluate RNA decay rates in cultured cell. Combined with techniques to measure transcript abundance genome-wide, these methods have been used to reveal novel features of the eukaryotic transcriptome. The stability of protein-coding mRNAs is in general closely associated to the physiological function of their encoded proteins, with short-lived mRNAs being significantly enriched among regulatory genes whereas genes associated with housekeeping functions are predominantly stable. Likewise, the stability of noncoding RNAs (ncRNAs) seems to reflect their functional role in the cell. Thus, investigating RNA stability can provide insights regarding the function of yet uncharacterized regulatory ncRNAs. In this chapter, we discuss the methodologies currently used to estimate RNA decay and outline an experimental protocol for genome-wide estimation of RNA stability of protein-coding and lncRNAs. This protocol details the transcriptional blockage of cultured cells with actinomycin D, followed by RNA isolation at different time points, the determination of transcript abundance by qPCR/DNA oligoarray hybridization, and the calculation of individual transcript half-lives.

  10. Evolving genomic metaphors: a new look at the language of DNA.


    Avise, J C


    Recent genome-sequencing efforts have confirmed that traditional "good-citizen" genes (those that encode functional RNA and protein molecules of obvious benefit to the organism) constitute only a small fraction of the genomic populace in humans and other multicellular creatures. The rest of the DNA sequence includes an astonishing collection of noncoding regions, regulatory modules, deadbeat pseudogenes, legions of repetitive elements, and hosts of oft-shifty, self-interested nomads, renegades, and immigrants. To help visualize functional operations in such intracellular genomic societies and to better encapsulate the evolutionary origins of complex genomes, new and evocative metaphors may be both entertaining and research-stimulating.

  11. A modular system of DNA enhancer elements mediates tissue-specific activation of transcription by high dietary zinc in C. elegans

    PubMed Central

    Roh, Hyun Cheol; Dimitrov, Ivan; Deshmukh, Krupa; Zhao, Guoyan; Warnhoff, Kurt; Cabrera, Daniel; Tsai, Wendy; Kornfeld, Kerry


    Zinc is essential for biological systems, and aberrant zinc metabolism is implicated in a broad range of human diseases. To maintain homeostasis in response to fluctuating levels of dietary zinc, animals regulate gene expression; however, mechanisms that mediate the transcriptional response to fluctuating levels of zinc have not been fully defined. Here, we identified DNA enhancer elements that mediate intestine-specific transcriptional activation in response to high levels of dietary zinc in C. elegans. Using bioinformatics, we characterized an evolutionarily conserved enhancer element present in multiple zinc-inducible genes, the high zinc activation (HZA) element. The HZA was consistently adjacent to a GATA element that mediates expression in intestinal cells. Functional studies using transgenic animals demonstrated that this modular system of DNA enhancers mediates tissue-specific transcriptional activation in response to high levels of dietary zinc. We used this information to search the genome and successfully identified novel zinc-inducible genes. To characterize the mechanism of enhancer function, we demonstrated that the GATA transcription factor ELT-2 and the mediator subunit MDT-15 are necessary for zinc-responsive transcriptional activation. These findings define new mechanisms of zinc homeostasis and tissue-specific regulation of transcription. PMID:25552416

  12. Crystallization and preliminary X-ray diffraction analysis of the Pax9 paired domain bound to a DC5 enhancer DNA element.


    Narasimhan, Kamesh; Hilbig, Antonia; Udayasuryan, Barath; Jayabal, Sriram; Kolatkar, Prasanna R; Jauch, Ralf


    Pax genes belong to a family of metazoan transcription factors that are known to play a critical role in eye, ear, kidney and neural development. The mammalian Pax family of transcription factors is characterized by a ∼128-amino-acid DNA-binding paired domain that makes sequence-specific contacts with DNA. The diversity in Pax gene activities emerges from complex modes of interaction with enhancer regions and heterodimerization with multiple interaction partners. Based on in vitro optimal binding-site selection studies and enhancer identification assays, it has been suggested that Pax proteins may recognize and bind their target DNA elements with different binding modes/topologies, however this hypothesis has not yet been structurally explored. One of the most extensively studied DNA target elements of the Pax6 paired domain is the eye-lens specific DC5 (δ-crystallin) enhancer element. In order to shed light on Pax6-DC5 DNA interactions, the related paired-domain prototype Pax9 was crystallized with the minimal δ-crystallin DC5 enhancer element and preliminary X-ray diffraction analysis was attempted. A 3.0 Å resolution native data set was collected at the National Synchrotron Light Source (NSLS), Brookhaven from crystals grown in a solution consisting of 10%(w/v) PEG 20K, 20%(v/v) PEG 550 MME, 0.03 M NaNO3, 0.03 M Na2HPO4, 0.03 M NH2SO4, 0.1 M MES/imidazole pH 6.5. The data set was indexed and merged in space group C2221, with unit-cell parameters a = 75.74, b = 165.59, c = 70.14 Å, α = β = γ = 90°. The solvent content in the unit cell is consistent with the presence of one Pax9 paired domain bound to duplex DNA in the asymmetric unit.

  13. Noncoding RNA Control of Cellular Senescence

    PubMed Central

    Abdelmohsen, Kotb; Gorospe, Myriam


    Senescent cells accumulate in normal tissues with advancing age and arise by long-term culture of primary cells. Senescence develops following exposure to a range of stress-causing agents and broadly influences the physiology and pathology of tissues, organs, and systems in the body. While many proteins are known to control senescence, numerous noncoding (nc)RNAs are also found to promote or repress the senescent phenotype. Here, we review the regulatory ncRNAs (primarily microRNAs and lncRNAs) identified to-date as key modulators of senescence. We highlight the major senescent pathways (p53/p21 and pRB/p16), as well as the senescence-associated secretory phenotype (SASP) and other senescence-associated events governed by ncRNAs, and discuss the importance of understanding comprehensively the ncRNAs implicated in cell senescence. PMID:26331977

  14. Visualization of Enhancer-Derived Noncoding RNA.


    Shibayama, Youtaro; Fanucchi, Stephanie; Mhlanga, Musa M


    Enhancers are principal regulators that allow spatiotemporal tissue-specific control of gene expression. While mounting evidence suggests that enhancer-derived long noncoding RNAs (long ncRNAs), including enhancer RNAs (eRNAs), are an important component of enhancer function, their expression has not been broadly analyzed at a single cell level via imaging techniques. This protocol describes a method to image eRNA in single cells by in situ hybridization followed by tyramide signal amplification (TSA). The procedure can be multiplexed to simultaneously visualize both eRNA and protein-coding transcript at the site of transcriptional elongation, thereby permitting analysis of dynamics between the two transcript species in single cells. Our approach is not limited to eRNAs, but can be implemented on other transcripts.

  15. Non-coding landscapes of colorectal cancer

    PubMed Central

    Ragusa, Marco; Barbagallo, Cristina; Statello, Luisa; Condorelli, Angelo Giuseppe; Battaglia, Rosalia; Tamburello, Lucia; Barbagallo, Davide; Di Pietro, Cinzia; Purrello, Michele


    For two decades Vogelstein’s model has been the paradigm for describing the sequence of molecular changes within protein-coding genes that would lead to overt colorectal cancer (CRC). This model is now too simplistic in the light of recent studies, which have shown that our genome is pervasively transcribed in RNAs other than mRNAs, denominated non-coding RNAs (ncRNAs). The discovery that mutations in genes encoding these RNAs [i.e., microRNAs (miRNAs), long non-coding RNAs, and circular RNAs] are causally involved in cancer phenotypes has profoundly modified our vision of tumour molecular genetics and pathobiology. By exploiting a wide range of different mechanisms, ncRNAs control fundamental cellular processes, such as proliferation, differentiation, migration, angiogenesis and apoptosis: these data have also confirmed their role as oncogenes or tumor suppressors in cancer development and progression. The existence of a sophisticated RNA-based regulatory system, which dictates the correct functioning of protein-coding networks, has relevant biological and biomedical consequences. Different miRNAs involved in neoplastic and degenerative diseases exhibit potential predictive and prognostic properties. Furthermore, the key roles of ncRNAs make them very attractive targets for innovative therapeutic approaches. Several recent reports have shown that ncRNAs can be secreted by cells into the extracellular environment (i.e., blood and other body fluids): this suggests the existence of extracellular signalling mechanisms, which may be exploited by cells in physiology and pathology. In this review, we will summarize the most relevant issues on the involvement of cellular and extracellular ncRNAs in disease. We will then specifically describe their involvement in CRC pathobiology and their translational applications to CRC diagnosis, prognosis and therapy. PMID:26556998

  16. Noncoder: a web interface for exon array-based detection of long non-coding RNAs

    PubMed Central

    Gellert, Pascal; Ponomareva, Yuliya; Braun, Thomas; Uchida, Shizuka


    Due to recent technical developments, a high number of long non-coding RNAs (lncRNAs) have been discovered in mammals. Although it has been shown that lncRNAs are regulated differently among tissues and disease statuses, functions of these transcripts are still unknown in most cases. GeneChip Exon 1.0 ST Arrays (exon arrays) from Affymetrix, Inc. have been used widely to profile genome-wide expression changes and alternative splicing of protein-coding genes. Here, we demonstrate that re-annotation of exon array probes can be used to profile expressions of tens of thousands of lncRNAs. With this annotation, a detailed inspection of lncRNAs and their isoforms is possible. To allow for a general usage to the research community, we developed a user-friendly web interface called ‘noncoder’. By uploading CEL files from exon arrays and with a few mouse clicks and parameter settings, exon array data will be normalized and analysed to identify differentially expressed lncRNAs. Noncoder provides the detailed annotation information of lncRNAs and is equipped with unique features to allow for an efficient search for interesting lncRNAs to be studied further. The web interface is available at PMID:23012263

  17. Potential roles of noncoding RNAs in environmental epigenetic transgenerational inheritance.


    Yan, Wei


    "Epigenetic transgenerational inheritance" (ETI) has been defined as germline (sperm or egg) transmission of epigenetic information between generations in the absence of direct exposures or genetic manipulations. Among reported cases of ETI in mammals, the majority are induced by environmental factors, including environmental toxicants [e.g. agricultural fungicide vinclozolin, plastic additive bisphenol A, pesticide methoxychlor, dioxin, di-(2-ethylhexyl) phthalate, dichlorodiphenyltrichloroethane, and hydrocarbons] and poor nutritional conditions. Although the ETI phenomenon is well established, the underlying mechanism remains elusive. Putative epimutations, including changes in DNA methylation and histone modification patterns, have been reported, but it remains unclear how these epimutations are formed in the first place, and how they are memorized in the germline and then get transmitted to subsequent generations. Based on recent advances in our understanding of regulatory noncoding RNAs (ncRNAs), I propose that ncRNAs are involved in ETI, during both the initial epimutation formation and the subsequent germline transmission of epimutations. ncRNAs can function at epigenetic levels by affecting DNA methylation and histone modifications, thereby changing gene transcriptional activities, which can lead to an altered mRNA transcriptome associated with a disease phenotype. Alternatively, novel or altered ncRNA expression can cause dysregulated post-transcriptional regulation, thus directly affecting the mRNA transcriptome and inducing a disease phenotype. Sperm-borne ncRNAs are potential mediators for epigenetic memory across generations, but they alone may not be sufficient for stable transmission of epimutations across generations. Overall, research on ncRNAs in the context of ETI is urgently needed to shed light on the underlying mechanism of ETI.

  18. In silico discovery and modeling of non-coding RNA structure in viruses.


    Moss, Walter N; Steitz, Joan A


    This review covers several computational methods for discovering structured non-coding RNAs in viruses and modeling their putative secondary structures. Here we will use examples from two target viruses to highlight these approaches: influenza A virus-a relatively small, segmented RNA virus; and Epstein-Barr virus-a relatively large DNA virus with a complex transcriptome. Each system has unique challenges to overcome and unique characteristics to exploit. From these particular cases, generically useful approaches can be derived for the study of additional viral targets.

  19. Multisubunit RNA Polymerases IV and V: Purveyors of Non-Coding RNA for Plant Gene Silencing

    SciTech Connect

    Haag, Jeremy R.; Pikaard, Craig S.


    In all eukaryotes, nuclear DNA-dependent RNA polymerases I, II and III synthesize the myriad RNAs that are essential for life. Remarkably, plants have evolved two additional multisubunit RNA polymerases, RNA polymerases IV and V, which orchestrate non-coding RNA-mediated gene silencing processes affecting development, transposon taming, antiviral defence and allelic crosstalk. Biochemical details concerning the templates and products of RNA polymerases IV and V are lacking. However, their subunit compositions reveal that they evolved as specialized forms of RNA polymerase II, which provides the unique opportunity to study the functional diversification of a eukaryotic RNA polymerase family.

  20. Long noncoding RNAs: functional surprises from the RNA world

    PubMed Central

    Wilusz, Jeremy E.; Sunwoo, Hongjae; Spector, David L.


    Most of the eukaryotic genome is transcribed, yielding a complex network of transcripts that includes tens of thousands of long noncoding RNAs with little or no protein-coding capacity. Although the vast majority of long noncoding RNAs have yet to be characterized thoroughly, many of these transcripts are unlikely to represent transcriptional “noise” as a significant number have been shown to exhibit cell type-specific expression, localization to subcellular compartments, and association with human diseases. Here, we highlight recent efforts that have identified a myriad of molecular functions for long noncoding RNAs. In some cases, it appears that simply the act of noncoding RNA transcription is sufficient to positively or negatively affect the expression of nearby genes. However, in many cases, the long noncoding RNAs themselves serve key regulatory roles that were assumed previously to be reserved for proteins, such as regulating the activity or localization of proteins and serving as organizational frameworks of subcellular structures. In addition, many long noncoding RNAs are processed to yield small RNAs or, conversely, modulate how other RNAs are processed. It is thus becoming increasingly clear that long noncoding RNAs can function via numerous paradigms and are key regulatory molecules in the cell. PMID:19571179

  1. Long Noncoding RNAs in Cardiovascular Pathology, Diagnosis, and Therapy.


    Bär, Christian; Chatterjee, Shambhabi; Thum, Thomas


    Vast parts of mammalian genomes encode for transcripts that are not further translated into proteins. The purpose of the majority of such noncoding ribonucleic acids (RNAs) remained paradoxical for a long time. However, a growing body of evidence demonstrates that long noncoding RNAs are dynamically expressed in different cell types, diseases, or developmental stages to execute a wide variety of regulatory roles at virtually every step of gene expression and translation. Indeed, long noncoding RNAs influence gene expression via epigenetic modulations, through regulating alternative splicing, or by acting as molecular sponges. The abundance of long noncoding RNAs in the cardiovascular system indicates that they may be part of a complex regulatory network governing physiology and pathology of the heart. In this review, we discuss the multifaceted functions of long noncoding RNAs and highlight the current literature with an emphasis on cardiac development and disease. Furthermore, as the enormous spectrum of long noncoding RNAs potentially opens up new avenues for diagnosis and prevention of heart failure, we ultimately evaluate the futuristic prospects of long noncoding RNAs as biomarkers, and therapeutic targets for the treatment of cardiovascular disorders, as well.

  2. A noncoding RNA antisense to moesin at 5p14.1 in autism.


    Kerin, Tara; Ramanathan, Anita; Rivas, Kasey; Grepo, Nicole; Coetzee, Gerhard A; Campbell, Daniel B


    People with autism spectrum disorder (ASD) are characterized by deficits in social interaction, language, and behavioral flexibility. Rare mutations and copy number variations have been identified in individuals with ASD, but in most patients, the causal variants remain unknown. A genome-wide association study (GWAS), designed to identify genes and pathways that contribute to ASD, indicated a genome-wide significant association of ASD with the single-nucleotide polymorphism (SNP) rs4307059 (P = 10⁻¹⁰), which is located in a gene-poor region of chromosome 5p14.1. We describe here a 3.9-kb noncoding RNA that is transcribed from the region of the chromosome 5p14.1 ASD GWAS association SNP. The noncoding RNA was encoded by the opposite (antisense) strand of moesin pseudogene 1 (MSNP1), and we therefore designated it as MSNP1AS (moesin pseudogene 1, antisense). Chromosome 5p14.1 MSNP1AS was 94% identical and antisense to the X chromosome transcript of MSN, which encodes a protein (moesin) that regulates neuronal architecture. Individuals who carry the ASD-associated rs4307059 T allele showed increased expression of MSNP1AS. The MSNP1AS noncoding RNA bound to MSN, was highly overexpressed (12.7-fold) in postmortem cerebral cortex of individuals with ASD, and could regulate levels of moesin protein in human cell lines. These data reveal a biologically functional element that may contribute to ASD risk.

  3. Functional annotation of the vlinc class of non-coding RNAs using systems biology approach

    PubMed Central

    Laurent, Georges St.; Vyatkin, Yuri; Antonets, Denis; Ri, Maxim; Qi, Yao; Saik, Olga; Shtokalo, Dmitry; de Hoon, Michiel J.L.; Kawaji, Hideya; Itoh, Masayoshi; Lassmann, Timo; Arner, Erik; Forrest, Alistair R.R.; Nicolas, Estelle; McCaffrey, Timothy A.; Carninci, Piero; Hayashizaki, Yoshihide; Wahlestedt, Claes; Kapranov, Philipp


    Functionality of the non-coding transcripts encoded by the human genome is the coveted goal of the modern genomics research. While commonly relied on the classical methods of forward genetics, integration of different genomics datasets in a global Systems Biology fashion presents a more productive avenue of achieving this very complex aim. Here we report application of a Systems Biology-based approach to dissect functionality of a newly identified vast class of very long intergenic non-coding (vlinc) RNAs. Using highly quantitative FANTOM5 CAGE dataset, we show that these RNAs could be grouped into 1542 novel human genes based on analysis of insulators that we show here indeed function as genomic barrier elements. We show that vlincRNAs genes likely function in cis to activate nearby genes. This effect while most pronounced in closely spaced vlincRNA–gene pairs can be detected over relatively large genomic distances. Furthermore, we identified 101 vlincRNA genes likely involved in early embryogenesis based on patterns of their expression and regulation. We also found another 109 such genes potentially involved in cellular functions also happening at early stages of development such as proliferation, migration and apoptosis. Overall, we show that Systems Biology-based methods have great promise for functional annotation of non-coding RNAs. PMID:27001520

  4. Origin and evolution of the long non-coding genes in the X-inactivation center.


    Romito, Antonio; Rougeulle, Claire


    Random X chromosome inactivation (XCI), the eutherian mechanism of X-linked gene dosage compensation, is controlled by a cis-acting locus termed the X-inactivation center (Xic). One of the striking features that characterize the Xic landscape is the abundance of loci transcribing non-coding RNAs (ncRNAs), including Xist, the master regulator of the inactivation process. Recent comparative genomic analyses have depicted the evolutionary scenario behind the origin of the X-inactivation center, revealing that this locus evolved from a region harboring protein-coding genes. During mammalian radiation, this ancestral protein-coding region was disrupted in the marsupial group, whilst it provided in eutherian lineage the starting material for the non-translated RNAs of the X-inactivation center. The emergence of non-coding genes occurred by a dual mechanism involving loss of protein-coding function of the pre-existing genes and integration of different classes of mobile elements, some of which modeled the structure and sequence of the non-coding genes in a species-specific manner. The rising genes started to produce transcripts that acquired function in regulating the epigenetic status of the X chromosome, as shown for Xist, its antisense Tsix, Jpx, and recently suggested for Ftx. Thus, the appearance of the Xic, which occurred after the divergence between eutherians and marsupials, was the basis for the evolution of random X inactivation as a strategy to achieve dosage compensation.

  5. Identification of functional elements and regulatory circuits by Drosophila modENCODE.


    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis


    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  6. The Landscape of Long Noncoding RNAs in the Human Transcriptome

    PubMed Central

    Iyer, Matthew K.; Niknafs, Yashar S.; Malik, Rohit; Singhal, Udit; Sahu, Anirban; Hosono, Yasuyuki; Barrette, Terrence R.; Prensner, John R.; Evans, Joseph R.; Zhao, Shuang; Poliakov, Anton; Cao, Xuhong; Dhanasekaran, Saravana M.; Wu, Yi-Mi; Robinson, Dan R.; Beer, David G.; Feng, Felix Y.; Iyer, Hariharan K.; Chinnaiyan, Arul M.


    Long non-coding RNAs (lncRNAs) are emerging as important regulators of tissue physiology and disease processes including cancer. In order to delineate genome-wide lncRNA expression, we curated 7,256 RNA-Seq libraries from tumors, normal tissues, and cell lines comprising over 43 terabases of sequence from 25 independent studies. We applied ab initio assembly methodology to this dataset, yielding a consensus human transcriptome of 91,013 expressed genes. Over 68% (58,648) of genes were classified as lncRNAs, of which 79% (48,952) were previously unannotated. About 1% (597) of the lncRNAs harbored ultraconserved elements and 7% (3,900) overlapped disease-associated single nucleotide polymorphisms (SNPs). To prioritize lineage-specific, disease-associated lncRNA expression we employed non-parametric differential expression testing and nominated 7,942 lineage- or cancer-associated lncRNA genes. The lncRNA landscape characterized here may shed light into normal biology and cancer pathogenesis, and be valuable for future biomarker development. PMID:25599403

  7. Temporal profiling of the coding and noncoding murine cytomegalovirus transcriptomes.


    Lacaze, Paul; Forster, Thorsten; Ross, Alan; Kerr, Lorraine E; Salvo-Chirnside, Eliane; Lisnic, Vanda Juranic; López-Campos, Guillermo H; García-Ramírez, José J; Messerle, Martin; Trgovcich, Joanne; Angulo, Ana; Ghazal, Peter


    The global transcriptional program of murine cytomegalovirus (MCMV), involving coding, noncoding, and antisense transcription, remains unknown. Here we report an oligonucleotide custom microarray platform capable of measuring both coding and noncoding transcription on a genome-wide scale. By profiling MCMV wild-type and immediate-early mutant strains in fibroblasts, we found rapid activation of the transcriptome by 6.5 h postinfection, with absolute dependency on ie3, but not ie1 or ie2, for genomic programming of viral gene expression. Evidence is also presented to show, for the first time, genome-wide noncoding and bidirectional transcription at late stages of MCMV infection.

  8. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel


    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  9. A brief history of the status of transposable elements: from junk DNA to major players in evolution.


    Biémont, Christian


    The idea that some genetic factors are able to move around chromosomes emerged more than 60 years ago when Barbara McClintock first suggested that such elements existed and had a major role in controlling gene expression and that they also have had a major influence in reshaping genomes in evolution. It was many years, however, before the accumulation of data and theories showed that this latter revolutionary idea was correct although, understandably, it fell far short of our present view of the significant influence of what are now known as "transposable elements" in evolution. In this article, I summarize the main events that influenced my thinking about transposable elements as a young scientist and the influence and role of these specific genomic elements in evolution over subsequent years. Today, we recognize that the findings about genomic changes affected by transposable elements have considerably altered our view of the ways in which genomes evolve and work.

  10. Power law exponents characterizing human DNA

    NASA Astrophysics Data System (ADS)

    Provata, A.; Oikonomou, Th.


    The size distributions of all known coding and noncoding DNA sequences are studied in all human chromosomes. In a unified approach, both introns and intergenic regions are treated as noncoding regions. The distributions of noncoding segments Pnc(S) of size S present long tails Pnc(S)˜S-1-μnc , with exponents μnc ranging between 0.71 (for chromosome 13) and 1.2 (for chromosome 19). On the contrary, the exponential, short-range decay terms dominate in the distributions of coding (exon) segments Pc(S) in all chromosomes. Aiming to address the emergence of these statistical features, minimal, stochastic, mean-field models are proposed, based on randomly aggregating DNA strings with duplication, influx and outflux of genomic segments. These minimal models produce both the short-range statistics in the coding and the observed power law and fractal statistics in the noncoding DNA. The minimal models also demonstrate that although the two systems (coding and noncoding) coexist, alternating on the same linear chain, they act independently: the coding as a closed, equilibrium system and the noncoding as an open, out-of-equilibrium one.

  11. A long noncoding way to alternative splicing in plant development.


    Kornblihtt, Alberto R


    In this issue of Developmental Cell, Bardou et al. (2014) elucidate how long, highly structured noncoding RNAs control alternative splicing regulators that specifically mediate the action of the hormone auxin in the promotion of lateral root growth in Arabidopsis.

  12. Noncoding oligonucleotides: the belle of the ball in gene therapy.


    Shum, Ka-To; Rossi, John J


    Gene therapy carries the promise of cures for many diseases based on manipulating the expression of a person's genes toward the therapeutic goal. The relevance of noncoding oligonucleotides to human disease is attracting widespread attention. Noncoding oligonucleotides are not only involved in gene regulation, but can also be modified into therapeutic tools. There are many strategies that leverage noncoding oligonucleotides for gene therapy, including small interfering RNAs, antisense oligonucleotides, aptamers, ribozymes, decoys, and bacteriophage phi 29 RNAs. In this chapter, we will provide a broad, comprehensive overview of gene therapies that use noncoding oligonucleotides for disease treatment. The mechanism and development of each therapeutic will be described, with a particular focus on its clinical development. Finally, we will discuss the challenges associated with developing nucleic acid therapeutics and the prospects for future success.

  13. Mutations in noncoding regions of GJB1 are a major cause of X-linked CMT

    PubMed Central

    Tomaselli, Pedro J.; Rossor, Alexander M.; Horga, Alejandro; Jaunmuktane, Zane; Carr, Aisling; Saveri, Paola; Piscosquito, Giuseppe; Pareyson, Davide; Laura, Matilde; Blake, Julian C.; Poh, Roy; Polke, James; Houlden, Henry


    Objective: To determine the prevalence and clinical and genetic characteristics of patients with X-linked Charcot-Marie-Tooth disease (CMT) due to mutations in noncoding regions of the gap junction β-1 gene (GJB1). Methods: Mutations were identified by bidirectional Sanger sequence analysis of the 595 bases of the upstream promoter region, and 25 bases of the 3′ untranslated region (UTR) sequence in patients in whom mutations in the coding region had been excluded. Clinical and neurophysiologic data were retrospectively collected. Results: Five mutations were detected in 25 individuals from 10 kindreds representing 11.4% of all cases of CMTX1 diagnosed in our neurogenetics laboratory between 1996 and 2016. Four pathogenic mutations, c.-17G>A, c.-17+1G>T, c.-103C>T, and c.-146-90_146-89insT were detected in the 5′UTR. A novel mutation, c.*15C>T, was detected in the 3′ UTR of GJB1 in 2 unrelated families with CMTX1 and is the first pathogenic mutation in the 3′UTR of any myelin-associated CMT gene. Mutations segregated with the phenotype, were at sites predicted to be pathogenic, and were not present in the normal population. Conclusions: Mutations in noncoding DNA are a major cause of CMTX1 and highlight the importance of mutations in noncoding DNA in human disease. Next-generation sequencing platforms for use in inherited neuropathy should therefore include coverage of these regions. PMID:28283593

  14. AzaHx, a novel fluorescent, DNA minor groove and G·C recognition element: Synthesis and DNA binding properties of a p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (azaHx-PI) polyamide.


    Satam, Vijay; Babu, Balaji; Patil, Pravin; Brien, Kimberly A; Olson, Kevin; Savagian, Mia; Lee, Megan; Mepham, Andrew; Jobe, Laura Beth; Bingham, John P; Pett, Luke; Wang, Shuo; Ferrara, Maddi; Bruce, Chrystal D; Wilson, W David; Lee, Moses; Hartley, John A; Kiakos, Konstantinos


    The design, synthesis, and DNA binding properties of azaHx-PI or p-anisyl-4-aza-benzimidazole-pyrrole-imidazole (5) are described. AzaHx, 2-(p-anisyl)-4-aza-benzimidazole-5-carboxamide, is a novel, fluorescent DNA recognition element, derived from Hoechst 33258 to recognize G·C base pairs. Supported by theoretical data, the results from DNase I footprinting, CD, ΔT(M), and SPR studies provided evidence that an azaHx/IP pairing, formed from antiparallel stacking of two azaHx-PI molecules in a side-by-side manner in the minor groove, selectively recognized a C-G doublet. AzaHx-PI was found to target 5'-ACGCGT-3', the Mlu1 Cell Cycle Box (MCB) promoter sequence with specificity and significant affinity (K(eq) 4.0±0.2×10(7) M(-1)).

  15. Long noncoding RNAs in viral infections

    PubMed Central

    Fortes, Puri; Morris, Kevin


    Viral infections induce strong modifications in the cell transcriptome. Among the RNAs whose expression is altered by infection are long noncoding RNAs (lncRNAs). LncRNAs are transcripts with potential to function as RNA molecules. Infected cells may express viral lncRNAs, cellular lncRNAs and chimeric lncRNAs formed by viral and cellular sequences. Some viruses express viral lncRNAs whose function is essential for viral viability. They are transcribed by polymerase II or III and some of them can be processed by unique maturation steps performed by host cell machineries. Some viral lncRNAs control transcription, stability or translation of cellular and viral genes. Surprisingly, similar functions can be exerted by cellular lncRNAs induced by infection. Expression of cellular lncRNAs may be altered in response to viral replication or viral protein expression. However, many cellular lncRNAs respond to the antiviral pathways induced by infection. In fact, many lncRNAs function as positive or negative regulators of the innate antiviral response. Our current knowledge about the identity and function of lncRNAs in infected cells is very limited. However, research into this field has already helped in the identification of novel cellular pathways and may help in the development of therapeutic tools for the treatment of viral infections, autoimmune diseases, neurological disorders and cancer. PMID:26454188

  16. Non-coding RNAs and atherosclerosis

    PubMed Central

    Fernández-Hernando, Carlos


    Non-coding RNAs (ncRNAs) represent a class of RNA molecules that typically do not code for proteins. Emerging data suggest that ncRNAs play an important role in several physiological and pathological conditions such as cancer and cardiovascular diseases (CVDs) including atherosclerosis. The best-characterized ncRNAs are the microRNAs (miRNAs), which are small, ~22 nucleotide (nt) sequences of RNA that regulate gene expression at the posttranscriptional level through transcript degradation or translational repression. MiRNAs control several aspects of atherosclerosis including endothelial cell, vascular smooth cell, and macrophage functions as well as lipoprotein metabolism. Apart from miRNAs, recently ncRNAs, especially long ncRNAs (lncRNAs), have emerged as important potential regulators of the progression of atherosclerosis. However, the molecular mechanism of their regulation and function as well as significance of other ncRNAs such as small nucleolar RNAs (snoRNAs) during atherogenesis is largely unknown. In this review, we summarize the recent findings in the field, highlighting the importance of ncRNAs in atherosclerosis and discuss their potential use as therapeutic targets in CVDs. PMID:24623179

  17. Short Stories on Zebrafish Long Noncoding RNAs

    PubMed Central

    Haque, Shadabul; Kaushik, Kriti; Leonard, Vincent Elvin; Kapoor, Shruti; Sivadas, Ambily; Joshi, Adita


    Abstract The recent re-annotation of the transcriptome of human and other model organisms, using next-generation sequencing approaches, has unravelled a hitherto unknown repertoire of transcripts that do not have a potential to code for proteins. These transcripts have been largely classified into an amorphous class popularly known as long noncoding RNAs (lncRNA). This discovery of lncRNAs in human and other model systems have added a new layer to the understanding of gene regulation at the transcriptional and post-transcriptional levels. In recent years, three independent studies have discovered a number of lncRNAs expressed in different stages of zebrafish development and adult tissues using a high-throughput RNA sequencing approach, significantly adding to the repertoire of genes known in zebrafish. A subset of these transcripts also shows distinct and specific spatiotemporal patterns of gene expression, pointing to a tight regulatory control and potential functional roles in development, organogenesis, and/ or homeostasis. This review provides an overview of the lncRNAs in zebrafish and discusses how their discovery could provide new insights into understanding biology, explaining mutant phenotypes, and helping in potentially modeling disease processes. PMID:25110965

  18. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.


    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A


    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser.

  19. Gene activation-associated long noncoding RNAs function in mouse preimplantation development

    PubMed Central

    Hamazaki, Nobuhiko; Uesaka, Masahiro; Nakashima, Kinichi; Agata, Kiyokazu; Imamura, Takuya


    In mice, zygotic activation occurs for a wide variety of genes, mainly at the 2-cell stage. Long noncoding RNAs (lncRNAs) are increasingly being recognized as modulators of gene expression. In this study, directional RNA-seq of MII oocytes and 2-cell embryos identified more than 1000 divergently transcribed lncRNA/mRNA gene pairs. Expression of these bidirectional promoter-associated noncoding RNAs (pancRNAs) was strongly associated with the upregulation of their cognate genes. Conversely, knockdown of three abundant pancRNAs led to reduced mRNA expression, accompanied by sustained DNA methylation even in the presence of enzymes responsible for DNA demethylation. In particular, microinjection of siRNA against the abundant pancRNA partner of interleukin 17d (Il17d) mRNA at the 1-cell stage caused embryonic lethality, which was rescued by supplying IL17D protein in vitro at the 4-cell stage. Thus, this novel class of lncRNAs can modulate the transcription machinery in cis to activate zygotic genes and is important for preimplantation development. PMID:25633350

  20. A meiosis-specific Spt5 homolog involved in non-coding transcription.


    Gruchota, Julita; Denby Wilkes, Cyril; Arnaiz, Olivier; Sperling, Linda; Nowak, Jacek K


    Spt5 is a conserved and essential transcriptional regulator that binds directly to RNA polymerase and is involved in transcription elongation, polymerase pausing and various co-transcriptional processes. To investigate the role of Spt5 in non-coding transcription, we used the unicellular model Paramecium tetraurelia In this ciliate, development is controlled by epigenetic mechanisms that use different classes of non-coding RNAs to target DNA elimination. We identified two SPT5 genes. One (STP5v) is involved in vegetative growth, while the other (SPT5m) is essential for sexual reproduction. We focused our study on SPT5m, expressed at meiosis and associated with germline nuclei during sexual processes. Upon Spt5m depletion, we observed absence of scnRNAs, piRNA-like 25 nt small RNAs produced at meiosis. The scnRNAs are a temporal copy of the germline genome and play a key role in programming DNA elimination. Moreover, Spt5m depletion abolishes elimination of all germline-limited sequences, including sequences whose excision was previously shown to be scnRNA-independent. This suggests that in addition to scnRNA production, Spt5 is involved in setting some as yet uncharacterized epigenetic information at meiosis. Our study establishes that Spt5m is crucial for developmental genome rearrangements and necessary for scnRNA production.

  1. Retrotransposon-like nature of Tp1 elements: implications for the organisation of highly repetitive, hypermethylated DNA in the genome of Physarum polycephalum.

    PubMed Central

    Rothnie, H M; McCurrach, K J; Glover, L A; Hardman, N


    The repetitive fraction of the genome of the eukaryotic slime mould Physarum polycephalum is dominated by the Tp1 family of highly repetitive retrotransposon-like sequences. Tp1 elements consist of two terminal direct repeats of 277bp which flank an internal domain of 8.3kb. They are the major sequence component in the hypermethylated (M+) fraction of the genome where they have been found exclusively in scrambled clusters of up to 50kb long. Scrambling is thought to have arisen by insertion of Tp1 into further copies of the same sequence. In the present study, sequence analysis of cloned Tp1 elements has revealed striking homologies of the predicted amino acid sequence to several highly conserved domains characteristic of retrotransposons. The relative order of the predicted coding regions indicates that Tp1 elements are more closely related to copia and Ty than to retroviruses. Self-integration and methylation of Tp1 elements may function to limit transposition frequency. Such mechanisms provide a possible explanation for the origin and organisation of M + DNA in the Physarum genome. PMID:1707520

  2. No longer a nuisance: long non-coding RNAs join CENP-A in epigenetic centromere regulation.


    Rošić, Silvana; Erhardt, Sylvia


    Centromeres represent the basis for kinetochore formation, and are essential for proper chromosome segregation during mitosis. Despite these essential roles, centromeres are not defined by specific DNA sequences, but by epigenetic means. The histone variant CENP-A controls centromere identity epigenetically and is essential for recruiting kinetochore components that attach the chromosomes to the mitotic spindle during mitosis. Recently, a new player in centromere regulation has emerged: long non-coding RNAs transcribed from repetitive regions of centromeric DNA function in regulating centromeres epigenetically. This review summarizes recent findings on the essential roles that transcription, pericentromeric transcripts, and centromere-derived RNAs play in centromere biology.

  3. Identification and punctate nuclear localization of a novel noncoding RNA, Ks-1, from the honeybee brain.

    PubMed Central

    Sawata, Miyuki; Yoshino, Daisuke; Takeuchi, Hideaki; Kamikouchi, Azusa; Ohashi, Kazuaki; Kubo, Takeo


    We identified a novel gene, Ks-1, which is expressed preferentially in the small-type Kenyon cells of the honeybee brain. This gene is also expressed in some of the large soma neurons in the brain and in the suboesophageal ganglion. Reverse transcription-polymerase chain reaction experiments indicated that Ks-1 transcripts are enriched in the honeybee brain. cDNA cloning revealed that the consensus Ks-1 cDNA is over 17 kbp and contains no significant open reading frames. Furthermore, fluorescent in situ hybridization revealed that Ks-1 transcripts are located in the nuclei of the neural cells, accumulating in some scattered spots. These findings demonstrate that Ks-1 encodes a novel class of noncoding nuclear RNA and is possibly involved in the regulation of neural functions. PMID:12088150

  4. Dimerization interfaces formed between the DNA binding domains determine the cooperative binding of RXR/RAR and RXR/TR heterodimers to DR5 and DR4 elements.

    PubMed Central

    Zechel, C; Shen, X Q; Chambon, P; Gronemeyer, H


    We have previously reported that the binding site repertoires of heterodimers formed between retinoid X receptor (RXR) and either retinoic acid receptor (RAR) or thyroid hormone receptor (TR) bound to response elements consisting of directly repeated PuG(G/T)TCA motifs spaced by 1-5 bp [direct repeat (DR) elements 1-5] are highly similar to those of their corresponding DNA binding domains (DBDs). We have now mapped the dimerization surfaces located in the DBDs of RXR, RAR and TR, which are responsible for cooperative interaction on DR4 (RXR and TR) and DR5 (RXR and RAR). The D-box of the C-terminal CII finger of RXR provides one of the surfaces which is specifically required for the formation of the heterodimerization interfaces on both DR4 and DR5. Heterodimerization with the RXR DBD on DR5 specifically requires the tip of the RAR CI finger as the complementary surface, while a 7 amino acid sequence encompassing the 'prefinger region', but not the TR CI finger, is specifically required for efficient dimerization of TR and RXR DBDs on DR4. Importantly, DBD swapping experiments demonstrate not only that the binding site repertoires of the full-length receptors are dictated by those of their DBDs, but also that the formation of distinct dimerization interfaces between the DBDs are the critical determinants for cooperative DNA binding of these receptors to specific DRs. Images PMID:8137825

  5. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Clostridium difficile Toxin B and Sensitive Detection in Human Fecal Matter

    PubMed Central

    Maher, Eamonn; Williams, Ryan M.; Sooter, Letha J.


    Toxin B is one of the major virulence factors of Clostridium difficile, a bacterium that is responsible for a significant number of diarrhea cases in acute care settings. Due to the prevalence of C. difficile induced diarrhea, rapid and correct diagnosis is crucial in the disease management. In this study, we have employed a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE) specific for toxin B. At the end of the 12-round selection, one MRE with high affinity (Kd = 47.3 nM) for toxin B was identified. The selected MRE demonstrated low cross binding activities on negative targets: bovine serum albumin, Staphylococcus aureus alpha toxin, Pseudomonas aeruginosa exotoxin A, and cholera toxin of Vibrio cholera. A modified sandwich ELISA assay was developed utilizing the selected ssDNA MRE as the antigen capturing element and achieved a sensitive detection of 50 nM of toxin B in human fecal preparations. PMID:25734010

  6. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    PubMed Central

    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.


    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. PMID:25633102

  7. Evolutionary conservation of regulatory elements in vertebrate Hox gene clusters.


    Santini, Simona; Boore, Jeffrey L; Meyer, Axel


    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aalpha or Abeta duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes.

  8. Select Prenatal Environmental Exposures and Subsequent Alterations of Gene-Specific and Repetitive Element DNA Methylation in Fetal Tissues

    PubMed Central

    Green, Benjamin B.; Marsit, Carmen J.


    Strong evidence implicates maternal environmental exposures in contributing to adverse outcomes during pregnancy and later in life through the developmental origins of health and disease hypothesis. Recent research suggests these effects are mediated through the improper regulation of DNA methylation in offspring tissues, specifically placental tissue, which plays a critical role in fetal development. This article reviews the relevant literature relating DNA methylation in multiple tissues at or near delivery to several prenatal environmental toxicants and stressors, including cigarette smoke, endocrine disruptors, heavy metals, as well as maternal diet. These human studies expand upon previously reported outcomes in animal model interventions and include effects on both imprinted and non-imprinted genes. We have also noted some of the strengths and limitations in the approaches used, and consider the appropriate interpretation of these findings in terms of their effect size and their relationship to differential gene expression and potential health outcomes. The studies suggest an important role of DNA methylation in mediating the effects of the intrauterine environment on children’s health and a need for additional research to better clarify the role of this epigenetic mechanism as well as others. PMID:26231362

  9. Portraying breast cancers with long noncoding RNAs

    PubMed Central

    Van Grembergen, Olivier; Bizet, Martin; de Bony, Eric J.; Calonne, Emilie; Putmans, Pascale; Brohée, Sylvain; Olsen, Catharina; Guo, Mingzhou; Bontempi, Gianluca; Sotiriou, Christos; Defrance, Matthieu; Fuks, François


    Evidence is emerging that long noncoding RNAs (lncRNAs) may play a role in cancer development, but this role is not yet clear. We performed a genome-wide transcriptional survey to explore the lncRNA landscape across 995 breast tissue samples. We identified 215 lncRNAs whose genes are aberrantly expressed in breast tumors, as compared to normal samples. Unsupervised hierarchical clustering of breast tumors on the basis of their lncRNAs revealed four breast cancer subgroups that correlate tightly with PAM50-defined mRNA-based subtypes. Using multivariate analysis, we identified no less than 210 lncRNAs prognostic of clinical outcome. By analyzing the coexpression of lncRNA genes and protein-coding genes, we inferred potential functions of the 215 dysregulated lncRNAs. We then associated subtype-specific lncRNAs with key molecular processes involved in cancer. A correlation was observed, on the one hand, between luminal A–specific lncRNAs and the activation of phosphatidylinositol 3-kinase, fibroblast growth factor, and transforming growth factor–β pathways and, on the other hand, between basal-like–specific lncRNAs and the activation of epidermal growth factor receptor (EGFR)–dependent pathways and of the epithelial-to-mesenchymal transition. Finally, we showed that a specific lncRNA, which we called CYTOR, plays a role in breast cancer. We confirmed its predicted functions, showing that it regulates genes involved in the EGFR/mammalian target of rapamycin pathway and is required for cell proliferation, cell migration, and cytoskeleton organization. Overall, our work provides the most comprehensive analyses for lncRNA in breast cancers. Our findings suggest a wide range of biological functions associated with lncRNAs in breast cancer and provide a foundation for functional investigations that could lead to new therapeutic approaches. PMID:27617288

  10. Structure of p53 binding to the BAX response element reveals DNA unwinding and compression to accommodate base-pair insertion

    SciTech Connect

    Chen, Y.; Zhang, X.; Dantas Machado, A. C.; Ding, Y.; Chen, Z.; Qin, P. Z.; Rohs, R.; Chen, L.


    The p53 core domain binds to response elements (REs) that contain two continuous half-sites as a cooperative tetramer, but how p53 recognizes discontinuous REs is not well understood. Here we describe the crystal structure of the p53 core domain bound to a naturally occurring RE located at the promoter of the Bcl-2-associated X protein (BAX) gene, which contains a one base-pair insertion between the two half-sites. Surprisingly, p53 forms a tetramer on the BAX-RE that is nearly identical to what has been reported on other REs with a 0-bp spacer. Each p53 dimer of the tetramer binds in register to a half-site and maintains the same protein–DNA interactions as previously observed, and the two dimers retain all the protein–protein contacts without undergoing rotation or translation. To accommodate the additional base pair, the DNA is deformed and partially disordered around the spacer region, resulting in an apparent unwinding and compression, such that the interactions between the dimers are maintained. Furthermore, DNA deformation within the p53-bound BAX-RE is confirmed in solution by site-directed spin labeling measurements. Our results provide a structural insight into the mechanism by which p53 binds to discontinuous sites with one base-pair spacer.

  11. Noncoding RNAs, cytokines, and inflammation-related diseases.


    Marques-Rocha, José Luiz; Samblas, Mirian; Milagro, Fermin I; Bressan, Josefina; Martínez, J Alfredo; Marti, Amelia


    Chronic inflammation is involved in the onset and development of many diseases, including obesity, atherosclerosis, type 2 diabetes, osteoarthritis, autoimmune and degenerative diseases, asthma, periodontitis, and cirrhosis. The inflammation process is mediated by chemokines, cytokines, and different inflammatory cells. Although the molecules and mechanisms that regulate this primary defense mechanism are not fully understood, recent findings offer a putative role of noncoding RNAs, especially microRNAs (miRNAs), in the progression and management of the inflammatory response. These noncoding RNAs are crucial for the stability and maintenance of gene expression patterns that characterize some cell types, tissues, and biologic responses. Several miRNAs, such as miR-126, miR-132, miR-146, miR-155, and miR-221, have emerged as important transcriptional regulators of some inflammation-related mediators. Additionally, little is known about the involvement of long noncoding RNAs, long intergenic noncoding RNAs, and circular RNAs in inflammation-mediated processes and the homeostatic imbalance associated with metabolic disorders. These noncoding RNAs are emerging as biomarkers with diagnosis value, in prognosis protocols, or in the personalized treatment of inflammation-related alterations. In this context, this review summarizes findings in the field, highlighting those noncoding RNAs that regulate inflammation, with emphasis on recognized mediators such as TNF-α, IL-1, IL-6, IL-18, intercellular adhesion molecule 1, VCAM-1, and plasminogen activator inhibitor 1. The down-regulation or antagonism of the noncoding RNAs and the administration of exogenous miRNAs could be, in the near future, a promising therapeutic strategy in the treatment of inflammation-related diseases.

  12. Conformational changes in the DNA-binding domains of the ecdysteroid receptor during the formation of a complex with the hsp27 response element.


    Pakuła, Szymon; Orłowski, Marek; Rymarczyk, Grzegorz; Krusiński, Tomasz; Jakób, Michał; Zoglowek, Anna; Ożyhar, Andrzej; Dobryszycki, Piotr


    The ecdysone receptor (EcR) and the ultraspiracle protein (Usp) form the functional receptor for ecdysteroids that initiates metamorphosis in insects. The Usp and EcR DNA-binding domains (UspDBD and EcRDBD, respectively) form a heterodimer on the natural pseudopalindromic element from the hsp27 gene promoter. The conformational changes in the protein-DNA during the formation of the UspDBD-EcRDBD-hsp27 complex were analyzed. Recombined UspDBD and EcRDBD proteins were purified and fluorescein labeled (FL) using the intein method at the C-ends of both proteins. The changes in the distances from the respective C-ends of EcRDBD and/or UspDBD to the 5'- and/or 3'-end of the response element were measured using fluorescence resonance energy transfer (FRET) methodology. The binding of EcRDBD induced a strong conformational change in UspDBD and caused the C-terminal fragment of the UspDBD molecule to move away from both ends of the regulatory element. UspDBD also induced a significant conformational change in the EcRDBD molecule. The EcRDBD C-terminus moved away from the 5'-end of the regulatory element and moved close to the 3'-end. An analysis was also done on the effect that DHR38DBD, the Drosophila ortholog of the mammalian NGFI-B, had on the interaction of UspDBD and EcRDBD with hsp27. FRET analysis demonstrated that hsp27 bending was induced by DHR38DBD. Fluorescence data revealed that hsp27 had a shorter end-to-end distance both in the presence of EcRDBD as well as in the presence of EcRDBD together with DHR38DBD, with DNA bend angles of about 36.2° and 33.6°, respectively. A model of how DHR38DBD binds to hsp27 in the presence of EcRDBD is presented.

  13. A zinc-dependent DNA-binding activity co-operates with cAMP-responsive-element-binding protein to activate the human thyroglobulin enhancer.

    PubMed Central

    Berg, V; Vassart, G; Christophe, D


    Footprinting experiments involving the human thyroglobulin gene enhancer and thyroid nuclear extracts revealed a protected region called X2, containing an incomplete cAMP-responsive element (CRE). Band-shift experiments identified two binding activities recognizing the X2 element: a CRE-binding protein (CREB)/activating transcription factor (ATF) relative that binds the half CRE motif and a second factor that interacts with a G-rich motif located just upstream from the CRE. The first factor appears to be CREB itself, as indicated by the supershifting when using an antibody directed against CREB, and the second DNA-binding activity involved was shown to be zinc-dependent and exhibited an apparent molecular mass of 42-44 kDa in South-Western blotting experiments. This factor may represent a novel entity, which we named CAF, for 'CREB Associated Factor'. Three copies of X2 sequence conferred a strong cAMP-dependent transcriptional activation to a heterologous promoter in transient transfection assay in cAMP-stimulated primary thyrocytes and HeLa cells. Transfection experiments of constructs containing the X2 element mutated in either the CRE or the G-rich site showed that both motifs were required for this transcription activating function. Moreover, the combination of several individual X2 elements mutated in either the CRE or the G-rich motif did not exhibit full transcriptional activity. This suggests that, in the context of the X2 element, CREB requires a close interaction with CAF to achieve both basal and cAMP-dependent transcriptional activation. PMID:9163323

  14. Nucleotide sequence of the capsid protein gene and 3' non-coding region of papaya mosaic virus RNA.


    Abouhaidar, M G


    The nucleotide sequences of cDNA clones corresponding to the 3' OH end of papaya mosaic virus RNA have been determined. The 3'-terminal sequence obtained was 900 nucleotides in length, excluding the poly(A) tail, and contained an open reading frame capable of giving rise to a protein of 214 amino acid residues with an Mr of 22930. This protein was identified as the viral capsid protein. The 3' non-coding region of PMV genome RNA was about 121 nucleotides long [excluding the poly(A) tail] and homologous to the complementary sequence of the non-coding region at the 5' end of PMV RNA. A long open reading frame was also found in the predicted 5' end region of the negative strand.

  15. Improved recombinant antibody production by CHO cells using a production enhancer DNA element with repeated transgene integration at a predetermined chromosomal site.


    Kawabe, Yoshinori; Inao, Takanori; Komatsu, Shodai; Huang, Guan; Ito, Akira; Omasa, Takeshi; Kamihira, Masamichi


    Chinese hamster ovary (CHO) cells are one of the most useful host cell lines for the production of biopharmaceutical proteins. Although a series of production processes have been refined to improve protein productivity and cost performance, establishing producer cells is still time-consuming and labor-intensive. Recombinase-mediated site-specific gene integration into a predetermined chromosomal locus may enable predictable protein expression, reducing the laborious process of cell screening. We previously developed an accumulative site-specific gene integration system (AGIS) using Cre recombinase and mutated loxP sites for transgene integration and amplification in the CHO cell genome. Epigenetic modifier elements such as insulators are effective DNA cis-regulatory elements for stabilizing transgene expression. Here, we attempted to enhance transgene expression in recombinant CHO cells generated by AGIS using a production enhancer DNA element (PE) derived from the CHO genome. The PE was introduced into an expression unit for a recombinant scFv-Fc antibody. The effect on scFv-Fc productivity of PE position and orientation within the transgene was evaluated, while keeping the background chromosomal structure constant. For the optimal PE arrangement, scFv-Fc productivity was enhanced 2.6-fold compared with an expression unit without a PE. The enhancing effect of the PE on transgene expression was also observed when two or three PE-flanked expression units were inserted as tandem repeats. These results indicate that AGIS using the PE-flanked expression unit is a promising approach for establishing producer cell lines for biopharmaceutical protein production.

  16. An intact DNA-binding domain is not required for peroxisome proliferator-activated receptor gamma (PPARgamma) binding and activation on some PPAR response elements.


    Temple, Karla A; Cohen, Ronald N; Wondisford, Sarah R; Yu, Christine; Deplewski, Dianne; Wondisford, Fredric E


    Peroxisome proliferator-activated receptor gamma (PPARgamma) interacts with retinoid X receptor (RXR) on PPAR response elements (PPREs) to regulate transcription of PPAR-responsive genes. To investigate the binding of PPARgamma and RXR to PPREs, three mutations were constructed in the DNA-binding domains of PPARgamma; two of the mutants maintained the structure of zinc finger I (PPARgamma-GS and PPARgamma-AA), and a third mutation disrupted the protein structure of zinc finger I (PPARgamma-CS). Results indicated that the mutations of PPARgamma that maintained intact zinc fingers were capable of binding to a variety of PPREs in the presence of RXR and could activate transcription on several PPREs. In parallel, a mutation was created in the DNA-binding domain of RXRalpha that maintained the structure of the zinc fingers (RXR-GS) but did not bind DNA and was transcriptionally inactive. Examination of the 3' half-site of several PPREs revealed that variations from the consensus sequence reduced or abolished transcriptional activity, but conversion to consensus improved transcriptional activity with PPARgamma-GS and PPARgamma-AA. Examination of the 5' half-site indicated that the upstream three nucleotides were more important for transcriptional activity than the downstream three nucleotides. Our data demonstrated that stringent binding of RXR to the 3' half-site of a PPRE is more influential on the binding of the PPARgamma/RXR heterodimer than the ability of PPARgamma to bind DNA. Thus, unlike RXR, PPARgamma exhibits promiscuity in binding on a PPRE, suggesting that the definition of a PPRE for PPARgamma may need to be expanded.

  17. Protein and DNA contact surfaces that mediate the selective action of the Phox1 homeodomain at the c-fos serum response element.

    PubMed Central

    Simon, K J; Grueneberg, D A; Gilman, M


    The human homeodomain protein Phox1 can impart serum-responsive transcriptional activity to the c-fos serum response element (SRE) by interacting with serum response factor (SRF). This activity is shared with other Paired class homeodomains but not with more distantly related homeodomains. To understand the mechanism of action of Phox1 at the SRE and the basis for the selective activity of Paired class homeodomains in this context, we performed a detailed mutagenesis of the Phox1 homeodomain. We found that amino acid residues that contact the major groove of the DNA are required for SRE activation in vivo, suggesting an in vivo requirement for major-groove DNA contact by the homeodomain. In contrast, substitution of a lysine residue in the N-terminal arm of the Phox1 homeodomain appeared to abolish DNA binding without affecting activity in vivo. Certain substitutions on the exposed surfaces of helices 1 and 2, not required for DNA binding, abolished activity in vivo, suggesting that these surfaces contact an accessory protein(s) required for this activity. We also found that transfer of a single amino acid residue from the surface of Phox1 helix 1 to the corresponding position in the distantly related Deformed (Dfd) homeodomain imparts to Dfd the ability to activate the SRE in vivo. We propose that Phox1 interacts with one or more factors at the SRE, in addition to SRF, and that the specificity of this interaction is determined by residues on the surfaces of helices 1 and 2. PMID:9343429

  18. Global Analysis of DNA Methylation Variation in Adipose Tissue from Twins Reveals Links to Disease-Associated Variants in Distal Regulatory Elements

    PubMed Central

    Grundberg, Elin; Meduri, Eshwar; Sandling, Johanna K.; Hedman, Åsa K.; Keildson, Sarah; Buil, Alfonso; Busche, Stephan; Yuan, Wei; Nisbet, James; Sekowska, Magdalena; Wilk, Alicja; Barrett, Amy; Small, Kerrin S.; Ge, Bing; Caron, Maxime; Shin, So-Youn; Ahmadi, Kourosh R.; Ainali, Chrysanthi; Barrett, Amy; Bataille, Veronique; Bell, Jordana T.; Buil, Alfonso; Deloukas, Panos; Dermitzakis, Emmanouil T.; Dimas, Antigone S.; Durbin, Richard; Glass, Daniel; Grundberg, Elin; Hassanali, Neelam; Hedman, Åsa K.; Ingle, Catherine; Knowles, David; Krestyaninova, Maria; Lindgren, Cecilia M.; Lowe, Christopher E.; McCarthy, Mark I.; Meduri, Eshwar; di Meglio, Paola; Min, Josine L.; Montgomery, Stephen B.; Nestle, Frank O.; Nica, Alexandra C.; Nisbet, James; O’Rahilly, Stephen; Parts, Leopold; Potter, Simon; Sandling, Johanna; Sekowska, Magdalena; Shin, So-Youn; Small, Kerrin S.; Soranzo, Nicole; Spector, Tim D.; Surdulescu, Gabriela; Travers, Mary E.; Tsaprouni, Loukia; Tsoka, Sophia; Wilk, Alicja; Yang, Tsun-Po; Zondervan, Krina T.; Lathrop, Mark; Dermitzakis, Emmanouil T.; McCarthy, Mark I.; Spector, Timothy D.; Bell, Jordana T.; Deloukas, Panos


    Epigenetic modifications such as DNA methylation play a key role in gene regulation and disease susceptibility. However, little is known about the genome-wide frequency, localization, and function of methylation variation and how it is regulated by genetic and environmental factors. We utilized the Multiple Tissue Human Expression Resource (MuTHER) and generated Illumina 450K adipose methylome data from 648 twins. We found that individual CpGs had low variance and that variability was suppressed in promoters. We noted that DNA methylation variation was highly heritable (h2median = 0.34) and that shared environmental effects correlated with metabolic phenotype-associated CpGs. Analysis of methylation quantitative-trait loci (metQTL) revealed that 28% of CpGs were associated with nearby SNPs, and when overlapping them with adipose expression quantitative-trait loci (eQTL) from the same individuals, we found that 6% of the loci played a role in regulating both gene expression and DNA methylation. These associations were bidirectional, but there were pronounced negative associations for promoter CpGs. Integration of metQTL with adipose reference epigenomes and disease associations revealed significant enrichment of metQTL overlapping metabolic-trait or disease loci in enhancers (the strongest effects were for high-density lipoprotein cholesterol and body mass index [BMI]). We followed up with the BMI SNP rs713586, a cg01884057 metQTL that overlaps an enhancer upstream of ADCY3, and used bisulphite sequencing to refine this region. Our results showed widespread population invariability yet sequence dependence on adipose DNA methylation but that incorporating maps of regulatory elements aid in linking CpG variation to gene regulation and disease risk in a tissue-dependent manner. PMID:24183450

  19. Noncoding RNA gene detection using comparative sequence analysis

    PubMed Central

    Rivas, Elena; Eddy, Sean R


    Background Noncoding RNA genes produce transcripts that exert their function without ever producing proteins. Noncoding RNA gene sequences do not have strong statistical signals, unlike protein coding genes. A reliable general purpose computational genefinder for noncoding RNA genes has been elusive. Results We describe a comparative sequence analysis algorithm for detecting novel structural RNA genes. The key idea is to test the pattern of substitutions observed in a pairwise alignment of two homologous sequences. A conserved coding region tends to show a pattern of synonymous substitutions, whereas a conserved structural RNA tends to show a pattern of compensatory mutations consistent with some base-paired secondary structure. We formalize this intuition using three probabilistic "pair-grammars": a pair stochastic context free grammar modeling alignments constrained by structural RNA evolution, a pair hidden Markov model modeling alignments constrained by coding sequence evolution, and a pair hidden Markov model modeling a null hypothesis of position-independent evolution. Given an input pairwise sequence alignment (e.g. from a BLASTN comparison of two related genomes) we classify the alignment into the coding, RNA, or null class according to the posterior probability of each class. Conclusions We have implemented this approach as a program, QRNA, which we consider to be a prototype structural noncoding RNA genefinder. Tests suggest that this approach detects noncoding RNA genes with a fair degree of reliability. PMID:11801179

  20. Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci.


    Farley, Brian M; Collins, Kathleen


    Transgenerational transmission of genome-regulatory epigenetic information can determine phenotypes in the progeny of sexual reproduction. Sequence specificity of transgenerational regulation derives from small RNAs assembled into Piwi-protein complexes. Known targets of transgenerational regulation are primarily transposons and transposon-derived sequences. Here, we extend the scope of Piwi-mediated transgenerational regulation to include unique noncoding RNA loci. Ciliates such as Tetrahymena have a phenotypically silent germline micronucleus and an expressed somatic macronucleus, which is differentiated anew from a germline genome copy in sexual reproduction. We show that the nuclear-localized Tetrahymena Piwi protein Twi8p shuttles from parental to zygotic macronuclei. Genetic elimination of Twi8p has no phenotype for cells in asexual growth. On the other hand, cells lacking Twi8p arrest in sexual reproduction with zygotic nuclei that retain the germline genome structure, without the DNA elimination and fragmentation required to generate a functional macronucleus. Twi8p-bound small RNAs originate from long-noncoding RNAs with a terminal hairpin, which become detectable in the absence of Twi8p. Curiously, the loci that generate Twi8p-bound small RNAs are essential for asexual cell growth, even though Twi8 RNPs are essential only in sexual reproduction. Our findings suggest the model that Twi8 RNPs act on silent germline chromosomes to permit their conversion to expressed macronuclear chromosomes. Overall this work reveals that a Piwi protein carrying small RNAs from long-noncoding RNA loci has transgenerational function in establishing zygotic nucleus competence for gene expression.

  1. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.


    Maliszewska-Olejniczak, Kamila; Gruchota, Julita; Gromadka, Robert; Denby Wilkes, Cyril; Arnaiz, Olivier; Mathy, Nathalie; Duharcourt, Sandra; Bétermier, Mireille; Nowak, Jacek K


    Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs) in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline) nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs). Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium, and establishes for

  2. Strategies for Development of Functionally Equivalent Promoters with Minimum Sequence Homology for Transgene Expression in Plants: cis-Elements in a Novel DNA Context versus Domain Swapping1

    PubMed Central

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar


    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) “domain swapping,” wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using β-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  3. Sequencing of Pooled DNA Samples (Pool-Seq) Uncovers Complex Dynamics of Transposable Element Insertions in Drosophila melanogaster

    PubMed Central

    Schlötterer, Christian


    Transposable elements (TEs) are mobile genetic elements that parasitize genomes by semi-autonomously increasing their own copy number within the host genome. While TEs are important for genome evolution, appropriate methods for performing unbiased genome-wide surveys of TE variation in natural populations have been lacking. Here, we describe a novel and cost-effective approach for estimating population frequencies of TE insertions using paired-end Illumina reads from a pooled population sample. Importantly, the method treats insertions present in and absent from the reference genome identically, allowing unbiased TE population frequency estimates. We apply this method to data from a natural Drosophila melanogaster population from Portugal. Consistent with previous reports, we show that low recombining genomic regions harbor more TE insertions and maintain insertions at higher frequencies than do high recombining regions. We conservatively estimate that there are almost twice as many “novel” TE insertion sites as sites known from the reference sequence in our population sample (6,824 novel versus 3,639 reference sites, with on average a 31-fold coverage per insertion site). Different families of transposable elements show large differences in their insertion densities and population frequencies. Our analyses suggest that the history of TE activity significantly contributes to this pattern, with recently active families segregating at lower frequencies than those active in the more distant past. Finally, using our high-resolution TE abundance measurements, we identified 13 candidate positively selected TE insertions based on their high population frequencies and on low Tajima's D values in their neighborhoods. PMID:22291611

  4. Role of Non-Coding RNAs in the Transgenerational Epigenetic Transmission of the Effects of Reprotoxicants.


    Larriba, Eduardo; del Mazo, Jesús


    Non-coding RNAs (ncRNAs) are regulatory elements of gene expression and chromatin structure. Both long and small ncRNAs can also act as inductors and targets of epigenetic programs. Epigenetic patterns can be transmitted from one cell to the daughter cell, but, importantly, also through generations. Diversity of ncRNAs is emerging with new and surprising roles. Functional interactions among ncRNAs and between specific ncRNAs and structural elements of the chromatin are drawing a complex landscape. In this scenario, epigenetic changes induced by environmental stressors, including reprotoxicants, can explain some transgenerationally-transmitted phenotypes in non-Mendelian ways. In this review, we analyze mechanisms of action of reprotoxicants upon different types of ncRNAs and epigenetic modifications causing transgenerationally transmitted characters through germ cells but affecting germ cells and reproductive systems. A functional model of epigenetic mechanisms of transgenerational transmission ncRNAs-mediated is also proposed.

  5. Role of Non-Coding RNAs in the Transgenerational Epigenetic Transmission of the Effects of Reprotoxicants

    PubMed Central

    Larriba, Eduardo; del Mazo, Jesús


    Non-coding RNAs (ncRNAs) are regulatory elements of gene expression and chromatin structure. Both long and small ncRNAs can also act as inductors and targets of epigenetic programs. Epigenetic patterns can be transmitted from one cell to the daughter cell, but, importantly, also through generations. Diversity of ncRNAs is emerging with new and surprising roles. Functional interactions among ncRNAs and between specific ncRNAs and structural elements of the chromatin are drawing a complex landscape. In this scenario, epigenetic changes induced by environmental stressors, including reprotoxicants, can explain some transgenerationally-transmitted phenotypes in non-Mendelian ways. In this review, we analyze mechanisms of action of reprotoxicants upon different types of ncRNAs and epigenetic modifications causing transgenerationally transmitted characters through germ cells but affecting germ cells and reproductive systems. A functional model of epigenetic mechanisms of transgenerational transmission ncRNAs-mediated is also proposed. PMID:27023531

  6. Resurrection of DNA Function In Vivo from an Extinct Genome

    PubMed Central

    Pask, Andrew J.; Behringer, Richard R.; Renfree, Marilyn B.


    There is a burgeoning repository of information available from ancient DNA that can be used to understand how genomes have evolved and to determine the genetic features that defined a particular species. To assess the functional consequences of changes to a genome, a variety of methods are needed to examine extinct DNA function. We isolated a transcriptional enhancer element from the genome of an extinct marsupial, the Tasmanian tiger (Thylacinus cynocephalus or thylacine), obtained from 100 year-old ethanol-fixed tissues from museum collections. We then examined the function of the enhancer in vivo. Using a transgenic approach, it was possible to resurrect DNA function in transgenic mice. The results demonstrate that the thylacine Col2A1 enhancer directed chondrocyte-specific expression in this extinct mammalian species in the same way as its orthologue does in mice. While other studies have examined extinct coding DNA function in vitro, this is the first example of the restoration of extinct non-coding DNA and examination of its function in vivo. Our method using transgenesis can be used to explore the function of regulatory and protein-coding sequences obtained from any extinct species in an in vivo model system, providing important insights into gene evolution and diversity. PMID:18493600

  7. Archaeal Haloarcula californiae Icosahedral Virus 1 Highlights Conserved Elements in Icosahedral Membrane-Containing DNA Viruses from Extreme Environments

    PubMed Central

    Demina, Tatiana A.; Pietilä, Maija K.; Svirskaitė, Julija; Ravantti, Janne J.; Atanasova, Nina S.; Bamford, Dennis H.


    ABSTRACT Despite their high genomic diversity, all known viruses are structurally constrained to a limited number of virion morphotypes. One morphotype of viruses infecting bacteria, archaea, and eukaryotes is the tailless icosahedral morphotype with an internal membrane. Although it is considered an abundant morphotype in extreme environments, only seven such archaeal viruses are known. Here, we introduce Haloarcula californiae icosahedral virus 1 (HCIV-1), a halophilic euryarchaeal virus originating from salt crystals. HCIV-1 also retains its infectivity under low-salinity conditions, showing that it is able to adapt to environmental changes. The release of progeny virions resulting from cell lysis was evidenced by reduced cellular oxygen consumption, leakage of intracellular ATP, and binding of an indicator ion to ruptured cell membranes. The virion contains at least 12 different protein species, lipids selectively acquired from the host cell membrane, and a 31,314-bp-long linear double-stranded DNA (dsDNA). The overall genome organization and sequence show high similarity to the genomes of archaeal viruses in the Sphaerolipoviridae family. Phylogenetic analysis based on the major conserved components needed for virion assembly—the major capsid proteins and the packaging ATPase—placed HCIV-1 along with the alphasphaerolipoviruses in a distinct, well-supported clade. On the basis of its virion morphology and sequence similarities, most notably, those of its core virion components, we propose that HCIV-1 is a member of the PRD1-adenovirus structure-based lineage together with other sphaerolipoviruses. This addition to the lineage reinforces the notion of the ancient evolutionary links observed between the viruses and further highlights the limits of the choices found in nature for formation of a virion. PMID:27435460

  8. DNA methylation dynamics in neurogenesis.


    Wang, Zhiqin; Tang, Beisha; He, Yuquan; Jin, Peng


    Neurogenesis is not limited to the embryonic stage, but continually proceeds in the adult brain throughout life. Epigenetic mechanisms, including DNA methylation, histone modification and noncoding RNA, play important roles in neurogenesis. For decades, DNA methylation was thought to be a stable modification, except for demethylation in the early embryo. In recent years, DNA methylation has proved to be dynamic during development. In this review, we summarize the latest understanding about DNA methylation dynamics in neurogenesis, including the roles of different methylation forms (5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine and 5-carboxylcytosine), as well as their 'writers', 'readers' and interactions with histone modifications.

  9. The epigenetic regulation of transposable elements by PIWI-interacting RNAs in Drosophila.


    Saito, Kuniaki


    A mechanism is required to repress the expression and transposition of transposable elements (TEs) to ensure the stable inheritance of genomic information. Accumulating evidence indicates that small non-coding RNAs are important regulators of TEs. Among small non-coding RNAs, PIWI-interacting RNAs (piRNAs) serve as guide molecules for recognizing and silencing numerous TEs and work in collaboration with PIWI subfamily proteins in gonadal cells. Disruption of the piRNA pathway correlates with loss of proper genomic organization, gene expression control and fertility. Moreover, recent studies on the molecular mechanisms of piRNA biogenesis and on piRNA function have shown that piRNAs act as maternally inherited genic elements, transferring information about repressed TEs to progeny. These findings enable a molecular explanation of mysterious epigenetic phenomena, such as hybrid dysgenesis and TE adaptation with age. Here, I review our current knowledge of piRNAs derived from biochemical and genetic studies and discuss how small RNAs are utilized to maintain genome organization and to provide non-DNA genetic information. I mainly focus on Drosophila but also discuss comparisons with other species.

  10. Long antisense non-coding RNAs and the epigenetic regulation of gene expression.


    Vadaie, Nadia; Morris, Kevin V


    Shortly after the completion of the human genome project in 2003, the Encode project was launched. The project was set out to identify the functional elements in the human genome, and unexpectedly it was found that >80% of the genome is transcribed. The Encode project identified those transcribed regions of the genome to be encoded by non-coding RNAs (ncRNAs). With only 2% of the genome carrying gene-encoding proteins, the conundrum was then, what is the function, if any, of these non-coding regions of the genome? These ncRNAs included both short and long RNAs. The focus of this review will be on antisense long non-coding RNAs (lncRNAs), as these transcripts have been observed to play a role in gene expression of protein-coding genes. Some lncRNAs have been found to regulate protein-coding gene transcription at the epigenetic level, whereby they suppress transcription through the recruitment of protein complexes to target loci in the genome. Conversely, there are lncRNAs that have a positive role in gene expression with less known about mechanism, and some lncRNAs have been shown to be involved in post-transcriptional processes. Additionally, lncRNAs have been observed to regulate their own expression in a positive feedback loop by functioning as a decoy. The biological significance of lncRNAs is only just now becoming evident, with many lncRNAs found to play a significant role in several human diseases.

  11. Long Noncoding RNAs: Fresh Perspectives into the RNA world

    PubMed Central

    Yang, Lin; Froberg, John E.; Lee, Jeannie T.


    Large scale mapping of transcriptomes has revealed significant levels of transcriptional activity within both unannotated and annotated regions of the genome. Interestingly, many of the novel transcripts demonstrate tissue-specific expression and some level of sequence conservation across species, but most have low protein-coding potential. Here we describe progress in identifying and characterizing long noncoding RNAs and review how these transcripts interact with other biological molecules to regulate diverse cellular processes. We also preview emerging techniques that will help advance the discovery and characterization of novel transcripts. Finally, we discuss the role of long non-coding RNAs in disease and therapeutics. PMID:24290031

  12. Functions of plants long non-coding RNAs.


    Shafiq, Sarfraz; Li, Jingrui; Sun, Qianwen


    Long non-coding RNAs (lncRNAs) have been emerged as important players for various biological pathways, including dosage compensation, genomic imprinting, chromatin regulation, alternative splicing and nuclear organization. A large number of lncRNAs had already been identified by different approaches in plants, while the functions of only a few of them have been investigated. This review will summarize our current understanding of a wide range of plant lncRNAs functions, and highlight their roles in the regulation of diverse pathways in plants. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa.

  13. Non-coding RNAs in Mammary Gland Development and Disease.


    Sandhu, Gurveen K; Milevskiy, Michael J G; Wilson, Wesley; Shewan, Annette M; Brown, Melissa A


    Non-coding RNAs (ncRNAs) are untranslated RNA molecules that function to regulate the expression of numerous genes and associated biochemical pathways and cellular functions. NcRNAs include small interfering RNAs (siRNAs), microRNAs (miRNAs), PIWI-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs) and long non-coding RNAs (lncRNAs). They participate in the regulation of all developmental processes and are frequently aberrantly expressed or functionally defective in disease. This Chapter will focus on the role of ncRNAs, in particular miRNAs and lncRNAs, in mammary gland development and disease.

  14. Overexpression of long non-coding RNAs following exposure to xenobiotics in the aquatic midge Chironomus riparius.


    Martínez-Guitarte, José-Luis; Planelló, Rosario; Morcillo, Gloria


    Non-coding RNAs (ncRNAs) represent an important transcriptional output of eukaryotic genomes. In addition to their functional relevance as housekeeping and regulatory elements, recent studies have suggested their involvement in rather unexpected cellular functions. The aim of this work was to analyse the transcriptional behaviour of non-coding RNAs in the toxic response to pollutants in Chironomus riparius, a reference organism in aquatic toxicology. Three well-characterized long non-coding sequences were studied: telomeric repeats, Cla repetitive elements and the SINE CTRT1. Transcription levels were evaluated by RT-PCR after 24-h exposures to three current aquatic contaminants: bisphenol A (BPA), benzyl butyl phthalate (BBP) and the heavy metal cadmium (Cd). Upregulation of telomeric transcripts was found after BPA treatments. Moreover, BPA significantly activated Cla transcription, which also appeared to be increased by cadmium, whereas BBP did not affect the transcription levels of these sequences. Transcription of SINE CTRT1 was not altered by any of the chemicals tested. These data are discussed in the light of previous studies that have shown a response by long ncRNAS (lncRNAs) to cellular stressors, indicating a relationship with environmental stimuli. Our results demonstrated for the first time the ability of bisphenol A to activate non-coding sequences mainly located at telomeres and centromeres. Overall, this study provides evidence that xenobiotics can induce specific responses in ncRNAs derived from repetitive sequences that could be relevant in the toxic response, and also suggests that ncRNAs could represent a novel class of potential biomarkers in toxicological assessment.

  15. A DNA-binding factor specific for xenobiotic responsive elements of P-450c gene exists as a cryptic form in cytoplasm: Its possible translocation to nucleus

    SciTech Connect

    Fujisawa-Sehara, Atsuko; Yamane, Miyuki; Fujii-Kuriyama, Yoshiaki


    Transcription of the drug-metabolizing cytochrome P-450c gene is induced by 3-methylcholanthrene or 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Previously, the authors defined two xenobiotic responsive elements (XREs) of {approx}15 base pairs, both of which activate transcription in cis in response to these xenobiotics. Using a gel mobility shift assay, they have identified a factor that specifically binds to the XREs. This factor appears in nuclei of mouse hepatoma cell line Hepa-1 only when the cells are treated with the xenobiotics, while the factor is undetectable in the nuclei of a 3-methylcholanthrene-treated mutant of Hepa-1 with defective function of a xenobiotic receptor. In addition, the nuclear factor bound to the XRE in the gel was found to be associated with ({sup 3}H)TCDD when the cells were treated with it, suggesting that the xenobiotic receptor is at least a component of the DNA-binding factor. The cytoplasmic fraction from nontreated Hepa-1 cells also contains the factor as a cryptic form and prominently reveals its DNA-binding activity by incubation with 3-methylcholanthrene in vitro. These results not only suggest the involvement of the XRE-binding factor in transcriptional activation via XREs but also provide evidence that the binding of ligands to the preexisting factor in a cryptic form induces its XRE-binding activity, which is probably followed by its translocation from cytoplasm to nucleus.

  16. DNA methylation of LINE-1 and Alu repetitive elements in relation to sex hormones and pubertal timing in Mexican-American children

    PubMed Central

    Huen, Karen; Harley, Kim; Kogut, Katherine; Rauch, Stephen; Eskenazi, Brenda; Holland, Nina


    Background The molecular mechanisms linking environmental exposures to earlier pubertal development are not well characterized. Epigenetics may play an important role, but data on the relationship between epigenetic marks and puberty, particularly in humans, is limited. Methods We used pyrosequencing to measure Alu and long interspersed nucleotide elements (LINE-1) methylation in DNA isolated from whole blood samples collected from newborns and 9-year-old children (n=266). Tanner staging was completed six times between ages 9 and 12 years to determine pubertal status, and hormone levels were measured in 12-year-old boys. Results Among girls, we observed a suggestive trend of increased odds of breast and pubic hair development with higher Alu and LINE-1 methylation in 9-year-old blood, respectively. The strongest association identified was an inverse association of LINE-1 methylation in 9-year-old girls with odds of experiencing menarche by age 12 (OR(95%CI): 0.63(0.46,0.87); p=0.005). We observed a consistent inverse relationship for Alu and LINE-1 methylation at 9 years with luteinizing hormone (LH), testosterone and follicle stimulating hormone levels in boys but it was only significant between LINE-1 and LH. Conclusion DNA methylation of Alu and LINE-1 may be involved in puberty initiation and development. This relationship should be confirmed in future studies. PMID:26882368

  17. Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.


    Callendret, Benoît; Lorin, Valérie; Charneau, Pierre; Marianneau, Philippe; Contamin, Hugues; Betton, Jean-Michel; van der Werf, Sylvie; Escriou, Nicolas


    The SARS-CoV spike glycoprotein (S) is the main target of the protective immune response in humans and animal models of SARS. Here, we demonstrated that efficient expression of S from the wild-type spike gene in cultured cells required the use of improved plasmid vectors containing donor and acceptor splice sites, as well as heterologous viral RNA export elements, such as the CTE of Mazon-Pfizer monkey virus or the PRE of Woodchuck hepatitis virus (WPRE). The presence of both splice sites and WPRE markedly improved the immunogenicity of S-based DNA vaccines against SARS. Upon immunization of mice with low doses (2 microg) of naked DNA, only intron and WPRE-containing vectors could induce neutralizing anti-S antibodies and provide protection against challenge with SARS-CoV. Our observations are likely to be useful for the construction of plasmid and viral vectors designed for optimal expression of intronless genes derived from cytoplasmic RNA viruses.

  18. Hx, a novel fluorescent, minor groove and sequence specific recognition element: design, synthesis, and DNA binding properties of p-anisylbenzimidazole-imidazole/pyrrole-containing polyamides.


    Chavda, Sameer; Liu, Yang; Babu, Balaji; Davis, Ryan; Sielaff, Alan; Ruprich, Jennifer; Westrate, Laura; Tronrud, Christopher; Ferguson, Amanda; Franks, Andrew; Tzou, Samuel; Adkins, Chandler; Rice, Toni; Mackay, Hilary; Kluza, Jerome; Tahir, Sharjeel A; Lin, Shicai; Kiakos, Konstantinos; Bruce, Chrystal D; Wilson, W David; Hartley, John A; Lee, Moses


    With the aim of incorporating a recognition element that acts as a fluorescent probe upon binding to DNA, three novel pyrrole (P) and imidazole (I)-containing polyamides were synthesized. The compounds contain a p-anisylbenzimidazolecarboxamido (Hx) moiety attached to a PP, IP, or PI unit, giving compounds HxPP (2), HxIP (3), and HxPI (4), respectively. These fluorescent hybrids were tested against their complementary nonfluorescent, non-formamido tetraamide counterparts, namely, PPPP (5), PPIP (6), and PPPI (7) (cognate sequences 5'-AAATTT-3', 5'-ATCGAT-3', and 5'-ACATGT-3', respectively). The binding affinities for both series of polyamides for their cognate and noncognate sequences were ascertained by surface plasmon resonance (SPR) studies, which revealed that the Hx-containing polyamides gave binding constants in the 10(6) M(-1) range while little binding was observed for the noncognates. The binding data were further compared to the corresponding and previously reported formamido-triamides f-PPP (8), f-PIP (9), and f-PPI (10). DNase I footprinting studies provided additional evidence that the Hx moiety behaved similarly to two consecutive pyrroles (PP found in 5-7), which also behaved like a formamido-pyrrole (f-P) unit found in distamycin and many formamido-triamides, including 8-10. The biophysical characterization of polyamides 2-7 on their binding to the abovementioned DNA sequences was determined using thermal melts (ΔT(M)), circular dichroism (CD), and isothermal titration calorimetry (ITC) studies. Density functional calculations (B3LYP) provided a theoretical framework that explains the similarity between PP and Hx on the basis of molecular electrostatic surfaces and dipole moments. Furthermore, emission studies on polyamides 2 and 3 showed that upon excitation at 322 nm binding to their respective cognate sequences resulted in an increase in fluorescence at 370 nm. These low molecular weight polyamides show promise for use as probes for monitoring

  19. CpG site DNA methylation patterns reveal a novel regulatory element in the mouse prion protein gene

    PubMed Central

    DALAI, Wuyun; MATSUO, Eiko; TAKEYAMA, Natsumi; KAWANO, Junichi; SAEKI, Keiichi


    The cellular isoform of the prion protein (PrPC) plays critical roles in the development of prion disorders. Although PrP mRNA is ubiquitously present in a tissue-specific manner, the DNA methylation of PrP gene (Prnp) is still unknown. In this study, we demonstrated that the CpG island (CGI, positioned at −218 to +152 bp from the transcriptional start site) including the Prnp core promoter region was completely unmethylated in all tested tissues. On the other hand, CpG methylation in the CGI shore region (positioned at −599 to −238 bp) occurred in various tissue- and site-specific proportions. Interestingly, the correlation analysis between CpG methylation status and PrP mRNA levels showed that one CpG site methylation at −576 was negatively correlated with the PrP mRNA level (Pearson’s r = −0.374, P=0.035). Taken together, our results suggest that Prnp is a typical housekeeping gene and various methylation frequencies of the CGI shore region are likely to affect Prnp expression in a tissue-specific manner. PMID:27666463

  20. Protein Phosphatase 2A (PP2A) Regulates Low Density Lipoprotein Uptake through Regulating Sterol Response Element-binding Protein-2 (SREBP-2) DNA Binding*

    PubMed Central

    Rice, Lyndi M.; Donigan, Melissa; Yang, Muhua; Liu, Weidong; Pandya, Devanshi; Joseph, Biny K.; Sodi, Valerie; Gearhart, Tricia L.; Yip, Jenny; Bouchard, Michael; Nickels, Joseph T.


    LDL-cholesterol (LDL-C) uptake by Ldlr is regulated at the transcriptional level by the cleavage-dependent activation of membrane-associated sterol response element-binding protein (SREBP-2). Activated SREBP-2 translocates to the nucleus, where it binds to an LDLR promoter sterol response element (SRE), increasing LDLR gene expression and LDL-C uptake. SREBP-2 cleavage and translocation steps are well established. Several SREBP-2 phosphorylation sites have been mapped and functionally characterized. The phosphatases dephosphorylating these sites remain elusive. The phosphatase(s) regulating SREBP-2 represents a novel pharmacological target for treating hypercholesterolemia. Here we show that protein phosphatase 2A (PP2A) promotes SREBP-2 LDLR promoter binding in response to cholesterol depletion. No binding to an LDLR SRE was observed in the presence of the HMG-CoA reductase inhibitor, lovastatin, when PP2A activity was inhibited by okadaic acid or depleted by siRNA methods. SREBP-2 cleavage and nuclear translocation were not affected by loss of PP2A. PP2A activity was required for SREBP-2 DNA binding. In response to cholesterol depletion, PP2A directly interacted with SREBP-2 and altered its phosphorylation state, causing an increase in SREBP-2 binding to an LDLR SRE site. Increased binding resulted in induced LDLR gene expression and increased LDL uptake. We conclude that PP2A activity regulates cholesterol homeostasis and LDL-C uptake. PMID:24770487

  1. DNA sequence analysis of a mouse pro alpha 1 (I) procollagen gene: evidence for a mouse B1 element within the gene.

    PubMed Central

    Monson, J M; Friedman, J; McCarthy, B J


    In a 3.8-kilobase mouse DNA sequence encoding amino acid sequences for the pro alpha 1(I) chain of type I procollagen, 14 coding sequences were identified which specify a sequence 95% homologous to amino acid residues 568 to 963 of the bovine alpha 1(I) chain. All of these coding sequences were flanked by appropriate splice junctions following the GT/AG rule. These observations suggest, but do not prove, that this pro alpha 1(I) gene is transcriptionally active. Of the 14 coding sequences, 7 were 54 base pairs in length, whereas the remainder were higher multiples of 54 base pairs. Nonrandom utilization of codons pertained throughout all of the coding sequences showing a preference (56%) for U in the wobble position. Two of the intervening sequences encoded imperfect vestiges of coding sequences which exhibited a codon preference different from that of the pro alpha 1(I) gene proper and were not flanked by splice junctions. One intervening sequence encoded a member of the mouse B1 family of middle repetitive sequences. It was flanked by 8-base-pair direct repeats and had a truncated A-rich region, suggesting that it may be a mobile element. Within this element were sequences which could function as a RNA polymerase III split promoter. Images PMID:6298597

  2. Germ cell-specific sustained activation of Wnt signalling perturbs spermatogenesis in aged mice, possibly through non-coding RNAs

    PubMed Central

    Kumar, Manish; Atkins, Joshua; Cairns, Murray; Ali, Ayesha; Tanwar, Pradeep S.


    Dysregulated Wnt signalling is associated with human infertility and testicular cancer. However, the role of Wnt signalling in male germ cells remains poorly understood. In this study, we first confirmed the activity of Wnt signalling in mouse, dog and human testes. To determine the physiological importance of the Wnt pathway, we developed a mouse model with germ cell-specific constitutive activation of βcatenin. In young mutants, similar to controls, germ cell development was normal. However, with age, mutant testes showed defective spermatogenesis, progressive germ cell loss, and flawed meiotic entry of spermatogonial cells. Flow sorting confirmed reduced germ cell populations at the leptotene/zygotene stages of meiosis in mutant group. Using thymidine analogues-based DNA double labelling technique, we further established decline in germ cell proliferation and differentiation. Overactivation of Wnt/βcatenin signalling in a spermatogonial cell line resulted in reduced cell proliferation, viability and colony formation. RNA sequencing analysis of testes revealed significant alterations in the non-coding regions of mutant mouse genome. One of the novel non-coding RNAs was switched on in mutant testes compared to controls. QPCR analysis confirmed upregulation of this unique non-coding RNA in mutant testis. In summary, our results highlight the significance of Wnt signalling in male germ cells. PMID:27992363

  3. Genome-wide analysis of long intergenic non-coding RNAs in chickpea and their potential role in flower development

    PubMed Central

    Khemka, Niraj; Singh, Vikash Kumar; Garg, Rohini; Jain, Mukesh


    Non-coding RNAs constitute a major portion of the transcriptome in most of eukaryotes. Long non-coding transcripts originating from the DNA segment present between the protein coding genes are termed as long intergenic non-coding RNAs (lincRNAs). Several evidences suggest the role of lincRNAs in regulation of various biological processes. In this study, we identified a total of 2248 lincRNAs in chickpea using RNA-seq data from eight successive stages of flower development and three vegetative tissues via an optimized pipeline. Different characteristic features of lincRNAs were studied and compared with those of predicted mRNAs in chickpea. Further, we utilized a method using network propagation algorithm to reveal the putative function of lincRNAs in plants. In total, at least 79% of the identified chickpea lincRNAs were assigned with a putative function. A comprehensive expression profiling revealed differential expression patterns and tissue specificity of lincRNAs in different stages of flower development in chickpea. In addition, potential lincRNAs-miRNA interactions were explored for the predicted lincRNAs in chickpea. These findings will pave the way for understanding the role of lincRNAs in the regulatory mechanism underlying flower development in chickpea and other legumes. PMID:27628568

  4. The Arginine/Lysine-Rich Element within the DNA-Binding Domain Is Essential for Nuclear Localization and Function of the Intracellular Pathogen Resistance 1

    PubMed Central

    Yao, Kezhen; Wu, Yongyan; Chen, Qi; Zhang, Zihan; Chen, Xin; Zhang, Yong


    The mouse intracellular pathogen resistance 1 (Ipr1) gene plays important roles in mediating host immunity and previous work showed that it enhances macrophage apoptosis upon mycobacterium infection. However, to date, little is known about the regulation pattern of Ipr1 action. Recent studies have investigated the protein-coding genes and microRNAs regulated by Ipr1 in mouse macrophages, but the structure and the functional motif of the Ipr1 protein have yet to be explored. In this study, we analyzed the domains and functional motif of the Ipr1 protein. The resulting data reveal that Ipr1 protein forms a homodimer and that the Sp100-like domain mediates the targeting of Ipr1 protein to nuclear dots (NDs). Moreover, we found that an Ipr1 mutant lacking the classic nuclear localization signal (cNLS) also translocated into the nuclei, suggesting that the cNLS is not the only factor that directs Ipr1 nuclear localization. Additionally, mechanistic studies revealed that an arginine/lysine-rich element within the DNA-binding domain (SAND domain) is critical for Ipr1 binding to the importin protein receptor NPI-1, demonstrating that this element plays an essential role in mediating the nuclear localization of Ipr1 protein. Furthermore, our results show that this arginine/lysine-rich element contributes to the transcriptional regulation and apoptotic activity of Ipr1. These findings highlight the structural foundations of Ipr1 action and provide new insights into the mechanism of Ipr1-mediated resistance to mycobacterium. PMID:27622275

  5. Energetics of the lattice: packing elements in crystals of four-stranded intercalated cytosine-rich DNA molecules

    NASA Technical Reports Server (NTRS)

    Berger, I.; Cai, L.; Chen, L.; Rich, A.


    Condensation of single molecules from solution into crystals represents a transition between distinct energetic states. In solution, the atomic interactions within the molecule dominate. In the crystalline state, however, a set of additional interactions are formed between molecules in close contact in the lattice--these are the packing interactions. The crystal structures of d(CCCT), d(TAACCC), d(CCCAAT), and d(AACCCC) have in common a four-stranded intercalated cytosine segment, built by stacked layers of cytosine.cytosine+ (C.C+) base pairs coming from two parallel duplexes that intercalate into each other with opposite polarity. The intercalated cytosine segments in these structures are similar in their geometry, even though the sequences crystallized in different space groups. In the crystals, adenine and thymine residues of the sequences are used to build the three-dimensional crystal lattice by elaborately interacting with symmetry-related molecules. The packing elements observed provide novel insight about the copious ways in which nucleic acid molecules can interact with each other--for example, when folded in more complicated higher order structures, such as mRNA and chromatin.

  6. A selfish DNA element engages a meiosis-specific motor and telomeres for germ-line propagation.


    Sau, Soumitra; Conrad, Michael N; Lee, Chih-Ying; Kaback, David B; Dresser, Michael E; Jayaram, Makkuni


    The chromosome-like mitotic stability of the yeast 2 micron plasmid is conferred by the plasmid proteins Rep1-Rep2 and the cis-acting locus STB, likely by promoting plasmid-chromosome association and segregation by hitchhiking. Our analysis reveals that stable plasmid segregation during meiosis requires the bouquet proteins Ndj1 and Csm4. Plasmid relocalization from the nuclear interior in mitotic cells to the periphery at or proximal to telomeres rises from early meiosis to pachytene. Analogous to chromosomes, the plasmid undergoes Csm4- and Ndj1-dependent rapid prophase movements with speeds comparable to those of telomeres. Lack of Ndj1 partially disrupts plasmid-telomere association without affecting plasmid colocalization with the telomere-binding protein Rap1. The plasmid appears to engage a meiosis-specific motor that orchestrates telomere-led chromosome movements for its telomere-associated segregation during meiosis I. This hitherto uncharacterized mode of germ-line transmission by a selfish genetic element signifies a mechanistic variation within the shared theme of chromosome-coupled plasmid segregation during mitosis and meiosis.

  7. A selfish DNA element engages a meiosis-specific motor and telomeres for germ-line propagation

    PubMed Central

    Sau, Soumitra; Conrad, Michael N.; Lee, Chih-Ying; Kaback, David B.; Dresser, Michael E.


    The chromosome-like mitotic stability of the yeast 2 micron plasmid is conferred by the plasmid proteins Rep1-Rep2 and the cis-acting locus STB, likely by promoting plasmid-chromosome association and segregation by hitchhiking. Our analysis reveals that stable plasmid segregation during meiosis requires the bouquet proteins Ndj1 and Csm4. Plasmid relocalization from the nuclear interior in mitotic cells to the periphery at or proximal to telomeres rises from early meiosis to pachytene. Analogous to chromosomes, the plasmid undergoes Csm4- and Ndj1-dependent rapid prophase movements with speeds comparable to those of telomeres. Lack of Ndj1 partially disrupts plasmid–telomere association without affecting plasmid colocalization with the telomere-binding protein Rap1. The plasmid appears to engage a meiosis-specific motor that orchestrates telomere-led chromosome movements for its telomere-associated segregation during meiosis I. This hitherto uncharacterized mode of germ-line transmission by a selfish genetic element signifies a mechanistic variation within the shared theme of chromosome-coupled plasmid segregation during mitosis and meiosis. PMID:24914236

  8. Evolutionary analysis reveals regulatory and functional landscape of coding and non-coding RNA editing.


    Zhang, Rui; Deng, Patricia; Jacobson, Dionna; Li, Jin Billy


    Adenosine-to-inosine RNA editing diversifies the transcriptome and promotes functional diversity, particularly in the brain. A plethora of editing sites has been recently identified; however, how they are selected and regulated and which are functionally important are largely unknown. Here we show the cis-regulation and stepwise selection of RNA editing during Drosophila evolution and pinpoint a large number of functional editing sites. We found that the establishment of editing and variation in editing levels across Drosophila species are largely explained and predicted by cis-regulatory elements. Furthermore, editing events that arose early in the species tree tend to be more highly edited in clusters and enriched in slowly-evolved neuronal genes, thus suggesting that the main role of RNA editing is for fine-tuning neurological functions. While nonsynonymous editing events have been long recognized as playing a functional role, in addition to nonsynonymous editing sites, a large fraction of 3'UTR editing sites is evolutionarily constrained, highly edited, and thus likely functional. We find that these 3'UTR editing events can alter mRNA stability and affect miRNA binding and thus highlight the functional roles of noncoding RNA editing. Our work, through evolutionary analyses of RNA editing in Drosophila, uncovers novel insights of RNA editing regulation as well as its functions in both coding and non-coding regions.

  9. Evolutionary analysis reveals regulatory and functional landscape of coding and non-coding RNA editing

    PubMed Central

    Jacobson, Dionna


    Adenosine-to-inosine RNA editing diversifies the transcriptome and promotes functional diversity, particularly in the brain. A plethora of editing sites has been recently identified; however, how they are selected and regulated and which are functionally important are largely unknown. Here we show the cis-regulation and stepwise selection of RNA editing during Drosophila evolution and pinpoint a large number of functional editing sites. We found that the establishment of editing and variation in editing levels across Drosophila species are largely explained and predicted by cis-regulatory elements. Furthermore, editing events that arose early in the species tree tend to be more highly edited in clusters and enriched in slowly-evolved neuronal genes, thus suggesting that the main role of RNA editing is for fine-tuning neurological functions. While nonsynonymous editing events have been long recognized as playing a functional role, in addition to nonsynonymous editing sites, a large fraction of 3’UTR editing sites is evolutionarily constrained, highly edited, and thus likely functional. We find that these 3’UTR editing events can alter mRNA stability and affect miRNA binding and thus highlight the functional roles of noncoding RNA editing. Our work, through evolutionary analyses of RNA editing in Drosophila, uncovers novel insights of RNA editing regulation as well as its functions in both coding and non-coding regions. PMID:28166241

  10. Conserved noncoding genomic sequences associated with a flowering-time quantitative trait locus in maize

    PubMed Central

    Salvi, Silvio; Sponza, Giorgio; Morgante, Michele; Tomes, Dwight; Niu, Xiaomu; Fengler, Kevin A.; Meeley, Robert; Ananiev, Evgueni V.; Svitashev, Sergei; Bruggemann, Edward; Li, Bailin; Hainey, Christine F.; Radovic, Slobodanka; Zaina, Giusi; Rafalski, J.-Antoni; Tingey, Scott V.; Miao, Guo-Hua; Phillips, Ronald L.; Tuberosa, Roberto


    Flowering time is a fundamental trait of maize adaptation to different agricultural environments. Although a large body of information is available on the map position of quantitative trait loci for flowering time, little is known about the molecular basis of quantitative trait loci. Through positional cloning and association mapping, we resolved the major flowering-time quantitative trait locus, Vegetative to generative transition 1 (Vgt1), to an ≈2-kb noncoding region positioned 70 kb upstream of an Ap2-like transcription factor that we have shown to be involved in flowering-time control. Vgt1 functions as a cis-acting regulatory element as indicated by the correlation of the Vgt1 alleles with the transcript expression levels of the downstream gene. Additionally, within Vgt1, we identified evolutionarily conserved noncoding sequences across the maize–sorghum–rice lineages. Our results support the notion that changes in distant cis-acting regulatory regions are a key component of plant genetic adaptation throughout breeding and evolution. PMID:17595297

  11. Non-coding RNAs in cancer brain metastasis.


    Wu, Kerui; Sharma, Sambad; Venkat, Suresh; Liu, Keqin; Zhou, Xiaobo; Watabe, Kounosuke


    More than 90% of cancer death is attributed to metastatic disease, and the brain is one of the major metastatic sites of melanoma, colon, renal, lung and breast cancers. Despite the recent advancement of targeted therapy for cancer, the incidence of brain metastasis is increasing. One reason is that most therapeutic drugs can't penetrate blood-brain-barrier and tumor cells find the brain as sanctuary site. In this review, we describe the pathophysiology of brain metastases to introduce the latest understandings of metastatic brain malignancies. This review also particularly focuses on non-coding RNAs and their roles in cancer brain metastasis. Furthermore, we discuss the roles of the extracellular vesicles as they are known to transport information between cells to initiate cancer cell-microenvironment communication. The potential clinical translation of non-coding RNAs as a tool for diagnosis and for treatment is also discussed in this review. At the end, the computational aspects of non-coding RNA detection, the sequence and structure calculation and epigenetic regulation of non-coding RNA in brain metastasis are discussed.

  12. HINCUTs in cancer: hypoxia-induced noncoding ultraconserved transcripts

    PubMed Central

    Ferdin, J; Nishida, N; Wu, X; Nicoloso, M S; Shah, M Y; Devlin, C; Ling, H; Shimizu, M; Kumar, K; Cortez, M A; Ferracin, M; Bi, Y; Yang, D; Czerniak, B; Zhang, W; Schmittgen, T D; Voorhoeve, M P; Reginato, M J; Negrini, M; Davuluri, R V; Kunej, T; Ivan, M; Calin, G A


    Recent data have linked hypoxia, a classic feature of the tumor microenvironment, to the function of specific microRNAs (miRNAs); however, whether hypoxia affects other types of noncoding transcripts is currently unknown. Starting from a genome-wide expression profiling, we demonstrate for the first time a functional link between oxygen deprivation and the modulation of long noncoding transcripts from ultraconserved regions, termed transcribed-ultraconserved regions (T-UCRs). Interestingly, several hypoxia-upregulated T-UCRs, henceforth named ‘hypoxia-induced noncoding ultraconserved transcripts' (HINCUTs), are also overexpressed in clinical samples from colon cancer patients. We show that these T-UCRs are predominantly nuclear and that the hypoxia-inducible factor (HIF) is at least partly responsible for the induction of several members of this group. One specific HINCUT, uc.475 (or HINCUT-1) is part of a retained intron of the host protein-coding gene, O-linked N-acetylglucosamine transferase, which is overexpressed in epithelial cancer types. Consistent with the hypothesis that T-UCRs have important function in tumor formation, HINCUT-1 supports cell proliferation specifically under hypoxic conditions and may be critical for optimal O-GlcNAcylation of proteins when oxygen tension is limiting. Our data gives a first glimpse of a novel functional hypoxic network comprising protein-coding transcripts and noncoding RNAs (ncRNAs) from the T-UCRs category. PMID:24037088

  13. Candida albicans repetitive elements display epigenetic diversity and plasticity

    PubMed Central

    Freire-Benéitez, Verónica; Price, R. Jordan; Tarrant, Daniel; Berman, Judith; Buscaino, Alessia


    Transcriptionally silent heterochromatin is associated with repetitive DNA. It is poorly understood whether and how heterochromatin differs between different organisms and whether its structure can be remodelled in response to environmental signals. Here, we address this question by analysing the chromatin state associated with DNA repeats in the human fungal pathogen Candida albicans. Our analyses indicate that, contrary to model systems, each type of repetitive element is assembled into a distinct chromatin state. Classical Sir2-dependent hypoacetylated and hypomethylated chromatin is associated with the rDNA locus while telomeric regions are assembled into a weak heterochromatin that is only mildly hypoacetylated and hypomethylated. Major Repeat Sequences, a class of tandem repeats, are assembled into an intermediate chromatin state bearing features of both euchromatin and heterochromatin. Marker gene silencing assays and genome-wide RNA sequencing reveals that C. albicans heterochromatin represses expression of repeat-associated coding and non-coding RNAs. We find that telomeric heterochromatin is dynamic and remodelled upon an environmental change. Weak heterochromatin is associated with telomeres at 30 °C, while robust heterochromatin is assembled over these regions at 39 °C, a temperature mimicking moderate fever in the host. Thus in C. albicans, differential chromatin states controls gene expression and epigenetic plasticity is linked to adaptation. PMID:26971880

  14. Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing) by the Topoisomerase II inhibitor, Etoposide, in rice

    PubMed Central


    Background Etoposide (epipodophyllotoxin) is a chemical commonly used as an anti-cancer drug which inhibits DNA synthesis by blocking topoisomerase II activity. Previous studies in animal cells have demonstrated that etoposide constitutes a genotoxic stress which may induce genomic instability including mobilization of normally quiescent transposable elements (TEs). However, it remained unknown whether similar genetically mutagenic effects could be imposed by etoposide in plant cells. Also, no information is available with regard to whether the drug may cause a perturbation of epigenetic stability in any organism. Results To investigate whether etoposide could generate genetic and/or epigenetic instability in plant cells, we applied etoposide to germinating seeds of six cultivated rice (Oryza sativa L.) genotypes including both subspecies, japonica and indica. Based on the methylation-sensitive gel-blotting results, epigenetic changes in DNA methylation of three TEs (Tos17, Osr23 and Osr36) and two protein-encoding genes (Homeobox and CDPK-related genes) were detected in the etoposide-treated plants (S0 generation) in four of the six studied japonica cultivars, Nipponbare, RZ1, RZ2, and RZ35, but not in the rest japonica cultivar (Matsumae) and the indica cultivar (93-11). DNA methylation changes in the etoposide-treated S0 rice plants were validated by bisulfite sequencing at both of two analyzed loci (Tos17 and Osr36). Transpositional activity was tested for eight TEs endogenous to the rice genome in both the S0 plants and their selfed progenies (S1 and S2) of one of the cultivars, RZ1, which manifested heritable phenotypic variations. Results indicated that no transposition occurred in the etoposide-treated S0 plants for any of the TEs. Nonetheless, a MITE transposon, mPing, showed rampant mobilization in the S1 and S2 progenies descended from the drug-treated S0 plants. Conclusions Our results demonstrate that etoposide imposes a similar genotoxic stress on

  15. Distinctive structures between chimpanzee and human in a brain noncoding RNA.


    Beniaminov, Artemy; Westhof, Eric; Krol, Alain


    Human accelerated region 1 (HAR1) is a short DNA region identified recently to have evolved the most rapidly among highly constrained regions since the divergence from our common ancestor with chimpanzee. It is transcribed as part of a noncoding RNA specifically expressed in the developing human neocortex. Employing a panoply of enzymatic and chemical probes, our analysis of HAR1 RNA proposed a secondary structure model differing from that published. Most surprisingly, we discovered that the substitutions between the chimpanzee and human sequences led the human HAR1 RNA to adopt a cloverleaf-like structure instead of an extended and unstable hairpin in the chimpanzee sequence. Thus, the rapid evolutionary changes resulted in a profound rearrangement of HAR1 RNA structure. Altogether, our results provide a structural context for elucidating HAR1 RNA function.

  16. Long non-coding RNAs in anti-cancer drug resistance

    PubMed Central

    Chen, Qin-nan; Wei, Chen-chen; Wang, Zhao-xia; Sun, Ming


    Chemotherapy is one of the basic treatments for cancers; however, drug resistance is mainly responsible for the failure of clinical treatment. The mechanism of drug resistance is complicated because of interaction among various factors including drug efflux, DNA damage repair, apoptosis and targets mutation. Long non-coding RNAs (lncRNAs) have been a focus of research in the field of bioscience, and the latest studies have revealed that lncRNAs play essential roles in drug resistance in breast cancer, gastric cancer and lung cancer, et al. Dysregulation of multiple targets and pathways by lncRNAs results in the occurrence of chemoresistance. In this review, we will discuss the mechanisms underlying lncRNA-mediated resistance to chemotherapy and the therapeutic potential of lncRNAs in future cancer treatment. PMID:27713133

  17. Epigenetic regulation of noncoding RNA transcription by mammalian RNA polymerase III.


    Park, Jong-Lyul; Lee, Yeon-Su; Kunkeaw, Nawapol; Kim, Seon-Young; Kim, In-Hoo; Lee, Yong Sun


    RNA polymerase III (Pol III) synthesizes a range of medium-sized noncoding RNAs (collectively 'Pol III genes') whose early established biological roles were so essential that they were considered 'housekeeping genes'. Besides these fundamental functions, diverse unconventional roles of mammalian Pol III genes have recently been recognized and their expression must be exquisitely controlled. In this review, we summarize the epigenetic regulation of Pol III genes by chromatin structure, histone modification and CpG DNA methylation. We also recapitulate the association between dysregulation of Pol III genes and diseases such as cancer and neurological disorders. Additionally, we will discuss why in-depth molecular studies of Pol III genes have not been attempted and how nc886, a Pol III gene, may resolve this issue.

  18. The Long Noncoding RNA Transcriptome of Dictyostelium discoideum Development

    PubMed Central

    Rosengarten, Rafael D.; Santhanam, Balaji; Kokosar, Janez; Shaulsky, Gad


    Dictyostelium discoideum live in the soil as single cells, engulfing bacteria and growing vegetatively. Upon starvation, tens of thousands of amoebae enter a developmental program that includes aggregation, multicellular differentiation, and sporulation. Major shifts across the protein-coding transcriptome accompany these developmental changes. However, no study has presented a global survey of long noncoding RNAs (ncRNAs) in D. discoideum. To characterize the antisense and long intergenic noncoding RNA (lncRNA) transcriptome, we analyzed previously published developmental time course samples using an RNA-sequencing (RNA-seq) library preparation method that selectively depletes ribosomal RNAs (rRNAs). We detected the accumulation of transcripts for 9833 protein-coding messenger RNAs (mRNAs), 621 lncRNAs, and 162 putative antisense RNAs (asRNAs). The noncoding RNAs were interspersed throughout the genome, and were distinct in expression level, length, and nucleotide composition. The noncoding transcriptome displayed a temporal profile similar to the coding transcriptome, with stages of gradual change interspersed with larger leaps. The transcription profiles of some noncoding RNAs were strongly correlated with known differentially expressed coding RNAs, hinting at a functional role for these molecules during development. Examining the mitochondrial transcriptome, we modeled two novel antisense transcripts. We applied yet another ribosomal depletion method to a subset of the samples to better retain transfer RNA (tRNA) transcripts. We observed polymorphisms in tRNA anticodons that suggested a post-transcriptional means by which D. discoideum compensates for codons missing in the genomic complement of tRNAs. We concluded that the prevalence and characteristics of long ncRNAs indicate that these molecules are relevant to the progression of molecular and cellular phenotypes during development. PMID:27932387

  19. The Long Noncoding RNA Transcriptome of Dictyostelium discoideum Development.


    Rosengarten, Rafael D; Santhanam, Balaji; Kokosar, Janez; Shaulsky, Gad


    Dictyostelium discoideum live in the soil as single cells, engulfing bacteria and growing vegetatively. Upon starvation, tens of thousands of amoebae enter a developmental program that includes aggregation, multicellular differentiation, and sporulation. Major shifts across the protein-coding transcriptome accompany these developmental changes. However, no study has presented a global survey of long noncoding RNAs (ncRNAs) in D. discoideum To characterize the antisense and long intergenic noncoding RNA (lncRNA) transcriptome, we analyzed previously published developmental time course samples using an RNA-sequencing (RNA-seq) library preparation method that selectively depletes ribosomal RNAs (rRNAs). We detected the accumulation of transcripts for 9833 protein-coding messenger RNAs (mRNAs), 621 lncRNAs, and 162 putative antisense RNAs (asRNAs). The noncoding RNAs were interspersed throughout the genome, and were distinct in expression level, length, and nucleotide composition. The noncoding transcriptome displayed a temporal profile similar to the coding transcriptome, with stages of gradual change interspersed with larger leaps. The transcription profiles of some noncoding RNAs were strongly correlated with known differentially expressed coding RNAs, hinting at a functional role for these molecules during development. Examining the mitochondrial transcriptome, we modeled two novel antisense transcripts. We applied yet another ribosomal depletion method to a subset of the samples to better retain transfer RNA (tRNA) transcripts. We observed polymorphisms in tRNA anticodons that suggested a post-transcriptional means by which D. discoideum compensates for codons missing in the genomic complement of tRNAs. We concluded that the prevalence and characteristics of long ncRNAs indicate that these molecules are relevant to the progression of molecular and cellular phenotypes during development.

  20. Prioritization of non-coding disease-causing variants and long non-coding RNAs in liver cancer

    PubMed Central

    Li, Hua; He, Zekun; Gu, Yang; Fang, Lin; Lv, Xin


    There are multiple bioinformatics tools available for the detection of coding driver mutations in cancers. However, the prioritization of pathogenic non-coding variants remains a challenging and demanding task. The present study was performed to discriminate non-coding disease-causing mutations and prioritize potential cancer-implicated long non-coding RNAs (lncRNAs) in liver cancer using a logistic regression model. A logistic regression model was constructed by combining 19,153 disease-associated ClinVar and human gene mutation database pathogenic variants as the response variable and non-coding features as the predictor variable. Genome-wide association study (GWAS) disease or trait-associated variants and recurrent somatic mutations were used to validate the model. Non-coding gene features with the highest fractions of load were characterized and potential cancer-associated lncRNA candidates were prioritized by combining the fraction of high-scoring regions and average score predicted by the logistic regression model. H3K9me3 and conserved regions were the most negatively and positively informative for the model, respectively. The area under the receiver operating characteristic curve of the model was 0.92. The average score of GWAS disease-associated variants was significantly increased compared with neutral single nucleotide polymorphisms (5.8642 vs. 5.4707; P<0.001), the average score of recurrent somatic mutations of liver cancer was significantly increased compared with non-recurrent somatic mutations (5.4101 vs. 5.2768; P=0.0125). The present study found regions in lncRNAs and introns/untranslated regions of protein coding genes where mutations are most likely to be damaging. In total, 847 lncRNAs were filtered out from the background. Characterization of this subset of lncRNAs showed that these lncRNAs are more conservative, less mutated and more highly expressed compared with other control lncRNAs. In addition, 23 of these lncRNAs were differentially

  1. Prioritization of non-coding disease-causing variants and long non-coding RNAs in liver cancer.


    Li, Hua; He, Zekun; Gu, Yang; Fang, Lin; Lv, Xin


    There are multiple bioinformatics tools available for the detection of coding driver mutations in cancers. However, the prioritization of pathogenic non-coding variants remains a challenging and demanding task. The present study was performed to discriminate non-coding disease-causing mutations and prioritize potential cancer-implicated long non-coding RNAs (lncRNAs) in liver cancer using a logistic regression model. A logistic regression model was constructed by combining 19,153 disease-associated ClinVar and human gene mutation database pathogenic variants as the response variable and non-coding features as the predictor variable. Genome-wide association study (GWAS) disease or trait-associated variants and recurrent somatic mutations were used to validate the model. Non-coding gene features with the highest fractions of load were characterized and potential cancer-associated lncRNA candidates were prioritized by combining the fraction of high-scoring regions and average score predicted by the logistic regression model. H3K9me3 and conserved regions were the most negatively and positively informative for the model, respectively. The area under the receiver operating characteristic curve of the model was 0.92. The average score of GWAS disease-associated variants was significantly increased compared with neutral single nucleotide polymorphisms (5.8642 vs. 5.4707; P<0.001), the average score of recurrent somatic mutations of liver cancer was significantly increased compared with non-recurrent somatic mutations (5.4101 vs. 5.2768; P=0.0125). The present study found regions in lncRNAs and introns/untranslated regions of protein coding genes where mutations are most likely to be damaging. In total, 847 lncRNAs were filtered out from the background. Characterization of this subset of lncRNAs showed that these lncRNAs are more conservative, less mutated and more highly expressed compared with other control lncRNAs. In addition, 23 of these lncRNAs were differentially

  2. Tumorigenesis by Meis1 overexpression is accompanied by a change of DNA target-sequence specificity which allows binding to the AP-1 element

    PubMed Central

    Dardaei, Leila; Penkov, Dmitry; Mathiasen, Lisa; Bora, Pranami; Morelli, Marco J.; Blasi, Francesco


    Meis1 overexpression induces tumorigenicity but its activity is inhibited by Prep1 tumor suppressor. Why does overexpression of Meis1 cause cancer and how does Prep1 inhibit? Tumor profiling and ChIP-sequencing data in a genetically-defined set of cell lines show that: 1) The number of Meis1 and Prep1 DNA binding sites increases linearly with their concentration resulting in a strong increase of “extra” target genes. 2) At high concentration, Meis1 DNA target specificity changes such that the most enriched consensus becomes that of the AP-1 regulatory element, whereas the specific OCTA consensus is not enriched because diluted within the many extra binding sites. 3) Prep1 inhibits Meis1 tumorigenesis preventing the binding to many of the “extra” genes containing AP-1 sites. 4) The overexpression of Prep1, but not of Meis1, changes the functional genomic distribution of the binding sites, increasing seven fold the number of its “enhancer” and decreasing its “promoter” targets. 5) A specific Meis1 “oncogenic” and Prep1 “tumor suppressing” signature has been identified selecting from the pool of genes bound by each protein those whose expression was modified uniquely by the “tumor-inducing” Meis1 or tumor-inhibiting Prep1 overexpression. In both signatures, the enriched gene categories are the same and are involved in signal transduction. However, Meis1 targets stimulatory genes while Prep1 targets genes that inhibit the tumorigenic signaling pathways. PMID:26259236

  3. The DNA replication-related element (DRE)/DRE-binding factor system is a transcriptional regulator of the Drosophila E2F gene.


    Sawado, T; Hirose, F; Takahashi, Y; Sasaki, T; Shinomiya, T; Sakaguchi, K; Matsukage, A; Yamaguchi, M


    Two mRNA species were observed for the Drosophila E2F (dE2F) gene, differing with regard to the first exons (exon 1-a and exon 1-b), which were expressed differently during development. A single transcription initiation site for mRNA containing exon 1-b was mapped by primer extension analysis and numbered +1. We found three tandemly aligned sequences, similar to the DNA replication-related element (DRE; 5'-TATCGATA), which is commonly required for transcription of genes related to DNA replication and cell proliferation, in the region upstream of this site. Band mobility shift analyses using oligonucleotides containing the DRE-related sequences with or without various base substitutions revealed that two out of three DRE-related sequences are especially important for binding to the DRE-binding factor (DREF). On footprinting analysis with Kc cell nuclear extracts and a glutathione S-transferase fusion protein with the N-terminal fragment (1-125 amino acid residues) of DREF, all three DRE-related sequences were found to be protected. Transient luciferase expression assays in Kc cells demonstrated that the region containing the three DRE-related sequences is required for high promoter activity. We have established transgenic lines of Drosophila in which ectopic expression of DREF was targeted to the eye imaginal disc cells. Overexpression of DREF in eye imaginal disc cells enhanced the promoter activity of dE2F. The obtained results indicate that the DRE/DREF system activates transcription of the dE2F gene.

  4. Normalized cDNA libraries


    Soares, M.B.; Efstratiadis, A.


    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  5. Normalized cDNA libraries


    Soares, Marcelo B.; Efstratiadis, Argiris


    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  6. The MluI cell cycle box (MCB) motifs, but not damage-responsive elements (DREs), are responsible for the transcriptional induction of the rhp51+ gene in response to DNA replication stress.


    Sartagul, Wugangerile; Zhou, Xin; Yamada, Yuki; Ma, Ning; Tanaka, Katsunori; Furuyashiki, Tomoyuki; Ma, Yan


    DNA replication stress induces the transcriptional activation of rhp51+, a fission yeast recA homolog required for repair of DNA double strand breaks. However, the mechanism by which DNA replication stress activates rhp51+ transcription is not understood. The promoter region of rhp51+ contains two damage-responsive elements (DREs) and two MluI cell cycle box (MCB) motifs. Using luciferase reporter assays, we examined the role of these elements in rhp51+ transcription. The full-length rhp51+ promoter and a promoter fragment containing MCB motifs only, but not a fragment containing DREs, mediated transcriptional activation upon DNA replication stress. Removal of the MCB motifs from the rhp51+ promoter abolished the induction of rhp51+ transcription by DNA replication stress. Consistent with a role for MCB motifs in rhp51+ transcription activation, deletion of the MBF (MCB-binding factor) co-repressors Nrm1 and Yox1 precluded rhp51+ transcriptional induction in response to DNA replication stress. Using cells deficient in checkpoint signaling molecules, we found that the Rad3-Cds1/Chk1 pathway partially mediated rhp51+ transcription in response to DNA replication stress, suggesting the involvement of unidentified checkpoint signaling pathways. Because MBF is critical for G1/S transcription, we examined how the cell cycle affected rhp51+ transcription. The transcription of rhp51+ and cdc18+, an MBF-dependent G1/S gene, peaked simultaneously in synchronized cdc25-22 cells. Furthermore, DNA replication stress maintained transcription of rhp51+ similarly to cdc18+. Collectively, these results suggest that MBF and its regulators mediate rhp51+ transcription in response to DNA replication stress, and underlie rhp51+ transcription at the G1/S transition.

  7. Long noncoding RNA GAS5: a novel marker involved in glucocorticoid response.


    Lucafo, M; De Iudicibus, S; Di Silvestre, A; Pelin, M; Candussio, L; Martelossi, S; Tommasini, A; Piscianz, E; Ventura, A; Decorti, G


    Glucocorticoids (GCs) exert their effects through regulation of gene expression after activation in the cytoplasm of the glucocorticoid receptor (GR) encoded by NR3C1 gene. A negative feedback mechanism resulting in GR autoregulation has been demonstrated through the binding of the activated receptor to intragenic sequences called GRE-like elements, contained in GR gene. The long noncoding RNA growth arrest-specific transcript 5 (GAS5) interacts with the activated GR suppressing its transcriptional activity. The aim of this study was to evaluate the possible role of GAS5 and NR3C1 gene expression in the antiproliferative effect of methylprednisolone in peripheral blood mononuclear cells and to correlate the expression with individual sensitivity to GCs. Subjects being poor responders to GCs presented higher levels of GAS5 and NR3C1 in comparison with good responders. We suggest that abnormal levels of GAS5 may alter GC effectiveness, probably interfering with the mechanism of GR autoregulation.

  8. Complete genomic sequence of a new Human polyomavirus 9 strain with an altered noncoding control region.


    Lednicky, John A; Butel, Janet S; Luetke, Maya C; Loeb, Julia C


    A complete Human polyomavirus 9 (HPyV9) genome, designated HPyV9 UF-1, was amplified by rolling circle DNA amplification from DNA extracted from the peripheral blood mononuclear cells (PBMC) of an AIDS patient. The noncoding control (enhancer/promoter) region (NCCR) of HPyV9 UF-1 has one less AML-1a binding site and three more potential Sp1/GC box binding sites than the NCCRs of two previously described HPyV9 genomes. Nucleotide polymorphisms within the coding regions result in two amino acid differences in the deduced VP2 and VP3 proteins of HPyV9 UF-1 relative to those of the two previously described HPyV9 genomes. Exhaustive attempts to detect HPyV9 in DNA samples extracted from the PBMC of 40 healthy humans and 9 other AIDS patients were unsuccessful, highlighting the need for improved search strategies and optimal specimens for the detection of HPyV9 in humans.

  9. Dissection of a Ciona regulatory element reveals complexity of cross-species enhancer activity

    PubMed Central

    Chen, Wei-Chung; Pauls, Stefan; Bacha, Jamil; Elgar, Greg; Loose, Matthew; Shimeld, Sebastian M.


    Vertebrate genomes share numerous conserved non-coding elements, many of which function as enhancer elements and are hypothesised to be under evolutionary constraint due to a need to be bound by combinations of sequence-specific transcription factors. In contrast, few such conserved elements can be detected between vertebrates and their closest invertebrate relatives. Despite this lack of sequence identity, cross-species transgenesis has identified some cases where non-coding DNA from invertebrates drives reporter gene expression in transgenic vertebrates in patterns reminiscent of the expression of vertebrate orthologues. Such instances are presumed to reflect the presence of conserved suites of binding sites in the regulatory regions of invertebrate and vertebrate orthologues, such that both regulatory elements can correctly interpret the trans-activating environment. Shuffling of binding sites has been suggested to lie behind loss of sequence conservation; however this has not been experimentally tested. Here we examine the underlying basis of enhancer activity for the Ciona intestinalis βγ-crystallin gene, which drives expression in the lens of transgenic vertebrates despite the Ciona lineage predating the evolution of the lens. We construct an interactive gene regulatory network (GRN) for vertebrate lens development, allowing network interactions to be robustly catalogued and conserved network components and features to be identified. We show that a small number of binding motifs are necessary for Ciona βγ-crystallin expression, and narrow down the likely factors that bind to these motifs. Several of these overlap with the conserved core of the vertebrate lens GRN, implicating these sites in cross species function. However when we test these motifs in a transgenic vertebrate they prove to be dispensable for reporter expression in the lens. These results show that current models depicting cross species enhancer function as dependent on conserved binding

  10. Occurrence of antibiotic resistance genes and mobile genetic elements in enterococci and genomic DNA during anaerobic digestion of pharmaceutical waste sludge with different pretreatments.


    Tong, Juan; Lu, XueTing; Zhang, JunYa; Sui, Qianwen; Wang, Rui; Chen, Meixue; Wei, Yuansong


    Pharmaceutical waste sludge harbors large amounts of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs), and it is necessary to study the reduction of ARGs and MGEs during sludge treatment. Therefore, the antibiotic resistance phenotypes and genotypes of enterococci, and the ARGs and MGEs in genomic DNA were investigated during anaerobic digestion (AD) with microwave (MW), thermal hydrolysis (TH) and ozone pretreatment. Results showed that sludge pretreatment increased the occurrence of the resistance phenotypes and genotypes of enterococci. During AD, the resistance of enterococci to macrolides decreased, except for in the MW-pretreated sludge. Horizontal gene transfer and co-occurrence of ermB and tetM in enterococci resulted in increased tetracycline resistance of enterococci throughout the sludge treatment. MGEs such as intI1, ISCR1 and Tn916/1545 had a significant effect on the distribution of ARGs. AD with pretreatment, especially TH pretreatment, resulted in greater ARGs and MGEs reduction and improved methane production.

  11. Satellite DNA Modulates Gene Expression in the Beetle Tribolium castaneum after Heat Stress.


    Feliciello, Isidoro; Akrap, Ivana; Ugarković, Đurđica


    Non-coding repetitive DNAs have been proposed to perform a gene regulatory role, however for tandemly repeated satellite DNA no such role was defined until now. Here we provide the first evidence for a role of satellite DNA in the modulation of gene expression under specific environmental conditions. The major satellite DNA TCAST1 in the beetle Tribolium castaneum is preferentially located within pericentromeric heterochromatin but is also dispersed as single repeats or short arrays in the vicinity of protein-coding genes within euchromatin. Our results show enhanced suppression of activity of TCAST1-associated genes and slower recovery of their activity after long-term heat stress relative to the same genes without associated TCAST1 satellite DNA elements. The level of gene suppression is not influenced by the distance of TCAST1 elements from the associated genes up to 40 kb from the genes' transcription start sites, but it does depend on the copy number of TCAST1 repeats within an element, being stronger for the higher number of copies. The enhanced gene suppression correlates with the enrichment of the repressive histone marks H3K9me2/3 at dispersed TCAST1 elements and their flanking regions as well as with increased expression of TCAST1 satellite DNA. The results reveal transient, RNAi based heterochromatin formation at dispersed TCAST1 repeats and their proximal regions as a mechanism responsible for enhanced silencing of TCAST1-associated genes. Differences in the pattern of distribution of TCAST1 elements contribute to gene expression diversity among T. castaneum strains after long-term heat stress and might have an impact on adaptation to different environmental conditions.

  12. Long non-coding RNAs in cancer metabolism.


    Xiao, Zhen-Dong; Zhuang, Li; Gan, Boyi


    Altered cellular metabolism is an emerging hallmark of cancer. Accumulating recent evidence links long non-coding RNAs (lncRNAs), a still poorly understood class of non-coding RNAs, to cancer metabolism. Here we review the emerging findings on the functions of lncRNAs in cancer metabolism, with particular emphasis on how lncRNAs regulate glucose and glutamine metabolism in cancer cells, discuss how lncRNAs regulate various aspects of cancer metabolism through their cross-talk with other macromolecules, explore the mechanistic conceptual framework of lncRNAs in reprogramming metabolism in cancers, and highlight the challenges in this field. A more in-depth understanding of lncRNAs in cancer metabolism may enable the development of novel and effective therapeutic strategies targeting cancer metabolism.

  13. Long noncoding RNAs during normal and malignant hematopoiesis

    PubMed Central

    Alvarez-Dominguez, Juan R.; Hu, Wenqian; Gromatzky, Austin A.


    Long noncoding RNAs (lncRNAs) are increasingly recognized to contribute to cellular development via diverse mechanisms during both health and disease. Here, we highlight recent progress on the study of lncRNAs that function in the development of blood cells. We emphasize lncRNAs that regulate blood cell fates through epigenetic control of gene expression, an emerging theme among functional lncRNAs. Many of these noncoding genes and their targets become dysregulated during malignant hematopoiesis, directly implicating lncRNAs in blood cancers such as leukemia. In a few cases, dysregulation of an lncRNA alone leads to malignant hematopoiesis in a mouse model. Thus, lncRNAs may be not only useful as markers for the diagnosis and prognosis of cancers of the blood, but also as potential targets for novel therapies. PMID:24609766

  14. The role of chromosomal retention of noncoding RNA in meiosis.


    Ding, Da-Qiao; Haraguchi, Tokuko; Hiraoka, Yasushi


    Meiosis is a process of fundamental importance for sexually reproducing eukaryotes. During meiosis, homologous chromosomes pair with each other and undergo homologous recombination, ultimately producing haploid sets of recombined chromosomes that will be inherited by the offspring. Compared with the extensive progress that has been made in understanding the molecular mechanisms underlying recombination, how homologous sequences pair with each other is still poorly understood. The diversity of the underlying mechanisms of pairing present in different organisms further increases the complexity of this problem. Involvement of meiosis-specific noncoding RNA in the pairing of homologous chromosomes has been found in the fission yeast Schizosaccharomyces pombe. Although different organisms may have developed other or additional systems that are involved in chromosome pairing, the findings in S. pombe will provide new insights into understanding the roles of noncoding RNA in meiosis.

  15. Structure and Gene-Silencing Mechanisms of Small Noncoding RNAs

    NASA Astrophysics Data System (ADS)

    Chu, Chia-Ying; Rana, Tariq M.

    Small (19-31-nucleotides) noncoding RNAs were identified in the past 10 years for their distinct function in gene silencing. The best known gene-silencing phenomenon, RNA interference (RNAi), is triggered in a sequence-specific manner by endogenously produced or exogenously introduced small doubled-stranded RNAs. As knowledge of the structure and function of the RNAi machinery has expanded, this phenomenon has become a powerful tool for biochemical research; it has enormous potential for therapeutics. This chapter summarizes significant aspects of three major classes of small noncoding, regulatory RNAs: small interfering RNAs (siRNAs), microRNAs (miRNAs), and Piwi-interacting RNAs (piRNAs). Here, we focus on the biogenesis of these small RNAs, their structural features and coupled effectors as well as the mechanisms of each small regulatory RNA pathway which reveal fascinating ways by which gene silencing is controlled and fine-tuned at an epigenetic level.

  16. Long noncoding RNAs during normal and malignant hematopoiesis.


    Alvarez-Dominguez, Juan R; Hu, Wenqian; Gromatzky, Austin A; Lodish, Harvey F


    Long noncoding RNAs (lncRNAs) are increasingly recognized to contribute to cellular development via diverse mechanisms during both health and disease. Here, we highlight recent progress on the study of lncRNAs that function in the development of blood cells. We emphasize lncRNAs that regulate blood cell fates through epigenetic control of gene expression, an emerging theme among functional lncRNAs. Many of these noncoding genes and their targets become dysregulated during malignant hematopoiesis, directly implicating lncRNAs in blood cancers such as leukemia. In a few cases, dysregulation of an lncRNA alone leads to malignant hematopoiesis in a mouse model. Thus, lncRNAs may be not only useful as markers for the diagnosis and prognosis of cancers of the blood, but also as potential targets for novel therapies.

  17. Dysregulation of non-coding RNAs in gastric cancer

    PubMed Central

    Yang, Qing; Zhang, Ren-Wen; Sui, Peng-Cheng; He, Hai-Tao; Ding, Lei


    Gastric cancer (GC) is one of the most common cancers in the world and a significant threat to the health of patients, especially those from China and Japan. The prognosis for patients with late stage GC receiving the standard of care treatment, including surgery, chemotherapy and radiotherapy, remains poor. Developing novel treatment strategies, identifying new molecules for targeted therapy, and devising screening techniques to detect this cancer in its early stages are needed for GC patients. The discovery of non-coding RNAs (ncRNAs), primarily microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), helped to elucidate the mechanisms of tumorigenesis, diagnosis and treatment of GC. Recently, significant research has been conducted on non-coding RNAs and how the regulatory dysfunction of these RNAs impacts the tumorigenesis of GC. In this study, we review papers published in the last five years concerning the dysregulation of non-coding RNAs, especially miRNAs and lncRNAs, in GC. We summarize instances of aberrant expression of the ncRNAs in GC and their effect on survival-related events, including cell cycle regulation, AKT signaling, apoptosis and drug resistance. Additionally, we evaluate how ncRNA dysregulation affects the metastatic process, including the epithelial-mesenchymal transition, stem cells, transcription factor activity, and oncogene and tumor suppressor expression. Lastly, we determine how ncRNAs affect angiogenesis in the microenvironment of GC. We further discuss the use of ncRNAs as potential biomarkers for use in clinical screening, early diagnosis and prognosis of GC. At present, no ideal ncRNAs have been identified as targets for the treatment of GC. PMID:26494954

  18. oskar RNA plays multiple noncoding roles to support oogenesis and maintain integrity of the germline/soma distinction

    PubMed Central

    Kanke, Matt; Jambor, Helena; Reich, John; Marches, Brittany; Gstir, Ronald; Ryu, Young Hee; Ephrussi, Anne; Macdonald, Paul M.


    The Drosophila oskar (osk) mRNA is unusual in that it has both coding and noncoding functions. As an mRNA, osk encodes a protein required for embryonic patterning and germ cell formation. Independent of that function, the absence of osk mRNA disrupts formation of the karyosome and blocks progression through oogenesis. Here we show that loss of osk mRNA also affects the distribution of regulatory proteins, relaxing their association with large RNPs within the germline, and allowing them to accumulate in the somatic follicle cells. This and other noncoding functions of the osk mRNA are mediated by multiple sequence elements with distinct roles. One role, provided by numerous binding sites in two distinct regions of the osk 3′ UTR, is to sequester the translational regulator Bruno (Bru), which itself controls translation of osk mRNA. This defines a novel regulatory circuit, with Bru restricting the activity of osk, and osk in turn restricting the activity of Bru. Other functional elements, which do not bind Bru and are positioned close to the 3′ end of the RNA, act in the oocyte and are essential. Despite the different roles played by the different types of elements contributing to RNA function, mutation of any leads to accumulation of the germline regulatory factors in the follicle cells. PMID:25862242

  19. oskar RNA plays multiple noncoding roles to support oogenesis and maintain integrity of the germline/soma distinction.


    Kanke, Matt; Jambor, Helena; Reich, John; Marches, Brittany; Gstir, Ronald; Ryu, Young Hee; Ephrussi, Anne; Macdonald, Paul M


    The Drosophila oskar (osk) mRNA is unusual in that it has both coding and noncoding functions. As an mRNA, osk encodes a protein required for embryonic patterning and germ cell formation. Independent of that function, the absence of osk mRNA disrupts formation of the karyosome and blocks progression through oogenesis. Here we show that loss of osk mRNA also affects the distribution of regulatory proteins, relaxing their association with large RNPs within the germline, and allowing them to accumulate in the somatic follicle cells. This and other noncoding functions of the osk mRNA are mediated by multiple sequence elements with distinct roles. One role, provided by numerous binding sites in two distinct regions of the osk 3' UTR, is to sequester the translational regulator Bruno (Bru), which itself controls translation of osk mRNA. This defines a novel regulatory circuit, with Bru restricting the activity of osk, and osk in turn restricting the activity of Bru. Other functional elements, which do not bind Bru and are positioned close to the 3' end of the RNA, act in the oocyte and are essential. Despite the different roles played by the different types of elements contributing to RNA function, mutation of any leads to accumulation of the germline regulatory factors in the follicle cells.

  20. CAHM, a long non-coding RNA gene hypermethylated in colorectal neoplasia

    PubMed Central

    Pedersen, Susanne K; Mitchell, Susan M; Graham, Lloyd D; McEvoy, Aidan; Thomas, Melissa L; Baker, Rohan T; Ross, Jason P; Xu, Zheng-Zhou; Ho, Thu; LaPointe, Lawrence C; Young, Graeme P; Molloy, Peter L


    The CAHM gene (Colorectal Adenocarcinoma HyperMethylated), previously LOC100526820, is located on chromosome 6, hg19 chr6:163 834 097–163 834 982. It lacks introns, encodes a long non-coding RNA (lncRNA) and is located adjacent to the gene QKI, which encodes an RNA binding protein. Deep bisulphite sequencing of ten colorectal cancer (CRC) and matched normal tissues demonstrated frequent hypermethylation within the CAHM gene in cancer. A quantitative methylation-specific PCR (qMSP) was used to characterize additional tissue samples. With a threshold of 5% methylation, the CAHM assay was positive in 2/26 normal colorectal tissues (8%), 17/21 adenomas (81%), and 56/79 CRC samples (71%). A reverse transcriptase-qPCR assay showed that CAHM RNA levels correlated negatively with CAHM % methylation, and therefore CAHM gene expression is typically decreased in CRC. The CAHM qMSP assay was applied to DNA isolated from plasma specimens from 220 colonoscopy-examined patients. Using a threshold of 3 pg methylated genomic DNA per mL plasma, methylated CAHM sequences were detected in the plasma DNA of 40/73 (55%) of CRC patients compared with 3/73 (4%) from subjects with adenomas and 5/74 (7%) from subjects without neoplasia. Both the frequency of detection and the amount of methylated CAHM DNA released into plasma increased with increasing cancer stage. Methylated CAHM DNA shows promise as a plasma biomarker for use in screening for CRC. PMID:24799664

  1. Noncoding RNA Profiles in Tobacco- and Alcohol-Associated Diseases

    PubMed Central

    Soares do Amaral, Nayra; Cruz e Melo, Natalia; de Melo Maia, Beatriz; Malagoli Rocha, Rafael


    Tobacco and alcohol are the leading environmental risk factors in the development of human diseases, such as cancer, cardiovascular disease, and liver injury. Despite the copious amount of research on this topic, by 2030, 8.3 million deaths are projected to occur worldwide due to tobacco use. The expression of noncoding RNAs, primarily microRNAs (miRNAs) and long noncoding RNAs (lncRNAs), is modulated by tobacco and alcohol consumption. Drinking alcohol and smoking cigarettes can modulate the expression of miRNAs and lncRNAs through various signaling pathways, such as apoptosis, angiogenesis, and inflammatory pathways—primarily interleukin 6 (IL-6)/signal transducer and activator of transcription 3 (STAT3), which seems to play a major role in the development of diseases associated with these risk factors. Since they may be predictive and prognostic biomarkers, they can be used both as predictors of the response to therapy and as a targeted therapy. Further, circulating miRNAs might be valuable noninvasive tools that can be used to examine diseases that are related to the use of tobacco and alcohol. This review discusses the function of noncoding RNAs in cancer and other human tobacco- and alcohol-associated diseases. PMID:28025544

  2. The Landscape of long non-coding RNA classification

    PubMed Central

    St Laurent, Georges; Wahlestedt, Claes; Kapranov, Philipp


    Advances in the depth and quality of transcriptome sequencing have revealed many new classes of long non-coding RNAs (lncRNAs). lncRNA classification has mushroomed to accommodate these new findings, even though the real dimensions and complexity of the non-coding transcriptome remain unknown. Although evidence of functionality of specific lncRNAs continues to accumulate, conflicting, confusing, and overlapping terminology has fostered ambiguity and lack of clarity in the field in general. The lack of fundamental conceptual un-ambiguous classification framework results in a number of challenges in the annotation and interpretation of non-coding transcriptome data. It also might undermine integration of the new genomic methods and datasets in an effort to unravel function of lncRNA. Here, we review existing lncRNA classifications, nomenclature, and terminology. Then we describe the conceptual guidelines that have emerged for their classification and functional annotation based on expanding and more comprehensive use of large systems biology-based datasets. PMID:25869999

  3. Long Non-Coding RNA Regulation of Reproduction and Development

    PubMed Central

    Taylor, David H.; Chu, Erin Tsi-Jia; Spektor, Roman; Soloway, Paul D.


    SUMMARY Noncoding RNAs (ncRNAs) have long been known to play vital roles in eukaryotic gene regulation. Studies conducted over a decade ago revealed that maturation of spliced, polyadenylated coding mRNA occurs by reactions involving small nuclear RNAs and small nucleolar RNAs; mRNA translation depends on activities mediated by transfer RNAs and ribosomal RNAs, subject to negative regulation by micro RNAs; transcriptional competence of sex chromosomes and some imprinted genes is regulated in cis by ncRNAs that vary by species; and both small-interfering RNAs and piwi-interacting RNAs bound to Argonaute-family proteins regulate post-translational modifications on chromatin and local gene expression states. More recently, gene-regulating noncoding RNAs have been identified, such as long intergenic and long noncoding RNAs (collectively referred to as lncRNAs)—a class totaling more than 100,000 transcripts in humans, which include some of the previously mentioned RNAs that regulate dosage compensation and imprinted gene expression. Here, we provide an overview of lncRNA activities, and then review the role of lncRNAs in processes vital to reproduction, such as germ cell specification, sex determination and gonadogenesis, sex hormone responses, meiosis, gametogenesis, placenta-tion, non-genetic inheritance, and pathologies affecting reproductive tissues. Results from many species are presented to illustrate the evolutionary conserved processes lncRNAs are involved in. PMID:26517592

  4. Identification of a long non-coding RNA gene, growth hormone secretagogue receptor opposite strand, which stimulates cell migration in non-small cell lung cancer cell lines.


    Whiteside, Eliza J; Seim, Inge; Pauli, Jana P; O'Keeffe, Angela J; Thomas, Patrick B; Carter, Shea L; Walpole, Carina M; Fung, Jenny N T; Josh, Peter; Herington, Adrian C; Chopin, Lisa K


    The molecular mechanisms involved in non‑small cell lung cancer tumourigenesis are largely unknown; however, recent studies have suggested that long non-coding RNAs (lncRNAs) are likely to play a role. In this study, we used public databases to identify an mRNA-like, candidate long non-coding RNA, GHSROS (GHSR opposite strand), transcribed from the antisense strand of the ghrelin receptor gene, growth hormone secretagogue receptor (GHSR). Quantitative real-time RT-PCR revealed higher expression of GHSROS in lung cancer tissue compared to adjacent, non-tumour lung tissue. In common with many long non-coding RNAs, GHSROS is 5' capped and 3' polyadenylated (mRNA-like), lacks an extensive open reading frame and harbours a transposable element. Engineered overexpression of GHSROS stimulated cell migration in the A549 and NCI-H1299 non-small cell lung cancer cell lines, but suppressed cell migration in the Beas-2B normal lung-derived bronchoepithelial cell line. This suggests that GHSROS function may be dependent on the oncogenic context. The identification of GHSROS, which is expressed in lung cancer and stimulates cell migration in lung cancer cell lines, contributes to the growing number of non-coding RNAs that play a role in the regulation of tumourigenesis and metastatic cancer progression.

  5. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements

    PubMed Central

    Maliszewska-Olejniczak, Kamila; Gruchota, Julita; Gromadka, Robert; Denby Wilkes, Cyril; Arnaiz, Olivier; Mathy, Nathalie; Duharcourt, Sandra; Bétermier, Mireille; Nowak, Jacek K.


    Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs) in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline) nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs). Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium, and establishes for

  6. A new avenue for obtaining insight into the functional characteristics of long noncoding RNAs associated with estrogen receptor signaling

    PubMed Central

    Wu, Liangcai; Xu, Qianqian; Zhang, Haohai; Li, Ming; Zhu, Chengpei; Jiang, Minjie; Sang, Xinting; Zhao, Yi; Sun, Qiang; Zhao, Haitao


    Estrogen receptor signalling plays important regulatory roles in multiple mammalian physiological processes. Dysregulation of estrogen receptor (ER) expression and/or its associated signalling pathway is strongly associated with the development, progression, transition, and endocrine-resistance of breast cancer. Non-coding transcripts are essential regulators of almost every level of gene regulation. However, few long non-coding transcripts (lncRNAs) associated with the estrogen receptor signalling pathway have been well-described. We used array-based methods to identify 33 estrogen receptor agitation-related (ERAR) lncRNAs. A coding–non-coding gene co-expression network analysis suggested that 15 ERAR lncRNAs were associated with mitosis, DNA damage, and DNA repair. Kaplan–Meier analysis indicated that five ERAR lncRNAs selected using the Random Forest-Recursive Feature Elimination algorithm were significantly correlated with endocrine resistance-free survival and distant metastasis-free survival as well as disease free survival. Our results suggest that ERAR lncRNAs may serve as novel biomarkers for guiding breast cancer treatment and prognosis. Furthermore, our findings reveal a new avenue by which estrogen receptor signalling can be further explored. PMID:27539025

  7. Noncoding 3' sequences of the transferrin receptor gene are required for mRNA regulation by iron.

    PubMed Central

    Owen, D; Kühn, L C


    The cell-surface receptor for transferrin mediates cellular uptake of iron from serum. Transferrin receptor protein and mRNA levels are increased in cells treated with iron chelating agents, and are decreased by treatment with iron salts or hemin. Here we report that expression of human transferrin receptor cDNA constructions in stably transfected mouse fibroblasts is regulated both by the iron chelator, desferrioxamine, and by hemin. We found that sequences within the 3' noncoding region are required for the iron-dependent feed-back regulation of receptor expression, whereas the presence of the transferrin receptor promoter region is not necessary. Regulation by iron is observed when transcription is initiated at either the SV-40 early promoter or the transferrin receptor promoter, but deletion of a 2.3 kb fragment within the 2.6 kb 3' noncoding region of the cDNA abolishes regulation and increases the constitutive level of receptor expression. Furthermore, the 3' deletion does not affect the decrease in receptors which is observed in response to growth arrest, indicating that transferrin receptor expression is controlled by at least two distinct mechanisms. Images Fig. 3. Fig. 6. Fig. 8. PMID:3608980

  8. Age-dependent differential expression profile of a novel intergenic long noncoding RNA in rat brain.


    Kour, Sukhleen; Rath, Pramod C


    Long noncoding RNAs (lncRNAs) are ≥200 nt long, abundant class of non-protein coding RNAs that are transcribed in complex, sense- and antisense patterns from the intergenic and intronic regions of mammalian genome. Mammalian central nervous system constitutes the largest repertoire of noncoding transcripts that are known to be expressed in developmentally regulated and cell-type specific manners. Although many lncRNAs, functioning in the brain development and diseases are known, none involved in brain aging has been reported so far. Here, we report involvement of a novel, repeat sequence (simple repeats and SINES)-containing, trans-spliced, long intergenic non-protein coding RNA (lincRNA), named as LINC-RBE (rat brain expressed transcript) involved in maturation and aging of mammalian brain. The LINC-RBE is strongly expressed in the rat brain and the upstream/downstream sequences of its DNA in the chromosome 5 contain binding sites for many cell growth, survival and development-specific transcriptional factors. Through RT-PCR and RNA in situ hybridization, LINC-RBE was found to be expressed in an age-dependent manner with significantly higher level of expression in the brain of adult (16 weeks) compared to both immature (4 weeks) and old (70 weeks) rats. Moreover, the expression pattern of the LINC-RBE showed distinct association with the specific neuro-anatomical regions, cell types and sub-cellular compartments of the rat brain in an age-related manner. Thus, its expression increased from immature stage to adulthood and declined further in old age. This is a first-time report of involvement of an intergenic repeat sequence-containing lncRNA in different regions of the rat brain in an age-dependent manner.

  9. Age-dependent differential expression profile of a novel intergenic long noncoding RNA in rat brain.


    Kour, Sukhleen; Rath, Pramod C


    Long noncoding RNAs (lncRNAs) are ≥ 200 nt long, abundant class of non-protein coding RNAs that are transcribed in complex, sense- and antisense patterns from the intergenic and intronic regions of mammalian genome. Mammalian central nervous system constitutes the largest repertoire of noncoding transcripts that are known to be expressed in developmentally regulated and cell-type specific manners. Although many lncRNAs, functioning in the brain development and diseases are known, none involved in brain aging has been reported so far. Here, we report involvement of a novel, repeat sequence (simple repeats and SINES)-containing, trans-spliced, long intergenic non-protein coding RNA (lincRNA), named as LINC-RBE (rat brain expressed transcript) involved in maturation and aging of mammalian brain. The LINC-RBE is strongly expressed in the rat brain and the upstream/downstream sequences of its DNA in the chromosome 5 contain binding sites for many cell growth, survival and development-specific transcriptional factors. Through RT-PCR and RNA in situ hybridization, LINC-RBE was found to be expressed in an age-dependent manner with significantly higher level of expression in the brain of adult (16 week) compared to both immature (4 week) and old (70 week) rats. Moreover, the expression pattern of the LINC-RBE showed distinct association with the specific neuro-anatomical regions, cell types and sub-cellular compartments of the rat brain in an age-related manner. Thus, its expression increased from immature stage to adulthood and declined further in old age. This is a first-time report of involvement of an intergenic repeat sequence-containing lncRNA in different regions of the rat brain in an age-dependent manner.

  10. Expression profile of long non-coding RNAs in colorectal cancer: A microarray analysis.


    Luo, Jia; Xu, Luning; Jiang, Yigui; Zhuo, Dexiang; Zhang, Shengjun; Wu, Lianhui; Xu, Huadong; Huang, Yue


    Colorectal cancer (CRC) is one of the most prevalent malignant tumors and the second cause of cancer-related mortality worldwide. Due to increased morbidity and mortality rates, there is an urgent need to understand the pathogenesis of CRC, discover strategies that can improve diagnosis, and ultimately identify therapies targeting this disease. Over the past several years, research into tumor progression mechanisms has been devoted to identifying and understanding various coding and non-coding regions of the genome and how these genetic variants may affect tumorigenesis and progression. Recently, long non-coding RNAs (lncRNAs), which are non‑protein coding transcripts longer than 200 nucleotides, have emerged as a key aspect in tumor pathogenesis. In the present study, we examined the lncRNA and mRNA expression profiles in 4 patients with colon adenocarcinoma, with paired adjacent normal tissues as controls. Microarray data showed that a total of 3,523 lncRNAs and 2,515 mRNAs were consistently differentially expressed in the CRC tissues compared to adjacent normal tissues. Upon comparison of the differentially expressed transcripts between the groups, we identified 22 pathways which were related to the upregulated transcripts and 24 pathways that corresponded to the downregulated transcripts. Gene ontology analysis revealed that the upregulated transcripts were predominantly enriched in DNA metabolic processes, and the downregulated transcripts were predominantly enriched in organic hydroxyl compound metabolic processes. Coding-non-coding gene co-expression analysis showed that these differentially expressed lncRNAs were closely correlated with 'Wnt signaling pathway' components, whose aberrant activation plays a central role in CRC, indicating that a functional correlation exists between them. In conclusion, the results of the microarray and informatic analysis strongly suggest that lncRNA dysregulation is involved in the complicated process of CRC development

  11. The identification of cis-regulatory elements: A review from a machine learning perspective.


    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W


    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  12. An expanding universe of noncoding RNAs between the poles of basic science and clinical investigations.


    Weil, Patrick P; Hensel, Kai O; Weber, David; Postberg, Jan


    The Keystone Symposium 'MicroRNAs and Noncoding RNAs in Cancer', Keystone, CO, USA, 7-12 June 2015 Since the discovery of RNAi, great efforts have been undertaken to unleash the potential biomedical applicability of small noncoding RNAs, mainly miRNAs, involving their use as biomarkers for personalized diagnostics or their usability as active agents or therapy targets. The research's focus on the noncoding RNA world is now slowly moving from a phase of basic discoveries into a new phase, where every single molecule out of many hundreds of cataloged noncoding RNAs becomes dissected in order to investigate these molecules' biomedical relevance. In addition, RNA classes neglected before, such as long noncoding RNAs or circular RNAs attract more attention. Numerous timely results and hypotheses were presented at the 2015 Keystone Symposium 'MicroRNAs and Noncoding RNAs in Cancer'.

  13. Research Techniques Made Simple: Identification and Characterization of Long Noncoding RNA in Dermatological Research.


    Antonini, Dario; Mollo, Maria Rosaria; Missero, Caterina


    Long noncoding RNAs (lncRNAs) are a functionally heterogeneous and abundant class of RNAs acting in all cellular compartments that can form complexes with DNA, RNA, and proteins. Recent advances in high-throughput sequencing and techniques leading to the identification of DNA-RNA, RNA-RNA, and RNA-protein complexes have allowed the functional characterization of a small set of lncRNAs. However, characterization of the full repertoire of lncRNAs playing essential roles in a number of normal and dysfunctional cellular processes remains an important goal for future studies. Here we describe the most commonly used techniques to identify lncRNAs, and to characterize their biological functions. In addition, we provide examples of these techniques applied to cutaneous research in healthy skin, that is, epidermal differentiation, and in diseases such as cutaneous squamous cell carcinomas and psoriasis. As with protein-coding RNA transcripts, lncRNAs are differentially regulated in disease, and can serve as novel biomarkers for the diagnosis and prognosis of skin diseases.

  14. Modeling diseases of noncoding unstable repeat expansions using mutant pluripotent stem cells

    PubMed Central

    Yanovsky-Dagan, Shira; Mor-Shaked, Hagar; Eiges, Rachel


    Pathogenic mutations involving DNA repeat expansions are responsible for over 20 different neuronal and neuromuscular diseases. All result from expanded tracts of repetitive DNA sequences (mostly microsatellites) that become unstable beyond a critical length when transmitted across generations. Nearly all are inherited as autosomal dominant conditions and are typically associated with anticipation. Pathologic unstable repeat expansions can be classified according to their length, repeat sequence, gene location and underlying pathologic mechanisms. This review summarizes the current contribution of mutant pluripotent stem cells (diseased human embryonic stem cells and patient-derived induced pluripotent stem cells) to the research of unstable repeat pathologies by focusing on particularly large unstable noncoding expansions. Among this class of disorders are Fragile X syndrome and Fragile X-associated tremor/ataxia syndrome, myotonic dystrophy type 1 and myotonic dystrophy type 2, Friedreich ataxia and C9 related amyotrophic lateral sclerosis and/or frontotemporal dementia, Facioscapulohumeral Muscular Dystrophy and potentially more. Common features that are typical to this subclass of conditions are RNA toxic gain-of-function, epigenetic loss-of-function, toxic repeat-associated non-ATG translation and somatic instability. For each mechanism we summarize the currently available stem cell based models, highlight how they contributed to better understanding of the related mechanism, and discuss how they may be utilized in future investigations. PMID:26131313

  15. Ancestral vinclozolin exposure alters the epigenetic transgenerational inheritance of sperm small noncoding RNAs.


    Schuster, Andrew; Skinner, Michael K; Yan, Wei

    Exposure to the agricultural fungicide vinclozolin during gestation promotes a higher incidence of various diseases in the subsequent unexposed F3 and F4 generations. This phenomenon is termed epigenetic transgenerational inheritance and has been shown to in part involve alterations in DNA methylation, but the role of other epigenetic mechanisms remains unknown. The current study investigated the alterations in small noncoding RNA (sncRNA) in the sperm from F3 generation control and vinclozolin lineage rats. Over 200 differentially expressed sncRNAs were identified and the tRNA-derived sncRNAs, namely 5' halves of mature tRNAs (5' halves), displayed the most dramatic changes. Gene targets of the altered miRNAs and tRNA 5' halves revealed associations between the altered sncRNAs and differentially DNA methylated regions. Dysregulated sncRNAs appear to correlate with mRNA profiles associated with the previously observed vinclozolin-induced disease phenotypes. Data suggest potential connections between sperm-borne RNAs and the vinclozolin-induced epigenetic transgenerational inheritance phenomenon.

  16. Prohead RNA: a noncoding viral RNA of novel structure and function

    PubMed Central

    Hill, Alyssa C.; Bartley, Laura E.


    Prohead RNA (pRNA) is an essential component of the powerful Φ29‐like bacteriophage DNA packaging motor. However, the specific role of this unique RNA in the Φ29 packaging motor remains unknown. This review examines pRNA as a noncoding RNA of novel structure and function. In order to highlight the reasons for exploring the structure and function of pRNA, we (1) provide an overview of Φ29‐like bacteriophage and the Φ29 DNA packaging motor, including putative motor mechanisms and structures of its component parts; (2) discuss pRNA structure and possible roles for pRNA in the Φ29 packaging motor; (3) summarize pRNA self‐assembly; and (4) describe the prospective therapeutic applications of pRNA. Many questions remain to be answered in order to connect what is currently known about pRNA structure to its novel function in the Φ29 packaging motor. The knowledge gained from studying the structure, function, and sequence variation in pRNA will help develop tools to better navigate the conformational landscapes of RNA. WIREs RNA 2016, 7:428–437. doi: 10.1002/wrna.1330 For further resources related to this article, please visit the WIREs website. PMID:26810250

  17. Ancestral vinclozolin exposure alters the epigenetic transgenerational inheritance of sperm small noncoding RNAs

    PubMed Central

    Schuster, Andrew; Skinner, Michael K.; Yan, Wei


    Exposure to the agricultural fungicide vinclozolin during gestation promotes a higher incidence of various diseases in the subsequent unexposed F3 and F4 generations. This phenomenon is termed epigenetic transgenerational inheritance and has been shown to in part involve alterations in DNA methylation, but the role of other epigenetic mechanisms remains unknown. The current study investigated the alterations in small noncoding RNA (sncRNA) in the sperm from F3 generation control and vinclozolin lineage rats. Over 200 differentially expressed sncRNAs were identified and the tRNA-derived sncRNAs, namely 5′ halves of mature tRNAs (5′ halves), displayed the most dramatic changes. Gene targets of the altered miRNAs and tRNA 5′ halves revealed associations between the altered sncRNAs and differentially DNA methylated regions. Dysregulated sncRNAs appear to correlate with mRNA profiles associated with the previously observed vinclozolin-induced disease phenotypes. Data suggest potential connections between sperm-borne RNAs and the vinclozolin-induced epigenetic transgenerational inheritance phenomenon. PMID:27390623

  18. Satellite non-coding RNAs: the emerging players in cells, cellular pathways and cancer.


    Ferreira, Daniela; Meles, Susana; Escudeiro, Ana; Mendes-da-Silva, Ana; Adega, Filomena; Chaves, Raquel


    For several decades, transcriptional inactivity was considered as one of the particular features of constitutive heterochromatin and, therefore, of its major component, satellite DNA sequences. However, more recently, succeeding evidences have demonstrated that these sequences can indeed be transcribed, yielding satellite non-coding RNAs with important roles in the organization and regulation of genomes. Since then, several studies have been conducted, trying to understand the function(s) of these sequences not only in the normal but also in cancer genomes. It is thought that the association between cancer and satncRNAs is mostly due to the influence of these transcripts in the genome instability, a hallmark of cancer. The few reports on satellite DNA transcription in cancer contexts point to its overexpression; however, this scenario may be far more complex, variable, and influenced by a number of factors and the exact role of satncRNAs in the oncogenic process remains poorly understood. The greater is the knowledge on the association of satncRNAs with cancer, the greater would be the opportunity to assist cancer treatment, either by the design of effective therapies targeting these molecules or by using them as biomarkers in cancer diagnosis, prognosis, and with predictive value.

  19. Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions.


    Chu, Ci; Qu, Kun; Zhong, Franklin L; Artandi, Steven E; Chang, Howard Y


    Long noncoding RNAs (lncRNAs) are key regulators of chromatin state, yet the nature and sites of RNA-chromatin interaction are mostly unknown. Here we introduce Chromatin Isolation by RNA Purification (ChIRP), where tiling oligonucleotides retrieve specific lncRNAs with bound protein and DNA sequences, which are enumerated by deep sequencing. ChIRP-seq of three lncRNAs reveal that RNA occupancy sites in the genome are focal, sequence-specific, and numerous. Drosophila roX2 RNA occupies male X-linked gene bodies with increasing tendency toward the 3' end, peaking at CES sites. Human telomerase RNA TERC occupies telomeres and Wnt pathway genes. HOTAIR lncRNA preferentially occupies a GA-rich DNA motif to nucleate broad domains of Polycomb occupancy and histone H3 lysine 27 trimethylation. HOTAIR occupancy occurs independently of EZH2, suggesting the order of RNA guidance of Polycomb occupancy. ChIRP-seq is generally applicable to illuminate the intersection of RNA and chromatin with newfound precision genome wide.

  20. DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts.


    Paraskevopoulou, Maria D; Vlachos, Ioannis S; Karagkouni, Dimitra; Georgakilas, Georgios; Kanellos, Ilias; Vergoulis, Thanasis; Zagganas, Konstantinos; Tsanakas, Panayiotis; Floros, Evangelos; Dalamagas, Theodore; Hatzigeorgiou, Artemis G


    microRNAs (miRNAs) are short non-coding RNAs (ncRNAs) that act as post-transcriptional regulators of coding gene expression. Long non-coding RNAs (lncRNAs) have been recently reported to interact with miRNAs. The sponge-like function of lncRNAs introduces an extra layer of complexity in the miRNA interactome. DIANA-LncBase v1 provided a database of experimentally supported and in silico predicted miRNA Recognition Elements (MREs) on lncRNAs. The second version of LncBase ( presents an extensive collection of miRNA:lncRNA interactions. The significantly enhanced database includes more than 70 000 low and high-throughput, (in)direct miRNA:lncRNA experimentally supported interactions, derived from manually curated publications and the analysis of 153 AGO CLIP-Seq libraries. The new experimental module presents a 14-fold increase compared to the previous release. LncBase v2 hosts in silico predicted miRNA targets on lncRNAs, identified with the DIANA-microT algorithm. The relevant module provides millions of predicted miRNA binding sites, accompanied with detailed metadata and MRE conservation metrics. LncBase v2 caters information regarding cell type specific miRNA:lncRNA regulation and enables users to easily identify interactions in 66 different cell types, spanning 36 tissues for human and mouse. Database entries are also supported by accurate lncRNA expression information, derived from the analysis of more than 6 billion RNA-Seq reads.

  1. Phenotypic evolution through variation in splicing of the noncoding RNA COOLAIR.


    Li, Peijin; Tao, Zhen; Dean, Caroline


    The extent to which natural polymorphisms in noncoding sequences have functional consequences is still unknown. A large proportion of the natural variation in flowering in Arabidopsis thaliana accessions is due to noncoding cis polymorphisms that define distinct haplotypes of FLOWERING LOCUS C (FLC). Here, we show that a single natural intronic polymorphism in one haplotype affects FLC expression and thus flowering by specifically changing splicing of the FLC antisense transcript COOLAIR. Altered antisense splicing increases FLC expression via a cotranscriptional mechanism involving capping of the FLC nascent transcript. Single noncoding polymorphisms can therefore be a major contributor to phenotypic evolution through modulation of noncoding transcripts.

  2. Regulation of mammalian cell differentiation by long non-coding RNAs.


    Hu, Wenqian; Alvarez-Dominguez, Juan R; Lodish, Harvey F


    Differentiation of specialized cell types from stem and progenitor cells is tightly regulated at several levels, both during development and during somatic tissue homeostasis. Many long non-coding RNAs have been recognized as an additional layer of regulation in the specification of cellular identities; these non-coding species can modulate gene-expression programmes in various biological contexts through diverse mechanisms at the transcriptional, translational or messenger RNA stability levels. Here, we summarize findings that implicate long non-coding RNAs in the control of mammalian cell differentiation. We focus on several representative differentiation systems and discuss how specific long non-coding RNAs contribute to the regulation of mammalian development.

  3. PF1: an A-T hook-containing DNA binding protein from rice that interacts with a functionally defined d(AT)-rich element in the oat phytochrome A3 gene promoter.

    PubMed Central

    Nieto-Sotelo, J; Ichida, A; Quail, P H


    Phytochrome-imposed down-regulation of the expression of its own phytochrome A gene (PHYA) is one of the fastest light-induced effects on transcription reported in plants to date. Functional analysis of the oat PHYA3 promoter in a transfection assay has revealed two positive elements, PE1 and PE3, that function synergistically to support high levels of transcription in the absence of light. We have isolated a rice cDNA clone (pR4) encoding a DNA binding protein that binds to the AT-rich PE1 element. We tested the selectivity of the pR4-encoded DNA binding activity using linker substitution mutations of PE1 that are known to disrupt positive expression supported by the PHYA3 promoter in vivo. Binding to these linker substitution mutants was one to two orders of magnitude less than to the native PE1 element. Because this is the behavior expected of positive factor 1 (PF1), the presumptive nuclear transcription factor that acts in trans at the PE1 element in vivo, the data support the conclusion that the protein encoded by pR4 is in fact rice PF1. The PF1 polypeptide encoded by pR4 is 213 amino acids long and contains four repeats of the A-T hook DNA binding motif found in high-mobility group I-Y (HMGI-Y) proteins. In addition, PF1 contains an 11-amino acid-long hydrophobic region characteristic of HMG I proteins, its N-terminal region shows strong similarities to a pea H1 histone sequence and a short peptide sequence from wheat HMGa, and it shows a high degree of similarity along its entire length to the HMG Y-like protein encoded by a soybean cDNA, SB16. In vitro footprinting and quantitative gel shift analyses showed that PF1 binds preferentially to the PE1 element but also at lower affinity to two other AT-rich regions upstream of PE1. This feature is consistent with the binding characteristics of HMG I-Y proteins that are known to bind to most runs of six or more AT base pairs. Taken together, the properties of PF1 suggest that it belongs to a newly described

  4. DNA nanostructure immobilization to lithographic DNA arrays

    NASA Astrophysics Data System (ADS)

    Negrete, Omar D.

    Although DNA is well known for its genetic role in biology, DNA has also been sought-after as a material for the self-assembly of biological and electronic devices. Examples of DNA nanostructure construction include DNA tiled self-assembly and DNA Origami, where by controlling the sequence and concentration of DNA molecules, the rational design of geometric DNA nanostructures is possible. The assembly of DNA nanostructures takes place in solution and thus they are in disorder and require further organization to construct circuitry or devices. Hence, it is essential for future applications of this technology to develop methods to direct the placement of DNA nanostructures on a surface. To address this challenge my research examines the use of DNA microarrays to capture DNA nanostructures via DNA hybridization. Modern DNA arrays offer a high-density of sequence-specific molecular recognition sites where the addressable placement of DNA nanostructures can be achieved. Using Maskless Array Synthesizer (MAS) technology, I have characterized photolithographic DNA arrays for the hybridization of DNA complexes like large DNA molecules (> 1 kb), DNA-gold nanoparticle conjugates, and DNA Origami. Although modern photolithographic DNA arrays can possess a high-density of sequence (106/cm2), the printed DNA areas are on the order of tens of microns. Thus, I have also developed a method to reduce the DNA array spot size to nanoscale dimensions through the combined use of electron beam lithography with photolithographic DNA synthesis. This work addresses the key elements towards developing a surface patterning technology that takes advantage of DNA base-pairing for both molecular sub-assembly and surface patterning.

  5. The Histone Modification H3K27me3 Is Retained after Gene Duplication and Correlates with Conserved Noncoding Sequences in Arabidopsis

    PubMed Central

    Berke, Lidija; Snel, Berend


    The histone modification H3K27me3 is involved in repression of transcription and plays a crucial role in developmental transitions in both animals and plants. It is deposited by PRC2 (Polycomb repressive complex 2), a conserved protein complex. In Arabidopsis thaliana, H3K27me3 is found at 15% of all genes. These tend to encode transcription factors and other regulators important for development. However, it is not known how PRC2 is recruited to target loci nor how this set of target genes arose during Arabidopsis evolution. To resolve the latter, we integrated A. thaliana gene families with five independent genome-wide H3K27me3 data sets. Gene families were either significantly enriched or depleted of H3K27me3, showing a strong impact of shared ancestry to H3K27me3 distribution. To quantify this, we performed ancestral state reconstruction of H3K27me3 on phylogenetic trees of gene families. The set of H3K27me3-marked genes changed less than expected by chance, suggesting that H3K27me3 was retained after gene duplication. This retention suggests that the PRC2-recruiting signal could be encoded in the DNA and also conserved among certain duplicated genes. Indeed, H3K27me3-marked genes were overrepresented among paralogs sharing conserved noncoding sequences (CNSs) that are enriched with transcription factor binding sites. The association of upstream CNSs with H3K27me3-marked genes represents the first genome-wide connection between H3K27me3 and potential regulatory elements in plants. Thus, we propose that CNSs likely function as part of the PRC2 recruitment in plants. PMID:24567304

  6. Long noncoding RNAs and Alzheimer’s disease

    PubMed Central

    Luo, Qiong; Chen, Yinghui


    Long noncoding RNAs (lncRNAs) are typically defined as transcripts longer than 200 nucleotides. lncRNAs can regulate gene expression at epigenetic, transcriptional, and posttranscriptional levels. Recent studies have shown that lncRNAs are involved in many neurological diseases such as epilepsy, neurodegenerative conditions, and genetic disorders. Alzheimer’s disease is a neurodegenerative disease, which accounts for >80% of dementia in elderly subjects. In this review, we will highlight recent studies investigating the role of lncRNAs in Alzheimer’s disease and focus on some specific