Sample records for noncoding dna elements

  1. A surrogate approach to study the evolution of noncoding DNA elements that organize eukaryotic genomes.


    Vermaak, Danielle; Bayes, Joshua J; Malik, Harmit S


    Comparative genomics provides a facile way to address issues of evolutionary constraint acting on different elements of the genome. However, several important DNA elements have not reaped the benefits of this new approach. Some have proved intractable to current day sequencing technology. These include centromeric and heterochromatic DNA, which are essential for chromosome segregation as well as gene regulation, but the highly repetitive nature of the DNA sequences in these regions make them difficult to assemble into longer contigs. Other sequences, like dosage compensation X chromosomal sites, origins of DNA replication, or heterochromatic sequences that encode piwi-associated RNAs, have proved difficult to study because they do not have recognizable DNA features that allow them to be described functionally or computationally. We have employed an alternate approach to the direct study of these DNA elements. By using proteins that specifically bind these noncoding DNAs as surrogates, we can indirectly assay the evolutionary constraints acting on these important DNA elements. We review the impact that such "surrogate strategies" have had on our understanding of the evolutionary constraints shaping centromeres, origins of DNA replication, and dosage compensation X chromosomal sites. These have begun to reveal that in contrast to the view that such structural DNA elements are either highly constrained (under purifying selection) or free to drift (under neutral evolution), some of them may instead be shaped by adaptive evolution and genetic conflicts (these are not mutually exclusive). These insights also help to explain why the same elements (e.g., centromeres and replication origins), which are so complex in some eukaryotic genomes, can be simple and well defined in other where similar conflicts do not exist.

  2. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T-cell fate.


    Zheng, Ye; Josefowicz, Steven; Chaudhry, Ashutosh; Peng, Xiao P; Forbush, Katherine; Rudensky, Alexander Y


    Immune homeostasis is dependent on tight control over the size of a population of regulatory T (T(reg)) cells capable of suppressing over-exuberant immune responses. The T(reg) cell subset is comprised of cells that commit to the T(reg) lineage by upregulating the transcription factor Foxp3 either in the thymus (tT(reg)) or in the periphery (iT(reg)). Considering a central role for Foxp3 in T(reg) cell differentiation and function, we proposed that conserved non-coding DNA sequence (CNS) elements at the Foxp3 locus encode information defining the size, composition and stability of the T(reg) cell population. Here we describe the function of three Foxp3 CNS elements (CNS1-3) in T(reg) cell fate determination in mice. The pioneer element CNS3, which acts to potently increase the frequency of T(reg) cells generated in the thymus and the periphery, binds c-Rel in in vitro assays. In contrast, CNS1, which contains a TGF-beta-NFAT response element, is superfluous for tT(reg) cell differentiation, but has a prominent role in iT(reg) cell generation in gut-associated lymphoid tissues. CNS2, although dispensable for Foxp3 induction, is required for Foxp3 expression in the progeny of dividing T(reg) cells. Foxp3 binds to CNS2 in a Cbf-beta-Runx1 and CpG DNA demethylation-dependent manner, suggesting that Foxp3 recruitment to this 'cellular memory module' facilitates the heritable maintenance of the active state of the Foxp3 locus and, therefore, T(reg) lineage stability. Together, our studies demonstrate that the composition, size and maintenance of the T(reg) cell population are controlled by Foxp3 CNS elements engaged in response to distinct cell-extrinsic or -intrinsic cues.

  3. Humans and chimpanzees differ in their cellular response to DNA damage and non-coding sequence elements of DNA repair-associated genes.


    Weis, E; Galetzka, D; Herlyn, H; Schneider, E; Haaf, T


    both species. Genetic differences in non-coding sequence elements may affect gene regulation in the DNA repair network and thus contribute to species differences in DNA repair and cancer susceptibility.

  4. Scaling features of noncoding DNA

    NASA Technical Reports Server (NTRS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.


    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  5. Scaling features of noncoding DNA

    NASA Astrophysics Data System (ADS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C.-K.; Simons, M.


    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range - indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the “redundancy” of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong “background” effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  6. Scaling features of noncoding DNA

    NASA Technical Reports Server (NTRS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.


    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  7. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.


    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions

  8. Characterization of noncoding regulatory DNA in the human genome.


    Elkon, Ran; Agami, Reuven


    Genetic variants associated with common diseases are usually located in noncoding parts of the human genome. Delineation of the full repertoire of functional noncoding elements, together with efficient methods for probing their biological roles, is therefore of crucial importance. Over the past decade, DNA accessibility and various epigenetic modifications have been associated with regulatory functions. Mapping these features across the genome has enabled researchers to begin to document the full complement of putative regulatory elements. High-throughput reporter assays to probe the functions of regulatory regions have also been developed but these methods separate putative regulatory elements from the chromosome so that any effects of chromatin context and long-range regulatory interactions are lost. Definitive assignment of function(s) to putative cis-regulatory elements requires perturbation of these elements. Genome-editing technologies are now transforming our ability to perturb regulatory elements across entire genomes. Interpretation of high-throughput genetic screens that incorporate genome editors might enable the construction of an unbiased map of functional noncoding elements in the human genome.

  9. Noncoding chloroplast DNA variation in Mexican pines.


    Perez de la Rosa, J; Harris, S A; Farjon, A


    Universal primers were used for PCR amplification of three noncoding regions of chloroplast DNA in order to study restriction site variation in 12 Mexican pine species. Two length mutations were identified that are of diagnostic value for two subgenera or sections of the genus. Phylogenetic analysis of the restriction site and length variation showed patterns of variation largely consistent with previous arrangements of these pines, except for the position of Pinus nelsonii, indicating that Pinus section Parraya Mayr, as circumscribed by Little and Critchfield (1969) and later authors, is not a monophyletic group.

  10. Noncoding DNA and the teem theory of inheritance, emotions and innate behaviour.


    Vendramini, Danny


    The evolutionary function of noncoding 'junk' DNA remains one of the most challenging mysteries of genetics. Here a new model of DNA is proposed to explain this function. The hypothesis asserts the DNA molecule contains not one, but two separate modes of inheritance. In addition to exons that code for proteins and physical traits, it is argued noncoding repetitive elements code for the inheritance of emotions and innate behaviour in metazoans. That is to say, noncoding DNA functions as the medium of a second, hitherto unknown evolutionary process that genetically archives adaptive information, configured as emotions and acquired during the life of an organism, into an inheritable form. This second evolutionary process, here called 'Teemosis', is a selectionist process, but paradoxically, because it does not affect physical traits, it has no maladaptive Lamarckian consequences. The medical implications of the hypothesis are discussed.

  11. Nonextensive statistical approach to non-coding human DNA

    NASA Astrophysics Data System (ADS)

    Oikonomou, Th.; Provata, A.; Tirnakli, U.


    We use q-exponential distributions, which maximize the nonextensive entropy Sq (defined as Sq≡(1-∑ipiq)/(q-1)), to study the size distributions of non-coding DNA (including introns and intergenic regions) in all human chromosomes. We show that the value of the exponent q describing the non-coding size distributions is similar for all chromosomes and varies between 2≤q≤2.3 with the exception of chromosomes X and Y.

  12. Genome-wide evolutionary analysis of the noncoding RNA genes and noncoding DNA of Paramecium tetraurelia

    PubMed Central

    Chen, Chun-Long; Zhou, Hui; Liao, Jian-You; Qu, Liang-Hu; Amar, Laurence


    The compact genome of the unicellular eukaryote Paramecium tetraurelia contains noncoding DNA (ncDNA) distributed into >39,000 intergenic sequences and >90,000 introns of 390 base pairs (bp) and 25 bp on average, respectively. Here we analyzed the molecular features of the ncRNA genes, introns, and intergenic sequences of this genome. We mainly used computational programs and comparative genomics possible because the P. tetraurelia genome had formed throughout whole-genome duplications (WGDs). We characterized 417 5S rRNA, snRNA, snoRNA, SRP RNA, and tRNA putative genes, 415 of which map within intergenic sequences, and two, within introns. The evolution of these ncRNA genes appears to have mainly involved purifying selection and gene deletion. We then compared the introns that interrupt the protein-coding gene duplicates arisen from the recent WGD and identified a population of a few thousands of introns having evolved under most stringent constraints (>95% of identity). We also showed that low nucleotide substitution levels characterize the 50 and 80–115 base pairs flanking, respectively, the stop and start codons of the protein-coding genes. Lower substitution levels mark the base pairs flanking the highly transcribed genes, or the start codons of the genes of the sets with a high number of WGD-related sequences. Finally, adjacent to protein-coding genes, we characterized 32 DNA motifs able to encode stable and evolutionary conserved RNA secondary structures and defining putative expression controlling elements. Fourteen DNA motifs with similar properties map distant from protein-coding genes and may encode regulatory ncRNAs. PMID:19218550

  13. Protection of the genome and central protein-coding sequences by non-coding DNA against DNA damage from radiation.


    Qiu, Guo-Hua


    frequently and may be removed by repetitive elements in non-coding DNA through the formation of eccDNAs and expelled out of the nucleus to the cytoplasm via the NPC. Therefore, this review proposes that the genome and central protein-coding sequences are doubly protected by non-coding DNA in peripheral heterochromatin against DNA damage from radiation, which may be a novel protective role of non-coding DNA in genome defense.

  14. An inducible long noncoding RNA amplifies DNA damage signaling.


    Schmitt, Adam M; Garcia, Julia T; Hung, Tiffany; Flynn, Ryan A; Shen, Ying; Qu, Kun; Payumo, Alexander Y; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K; Attardi, Laura D; Chang, Howard Y


    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently precise regulation but mostly unknown functions. Here we demonstrate that lncRNAs guide the organismal DNA damage response. DNA damage activated transcription of the DINO (Damage Induced Noncoding) lncRNA via p53. DINO was required for p53-dependent gene expression, cell cycle arrest and apoptosis in response to DNA damage, and DINO expression was sufficient to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO bound to p53 protein and promoted its stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampened p53 signaling and ameliorated acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks.

  15. An inducible long noncoding RNA amplifies DNA damage signaling

    PubMed Central

    Schmitt, Adam M.; Garcia, Julia T.; Hung, Tiffany; Flynn, Ryan A.; Shen, Ying; Qu, Kun; Payumo, Alexander Y.; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K.; Attardi, Laura D.; Chang, Howard Y.


    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently exquisite regulation but mostly unknown functions. Here we demonstrate a role of lncRNAs in guiding organismal DNA damage response. DNA damage activates transcription of DINO (Damage Induced NOncoding) via p53. DINO is required for p53-dependent gene expression, cell cycle arrest, and apoptosis in response to DNA damage, and DINO expression suffice to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO binds to and promotes p53 protein stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampens p53 signaling and ameliorates acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks. PMID:27668660

  16. "Reverse Genomics" Predicts Function of Human Conserved Noncoding Elements.


    Marcovitz, Amir; Jia, Robin; Bejerano, Gill


    Evolutionary changes in cis-regulatory elements are thought to play a key role in morphological and physiological diversity across animals. Many conserved noncoding elements (CNEs) function as cis-regulatory elements, controlling gene expression levels in different biological contexts. However, determining specific associations between CNEs and related phenotypes is a challenging task. Here, we present a computational "reverse genomics" approach that predicts the phenotypic functions of human CNEs. We identify thousands of human CNEs that were lost in at least two independent mammalian lineages (IL-CNEs), and match their evolutionary profiles against a diverse set of phenotypes recently annotated across multiple mammalian species. We identify 2,759 compelling associations between human CNEs and a diverse set of mammalian phenotypes. We discuss multiple CNEs, including a predicted ear element near BMP7, a pelvic CNE in FBN1, a brain morphology element in UBE4B, and an aquatic adaptation forelimb CNE near EGR2, and provide a full list of our predictions. As more genomes are sequenced and more traits are annotated across species, we expect our method to facilitate the interpretation of noncoding mutations in human disease and expedite the discovery of individual CNEs that play key roles in human evolution and development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail:

  17. Long noncoding RNA, the methylation of genomic elements and their emerging crosstalk in hepatocellular carcinoma.


    Yuan, Sheng-Xian; Zhang, Jin; Xu, Qing-Guo; Yang, Yuan; Zhou, Wei-Ping


    The epigenetic mechanism that incorporates DNA methylation alterations, histone modifications, and non-coding RNA expression has been identified as a major characteristic in distinguishing physiological and pathological settings of cancers including hepatocellular carcinoma (HCC), the third leading cause of mortality related cancer. The advance in methylation modification of chromatin elements (for both genomic DNA and histone tails) and the emerging roles of long noncoding RNA (lncRNA) have given us a better understanding of molecular mechanisms underlying HCC. Recently, methods like genome-wide lncRNA profiling and histone hallmark detection were reported to discover mass tumor-associated lncRNAs epigenetically deregulated by differential chromosome modification, mainly by genomic DNA and histone methylation. Therefore, aberrant methylation modification of certain particular lncRNA genes could be crucial events correlating with unfavorable outcomes in HCC. In addition, amount of lncRNAs could act as a manipulator for DNA methylation or a scaffold for histone modification to affect key signaling pathways in hepatocarcinogenesis. This suggests that methylation modification of chromatin elements may have functional crosstalk with lncRNA. Here, we aim to outline the emerging role of the methylation and lncRNA, and their crosstalk of molecular mechanism. Copyright © 2016. Published by Elsevier Ireland Ltd.

  18. Polyphyletism of Celastrales deduced from a chloroplast noncoding DNA region.


    Savolainen, V; Spichiger, R; Manen, J F


    In a previous study we examined the phylogeny of four families related to the angiosperm order Celastrales based on chloroplast rbcL 5' flanking sequences. We have added here several additional dicots, sampled from 6 of the 7 families of Celastrales sensu Cronquist and 19 putatively related genera. Based on a cladistic analysis of these DNA sequences, the order Celastrales appears polyphyletic: it is here restricted to Celastraceae (including Hippocrateaceae and Brexia) with Parnassia as sister; Aquifoliaceae plus Helwingia are included in Asteridae. Neither Salvadoraceae nor Geissolomataceae, Icacinaceae, Phellinaceae, Aextoxicaceae, Corynocarpaceae, Dichapetalaceae, Stackhousiaceae, or Goupiaceae are related to Celastrales. The usefulness of this noncoding region is discussed and the influence of the A + T content of neighboring bases on the increase of transversions is also observed as previously shown in chloroplast noncoding regions of monocots.

  19. Genomic context analysis reveals dense interaction network between vertebrate ultraconserved non-coding elements

    PubMed Central

    Dimitrieva, Slavica; Bucher, Philipp


    Motivation: Genomic context analysis, also known as phylogenetic profiling, is widely used to infer functional interactions between proteins but rarely applied to non-coding cis-regulatory DNA elements. We were wondering whether this approach could provide insights about utlraconserved non-coding elements (UCNEs). These elements are organized as large clusters, so-called gene regulatory blocks (GRBs) around key developmental genes. Their molecular functions and the reasons for their high degree of conservation remain enigmatic. Results: In a special setting of genomic context analysis, we analyzed the fate of GRBs after a whole-genome duplication event in five fish genomes. We found that in most cases all UCNEs were retained together as a single block, whereas the corresponding target genes were often retained in two copies, one completely devoid of UCNEs. This ‘winner-takes-all’ pattern suggests that UCNEs of a GRB function in a highly cooperative manner. We propose that the multitude of interactions between UCNEs is the reason for their extreme sequence conservation. Supplementary information: Supplementary data are available at Bioinformatics online and at PMID:22962458

  20. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro


    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  1. Adaptive Evolution of Conserved Noncoding Elements in Mammals

    PubMed Central

    Kim, Su Yeon; Pritchard, Jonathan K


    Conserved noncoding elements (CNCs) are an abundant feature of vertebrate genomes. Some CNCs have been shown to act as cis-regulatory modules, but the function of most CNCs remains unclear. To study the evolution of CNCs, we have developed a statistical method called the “shared rates test” to identify CNCs that show significant variation in substitution rates across branches of a phylogenetic tree. We report an application of this method to alignments of 98,910 CNCs from the human, chimpanzee, dog, mouse, and rat genomes. We find that ∼68% of CNCs evolve according to a null model where, for each CNC, a single parameter models the level of constraint acting throughout the phylogeny linking these five species. The remaining ∼32% of CNCs show departures from the basic model including speed-ups and slow-downs on particular branches and occasionally multiple rate changes on different branches. We find that a subset of the significant CNCs have evolved significantly faster than the local neutral rate on a particular branch, providing strong evidence for adaptive evolution in these CNCs. The distribution of these signals on the phylogeny suggests that adaptive evolution of CNCs occurs in occasional short bursts of evolution. Our analyses suggest a large set of promising targets for future functional studies of adaptation. PMID:17845075

  2. Junk DNA and the long non-coding RNA twist in cancer genetics

    PubMed Central

    Ling, Hui; Vincent, Kimberly; Pichler, Martin; Fodde, Riccardo; Berindan-Neagoe, Ioana; Slack, Frank J.; Calin, George A


    The central dogma of molecular biology states that the flow of genetic information moves from DNA to RNA to protein. However, in the last decade this dogma has been challenged by new findings on non-coding RNAs (ncRNAs) such as microRNAs (miRNAs). More recently, long non-coding RNAs (lncRNAs) have attracted much attention due to their large number and biological significance. Many lncRNAs have been identified as mapping to regulatory elements including gene promoters and enhancers, ultraconserved regions, and intergenic regions of protein-coding genes. Yet, the biological function and molecular mechanisms of lncRNA in human diseases in general and cancer in particular remain largely unknown. Data from the literature suggest that lncRNA, often via interaction with proteins, functions in specific genomic loci or use their own transcription loci for regulatory activity. In this review, we summarize recent findings supporting the importance of DNA loci in lncRNA function, and the underlying molecular mechanisms via cis or trans regulation, and discuss their implications in cancer. In addition, we use the 8q24 genomic locus, a region containing interactive SNPs, DNA regulatory elements and lncRNAs, as an example to illustrate how single nucleotide polymorphism (SNP) located within lncRNAs may be functionally associated with the individual’s susceptibility to cancer. PMID:25619839

  3. Noncoding RNAs in DNA Repair and Genome Integrity

    PubMed Central

    Wan, Guohui; Liu, Yunhua; Han, Cecil; Zhang, Xinna


    Abstract Significance: The well-studied sequences in the human genome are those of protein-coding genes, which account for only 1%–2% of the total genome. However, with the advent of high-throughput transcriptome sequencing technology, we now know that about 90% of our genome is extensively transcribed and that the vast majority of them are transcribed into noncoding RNAs (ncRNAs). It is of great interest and importance to decipher the functions of these ncRNAs in humans. Recent Advances: In the last decade, it has become apparent that ncRNAs play a crucial role in regulating gene expression in normal development, in stress responses to internal and environmental stimuli, and in human diseases. Critical Issues: In addition to those constitutively expressed structural RNA, such as ribosomal and transfer RNAs, regulatory ncRNAs can be classified as microRNAs (miRNAs), Piwi-interacting RNAs (piRNAs), small interfering RNAs (siRNAs), small nucleolar RNAs (snoRNAs), and long noncoding RNAs (lncRNAs). However, little is known about the biological features and functional roles of these ncRNAs in DNA repair and genome instability, although a number of miRNAs and lncRNAs are regulated in the DNA damage response. Future Directions: A major goal of modern biology is to identify and characterize the full profile of ncRNAs with regard to normal physiological functions and roles in human disorders. Clinically relevant ncRNAs will also be evaluated and targeted in therapeutic applications. Antioxid. Redox Signal. 20, 655–677. PMID:23879367

  4. High-resolution interrogation of functional elements in the noncoding genome

    PubMed Central

    Sanjana, Neville E.; Wright, Jason; Zheng, Kaijie; Shalem, Ophir; Fontanillas, Pierre; Joung, Julia; Cheng, Christine; Regev, Aviv; Zhang, Feng


    The noncoding genome affects gene regulation and disease, yet we lack tools for rapid identification and manipulation of noncoding elements. We develop a CRISPR screen employing ~18,000 sgRNAs targeting >700 kb surrounding the genes NF1, NF2, and CUL3, which are involved in BRAF inhibitor resistance in melanoma. We find that noncoding locations that modulate drug resistance also harbor predictive hallmarks of noncoding function. With a subset of regions at the CUL3 locus, we demonstrate that engineered mutations alter transcription factor occupancy and long-range and local epigenetic environments, implicating these sites in gene regulation and chemotherapeutic resistance. Though our expansion of the potential of pooled CRISPR screens we provide tools for genomic discovery and for elucidating biologically relevant mechanisms of gene regulation. Pooled CRISPR mutagenesis identifies functional elements in the noncoding genome. PMID:27708104

  5. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle


    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C.; ...


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20–25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. In this paper, we use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% ofmore » the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Finally, our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual “inflation” of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.« less

  6. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    SciTech Connect

    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, Tijana; Goodwin, Lynne; Kyrpides, Nikos C.; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20–25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. In this paper, we use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% of the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Finally, our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual “inflation” of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  7. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle.


    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C; Mincer, Tracy; Heidelberg, John F; Fu, Feixue; Waterbury, John B; Glavina del Rio, Tijana; Goodwin, Lynne; Kyrpides, Nikos C; Land, Miriam L; Woyke, Tanja; Hutchins, David A; Hess, Wolfgang R; Webb, Eric A


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20-25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. We use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% of the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual "inflation" of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  8. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    PubMed Central

    Walworth, Nathan; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, Tijana; Goodwin, Lynne; Kyrpides, Nikos C.; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance because of its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20–25% less than the average for other cyanobacteria and nonpathogenic, free-living bacteria. We use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus, both in culture and in situ. Transcriptome analysis indicates that 86% of the noncoding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and twofold higher than that found in the gene-dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium noncoding RNA secondary structures were predicted between most culture and metagenomic sequences, lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Our data suggest that transposition of selfish DNA, low effective population size, and high-fidelity replication allowed the unusual “inflation” of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle. PMID:25831533

  9. Coding and noncoding plastid DNA in palm systematics.


    Asmussen, C B; Chase, M W


    Plastid DNA sequences evolve slowly in palms but show that the family is monophyletic and highly divergent relative to other major monocot clades. It is therefore difficult to place the root within the palms because faster evolving, length-variable sequences cannot be aligned with outgroup monocots, and length-conserved regions have been thought to give too few characters to resolve basal nodes. To solve this problem, we combined 94 ingroup and 24 outgroup sequences from the length-conserved rbcL gene with ingroup and alignable outgroup sequences from noncoding rps16 intron and trnL-trnF regions. The separate rps16 intron and trnL-trnF region contained about the same number of variable sites (autapomorphies not included) as rbcL, but gave higher retention indices and more clades with bootstrap support. In general, the strict consensus tree based on combined rbcL, rps16 intron, and trnL-trnF data showed more resolution towards the base of the palm family than previous hypotheses of relationships of the Arecaceae. An important result was the position of subfamily Calamoideae as sister to the rest of the palms, but this received <50% bootstrap support. Another result of systematic significance was the indication that subfamily Phytelephantoideae is related to two tribes from subfamily Ceroxyloideae, Cyclospatheae and Ceroxyleae.

  10. Non-coding RNAs: an emerging player in DNA damage response.


    Zhang, Chunzhi; Peng, Guang


    Non-coding RNAs play a crucial role in maintaining genomic stability which is essential for cell survival and preventing tumorigenesis. Through an extensive crosstalk between non-coding RNAs and the canonical DNA damage response (DDR) signaling pathway, DDR-induced expression of non-coding RNAs can provide a regulatory mechanism to accurately control the expression of DNA damage responsive genes in a spatio-temporal manner. Mechanistically, DNA damage alters expression of a variety of non-coding RNAs at multiple levels including transcriptional regulation, post-transcriptional regulation, and RNA degradation. In parallel, non-coding RNAs can directly regulate cellular processes involved in DDR by altering expression of their targeting genes, with a particular emphasis on miRNAs and lncRNAs. MiRNAs are required for almost every aspect of cellular responses to DNA damage, including sensing DNA damage, transducing damage signals, repairing damaged DNA, activating cell cycle checkpoints, and inducing apoptosis. As for lncRNAs, they control transcription of DDR relevant gene by four different regulatory models, including signal, decoy, guide, and scaffold. In addition, we also highlight potential clinical applications of non-coding RNAs as biomarkers and therapeutic targets for anti-cancer treatments using DNA-damaging agents including radiation and chemotherapy. Although tremendous advances have been made to elucidate the role of non-coding RANs in genome maintenance, many key questions remain to be answered including mechanistically how non-coding RNA pathway and DNA damage response pathway is coordinated in response to genotoxic stress. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. High-resolution interrogation of functional elements in the noncoding genome.


    Sanjana, Neville E; Wright, Jason; Zheng, Kaijie; Shalem, Ophir; Fontanillas, Pierre; Joung, Julia; Cheng, Christine; Regev, Aviv; Zhang, Feng


    The noncoding genome affects gene regulation and disease, yet we lack tools for rapid identification and manipulation of noncoding elements. We developed a CRISPR screen using ~18,000 single guide RNAs targeting >700 kilobases surrounding the genes NF1, NF2, and CUL3, which are involved in BRAF inhibitor resistance in melanoma. We find that noncoding locations that modulate drug resistance also harbor predictive hallmarks of noncoding function. With a subset of regions at the CUL3 locus, we demonstrate that engineered mutations alter transcription factor occupancy and long-range and local epigenetic environments, implicating these sites in gene regulation and chemotherapeutic resistance. Through our expansion of the potential of pooled CRISPR screens, we provide tools for genomic discovery and for elucidating biologically relevant mechanisms of gene regulation. Copyright © 2016, American Association for the Advancement of Science.

  12. The RIDL hypothesis: transposable elements as functional domains of long noncoding RNAs

    PubMed Central

    Johnson, Rory; Guigó, Roderic


    Our genome contains tens of thousands of long noncoding RNAs (lncRNAs), many of which are likely to have genetic regulatory functions. It has been proposed that lncRNA are organized into combinations of discrete functional domains, but the nature of these and their identification remain elusive. One class of sequence elements that is enriched in lncRNA is represented by transposable elements (TEs), repetitive mobile genetic sequences that have contributed widely to genome evolution through a process termed exaptation. Here, we link these two concepts by proposing that exonic TEs act as RNA domains that are essential for lncRNA function. We term such elements Repeat Insertion Domains of LncRNAs (RIDLs). A growing number of RIDLs have been experimentally defined, where TE-derived fragments of lncRNA act as RNA-, DNA-, and protein-binding domains. We propose that these reflect a more general phenomenon of exaptation during lncRNA evolution, where inserted TE sequences are repurposed as recognition sites for both protein and nucleic acids. We discuss a series of genomic screens that may be used in the future to systematically discover RIDLs. The RIDL hypothesis has the potential to explain how functional evolution can keep pace with the rapid gene evolution observed in lncRNA. More practically, TE maps may in the future be used to predict lncRNA function. PMID:24850885

  13. Trichodesmium genome maintains abundant, widespread noncoding DNA in situ, despite oligotrophic lifestyle

    SciTech Connect

    Walworth, Nathan G.; Pfreundt, Ulrike; Nelson, William C.; Mincer, Tracy; Heidelberg, John F.; Fu, Feixue; Waterbury, John B.; Glavina del Rio, T.; Goodwin, Lynne A.; Kyrpides, Nikos; Land, Miriam L.; Woyke, Tanja; Hutchins, David A.; Hess, Wolfgang R.; Webb, Eric A.


    Understanding the evolution of the free-living, cyanobacterial, diazotroph Trichodesmium is of great importance due to its critical role in oceanic biogeochemistry and primary production. Unlike the other >150 available genomes of free-living cyanobacteria, only 63.8% of the Trichodesmium erythraeum (strain IMS101) genome is predicted to encode protein, which is 20-25% less than the average for other cyanobacteria and non-pathogenic, free-living bacteria. We use distinctive isolates and metagenomic data to show that low coding density observed in IMS101 is a common feature of the Trichodesmium genus both in culture and in situ. Transcriptome analysis indicates that 86% of the non-coding space is expressed, although the function of these transcripts is unclear. The density of noncoding, possible regulatory elements predicted in Trichodesmium, when normalized per intergenic kilobase, was comparable and two fold higher than that found in the gene dense genomes of the sympatric cyanobacterial genera Synechococcus and Prochlorococcus, respectively. Conserved Trichodesmium ncRNA secondary structures were predicted between most culture and metagenomic sequences lending support to the structural conservation. Conservation of these intergenic regions in spatiotemporally separated Trichodesmium populations suggests possible genus-wide selection for their maintenance. These large intergenic spacers may have developed during intervals of strong genetic drift caused by periodic blooms of a subset of genotypes, which may have reduced effective population size. Our data suggest that transposition of selfish DNA, low effective population size, and high fidelity replication allowed the unusual ‘inflation’ of noncoding sequence observed in Trichodesmium despite its oligotrophic lifestyle.

  14. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.


    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  15. In search of coding and non-coding regions of DNA sequences based on balanced estimation of diffusion entropy.


    Zhang, Jin; Zhang, Wenqing; Yang, Huijie


    Identification of coding regions in DNA sequences remains challenging. Various methods have been proposed, but these are limited by species-dependence and the need for adequate training sets. The elements in DNA coding regions are known to be distributed in a quasi-random way, while those in non-coding regions have typical similar structures. For short sequences, these statistical characteristics cannot be extracted correctly and cannot even be detected. This paper introduces a new way to solve the problem: balanced estimation of diffusion entropy (BEDE).

  16. Statistical analysis of nucleotide runs in coding and noncoding DNA sequences.


    Sprizhitsky YuA; Nechipurenko YuD; Alexandrov, A A; Volkenstein, M V


    A statistical analysis of the occurrence of particular nucleotide runs in DNA sequences of different species has been carried out. There are considerable differences of run distributions in DNA sequences of procaryotes, invertebrates and vertebrates. There is an abundance of short runs (1-2 nucleotides long) in the coding sequences and there is a deficiency of such runs in the noncoding regions. However, some interesting exceptions from this rule exist for the run distribution of adenine in procaryotes and for the arrangement of purine-pyrimidine runs in eucaryotes. The similarity in the distributions of such runs in the coding and noncoding regions may be due to some structural features of the DNA molecule as a whole. Runs of guanine (or cytosine) of three to six nucleotides occur predominantly in noncoding DNA regions in eucaryotes, especially in vertebrates.

  17. Natural Selection and Functional Potentials of Human Noncoding Elements Revealed by Analysis of Next Generation Sequencing Data.


    Jha, Pankaj; Lu, Dongsheng; Xu, Shuhua


    Noncoding DNA sequences (NCS) have attracted much attention recently due to their functional potentials. Here we attempted to reveal the functional roles of noncoding sequences from the point of view of natural selection that typically indicates the functional potentials of certain genomic elements. We analyzed nearly 37 million single nucleotide polymorphisms (SNPs) of Phase I data of the 1000 Genomes Project. We estimated a series of key parameters of population genetics and molecular evolution to characterize sequence variations of the noncoding genome within and between populations, and identified the natural selection footprints in NCS in worldwide human populations. Our results showed that purifying selection is prevalent and there is substantial constraint of variations in NCS, while positive selectionis more likely to be specific to some particular genomic regions and regional populations. Intriguingly, we observed larger fraction of non-conserved NCS variants with lower derived allele frequency in the genome, indicating possible functional gain of non-conserved NCS. Notably, NCS elements are enriched for potentially functional markers such as eQTLs, TF motif, and DNase I footprints in the genome. More interestingly, some NCS variants associated with diseases such as Alzheimer's disease, Type 1 diabetes, and immune-related bowel disorder (IBD) showed signatures of positive selection, although the majority of NCS variants, reported as risk alleles by genome-wide association studies, showed signatures of negative selection. Our analyses provided compelling evidence of natural selection forces on noncoding sequences in the human genome and advanced our understanding of their functional potentials that play important roles in disease etiology and human evolution.

  18. Natural Selection and Functional Potentials of Human Noncoding Elements Revealed by Analysis of Next Generation Sequencing Data

    PubMed Central

    Xu, Shuhua


    Noncoding DNA sequences (NCS) have attracted much attention recently due to their functional potentials. Here we attempted to reveal the functional roles of noncoding sequences from the point of view of natural selection that typically indicates the functional potentials of certain genomic elements. We analyzed nearly 37 million single nucleotide polymorphisms (SNPs) of Phase I data of the 1000 Genomes Project. We estimated a series of key parameters of population genetics and molecular evolution to characterize sequence variations of the noncoding genome within and between populations, and identified the natural selection footprints in NCS in worldwide human populations. Our results showed that purifying selection is prevalent and there is substantial constraint of variations in NCS, while positive selectionis more likely to be specific to some particular genomic regions and regional populations. Intriguingly, we observed larger fraction of non-conserved NCS variants with lower derived allele frequency in the genome, indicating possible functional gain of non-conserved NCS. Notably, NCS elements are enriched for potentially functional markers such as eQTLs, TF motif, and DNase I footprints in the genome. More interestingly, some NCS variants associated with diseases such as Alzheimer's disease, Type 1 diabetes, and immune-related bowel disorder (IBD) showed signatures of positive selection, although the majority of NCS variants, reported as risk alleles by genome-wide association studies, showed signatures of negative selection. Our analyses provided compelling evidence of natural selection forces on noncoding sequences in the human genome and advanced our understanding of their functional potentials that play important roles in disease etiology and human evolution. PMID:26053627

  19. Origin of noncoding DNA sequences: molecular fossils of genome evolution.


    Naora, H; Miyahara, K; Curnow, R N


    The total amount of noncoding sequences on chromosomes of contemporary organisms varies significantly from species to species. We propose a hypothesis for the origin of these noncoding sequences that assumes that (i) an approximately equal to 0.55-kilobase (kb)-long reading frame composed the primordial gene and (ii) a 20-kb-long single-stranded polynucleotide is the longest molecule (as a genome) that was polymerized at random and without a specific template in the primordial soup/cell. The statistical distribution of stop codons allows examination of the probability of generating reading frames of approximately equal to 0.55 kb in this primordial polynucleotide. This analysis reveals that with three stop codons, a run of at least 0.55-kb equivalent length of nonstop codons would occur in 4.6% of 20-kb-long polynucleotide molecules. We attempt to estimate the total amount of noncoding sequences that would be present on the chromosomes of contemporary species assuming that present-day chromosomes retain the prototype primordial genome structure. Theoretical estimates thus obtained for most eukaryotes do not differ significantly from those reported for these specific organisms, with only a few exceptions. Furthermore, analysis of possible stop-codon distributions suggests that life on earth would not exist, at least in its present form, had two or four stop codons been selected early in evolution.

  20. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle

    PubMed Central

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W.; Kozmik, Zbynek; Putnam, Nicholas H.; Yu, Jr-Kai; Holland, Linda Z.


    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120–160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  1. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    NASA Technical Reports Server (NTRS)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.


    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  2. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    NASA Technical Reports Server (NTRS)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.


    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  3. Correia Repeat Enclosed Elements and Non-Coding RNAs in the Neisseria Species

    PubMed Central

    Roberts, Sabrina B.; Spencer-Smith, Russell; Shah, Mahwish; Nebel, Jean-Christophe; Cook, Richard T.; Snyder, Lori A. S.


    Neisseria gonorrhoeae is capable of causing gonorrhoea and more complex diseases in the human host. Neisseria meningitidis is a closely related pathogen that shares many of the same genomic features and virulence factors, but causes the life threatening diseases meningococcal meningitis and septicaemia. The importance of non-coding RNAs in gene regulation has become increasingly evident having been demonstrated to be involved in regulons responsible for iron acquisition, antigenic variation, and virulence. Neisseria spp. contain an IS-like element, the Correia Repeat Enclosed Element, which has been predicted to be mobile within the genomes or to have been in the past. This repeat, present in over 100 copies in the genome, has the ability to alter gene expression and regulation in several ways. We reveal here that Correia Repeat Enclosed Elements tend to be near non-coding RNAs in the Neisseria spp., especially N. gonorrhoeae. These results suggest that Correia Repeat Enclosed Elements may have disrupted ancestral regulatory networks not just through their influence on regulatory proteins but also for non-coding RNAs. PMID:27681925

  4. Genome-wide computational analysis of potential long noncoding RNA mediated DNA:DNA:RNA triplexes in the human genome.


    Jalali, Saakshi; Singh, Amrita; Maiti, Souvik; Scaria, Vinod


    Only a handful of long noncoding RNAs have been functionally characterized. They are known to modulate regulation through interacting with other biomolecules in the cell: DNA, RNA and protein. Though there have been detailed investigations on lncRNA-miRNA and lncRNA-protein interactions, the interaction of lncRNAs with DNA have not been studied extensively. In the present study, we explore whether lncRNAs could modulate genomic regulation by interacting with DNA through the formation of highly stable DNA:DNA:RNA triplexes. We computationally screened 23,898 lncRNA transcripts as annotated by GENCODE, across the human genome for potential triplex forming sequence stretches (PTS). The PTS frequencies were compared across 5'UTR, CDS, 3'UTR, introns, promoter and 1000 bases downstream of the transcription termination sites. These regions were annotated by mapping to experimental regulatory regions, classes of repeat regions and transcription factors. We validated few putative triplex mediated interactions where lncRNA-gene pair interaction is via pyrimidine triplex motif using biophysical methods. We identified 20,04,034 PTS sites to be enriched in promoter and intronic regions across human genome. Additional analysis of the association of PTS with core promoter elements revealed a systematic paucity of PTS in all regulatory regions, except TF binding sites. A total of 25 transcription factors were found to be associated with PTS. Using an interaction network, we showed that a subset of the triplex forming lncRNAs, have a positive association with gene promoters. We also demonstrated an in vitro interaction of one lncRNA candidate with its predicted gene target promoter regions. Our analysis shows that PTS are enriched in gene promoter and largely associated with simple repeats. The current study suggests a major role of a subset of lncRNAs in mediating chromatin organization modulation through CTCF and NSRF proteins.

  5. Extreme conservation of noncoding DNA near HoxD complex of vertebrates

    PubMed Central

    Sabarinadh, Chilaka; Subramanian, Subbaya; Tripathi, Anshuman; Mishra, Rakesh K


    Background Homeotic gene complexes determine the anterior-posterior body axis in animals. The expression pattern and function of hox genes along this axis is colinear with the order in which they are organized in the complex. This 'chromosomal organization and functional correspondence' is conserved in all bilaterians investigated. Genomic sequences covering the HoxD complex from several vertebrate species are now available. This offers a comparative genomics approach to identify conserved regions linked to this complex. Although the molecular basis of 'colinearity' of Hox complexes is not yet understood, it is possible that there are control elements within or in the proximity of these complexes that establish and maintain the expression patterns of hox genes in a coordinated fashion. Results We have compared DNA sequence flanking the HoxD complex of several primate, rodent and fish species. This analysis revealed an unprecedented conservation of non-coding DNA sequences adjacent to the HoxD complex from fish to human. Stretches of hundreds of base pairs in a 7 kb region, upstream of HoxD complex, show 100% conservation across the vertebrate species. Using PCR primers from the human sequence, these conserved regions could be amplified from other vertebrate species, including other mammals, birds, reptiles, amphibians and fish. Our analysis of these sequences also indicates that starting from the conserved core regions, more sequences have been added on and maintained during evolution from fish to human. Conclusion Such a high degree of conservation in the core regions of this 7 kb DNA, where no variation occurred during ~500 million years of evolution, suggests critical function for these sequences. We suggest that such sequences are likely to provide molecular handle to gain insight into the evolution and mechanism of regulation of associated gene complexes. PMID:15462684

  6. “Reverse Genomics” Predicts Function of Human Conserved Noncoding Elements

    PubMed Central

    Marcovitz, Amir; Jia, Robin; Bejerano, Gill


    Evolutionary changes in cis-regulatory elements are thought to play a key role in morphological and physiological diversity across animals. Many conserved noncoding elements (CNEs) function as cis-regulatory elements, controlling gene expression levels in different biological contexts. However, determining specific associations between CNEs and related phenotypes is a challenging task. Here, we present a computational “reverse genomics” approach that predicts the phenotypic functions of human CNEs. We identify thousands of human CNEs that were lost in at least two independent mammalian lineages (IL-CNEs), and match their evolutionary profiles against a diverse set of phenotypes recently annotated across multiple mammalian species. We identify 2,759 compelling associations between human CNEs and a diverse set of mammalian phenotypes. We discuss multiple CNEs, including a predicted ear element near BMP7, a pelvic CNE in FBN1, a brain morphology element in UBE4B, and an aquatic adaptation forelimb CNE near EGR2, and provide a full list of our predictions. As more genomes are sequenced and more traits are annotated across species, we expect our method to facilitate the interpretation of noncoding mutations in human disease and expedite the discovery of individual CNEs that play key roles in human evolution and development. PMID:26744417

  7. Genome defense against exogenous nucleic acids in eukaryotes by non-coding DNA occurs through CRISPR-like mechanisms in the cytosol and the bodyguard protection in the nucleus.


    Qiu, Guo-Hua


    In this review, the protective function of the abundant non-coding DNA in the eukaryotic genome is discussed from the perspective of genome defense against exogenous nucleic acids. Peripheral non-coding DNA has been proposed to act as a bodyguard that protects the genome and the central protein-coding sequences from ionizing radiation-induced DNA damage. In the proposed mechanism of protection, the radicals generated by water radiolysis in the cytosol and IR energy are absorbed, blocked and/or reduced by peripheral heterochromatin; then, the DNA damage sites in the heterochromatin are removed and expelled from the nucleus to the cytoplasm through nuclear pore complexes, most likely through the formation of extrachromosomal circular DNA. To strengthen this hypothesis, this review summarizes the experimental evidence supporting the protective function of non-coding DNA against exogenous nucleic acids. Based on these data, I hypothesize herein about the presence of an additional line of defense formed by small RNAs in the cytosol in addition to their bodyguard protection mechanism in the nucleus. Therefore, exogenous nucleic acids may be initially inactivated in the cytosol by small RNAs generated from non-coding DNA via mechanisms similar to the prokaryotic CRISPR-Cas system. Exogenous nucleic acids may enter the nucleus, where some are absorbed and/or blocked by heterochromatin and others integrate into chromosomes. The integrated fragments and the sites of DNA damage are removed by repetitive non-coding DNA elements in the heterochromatin and excluded from the nucleus. Therefore, the normal eukaryotic genome and the central protein-coding sequences are triply protected by non-coding DNA against invasion by exogenous nucleic acids. This review provides evidence supporting the protective role of non-coding DNA in genome defense.

  8. Differentiating the Protein Coding and Noncoding RNA Segments of DNA Using Shannon Entropy

    NASA Astrophysics Data System (ADS)

    Mazaheri, P.; Shirazi, A. H.; Saeedi, N.; Reza Jafari, G.; Sahimi, Muhammad

    The complexity of DNA sequences is evaluated in order to differentiate between protein-coding and noncoding RNA segments. The method is based on computing the Shannon entropy of the sequences. By comparing the entropy of the original sequence with that of its shuffled one, we identify the source of the difference between the two segments and their relative contributions to the sequence. To demonstrate the method, the DNA sequences of the bacterium Clostridium difficile 630 (G + C = 29.1%) and Bdellovibrio bacteriovorus (G + C = 50.6%) are analyzed, which are representatives of bacteria with unbalanced and balanced nucleotide content, respectively. It is shown that in both bacteria, regardless of nucleotide content, ΔrS — the relative difference of the two entropies — is significantly greater in protein-coding regions, when compared with noncoding RNA segments.

  9. Long non-coding RNA PARTICLE bridges histone and DNA methylation.


    O'Leary, Valerie Bríd; Hain, Sarah; Maugg, Doris; Smida, Jan; Azimzadeh, Omid; Tapio, Soile; Ovsepian, Saak Victor; Atkinson, Michael John


    PARTICLE (Gene PARTICL- 'Promoter of MAT2A-Antisense RadiaTion Induced Circulating LncRNA) expression is transiently elevated following low dose irradiation typically encountered in the workplace and from natural sources. This long non-coding RNA recruits epigenetic silencers for cis-acting repression of its neighbouring Methionine adenosyltransferase 2A gene. It now emerges that PARTICLE operates as a trans-acting mediator of DNA and histone lysine methylation. Chromatin immunoprecipitation sequencing (ChIP-seq) and immunological evidence established elevated PARTICLE expression linked to increased histone 3 lysine 27 trimethylation. Live-imaging of dbroccoli-PARTICLE revealing its dynamic association with DNA methyltransferase 1 was confirmed by flow cytometry, immunoprecipitation and direct competitive binding interaction through electrophoretic mobility shift assay. Acting as a regulatory docking platform, the long non-coding RNA PARTICLE serves to interlink epigenetic modification machineries and represents a compelling innovative component necessary for gene silencing on a global scale.

  10. Comparative genomics and evolution of conserved noncoding elements (CNE) in rainbow trout.


    Moghadam, Hooman K; Ferguson, Moira M; Danzmann, Roy G


    Recent advances in the accumulation of genetic mapping and DNA sequence information from several salmonid species support the long standing view of an autopolyploid origin of these fishes (i.e., 4R). However, the paralogy relationships of the chromosomal segments descendent from earlier polyploidization events (i.e., 2R/3R) largely remain unknown, mainly due to an unbalanced pseudogenization of paralogous genes that were once resident on the ancient duplicated segments. Inter-specific conserved noncoding elements (CNE) might hold the key in identifying these regions, if they are associated with arrays of genes that have been highly conserved in syntenic blocks through evolution. To test this hypothesis, we investigated the chromosomal positions of subset of CNE in the rainbow trout genome using a comparative genomic framework. Through a genome wide analysis, we selected 41 pairs of adjacent CNE located on various chromosomes in zebrafish and obtained their intervening, less conserved, sequence information from rainbow trout. We identified 56 distinct fragments corresponding to about 150 Kbp of sequence data that were localized to 67 different chromosomal regions in the rainbow trout genome. The genomic positions of many duplicated CNE provided additional support for some previously suggested homeologies in this species. Additionally, we now propose 40 new potential paralogous affinities by analyzing the variation in the segregation patterns of some multi-copy CNE along with the synteny association comparison using several model vertebrates. Some of these regions appear to carry signatures of the 1R, 2R or 3R duplications. A subset of these CNE markers also demonstrated high utility in identifying homologous chromosomal segments in the genomes of Atlantic salmon and Arctic charr. CNE seem to be more efficacious than coding sequences in providing insights into the ancient paralogous affinities within the vertebrate genomes. Such a feature makes these elements

  11. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.


    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  12. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.


    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  13. Life-history traits drive the evolutionary rates of mammalian coding and noncoding genomic elements

    PubMed Central

    Nikolaev, Sergey I.; Montoya-Burgos, Juan I.; Popadin, Konstantin; Parand, Leila; Margulies, Elliott H.; Antonarakis, Stylianos E.


    A comprehensive phylogenetic framework is indispensable for investigating the evolution of genomic features in mammals as a whole, and particularly in humans. Using the ENCODE sequence data, we estimated mammalian neutral evolutionary rates and selective pressures acting on conserved coding and noncoding elements. We show that neutral evolutionary rates can be explained by the generation time (GT) hypothesis. Accordingly, primates (especially humans), having longer GTs than other mammals, display slower rates of neutral evolution. The evolution of constrained elements, particularly of nonsynonymous sites, is in agreement with the expectations of the nearly neutral theory of molecular evolution. We show that rates of nonsynonymous substitutions (dN) depend on the population size of a species. The results are robust to the exclusion of hypermutable CpG prone sites. The average rate of evolution in conserved noncoding sequences (CNCs) is 1.7 times higher than in nonsynonymous sites. Despite this, CNCs evolve at similar or even lower rates than nonsynonymous sites in the majority of basal branches of the eutherian tree. This observation could be the result of an overall gradual or, alternatively, lineage-specific relaxation of CNCs. The latter hypothesis was supported by the finding that 3 of the 20 longest CNCs displayed significant relaxation of individual branches. This observation may explain why the evolution of CNCs fits the expectations of the nearly neutral theory less well than the evolution of nonsynonymous sites. PMID:18077382

  14. Rapid Degeneration of Noncoding DNA Regions Surrounding SlAP3X/Y After Recombination Suppression in the Dioecious Plant Silene latifolia

    PubMed Central

    Ishii, Kotaro; Nishiyama, Rie; Shibata, Fukashi; Kazama, Yusuke; Abe, Tomoko; Kawano, Shigeyuki


    Silene latifolia is a dioecious plant with heteromorphic XY sex chromosomes. Previous studies of sex chromosome–linked genes have suggested a gradual divergence between the X-linked and the Y-linked genes in proportion to the distance from the pseudoautosomal region. However, such a comparison has yet to be made for the noncoding regions. To better characterize the nonrecombining region of the X and Y chromosomes, we sequenced bacterial artificial chromosome clones containing the sex chromosome–linked paralogs SlAP3X and SlAP3Y, including 115 kb and 73 kb of sequences, respectively, flanking these genes. The synonymous nucleotide divergence between SlAP3X and SlAP3Y indicated that recombination stopped approximately 3.4 million years ago. Sequence homology analysis revealed the presence of six long terminal repeat retrotransposon-like elements. Using the nucleotide divergence calculated between left and right long terminal repeat sequences, insertion dates were estimated to be 0.083–1.6 million years ago, implying that all elements detected were inserted after recombination stopped. A reciprocal sequence homology search facilitated the identification of four homologous noncoding DNA regions between the X and Y chromosomes, spanning 6.7% and 10.6% of the X chromosome–derived and Y chromosome–derived sequences, respectively, investigated. Genomic Southern blotting and fluorescence in situ hybridization showed that the noncoding DNA flanking SlAP3X/Y has homology to many regions throughout the genome, regardless of whether they were homologous between the X and Y chromosomes. This finding suggests that most noncoding DNA regions rapidly lose their counterparts because of the introduction of transposable elements and indels (insertion–deletions) after recombination has stopped. PMID:24122056

  15. DNA variants in region for noncoding interfering transcript of dihydrofolate reductase gene and outcome in childhood acute lymphoblastic leukemia.


    Al-Shakfa, Fidaa; Dulucq, Stéphanie; Brukner, Ivan; Milacic, Iva; Ansari, Marc; Beaulieu, Patrick; Moghrabi, Albert; Laverdière, Caroline; Sallan, Stephen E; Silverman, Lewis B; Neuberg, Donna; Kutok, Jeffery L; Sinnett, Daniel; Krajinovic, Maja


    Dihydrofolate reductase (DHFR) is the major target of methotrexate, a key component in childhood acute lymphoblastic leukemia (ALL) treatment. We recently reported an association of DHFR promoter polymorphisms with ALL outcome. Lower event-free survival correlated with haplotype *1, defined by A(-317) and C(-1610) alleles. Haplotype *1 was also associated higher DHFR expression. Here, we analyzed adjacent 400-bp region participating in DHFR regulation as both a major promoter and a noncoding minor transcript. Six polymorphisms were identified, of which five were single nucleotide polymorphisms and one was length polymorphism composed of variable number of 9-bp elements and 9-bp insertion/deletion. Haplotype analysis including all promoter polymorphisms revealed diversification of haplotype *1 into five subtypes (*1a-*1e). DNA variations of major promoter/noncoding transcript region and haplotype *1 subtypes were subsequently analyzed for the association with ALL outcome. Lower event-free survival was associated with an A allele of G(308)A polymorphism (P = 0.02) and with *1b haplotype (P = 0.01). This association was particularly striking in high-risk patients (P = 0.001) and was subsequently confirmed in independent patient cohort (P = 0.02). Haplotype *1b was the only haplotype *1 subtype associated with higher mRNA levels. The study provides a new insight into DHFR regulatory variations predisposing to an event in ALL patients.

  16. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin


    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  17. Transposable elements: from DNA parasites to architects of metazoan evolution.


    Piskurek, Oliver; Jackson, Daniel J


    One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs). Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty.

  18. Transposable Elements: From DNA Parasites to Architects of Metazoan Evolution

    PubMed Central

    Piskurek, Oliver; Jackson, Daniel J.


    One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs). Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty. PMID:24704977

  19. Long noncoding RNA LINP1 regulates double strand DNA break repair in triple negative breast cancer

    PubMed Central

    Zhang, Youyou; He, Qun; Hu, Zhongyi; Feng, Yi; Fan, Lingling; Tang, Zhaoqing; Yuan, Jiao; Shan, Weiwei; Li, Chunsheng; Hu, Xiaowen; Tanyi, Janos L; Fan, Yi; Huang, Qihong; Montone, Kathleen; Dang, Chi V; Zhang, Lin


    Long noncoding RNAs (lncRNAs), which are transcripts that are larger than 200 nucleotides but do not appear to have protein-coding potential, play critical roles during tumorigenesis by functioning as scaffolds to regulate protein-protein, protein-DNA or protein-RNA interactions. Using a clinically guided genetic screening approach, we identified (lncRNA in Non-homologous end joining [NHEJ] pathway 1) as a lncRNA that is overexpressed in human triple-negative breast cancer. We found that LINP1 enhances double-strand DNA break repair by serving as a scaffold that links Ku80 and DNA-PKcs, thereby coordinating the NHEJ pathway. Importantly, blocking LINP1, which is regulated by the p53 and epidermal growth factor receptor (EGFR) signaling, increases sensitivity of tumor cell response to radiotherapy in breast cancer. PMID:27111890

  20. Sigma: multiple alignment of weakly-conserved non-coding DNA sequence.


    Siddharthan, Rahul


    Existing tools for multiple-sequence alignment focus on aligning protein sequence or protein-coding DNA sequence, and are often based on extensions to Needleman-Wunsch-like pairwise alignment methods. We introduce a new tool, Sigma, with a new algorithm and scoring scheme designed specifically for non-coding DNA sequence. This problem acquires importance with the increasing number of published sequences of closely-related species. In particular, studies of gene regulation seek to take advantage of comparative genomics, and recent algorithms for finding regulatory sites in phylogenetically-related intergenic sequence require alignment as a preprocessing step. Much can also be learned about evolution from intergenic DNA, which tends to evolve faster than coding DNA. Sigma uses a strategy of seeking the best possible gapless local alignments (a strategy earlier used by DiAlign), at each step making the best possible alignment consistent with existing alignments, and scores the significance of the alignment based on the lengths of the aligned fragments and a background model which may be supplied or estimated from an auxiliary file of intergenic DNA. Comparative tests of sigma with five earlier algorithms on synthetic data generated to mimic real data show excellent performance, with Sigma balancing high "sensitivity" (more bases aligned) with effective filtering of "incorrect" alignments. With real data, while "correctness" can't be directly quantified for the alignment, running the PhyloGibbs motif finder on pre-aligned sequence suggests that Sigma's alignments are superior. By taking into account the peculiarities of non-coding DNA, Sigma fills a gap in the toolbox of bioinformatics.

  1. Noncoding RNAs of trithorax response elements recruit Drosophila Ash1 to Ultrabithorax.


    Sanchez-Elsner, Tilman; Gou, Dawei; Kremmer, Elisabeth; Sauer, Frank


    Homeotic genes contain cis-regulatory trithorax response elements (TREs) that are targeted by epigenetic activators and transcribed in a tissue-specific manner. We show that the transcripts of three TREs located in the Drosophila homeotic gene Ultrabithorax (Ubx) mediate transcription activation by recruiting the epigenetic regulator Ash1 to the template TREs. TRE transcription coincides with Ubx transcription and recruitment of Ash1 to TREs in Drosophila. The SET domain of Ash1 binds all three TRE transcripts, with each TRE transcript hybridizing with and recruiting Ash1 only to the corresponding TRE in chromatin. Transgenic transcription of TRE transcripts restores recruitment of Ash1 to Ubx TREs and restores Ubx expression in Drosophila cells and tissues that lack endogenous TRE transcripts. Small interfering RNA-induced degradation of TRE transcripts attenuates Ash1 recruitment to TREs and Ubx expression, which suggests that noncoding TRE transcripts play an important role in epigenetic activation of gene expression.

  2. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis.


    Shaw, Joey; Lickey, Edgar B; Beck, John T; Farmer, Susan B; Liu, Wusheng; Miller, Jermey; Siripun, Kunsiri C; Winder, Charles T; Schilling, Edward E; Small, Randall L


    Chloroplast DNA sequences are a primary source of data for plant molecular systematic studies. A few key papers have provided the molecular systematics community with universal primer pairs for noncoding regions that have dominated the field, namely trnL-trnF and trnK/matK. These two regions have provided adequate information to resolve species relationships in some taxa, but often provide little resolution at low taxonomic levels. To obtain better phylogenetic resolution, sequence data from these regions are often coupled with other sequence data. Choosing an appropriate cpDNA region for phylogenetic investigation is difficult because of the scarcity of information about the tempo of evolutionary rates among different noncoding cpDNA regions. The focus of this investigation was to determine whether there is any predictable rate heterogeneity among 21 noncoding cpDNA regions identified as phylogenetically useful at low levels. To test for rate heterogeneity among the different cpDNA regions, we used three species from each of 10 groups representing eight major phylogenetic lineages of phanerogams. The results of this study clearly show that a survey using as few as three representative taxa can be predictive of the amount of phylogenetic information offered by a cpDNA region and that rate heterogeneity exists among noncoding cpDNA regions.

  3. Fractality and entropic scaling in the chromosomal distribution of conserved noncoding elements in the human genome.


    Polychronopoulos, Dimitris; Athanasopoulou, Labrini; Almirantis, Yannis


    Conserved non-coding elements (CNEs) are defined using various degrees of sequence identity and thresholds of minimal length. Their conservation frequently exceeds the one observed for protein-coding sequences. We explored the chromosomal distribution of different classes of CNEs in the human genome. We employed two methodologies: the scaling of block entropy and box-counting, with the aim to assess fractal characteristics of different CNE datasets. Both approaches converged to the conclusion that well-developed fractality is characteristic of elements that are either extremely conserved between species or are of ancient origin, i.e. conserved between distant organisms across evolution. Given that CNEs are often clustered around genes, we verified by appropriate gene masking that fractal-like patterns emerge even when elements found in proximity or inside genes are excluded. An evolutionary scenario is proposed, involving genomic events that might account for fractal distribution of CNEs in the human genome as indicated through numerical simulations. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. The non-coding B2 RNA binds to the DNA cleft and active site region of RNA polymerase II

    PubMed Central

    Ponicsan, Steven L.; Houel, Stephane; Old, William M.; Ahn, Natalie G.; Goodrich, James A.; Kugel, Jennifer F.


    The B2 family of short interspersed elements is transcribed into non-coding RNA by RNA polymerase III. The ~180 nt B2 RNA has been shown to potently repress mRNA transcription by binding tightly to RNA polymerase II (Pol II) and assembling with it into complexes on promoter DNA, where it keeps the polymerase from properly engaging the promoter DNA. Mammalian Pol II is a ~500 kD complex that contains 12 different protein subunits, providing many possible surfaces for interaction with B2 RNA. We found that the carboxy-terminal domain of the largest Pol II subunit was not required for B2 RNA to bind Pol II and repress transcription in vitro. To identify the surface on Pol II to which the minimal functional region of B2 RNA binds, we coupled multi-step affinity purification, reversible formaldehyde crosslinking, peptide sequencing by mass spectrometry, and analysis of peptide enrichment. The Pol II peptides most highly recovered after crosslinking to B2 RNA mapped to the DNA binding cleft and active site region of Pol II. These studies determine the location of a defined nucleic acid binding site on a large, native, multi-subunit complex and provide insight into the mechanism of transcriptional repression by B2 RNA. PMID:23416138

  5. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silencing in the C. elegans Germline.


    Frøkjær-Jensen, Christian; Jain, Nimit; Hansen, Loren; Davis, M Wayne; Li, Yongbin; Zhao, Di; Rebora, Karine; Millet, Jonathan R M; Liu, Xiao; Kim, Stuart K; Dupuy, Denis; Jorgensen, Erik M; Fire, Andrew Z


    Cells benefit from silencing foreign genetic elements but must simultaneously avoid inactivating endogenous genes. Although chromatin modifications and RNAs contribute to maintenance of silenced states, the establishment of silenced regions will inevitably reflect underlying DNA sequence and/or structure. Here, we demonstrate that a pervasive non-coding DNA feature in Caenorhabditis elegans, characterized by 10-base pair periodic An/Tn-clusters (PATCs), can license transgenes for germline expression within repressive chromatin domains. Transgenes containing natural or synthetic PATCs are resistant to position effect variegation and stochastic silencing in the germline. Among endogenous genes, intron length and PATC-character undergo dramatic changes as orthologs move from active to repressive chromatin over evolutionary time, indicating a dynamic character to the An/Tn periodicity. We propose that PATCs form the basis of a cellular immune system, identifying certain endogenous genes in heterochromatic contexts as privileged while foreign DNA can be suppressed with no requirement for a cellular memory of prior exposure.

  6. Small Open Reading Frames, Non-Coding RNAs and Repetitive Elements in Bradyrhizobium japonicum USDA 110

    PubMed Central

    Hahn, Julia; Tsoy, Olga V.; Thalmann, Sebastian; Čuklina, Jelena; Gelfand, Mikhail S.


    Small open reading frames (sORFs) and genes for non-coding RNAs are poorly investigated components of most genomes. Our analysis of 1391 ORFs recently annotated in the soybean symbiont Bradyrhizobium japonicum USDA 110 revealed that 78% of them contain less than 80 codons. Twenty-one of these sORFs are conserved in or outside Alphaproteobacteria and most of them are similar to genes found in transposable elements, in line with their broad distribution. Stabilizing selection was demonstrated for sORFs with proteomic evidence and bll1319_ISGA which is conserved at the nucleotide level in 16 alphaproteobacterial species, 79 species from other taxa and 49 other Proteobacteria. Further we used Northern blot hybridization to validate ten small RNAs (BjsR1 to BjsR10) belonging to new RNA families. We found that BjsR1 and BjsR3 have homologs outside the genus Bradyrhizobium, and BjsR5, BjsR6, BjsR7, and BjsR10 have up to four imperfect copies in Bradyrhizobium genomes. BjsR8, BjsR9, and BjsR10 are present exclusively in nodules, while the other sRNAs are also expressed in liquid cultures. We also found that the level of BjsR4 decreases after exposure to tellurite and iron, and this down-regulation contributes to survival under high iron conditions. Analysis of additional small RNAs overlapping with 3’-UTRs revealed two new repetitive elements named Br-REP1 and Br-REP2. These REP elements may play roles in the genomic plasticity and gene regulation and could be useful for strain identification by PCR-fingerprinting. Furthermore, we studied two potential toxin genes in the symbiotic island and confirmed toxicity of the yhaV homolog bll1687 but not of the newly annotated higB homolog blr0229_ISGA in E. coli. Finally, we revealed transcription interference resulting in an antisense RNA complementary to blr1853, a gene induced in symbiosis. The presented results expand our knowledge on sORFs, non-coding RNAs and repetitive elements in B. japonicum and related bacteria. PMID

  7. Multifractal detrended cross-correlation analysis of coding and non-coding DNA sequences through chaos-game representation

    NASA Astrophysics Data System (ADS)

    Pal, Mayukha; Satish, B.; Srinivas, K.; Rao, P. Madhusudana; Manimaran, P.


    We propose a new approach combining the chaos game representation and the two dimensional multifractal detrended cross correlation analysis methods to examine multifractal behavior in power law cross correlation between any pair of nucleotide sequences of unequal lengths. In this work, we analyzed the characteristic behavior of coding and non-coding DNA sequences of eight prokaryotes. The results show the presence of strong multifractal nature between coding and non-coding sequences of all data sets. We found that this integrative approach helps us to consider complete DNA sequences for characterization, and further it may be useful for classification, clustering, identification of class affiliation of nucleotide sequences etc. with high precision.

  8. Sequence polymorphism in a novel noncoding region of Pacific oyster mitochondrial DNA.


    Aranishi, Futoshi; Okimoto, Takane


    Nucleotide sequence polymorphism in a 641-bp novel major noncoding region of mitochondrial DNA (mtDNA-NC) of the Pacific oyster Crassostrea gigas was analysed for 29 cultured individuals within the Goseong population. A total of 30 variable sites were detected, and the relative frequency of nucleotide alteration was determined to be 4.68. Alterations were mostly single nucleotide substitutions. Transition, transversion, both transition and transversion, and both transversion and nucleotide deletion were observed at 18, 9, 2 and 1 sites, respectively. Among 29 specimens, 22 haplotypes were identified, and pairwise genetic diversity of haplotypes was calculated to be 0.988 from multiple sequence substitutions using the two-parameter model. A phylogenetic tree, obtained for haplotypes by the neighbor-joining method, showed a single cluster of linkages. The cluster comprised 11 haplotypes associating with 14 specimens, while the other 11 haplotypes associating with 15 specimens were scattered. This mtDNA-NC presenting a high nucleotide sequence polymorphism is a potential mtDNA control region. It therefore can serve as a genetic marker for intraspecies phylogenetic analysis of the Pacific oyster and is more useful than the less polymorphic mtDNA coding genes.

  9. Genetic evidence for conserved non-coding element function across species–the ears have it

    PubMed Central

    Turner, Eric E.; Cox, Timothy C.


    Comparison of genomic sequences from diverse vertebrate species has revealed numerous highly conserved regions that do not appear to encode proteins or functional RNAs. Often these “conserved non-coding elements,” or CNEs, can direct gene expression to specific tissues in transgenic models, demonstrating they have regulatory function. CNEs are frequently found near “developmental” genes, particularly transcription factors, implying that these elements have essential regulatory roles in development. However, actual examples demonstrating CNE regulatory functions across species have been few, and recent loss-of-function studies of several CNEs in mice have shown relatively minor effects. In this Perspectives article, we discuss new findings in “fancy” rats and Highland cattle demonstrating that function of a CNE near the Hmx1 gene is crucial for normal external ear development and when disrupted can mimic loss-of function Hmx1 coding mutations in mice and humans. These findings provide important support for conserved developmental roles of CNEs in divergent species, and reinforce the concept that CNEs should be examined systematically in the ongoing search for genetic causes of human developmental disorders in the era of genome-scale sequencing. PMID:24478720

  10. Non-extensive trends in the size distribution of coding and non-coding DNA sequences in the human genome

    NASA Astrophysics Data System (ADS)

    Oikonomou, Th.; Provata, A.


    We study the primary DNA structure of four of the most completely sequenced human chromosomes (including chromosome 19 which is the most dense in coding), using non-extensive statistics. We show that the exponents governing the spatial decay of the coding size distributions vary between 5.2 ≤r ≤5.7 for the short scales and 1.45 ≤q ≤1.50 for the large scales. On the contrary, the exponents governing the spatial decay of the non-coding size distributions in these four chromosomes, take the values 2.4 ≤r ≤3.2 for the short scales and 1.50 ≤q ≤1.72 for the large scales. These results, in particular the values of the tail exponent q, indicate the existence of correlations in the coding and non-coding size distributions with tendency for higher correlations in the non-coding DNA.

  11. EBV noncoding RNA binds nascent RNA to drive host PAX5 to viral DNA

    PubMed Central

    Lee, Nara; Moss, Walter N.; Yario, Therese A.; Steitz, Joan A.


    Summary EBER2 is an abundant nuclear noncoding RNA expressed by Epstein-Barr virus (EBV). Probing its possible chromatin localization by CHART revealed EBER2’s presence at the terminal repeats (TRs) of the latent EBV genome, overlapping previously identified binding sites for the B-cell transcription factor PAX5. EBER2 interacts with and is required for PAX5 localization to the TRs. EBER2 knockdown phenocopies PAX5 depletion in upregulating the expression of LMP2A/B and LMP1, genes nearest the TRs. Knockdown of EBER2 also decreases EBV lytic replication, underscoring the essential role of the TRs in viral replication. Recruitment of the EBER2-PAX5 complex is mediated by base-pairing between EBER2 and nascent transcripts from the TR locus. The interaction is evolutionarily conserved in the related primate herpesvirus CeHV15 despite great sequence divergence. Using base-pairing with nascent RNA to guide an interacting transcription factor to its DNA target site is a previously undescribed function for a trans-acting noncoding RNA. PMID:25662012

  12. An Oncogenic Super-Enhancer Formed Through Somatic Mutation of a Noncoding Intergenic Element

    PubMed Central

    Mansour, Marc R.; Abraham, Brian J; Anders, Lars; Berezovskaya, Alla; Gutierrez, Alejandro; Durbin, Adam D; Etchin, Julia; Lawton, Lee; Sallan, Stephen E.; Silverman, Lewis B.; Loh, Mignon L.; Hunger, Stephen P.; Sanda, Takaomi; Young, Richard A.; Look, A. Thomas


    In certain human cancers, the expression of critical oncogenes is driven from large regulatory elements, called super-enhancers, which recruit much of the cell’s transcriptional apparatus and are defined by extensive acetylation of histone H3 lysine 27 (H3K27ac). In a subset of T-cell acute lymphoblastic leukemia (T-ALL) cases, we found that heterozygous somatic mutations are acquired that introduce binding motifs for the MYB transcription factor in a precise noncoding site, which creates a super-enhancer upstream of the TAL1 oncogene. MYB binds to this new site and recruits it’s H3K27 acetylase binding partner CBP, as well as core components of a major leukemogenic transcriptional complex that contains RUNX1, GATA-3, and TAL1 itself. Additionally, most endogenous super-enhancers found in T-ALL cells are occupied by MYB and CBP, suggesting a general role for MYB in super-enhancer initiation. Thus, this study identifies a genetic mechanism responsible for the generation of oncogenic super-enhancers in malignant cells. PMID:25394790

  13. Transposable Element Insertions in Long Intergenic Non-Coding RNA Genes

    PubMed Central

    Kannan, Sivakumar; Chernikova, Diana; Rogozin, Igor B.; Poliakov, Eugenia; Managadze, David; Koonin, Eugene V.; Milanesi, Luciano


    Transposable elements (TEs) are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA) genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences (TES), followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TES in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the repeat insertion domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and, in particular, fast functional diversification, of lincRNA genes. PMID:26106594

  14. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio


    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  15. Ancient vertebrate conserved noncoding elements have been evolving rapidly in teleost fishes.


    Lee, Alison P; Kerk, Sze Yen; Tan, Yue Ying; Brenner, Sydney; Venkatesh, Byrappa


    Vertebrate genomes contain thousands of conserved noncoding elements (CNEs) that often function as tissue-specific enhancers. In this study, we have identified CNEs in human, dog, chicken, Xenopus, and four teleost fishes (zebrafish, stickleback, medaka, and fugu) using elephant shark, a cartilaginous vertebrate, as the base genome and investigated the evolution of these ancient vertebrate CNEs (aCNEs) in bony vertebrate lineages. Our analysis shows that aCNEs have been evolving at different rates in different bony vertebrate lineages. Although 78-83% of CNEs have diverged beyond recognition ("lost") in different teleost fishes, only 24% and 40% have been lost in the chicken and mammalian lineages, respectively. Relative rate tests of substitution rates in CNEs revealed that the teleost fish CNEs have been evolving at a significantly higher rate than those in other bony vertebrates. In the ray-finned fish lineage, 68% of aCNEs were lost before the divergence of the four teleosts. This implicates the "fish-specific" whole-genome duplication in the accelerated evolution and the loss of a large number of both copies of duplicated CNEs in teleost fishes. The aCNEs are rich in tissue-specific enhancers and thus many of them are likely to be evolutionarily constrained cis-regulatory elements. The rapid evolution of aCNEs might have affected the expression patterns driven by them. Transgenic zebrafish assay of some human CNE enhancers that have been lost in teleosts has indicated instances of conservation or changes in trans-acting factors between mammals and fishes.

  16. Intraspecific nucleotide sequence differences in the major noncoding region of human mitochondrial DNA.

    PubMed Central

    Horai, S; Hayasaka, K


    Nucleotide sequences of the major noncoding region of human mitochondrial DNA (mtDNA) from 95 human placentas have been determined. These sequences include at least a 482-bp-long region encompassing most of the D-loop-forming region. Comparisons of these sequences with those previously determined have revealed remarkable features of nucleotide substitutions and insertion/deletion events. The nucleotide diversity among the sequences is estimated as 1.45%, which is three- to fourfold higher than the corresponding value estimated from restriction-enzyme analysis of whole mtDNA genome. A hypervariable region has also been defined. In this 14-bp region, 17 different sequences were detected. More than 97% of the base changes are transitions. A significantly nonrandom distribution of nucleotide substitutions and sequence length variations were also noted. The phylogenetic analysis indicates that diversity among the negroids is much larger than that among the caucasoids or the mongoloids. In fact, part of the negroids first diverged from other humans in the phylogenetic tree. A striking finding in the phylogenetic analysis is that the mongoloids can be separated into two distinct groups. Divergence of part of the mongoloids follows the earliest divergence of part of the negroids. The remainder of the mongoloids subsequently diverged together with the caucasoids. This observation confirmed our earlier study, which clearly demonstrated, by the restriction-enzyme analysis, existence of two distinct groups in the Japanese. Images Figure 3 PMID:2316527

  17. Possible Role of Natural Selection in the Formation of Tandem-Repetitive Noncoding DNA

    PubMed Central

    Stephan, W.; Cho, S.


    A simulation model of sequence-dependent amplification, unequal crossing over and mutation is analyzed. This model predicts the spontaneous formation of tandem-repetitive patterns of noncoding DNA from arbitrary sequences for a wide range of parameter values. Natural selection is found to play an essential role in this self-organizing process. Natural selection which is modeled as a mechanism for controlling the length of a nucleotide string but not the sequence itself favors the formation of tandem-repetitive structures. Two measures of sequence heterogeneity, inter-repeat variability and repeat length, are analyzed in detail. For fixed mutation rate, both inter-repeat variability and repeat length are found to increase with decreasing rates of (unequal) crossing over. The results are compared with data on micro-, mini- and satellite DNAs. The properties of minisatellites and satellite DNAs resemble the simulated structures very closely. This suggests that unequal crossing over is a dominant long-range ordering force which keeps these arrays homogeneous even in regions of very low recombination rates, such as at satellite DNA loci. Our analysis also indicates that in regions of low rates of (unequal) crossing over, inter-repeat variability is maintained at a low level at the expense of much larger repeat units (multimeric repeats), which are characteristic of satellite DNA. In contrast, the microsatellite data do not fit the proposed model well, suggesting that unequal crossing over does not act on these very short tandem arrays. PMID:8138169

  18. DNA methylation patterns of protein coding genes and long noncoding RNAs in female schizophrenic patients.


    Liao, Qi; Wang, Yunliang; Cheng, Jia; Dai, Dongjun; Zhou, Xingyu; Zhang, Yuzheng; Gao, Shugui; Duan, Shiwei


    Schizophrenia (SCZ) is a complex mental disorder contributed by both genetic and epigenetic factors. Long noncoding RNAs (lncRNAs) was recently found playing an important regulatory role in mental disorders. However, little was known about the DNA methylation of lncRNAs, although numerous SCZ studies have been performed on genetic polymorphisms or epigenetic marks in protein coding genes. We presented a comprehensive genome wide DNA methylation study of both protein coding genes and lncRNAs in female patients with paranoid and undifferentiated SCZ. Using the methyl-CpG binding domain (MBD) protein-enriched genome sequencing (MBD-seq), 8,163 and 764 peaks were identified in paranoid and undifferentiated SCZ, respectively (p < 1 × 10-5). Gene ontology analysis showed that the hypermethylated regions were enriched in the genes related to neuron system and brain for both paranoid and undifferentiated SCZ (p < 0.05). Among these peaks, 121 peaks were located in gene promoter regions that might affect gene expression and influence the SCZ related pathways. Interestingly, DNA methylation of 136 and 23 known lncRNAs in Refseq database were identified in paranoid and undifferentiated SCZ, respectively. In addition, ∼20% of intergenic peaks annotated based on Refseq genes were overlapped with lncRNAs in UCSC and gencode databases. In order to show the results well for most biological researchers, we created an online database to display and visualize the information of DNA methyation peaks in both types of SCZ ( Our results showed that the aberrant DNA methylation of lncRNAs might be another important epigenetic factor for SCZ.

  19. Identification and functional modelling of DNA sequence elements of transcription.


    Werner, T


    Identification of transcriptional elements in large sequences is a very difficult task, as individual transcription elements (eg transcription factor binding sites,TF-sites) are not clearly correlated with regions exerting transcription control. However, elucidation of the molecular organisation of genomic regions responsible for the control of gene expression is an essential part of the efforts to annotate the genomic sequences, especially within the Human Genome Project. The task for bioinformatics in this context is twofold. The first step required is the approximate localisation of regulatory sequences in large anonymous DNA sequences. Once those regions are located, the second task is the identification of individual transcriptional control elements and correlation of a subset of such elements with transcriptional functions. Part of this second task can be achieved by constructing organisational models of regulatory regions like promoters which can reveal elements important for a gene class or the coexpression of a set of genes. Comparative genomics in non-coding regions (eg phylogenetic footprinting) is a very promising approach that allows identification of potential new regulatory elements which may be used in modelling approaches.

  20. DNA methylation signature of long noncoding RNA genes during human pre-implantation embryonic development

    PubMed Central

    Shen, Xiaoli; Han, Shubiao; Ye, Hong; Huang, Guoning


    DNA methylation have crucial roles in regulating the expression of developmental genes during mammalian pre-implantation embryonic development (PED). However, the DNA methylation dynamic pattern of long noncoding RNA (lncRNA) genes, one type of epigenetic regulators, in human PED have not yet been demonstrated. Here, we performed a comprehensive analysis of lncRNA genes in human PED based on public reduced representation bisulphite sequencing (RRBS) data. We observed that both lncRNA and protein-coding genes complete the major demethylation wave at the 2-cell stage, whereas the promoters of lncRNA genes show higher methylation level than protein-coding genes during PED. Similar methylation distribution was observed across the transcription start sites (TSS) of lncRNA and protein-coding genes, contrary to previous observations in tissues. Besides, not only the gamete-specific differentially methylated regions (G-DMRs) but also the embryonic developmental-specific DMRs (D-DMRs) showed more paternal bias, especially in promoter regions in lncRNA genes. Moreover, coding-non-coding gene co-expression network analysis of genes containing D-DMRs suggested that lncRNA genes involved in PED are associated with gene expression regulation through several means, such as mRNA splicing, translational regulation and mRNA catabolic. This firstly provides study provides the methylation profiles of lncRNA genes in human PED and improves the understanding of lncRNA genes involvement in human PED. PMID:28915634

  1. Low mitochondrial DNA variation among American alligators and a novel non-coding region in crocodilians.


    Glenn, Travis C; Staton, Joseph L; Vu, Alex T; Davis, Lisa M; Bremer, Jaime R Alvarado; Rhodes, Walter E; Brisbin, I Lehr; Sawyer, Roger H


    We analyzed 1317-1823 base pairs (bp) of mitochondrial DNA sequence beginning in the 5' end of cytochrome b (cyt b) and ending in the central domain of the control region for 25 American alligators (Alligator mississippiensis) and compared these to a homologous sequence from a Chinese alligator (A. sinensis). Both species share a non-coding spacer between cyt b and tRNA(Thr). Chinese alligator cyt b differs from that of the American alligator by 17.5% at the nucleotide level and 13.8% for inferred amino acids, which is consistent with their presumed ancient divergence. Only two cyt b haplotypes were detected among the 25 American alligators (693-1199 bp surveyed), with one haplotype shared among 24 individuals. One alligator from Mississippi differed from all other alligators by a single silent substitution. The control region contained only slightly more variation among the 25 American alligators, with two variable positions (624 bp surveyed), yielding three haplotypes with 22, two, and one individuals in each of these groups. Previous genetic studies examining allozymes and the proportion of variable microsatellite DNA loci also found low levels of genetic diversity in American alligators. However, in contrast with allozymes, microsatellites, and morphology, the mtDNA data shows no evidence of differentiation among populations from the extremes of the species range. These results suggest that American alligators underwent a severe population bottleneck in the late Pleistocene, resulting in nearly homogenous mtDNA among all American alligators today. Copyright 2002 Wiley-Liss, Inc.

  2. Translational efficiency of poliovirus mRNA: mapping inhibitory cis-acting elements within the 5' noncoding region.

    PubMed Central

    Pelletier, J; Kaplan, G; Racaniello, V R; Sonenberg, N


    Poliovirus mRNA contains a long 5' noncoding region of about 750 nucleotides (the exact number varies among the three virus serotypes), which contains several AUG codons upstream of the major initiator AUG. Unlike most eucaryotic mRNAs, poliovirus does not contain a m7GpppX (where X is any nucleotide) cap structure at its 5' end and is translated by a cap-independent mechanism. To study the manner by which poliovirus mRNA is expressed, we examined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. In this paper we report striking translation system-specific differences in the ability of the altered mRNAs to be translated. The results suggest the existence of an inhibitory cis-acting element(s) within the 5' noncoding region of poliovirus (between nucleotides 70 and 381) which restricts mRNA translation in reticulocyte lysate, wheat germ extract, and Xenopus oocytes, but not in HeLa cell extracts. In addition, we show that HeLa cell extracts contain a trans-acting factor(s) that overcomes this restriction. Images PMID:2836606

  3. Defining functional DNA elements in the human genome.


    Kellis, Manolis; Wold, Barbara; Snyder, Michael P; Bernstein, Bradley E; Kundaje, Anshul; Marinov, Georgi K; Ward, Lucas D; Birney, Ewan; Crawford, Gregory E; Dekker, Job; Dunham, Ian; Elnitski, Laura L; Farnham, Peggy J; Feingold, Elise A; Gerstein, Mark; Giddings, Morgan C; Gilbert, David M; Gingeras, Thomas R; Green, Eric D; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D; Myers, Richard M; Pazin, Michael J; Ren, Bing; Stamatoyannopoulos, John A; Weng, Zhiping; White, Kevin P; Hardison, Ross C


    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease.

  4. Defining functional DNA elements in the human genome

    PubMed Central

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.


    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  5. Widespread selection across coding and noncoding DNA in the pea aphid genome.


    Bickel, Ryan D; Dunham, Joseph P; Brisson, Jennifer A


    Genome-wide patterns of diversity and selection are critical measures for understanding how evolution has shaped the genome. Yet, these population genomic estimates are available for only a limited number of model organisms. Here we focus on the population genomics of the pea aphid (Acyrthosiphon pisum). The pea aphid is an emerging model system that exhibits a range of intriguing biological traits not present in classic model systems. We performed low-coverage genome resequencing of 21 clonal pea aphid lines collected from alfalfa host plants in North America to characterize genome-wide patterns of diversity and selection. We observed an excess of low-frequency polymorphisms throughout coding and noncoding DNA, which we suggest is the result of a founding event and subsequent population expansion in North America. Most gene regions showed lower levels of Tajima's D than synonymous sites, suggesting that the majority of the genome is not evolving neutrally but rather exhibits significant constraint. Furthermore, we used the pea aphid's unique manner of X-chromosome inheritance to assign genomic scaffolds to either autosomes or the X chromosome. Comparing autosomal vs. X-linked sequence variation, we discovered that autosomal genes show an excess of low frequency variants indicating that purifying selection acts more efficiently on the X chromosome. Overall, our results provide a critical first step in characterizing the genetic diversity and evolutionary pressures on an aphid genome.

  6. Identification of Putative Noncoding RNAs Among the RIKEN Mouse Full-Length cDNA Collection

    PubMed Central

    Numata, Koji; Kanai, Akio; Saito, Rintaro; Kondo, Shinji; Adachi, Jun; Wilming, Laurens G.; Hume, David A.; Hayashizaki, Yoshihide; Tomita, Masaru


    With the sequencing and annotation of genomes and transcriptomes of several eukaryotes, the importance of noncoding RNA (ncRNA)—RNA molecules that are not translated to protein products—has become more evident. A subclass of ncRNA transcripts are encoded by highly regulated, multi-exon, transcriptional units, are processed like typical protein-coding mRNAs and are increasingly implicated in regulation of many cellular functions in eukaryotes. This study describes the identification of candidate functional ncRNAs from among the RIKEN mouse full-length cDNA collection, which contains 60,770 sequences, by using a systematic computational filtering approach. We initially searched for previously reported ncRNAs and found nine murine ncRNAs and homologs of several previously described nonmouse ncRNAs. Through our computational approach to filter artifact-free clones that lack protein coding potential, we extracted 4280 transcripts as the largest-candidate set. Many clones in the set had EST hits, potential CpG islands surrounding the transcription start sites, and homologies with the human genome. This implies that many candidates are indeed transcribed in a regulated manner. Our results demonstrate that ncRNAs are a major functional subclass of processed transcripts in mammals. PMID:12819127

  7. Translating the ENCyclopedia Of DNA Elements Project findings to the clinic: ENCODE's implications for eye disease.


    Sanfilippo, Paul G; Hewitt, Alex W


    Approximately 10 years after the Human Genome Project unravelled the sequence of our DNA, the ENCyclopedia Of DNA Elements (ENCODE) Project sought to interpret it. Data from the recently completed project have shed new light on the proportion of biologically active human DNA, assigning a biochemical role to much of the sequence previously considered to be 'junk'. Many of these newly catalogued functional elements represent epigenetic mechanisms involved in regulation of gene expression. Analogous to an Ishihara plate, a gene-coding region of DNA (target dots) only comes into context when the non-coding DNA (surrounding dots) is appreciated. In this review we provide an overview of the ENCODE project, discussing the significance of these data for ophthalmic research and eye disease. The novel insights afforded by the ENCODE project will in time allow for the development of new therapeutic strategies in the management of common blinding disorders.

  8. Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region.

    PubMed Central

    Pelletier, J; Kaplan, G; Racaniello, V R; Sonenberg, N


    Poliovirus polysomal RNA is naturally uncapped, and as such, its translation must bypass any 5' cap-dependent ribosome recognition event. To elucidate the manner by which poliovirus mRNA is translated, we have determined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. We found striking differences in translatability among the altered mRNAs when assayed in mock-infected and poliovirus-infected HeLa cell extracts. The results identify a functional cis-acting element within the 5' noncoding region of the poliovirus mRNA which enables it to translate in a cap-independent fashion. The major determinant of this element maps between nucleotides 320 and 631 of the 5' end of the poliovirus mRNA. We also show that this region (320 to 631), when fused to a heterologous mRNA, can function in cis to render the mRNA cap independent in translation. Images PMID:2835660

  9. Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5' noncoding region

    SciTech Connect

    Pelletier, J.; Kaplan, G.; Racaniello, V.R.; Sonenberg, N.


    Poliovirus polysomal RNA is naturally uncapped, and as such, its translation must bypass any 5' cap-dependent ribosome recognition event. To elucidate the manner by which poliovirus mRNA is translated, the authors determined the translational efficiencies of a series of deletion mutants within the 5' noncoding region of the mRNA. They found striking differences in translatability among the altered mRNAs when assayed in mock-infected and poliovirus-infected HeLa cell extracts. The results identify a functional cis-acting element within the 5' noncoding region of the poliovirus mRNA which enables it to translate in a cap-independent fashion. The major determinant of this element maps between nucleotides 320 and 631 of the 5' end of the poliovirus mRNA. They also show that this region (320 to 631), when fused to a heterologous mRNA, can function in cis to render the mRNA cap independent in translation.

  10. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De


    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  11. Identification of evolutionarily conserved, functional noncoding elements in the promoter region of the sodium channel gene SCN8A.


    Drews, Valerie L; Shi, Kehui; de Haan, Georgius; Meisler, Miriam H


    SCN8A is a major neuronal sodium channel gene expressed throughout the central and peripheral nervous systems. Mutations of SCN8A result in movement disorders and impaired cognition. To investigate the basis for the tissue-specific expression of SCN8A, we located conserved, potentially regulatory sequences in the human, mouse, chicken, and fish genes by 5' RACE of brain RNA and genomic sequence comparison. A highly conserved 5' noncoding exon, exon 1c, is present in vertebrates from fish to mammals and appears to define the ancestral promoter region. The distance from exon 1c to the first coding exon increased tenfold during vertebrate evolution, largely by insertion of repetitive elements. The mammalian gene acquired three novel, mutually exclusive noncoding exons that are not represented in the lower vertebrates. Within the shared exon 1c, we identified four short sequence elements of 10-20 bp with an unusually high level of evolutionary conservation. The conserved elements are most similar to consensus sites for the transcription factors Pou6f1/Brn5, YY1, and REST/NRSF. Introduction of mutations into the predicted Pou6f1 and REST sites reduced promoter activity in transfected neuronal cells. A 470-bp promoter fragment containing all of the conserved elements directed brain-specific expression of the LacZ reporter in transgenic mice. Transgene expression was highest in hippocampal neurons and cerebellar Purkinje cells, consistent with the expression of the endogenous gene. The compact cluster of conserved regulatory elements in SCN8A provides a useful target for molecular analysis of neuronal gene expression.

  12. Noncoding RNA and its associated proteins as regulatory elements of the immune system.


    Turner, Martin; Galloway, Alison; Vigorito, Elena


    The rapid changes in gene expression that accompany developmental transitions, stress responses and proliferation are controlled by signal-mediated coordination of transcriptional and post-transcriptional mechanisms. In recent years, understanding of the mechanics of these processes and the contexts in which they are employed during hematopoiesis and immune challenge has increased. An important aspect of this progress is recognition of the importance of RNA-binding proteins and noncoding RNAs. These have roles in the development and function of the immune system and in pathogen life cycles, and they represent an important aspect of intracellular immunity.

  13. BioCode: Two biologically compatible Algorithms for embedding data in non-coding and coding regions of DNA

    PubMed Central


    Background In recent times, the application of deoxyribonucleic acid (DNA) has diversified with the emergence of fields such as DNA computing and DNA data embedding. DNA data embedding, also known as DNA watermarking or DNA steganography, aims to develop robust algorithms for encoding non-genetic information in DNA. Inherently DNA is a digital medium whereby the nucleotide bases act as digital symbols, a fact which underpins all bioinformatics techniques, and which also makes trivial information encoding using DNA straightforward. However, the situation is more complex in methods which aim at embedding information in the genomes of living organisms. DNA is susceptible to mutations, which act as a noisy channel from the point of view of information encoded using DNA. This means that the DNA data embedding field is closely related to digital communications. Moreover it is a particularly unique digital communications area, because important biological constraints must be observed by all methods. Many DNA data embedding algorithms have been presented to date, all of which operate in one of two regions: non-coding DNA (ncDNA) or protein-coding DNA (pcDNA). Results This paper proposes two novel DNA data embedding algorithms jointly called BioCode, which operate in ncDNA and pcDNA, respectively, and which comply fully with stricter biological restrictions. Existing methods comply with some elementary biological constraints, such as preserving protein translation in pcDNA. However there exist further biological restrictions which no DNA data embedding methods to date account for. Observing these constraints is key to increasing the biocompatibility and in turn, the robustness of information encoded in DNA. Conclusion The algorithms encode information in near optimal ways from a coding point of view, as we demonstrate by means of theoretical and empirical (in silico) analyses. Also, they are shown to encode information in a robust way, such that mutations have isolated

  14. BioCode: two biologically compatible Algorithms for embedding data in non-coding and coding regions of DNA.


    Haughton, David; Balado, Félix


    In recent times, the application of deoxyribonucleic acid (DNA) has diversified with the emergence of fields such as DNA computing and DNA data embedding. DNA data embedding, also known as DNA watermarking or DNA steganography, aims to develop robust algorithms for encoding non-genetic information in DNA. Inherently DNA is a digital medium whereby the nucleotide bases act as digital symbols, a fact which underpins all bioinformatics techniques, and which also makes trivial information encoding using DNA straightforward. However, the situation is more complex in methods which aim at embedding information in the genomes of living organisms. DNA is susceptible to mutations, which act as a noisy channel from the point of view of information encoded using DNA. This means that the DNA data embedding field is closely related to digital communications. Moreover it is a particularly unique digital communications area, because important biological constraints must be observed by all methods. Many DNA data embedding algorithms have been presented to date, all of which operate in one of two regions: non-coding DNA (ncDNA) or protein-coding DNA (pcDNA). This paper proposes two novel DNA data embedding algorithms jointly called BioCode, which operate in ncDNA and pcDNA, respectively, and which comply fully with stricter biological restrictions. Existing methods comply with some elementary biological constraints, such as preserving protein translation in pcDNA. However there exist further biological restrictions which no DNA data embedding methods to date account for. Observing these constraints is key to increasing the biocompatibility and in turn, the robustness of information encoded in DNA. The algorithms encode information in near optimal ways from a coding point of view, as we demonstrate by means of theoretical and empirical (in silico) analyses. Also, they are shown to encode information in a robust way, such that mutations have isolated effects. Furthermore, the

  15. The ENCODE (ENCyclopedia Of DNA Elements) Project.



    The ENCyclopedia Of DNA Elements (ENCODE) Project aims to identify all functional elements in the human genome sequence. The pilot phase of the Project is focused on a specified 30 megabases (approximately 1%) of the human genome sequence and is organized as an international consortium of computational and laboratory-based scientists working to develop and apply high-throughput approaches for detecting all sequence elements that confer biological function. The results of this pilot phase will guide future efforts to analyze the entire human genome.

  16. Long noncoding RNA LINP1 regulates repair of DNA double-strand breaks in triple-negative breast cancer.


    Zhang, Youyou; He, Qun; Hu, Zhongyi; Feng, Yi; Fan, Lingling; Tang, Zhaoqing; Yuan, Jiao; Shan, Weiwei; Li, Chunsheng; Hu, Xiaowen; Tanyi, Janos L; Fan, Yi; Huang, Qihong; Montone, Kathleen; Dang, Chi V; Zhang, Lin


    Long noncoding RNAs (lncRNAs) play critical roles during tumorigenesis by functioning as scaffolds that regulate protein-protein, protein-DNA or protein-RNA interactions. Using a clinically guided genetic screening approach, we identified lncRNA in nonhomologous end joining (NHEJ) pathway 1 (LINP1), which is overexpressed in human triple-negative breast cancer. We found that LINP1 enhances repair of DNA double-strand breaks by serving as a scaffold linking Ku80 and DNA-PKcs, thereby coordinating the NHEJ pathway. Importantly, blocking LINP1, which is regulated by p53 and epidermal growth factor receptor (EGFR) signaling, increases the sensitivity of the tumor-cell response to radiotherapy in breast cancer.

  17. DNA methylation patterns of protein-coding genes and long non-coding RNAs in males with schizophrenia.


    Liao, Qi; Wang, Yunliang; Cheng, Jia; Dai, Dongjun; Zhou, Xingyu; Zhang, Yuzheng; Li, Jinfeng; Yin, Honglei; Gao, Shugui; Duan, Shiwei


    Schizophrenia (SCZ) is one of the most complex mental illnesses affecting ~1% of the population worldwide. SCZ pathogenesis is considered to be a result of genetic as well as epigenetic alterations. Previous studies have aimed to identify the causative genes of SCZ. However, DNA methylation of long non-coding RNAs (lncRNAs) involved in SCZ has not been fully elucidated. In the present study, a comprehensive genome-wide analysis of DNA methylation was conducted using samples from two male patients with paranoid and undifferentiated SCZ, respectively. Methyl-CpG binding domain protein-enriched genome sequencing was used. In the two patients with paranoid and undifferentiated SCZ, 1,397 and 1,437 peaks were identified, respectively. Bioinformatic analysis demonstrated that peaks were enriched in protein-coding genes, which exhibited nervous system and brain functions. A number of these peaks in gene promoter regions may affect gene expression and, therefore, influence SCZ-associated pathways. Furthermore, 7 and 20 lncRNAs, respectively, in the Refseq database were hypermethylated. According to the lncRNA dataset in the NONCODE database, ~30% of intergenic peaks overlapped with novel lncRNA loci. The results of the present study demonstrated that aberrant hypermethylation of lncRNA genes may be an important epigenetic factor associated with SCZ. However, further studies using larger sample sizes are required.

  18. The non-coding B2 RNA binds to the DNA cleft and active-site region of RNA polymerase II.


    Ponicsan, Steven L; Houel, Stephane; Old, William M; Ahn, Natalie G; Goodrich, James A; Kugel, Jennifer F


    The B2 family of short interspersed elements is transcribed into non-coding RNA by RNA polymerase III. The ~180-nt B2 RNA has been shown to potently repress mRNA transcription by binding tightly to RNA polymerase II (Pol II) and assembling with it into complexes on promoter DNA, where it keeps the polymerase from properly engaging the promoter DNA. Mammalian Pol II is an ~500-kDa complex that contains 12 different protein subunits, providing many possible surfaces for interaction with B2 RNA. We found that the carboxy-terminal domain of the largest Pol II subunit was not required for B2 RNA to bind Pol II and repress transcription in vitro. To identify the surface on Pol II to which the minimal functional region of B2 RNA binds, we coupled multi-step affinity purification, reversible formaldehyde cross-linking, peptide sequencing by mass spectrometry, and analysis of peptide enrichment. The Pol II peptides most highly recovered after cross-linking to B2 RNA mapped to the DNA binding cleft and active-site region of Pol II. These studies determine the location of a defined nucleic acid binding site on a large, native, multi-subunit complex and provide insight into the mechanism of transcriptional repression by B2 RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. A molecular genetic analysis of Eragrostis tef (Zucc.) Trotter: non-coding regions of chloroplast DNA, 18S rDNA and the transcription factor VP1.


    Espelund, M; Bekele, E; Holst-Jensen, A; Jakobsen, K S; Nordal, I


    The non-coding chloroplast DNA sequences of the trnL (UAA) intron and the trnL-trnF (GAA) intergeneric spacer (IGS), the coding sequences of nuclear 18S rDNA, and the transcription factor Vp1 of the cereal tef (Eragrostis tef (Zucc.) Trotter) were studied. No intraspecific variation was found among the 6 studied tef varieties. However, the study displayed that Eragrostis tef has a number of unique traits compared to other grasses. Phylogenetic analysis of the chloroplast DNA gave three grass clades, joining Eragrostis with sorghum and maize in one. In the analysis of the 18S rDNA sequences, the three grass species were joined in a monophyletic trichotomy in the cladogram, in which maize is the most divergent, rice the least and tef intermediate. The Vp1 is highly conserved. The Vp1 phylogeny showed that the tef Vp1-sequence is the hitherto most divergent Vp1-sequence reported from a grass.

  20. Conformational Diversity of Single-Stranded DNA from Bacterial Repetitive Extragenic Palindromes: Implications for the DNA Recognition Elements of Transposases

    PubMed Central

    Charnavets, Tatsiana; Nunvar, Jaroslav; Nečasová, Iva; Völker, Jens; Breslauer, Kenneth J; Schneider, Bohdan


    Repetitive extragenic palindrome (REP)—associated tyrosine transposase enzymes (RAYTs) bind REP DNA domains and catalyze their cleavage. Genomic sequence analyses identify potential noncoding REP sequences associated with RAYT-encoding genes. To probe the conformational space of potential RAYT DNA binding domains, we report here spectroscopic and calorimetric measurements that detect and partially characterize the solution conformational heterogeneity of REP oligonucleotides from six bacterial species. Our data reveal most of these REP oligonucleotides adopt multiple conformations, suggesting that RAYTs confront a landscape of potential DNA substrates in dynamic equilibrium that could be selected, enriched, and/or induced via differential binding. Thus, the transposase-bound DNA motif may not be the predominant conformation of the isolated REP domain. Intriguingly, for several REPs, the circular dichroism spectra suggest guanine tetraplexes as potential alternative or additional RAYT recognition elements, an observation consistent with these REP domains being highly nonrandom, with tetraplex-favoring 5′-G and 3′-C-rich segments. In fact, the conformational heterogeneity of REP domains detected and reported here, including the formation of noncanonical DNA secondary structures, may reflect a general feature required for recognition by RAYT transposases. Based on our biophysical data, we propose guanine tetraplexes as an additional DNA recognition element for binding by RAYT transposase enzymes. © 2015 Wiley Periodicals, Inc. Biopolymers 103: 585–596, 2015. PMID:25951997

  1. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    PubMed Central

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong


    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity. PMID:26472689

  2. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    NASA Astrophysics Data System (ADS)

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong


    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity.

  3. The effect of non-coding DNA variations on P53 and cMYC competitive inhibition at cis-overlapping motifs.


    Kin, Katherine; Chen, Xi; Gonzalez-Garay, Manuel; Fakhouri, Walid D


    Non-coding DNA variations play a critical role in increasing the risk for development of common complex diseases, and account for the majority of SNPs highly associated with cancer. However, it remains a challenge to identify etiologic variants and to predict their pathological effects on target gene expression for clinical purposes. Cis-overlapping motifs (COMs) are elements of enhancer regions that impact gene expression by enabling competitive binding and switching between transcription factors. Mutations within COMs are especially important when the involved transcription factors have opposing effects on gene regulation, like P53 tumor suppressor and cMYC proto-oncogene. In this study, genome-wide analysis of ChIP-seq data from human cancer and mouse embryonic cells identified a significant number of putative regulatory elements with signals for both P53 and cMYC. Each co-occupied element contains, on average, two COMs, and one common SNP every two COMs. Gene ontology of predicted target genes for COMs showed that the majority are involved in DNA damage, apoptosis, cell cycle regulation, and RNA processing. EMSA results showed that both cMYC and P53 bind to cis-overlapping motifs within a ChIP-seq co-occupied region in Chr12. In vitro functional analysis of selected co-occupied elements verified enhancer activity, and also showed that the occurrence of SNPs within three COMs significantly altered enhancer activity. We identified a list of COM-associated functional SNPs that are in close proximity to SNPs associated with common diseases in large population studies. These results suggest a potential molecular mechanism to identify etiologic regulatory mutations associated with common diseases.

  4. Transposable Elements: No More 'Junk DNA'.


    Kim, Yun-Ji; Lee, Jungnam; Han, Kyudong


    Since the advent of whole-genome sequencing, transposable elements (TEs), just thought to be 'junk' DNA, have been noticed because of their numerous copies in various eukaryotic genomes. Many studies about TEs have been conducted to discover their functions in their host genomes. Based on the results of those studies, it has been generally accepted that they have a function to cause genomic and genetic variations. However, their infinite functions are not fully elucidated. Through various mechanisms, including de novo TE insertions, TE insertion-mediated deletions, and recombination events, they manipulate their host genomes. In this review, we focus on Alu, L1, human endogenous retrovirus, and short interspersed element/variable number of tandem repeats/Alu (SVA) elements and discuss how they have affected primate genomes, especially the human and chimpanzee genomes, since their divergence.

  5. Differential DNA methylation profiles of coding and non-coding genes define hippocampal sclerosis in human temporal lobe epilepsy

    PubMed Central

    Miller-Delaney, Suzanne F.C.; Bryan, Kenneth; Das, Sudipto; McKiernan, Ross C.; Bray, Isabella M.; Reynolds, James P.; Gwinn, Ryder; Stallings, Raymond L.


    Temporal lobe epilepsy is associated with large-scale, wide-ranging changes in gene expression in the hippocampus. Epigenetic changes to DNA are attractive mechanisms to explain the sustained hyperexcitability of chronic epilepsy. Here, through methylation analysis of all annotated C-phosphate-G islands and promoter regions in the human genome, we report a pilot study of the methylation profiles of temporal lobe epilepsy with or without hippocampal sclerosis. Furthermore, by comparative analysis of expression and promoter methylation, we identify methylation sensitive non-coding RNA in human temporal lobe epilepsy. A total of 146 protein-coding genes exhibited altered DNA methylation in temporal lobe epilepsy hippocampus (n = 9) when compared to control (n = 5), with 81.5% of the promoters of these genes displaying hypermethylation. Unique methylation profiles were evident in temporal lobe epilepsy with or without hippocampal sclerosis, in addition to a common methylation profile regardless of pathology grade. Gene ontology terms associated with development, neuron remodelling and neuron maturation were over-represented in the methylation profile of Watson Grade 1 samples (mild hippocampal sclerosis). In addition to genes associated with neuronal, neurotransmitter/synaptic transmission and cell death functions, differential hypermethylation of genes associated with transcriptional regulation was evident in temporal lobe epilepsy, but overall few genes previously associated with epilepsy were among the differentially methylated. Finally, a panel of 13, methylation-sensitive microRNA were identified in temporal lobe epilepsy including MIR27A, miR-193a-5p (MIR193A) and miR-876-3p (MIR876), and the differential methylation of long non-coding RNA documented for the first time. The present study therefore reports select, genome-wide DNA methylation changes in human temporal lobe epilepsy that may contribute to the molecular architecture of the epileptic brain. PMID

  6. The long non-coding RNA GAS5 regulates transforming growth factor β (TGF-β)-induced smooth muscle cell differentiation via RNA Smad-binding elements.


    Tang, Rui; Zhang, Gui; Wang, Yung-Chun; Mei, Xiaohan; Chen, Shi-You


    Smooth muscle cell (SMC) differentiation is essential for vascular development, and TGF-β signaling plays a critical role in this process. Although long non-coding RNAs (lncRNAs) regulate various cellular events, their functions in SMC differentiation remain largely unknown. Here, we demonstrate that the lncRNA growth arrest-specific 5 (GAS5) suppresses TGF-β/Smad3 signaling in smooth muscle cell differentiation of mesenchymal progenitor cells. We found that forced expression of GAS5 blocked, but knockdown of GAS5 increased, the expression of SMC contractile proteins. Mechanistically, GAS5 competitively bound Smad3 protein via multiple RNA Smad-binding elements (rSBEs), which prevented Smad3 from binding to SBE DNA in TGF-β-responsive SMC gene promoters, resulting in suppression of SMC marker gene transcription and, consequently, in inhibition of TGF-β/Smad3-mediated SMC differentiation. Importantly, other lncRNAs or artificially synthesized RNA molecules that contained rSBEs also effectively inhibited TGF-β/Smad3 signaling, suggesting that lncRNA-rSBE may be a general mechanism used by cells to fine-tune Smad3 activity in both basal and TGF-β-stimulated states. Taken together, our results have uncovered an lncRNA-based mechanism that modulates TGF-β/Smad3 signaling during SMC differentiation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. A strand-specific switch in noncoding transcription switches the function of a Polycomb/Trithorax response element

    PubMed Central

    Trupke, Johanna; Okulski, Helena; Altmutter, Christina; Ruge, Frank; Boidol, Bernd; Kubicek, Stefan; Schmauss, Gerald; Aumayr, Karin; Ruf, Marius; Pospisilik, Andrew; Dimond, Andrew; Senergin, Hasene Basak; Vargas, Marcus L.; Simon, Jeffrey A.; Ringrose, Leonie


    Polycomb/Trithorax response elements (PRE/TREs) can switch their function reversibly between silencing and activation, by mechanisms that are poorly understood. Here we show that a switch in forward and reverse noncoding transcription from the Drosophila vestigial (vg) PRE/TRE switches the status of the element between silencing (induced by the forward strand) and activation (induced by the reverse strand). In vitro, both ncRNAs inhibit PRC2 histone methyltransferase activity, but in vivo only the reverse strand binds PRC2. Over-expression of the reverse strand evicts PRC2 from chromatin and inhibits its enzymatic activity. We propose that interactions of RNAs with PRC2 are differentially regulated in vivo, allowing regulated inhibition of local PRC2 activity. Genome-wide analysis shows that strand switching of ncRNAs occurs at several hundred PcG binding sites in fly and vertebrate genomes. This work identifies a novel and potentially widespread class of PRE/TREs that switch function by switching the direction of ncRNA transcription. PMID:25108384

  8. A novel non-coding RNA lncRNA-JADE connects DNA damage signalling to histone H4 acetylation.


    Wan, Guohui; Hu, Xiaoxiao; Liu, Yunhua; Han, Cecil; Sood, Anil K; Calin, George A; Zhang, Xinna; Lu, Xiongbin


    A prompt and efficient DNA damage response (DDR) eliminates the detrimental effects of DNA lesions in eukaryotic cells. Basic and preclinical studies suggest that the DDR is one of the primary anti-cancer barriers during tumorigenesis. The DDR involves a complex network of processes that detect and repair DNA damage, in which long non-coding RNAs (lncRNAs), a new class of regulatory RNAs, may play an important role. In the current study, we identified a novel lncRNA, lncRNA-JADE, that is induced after DNA damage in an ataxia-telangiectasia mutated (ATM)-dependent manner. LncRNA-JADE transcriptionally activates Jade1, a key component in the HBO1 (human acetylase binding to ORC1) histone acetylation complex. Consequently, lncRNA-JADE induces histone H4 acetylation in the DDR. Markedly higher levels of lncRNA-JADE were observed in human breast tumours in comparison with normal breast tissues. Knockdown of lncRNA-JADE significantly inhibited breast tumour growth in vivo. On the basis of these results, we propose that lncRNA-JADE is a key functional link that connects the DDR to histone H4 acetylation, and that dysregulation of lncRNA-JADE may contribute to breast tumorigenesis.

  9. A novel non-coding RNA lncRNA-JADE connects DNA damage signalling to histone H4 acetylation

    PubMed Central

    Wan, Guohui; Hu, Xiaoxiao; Liu, Yunhua; Han, Cecil; Sood, Anil K; Calin, George A; Zhang, Xinna; Lu, Xiongbin


    A prompt and efficient DNA damage response (DDR) eliminates the detrimental effects of DNA lesions in eukaryotic cells. Basic and preclinical studies suggest that the DDR is one of the primary anti-cancer barriers during tumorigenesis. The DDR involves a complex network of processes that detect and repair DNA damage, in which long non-coding RNAs (lncRNAs), a new class of regulatory RNAs, may play an important role. In the current study, we identified a novel lncRNA, lncRNA-JADE, that is induced after DNA damage in an ataxia-telangiectasia mutated (ATM)-dependent manner. LncRNA-JADE transcriptionally activates Jade1, a key component in the HBO1 (human acetylase binding to ORC1) histone acetylation complex. Consequently, lncRNA-JADE induces histone H4 acetylation in the DDR. Markedly higher levels of lncRNA-JADE were observed in human breast tumours in comparison with normal breast tissues. Knockdown of lncRNA-JADE significantly inhibited breast tumour growth in vivo. On the basis of these results, we propose that lncRNA-JADE is a key functional link that connects the DDR to histone H4 acetylation, and that dysregulation of lncRNA-JADE may contribute to breast tumorigenesis. PMID:24097061

  10. Biological function of Foot-and-mouth disease virus non-structural proteins and non-coding elements.


    Gao, Yuan; Sun, Shi-Qi; Guo, Hui-Chen


    Foot-and-mouth disease virus (FMDV) represses host translation machinery, blocks protein secretion, and cleaves cellular proteins associated with signal transduction and the innate immune response to infection. Non-structural proteins (NSPs) and non-coding elements (NCEs) of FMDV play a critical role in these biological processes. The FMDV virion consists of capsid and nucleic acid. The virus genome is a positive single stranded RNA and encodes a single long open reading frame (ORF) flanked by a long structured 5'-untranslated region (5'-UTR) and a short 3'-UTR. The ORF is translated into a polypeptide chain and processed into four structural proteins (VP1, VP2, VP3, and VP4), 10 NSPs (L(pro), 2A, 2B, 2C, 3A, 3B1-3, 3C(pro), and 3D(pol)), and some cleavage intermediates. In the past decade, an increasing number of studies have begun to focus on the molecular pathogenesis of FMDV NSPs and NCEs. This review collected recent research progress on the biological functions of these NSPs and NCEs on the replication and host cellular regulation of FMDV to understand the molecular mechanism of host-FMDV interactions and provide perspectives for antiviral strategy and development of novel vaccines.

  11. Catarrhine phylogeny: noncoding DNA evidence for a diphyletic origin of the mangabeys and for a human-chimpanzee clade.


    Page, S L; Goodman, M


    Maximum-parsimony and maximum-likelihood analyses of two of the serum albumin gene's intron sequences from 24 catarrhines (17 cercopithecid and 7 hominid) and 3 platyrrhines (an outgroup to the catarrhines) yielded results on catarrhine phylogeny that are congruent with those obtained with noncoding sequences of the gamma(1)-gamma(2) globin gene genomic region, using only those flanking and intergenic gamma sequences that in their history were not involved in gene conversion. A data set that combined in a tandem alignment these two sets of noncoding DNA orthologues from the two unlinked nuclear genomic loci yielded the following confirmatory results both on the course of cladistic branchings (the divisions in a cladistic classification of higher ranking taxa into subordinate taxa) and on the ages of the taxa (each taxon representing a clade). The cercopithecid branch of catarrhines, at approximately 14 Ma (mega annum) divided into Colobini (the leaf-eating Old World monkeys) and Cercopithecini (the cheek-pouched Old World monkeys). At approximately 10-9 Ma, Colobini divided into an African clade, Colobina, and an Asian clade, Presbytina; similarly at this time level, Cercopithecini divided into Cercopithecina (the guenons, patas, and green monkeys) and Papionina. At approximately 7 Ma, Papionina divided into Macaca, Cercocebus, and Papio. At approximately 5 Ma, Cercocebus divided subgenerically into C. (Cercocebus) for terrestrial mangabeys and C. (Mandrillus) for drills and mandrills, while at approximately 4 Ma Papio divided subgenerically into P. (Locophocebus) for arboreal mangabeys, P. (Theropithecus) for gelada baboons, and P. (Papio) for hamadryas baboons. In turn, the hominid branch of catarrhines at approximately 18 Ma divided into Hylobatini (gibbons and siamangs) and Hominini; at approximately 14 Ma, Hominini divided into Pongina (orangutans) and Hominina; at approximately 7 Ma, Hominina divided into Gorilla and Homo; and at approximately 6-5 Ma, Homo

  12. Differential DNA methylation profiles of coding and non-coding genes define hippocampal sclerosis in human temporal lobe epilepsy.


    Miller-Delaney, Suzanne F C; Bryan, Kenneth; Das, Sudipto; McKiernan, Ross C; Bray, Isabella M; Reynolds, James P; Gwinn, Ryder; Stallings, Raymond L; Henshall, David C


    Temporal lobe epilepsy is associated with large-scale, wide-ranging changes in gene expression in the hippocampus. Epigenetic changes to DNA are attractive mechanisms to explain the sustained hyperexcitability of chronic epilepsy. Here, through methylation analysis of all annotated C-phosphate-G islands and promoter regions in the human genome, we report a pilot study of the methylation profiles of temporal lobe epilepsy with or without hippocampal sclerosis. Furthermore, by comparative analysis of expression and promoter methylation, we identify methylation sensitive non-coding RNA in human temporal lobe epilepsy. A total of 146 protein-coding genes exhibited altered DNA methylation in temporal lobe epilepsy hippocampus (n = 9) when compared to control (n = 5), with 81.5% of the promoters of these genes displaying hypermethylation. Unique methylation profiles were evident in temporal lobe epilepsy with or without hippocampal sclerosis, in addition to a common methylation profile regardless of pathology grade. Gene ontology terms associated with development, neuron remodelling and neuron maturation were over-represented in the methylation profile of Watson Grade 1 samples (mild hippocampal sclerosis). In addition to genes associated with neuronal, neurotransmitter/synaptic transmission and cell death functions, differential hypermethylation of genes associated with transcriptional regulation was evident in temporal lobe epilepsy, but overall few genes previously associated with epilepsy were among the differentially methylated. Finally, a panel of 13, methylation-sensitive microRNA were identified in temporal lobe epilepsy including MIR27A, miR-193a-5p (MIR193A) and miR-876-3p (MIR876), and the differential methylation of long non-coding RNA documented for the first time. The present study therefore reports select, genome-wide DNA methylation changes in human temporal lobe epilepsy that may contribute to the molecular architecture of the epileptic brain. © The

  13. Natural selection on coding and noncoding DNA sequences is associated with virulence genes in a plant pathogenic fungus.


    Rech, Gabriel E; Sanz-Martín, José M; Anisimova, Maria; Sukno, Serenella A; Thon, Michael R


    Natural selection leaves imprints on DNA, offering the opportunity to identify functionally important regions of the genome. Identifying the genomic regions affected by natural selection within pathogens can aid in the pursuit of effective strategies to control diseases. In this study, we analyzed genome-wide patterns of selection acting on different classes of sequences in a worldwide sample of eight strains of the model plant-pathogenic fungus Colletotrichum graminicola. We found evidence of selective sweeps, balancing selection, and positive selection affecting both protein-coding and noncoding DNA of pathogenicity-related sequences. Genes encoding putative effector proteins and secondary metabolite biosynthetic enzymes show evidence of positive selection acting on the coding sequence, consistent with an Arms Race model of evolution. The 5' untranslated regions (UTRs) of genes coding for effector proteins and genes upregulated during infection show an excess of high-frequency polymorphisms likely the consequence of balancing selection and consistent with the Red Queen hypothesis of evolution acting on these putative regulatory sequences. Based on the findings of this work, we propose that even though adaptive substitutions on coding sequences are important for proteins that interact directly with the host, polymorphisms in the regulatory sequences may confer flexibility of gene expression in the virulence processes of this important plant pathogen.

  14. Natural Selection on Coding and Noncoding DNA Sequences Is Associated with Virulence Genes in a Plant Pathogenic Fungus

    PubMed Central

    Rech, Gabriel E.; Sanz-Martín, José M.; Anisimova, Maria; Sukno, Serenella A.; Thon, Michael R.


    Natural selection leaves imprints on DNA, offering the opportunity to identify functionally important regions of the genome. Identifying the genomic regions affected by natural selection within pathogens can aid in the pursuit of effective strategies to control diseases. In this study, we analyzed genome-wide patterns of selection acting on different classes of sequences in a worldwide sample of eight strains of the model plant-pathogenic fungus Colletotrichum graminicola. We found evidence of selective sweeps, balancing selection, and positive selection affecting both protein-coding and noncoding DNA of pathogenicity-related sequences. Genes encoding putative effector proteins and secondary metabolite biosynthetic enzymes show evidence of positive selection acting on the coding sequence, consistent with an Arms Race model of evolution. The 5′ untranslated regions (UTRs) of genes coding for effector proteins and genes upregulated during infection show an excess of high-frequency polymorphisms likely the consequence of balancing selection and consistent with the Red Queen hypothesis of evolution acting on these putative regulatory sequences. Based on the findings of this work, we propose that even though adaptive substitutions on coding sequences are important for proteins that interact directly with the host, polymorphisms in the regulatory sequences may confer flexibility of gene expression in the virulence processes of this important plant pathogen. PMID:25193312

  15. A new method for species identification via protein-coding and non-coding DNA barcodes by combining machine learning with bioinformatic methods.


    Zhang, Ai-bing; Feng, Jie; Ward, Robert D; Wan, Ping; Gao, Qiang; Wu, Jun; Zhao, Wei-zhong


    Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI) region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS) genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF) to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish) and two representing non-coding ITS barcodes (rust fungi and brown algae). Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ) and Maximum likelihood (ML) methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI) of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40%) for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37%) for 1094 brown algae queries, both using ITS barcodes.

  16. Small RNAs, DNA methylation and transposable elements in wheat

    PubMed Central


    Background More than 80% of the wheat genome is composed of transposable elements (TEs). Since active TEs can move to different locations and potentially impose a significant mutational load, their expression is suppressed in the genome via small non-coding RNAs (sRNAs). sRNAs guide silencing of TEs at the transcriptional (mainly 24-nt sRNAs) and post-transcriptional (mainly 21-nt sRNAs) levels. In this study, we report the distribution of these two types of sRNAs among the different classes of wheat TEs, the regions targeted within the TEs, and their impact on the methylation patterns of the targeted regions. Results We constructed an sRNA library from hexaploid wheat and developed a database that included our library and three other publicly available sRNA libraries from wheat. For five completely-sequenced wheat BAC contigs, most perfectly matching sRNAs represented TE sequences, suggesting that a large fraction of the wheat sRNAs originated from TEs. An analysis of all wheat TEs present in the Triticeae Repeat Sequence database showed that sRNA abundance was correlated with the estimated number of TEs within each class. Most of the sRNAs perfectly matching miniature inverted repeat transposable elements (MITEs) belonged to the 21-nt class and were mainly targeted to the terminal inverted repeats (TIRs). In contrast, most of the sRNAs matching class I and class II TEs belonged to the 24-nt class and were mainly targeted to the long terminal repeats (LTRs) in the class I TEs and to the terminal repeats in CACTA transposons. An analysis of the mutation frequency in potentially methylated sites revealed a three-fold increase in TE mutation frequency relative to intron and untranslated genic regions. This increase is consistent with wheat TEs being preferentially methylated, likely by sRNA targeting. Conclusions Our study examines the wheat epigenome in relation to known TEs. sRNA-directed transcriptional and post-transcriptional silencing plays important roles in

  17. Study characterizes long non-coding RNA’s response to DNA damage in colon cancer cells | Center for Cancer Research

    Researchers led by Ashish Lal, Ph.D., Investigator in the Genetics Branch, have shown that when the DNA in human colon cancer cells is damaged, a long non-coding RNA (lncRNA) regulates the expression of genes that halt growth, which allows the cells to repair the damage and promote survival. Their findings suggest an important pro-survival function of a lncRNA in cancer cells.  Read more...

  18. Fact or fiction: updates on how protein-coding genes might emerge de novo from previously non-coding DNA.


    Schmitz, Jonathan F; Bornberg-Bauer, Erich


    Over the last few years, there has been an increasing amount of evidence for the de novo emergence of protein-coding genes, i.e. out of non-coding DNA. Here, we review the current literature and summarize the state of the field. We focus specifically on open questions and challenges in the study of de novo protein-coding genes such as the identification and verification of de novo-emerged genes. The greatest obstacle to date is the lack of high-quality genomic data with very short divergence times which could help precisely pin down the location of origin of a de novo gene. We conclude that, while there is plenty of evidence from a genetics perspective, there is a lack of functional studies of bona fide de novo genes and almost no knowledge about protein structures and how they come about during the emergence of de novo protein-coding genes. We suggest that future studies should concentrate on the functional and structural characterization of de novo protein-coding genes as well as the detailed study of the emergence of functional de novo protein-coding genes.

  19. A non-coding plastid DNA phylogeny of Asian Begonia (Begoniaceae): evidence for morphological homoplasy and sectional polyphyly.


    Thomas, D C; Hughes, M; Phutthai, T; Rajbhandary, S; Rubite, R; Ardi, W H; Richardson, J E


    Maximum likelihood and Bayesian analyses of non-coding plastid DNA sequence data based on a broad sampling of all major Asian Begonia sections (ndhA intron, ndhF-rpl32 spacer, rpl32-trnL spacer, 3977 aligned characters, 84 species) were used to reconstruct the phylogeny of Asian Begonia and to test the monophyly of major Asian Begonia sections. Ovary and fruit characters which are crucial in current sectional circumscriptions were mapped on the phylogeny to assess their utility in infrageneric classifications. The results indicate that the strong systematic emphasis placed on single, homoplasious characters such as undivided placenta lamellae (section Reichenheimia) and fleshy pericarps (section Sphenanthera), and the recognition of sections primarily based on a suite of plesiomorphic characters including three-locular ovaries with axillary, bilamellate placentae and dry, dehiscent pericarps (section Diploclinium), has resulted in the circumscription of several polyphyletic sections. Moreover, sections Platycentrum and Petermannia were recovered as paraphyletic. Because of the homoplasy of systematically important characters, current classifications have a certain diagnostic, but only poor predictive value. The presented phylogeny provides for the first time a reasonably resolved and supported phylogenetic framework for Asian Begonia which has the power to inform future taxonomic, biogeographic and evolutionary studies.

  20. Fact or fiction: updates on how protein-coding genes might emerge de novo from previously non-coding DNA

    PubMed Central

    Schmitz, Jonathan F; Bornberg-Bauer, Erich


    Over the last few years, there has been an increasing amount of evidence for the de novo emergence of protein-coding genes, i.e. out of non-coding DNA. Here, we review the current literature and summarize the state of the field. We focus specifically on open questions and challenges in the study of de novo protein-coding genes such as the identification and verification of de novo-emerged genes. The greatest obstacle to date is the lack of high-quality genomic data with very short divergence times which could help precisely pin down the location of origin of a de novo gene. We conclude that, while there is plenty of evidence from a genetics perspective, there is a lack of functional studies of bona fide de novo genes and almost no knowledge about protein structures and how they come about during the emergence of de novo protein-coding genes. We suggest that future studies should concentrate on the functional and structural characterization of de novo protein-coding genes as well as the detailed study of the emergence of functional de novo protein-coding genes. PMID:28163910

  1. A Note on Zipf’s Law, Natural Languages, and Noncoding DNA Regions.

    DTIC Science & Technology


    the lower 1 Indeed, as N. Chomsky points out (p.c.), if we take a col- lection of English sentences and define "words" by taking the strings...words in written English . American Journal of Psychology, 71, 209-218. [6] Mandelbrot, B. 1961. Word frequencies and Marko- vian models of discourse...similarity between DNA’s " gramar " and natural language grammars, just as the observation of exact Zipf-like behavior cannot distinguish between the

  2. Altered DNA Methylation of Long Noncoding RNA H19 in Calcific Aortic Valve Disease Promotes Mineralization by Silencing NOTCH1.


    Hadji, Fayez; Boulanger, Marie-Chloé; Guay, Simon-Pierre; Gaudreault, Nathalie; Amellah, Soumiya; Mkannez, Guada; Bouchareb, Rihab; Marchand, Joël Tremblay; Nsaibia, Mohamed Jalloul; Guauque-Olarte, Sandra; Pibarot, Philippe; Bouchard, Luigi; Bossé, Yohan; Mathieu, Patrick


    Calcific aortic valve disease is characterized by an abnormal mineralization of the aortic valve. Osteogenic activity in the aortic valve is under the control of NOTCH1, which regulates the expression of key pro-osteogenic genes such as RUNX2 and BMP2. Long noncoding RNAs (lncRNAs) may reprogram cells by altering the gene expression pattern. Multidimensional genomic profiling was performed in human aortic valves to document the expression of lncRNAs and the DNA methylation pattern in calcific aortic valve disease. In-depth functional assays were carried out to document the impact of lncRNA on the mineralization of the aortic valve. We documented that lncRNA H19 (H19) was increased in calcific aortic valve disease. Hypomethylation of the promoter region was observed in mineralized aortic valves and was inversely associated with H19 expression. Knockdown and overexpression experiments showed that H19 induces a strong osteogenic phenotype by altering the NOTCH1 pathway. Gene promoter analyses showed that H19 silenced NOTCH1 by preventing the recruitment of p53 to its promoter. A knockdown of H19 in valve interstitial cells (VICs) increased the expression of NOTCH1 and decreased the level of RUNX2 and BMP2, 2 downstream targets repressed by NOTCH1. In rescue experiments, the transfection of a vector encoding for the active Notch intracellular domain prevented H19-induced mineralization of valve interstitial cells. These findings indicate that a dysregulation of DNA methylation in the promoter of H19 during calcific aortic valve disease is associated with a higher expression of this lncRNA, which promotes an osteogenic program by interfering with the expression of NOTCH1. © 2016 American Heart Association, Inc.

  3. Analysis of Five Gene Sets in Chimpanzees Suggests Decoupling between the Action of Selection on Protein-Coding and on Noncoding Elements

    PubMed Central

    Santpere, Gabriel; Carnero-Montoro, Elena; Petit, Natalia; Serra, François; Hvilsom, Christina; Rambla, Jordi; Heredia-Genestar, Jose Maria; Halligan, Daniel L.; Dopazo, Hernan; Navarro, Arcadi; Bosch, Elena


    We set out to investigate potential differences and similarities between the selective forces acting upon the coding and noncoding regions of five different sets of genes defined according to functional and evolutionary criteria: 1) two reference gene sets presenting accelerated and slow rates of protein evolution (the Complement and Actin pathways); 2) a set of genes with evidence of accelerated evolution in at least one of their introns; and 3) two gene sets related to neurological function (Parkinson’s and Alzheimer’s diseases). To that effect, we combine human–chimpanzee divergence patterns with polymorphism data obtained from target resequencing 20 central chimpanzees, our closest relatives with largest long-term effective population size. By using the distribution of fitness effect-alpha extension of the McDonald–Kreitman test, we reproduce inferences of rates of evolution previously based only on divergence data on both coding and intronic sequences and also obtain inferences for other classes of genomic elements (untranslated regions, promoters, and conserved noncoding sequences). Our results suggest that 1) the distribution of fitness effect-alpha method successfully helps distinguishing different scenarios of accelerated divergence (adaptation or relaxed selective constraints) and 2) the adaptive history of coding and noncoding sequences within the gene sets analyzed is decoupled. PMID:25977458

  4. Polymorphism of Unique Noncoding DNA Sequences in Wild and Laboratory Mice

    PubMed Central

    Figueroa, Felipe; Kasahara, Masanori; Tichy, Herbert; Neufeld, Esther; Ritte, Uzi; Klein, Jan


    Two DNA probes, D17Tul and D17Tu2, were isolated from a genomic DNA library containing only two mouse chromosomes, one of which is chromosome 17, carrying the major histocompatibility complex (H-2), as well as the t complex genes. The D17Tul probe was mapped to the centromeric region of chromosome 17 and the D17Tu2 probe to the S region of the H-2 complex. Neither of the two probes appeared to detect any genes, but both contained unique, nonrepetitive sequences. Typing of DNA obtained from a large panel of mice revealed the presence of four D17Tul patterns in inbred mouse strains, one very common, one less common, and two present in one strain each. The two common patterns could not be detected in appreciable frequencies in the European wild mice tested (one of the two patterns was, however, found in Australian wild mice). Conversely, the patterns found frequently in European wild mice are absent in the laboratory mice. We therefore conclude that wild mice from the sampled regions of Europe could not have provided the ancestral stocks from which inbred strains were derived. Only one D17Tul pattern was found in all the populations of Mus musculus tested, while eight patterns were found in Mus domesticus, with virtually all the populations being polymorphic. We suggest that this difference reflects different modes in which the two species colonized Europe. The distribution of the D17Tu2 patterns in inbred strains correlates with the distribution of H-2 haplotypes. PMID:3666438

  5. Regulation of Immunoglobulin Class-Switch Recombination: Choreography of Noncoding Transcription, Targeted DNA Deamination, and Long-Range DNA Repair

    PubMed Central

    Matthews, Allysia J.; Zheng, Simin; DiMenna, Lauren J.; Chaudhuri, Jayanta


    Upon encountering antigens, mature IgM-positive B lymphocytes undergo class-switch recombination (CSR) wherein exons encoding the default Cμ constant coding gene segment of the immunoglobulin (Ig) heavy-chain (Igh) locus are excised and replaced with a new constant gene segment (referred to as “Ch genes”, e.g., Cγ, Cε, or Cα). The B cell thereby changes from expressing IgM to one producing IgG, IgE, or IgA, with each antibody isotype having a different effector function during an immune reaction. CSR is a DNA deletional-recombination reaction that proceeds through the generation of DNA double-strand breaks (DSBs) in repetitive switch (S) sequences preceding each Ch gene and is completed by end-joining between donor Sμ and acceptor S regions. CSR is a multistep reaction requiring transcription through S regions, the DNA cytidine deaminase AID, and the participation of several general DNA repair pathways including base excision repair, mismatch repair, and classical nonhomologous end-joining. In this review, we discuss our current understanding of how transcription through S regions generates substrates for AID-mediated deamination and how AID participates not only in the initiation of CSR but also in the conversion of deaminated residues into DSBs. Additionally, we review the multiple processes that regulate AID expression and facilitate its recruitment specifically to the Ig loci, and how deregulation of AID specificity leads to oncogenic translocations. Finally, we summarize recent data on the potential role of AID in the maintenance of the pluripotent stem cell state during epigenetic reprogramming. PMID:24507154

  6. Regulation of immunoglobulin class-switch recombination: choreography of noncoding transcription, targeted DNA deamination, and long-range DNA repair.


    Matthews, Allysia J; Zheng, Simin; DiMenna, Lauren J; Chaudhuri, Jayanta


    Upon encountering antigens, mature IgM-positive B lymphocytes undergo class-switch recombination (CSR) wherein exons encoding the default Cμ constant coding gene segment of the immunoglobulin (Ig) heavy-chain (Igh) locus are excised and replaced with a new constant gene segment (referred to as "Ch genes", e.g., Cγ, Cɛ, or Cα). The B cell thereby changes from expressing IgM to one producing IgG, IgE, or IgA, with each antibody isotype having a different effector function during an immune reaction. CSR is a DNA deletional-recombination reaction that proceeds through the generation of DNA double-strand breaks (DSBs) in repetitive switch (S) sequences preceding each Ch gene and is completed by end-joining between donor Sμ and acceptor S regions. CSR is a multistep reaction requiring transcription through S regions, the DNA cytidine deaminase AID, and the participation of several general DNA repair pathways including base excision repair, mismatch repair, and classical nonhomologous end-joining. In this review, we discuss our current understanding of how transcription through S regions generates substrates for AID-mediated deamination and how AID participates not only in the initiation of CSR but also in the conversion of deaminated residues into DSBs. Additionally, we review the multiple processes that regulate AID expression and facilitate its recruitment specifically to the Ig loci, and how deregulation of AID specificity leads to oncogenic translocations. Finally, we summarize recent data on the potential role of AID in the maintenance of the pluripotent stem cell state during epigenetic reprogramming.

  7. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA.


    Turner, Tychele N; Hormozdiari, Fereydoun; Duyzend, Michael H; McClymont, Sarah A; Hook, Paul W; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A; Zody, Michael C; Nelson, Bradley J; Huddleston, John; Sandstrom, Richard; Smith, Joshua D; Hanna, David; Swanson, James M; Faustman, Elaine M; Bamshad, Michael J; Stamatoyannopoulos, John; Nickerson, Deborah A; McCallion, Andrew S; Darnell, Robert; Eichler, Evan E


    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. Copyright © 2016 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  8. Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DNA

    PubMed Central

    Turner, Tychele N.; Hormozdiari, Fereydoun; Duyzend, Michael H.; McClymont, Sarah A.; Hook, Paul W.; Iossifov, Ivan; Raja, Archana; Baker, Carl; Hoekzema, Kendra; Stessman, Holly A.; Zody, Michael C.; Nelson, Bradley J.; Huddleston, John; Sandstrom, Richard; Smith, Joshua D.; Hanna, David; Swanson, James M.; Faustman, Elaine M.; Bamshad, Michael J.; Stamatoyannopoulos, John; Nickerson, Deborah A.; McCallion, Andrew S.; Darnell, Robert; Eichler, Evan E.


    We performed whole-genome sequencing (WGS) of 208 genomes from 53 families affected by simplex autism. For the majority of these families, no copy-number variant (CNV) or candidate de novo gene-disruptive single-nucleotide variant (SNV) had been detected by microarray or whole-exome sequencing (WES). We integrated multiple CNV and SNV analyses and extensive experimental validation to identify additional candidate mutations in eight families. We report that compared to control individuals, probands showed a significant (p = 0.03) enrichment of de novo and private disruptive mutations within fetal CNS DNase I hypersensitive sites (i.e., putative regulatory regions). This effect was only observed within 50 kb of genes that have been previously associated with autism risk, including genes where dosage sensitivity has already been established by recurrent disruptive de novo protein-coding mutations (ARID1B, SCN2A, NR3C2, PRKCA, and DSCAM). In addition, we provide evidence of gene-disruptive CNVs (in DISC1, WNT7A, RBFOX1, and MBD5), as well as smaller de novo CNVs and exon-specific SNVs missed by exome sequencing in neurodevelopmental genes (e.g., CANX, SAE1, and PIK3CA). Our results suggest that the detection of smaller, often multiple CNVs affecting putative regulatory elements might help explain additional risk of simplex autism. PMID:26749308

  9. Group 1 Innate Lymphoid Cell Lineage Identity Is Determined by a cis-Regulatory Element Marked by a Long Non-coding RNA.


    Mowel, Walter K; McCright, Sam J; Kotzin, Jonathan J; Collet, Magalie A; Uyar, Asli; Chen, Xin; DeLaney, Alexandra; Spencer, Sean P; Virtue, Anthony T; Yang, EnJun; Villarino, Alejandro; Kurachi, Makoto; Dunagin, Margaret C; Pritchard, Gretchen Harms; Stein, Judith; Hughes, Cynthia; Fonseca-Pereira, Diogo; Veiga-Fernandes, Henrique; Raj, Arjun; Kambayashi, Taku; Brodsky, Igor E; O'Shea, John J; Wherry, E John; Goff, Loyal A; Rinn, John L; Williams, Adam; Flavell, Richard A; Henao-Mejia, Jorge


    Commitment to the innate lymphoid cell (ILC) lineage is determined by Id2, a transcriptional regulator that antagonizes T and B cell-specific gene expression programs. Yet how Id2 expression is regulated in each ILC subset remains poorly understood. We identified a cis-regulatory element demarcated by a long non-coding RNA (lncRNA) that controls the function and lineage identity of group 1 ILCs, while being dispensable for early ILC development and homeostasis of ILC2s and ILC3s. The locus encoding this lncRNA, which we termed Rroid, directly interacted with the promoter of its neighboring gene, Id2, in group 1 ILCs. Moreover, the Rroid locus, but not the lncRNA itself, controlled the identity and function of ILC1s by promoting chromatin accessibility and deposition of STAT5 at the promoter of Id2 in response to interleukin (IL)-15. Thus, non-coding elements responsive to extracellular cues unique to each ILC subset represent a key regulatory layer for controlling the identity and function of ILCs. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. An encyclopedia of mouse DNA elements (Mouse ENCODE).


    Stamatoyannopoulos, John A; Snyder, Michael; Hardison, Ross; Ren, Bing; Gingeras, Thomas; Gilbert, David M; Groudine, Mark; Bender, Michael; Kaul, Rajinder; Canfield, Theresa; Giste, Erica; Johnson, Audra; Zhang, Mia; Balasundaram, Gayathri; Byron, Rachel; Roach, Vaughan; Sabo, Peter J; Sandstrom, Richard; Stehling, A Sandra; Thurman, Robert E; Weissman, Sherman M; Cayting, Philip; Hariharan, Manoj; Lian, Jin; Cheng, Yong; Landt, Stephen G; Ma, Zhihai; Wold, Barbara J; Dekker, Job; Crawford, Gregory E; Keller, Cheryl A; Wu, Weisheng; Morrissey, Christopher; Kumar, Swathi A; Mishra, Tejaswini; Jain, Deepti; Byrska-Bishop, Marta; Blankenberg, Daniel; Lajoie, Bryan R; Jain, Gaurav; Sanyal, Amartya; Chen, Kaun-Bei; Denas, Olgert; Taylor, James; Blobel, Gerd A; Weiss, Mitchell J; Pimkin, Max; Deng, Wulan; Marinov, Georgi K; Williams, Brian A; Fisher-Aylor, Katherine I; Desalvo, Gilberto; Kiralusha, Anthony; Trout, Diane; Amrhein, Henry; Mortazavi, Ali; Edsall, Lee; McCleary, David; Kuan, Samantha; Shen, Yin; Yue, Feng; Ye, Zhen; Davis, Carrie A; Zaleski, Chris; Jha, Sonali; Xue, Chenghai; Dobin, Alex; Lin, Wei; Fastuca, Meagan; Wang, Huaien; Guigo, Roderic; Djebali, Sarah; Lagarde, Julien; Ryba, Tyrone; Sasaki, Takayo; Malladi, Venkat S; Cline, Melissa S; Kirkup, Vanessa M; Learned, Katrina; Rosenbloom, Kate R; Kent, W James; Feingold, Elise A; Good, Peter J; Pazin, Michael; Lowdon, Rebecca F; Adams, Leslie B


    To complement the human Encyclopedia of DNA Elements (ENCODE) project and to enable a broad range of mouse genomics efforts, the Mouse ENCODE Consortium is applying the same experimental pipelines developed for human ENCODE to annotate the mouse genome.

  11. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L


    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  12. Profiling DNA Methylation and Hydroxymethylation at Retrotransposable Elements.


    de la Rica, Lorenzo; Stanley, Jatinder S; Branco, Miguel R


    DNA methylation is a key epigenetic modification controlling the transcriptional activity of mammalian retrotransposable elements. Its oxidation to DNA hydroxymethylation has been linked to DNA demethylation and reactivation of retrotransposons. Here we describe in detail protocols for three methods to measure DNA methylation and hydroxymethylation at specific genomic targets: glucMS-qPCR, and two sequencing approaches (pyrosequencing and high-throughput sequencing) for analyzing bisulfite- and oxidative bisulfite-modified DNA. All three techniques provide absolute measurements of methylation and hydroxymethylation levels at single-base resolution. Differences between the methods are discussed, mainly with respect to throughput and target coverage. These constitute the core techniques that are used in our laboratory for accurately surveying the epigenetics of retrotransposable elements.

  13. RNA Helicase Associated with AU-rich Element (RHAU/DHX36) Interacts with the 3′-Tail of the Long Non-coding RNA BC200 (BCYRN1)*

    PubMed Central

    Booy, Evan P.; McRae, Ewan K. S.; Howard, Ryan; Deo, Soumya R.; Ariyo, Emmanuel O.; Dzananovic, Edis; Meier, Markus; Stetefeld, Jörg; McKenna, Sean A.


    RNA helicase associated with AU-rich element (RHAU) is an ATP-dependent RNA helicase that demonstrates high affinity for quadruplex structures in DNA and RNA. To elucidate the significance of these quadruplex-RHAU interactions, we have performed RNA co-immunoprecipitation screens to identify novel RNAs bound to RHAU and characterize their function. In the course of this study, we have identified the non-coding RNA BC200 (BCYRN1) as specifically enriched upon RHAU immunoprecipitation. Although BC200 does not adopt a quadruplex structure and does not bind the quadruplex-interacting motif of RHAU, it has direct affinity for RHAU in vitro. Specifically designed BC200 truncations and RNase footprinting assays demonstrate that RHAU binds to an adenosine-rich region near the 3′-end of the RNA. RHAU truncations support binding that is dependent upon a region within the C terminus and is specific to RHAU isoform 1. Tests performed to assess whether BC200 interferes with RHAU helicase activity have demonstrated the ability of BC200 to act as an acceptor of unwound quadruplexes via a cytosine-rich region near the 3′-end of the RNA. Furthermore, an interaction between BC200 and the quadruplex-containing telomerase RNA was confirmed by pull-down assays of the endogenous RNAs. This leads to the possibility that RHAU may direct BC200 to bind and exert regulatory functions at quadruplex-containing RNA or DNA sequences. PMID:26740632

  14. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) - Definition of a Distinct Class of Begomovirus-Associated Satellites.


    Lozano, Gloria; Trenado, Helena P; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W; Navas-Castillo, Jesús


    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem-loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed.

  15. Characterization of Non-coding DNA Satellites Associated with Sweepoviruses (Genus Begomovirus, Geminiviridae) – Definition of a Distinct Class of Begomovirus-Associated Satellites

    PubMed Central

    Lozano, Gloria; Trenado, Helena P.; Fiallo-Olivé, Elvira; Chirinos, Dorys; Geraud-Pouey, Francis; Briddon, Rob W.; Navas-Castillo, Jesús


    Begomoviruses (family Geminiviridae) are whitefly-transmitted, plant-infecting single-stranded DNA viruses that cause crop losses throughout the warmer parts of the World. Sweepoviruses are a phylogenetically distinct group of begomoviruses that infect plants of the family Convolvulaceae, including sweet potato (Ipomoea batatas). Two classes of subviral molecules are often associated with begomoviruses, particularly in the Old World; the betasatellites and the alphasatellites. An analysis of sweet potato and Ipomoea indica samples from Spain and Merremia dissecta samples from Venezuela identified small non-coding subviral molecules in association with several distinct sweepoviruses. The sequences of 18 clones were obtained and found to be structurally similar to tomato leaf curl virus-satellite (ToLCV-sat, the first DNA satellite identified in association with a begomovirus), with a region with significant sequence identity to the conserved region of betasatellites, an A-rich sequence, a predicted stem–loop structure containing the nonanucleotide TAATATTAC, and a second predicted stem–loop. These sweepovirus-associated satellites join an increasing number of ToLCV-sat-like non-coding satellites identified recently. Although sharing some features with betasatellites, evidence is provided to suggest that the ToLCV-sat-like satellites are distinct from betasatellites and should be considered a separate class of satellites, for which the collective name deltasatellites is proposed. PMID:26925037

  16. The elemental role of iron in DNA synthesis and repair.


    Puig, Sergi; Ramos-Alonso, Lucía; Romero, Antonia María; Martínez-Pastor, María Teresa


    Iron is an essential redox element that functions as a cofactor in many metabolic pathways. Critical enzymes in DNA metabolism, including multiple DNA repair enzymes (helicases, nucleases, glycosylases, demethylases) and ribonucleotide reductase, use iron as an indispensable cofactor to function. Recent striking results have revealed that the catalytic subunit of DNA polymerases also contains conserved cysteine-rich motifs that bind iron-sulfur (Fe/S) clusters that are essential for the formation of stable and active complexes. In line with this, mitochondrial and cytoplasmic defects in Fe/S cluster biogenesis and insertion into the nuclear iron-requiring enzymes involved in DNA synthesis and repair lead to DNA damage and genome instability. Recent studies have shown that yeast cells possess multi-layered mechanisms that regulate the ribonucleotide reductase function in response to fluctuations in iron bioavailability to maintain optimal deoxyribonucleotide concentrations. Finally, a fascinating DNA charge transport model indicates how the redox active Fe/S centers present in DNA repair machinery components are critical for detecting and repairing DNA mismatches along the genome by long-range charge transfers through double-stranded DNA. These unexpected connections between iron and DNA replication and repair have to be considered to properly understand cancer, aging and other DNA-related diseases.

  17. Sequence evaluation of FGF and FGFR gene conserved non-coding elements in non-syndromic cleft lip and palate cases.


    Riley, Bridget M; Murray, Jeffrey C


    Non-syndromic cleft lip and palate (NS CLP) is a complex birth defect resulting from multiple genetic and environmental factors. We have previously reported the sequencing of the coding region of genes in the fibroblast growth factor (FGF) signaling pathway, in which missense and non-sense mutations contribute to approximately 5%-6% NS CLP cases. In this article we report the sequencing of conserved non-coding elements (CNEs) in and around 11 of the FGF and FGFR genes, which identified 55 novel variants. Seven of variants are highly conserved among >/=8 species and 31 variants alter transcription factor binding sites, 8 of which are important for craniofacial development. Additionally, 15 NS CLP patients had a combination of coding mutations and CNE variants, suggesting that an accumulation of variants in the FGF signaling pathway may contribute to clefting. (c) 2007 Wiley-Liss, Inc.

  18. Transcriptional regulation by activation and repression elements located at the 5'-noncoding region of the human alpha9 nicotinic receptor subunit gene.


    Valor, Luis M; Castillo, Mar; Ortiz, José A; Criado, Manuel


    The alpha9 subunit is a component of the neuronal nicotinic acetylcholine receptor gene superfamily that is expressed in very restricted locations. The promoter of the human gene has been analyzed in the human neuroblastoma SH-SY5Y, where alpha9 subunit expression was detected, and in C2C12 cells that do not express alpha9. A proximal promoter region (from -322 to +113) showed maximal transcriptional activity in SH-SY5Y cells, whereas its activity in C1C12 cells was much lower. Two elements unusually located at the 5'-noncoding region exhibited opposite roles. A negative element located between +15 and +48 appears to be cell-specific because it was effective in C2C12 but not in SH-SY5Y cells, where it was counterbalanced by the presence of the promoter region 5' to the initiation site. An activating element located between +66 and +79 and formed by two adjacent Sox boxes increased the activity of the alpha9 promoter about 4-fold and was even able to activate other promoters. This element interacts with Sox proteins, probably through a cooperative mechanism in which the two Sox boxes are necessary. We propose that the Sox complex provides an initial scaffold that facilitates the recruiting of the transcriptional machinery responsible for alpha9 subunit expression.

  19. HEXIM1 and NEAT1 Long Non-coding RNA Form a Multi-subunit Complex that Regulates DNA-Mediated Innate Immune Response.


    Morchikh, Mehdi; Cribier, Alexandra; Raffel, Raoul; Amraoui, Sonia; Cau, Julien; Severac, Dany; Dubois, Emeric; Schwartz, Olivier; Bennasser, Yamina; Benkirane, Monsef


    The DNA-mediated innate immune response underpins anti-microbial defenses and certain autoimmune diseases. Here we used immunoprecipitation, mass spectrometry, and RNA sequencing to identify a ribonuclear complex built around HEXIM1 and the long non-coding RNA NEAT1 that we dubbed the HEXIM1-DNA-PK-paraspeckle components-ribonucleoprotein complex (HDP-RNP). The HDP-RNP contains DNA-PK subunits (DNAPKc, Ku70, and Ku80) and paraspeckle proteins (SFPQ, NONO, PSPC1, RBM14, and MATRIN3). We show that binding of HEXIM1 to NEAT1 is required for its assembly. We further demonstrate that the HDP-RNP is required for the innate immune response to foreign DNA, through the cGAS-STING-IRF3 pathway. The HDP-RNP interacts with cGAS and its partner PQBP1, and their interaction is remodeled by foreign DNA. Remodeling leads to the release of paraspeckle proteins, recruitment of STING, and activation of DNAPKc and IRF3. Our study establishes the HDP-RNP as a key nuclear regulator of DNA-mediated activation of innate immune response through the cGAS-STING pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Applications of DNA integrating elements: Facing the bias bully

    PubMed Central

    de Jong, Johann; Wessels, Lodewyk F A; van Lohuizen, Maarten; de Ridder, Jeroen; Akhtar, Waseem


    Retroviruses and DNA transposons are an important part of molecular biologists' toolbox. The applications of these elements range from functional genomics to oncogene discovery and gene therapy. However, these elements do not integrate uniformly across the genome, which is an important limitation to their use. A number of genetic and epigenetic factors have been shown to shape the integration preference of these elements. Insight into integration bias can significantly enhance the analysis and interpretation of results obtained using these elements. For three different applications, we outline how bias can affect results, and can potentially be addressed. PMID:26442173

  1. A DNA element in the slo gene modulates ethanol tolerance.


    Krishnan, Harish R; Li, Xiaolei; Ghezzi, Alfredo; Atkinson, Nigel S


    In Drosophila, the slo gene encodes BK-type Ca(2+)-activated K(+) channels and is involved in producing rapid functional tolerance to sedation with ethanol. Drosophila are ideal for the study of functional ethanol tolerance because the adult does not acquire metabolic ethanol tolerance (Scholz, Ramond, Singh, & Heberlein, 2000). It has been shown that mutations in slo block the capacity to acquire tolerance, that sedation with ethanol vapor induces slo gene expression in the nervous system, and that transgenic induction of slo can phenocopy tolerance (Cowmeadow, Krishnan, & Atkinson, 2005; Cowmeadow et al., 2006). Here we use ethanol-induced histone acetylation to map a DNA regulatory element in the slo transcriptional control region and functionally test the element for a role in producing ethanol tolerance. Histone acetylation is commonly associated with activating transcription factors. We used the chromatin immunoprecipitation assay to map histone acetylation changes following ethanol sedation to identify an ethanol-responsive DNA element. Ethanol sedation induced an increase in histone acetylation over a 60 n DNA element called 6b, which is situated between the two ethanol-responsive neural promoters of the slo gene. Removal of the 6b element from the endogenous slo gene affected the production of functional ethanol tolerance as assayed in an ethanol-vapor recovery from sedation assay. Removal of element 6b extended the period of functional ethanol tolerance from ∼10 days to more than 21 days after a single ethanol-vapor sedation. This study demonstrates that mapping the position of ethanol-induced histone acetylation is an effective way to identify DNA regulatory elements that help to mediate the response of a gene to ethanol. Using this approach, we identified a DNA element, which is conserved among Drosophila species, and which is important for producing a behaviorally relevant ethanol response.

  2. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.


    Campo, Daniel; García-Vázquez, Eva


    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  3. Rapid proliferation of repetitive palindromic elements in mtDNA of the endemic Baikalian sponge Lubomirskia baicalensis.


    Lavrov, Dennis V


    Animal mitochondrial DNA (mtDNA) is a remarkably compact molecule largely because of the scarcity of noncoding "selfish" DNA. Recently, however, we found that mitochondrial genomes of several phylogenetically diverse species of demosponges contain small repetitive palindromic sequences, interspersed within intergenic regions and fused in protein and ribosomal RNA genes. Here, I report and analyze the proliferation of such elements in the mitochondrial genome of the endemic sponge of Lake Baikal Lubomirskia baicalensis. Because Baikal sponges are closely related to the circumglobally distributed freshwater sponge Ephydatia muelleri with which they shared a common ancestor approximately 3-10 Ma, both the rate of single nucleotide substitutions and the rate of palindromic repeat insertions can be calculated in this system. I found the rate of nucleotide substitutions in mtDNA of freshwater sponges to be extremely low (0.5-1.6 x 10(-9) per site per year), more similar to that in plants than bilaterian animals. By contrast, the per/nucleotide rate of insertions of repetitive elements is at least four times higher. This rapid rate of proliferation combined with the broad phylogenetic distribution of hairpin elements can make them a defining force in the evolution of mitochondrial genomes of demosponges.

  4. A simple method for estimating global DNA methylation using bisulfite PCR of repetitive DNA elements

    PubMed Central

    Yang, Allen S.; Estécio, Marcos R. H.; Doshi, Ketan; Kondo, Yutaka; Tajara, Eloiza H.; Issa, Jean-Pierre J.


    We report a method for studying global DNA methylation based on using bisulfite treatment of DNA and simultaneous PCR of multiple DNA repetitive elements, such as Alu elements and long interspersed nucleotide elements (LINE). The PCR product, which represents a pool of approximately 15 000 genomic loci, could be used for direct sequencing, selective restriction digestion or pyrosequencing, in order to quantitate DNA methylation. By restriction digestion or pyrosequencing, the assay was reproducible with a standard deviation of only 2% between assays. Using this method we found that almost two-thirds of the CpG methylation sites in Alu elements are mutated, but of the remaining methylation target sites, 87% were methylated. Due to the heavy methylation of repetitive elements, this assay was especially useful in detecting decreases in DNA methylation, and this assay was validated by examining cell lines treated with the methylation inhibitor 5-aza-2′deoxycytidine (DAC), where we found a 1–16% decrease in Alu element and 18–60% LINE methylation within 3 days of treatment. This method can be used as a surrogate marker of genome-wide methylation changes. In addition, it is less labor intensive and requires less DNA than previous methods of assessing global DNA methylation. PMID:14973332

  5. Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

    PubMed Central

    Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan


    Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: PMID:26196146

  6. Comparative analyses of coding and noncoding DNA regions indicate that Acropora (Anthozoa: Scleractina) possesses a similar evolutionary tempo of nuclear vs. mitochondrial genomes as in plants.


    Chen, I-Ping; Tang, Chung-Yu; Chiou, Chih-Yung; Hsu, Jia-Ho; Wei, Nuwei Vivian; Wallace, Carden C; Muir, Paul; Wu, Henry; Chen, Chaolun Allen


    Evidence suggests that the mitochondrial (mt)DNA of anthozoans is evolving at a slower tempo than their nuclear DNA; however, parallel surveys of nuclear and mitochondrial variations and calibrated rates of both synonymous and nonsynonymous substitutions across taxa are needed in order to support this scenario. We examined species of the scleractinian coral genus Acropora, including previously unstudied species, for molecular variations in protein-coding genes and noncoding regions of both nuclear and mt genomes. DNA sequences of a calmodulin (CaM)-encoding gene region containing three exons, two introns and a 411-bp mt intergenic spacer (IGS) spanning the cytochrome b (cytb) and NADH 2 genes, were obtained from 49 Acropora species. The molecular evolutionary rates of coding and noncoding regions in nuclear and mt genomes were compared in conjunction with published data, including mt cytochrome b, the control region, and nuclear Pax-C introns. Direct sequencing of the mtIGS revealed an average interspecific variation comparable to that seen in published data for mt cytb. The average interspecific variation of the nuclear genome was two to five times greater than that of the mt genome. Based on the calibration of the closure of Panama Isthmus (3.0 mya) and closure of the Tethy Seaway (12 mya), synonymous substitution rates ranged from 0.367% to 1.467% Ma(-1) for nuclear CaM, which is about 4.8 times faster than those of mt cytb (0.076-0.303% Ma(-1)). This is similar to the findings in plant genomes that the nuclear genome is evolving at least five times faster than those of mitochondrial counterparts.

  7. Cross-Regulation between Transposable Elements and Host DNA Replication

    PubMed Central

    Zaratiegui, Mikel


    Transposable elements subvert host cellular functions to ensure their survival. Their interaction with the host DNA replication machinery indicates that selective pressures lead them to develop ancestral and convergent evolutionary adaptations aimed at conserved features of this fundamental process. These interactions can shape the co-evolution of the transposons and their hosts. PMID:28335567

  8. An encyclopedia of mouse DNA elements (Mouse ENCODE)

    PubMed Central


    To complement the human Encyclopedia of DNA Elements (ENCODE) project and to enable a broad range of mouse genomics efforts, the Mouse ENCODE Consortium is applying the same experimental pipelines developed for human ENCODE to annotate the mouse genome. PMID:22889292

  9. Structural and functional analysis of four non-coding Y RNAs from Chinese hamster cells: identification, molecular dynamics simulations and DNA replication initiation assays.


    de Lima Neto, Quirino Alves; Duarte Junior, Francisco Ferreira; Bueno, Paulo Sérgio Alves; Seixas, Flavio Augusto Vicente; Kowalski, Madzia Pauline; Kheir, Eyemen; Krude, Torsten; Fernandez, Maria Aparecida


    The genes coding for Y RNAs are evolutionarily conserved in vertebrates. These non-coding RNAs are essential for the initiation of chromosomal DNA replication in vertebrate cells. However thus far, no information is available about Y RNAs in Chinese hamster cells, which have already been used to detect replication origins and alternative DNA structures around these sites. Here, we report the gene sequences and predicted structural characteristics of the Chinese hamster Y RNAs, and analyze their ability to support the initiation of chromosomal DNA replication in vitro. We identified DNA sequences in the Chinese hamster genome of four Y RNAs (chY1, chY3, chY4 and chY5) with upstream promoter sequences, which are homologous to the four main types of vertebrate Y RNAs. The chY1, chY3 and chY5 genes were highly conserved with their vertebrate counterparts, whilst the chY4 gene showed a relatively high degree of diversification from the other vertebrate Y4 genes. Molecular dynamics simulations suggest that chY4 RNA is structurally stable despite its evolutionarily divergent predicted stem structure. Of the four Y RNA genes present in the hamster genome, we found that only the chY1 and chY3 RNA were strongly expressed in the Chinese hamster GMA32 cell line, while expression of the chY4 and chY5 RNA genes was five orders of magnitude lower, suggesting that they may in fact not be expressed. We synthesized all four chY RNAs and showed that any of these four could support the initiation of DNA replication in an established human cell-free system. These data therefore establish that non-coding chY RNAs are stable structures and can substitute for human Y RNAs in a reconstituted cell-free DNA replication initiation system. The pattern of Y RNA expression and functionality is consistent with Y RNAs of other rodents, including mouse and rat.

  10. Long interspersed nuclear elements (LINEs) show tissue-specific, mosaic genome and methylation-unrestricted, widespread expression of noncoding RNAs in somatic tissues of the rat

    PubMed Central

    Singh, Deepak K.; Rath, Pramod C.


    We report strong somatic and germ line expression of LINE RNAs in eight different tissues of rat by using a novel ~2.8 kb genomic PstI-LINE DNA (P1-LINE) isolated from the rat brain. P1-LINE is present in a 93 kb LINE-SINE-cluster in sub-telomeric region of chromosome 12 (12p12) and as multiple truncated copies interspersed in all rat chromosomes. P1-LINEs occur as inverted repeats at multiple genomic loci in tissue-specific and mosaic patterns. P1-LINE RNAs are strongly expressed in brain, liver, lungs, heart, kidney, testes, spleen and thymus into large to small heterogeneous RNAs (~5.0 to 0.2 kb) in tissue-specific and dynamic patterns in individual rats. P1-LINE DNA is strongly methylated at CpG-dinucleotides in most genomic copies in all the tissues and weakly hypomethylated in few copies in some tissues. Small (700–75 nt) P1-LINE RNAs expressed in all tissues may be possible precursors for small regulatory RNAs (PIWI-interacting/piRNAs) bioinformatically derived from P1-LINE. The strong and dynamic expression of LINE RNAs from multiple chromosomal loci and the putative piRNAs in somatic tissues of rat under normal physiological conditions may define functional chromosomal domains marked by LINE RNAs as long noncoding RNAs (lncRNAs) unrestricted by DNA methylation. The tissue-specific, dynamic RNA expression and mosaic genomic distribution of LINEs representing a steady-state genomic flux of retrotransposon RNAs suggest for biological role of LINE RNAs as long ncRNAs and small piRNAs in mammalian tissues independent of their cellular fate for translation, reverse-transcription and retrotransposition. This may provide evolutionary advantages to LINEs and mammalian genomes. PMID:23064113

  11. Unique alterations of an ultraconserved non-coding element in the 3'UTR of ZIC2 in holoprosencephaly.


    Roessler, Erich; Hu, Ping; Hong, Sung-Kook; Srivastava, Kshitij; Carrington, Blake; Sood, Raman; Petrykowska, Hanna; Elnitski, Laura; Ribeiro, Lucilene A; Richieri-Costa, Antonio; Feldman, Benjamin; Odenwald, Ward F; Muenke, Maximilian


    Coding region alterations of ZIC2 are the second most common type of mutation in holoprosencephaly (HPE). Here we use several complementary bioinformatic approaches to identify ultraconserved cis-regulatory sequences potentially driving the expression of human ZIC2. We demonstrate that an 804 bp element in the 3' untranslated region (3'UTR) is highly conserved across the evolutionary history of vertebrates from fish to humans. Furthermore, we show that while genetic variation of this element is unexpectedly common among holoprosencephaly subjects (6/528 or >1%), it is not present in control individuals. Two of six proband-unique variants are de novo, supporting their pathogenic involvement in HPE outcomes. These findings support a general recommendation that the identification and analysis of key ultraconserved elements should be incorporated into the genetic risk assessment of holoprosencephaly cases.

  12. Alu elements and DNA double-strand break repair.


    White, Travis B; Morales, Maria E; Deininger, Prescott L


    Alu elements represent one of the most common sources of homology and homeology in the human genome. Homeologous recombination between Alu elements represents a major form of genetic instability leading to deletions and duplications. Although these types of events have been studied extensively through genomic sequencing to assess the impact of Alu elements on disease mutations and genome evolution, the overall abundance of Alu elements in the genome often makes it difficult to assess the relevance of the Alu elements to specific recombination events. We recently reported a powerful new reporter gene system that allows the assessment of various cis and trans factors on the contribution of Alu elements to various forms of genetic instability. This allowed a quantitative measurement of the influence of mismatches on Alu elements and instability. It also confirmed that homeologous Alu elements are able to stimulate non-homologous end joining events in their vicinity. This appears to be dependent on portions of the mismatch repair pathway. We are now in a position to begin to unravel the complex influences of Alu density, mismatch and location with alterations of DNA repair processes in various tissues and tumors.

  13. Putative regulatory elements within the non-coding regions of Chrysomelidae Diapause Associated Transcript-1 (DAT-1) orthologs

    USDA-ARS?s Scientific Manuscript database

    To develop a more comprehensive understanding of diapause within Chrysomelidae, we are employing phylogenetic foot-printing to isolate and characterize the regulatory elements associated with the diapause-associated gene, DAT-1. Leptinotarsa decemlineata (Colorado potato beetle, CPB) DAT-1 has been ...

  14. Differential nuclease sensitivity profiling of chromatin reveals biochemical footprints coupled to gene expression and functional DNA elements in maize.


    Vera, Daniel L; Madzima, Thelma F; Labonne, Jonathan D; Alam, Mohammad P; Hoffman, Gregg G; Girimurugan, S B; Zhang, Jinfeng; McGinnis, Karen M; Dennis, Jonathan H; Bass, Hank W


    The eukaryotic genome is organized into nucleosomes, the fundamental units of chromatin. The positions of nucleosomes on DNA regulate protein-DNA interactions and in turn influence DNA-templated events. Despite the increasing number of genome-wide maps of nucleosome position, how global changes in gene expression relate to changes in nucleosome position is poorly understood. We show that in nucleosome occupancy mapping experiments in maize (Zea mays), particular genomic regions are highly susceptible to variation introduced by differences in the extent to which chromatin is digested with micrococcal nuclease (MNase). We exploited this digestion-linked variation to identify protein footprints that are hypersensitive to MNase digestion, an approach we term differential nuclease sensitivity profiling (DNS-chip). Hypersensitive footprints were enriched at the 5' and 3' ends of genes, associated with gene expression levels, and significantly overlapped with conserved noncoding sequences and the binding sites of the transcription factor KNOTTED1. We also found that the tissue-specific regulation of gene expression was linked to tissue-specific hypersensitive footprints. These results reveal biochemical features of nucleosome organization that correlate with gene expression levels and colocalize with functional DNA elements. This approach to chromatin profiling should be broadly applicable to other species and should shed light on the relationships among chromatin organization, protein-DNA interactions, and genome regulation.

  15. A DNA Element Regulates Drug Tolerance and Withdrawal in Drosophila

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.


    Drug tolerance and withdrawal are insidious responses to drugs of abuse; the first increases drug consumption while the second punishes abstention. Drosophila generate functional tolerance to benzyl alcohol sedation by increasing neural expression of the slo BK-type Ca2+ activated K+ channel gene. After drug clearance this change produces a withdrawal phenotype—increased seizure susceptibility. The drug-induced histone modification profile identified the 6b element (60 nt) as a drug responsive element. Genomic deletion of 6b produces the allele, sloΔ6b, that reacts more strongly to the drug with increased induction, a massive increase in the duration of tolerance, and an increase in the withdrawal phenotype yet does not alter other slo-dependent behaviors. The 6b element is a homeostatic regulator of BK channel gene expression and is the first cis-acting DNA element shown to specifically affect the duration of a drug action. PMID:24086565

  16. Fast turnover of genome transcription across evolutionary time exposes entire non-coding DNA to de novo gene emergence.


    Neme, Rafik; Tautz, Diethard


    Deep sequencing analyses have shown that a large fraction of genomes is transcribed, but the significance of this transcription is much debated. Here, we characterize the phylogenetic turnover of poly-adenylated transcripts in a comprehensive sampling of taxa of the mouse (genus Mus), spanning a phylogenetic distance of 10 Myr. Using deep RNA sequencing we find that at a given sequencing depth transcriptome coverage becomes saturated within a taxon, but keeps extending when compared between taxa, even at this very shallow phylogenetic level. Our data show a high turnover of transcriptional states between taxa and that no major transcript-free islands exist across evolutionary time. This suggests that the entire genome can be transcribed into poly-adenylated RNA when viewed at an evolutionary time scale. We conclude that any part of the non-coding genome can potentially become subject to evolutionary functionalization via de novo gene evolution within relatively short evolutionary time spans.

  17. Replication of a pathogenic non-coding RNA increases DNA methylation in plants associated with a bromodomain-containing viroid-binding protein

    PubMed Central

    Lv, Dian-Qiu; Liu, Shang-Wu; Zhao, Jian-Hua; Zhou, Bang-Jun; Wang, Shao-Peng; Guo, Hui-Shan; Fang, Yuan-Yuan


    Viroids are plant-pathogenic molecules made up of single-stranded circular non-coding RNAs. How replicating viroids interfere with host silencing remains largely unknown. In this study, we investigated the effects of a nuclear-replicating Potato spindle tuber viroid (PSTVd) on interference with plant RNA silencing. Using transient induction of silencing in GFP transgenic Nicotiana benthamiana plants (line 16c), we found that PSTVd replication accelerated GFP silencing and increased Virp1 mRNA, which encodes bromodomain-containing viroid-binding protein 1 and is required for PSTVd replication. DNA methylation was increased in the GFP transgene promoter of PSTVd-replicating plants, indicating involvement of transcriptional gene silencing. Consistently, accelerated GFP silencing and increased DNA methylation in the of GFP transgene promoter were detected in plants transiently expressing Virp1. Virp1 mRNA was also increased upon PSTVd infection in natural host potato plants. Reduced transcript levels of certain endogenous genes were also consistent with increases in DNA methylation in related gene promoters in PSTVd-infected potato plants. Together, our data demonstrate that PSTVd replication interferes with the nuclear silencing pathway in that host plant, and this is at least partially attributable to Virp1. This study provides new insights into the plant-viroid interaction on viroid pathogenicity by subverting the plant cell silencing machinery. PMID:27767195

  18. Conserved noncoding elements follow power-law-like distributions in several genomes as a result of genome dynamics.


    Polychronopoulos, Dimitris; Sellis, Diamantis; Almirantis, Yannis


    Conserved, ultraconserved and other classes of constrained elements (collectively referred as CNEs here), identified by comparative genomics in a wide variety of genomes, are non-randomly distributed across chromosomes. These elements are defined using various degrees of conservation between organisms and several thresholds of minimal length. We here investigate the chromosomal distribution of CNEs by studying the statistical properties of distances between consecutive CNEs. We find widespread power-law-like distributions, i.e. linearity in double logarithmic scale, in the inter-CNE distances, a feature which is connected with fractality and self-similarity. Given that CNEs are often found to be spatially associated with genes, especially with those that regulate developmental processes, we verify by appropriate gene masking that a power-law-like pattern emerges irrespectively of whether elements found close or inside genes are excluded or not. An evolutionary model is put forward for the understanding of these findings that includes segmental or whole genome duplication events and eliminations (loss) of most of the duplicated CNEs. Simulations reproduce the main features of the observed size distributions. Power-law-like patterns in the genomic distributions of CNEs are in accordance with current knowledge about their evolutionary history in several genomes.

  19. A User's Guide to the Encyclopedia of DNA Elements (ENCODE)

    PubMed Central


    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome. PMID:21526222

  20. A user's guide to the encyclopedia of DNA elements (ENCODE).



    The mission of the Encyclopedia of DNA Elements (ENCODE) Project is to enable the scientific and medical communities to interpret the human genome sequence and apply it to understand human biology and improve health. The ENCODE Consortium is integrating multiple technologies and approaches in a collective effort to discover and define the functional elements encoded in the human genome, including genes, transcripts, and transcriptional regulatory regions, together with their attendant chromatin states and DNA methylation patterns. In the process, standards to ensure high-quality data have been implemented, and novel algorithms have been developed to facilitate analysis. Data and derived results are made available through a freely accessible database. Here we provide an overview of the project and the resources it is generating and illustrate the application of ENCODE data to interpret the human genome.

  1. Mobile DNA Elements: The Seeds of Organic Complexity on Earth.


    Habibi, Laleh; Pedram, Mehrdad; AmirPhirozy, Akbar; Bonyadi, Khadijeh


    Mobile DNA or transposable elements (TEs) are genomic sequences capable of moving themselves independently into different parts of the genome. Viral invasion of eukaryotic genomes is assumed to be the main source of TEs. Selfish transposition of these elements could be a serious threat to the host cell, as they can insert themselves into the middle of coding genes and/or induce genomic instability. In response, through millions of years of evolution, cells have come up with various mechanisms such as genomic imprinting, DNA methylation, heterochromatin formation, and RNA interference to deactivate them. Interestingly, these processes have also greatly contributed to important cellular functions involved in cell differentiation, development, and differential gene expression. Propagation of TE copies during the course of evolution have resulted in increasing the genome size and providing proper space and flexibility in shaping the genome by creating new genes and establishing essential cellular structures such as heterochromatin, centromere, and telomeres. Yet, these elements are mostly labeled for playing a role in pathogenesis of human diseases. Here, we attempt to introduce TEs as factors necessary for making us human rather than just selfish sequences or obligatory guests invading our DNA.

  2. Transposable DNA elements and life history traits: II. Transposition of P DNA elements in somatic cells reduces fitness, mating activity, and locomotion of Drosophila melanogaster.


    Woodruff, R C; Thompson, J N; Barker, J S; Huai, H


    Some transposable DNA elements in higher organisms are active in somatic cells, as well as in germinal cells. What effect does the movement of DNA elements in somatic cells have on life history traits? It has previously been reported that somatically active P and mariner elements in Drosophila induce genetic damage and significantly reduce lifespan. In this study, we report that the movement of P elements in somatic cells also significantly reduces fitness, mating activity, and locomotion of Drosophila melanogaster. If other elements cause similar changes in life history traits, it is doubtful if transposable DNA elements remain active for long in somatic cells in natural populations.

  3. An Integrated Encyclopedia of DNA Elements in the Human Genome

    PubMed Central


    Summary The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure, and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall the project provides new insights into the organization and regulation of our genes and genome, and an expansive resource of functional annotations for biomedical research. PMID:22955616

  4. An integrated encyclopedia of DNA elements in the human genome.



    The human genome encodes the blueprint of life, but the function of the vast majority of its nearly three billion bases is unknown. The Encyclopedia of DNA Elements (ENCODE) project has systematically mapped regions of transcription, transcription factor association, chromatin structure and histone modification. These data enabled us to assign biochemical functions for 80% of the genome, in particular outside of the well-studied protein-coding regions. Many discovered candidate regulatory elements are physically associated with one another and with expressed genes, providing new insights into the mechanisms of gene regulation. The newly identified elements also show a statistical correspondence to sequence variants linked to human disease, and can thereby guide interpretation of this variation. Overall, the project provides new insights into the organization and regulation of our genes and genome, and is an expansive resource of functional annotations for biomedical research.

  5. Analysis of Argonaute 4-Associated Long Non-Coding RNA in Arabidopsis thaliana Sheds Novel Insights into Gene Regulation through RNA-Directed DNA Methylation.


    Au, Phil Chi Khang; Dennis, Elizabeth S; Wang, Ming-Bo


    RNA-directed DNA methylation (RdDM) is a plant-specific de novo DNA methylation mechanism that requires long noncoding RNA (lncRNA) as scaffold to define target genomic loci. While the role of RdDM in maintaining genome stability is well established, how it regulates protein-coding genes remains poorly understood and few RdDM target genes have been identified. In this study, we obtained sequences of RdDM-associated lncRNAs using nuclear RNA immunoprecipitation against ARGONAUTE 4 (AGO4), a key component of RdDM that binds specifically with the lncRNA. Comparison of these lncRNAs with gene expression data of RdDM mutants identified novel RdDM target genes. Surprisingly, a large proportion of these target genes were repressed in RdDM mutants suggesting that they are normally activated by RdDM. These RdDM-activated genes are more enriched for gene body lncRNA than the RdDM-repressed genes. Histone modification and RNA analyses of several RdDM-activated stress response genes detected increased levels of active histone mark and short RNA transcript in the lncRNA-overlapping gene body regions in the ago4 mutant despite the repressed expression of these genes. These results suggest that RdDM, or AGO4, may play a role in maintaining or activating stress response gene expression by directing gene body chromatin modification preventing cryptic transcription.

  6. Analysis of Argonaute 4-Associated Long Non-Coding RNA in Arabidopsis thaliana Sheds Novel Insights into Gene Regulation through RNA-Directed DNA Methylation

    PubMed Central

    Au, Phil Chi Khang; Dennis, Elizabeth S.; Wang, Ming-Bo


    RNA-directed DNA methylation (RdDM) is a plant-specific de novo DNA methylation mechanism that requires long noncoding RNA (lncRNA) as scaffold to define target genomic loci. While the role of RdDM in maintaining genome stability is well established, how it regulates protein-coding genes remains poorly understood and few RdDM target genes have been identified. In this study, we obtained sequences of RdDM-associated lncRNAs using nuclear RNA immunoprecipitation against ARGONAUTE 4 (AGO4), a key component of RdDM that binds specifically with the lncRNA. Comparison of these lncRNAs with gene expression data of RdDM mutants identified novel RdDM target genes. Surprisingly, a large proportion of these target genes were repressed in RdDM mutants suggesting that they are normally activated by RdDM. These RdDM-activated genes are more enriched for gene body lncRNA than the RdDM-repressed genes. Histone modification and RNA analyses of several RdDM-activated stress response genes detected increased levels of active histone mark and short RNA transcript in the lncRNA-overlapping gene body regions in the ago4 mutant despite the repressed expression of these genes. These results suggest that RdDM, or AGO4, may play a role in maintaining or activating stress response gene expression by directing gene body chromatin modification preventing cryptic transcription. PMID:28783101

  7. The landscape of DNA methylation-mediated regulation of long non-coding RNAs in breast cancer

    PubMed Central

    Li, Xuecang; Zhao, Ning; Wang, Yihan; Han, Xiaole; Ci, Ce; Zhang, Jian; Li, Meng; Zhang, Yan


    Although systematic studies have identified a host of long non-coding RNAs (lncRNAs) which are involved in breast cancer, the knowledge about the methyla-tion-mediated dysregulation of those lncRNAs remains limited. Here, we integrated multi-omics data to analyze the methylated alteration of lncRNAs in breast invasive carcinoma (BRCA). We found that lncRNAs showed diverse methylation patterns on promoter regions in BRCA. LncRNAs were divided into two categories and four subcategories based on their promoter methylation patterns and expression levels be-tween tumor and normal samples. Through cis-regulatory analysis and gene ontology network, abnormally methylated lncRNAs were identified to be associated with can-cer regulation, proliferation or expression of transcription factors. Competing endog-enous RNA network and functional enrichment analysis of abnormally methylated lncRNAs showed that lncRNAs with different methylation patterns were involved in several hallmarks and KEGG pathways of cancers significantly. Finally, survival analysis based on mRNA modules in networks revealed that lncRNAs silenced by high methylation were associated with prognosis significantly in BRCA. This study enhances the understanding of aberrantly methylated patterns of lncRNAs and pro-vides a novel insight for identifying cancer biomarkers and potential therapeutic tar-gets in breast cancer. PMID:28881636

  8. Phylogeography and conservation genetics of Hygrophila pogonocalyx (Acanthaceae) based on atpB-rbcL noncoding spacer cpDNA.


    Huang, Jao-Ching; Wang, Wei-Kuang; Peng, Ching-I; Chiang, Tzen-Yuh


    Genetic variation in the atpB-rbcL intergenic spacer region of chloroplast DNA (cpDNA) was investigated in Hygrophila pogonocalyx Hayata (Acanthaceae), an endangered and endemic species in Taiwan. In this aquatic species, seed dispersal from capsules via elasticity is constrained by gravity and is thereby confined within populations, resulting in limited gene flow between populations. In this study, a total of 849 bp of the cpDNA atpB-rbcL spacer were sequenced from eight populations of H. pogonocalyx. Nucleotide diversity in the cpDNA is low (theta = 0.00343+/-0.00041). The distribution of genetic variation among populations agrees with an "isolation-by-distance" model. Two geographically correlated groups, the western and eastern regions, were identified in a neighbor-joining tree and a minimum-spanning network. Phylogeographical analyses based on the cpDNA network suggest that the present-day differentiation between western and eastern groups of H. pogonocalyx resulted from past fragmentation. The differentiation between eastern and western populations may be ascribed to isolation since the formation of the Central Mountain Range about 5 million years ago, which is consistent with the rate estimates based on a molecular clock of cpDNA.

  9. Association between hypermethylation of DNA repetitive elements in white blood cell DNA and pancreatic cancer.


    Neale, Rachel E; Clark, Paul J; Fawcett, Jonathan; Fritschi, Lin; Nagler, Belinda N; Risch, Harvey A; Walters, Rhiannon J; Crawford, William J; Webb, Penelope M; Whiteman, David C; Buchanan, Daniel D


    Pancreatic cancer is a leading cause of cancer-related deaths worldwide. Methylation of DNA may influence risk or be a marker of early disease. The aim of this study was to measure the association between methylation of three DNA repetitive elements in white blood cell (WBC) DNA and pancreatic cancer. DNA from WBCs of pancreatic cancer cases (n=559) and healthy unrelated controls (n=603) were tested for methylation of the LINE-1, Alu and Sat2 DNA repetitive elements using MethyLight quantitative PCR assays. Odds ratios (ORs) and 95% confidence intervals (95%CI) between both continuous measures of percent of methylated sample compared to a reference (PMR) or quintiles of PMR and pancreatic cancer, adjusted for age, sex, smoking, BMI, alcohol and higher education, were estimated. The PMR for each of the three markers was higher in cases than in controls, although only LINE-1 was significantly associated with pancreatic cancer (OR per log unit=1.37, 95%CI=1.16-1.63). The marker methylation score for all three markers combined was significantly associated with pancreatic cancer (p-trend=0.0006). There were no associations between measures of PMR and either presence of metastases, or timing of blood collection in relation to diagnosis, surgery, chemotherapy or death (all p>0.1). We observed an association between methylation of LINE-1 in WBC DNA and risk of pancreatic cancer. Further studies are needed to confirm this association.

  10. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.


    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G


    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  11. Chromatin landscape dictates HSF binding to target DNA elements.


    Guertin, Michael J; Lis, John T


    Sequence-specific transcription factors (TFs) are critical for specifying patterns and levels of gene expression, but target DNA elements are not sufficient to specify TF binding in vivo. In eukaryotes, the binding of a TF is in competition with a constellation of other proteins, including histones, which package DNA into nucleosomes. We used the ChIP-seq assay to examine the genome-wide distribution of Drosophila Heat Shock Factor (HSF), a TF whose binding activity is mediated by heat shock-induced trimerization. HSF binds to 464 sites after heat shock, the vast majority of which contain HSF Sequence-binding Elements (HSEs). HSF-bound sequence motifs represent only a small fraction of the total HSEs present in the genome. ModENCODE ChIP-chip datasets, generated during non-heat shock conditions, were used to show that inducibly bound HSE motifs are associated with histone acetylation, H3K4 trimethylation, RNA Polymerase II, and coactivators, compared to HSE motifs that remain HSF-free. Furthermore, directly changing the chromatin landscape, from an inactive to an active state, permits inducible HSF binding. There is a strong correlation of bound HSEs to active chromatin marks present prior to induced HSF binding, indicating that an HSE's residence in "active" chromatin is a primary determinant of whether HSF can bind following heat shock.

  12. DNA methylation in repetitive elements and Alzheimer disease.


    Bollati, V; Galimberti, D; Pergoli, L; Dalla Valle, E; Barretta, F; Cortini, F; Scarpini, E; Bertazzi, P A; Baccarelli, A


    Epigenetics is believed to play a role in Alzheimer's disease (AD). DNA methylation, the most investigated epigenetic hallmark, is a reversible mechanism that modifies genome function and chromosomal stability through the addition of methyl groups to cytosine located in CpG dinucleotides to form 5 methylcytosine (5mC). Methylation status of repetitive elements (i.e. Alu, LINE-1 and SAT-α) is a major contributor of global DNA methylation patterns and has been investigated in relation to a variety of human diseases. However, the role of methylation of repetitive elements in blood of AD patients has never been investigated so far. In the present study, a quantitative bisulfite-PCR pyrosequencing method was used to evaluate methylation of Alu, LINE-1 and SAT-α sequences in 43 AD patients and 38 healthy donors. In multivariate analysis adjusting for age and gender, LINE-1 was increased in AD patients compared with healthy volunteers (ADs: 83.6%5mC, volunteers: 83.1%5mC, p-value: 0.05). The group with best performances in mini mental state examination (MMSE) showed higher levels of LINE-1 methylation compared to the group with worst performances (MMSE>22: 83.9%5mC; MMSE≤22: 83.2%5mC; p=0.05). Our data suggest that LINE-1 methylation may lead to a better understanding of AD pathogenesis and course, and may contribute to identify novel markers useful to assess risk stratification. Further prospective investigations are warranted to evaluate the dynamics of DNA methylation from early-stage AD to advanced phases of the disease.

  13. A New Noncoding RNA Arranges Bacterial Chromosome Organization.


    Qian, Zhong; Macvanin, Mirjana; Dimitriadis, Emilios K; He, Ximiao; Zhurkin, Victor; Adhya, Sankar


    Repeated extragenic palindromes (REPs) in the enterobacterial genomes are usually composed of individual palindromic units separated by linker sequences. A total of 355 annotated REPs are distributed along the Escherichia coli genome. RNA sequence (RNAseq) analysis showed that almost 80% of the REPs in E. coli are transcribed. The DNA sequence of REP325 showed that it is a cluster of six repeats, each with two palindromic units capable of forming cruciform structures in supercoiled DNA. Here, we report that components of the REP325 element and at least one of its RNA products play a role in bacterial nucleoid DNA condensation. These RNA not only are present in the purified nucleoid but bind to the bacterial nucleoid-associated HU protein as revealed by RNA IP followed by microarray analysis (RIP-Chip) assays. Deletion of REP325 resulted in a dramatic increase of the nucleoid size as observed using transmission electron microscopy (TEM), and expression of one of the REP325 RNAs, nucleoid-associated noncoding RNA 4 (naRNA4), from a plasmid restored the wild-type condensed structure. Independently, chromosome conformation capture (3C) analysis demonstrated physical connections among various REP elements around the chromosome. These connections are dependent in some way upon the presence of HU and the REP325 element; deletion of HU genes and/or the REP325 element removed the connections. Finally, naRNA4 together with HU condensed DNA in vitro by connecting REP325 or other DNA sequences that contain cruciform structures in a pairwise manner as observed by atomic force microscopy (AFM). On the basis of our results, we propose molecular models to explain connections of remote cruciform structures mediated by HU and naRNA4. Nucleoid organization in bacteria is being studied extensively, and several models have been proposed. However, the molecular nature of the structural organization is not well understood. Here we characterized the role of a novel nucleoid

  14. Symmetry elements in DNA structure important for recognition/methylation by DNA [amino]-methyltransferases.


    Zinoviev, Victor V; Yakishchik, S I; Evdokimov, Alexey A; Malygin, Ernst G; Hattman, Stanley


    The phage T4Dam and EcoDam DNA-[adenine-N6] methyltransferases (MTases) methylate GATC palindromic sequences, while the BamHI DNA-[cytosine-N4] MTase methylates the GGATCC palindrome (which contains GATC) at the internal cytosine residue. We compared the ability of these enzymes to interact productively with defective duplexes in which individual elements were deleted on one chain. A sharp decrease in kcat was observed for all three enzymes if a particular element of structural symmetry was disrupted. For the BamHI MTase, integrity of the ATCC was critical, while an intact GAT sequence was necessary for the activity of T4Dam, and an intact GA was necessary for EcoDam. Theoretical alignment of the region of best contacts between the protein and DNA showed that in the case of a palindromic interaction site, a zone covering the 5'-symmetric residues is located in the major groove versus a zone of contact covering the 3'-symmetric residues in the minor groove. Our data fit a simple rule of thumb that the most important contacts are aligned around the methylation target base: if the target base is in the 5' half of the palindrome, the interaction between the enzyme and the DNA occurs mainly in the major groove; if it is in the 3' half, the interaction occurs mainly in the minor groove.

  15. Symmetry elements in DNA structure important for recognition/methylation by DNA [amino]-methyltransferases

    PubMed Central

    Zinoviev, Victor V.; Yakishchik, S. I.; Evdokimov, Alexey A.; Malygin, Ernst G.; Hattman, Stanley


    The phage T4Dam and EcoDam DNA-[adenine-N6] methyltransferases (MTases) methylate GATC palindromic sequences, while the BamHI DNA-[cytosine-N4] MTase methylates the GGATCC palindrome (which contains GATC) at the internal cytosine residue. We compared the ability of these enzymes to interact productively with defective duplexes in which individual elements were deleted on one chain. A sharp decrease in kcat was observed for all three enzymes if a particular element of structural symmetry was disrupted. For the BamHI MTase, integrity of the ATCC was critical, while an intact GAT sequence was necessary for the activity of T4Dam, and an intact GA was necessary for EcoDam. Theoretical alignment of the region of best contacts between the protein and DNA showed that in the case of a palindromic interaction site, a zone covering the 5′-symmetric residues is located in the major groove versus a zone of contact covering the 3′-symmetric residues in the minor groove. Our data fit a simple rule of thumb that the most important contacts are aligned around the methylation target base: if the target base is in the 5′ half of the palindrome, the interaction between the enzyme and the DNA occurs mainly in the major groove; if it is in the 3′ half, the interaction occurs mainly in the minor groove. PMID:15280508

  16. Mobile DNA elements in T4 and related phages

    PubMed Central


    Mobile genetic elements are common inhabitants of virtually every genome where they can exert profound influences on genome structure and function in addition to promoting their own spread within and between genomes. Phage T4 and related phage have long served as a model system for understanding the molecular mechanisms by which a certain class of mobile DNA, homing endonucleases, promote their spread. Homing endonucleases are site-specific DNA endonucleases that initiate mobility by introducing double-strand breaks at defined positions in genomes lacking the endonuclease gene, stimulating repair and recombination pathways that mobilize the endonuclease coding region. In phage T4, homing endonucleases were first discovered as encoded within the self-splicing td, nrdB and nrdD introns of T4. Genomic data has revealed that homing endonucleases are extremely widespread in T-even-like phage, as evidenced by the astounding fact that ~11% of the T4 genome encodes homing endonuclease genes, with most of them located outside of self-splicing introns. Detailed studies of the mobile td intron and its encoded endonuclease, I-TevI, have laid the foundation for genetic, biochemical and structural aspects that regulate the mobility process, and more recently have provided insights into regulation of homing endonuclease function. Here, we summarize the current state of knowledge regarding T4-encoded homing endonucleases, with particular emphasis on the td/I-TevI model system. We also discuss recent progress in the biology of free-standing endonucleases, and present areas of future research for this fascinating class of mobile genetic elements. PMID:21029434

  17. Long non-coding RNA produced by RNA polymerase V determines boundaries of heterochromatin.


    Böhmdorfer, Gudrun; Sethuraman, Shriya; Rowley, M Jordan; Krzyszton, Michal; Rothi, M Hafiz; Bouzit, Lilia; Wierzbicki, Andrzej T


    RNA-mediated transcriptional gene silencing is a conserved process where small RNAs target transposons and other sequences for repression by establishing chromatin modifications. A central element of this process are long non-coding RNAs (lncRNA), which in Arabidopsis thaliana are produced by a specialized RNA polymerase known as Pol V. Here we show that non-coding transcription by Pol V is controlled by preexisting chromatin modifications located within the transcribed regions. Most Pol V transcripts are associated with AGO4 but are not sliced by AGO4. Pol V-dependent DNA methylation is established on both strands of DNA and is tightly restricted to Pol V-transcribed regions. This indicates that chromatin modifications are established in close proximity to Pol V. Finally, Pol V transcription is preferentially enriched on edges of silenced transposable elements, where Pol V transcribes into TEs. We propose that Pol V may play an important role in the determination of heterochromatin boundaries.

  18. Genome-wide DNA methylation patterns in LSH mutant reveals de-repression of repeat elements and redundant epigenetic silencing pathways

    PubMed Central

    Yu, Weishi; McIntosh, Carl; Lister, Ryan; Zhu, Iris; Han, Yixing; Ren, Jianke; Landsman, David; Lee, Eunice; Briones, Victorino; Terashima, Minoru; Leighty, Robert; Ecker, Joseph R.


    Cytosine methylation is critical in mammalian development and plays a role in diverse biologic processes such as genomic imprinting, X chromosome inactivation, and silencing of repeat elements. Several factors regulate DNA methylation in early embryogenesis, but their precise role in the establishment of DNA methylation at a given site remains unclear. We have generated a comprehensive methylation map in fibroblasts derived from the murine DNA methylation mutant Hells−/− (helicase, lymphoid specific, also known as LSH). It has been previously shown that HELLS can influence de novo methylation of retroviral sequences and endogenous genes. Here, we describe that HELLS controls cytosine methylation in a nuclear compartment that is in part defined by lamin B1 attachment regions. Despite widespread loss of cytosine methylation at regulatory sequences, including promoter regions of protein-coding genes and noncoding RNA genes, overall relative transcript abundance levels in the absence of HELLS are similar to those in wild-type cells. A subset of promoter regions shows increases of the histone modification H3K27me3, suggesting redundancy of epigenetic silencing mechanisms. Furthermore, HELLS modulates CG methylation at all classes of repeat elements and is critical for repression of a subset of repeat elements. Overall, we provide a detailed analysis of gene expression changes in relation to DNA methylation alterations, which contributes to our understanding of the biological role of cytosine methylation. PMID:25170028

  19. A Transposable Element within the Non-canonical Telomerase RNA of Arabidopsis thaliana Modulates Telomerase in Response to DNA Damage

    PubMed Central

    Xu, Hengyi; Nelson, Andrew D. L.; Shippen, Dorothy E.


    Long noncoding RNAs (lncRNAs) have emerged as critical factors in many biological processes, but little is known about how their regulatory functions evolved. One of the best-studied lncRNAs is TER, the essential RNA template for telomerase reverse transcriptase. We previously showed that Arabidopsis thaliana harbors three TER isoforms: TER1, TER2 and TER2S. TER1 serves as a canonical telomere template, while TER2 is a novel negative regulator of telomerase activity, induced in response to double-strand breaks (DSBs). TER2 contains a 529 nt intervening sequence that is removed along with 36 nt at the RNA 3’ terminus to generate TER2S, an RNA of unknown function. Here we investigate how A. thaliana TER2 acquired its regulatory function. Using data from the 1,001 Arabidopsis genomes project, we report that the intervening sequence within TER2 is derived from a transposable element termed DSB responsive element (DRE). DRE is found in the TER2 loci of most but not all A. thaliana accessions. By analyzing accessions with (TER2) and without DRE (TER2Δ) we demonstrate that this element is responsible for many of the unique properties of TER2, including its enhanced binding to TERT and telomerase inhibitory function. We show that DRE destabilizes TER2, and further that TER2 induction by DNA damage reflects increased RNA stability and not increased transcription. DRE-mediated changes in TER2 stability thus provide a rapid and sensitive switch to fine-tune telomerase enzyme activity. Altogether, our data shows that invasion of the TER2 locus by a small transposon converted this lncRNA into a DNA damage sensor that modulates telomerase enzyme activity in response to genome assault. PMID:26075395

  20. Mobile DNA elements in the generation of diversity and complexity in the brain.


    Erwin, Jennifer A; Marchetto, Maria C; Gage, Fred H


    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia.

  1. Mobile DNA elements in the generation of diversity and complexity in the brain

    PubMed Central

    Erwin, Jennifer A.; Marchetto, Maria C.; Gage, Fred H.


    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia. PMID:25005482

  2. DNA preservation in skeletal elements from the World Trade Center disaster: recommendations for mass fatality management.


    Mundorff, Amy Z; Bartelink, Eric J; Mar-Cash, Elaine


    The World Trade Center (WTC) victim identification effort highlights taphonomic influences on the degradation of DNA from victims of mass fatality incidents. This study uses a subset of the WTC-Human Remains Database to evaluate differential preservation of DNA by skeletal element. Recovery location, sex, and victim type (civilian, firefighter, or plane passenger) do not appear to influence DNA preservation. Results indicate that more intact elements, as well as elements encased in soft tissue, produced slightly higher identification rates than more fragmented remains. DNA identification rates by element type conform to previous findings, with higher rates generally found in denser, weight-bearing bones. However, smaller bones including patellae, metatarsals, and foot phalanges yielded rates comparable to both femora and tibiae. These elements can be easily sampled with a disposable scalpel, and thus reduce potential DNA contamination. These findings have implications for DNA sampling guidelines in future mass fatality incidents.

  3. Movable Genetic Elements: Detection of Changes in Maize DNA at the Shrunken Locus Due to the Intervention of Ds Elements

    DOE R&D Accomplishments Database

    Burr, B.; Burr, F.A.


    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  4. Movable genetic elements: detection of changes in maize DNA at the Shrunken locus due to the intervention of Ds elements

    SciTech Connect

    Burr, B.; Burr, F.A.


    This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

  5. Single Nucleotide Polymorphisms in Noncoding Regions of Rad51C Do Not Change the Risk of Unselected Breast Cancer but They Modulate the Level of Oxidative Stress and the DNA Damage Characteristics: A Case-Control Study

    PubMed Central

    Gresner, Peter; Gromadzinska, Jolanta; Jablonska, Ewa; Stepnik, Maciej; Zambrano Quispe, Oscar; Twardowska, Ewa; Wasowicz, Wojciech


    Deleterious and missense mutations of RAD51C have recently been suggested to modulate the individual susceptibility to hereditary breast and ovarian cancer and unselected ovarian cancer, but not unselected breast cancer (BrC). We enrolled 132 unselected BrC females and 189 cancer-free female subjects to investigate whether common single nucleotide polymorphisms (SNPs) in non-coding regions of RAD51C modulate the risk of BrC, and whether they affect the level of oxidative stress and the extent/characteristics of DNA damage. Neither SNPs nor reconstructed haplotypes were found to significantly affect the unselected BrC risk. Contrary to this, carriers of rs12946522, rs16943176, rs12946397 and rs17222691 rare-alleles were found to present significantly increased level of blood plasma TBARS compared to respective wild-type homozygotes (p<0.05). Furthermore, these carriers showed significantly decreased fraction of oxidatively generated DNA damage (34% of total damaged DNA) in favor of DNA strand breakage, with no effect on total DNA damage, unlike respective wild-types, among which more evenly distributed proportions between oxidatively damaged DNA (48% of total DNA damage) and DNA strand breakage was found (p<0.0005 for the difference). Such effects were found among both the BrC cases and healthy subjects, indicating that they cannot be assumed as causal factors contributing to BrC development. PMID:25343521

  6. Detecting selection in noncoding regions of nucleotide sequences.

    PubMed Central

    Wong, Wendy S W; Nielsen, Rasmus


    We present a maximum-likelihood method for examining the selection pressure and detecting positive selection in noncoding regions using multiple aligned DNA sequences. The rate of substitution in noncoding regions relative to the rate of synonymous substitution in coding regions is modeled by a parameter zeta. When a site in a noncoding region is evolving neutrally zeta = 1, while zeta > 1 indicates the action of positive selection, and zeta < 1 suggests negative selection. Using a combined model for the evolution of noncoding and coding regions, we develop two likelihood-ratio tests for the detection of selection in noncoding regions. Data analysis of both simulated and real viral data is presented. Using the new method we show that positive selection in viruses is acting primarily in protein-coding regions and is rare or absent in noncoding regions. PMID:15238543

  7. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements.


    Prior, Sara; Miousse, Isabelle R; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R; Allen, Antiño R; Raber, Jacob; Tackett, Alan J; Hauer-Jensen, Martin; Nelson, Gregory A; Koturbash, Igor


    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2'-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5'-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Viral noncoding RNAs: more surprises

    PubMed Central

    Tycowski, Kazimierz T.; Guo, Yang Eric; Lee, Nara; Moss, Walter N.; Vallery, Tenaya K.; Xie, Mingyi


    Eukaryotic cells produce several classes of long and small noncoding RNA (ncRNA). Many DNA and RNA viruses synthesize their own ncRNAs. Like their host counterparts, viral ncRNAs associate with proteins that are essential for their stability, function, or both. Diverse biological roles—including the regulation of viral replication, viral persistence, host immune evasion, and cellular transformation—have been ascribed to viral ncRNAs. In this review, we focus on the multitude of functions played by ncRNAs produced by animal viruses. We also discuss their biogenesis and mechanisms of action. PMID:25792595

  9. Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach.


    Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders


    The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

  10. Long Noncoding RNAs in Cancer Pathways

    PubMed Central

    Schmitt, Adam M.; Chang, Howard Y.


    Genome-wide cancer mutation analyses are revealing an extensive landscape of functional mutations within the noncoding genome, with profound effects on the expression of long noncoding RNAs (lncRNAs). While the exquisite regulation of lncRNA transcription can provide signals of malignant transformation, we now understand that lncRNAs drive many important cancer phenotypes through their interactions with other cellular macromolecules including DNA, protein, and RNA. Recent advancements in surveying lncRNA molecular mechanisms are now providing the tools to functionally annotate these cancer associated transcripts, making these molecules attractive targets for therapeutic intervention in the fight against cancer. PMID:27070700

  11. Mapping Fifteen Trace Elements in Human Seminal Plasma and Sperm DNA.


    Ali, Sazan; Chaspoul, Florence; Anderson, Loundou; Bergé-Lefranc, David; Achard, Vincent; Perrin, Jeanne; Gallice, Philippe; Guichaoua, Marie


    Studies suggest a relationship between semen quality and the concentration of trace elements in serum or seminal plasma. However, trace elements may be linked to DNA and capable of altering the gene expression patterns. Thus, trace element interactions with DNA may contribute to the mechanisms for a trans-generational reproductive effect. We developed an analytical method to determine the amount of trace elements bound to the sperm DNA, and to estimate their affinity for the sperm DNA by the ratio: R = Log [metal concentration in the sperm DNA/metal concentration in seminal plasma]. We then analyzed the concentrations of 15 trace elements (Al, Cd, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Ti, V, Zn, As, Sb, and Se) in the seminal plasma and the sperm DNA in 64 normal and 30 abnormal semen specimens with Inductively Coupled Plasma/Mass Spectrometry (ICP-MS). This study showed all trace elements were detected in the seminal plasma and only metals were detected in the sperm DNA. There was no correlation between the metals' concentrations in the seminal plasma and the sperm DNA. Al had the highest affinity for DNA followed by Pb and Cd. This strong affinity is consistent with the known mutagenic effects of these metals. The lowest affinity was observed for Zn and Ti. We observed a significant increase of Al linked to the sperm DNA of patients with oligozoospermia and teratozoospermia. Al's reproductive toxicity might be due to Al linked to DNA, by altering spermatogenesis and expression patterns of genes involved in the function of reproduction.

  12. Characterization of human glucocorticoid receptor complexes formed with DNA fragments containing or lacking glucocorticoid response elements

    SciTech Connect

    Tully, D.B.; Cidlowski, J.A. )


    Sucrose density gradient shift assays were used to study the interactions of human glucocorticoid receptors (GR) with small DNA fragments either containing or lacking glucocorticoid response element (GRE) DNA consensus sequences. When crude cytoplasmic extracts containing ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) labeled GR were incubated with unlabeled DNA under conditions of DNA excess, a GRE-containing DNA fragment obtained from the 5' long terminal repeat of mouse mammary tumor virus (MMTV LTR) formed a stable 12-16S complex with activated, but not nonactivated, ({sup 3}H)TA receptor. By contrast, if the cytosols were treated with calf thymus DNA-cellulose to deplete non-GR-DNA-binding proteins prior to heat activation, a smaller 7-10S complex was formed with the MMTV LTR DNA fragment. Activated ({sup 3}H)TA receptor from DNA-cellulose pretreated cytosols also interacted with two similarly sized fragments from pBR322 DNA. Stability of the complexes formed between GR and these three DNA fragments was strongly affected by even moderate alterations in either the salt concentration or the pH of the gradient buffer. Under all conditions tested, the complex formed with the MMTV LTR DNA fragment was more stable than the complexes formed with either of the pBR322 DNA fragments. Together these observations indicate that the formation of stable complexes between activated GR and isolated DNA fragments requires the presence of GRE consensus sequences in the DNA.

  13. In Vivo Enhancer Analysis Chromosome 16 Conserved NoncodingSequences

    SciTech Connect

    Pennacchio, Len A.; Ahituv, Nadav; Moses, Alan M.; Nobrega,Marcelo; Prabhakar, Shyam; Shoukry, Malak; Minovitsky, Simon; Visel,Axel; Dubchak, Inna; Holt, Amy; Lewis, Keith D.; Plajzer-Frick, Ingrid; Akiyama, Jennifer; De Val, Sarah; Afzal, Veena; Black, Brian L.; Couronne, Olivier; Eisen, Michael B.; Rubin, Edward M.


    The identification of enhancers with predicted specificitiesin vertebrate genomes remains a significant challenge that is hampered bya lack of experimentally validated training sets. In this study, weleveraged extreme evolutionary sequence conservation as a filter toidentify putative gene regulatory elements and characterized the in vivoenhancer activity of human-fish conserved and ultraconserved1 noncodingelements on human chromosome 16 as well as such elements from elsewherein the genome. We initially tested 165 of these extremely conservedsequences in a transgenic mouse enhancer assay and observed that 48percent (79/165) functioned reproducibly as tissue-specific enhancers ofgene expression at embryonic day 11.5. While driving expression in abroad range of anatomical structures in the embryo, the majority of the79 enhancers drove expression in various regions of the developingnervous system. Studying a set of DNA elements that specifically droveforebrain expression, we identified DNA signatures specifically enrichedin these elements and used these parameters to rank all ~;3,400human-fugu conserved noncoding elements in the human genome. The testingof the top predictions in transgenic mice resulted in a three-foldenrichment for sequences with forebrain enhancer activity. These datadramatically expand the catalogue of in vivo-characterized human geneenhancers and illustrate the future utility of such training sets for avariety of iological applications including decoding the regulatoryvocabulary of the human genome.

  14. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.


    Suyama, Mikita; Lathe, Warren C; Bork, Peer


    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

  15. Intrinsic Characteristics of Neighboring DNA Modulate Transposable Element Activity in Drosophila melanogaster

    PubMed Central

    Esnault, Caroline; Palavesam, Azhahianambi; Pilitt, Kristina; O'Brochta, David A.


    Identifying factors influencing transposable element activity is essential for understanding how these elements impact genomes and their evolution as well as for fully exploiting them as functional genomics tools and gene-therapy vectors. Using a genetics-based approach, the influence of genomic position on piggyBac mobility in Drosophila melanogaster was assessed while controlling for element structure, genetic background, and transposase concentration. The mobility of piggyBac elements varied over more than two orders of magnitude solely as a result of their locations within the genome. The influence of genomic position on element activities was independent of factors resulting in position-dependent transgene expression (“position effects”). Elements could be relocated to new genomic locations without altering their activity if ≥500 bp of genomic DNA originally flanking the element was also relocated. Local intrinsic factors within the neighboring DNA that determined the activity of piggyBac elements were portable not only within the genome but also when elements were moved to plasmids. The predicted bendability of the first 50 bp flanking the 5′ and 3′ termini of piggyBac elements could account for 60% of the variance in position-dependent activity observed among elements. These results are significant because positional influences on transposable element activities will impact patterns of accumulation of elements within genomes. Manipulating and controlling the local sequence context of piggyBac elements could be a powerful, novel way of optimizing gene vector activity. PMID:20944016

  16. Magnetic particle-based sandwich sensor with DNA-modified carbon nanotubes as recognition elements for detection of DNA hybridization.


    Hu, Po; Huang, Cheng Zhi; Li, Yuan Fang; Ling, Jian; Liu, Yu Ling; Fei, Liang Run; Xie, Jian Ping


    In this contribution, we design a visual sensor for DNA hybridization with DNA probe-modified magnetic particles (MPs) and multiwalled carbon nanotubes (MWNTs) without involving a visual recognition element such as fluorescent/chemiluminescent reagents. It was found that DNA probe-modified MWNTs, which could be dispersed in aqueous medium and have strong light scattering signals under the excitation of a light beam in the UV-vis region, could connect with DNA probe-modified MPs together in the presence of perfectly complementary target DNA and form a sandwich structure. In a magnetic field, the formed MP-MWNT species can easily be removed from the solution, resulting in a decrease of light scattering signals. Thus, a magnetic particle-based sandwich sensor could be developed to detect DNA hybridization by measuring the light scattering signals with DNA-modified MWNTs as recognition elements. Experiments showed that the DNA-modified MPs sensor could be reused at least 17 times and was stable for more than 6 months.

  17. Variation in conserved non-coding sequences on chromosome 5q andsusceptibility to asthma and atopy

    SciTech Connect

    Donfack, Joseph; Schneider, Daniel H.; Tan, Zheng; Kurz,Thorsten; Dubchak, Inna; Frazer, Kelly A.; Ober, Carole


    Background: Evolutionarily conserved sequences likely havebiological function. Methods: To determine whether variation in conservedsequences in non-coding DNA contributes to risk for human disease, westudied six conserved non-coding elements in the Th2 cytokine cluster onhuman chromosome 5q31 in a large Hutterite pedigree and in samples ofoutbred European American and African American asthma cases and controls.Results: Among six conserved non-coding elements (>100 bp,>70percent identity; human-mouse comparison), we identified one singlenucleotide polymorphism (SNP) in each of two conserved elements and sixSNPs in the flanking regions of three conserved elements. We genotypedour samples for four of these SNPs and an additional three SNPs each inthe IL13 and IL4 genes. While there was only modest evidence forassociation with single SNPs in the Hutterite and European Americansamples (P<0.05), there were highly significant associations inEuropean Americans between asthma and haplotypes comprised of SNPs in theIL4 gene (P<0.001), including a SNP in a conserved non-codingelement. Furthermore, variation in the IL13 gene was strongly associatedwith total IgE (P = 0.00022) and allergic sensitization to mold allergens(P = 0.00076) in the Hutterites, and more modestly associated withsensitization to molds in the European Americans and African Americans (P<0.01). Conclusion: These results indicate that there is overalllittle variation in the conserved non-coding elements on 5q31, butvariation in IL4 and IL13, including possibly one SNP in a conservedelement, influence asthma and atopic phenotypes in diversepopulations.

  18. Capture of flanking DNA by a P element in Drosophila melanogaster: Creation of a transposable element

    SciTech Connect

    Tsubota, Stuart, I.; Huong Dangvu )


    A 6.1-kilobase nsertion into the rudimentary (r) gene was cloned and partially sequenced. The insertion consists of a 703-base-pair (bp) P element next to a 5.4-kilobase single-copy sequence. The normal positon of the single-copy sequence is near the tip of the X chromosome. Upon insertion into the r gene, this chimeric element generated an 8-bp target-site duplication, characteristic of P elements. At the non-P-element end of the insertion, the first 8 bp are identical to the first 8 bp of the inverted terminal repeats of the P element. Thus, this element has inverted terminal repeats of 8 bp. This large element can excise from the r gene under conditions of hybrid dysgenesis, which indicates that it behaves like a normal P element. These data support the conclusion that a normally stable single-copy sequence has now become unstable and duplicated within the genome.

  19. cis-acting translational effects of the 5' noncoding region of c-myc mRNA

    SciTech Connect

    Parkin, N.; Darveau, A.; Nicholson, R.; Sonenberg, N.


    The authors previously shown that the 5' noncoding region of mouse c-myc mRNA has a negative effect on translational efficiency in a rabbit reticulocyte Iysate. They wanted to localize and characterize the inhibitory translational element(s) in the mRNA and to study its effect in other in vitro and in vivo systems. There they report that the restrictive element is confined to a 240-nucleotide sequence of the 5' noncoding region of mouse c-myc mRNA and that this sequence acts in cis to inhibit the translation of a heterologous mRNA. In addition, they report that the cis-inhibitory effect is also exhibited in microinjected Xenopus ooctyes and wheat-germ extracts but not in HeLa cell extracts. Transfection of corresponding plasmid DNA constructs into several established cell lines did not produce the cis-inhibitory effect. A model to explain these results is presented.

  20. Pliable DNA Conformation of Response Elements Bound to Transcription Factor p63

    SciTech Connect

    Chen, Chen; Gorlatova, Natalia; Herzberg, Osnat


    We show that changes in the nucleotide sequence alter the DNA conformation in the crystal structures of p63 DNA-binding domain (p63DBD) bound to its response element. The conformation of a 22-bp canonical response element containing an AT spacer between the two half-sites is unaltered compared with that containing a TA spacer, exhibiting superhelical trajectory. In contrast, a GC spacers abolishes the DNA superhelical trajectory and exhibits less bent DNA, suggesting that increased GC content accompanies increased double helix rigidity. A 19-bp DNA, representing an AT-rich response element with overlapping half-sites, maintains superhelical trajectory and reveals two interacting p63DBD dimers crossing one another at 120{sup o}. p63DBD binding assays to response elements of increasing length complement the structural studies. We propose that DNA deformation may affect promoter activity, that the ability of p63DBD to bind to superhelical DNA suggests that it is capable of binding to nucleosomes, and that overlapping response elements may provide a mechanism to distinguish between p63 and p53 promoters.

  1. NONCODE v2.0: decoding the non-coding.


    He, Shunmin; Liu, Changning; Skogerbø, Geir; Zhao, Haitao; Wang, Jie; Liu, Tao; Bai, Baoyan; Zhao, Yi; Chen, Runsheng


    The NONCODE database is an integrated knowledge database designed for the analysis of non-coding RNAs (ncRNAs). Since NONCODE was first released 3 years ago, the number of known ncRNAs has grown rapidly, and there is growing recognition that ncRNAs play important regulatory roles in most organisms. In the updated version of NONCODE (NONCODE v2.0), the number of collected ncRNAs has reached 206 226, including a wide range of microRNAs, Piwi-interacting RNAs and mRNA-like ncRNAs. The improvements brought to the database include not only new and updated ncRNA data sets, but also an incorporation of BLAST alignment search service and access through our custom UCSC Genome Browser. NONCODE can be found under or

  2. Identification of a conserved sequence in the non-coding regions of many human genes.

    PubMed Central

    Donehower, L A; Slagle, B L; Wilde, M; Darlington, G; Butel, J S


    We have analyzed a sequence of approximately 70 base pairs (bp) that shows a high degree of similarity to sequences present in the non-coding regions of a number of human and other mammalian genes. The sequence was discovered in a fragment of human genomic DNA adjacent to an integrated hepatitis B virus genome in cells derived from human hepatocellular carcinoma tissue. When one of the viral flanking sequences was compared to nucleotide sequences in GenBank, more than thirty human genes were identified that contained a similar sequence in their non-coding regions. The sequence element was usually found once or twice in a gene, either in an intron or in the 5' or 3' flanking regions. It did not share any similarities with known short interspersed nucleotide elements (SINEs) or presently known gene regulatory elements. This element was highly conserved at the same position within the corresponding human and mouse genes for myoglobin and N-myc, indicating evolutionary conservation and possible functional importance. Preliminary DNase I footprinting data suggested that the element or its adjacent sequences may bind nuclear factors to generate specific DNase I hypersensitive sites. The size, structure, and evolutionary conservation of this sequence indicates that it is distinct from other types of short interspersed repetitive elements. It is possible that the element may have a cis-acting functional role in the genome. Images PMID:2536922

  3. Insulin Regulation of the Glucagon Gene is Mediated by an Insulin- Responsive DNA Element

    NASA Astrophysics Data System (ADS)

    Philippe, Jacques


    Diabetes mellitus is characterized by insulin deficiency and high plasma glucagon levels, which can be normalized by insulin replacement. It has previously been reported that glucagon gene expression is negatively regulated by insulin at the transcriptional level. By transfection studies, I have now localized a DNA control element that mediates insulin effects on glucagon gene transcription. This element also confers insulin responsiveness to a heterologous promoter. DNA-binding proteins that specifically interact with this insulin-responsive element are found in both glucagon- and non-glucagon-producing cells; and the pattern of binding, as assessed by the gel retardation assay, is not modified by prior insulin treatment.

  4. A 5' Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo.


    Lu, Jiamiao; Williams, James A; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A


    We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5' UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo.

  5. Identification of a Soybean Protein That Interacts with GAGA Element Dinucleotide Repeat DNA1

    PubMed Central

    Sangwan, Indu; O'Brian, Mark R.


    Dinucleotide repeat DNA with the pattern (GA)n/(TC)n, so-called GAGA elements, control gene expression in animals, and are recognized by a specific regulatory protein. Here, a yeast one-hybrid screen was used to isolate soybean (Glycine max) cDNA encoding a GAGA-binding protein (GBP) that binds to (GA)n/(CT)n DNA. Soybean GBP was dissimilar from the GAGA factor of Drosophila melanogaster. Recombinant GBP protein did not bind to dinucleotide repeat sequences other than (GA)n/(CT)n. GBP bound to the promoter of the heme and chlorophyll synthesis gene Gsa1, which contains a GAGA element. Removal of that GAGA element abrogated binding of GBP to the promoter. Furthermore, insertion of the GAGA element to a nonspecific DNA conferred GBP-binding activity on that DNA. Thus, the GAGA element of the Gsa1 promoter is both necessary and sufficient for GBP binding. Gbp mRNA was expressed in leaves and was induced in symbiotic root nodules elicited by the bacterium Bradyrhizobium japonicum. In addition, Gbp transcripts were much higher in leaves of dark-treated etiolated plantlets than in those exposed to light for 24 h. Homologs of GBP were found in other dicots and in the monocot rice (Oryza sativa), as well. We suggest that interaction between GAGA elements and GBP-like proteins is a regulatory feature in plants. PMID:12177492

  6. Structure of a Thyroid Hormone Receptor DNA-Binding Domain Homodimer Bound to an Inverted Palindrome DNA Response Element

    SciTech Connect

    Chen, Yi; Young, Matthew A.


    Thyroid hormone receptor (TR), as a member of the nuclear hormone receptor family, can recognize and bind different classes of DNA response element targets as either a monomer, a homooligomer, or a heterooligomer. We report here the first crystal structure of a homodimer TR DNA-binding domain (DBD) in complex with an inverted repeat class of thyroid response element (TRE). The structure shows a nearly symmetric structure of the TR DBD assembled on the F2 TRE where the base recognition contacts in the homodimer DNA complex are conserved relative to the previously published structure of a TR-9-cis-retinoic acid receptor heterodimer DNA complex. The new structure also reveals that the T-box region of the DBD can function as a structural hinge that enables a large degree of flexibility in the position of the C-terminal extension helix that connects the DBD to the ligand-binding domain. Although the isolated TR DBDs exist as monomers in solution, we have measured highly cooperative binding of the two TR DBD subunits onto the inverted repeat DNA sequence. This suggests that elements of the DBD can influence the specific TR oligomerization at target genes, and it is not just interactions between the ligand-binding domains that are responsible for TR oligomerization at target genes. Mutational analysis shows that intersubunit contacts at the DBD C terminus account for some, but not all, of the cooperative homodimer TR binding to the inverted repeat class TRE.

  7. Altered TERT promoter and other genomic regulatory elements: occurrence and impact.


    Heidenreich, Barbara; Kumar, Rajiv


    Study of genetic alterations, inherited or acquired, that increase the risk or drive cancers and many other diseases had remained mostly confined to coding sequences of the human genome. Data from genome wide associations studies, development of the Encyclopedia of DNA Elements (ENCODE), and a spurt in detection of driver somatic mutations have shifted focus towards noncoding regions of the human genome. The majority of genetic variants robustly associated with cancers and other syndromes identified through genome wide studies are located within noncoding regulatory regions of the genome. Genome wide techniques have put an emphasis on the role of three-dimensional chromosomal structures and cis-acting elements in regulations of different genes. The variants within noncoding genomic regions can potentially alter a number of regulatory elements including promoters, enhancers, insulators, noncoding long RNAs and others that affect cancers and various diseases through altered expression of critical genes. With effect of genetic alterations within regulatory elements dependent on other partner molecules like transcription factors and histone marks, an understanding of such modifications can potentially identify extended therapeutic targets. That concept has been augmented by the detection of driver somatic noncoding mutations within the promoter region of the telomerase reverse transcriptase (TERT) gene in different cancers. The acquired somatic noncoding mutations within different regulatory elements are now being reported in different cancers with an increased regularity. In this review we discuss the occurrence and impact of germline and somatic alterations within the TERT promoter and other genomic regulatory elements. © 2017 UICC.

  8. BOX DNA: a novel regulatory element related to embryonal carcinoma cell differentiation.

    PubMed Central

    Kihara-Negishi, F; Tsujita, R; Negishi, Y; Ariga, H


    BOX DNA was previously isolated from the DNA sequence inserted in the enhancer B domain of mutant polyomavirus (fPyF9) DNA. We also reported that BOX DNA functioned negatively on DNA replication and transcription of another polyomavirus mutant (PyhrN2) in F9-28 cells, a subclone of mouse F9 embryonal carcinoma (EC) cells expressing the polyomavirus large T antigen. In this study, we demonstrate that BOX DNA enhances transcription from the thymidine kinase (TK) promoter in various EC cells. One or three copies of BOX DNA, linked to the bacterial chloramphenicol acetyltransferase gene under the control of the herpes simplex virus TK promoter, activated promoter activity in F9, P19, and ECA2 cells. Band shift assays using BOX DNA as a probe revealed that specific binding proteins were present in all EC cells examined; the patterns of BOX DNA-protein complexes were the same among them. A mutation introduced within BOX DNA abolished enhancer activity as well as the formation of specific DNA-protein complexes. In non-EC cells, including L and BALB/3T3 cells, the enhancer activity of BOX DNA on the TK promoter was not observed, although binding proteins specific to the sequence exist. In band shift assays, the patterns of the DNA-protein complexes of either L or BALB/3T3 cells were different from those of EC cells. Furthermore, the enhancer activity of BOX DNA decreased upon differentiation induction in all EC cells examined, of different origins and distinct differentiation ability. In parallel with the loss of enhancer activity, the binding proteins specific for BOX DNA decreased in these cells. Moreover, we cloned a genomic DNA of F9, termed BOXF1, containing BOX DNA sequence approximately 400 bp upstream from the RNA start site of the gene. BOXF1, containing a TATA-like motif and the binding elements for Sp1 and Oct in addition to BOX DNA, possessed promoter activity deduced by a BOXF1-chloramphenicol acetyltransferase construct. Deletion analyses of the construct

  9. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.


    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  10. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  11. Evolutionary age of repetitive element subfamilies and sensitivity of DNA methylation to airborne pollutants

    PubMed Central


    Background Repetitive elements take up >40% of the human genome and can change distribution through transposition, thus generating subfamilies. Repetitive element DNA methylation has associated with several diseases and environmental exposures, including exposure to airborne pollutants. No systematic analysis has yet been conducted to examine the effects of exposures across different repetitive element subfamilies. The purpose of the study is to evaluate sensitivity of DNA methylation in differentially‒evolved LINE, Alu, and HERV subfamilies to different types of airborne pollutants. Methods We sampled a total of 120 male participants from three studies (20 high-, 20 low-exposure in each study) of steel workers exposed to metal-rich particulate matter (measured as PM10) (Study 1); gas-station attendants exposed to air benzene (Study 2); and truck drivers exposed to traffic-derived elemental carbon (Study 3). We measured methylation by bisulfite-PCR-pyrosequencing in 10 differentially‒evolved repetitive element subfamilies. Results High-exposure groups exhibited subfamily-specific methylation differences compared to low-exposure groups: L1PA2 showed lower DNA methylation in steel workers (P=0.04) and gas station attendants (P=0.03); L1Ta showed lower DNA methylation in steel workers (P=0.02); AluYb8 showed higher DNA methylation in truck drivers (P=0.05). Within each study, dose–response analyses showed subfamily-specific correlations of methylation with exposure levels. Interaction models showed that the effects of the exposures on DNA methylation were dependent on the subfamily evolutionary age, with stronger effects on older LINEs from PM10 (p‒interaction=0.003) and benzene (p‒interaction=0.04), and on younger Alus from PM10 (p-interaction=0.02). Conclusions The evolutionary age of repetitive element subfamilies determines differential susceptibility of DNA methylation to airborne pollutants. PMID:23855992

  12. Noncoding RNAs and epigenetic mechanisms during X-chromosome inactivation.


    Gendrel, Anne-Valerie; Heard, Edith


    In mammals, the process of X-chromosome inactivation ensures equivalent levels of X-linked gene expression between males and females through the silencing of one of the two X chromosomes in female cells. The process is established early in development and is initiated by a unique locus, which produces a long noncoding RNA, Xist. The Xist transcript triggers gene silencing in cis by coating the future inactive X chromosome. It also induces a cascade of chromatin changes, including posttranslational histone modifications and DNA methylation, and leads to the stable repression of all X-linked genes throughout development and adult life. We review here recent progress in our understanding of the molecular mechanisms involved in the initiation of Xist expression, the propagation of the Xist RNA along the chromosome, and the cis-elements and trans-acting factors involved in the maintenance of the repressed state. We also describe the diverse strategies used by nonplacental mammals for X-chromosome dosage compensation and highlight the common features and differences between eutherians and metatherians, in particular regarding the involvement of long noncoding RNAs.

  13. Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library.


    Zhu, Shiyou; Li, Wei; Liu, Jingze; Chen, Chen-Hao; Liao, Qi; Xu, Ping; Xu, Han; Xiao, Tengfei; Cao, Zhongzheng; Peng, Jingyu; Yuan, Pengfei; Brown, Myles; Liu, Xiaole Shirley; Wei, Wensheng


    CRISPR-Cas9 screens have been widely adopted to analyze coding-gene functions, but high-throughput screening of non-coding elements using this method is more challenging because indels caused by a single cut in non-coding regions are unlikely to produce a functional knockout. A high-throughput method to produce deletions of non-coding DNA is needed. We report a high-throughput genomic deletion strategy to screen for functional long non-coding RNAs (lncRNAs) that is based on a lentiviral paired-guide RNA (pgRNA) library. Applying our screening method, we identified 51 lncRNAs that can positively or negatively regulate human cancer cell growth. We validated 9 of 51 lncRNA hits using CRISPR-Cas9-mediated genomic deletion, functional rescue, CRISPR activation or inhibition and gene-expression profiling. Our high-throughput pgRNA genome deletion method will enable rapid identification of functional mammalian non-coding elements.

  14. A Coxiella burnetti repeated DNA element resembling a bacterial insertion sequence.

    PubMed Central

    Hoover, T A; Vodkin, M H; Williams, J C


    A DNA fragment located on the 3' side of the Coxiella burnetii htpAB operon was determined by Southern blotting to exist in approximately 19 copies in the Nine Mile I genome. The DNA sequences of this htpAB-associated repetitive element and two other independent copies were analyzed to determine the size and nature of the element. The three copies of the element were 1,450, 1,452, and 1,458 bp long, with less than 2% divergence among the three sequences. Several features characteristic of bacterial insertion sequences were discovered. These included a single significant open reading frame that would encode a 367-amino-acid polypeptide which was predicted to be highly basic, to have a DNA-binding helix-turn-helix motif, to have a leucine zipper motif, and to have homology to polypeptides found in several other bacterial insertion sequences. Identical 7-bp inverted repeats were found at the ends of all three copies of the element. However, duplications generated by many bacterial mobile elements in the recipient DNA during insertion events did not flank the inverted repeats of any of the three C. burnetii elements examined. A second pair of inverted repeats that flanked the open reading frame was also found in all three copies of the element. Most of the divergence among the three copies of the element occurred in the region between the two inverted repeat sequences in the 3' end of the element. Despite the sequence changes, all three copies of the element have retained significant dyad symmetry in this region. Images PMID:1324903

  15. Invertrons, a class of structurally and functionally related genetic elements that includes linear DNA plasmids, transposable elements, and genomes of adeno-type viruses.

    PubMed Central

    Sakaguchi, K


    Invertrons are genetic elements composed of DNA with inverted terminal repeats at both ends, covalently bonded to terminal proteins involved in the initiation of DNA replication at both their 5' termini when they exist in the cytoplasm of their host in free form. They function as viruses, linear DNA plasmids, transposable elements, and sometimes combinations of two of these properties. They differ from retroviruses and related retro-type transposons which have direct repeats on both their genomic ends and exploit RNA intermediates for replication of their DNA. A model for replication and integration of invertrons is presented, as well as a model for transposition of transposable elements. PMID:2157134

  16. TFIIIC Bound DNA Elements in Nuclear Organization and Insulation

    PubMed Central

    Kirkland, Jacob G.; Raab, Jesse R.


    tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short Interspersed Nuclear Elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer -blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vise versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. \\ PMID:23000638

  17. TFIIIC bound DNA elements in nuclear organization and insulation.


    Kirkland, Jacob G; Raab, Jesse R; Kamakaka, Rohinton T


    tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short interspersed nuclear elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer - blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vice versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. This article is part of a Special Issue entitled: Transcription by Odd Pols. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Divergence of conserved non-coding sequences: rate estimates and relative rate tests.


    Wagner, Günter P; Fried, Claudia; Prohaska, Sonja J; Stadler, Peter F


    In many eukaryotic genomes only a small fraction of the DNA codes for proteins, but the non-protein coding DNA harbors important genetic elements directing the development and the physiology of the organisms, like promoters, enhancers, insulators, and micro-RNA genes. The molecular evolution of these genetic elements is difficult to study because their functional significance is hard to deduce from sequence information alone. Here we propose an approach to the study of the rate of evolution of functional non-coding sequences at a macro-evolutionary scale. We identify functionally important non-coding sequences as Conserved Non-Coding Nucleotide (CNCN) sequences from the comparison of two outgroup species. The CNCN sequences so identified are then compared to their homologous sequences in a pair of ingroup species, and we monitor the degree of modification these sequences suffered in the two ingroup lineages. We propose a method to test for rate differences in the modification of CNCN sequences among the two ingroup lineages, as well as a method to estimate their rate of modification. We apply this method to the full sequences of the HoxA clusters from six gnathostome species: a shark, Heterodontus francisci; a basal ray finned fish, Polypterus senegalus; the amphibian, Xenopus tropicalis; as well as three mammalian species, human, rat and mouse. The results show that the evolutionary rate of CNCN sequences is not distinguishable among the three mammalian lineages, while the Xenopus lineage has a significantly increased rate of evolution. Furthermore the estimates of the rate parameters suggest that in the stem lineage of mammals the rate of CNCN sequence evolution was more than twice the rate observed within the placental amniotes clade, suggesting a high rate of evolution of cis-regulatory elements during the origin of amniotes and mammals. We conclude that the proposed methods can be used for testing hypotheses about the rate and pattern of evolution of putative

  19. Non-coding RNAs: An Introduction.


    Yang, Jennifer X; Rastetter, Raphael H; Wilhelm, Dagmar


    For many years the main role of RNA, it addition to the housekeeping functions of for example tRNAs and rRNAs, was believed to be a messenger between the genes encoded on the DNA and the functional units of the cell, the proteins. This changed drastically with the identification of the first small non-coding RNA, termed microRNA, some 20 years ago. This discovery opened the field of regulatory RNAs with no or little protein-coding potential. Since then many new classes of regulatory non-coding RNAs, including endogenous small interfering RNAs (endo-siRNAs), PIWI-associated RNAs (piRNAs), and long non-coding RNAs, have been identified and we have made amazing progress in elucidating their expression, biogenesis, mechanisms and mode of action, and function in many, if not all, biological processes. In this chapter we provide an introduction about the current knowledge of the main classes of non-coding RNAs, what is know about their biogenesis and mechanism of function.

  20. Stressing out over long noncoding RNA.


    Audas, Timothy E; Lee, Stephen


    Genomic studies have revealed that humans possess far fewer protein-encoding genes than originally predicted. These over-estimates were drawn from the inherent developmental and stimuli-responsive complexity found in humans and other mammals, when compared to lower eukaryotic organisms. This left a conceptual void in many cellular networks, as a new class of functional molecules was necessary for "fine-tuning" the basic proteomic machinery. Transcriptomics analyses have determined that the vast majority of the genetic material is transcribed as noncoding RNA, suggesting that these molecules could provide the functional diversity initially sought from proteins. Indeed, as discussed in this review, long noncoding RNAs (lncRNAs), the largest family of noncoding transcripts, have emerged as common regulators of many cellular stressors; including heat shock, metabolic deprivation and DNA damage. These stimuli, while divergent in nature, share some common stress-responsive pathways, notably inhibition of cell proliferation. This role intrinsically makes stress-responsive lncRNA regulators potential tumor suppressor or proto-oncogenic genes. As the list of functional RNA molecules continues to rapidly expand it is becoming increasingly clear that the significance and functionality of this family may someday rival that of proteins. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element Specific for Bromacil

    PubMed Central

    Williams, Ryan M.; Kulick, Amanda R.; Yedlapalli, Srilakshmi; Battistella, Louisa; Hajiran, Cyrus J.; Sooter, Letha J.


    Bromacil is a widely used herbicide that is known to contaminate environmental systems. Due to the hazards it presents and inefficient detection methods, it is necessary to create a rapid and efficient sensing device. Towards this end, we have utilized a stringent in vitro selection method to identify single-stranded DNA molecular recognition elements (MRE) specific for bromacil. We have identified one MRE with high affinity (Kd = 9.6 nM) and specificity for bromacil compared to negative targets of selection and other pesticides. The selected ssDNA MRE will be useful as the sensing element in a field-deployable bromacil detection device. PMID:25400940

  2. Efficient chromosomal-scale DNA looping in Escherichia coli using multiple DNA-looping elements.


    Hao, Nan; Sneppen, Kim; Shearwin, Keith E; Dodd, Ian B


    Genes are frequently regulated by interactions between proteins that bind to the DNA near the gene and proteins that bind to DNA sites located far away, with the intervening DNA looped out. But it is not understood how efficient looping can occur when the sites are very far apart. We develop a simple theoretical framework that relates looping efficiency to the energetic cost and benefit of looping, allowing prediction of the efficiency of single or multiple nested loops at different distances. Measurements of absolute loop efficiencies for Lac repressor and λ CI using gene expression reporters in Escherichia coli cells show that, as predicted by the model, long-range DNA looping between a pair of sites can be strongly enhanced by the use of nested DNA loops or by the use of additional protein-binding sequences. A combination of these approaches was able to generate efficient DNA looping at a 200 kb distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. DNA capture elements for rapid detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva


    DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

  4. Radiation-induced changes in DNA methylation of repetitive elements in the mouse heart.


    Koturbash, Igor; Miousse, Isabelle R; Sridharan, Vijayalakshmi; Nzabarushimana, Etienne; Skinner, Charles M; Melnyk, Stepan B; Pavliv, Oleksandra; Hauer-Jensen, Martin; Nelson, Gregory A; Boerma, Marjan


    DNA methylation is a key epigenetic mechanism, needed for proper control over the expression of genetic information and silencing of repetitive elements. Exposure to ionizing radiation, aside from its strong genotoxic potential, may also affect the methylation of DNA, within the repetitive elements, in particular. In this study, we exposed C57BL/6J male mice to low absorbed mean doses of two types of space radiation-proton (0.1 Gy, 150 MeV, dose rate 0.53 ± 0.08 Gy/min), and heavy iron ions ((56)Fe) (0.5 Gy, 600 MeV/n, dose rate 0.38 ± 0.06 Gy/min). Radiation-induced changes in cardiac DNA methylation associated with repetitive elements were detected. Specifically, modest hypomethylation of retrotransposon LINE-1 was observed at day 7 after irradiation with either protons or (56)Fe. This was followed by LINE-1, and other retrotransposons, ERV2 and SINE B1, as well as major satellite DNA hypermethylation at day 90 after irradiation with (56)Fe. These changes in DNA methylation were accompanied by alterations in the expression of DNA methylation machinery and affected the one-carbon metabolism pathway. Furthermore, loss of transposable elements expression was detected in the cardiac tissue at the 90-day time-point, paralleled by substantial accumulation of mRNA transcripts, associated with major satellites. Given that the one-carbon metabolism pathway can be modulated by dietary modifications, these findings suggest a potential strategy for the mitigation and, possibly, prevention of the negative effects exerted by ionizing radiation on the cardiovascular system. Additionally, we show that the methylation status and expression of repetitive elements may serve as early biomarkers of exposure to space radiation. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. C.U.R.R.F. (Codon Usage regarding Restriction Finder): a free Java(®)-based tool to detect potential restriction sites in both coding and non-coding DNA sequences.


    Gatter, Michael; Gatter, Thomas; Matthäus, Falk


    The synthesis of complete genes is becoming a more and more popular approach in heterologous gene expression. Reasons for this are the decreasing prices and the numerous advantages in comparison to classic molecular cloning methods. Two of these advantages are the possibility to adapt the codon usage to the host organism and the option to introduce restriction enzyme target sites of choice. C.U.R.R.F. (Codon Usage regarding Restriction Finder) is a free Java(®)-based software program which is able to detect possible restriction sites in both coding and non-coding DNA sequences by introducing multiple silent or non-silent mutations, respectively. The deviation of an alternative sequence containing a desired restriction motive from the sequence with the optimal codon usage is considered during the search of potential restriction sites in coding DNA and mRNA sequences as well as protein sequences. C.U.R.R.F is available at

  6. Enhancer connectome in primary human cells identifies target genes of disease-associated DNA elements.


    Mumbach, Maxwell R; Satpathy, Ansuman T; Boyle, Evan A; Dai, Chao; Gowen, Benjamin G; Cho, Seung Woo; Nguyen, Michelle L; Rubin, Adam J; Granja, Jeffrey M; Kazane, Katelynn R; Wei, Yuning; Nguyen, Trieu; Greenside, Peyton G; Corces, M Ryan; Tycko, Josh; Simeonov, Dimitre R; Suliman, Nabeela; Li, Rui; Xu, Jin; Flynn, Ryan A; Kundaje, Anshul; Khavari, Paul A; Marson, Alexander; Corn, Jacob E; Quertermous, Thomas; Greenleaf, William J; Chang, Howard Y


    The challenge of linking intergenic mutations to target genes has limited molecular understanding of human diseases. Here we show that H3K27ac HiChIP generates high-resolution contact maps of active enhancers and target genes in rare primary human T cell subtypes and coronary artery smooth muscle cells. Differentiation of naive T cells into T helper 17 cells or regulatory T cells creates subtype-specific enhancer-promoter interactions, specifically at regions of shared DNA accessibility. These data provide a principled means of assigning molecular functions to autoimmune and cardiovascular disease risk variants, linking hundreds of noncoding variants to putative gene targets. Target genes identified with HiChIP are further supported by CRISPR interference and activation at linked enhancers, by the presence of expression quantitative trait loci, and by allele-specific enhancer loops in patient-derived primary cells. The majority of disease-associated enhancers contact genes beyond the nearest gene in the linear genome, leading to a fourfold increase in the number of potential target genes for autoimmune and cardiovascular diseases.

  7. Juvenile hormone regulation of an insect gene: a specific transcription factor and a DNA response element.


    Zhang, J; Saleh, D S; Wyatt, G R


    We have used locust fat body nuclear protein extracts and upstream DNA of the juvenile hormone (JH)-inducible locust gene, jhp21, to examine the regulation of specific transcription by JH. Promoter activity was assayed with G-free cassette reporter constructs. Nuclear extracts from adult female fat body, previously exposed to JH or an analog, actively transcribe from the jhp21 promoter and a control adenovirus major late (AdML) promoter, whereas extracts from JH-deprived female fat body, or other tissues, transcribe strongly from the AdML promoter but weakly or not at all from the jhp21 promoter. Transcription is enhanced by sequences between -140 and -211 nt from the jhp21 transcription start point (tsp), which include a CAAT box, and also by sequences between -1056 and -1200. A 15-nt partially palindromic sequence element found at -1152, resembling known hormone response elements, was shown to stimulate transcription when restored to truncated jhp21 DNA. Two very similar sequences occur further upstream. In electrophoretic mobility shift assays (EMSA), the same sequence element was shown to specifically bind a protein that was present in nuclear extracts from JH-exposed, but not from JH-deprived, fat body. Several lines of evidence suggest that the DNA element may be a JH response element (JHRE). The JH-induced protein that binds to it appears to be a transcription factor that activates the initiation of JH target gene (jhp21) transcription, and could be a JH receptor.

  8. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes

    PubMed Central

    Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B.


    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  9. Nonconsensus Protein Binding to Repetitive DNA Sequence Elements Significantly Affects Eukaryotic Genomes.


    Afek, Ariel; Cohen, Hila; Barber-Zucker, Shiran; Gordân, Raluca; Lukatsky, David B


    Recent genome-wide experiments in different eukaryotic genomes provide an unprecedented view of transcription factor (TF) binding locations and of nucleosome occupancy. These experiments revealed that a large fraction of TF binding events occur in regions where only a small number of specific TF binding sites (TFBSs) have been detected. Furthermore, in vitro protein-DNA binding measurements performed for hundreds of TFs indicate that TFs are bound with wide range of affinities to different DNA sequences that lack known consensus motifs. These observations have thus challenged the classical picture of specific protein-DNA binding and strongly suggest the existence of additional recognition mechanisms that affect protein-DNA binding preferences. We have previously demonstrated that repetitive DNA sequence elements characterized by certain symmetries statistically affect protein-DNA binding preferences. We call this binding mechanism nonconsensus protein-DNA binding in order to emphasize the point that specific consensus TFBSs do not contribute to this effect. In this paper, using the simple statistical mechanics model developed previously, we calculate the nonconsensus protein-DNA binding free energy for the entire C. elegans and D. melanogaster genomes. Using the available chromatin immunoprecipitation followed by sequencing (ChIP-seq) results on TF-DNA binding preferences for ~100 TFs, we show that DNA sequences characterized by low predicted free energy of nonconsensus binding have statistically higher experimental TF occupancy and lower nucleosome occupancy than sequences characterized by high free energy of nonconsensus binding. This is in agreement with our previous analysis performed for the yeast genome. We suggest therefore that nonconsensus protein-DNA binding assists the formation of nucleosome-free regions, as TFs outcompete nucleosomes at genomic locations with enhanced nonconsensus binding. In addition, here we perform a new, large-scale analysis using

  10. Satellite DNA-Like Elements Associated With Genes Within Euchromatin of the Beetle Tribolium castaneum

    PubMed Central

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Đurđica


    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5′ untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  11. Nonhomologous-end-joining factors regulate DNA repair fidelity during Sleeping Beauty element transposition in mammalian cells.


    Yant, Stephen R; Kay, Mark A


    Herein, we report that the DNA-dependent protein kinase (DNA-PK) regulates the DNA damage introduced during Sleeping Beauty (SB) element excision and reinsertion in mammalian cells. Using both plasmid- and chromosome-based mobility assays, we analyzed the repair of transposase-induced double-stranded DNA breaks in cells deficient in either the DNA-binding subunit of DNA-PK (Ku) or its catalytic subunit (DNA-PKcs). We found that the free 3' overhangs left after SB element excision were efficiently and accurately processed by the major Ku-dependent nonhomologous-end-joining pathway. Rejoining of broken DNA molecules in the absence of Ku resulted in extensive end degradation at the donor site and greatly increased the frequency of recombination with ectopic templates. Therefore, the major DNA-PK-dependent DNA damage response predominates over more-error-prone repair pathways and thereby facilitates high-fidelity DNA repair during transposon mobilization in mammalian cells. Although transposable elements were not found to be efficiently circularized after transposase-mediated excision, DNA-PK deficiency supported more-frequent transposase-mediated element insertion than was found in wild-type controls. We conclude that, based on its ability to regulate excision site junctional diversity and transposon insertion frequency, DNA-PK serves an important protective role during transpositional recombination in mammals.

  12. Identification of a conserved sequence in the non-coding regions of many human genes

    SciTech Connect

    Donehower, L.A.; Slagle, B.L.; Wilde, M.; Darlington, G.; Butel, J.S. )


    The authors have analyzed a sequence of approximately 70 base pairs (bp) that shows a high degree of similarity to sequences present in the non-coding regions of a number of human and other mammalian genes. The sequence was discovered in a fragment of human genomic DNA adjacent to an integrated hepatitis B virus genome in cells derived from human hepatocellular carcinoma tissue. When one of the viral flanking sequences was compared to nucleotide sequences in GenBank, more than thirty human genes were identified that contained a similar sequence in their non-coding regions. This element was highly conserved at the same position within the corresponding human and mouse genes for myoglobin and N-myc, indicating evolutionary conservation and possible functional importance. Preliminary DNase I footprinting data suggested that the element or its adjacent sequences may bind nuclear factors to generate specific DNase I hypersensitive sites. The size, structure, and evolutionary conservation of this sequence indicates that it is distinct from other types of short interspersed repetitive elements. It is possible that the element may have a cis-acting functional role in the genome.

  13. A histone modification identifies a DNA element controlling slo BK channel gene expression in muscle

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Krishnan, Harish R.; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.


    The slo gene encodes BK type Ca2+-activated K+ channels. In Drosophila, expression of slo is induced by organic solvent sedation (benzyl alcohol and ethanol) and this increase in neural slo expression contributes to the production of functional behavioral tolerance (inducible resistance) to these drugs. Within the slo promoter region, we observed that benzyl alcohol sedation produces a localized spike of histone acetylation over a 65 n conserved DNA element called 55b. Changes in histone acetylation are commonly the consequence of transcription factor activity and previously, a localized histone acetylation spike was used to successfully map a DNA element involved in benzyl alcohol-induced slo expression. To determine whether the 55b element was also involved in benzyl alcohol-induced neural expression of slo we deleted it from the endogenous slo gene by homologous recombination. Flies lacking the 55b element were normal with respect to basal and benzyl alcohol-induced neural slo expression, the capacity to acquire and maintain functional tolerance, their threshold for electrically-induced seizures and most slo-related behaviors. Removal of the 55b element did however increase the level of basal expression from the muscle/tracheal cell-specific slo core promoter and produced a slight increase in overall locomotor activity. We conclude that the 55b element is involved in control of slo expression from the muscle and tracheal-cell promoter but is not involved in the production of functional benzyl alcohol tolerance. PMID:25967280

  14. Identification of the functional elements in the promoter region of human DNA topoisomerase IIIbeta gene.


    Cho, Young Hoon; Park, Jee Young; Han, Sang Youp; Chung, In Kwon


    In this study, we have isolated and characterized the promoter region of the human DNA topoisomerase IIIbeta (hTOP3beta) gene. The 5' RACE assay showed a short exon 1 encoding only the 35-bp untranslated region and suggested the presence of multiple transcription initiation sites. The hTOP3beta gene promoter lacks a canonical TATA box or initiation element and is moderately high in GC content. Transient expression of a luciferase reporter gene under the control of serially deleted 5'-flanking sequence identified an activator element between -141 and -119 upstream of the transcription initiation site and a second regulatory element between -91 and -71. On the basis of scanning mutations of triple nucleotides, we demonstrated that a 5'GGAACC3' element between -117 and -112 plays a critical role in the up-regulation of the basal transcription activity. Changing the 5'GGAACC3' sequence leads to markedly reduced promoter activity. Gel mobility shift assays revealed that the 5'GGAACC3' element is required for DNA binding by the transcription factor complex. These observations lead to the conclusion that the positive regulatory region including the 5'GGAACC3' core element is essential for efficient expression of the hTOP3beta gene as well as for the binding of as yet unidentified regulatory factor(s).

  15. DNA Elements Reducing Transcriptional Gene Silencing Revealed by a Novel Screening Strategy

    PubMed Central

    Ueno, Keiichiro; Ohashi, Yuko; Mitsuhara, Ichiro


    Transcriptional gene silencing (TGS)–a phenomenon observed in endogenous genes/transgenes in eukaryotes–is a huge hindrance to transgenic technology and occurs mainly when the genes involved share sequence homology in their promoter regions. TGS depends on chromosomal position, suggesting the existence of genomic elements that suppress TGS. However, no systematic approach to identify such DNA elements has yet been reported. Here, we developed a successful novel screening strategy to identify such elements (anti-silencing regions–ASRs), based on their ability to protect a flanked transgene from TGS. A silenced transgenic tobacco plant in which a subsequently introduced transgene undergoes obligatory promoter-homology dependent TGS in trans allowed the ability of DNA elements to prevent TGS to be used as the screening criterion. We also identified ASRs in a genomic library from a different plant species (Lotus japonicus: a perennial legume); the ASRs include portions of Ty1/copia retrotransposon-like and pararetrovirus-like sequences; the retrotransposon-like sequences also showed interspecies anti-TGS activity in a TGS-induction system in Arabidopsis. Anti-TGS elements could provide effective tools to reduce TGS and ensure proper regulation of transgene expression. Furthermore, the screening strategy described here will also facilitate the efficient identification of new classes of anti-TGS elements. PMID:23382937

  16. Organization of the cis-acting element required for wheat dwarf geminivirus DNA replication and visualization of a rep protein-DNA complex.


    Sanz-Burgos, A P; Gutiérrez, C


    Initiation of geminivirus DNA replication depends on the activity of the initiator protein (Rep) upon interaction with DNA sequences present in the intergenic region of the viral DNA. In this study, we have analyzed the DNA sequences present in the large intergenic region (LIR) of wheat dwarf virus (WDV), a subgroup I member of the geminivirus family, which are required for viral DNA replication. We have (i) defined the boundaries of the viral cis-acting DNA replication element, (ii) determined the contribution of different domains of the LIR to DNA replication efficiency, and (iii) visualized WDV Rep-DNA complexes. Analysis of unidirectional deletions from both sides of the LIR leads us to establish that a approximately 200-bp cis-acting element (core) is essential for viral DNA replication. It spans approximately 170 and 28 bp upstream and downstream, respectively, from the initiation site (+1), located in the invariant loop. This core element is flanked, at each side, by auxiliary regions (5'-aux and 3'-aux, approximately 70 and approximately 25 bp long, respectively), which contain DNA sequences that stimulate DNA replication. Competition experiments using viral replicating vectors bearing wild-type or mutant WDV LIRs suggest that the auxiliary regions may contribute to the stabilization and/or activity of the initiation complex formed by WDV Rep at the origin. We have visualized DNA-protein complexes by electron microscopy and a high-affinity binding site of WDV Rep protein within the core element has been mapped to approximately 144 +/- 18 bp upstream from the initiation site, between the start site for complementary-sense transcription and the TATA box. Our studies (i) establish the modular structure of the WDV DNA replication cis-acting element and (ii) provide direct evidence for the formation in vitro of a large nucleoprotein complex within the essential cis-acting element.

  17. Recovery and separation of rare earth elements using columns loaded with DNA-filter hybrid.


    Takahashi, Yoshio; Kondo, Kazuhiro; Miyaji, Asami; Umeo, Miyuki; Honma, Tetsuo; Asaoka, Satoshi


    Given that the supply of several rare earth elements (REEs) is sometimes limited, recycling REEs used in various advanced materials, such as Nd magnets, is important for realizing efficient use of REE resources. In the present work, the feasibility of using DNA for REE recovery and separation was examined, along with the identification of the binding site of REEs in DNA. In particular, a DNA-cellulose filter paper hybrid was prepared so that DNA-based materials can be used for the separation of REEs using columns loaded with DNA. N,N'-Disuccinimidyl was used as a cross-linker reagent for the fixation of DNA onto a fibrous cellulose filter. The results showed that (i) the DNA-filter hybrid has a sufficiently high affinity to adsorb REEs; (ii) the adsorption capacity was 0.182 mg/g for Nd; and (iii) the affinity of REEs for DNA was stronger for REEs with larger atomic numbers. The difference of the affinity among REEs in the third result was compared with the adsorption patterns of REEs discussed in the literature. The comparison suggests that phosphate in the DNA-filter paper hybrid was responsible for REE adsorption onto the hybrid. The results were supported by the Nd, Dy, and Lu L(III)-edge EXAFS; the REE-P shell was identified for the second neighboring atom, showing the importance of the phosphate site as REE binding sites. The difference in the affinity among REEs suggest that group separation of REEs (such as La, Ce, (Pr and Nd), (Ho, Dy, and Er), (Tb and Gd), (Sm, Eu), Tm, Yb, and Lu) is possible, although complete isolation of each REE from a solution containing all REEs may be difficult. For practical applications, Nd and Fe(III) were successfully separated from a synthetic solution of Nd magnet waste using columns loaded with the DNA-filter hybrid.

  18. Evaluation of effect of selected trace elements on dynamics of sperm DNA fragmentation.


    Wdowiak, Artur; Bakalczuk, Grzegorz; Bakalczuk, Szymon


    Lead and cadmium can lead to negative effects on sperm chromatin DNA integrity. Copper, zinc and selenium are essential components of many enzymes which are important for reproduction. The aim of this research was to evaluate the influence of lead, cadmium, zinc, copper and selenium on the dynamics of semen DNA fragmentation. The present study concerned 85 fertile and 131 infertile men aged 25-35. DNA fragmentation in the samples was determined after 3 h, 6 h and 12 h. The Pb, Cd, Cu, Zn, and Se measurements were performed by the electrothermal-atomic absorption spectrometry method. We found that sperm DNA fragmentation was a dynamic process which was intensified with an increase in the level of lead in seminal plasma. The levels of lead and cadmium were higher in seminal plasma of infertile men, compared to fertile men. The levels of zinc, copper and selenium in seminal plasma were higher in men with proven fertility, compared to infertile men, and did not exert a significant effect on the dynamics of sperm DNA fragmentation. The level of cadmium had no significant effect on intensification of sperm DNA fragmentation in time. Reports in the literature which concern the effect of trace elements on human reproduction are equivocal. The present study confirmed an unfavourable effect, especially that of lead, on the dynamics of sperm DNA fragmentation; however, these studies need to be expanded and continued in the future.

  19. A DNA unwinding element and an ARS consensus comprise a replication origin within a yeast chromosome.

    PubMed Central

    Huang, R Y; Kowalski, D


    We have defined a replication origin, ORI305, within chromosome III of Saccharomyces cerevisiae by means of mutational analysis. cis-acting elements required for origin activity in the chromosome, as assayed by two-dimensional gel electrophoresis of replication intermediates, are the same as those required for the function of an autonomously replicating sequence, ARS305, in a plasmid. Essential elements include (i) an 11 bp sequence that is a near match to the ARS consensus and (ii) a broad sequence directly 3' to the consensus near match. Origin function is inactivated by point mutations in the essential near match sequence, suggesting that the sequence contributes to specifying the origin in the chromosome. Other consensus near matches with different sequences are present but are not required. The essential 3'-flanking sequence exhibits DNA helical instability and is sensitive to deletion mutations that stabilize the DNA helix. The wild-type 3'-flanking sequence can be functionally substituted by dissimilar sequences that also exhibit helical instability. The requirement for DNA helical instability indicates that the essential 3'-flanking sequence serves as a DNA unwinding element in the chromosome. Images PMID:8223462

  20. Long noncoding RNA turnover

    PubMed Central

    Yoon, Je-Hyun; Kim, Jiyoung; Gorospe, Myriam


    Most RNAs transcribed in mammalian cells lack protein-coding sequences. Among them is a vast family of long (>200 nt) noncoding (lnc)RNAs. LncRNAs can modulate cellular protein expression patterns by influencing the transcription of many genes, the post-transcriptional fate of mRNAs and ncRNAs, and the turnover and localization of proteins. Given the broad impact of lncRNAs on gene regulation, there is escalating interest in elucidating the mechanisms that govern the steady-state levels of lncRNAs. In this review, we summarize our current knowledge of the factors and mechanisms that modulate mammalian lncRNA stability. PMID:25769416

  1. A brief review on the Human Encyclopedia of DNA Elements (ENCODE) project.


    Qu, Hongzhu; Fang, Xiangdong


    The ENCyclopedia Of DNA Elements (ENCODE) project is an international research consortium that aims to identify all functional elements in the human genome sequence. The second phase of the project comprised 1640 datasets from 147 different cell types, yielding a set of 30 publications across several journals. These data revealed that 80.4% of the human genome displays some functionality in at least one cell type. Many of these regulatory elements are physically associated with one another and further form a network or three-dimensional conformation to affect gene expression. These elements are also related to sequence variants associated with diseases or traits. All these findings provide us new insights into the organization and regulation of genes and genome, and serve as an expansive resource for understanding human health and disease. Copyright © 2013. Production and hosting by Elsevier Ltd.

  2. Long non-coding RNA produced by RNA polymerase V determines boundaries of heterochromatin

    PubMed Central

    Böhmdorfer, Gudrun; Sethuraman, Shriya; Rowley, M Jordan; Krzyszton, Michal; Rothi, M Hafiz; Bouzit, Lilia; Wierzbicki, Andrzej T


    RNA-mediated transcriptional gene silencing is a conserved process where small RNAs target transposons and other sequences for repression by establishing chromatin modifications. A central element of this process are long non-coding RNAs (lncRNA), which in Arabidopsis thaliana are produced by a specialized RNA polymerase known as Pol V. Here we show that non-coding transcription by Pol V is controlled by preexisting chromatin modifications located within the transcribed regions. Most Pol V transcripts are associated with AGO4 but are not sliced by AGO4. Pol V-dependent DNA methylation is established on both strands of DNA and is tightly restricted to Pol V-transcribed regions. This indicates that chromatin modifications are established in close proximity to Pol V. Finally, Pol V transcription is preferentially enriched on edges of silenced transposable elements, where Pol V transcribes into TEs. We propose that Pol V may play an important role in the determination of heterochromatin boundaries. DOI: PMID:27779094

  3. Non-coding RNAs in lung cancer

    PubMed Central

    Ricciuti, Biagio; Mecca, Carmen; Crinò, Lucio; Baglivo, Sara; Cenci, Matteo; Metro, Giulio


    The discovery that protein-coding genes represent less than 2% of all human genome, and the evidence that more than 90% of it is actively transcribed, changed the classical point of view of the central dogma of molecular biology, which was always based on the assumption that RNA functions mainly as an intermediate bridge between DNA sequences and protein synthesis machinery. Accumulating data indicates that non-coding RNAs are involved in different physiological processes, providing for the maintenance of cellular homeostasis. They are important regulators of gene expression, cellular differentiation, proliferation, migration, apoptosis, and stem cell maintenance. Alterations and disruptions of their expression or activity have increasingly been associated with pathological changes of cancer cells, this evidence and the prospect of using these molecules as diagnostic markers and therapeutic targets, make currently non-coding RNAs among the most relevant molecules in cancer research. In this paper we will provide an overview of non-coding RNA function and disruption in lung cancer biology, also focusing on their potential as diagnostic, prognostic and predictive biomarkers. PMID:25593996

  4. Functional roles of non-coding Y RNAs.


    Kowalski, Madzia P; Krude, Torsten


    Non-coding RNAs are involved in a multitude of cellular processes but the biochemical function of many small non-coding RNAs remains unclear. The family of small non-coding Y RNAs is conserved in vertebrates and related RNAs are present in some prokaryotic species. Y RNAs are also homologous to the newly identified family of non-coding stem-bulge RNAs (sbRNAs) in nematodes, for which potential physiological functions are only now emerging. Y RNAs are essential for the initiation of chromosomal DNA replication in vertebrates and, when bound to the Ro60 protein, they are involved in RNA stability and cellular responses to stress in several eukaryotic and prokaryotic species. Additionally, short fragments of Y RNAs have recently been identified as abundant components in the blood and tissues of humans and other mammals, with potential diagnostic value. While the number of functional roles of Y RNAs is growing, it is becoming increasingly clear that the conserved structural domains of Y RNAs are essential for distinct cellular functions. Here, we review the biochemical functions associated with these structural RNA domains, as well as the functional conservation of Y RNAs in different species. The existing biochemical and structural evidence supports a domain model for these small non-coding RNAs that has direct implications for the modular evolution of functional non-coding RNAs.

  5. The Contribution of Alu Elements to Mutagenic DNA Double-Strand Break Repair

    PubMed Central

    Streva, Vincent A.; DeFreece, Cecily B.; Hedges, Dale J.; Deininger, Prescott L.


    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both

  6. Cpf1 protein induced bending of yeast centromere DNA element I.

    PubMed Central

    Niedenthal, R K; Sen-Gupta, M; Wilmen, A; Hegemann, J H


    The centromere complex is a multicomponent structure essential for faithful chromosome transmission. Here we show that the S. cerevisiae centromere protein Cpf1 bends centromere DNA element I (CDEI) with the bend angle ranging from 66 degrees to 71 degrees. CDEI DNA sequences that carry point mutations which lead to reduced Cpf1 binding affinity and in vivo centromere activity are still able to show bending. The Cpf1 induced bend is directed towards the major groove with the bend centre located in CDEI. An intrinsic bend cannot replace the Cpf1 induced DNA bend for in vivo centromere function. An in vivo phasing experiment suggests that both the distance and the correct spatial arrangement of the CDEI/Cpf1 complex to CDEII and CDEIII are important for optimal centromere function. Images PMID:8233820

  7. Mobile elements and viral integrations prompt considerations for bacterial DNA integration as a novel carcinogen

    PubMed Central

    Robinson, Kelly M.; Hotopp, Julie C. Dunning


    Insertional mutagenesis has been repeatedly demonstrated in cancer genomes and has a role in oncogenesis. Mobile genetic elements can induce cancer development by random insertion into cancer related genes or by inducing translocations. L1s are typically implicated in cancers of an epithelial cell origin, while Alu elements have been implicated in leukemia as well as epithelial cell cancers. Likewise, viral infections have a significant role in cancer development predominantly through integration into the human genome and mutating or deregulating cancer related genes. Human papilloma virus is the best-known example of viral integrations contributing to carcinogenesis. However, hepatitis B virus, Epstein-Barr virus, and Merkel cell polyomavirus also integrate into the human genome and disrupt cancer related genes. Thus far, the role of microbes in cancer has primarily been attributed to mutations induced through chronic inflammation or toxins, as is the case with Helicobacter pylori and enterotoxigenic Bacteroides fragilis. We hypothesize that like mobile elements and viral DNA, bacterial and parasitic DNA may also integrate into the human somatic genome and be oncogenic. Until recently it was believed that bacterial DNA could not integrate into the human genome, but new evidence demonstrates that bacterial insertional mutagenesis may occur in cancer cells. Although this work does not show causation between bacterial insertions and cancer, it prompts more research in this area. Promising new sequencing technologies may reduce the risk of artifactual chimeric sequences, thus diminishing some of the challenges of identifying novel insertions in the somatic human genome. PMID:24956175

  8. Transcriptional activation of short interspersed elements by DNA-damaging agents.


    Rudin, C M; Thompson, C B


    Short interspersed elements (SINEs), typified by the human Alu repeat, are RNA polymerase III (pol III)-transcribed sequences that replicate within the genome through an RNA intermediate. Replication of SINEs has been extensive in mammalian evolution: an estimated 5% of the human genome consists of Alu repeats. The mechanisms regulating transcription, reverse transcription, and reinsertion of SINE elements in genomic DNA are poorly understood. Here we report that expression of murine SINE transcripts of both the B1 and B2 classes is strongly upregulated after prolonged exposure to cisplatin, etoposide, or gamma radiation. A similar induction of Alu transcripts in human cells occurs under these conditions. This induction is not due to a general upregulation of pol III activity in either species. Genotoxic treatment of murine cells containing an exogenous human Alu element induced Alu transcription. Concomitant with the increased expression of SINEs, an increase in cellular reverse transcriptase was observed after exposure to these same DNA-damaging agents. These findings suggest that genomic damage may be an important activator of SINEs, and that SINE mobility may contribute to secondary malignancy after exposure to DNA-damaging chemotherapy.

  9. Prenatal exposure to mixtures of xenoestrogens and repetitive element DNA methylation changes in human placenta

    PubMed Central

    Vilahur, Nadia; Bustamante, Mariona; Byun, Hyang-Min; Fernandez, Mariana F.; Marina, Loreto Santa; Basterrechea, Mikel; Ballester, Ferran; Murcia, Mario; Tardón, Adonina; Fernández-Somoano, Ana; Estivill, Xavier; Olea, Nicolas; Sunyer, Jordi; Baccarelli, Andrea A.


    Background Prenatal exposure to endocrine disrupting compounds (EDCs) has previously shown to alter epigenetic marks. Objectives In this work we explore whether prenatal exposure to mixtures of xenoestrogens has the potential to alter the placenta epigenome, by studying DNA methylation in retrotransposons as a surrogate of global DNA methylation. Methods The biomarker Total Effective Xenoestrogen Burden (TEXB) was measured in 192 placentas from participants in the longitudinal INMA Project. DNA methylation was quantitatively assessed by bisulfite pyrosequencing on 10 different retrotransposons including 3 different long interspersed nuclear elements (LINEs), 4 short interspersed nuclear elements (SINEs) and 3 human endogenous retrovirus (HERVs). Associations were tested using linear mixed-effects regression models and sex interaction was evaluated. Results A significant sex interaction was observed for AluYb8 (p value for interaction <0.001, significant at Bonferroni corrected p-value threshold of 0.0025). Boys with the highest TEXB-alpha levels of exposure (third tertile) presented on average a decrease of 0.84% in methylation compared to those in the first tertile (p value<0.001), while no significant effects were found in girls (p value= 0.134). Conclusions Our findings suggest that boys may be more susceptible to the effect of exposure to xenoestrogens during prenatal development, producing shifts in DNA methylation of certain sensitive genomic repetitive sequences in a tissue important for fetal growth and development. PMID:24980756

  10. Repetitive Element DNA Methylation and Circulating Endothelial and Inflammation Markers in the VA Normative Aging Study

    PubMed Central

    Baccarelli, Andrea; Tarantini, Letizia; Wright, Robert O.; Bollati, Valentina; Litonjua, Augusto A.; Zanobetti, Antonella; Sparrow, David; Vokonas, Pantel; Schwartz, Joel


    BACKGROUND Lower blood DNA methylation has been associated with atherosclerosis and high cardiovascular risk. Mechanisms linking DNA hypomethylation to increased cardiovascular risk are still largely unknown. In a population of community-dwelling elderly individuals, we evaluated whether DNA methylation in LINE-1 repetitive element, heavily methylated sequences dispersed throughout the human genome, was associated with circulating Vascular Cell Adhesion Molecule-1 (VCAM-1), Inter-Cellular Adhesion Molecule-1 (ICAM-1), and C-reactive protein (CRP). METHODS AND RESULTS We measured LINE-1 methylation by bisulfite PCR-Pyrosequencing on 742 blood DNA samples from male participants in the Boston area Normative Aging Study (mean age=74.8 years). Mean serum VCAM-1 increased progressively in association with LINE-1 hypomethylation (from 975.2 to 1063.4 ng/ml in the highest vs. lowest methylation quintiles; p-trend=0.004). The association between VCAM-1 and LINE-1 hypomethylation was significant in individuals without ischemic heart disease or stroke (n=480; p=0.001), but not in those with prevalent disease (n=262; p=0.57). Serum ICAM-1 and CRP were not associated with LINE-1 methylation (p-trend=>0.25). All results were confirmed by multivariable analyses adjusting for age, BMI, smoking, pack-years, and ischemic heart disease/stroke. CONCLUSIONS LINE-1 element hypomethylation is associated with higher serum VCAM-1. Our data provide new insights into epigenetic events that may accompany the development of cardiovascular disease. PMID:20305373

  11. Effect of oxidative DNA damage in promoter elements on transcription factor binding.


    Ghosh, R; Mitchell, D L


    Reactive oxygen species produced by endogenous metabolic activity and exposure to a multitude of exogenous agents impact cells in a variety of ways. The DNA base damage 8-oxodeoxyguanosine (8-oxodG) is a prominent indicator of oxidative stress and has been well-characterized as a premutagenic lesion in mammalian cells and putative initiator of the carcinogenic process. Commensurate with the recent interest in epigenetic pathways of cancer causation we investigated how 8-oxodG alters the interaction between cis elements located on gene promoters and sequence-specific DNA binding proteins associated with these promoters. Consensus binding sequences for the transcription factors AP-1, NF-kappaB and Sp1 were modified site-specifically at guanine residues and electrophoretic mobility shift assays were performed to assess DNA-protein interactions. Our results indicate that whereas a single 8-oxodG was sufficient to inhibit transcription factor binding to AP-1 and Sp1 sequences it had no effect on binding to NF-kappaB, regardless of its position. We conclude from these data that minor alterations in base composition at a crucial position within some, but not all, promoter elements have the ability to disrupt transcription factor binding. The lack of inhibition by damaged NF-kappaB sequences suggests that DNA-protein contact sites may not be as determinative for stable p50 binding to this promoter as other, as yet undefined, structural parameters.

  12. Nanoparticle-labeled DNA capture elements for detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Holwitt, Eric A.; Parker, Jill E.; Vivekananda, Jeevalatha; Franz, Veronica


    Aptamers, synthetic DNA capture elements (DCEs), can be made chemically or in genetically engineered bacteria. DNA capture elements are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare or terrorism agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. The probes can then be conjugated to Quantum Dots and super paramagnetic nanoparticles. The former provide intense, bleach-resistant fluorescent detection of bioagent and the latter provide a means to collect the bioagents with a magnet. The fluorescence can be detected in a flow cytometer, in a fluorescence plate reader, or with a fluorescence microscope. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. DCEs can easily distinguish Bacillus anthracis from its nearest relatives, Bacillus cereus and Bacillus thuringiensis. Development of a high through-put process is currently being investigated.

  13. The fission yeast CENP-B protein Abp1 prevents pervasive transcription of repetitive DNA elements.


    Daulny, Anne; Mejía-Ramírez, Eva; Reina, Oscar; Rosado-Lugo, Jesus; Aguilar-Arnal, Lorena; Auer, Herbert; Zaratiegui, Mikel; Azorin, Fernando


    It is well established that eukaryotic genomes are pervasively transcribed producing cryptic unstable transcripts (CUTs). However, the mechanisms regulating pervasive transcription are not well understood. Here, we report that the fission yeast CENP-B homolog Abp1 plays an important role in preventing pervasive transcription. We show that loss of abp1 results in the accumulation of CUTs, which are targeted for degradation by the exosome pathway. These CUTs originate from different types of genomic features, but the highest increase corresponds to Tf2 retrotransposons and rDNA repeats, where they map along the entire elements. In the absence of abp1, increased RNAPII-Ser5P occupancy is observed throughout the Tf2 coding region and, unexpectedly, RNAPII-Ser5P is enriched at rDNA repeats. Loss of abp1 also results in Tf2 derepression and increased nucleolus size. Altogether these results suggest that Abp1 prevents pervasive RNAPII transcription of repetitive DNA elements (i.e., Tf2 and rDNA repeats) from internal cryptic sites.

  14. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P


    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  15. Bacterial repetitive extragenic palindromic sequences are DNA targets for Insertion Sequence elements

    PubMed Central

    Tobes, Raquel; Pareja, Eduardo


    Background Mobile elements are involved in genomic rearrangements and virulence acquisition, and hence, are important elements in bacterial genome evolution. The insertion of some specific Insertion Sequences had been associated with repetitive extragenic palindromic (REP) elements. Considering that there are a sufficient number of available genomes with described REPs, and exploiting the advantage of the traceability of transposition events in genomes, we decided to exhaustively analyze the relationship between REP sequences and mobile elements. Results This global multigenome study highlights the importance of repetitive extragenic palindromic elements as target sequences for transposases. The study is based on the analysis of the DNA regions surrounding the 981 instances of Insertion Sequence elements with respect to the positioning of REP sequences in the 19 available annotated microbial genomes corresponding to species of bacteria with reported REP sequences. This analysis has allowed the detection of the specific insertion into REP sequences for ISPsy8 in Pseudomonas syringae DC3000, ISPa11 in P. aeruginosa PA01, ISPpu9 and ISPpu10 in P. putida KT2440, and ISRm22 and ISRm19 in Sinorhizobium meliloti 1021 genome. Preference for insertion in extragenic spaces with REP sequences has also been detected for ISPsy7 in P. syringae DC3000, ISRm5 in S. meliloti and ISNm1106 in Neisseria meningitidis MC58 and Z2491 genomes. Probably, the association with REP elements that we have detected analyzing genomes is only the tip of the iceberg, and this association could be even more frequent in natural isolates. Conclusion Our findings characterize REP elements as hot spots for transposition and reinforce the relationship between REP sequences and genomic plasticity mediated by mobile elements. In addition, this study defines a subset of REP-recognizer transposases with high target selectivity that can be useful in the development of new tools for genome manipulation. PMID

  16. LINE-1 Retrotransposable Element DNA Accumulates in HIV-1-Infected Cells

    PubMed Central

    Song, Haihan; Xu, Yang; Garrison, Keith E.; Buzdin, Anton A.; Anwar, Naveed; Hunter, Diana V.; Mujib, Shariq; Mihajlovic, Vesna; Martin, Eric; Lee, Erika; Kuciak, Monika; Raposo, Rui André Saraiva; Bozorgzad, Ardalan; Meiklejohn, Duncan A.; Ndhlovu, Lishomwa C.; Nixon, Douglas F.; Ostrowski, Mario A.


    Type 1 long-interspersed nuclear elements (L1s) are autonomous retrotransposable elements that retain the potential for activity in the human genome but are suppressed by host factors. Retrotransposition of L1s into chromosomal DNA can lead to genomic instability, whereas reverse transcription of L1 in the cytosol has the potential to activate innate immune sensors. We hypothesized that HIV-1 infection would compromise cellular control of L1 elements, resulting in the induction of retrotransposition events. Here, we show that HIV-1 infection enhances L1 retrotransposition in Jurkat cells in a Vif- and Vpr-dependent manner. In primary CD4+ cells, HIV-1 infection results in the accumulation of L1 DNA, at least the majority of which is extrachromosomal. These data expose an unrecognized interaction between HIV-1 and endogenous retrotransposable elements, which may have implications for the innate immune response to HIV-1 infection, as well as for HIV-1-induced genomic instability and cytopathicity. PMID:24089548

  17. LINE-1 retrotransposable element DNA accumulates in HIV-1-infected cells.


    Jones, R Brad; Song, Haihan; Xu, Yang; Garrison, Keith E; Buzdin, Anton A; Anwar, Naveed; Hunter, Diana V; Mujib, Shariq; Mihajlovic, Vesna; Martin, Eric; Lee, Erika; Kuciak, Monika; Raposo, Rui André Saraiva; Bozorgzad, Ardalan; Meiklejohn, Duncan A; Ndhlovu, Lishomwa C; Nixon, Douglas F; Ostrowski, Mario A


    Type 1 long-interspersed nuclear elements (L1s) are autonomous retrotransposable elements that retain the potential for activity in the human genome but are suppressed by host factors. Retrotransposition of L1s into chromosomal DNA can lead to genomic instability, whereas reverse transcription of L1 in the cytosol has the potential to activate innate immune sensors. We hypothesized that HIV-1 infection would compromise cellular control of L1 elements, resulting in the induction of retrotransposition events. Here, we show that HIV-1 infection enhances L1 retrotransposition in Jurkat cells in a Vif- and Vpr-dependent manner. In primary CD4(+) cells, HIV-1 infection results in the accumulation of L1 DNA, at least the majority of which is extrachromosomal. These data expose an unrecognized interaction between HIV-1 and endogenous retrotransposable elements, which may have implications for the innate immune response to HIV-1 infection, as well as for HIV-1-induced genomic instability and cytopathicity.

  18. Hypoxic regulation of the noncoding genome and NEAT1

    PubMed Central

    Choudhry, Hani


    Activation of hypoxia pathways is both associated with and contributes to an aggressive phenotype across multiple types of solid cancers. The regulation of gene transcription by hypoxia-inducible factor (HIF) is a key element in this response. HIF directly upregulates the expression of many hundreds of protein-coding genes, which act to both improve oxygen delivery and to reduce oxygen demand. However, it is now becoming apparent that many classes of noncoding RNAs are also regulated by hypoxia, with several (e.g. micro RNAs, long noncoding RNAs and antisense RNAs) under direct transcriptional regulation by HIF. These hypoxia-regulated, noncoding RNAs may act as effectors of the indirect response to HIF by acting on specific coding transcripts or by affecting generic RNA-processing pathways. In addition, noncoding RNAs may also act as modulators of the HIF pathway, either by integrating other physiological responses or, in the case of HIF-regulated, noncoding RNAs, by providing negative or positive feedback and feedforward loops that affect upstream or downstream components of the HIF cascade. These hypoxia-regulated, noncoding transcripts play important roles in the aggressive hypoxic phenotype observed in cancer. PMID:26590207

  19. Identification of sequence elements contributing to the intrinsic curvature of the mouse satellite DNA repeat.

    PubMed Central

    Carrera, P; Martínez-Balbás, M A; Portugal, J; Azorín, F


    In this paper, the contribution of different sequence elements to the intrisic curvature of the mouse satellite DNA repeat was investigated. This DNA fragment contains nineteen groups of three or more consecutive adenines which are only poorly phased with respect to the helical repeat. The mouse satellite DNA repeat shows a sinusoidal pattern of cleavage by the hydroxyl radical; the waves of reactivity are phased with respect to the A-tracts. Some interesting observations arise from a detailed analysis of these cleavage patterns: a) the maxima of hydroxyl radical cleavage are more periodically spaced along the DNA sequence than the A-tracts themselves. As a consequence, the position of each maximum with respect to the A-tract is variable; b) the sequence 5' TGGAATATG/AA 3' shows a sinusoidal pattern of hydroxyl radical cleavage. This sequence shows a retarded migration in polyacrylamide gels indicating that it is actually intrinsically curved. These results are discussed in view of the current models for DNA curvature. Images PMID:1658737

  20. Tec3, a New Developmentally Eliminated DNA Element in Euplotes crassus

    PubMed Central

    Jacobs, Mary Ellen; Sánchez-Blanco, Adolfo; Katz, Laura A.; Klobutcher, Lawrence A.


    More than 100,000 interstitial segments of DNA (internal eliminated sequences [IESs]) are excised from the genome during the formation of a new macronucleus in Euplotes crassus. IESs include unique sequence DNA as well as two related families of transposable elements, Tec1 and Tec2. Here we describe a new class of E. crassus transposons, Tec3, which is present in 20 to 30 copies in the micronuclear genome. Tec3 elements have long inverted terminal repeats and contain a degenerate open reading frame encoding a tyrosine-type recombinase. One characterized copy of Tec3 (Tec3-1) is 4.48 kbp long, has 1.23-kbp inverted terminal repeats, and resides within the micronuclear copy of the ribosomal protein L29 gene (RPL29). The 23 bp at the extreme ends of this element are very similar to those in other E. crassus IESs and, like these other IESs, Tec3-1 is excised during the polytene chromosome stage of macronuclear development to generate a free circular form with an unusual junction structure. In contrast, a second cloned element, Tec3-2, is quite similar to Tec3-1 but lacks the terminal 258 bp of the inverted repeats, so that its ends do not resemble the other E. crassus IES termini. The Tec3-2 element appears to reside in a large segment of the micronuclear genome that is subject to developmental elimination. Models for the origins of these two types of Tec3 elements are presented, along with a discussion of how some members of this new transposon family may have come to be excised by the same machinery that removes other E. crassus IESs. PMID:12582127

  1. Phylogenetic footprinting of non-coding RNA: hammerhead ribozyme sequences in a satellite DNA family of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae)

    PubMed Central


    Background The great variety in sequence, length, complexity, and abundance of satellite DNA has made it difficult to ascribe any function to this genome component. Recent studies have shown that satellite DNA can be transcribed and be involved in regulation of chromatin structure and gene expression. Some satellite DNAs, such as the pDo500 sequence family in Dolichopoda cave crickets, have a catalytic hammerhead (HH) ribozyme structure and activity embedded within each repeat. Results We assessed the phylogenetic footprints of the HH ribozyme within the pDo500 sequences from 38 different populations representing 12 species of Dolichopoda. The HH region was significantly more conserved than the non-hammerhead (NHH) region of the pDo500 repeat. In addition, stems were more conserved than loops. In stems, several compensatory mutations were detected that maintain base pairing. The core region of the HH ribozyme was affected by very few nucleotide substitutions and the cleavage position was altered only once among 198 sequences. RNA folding of the HH sequences revealed that a potentially active HH ribozyme can be found in most of the Dolichopoda populations and species. Conclusions The phylogenetic footprints suggest that the HH region of the pDo500 sequence family is selected for function in Dolichopoda cave crickets. However, the functional role of HH ribozymes in eukaryotic organisms is unclear. The possible functions have been related to trans cleavage of an RNA target by a ribonucleoprotein and regulation of gene expression. Whether the HH ribozyme in Dolichopoda is involved in similar functions remains to be investigated. Future studies need to demonstrate how the observed nucleotide changes and evolutionary constraint have affected the catalytic efficiency of the hammerhead. PMID:20047671

  2. Effects of trace elements and pesticides on dephosphorylation of RNA and DNA added to soils

    SciTech Connect

    Frankenberger, W.T. Jr.; Johanson, J.B.; Lund L.J.


    This study was carried out to assess the effects of 14 trace elements, 12 herbicides, and two fungicides on dephosphorylation of yeast ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) added to soils (Xerollic Calciorthids and Typic Haploxeralfs). The cumulative amount of ortho phosphate (Pi) released from nucleic acids increased linearly with time of incubation (up to 72 h), decreased with profile depth, and was highly influenced by soil pH. When trace elements were applied and compared by using 2.5 mmol kg/sup -1/ of soil, the average inhibition in dephosphorylation of RNA and DNA in two soils ranged from 17% with Co(II) to 52% with Cu(II). The most effective inhibitors of nucleic acid dephosphorylation were Ag(I), Cu(I), Cd(II), Cu(II), Mn(II), Ni(II), and Pb(II) (avg inhibition greater than or equal to 35%). Other elements that inhibited dephosphorylation of RNA and DNA added to soils included Ba(II), Co(II), Hg(II), Zn(II), Ti(IV), V(IV), and W(VI). When the pesticides were compared by using 5 mg of active ingredient kg/sup -1/ of soil, the average inhibition in nucleic acid dephosphorylation ranged from 14% with butylate to 39% with chloramben. The most effective inhibitors (> 25%) were atrazine, naptalam, chloramben, dicamba, trifluralin, and maneb. Other pesticides that inhibited RNA and DNA dephosphorylation in soils included cyanazine, 2,4-D, dinitroamine, EPTC plus R-25788, alachlor, paraquat, butylate, and captan.

  3. Selective constraint on noncoding regions of hominid genomes.


    Bush, Eliot C; Lahn, Bruce T


    An important challenge for human evolutionary biology is to understand the genetic basis of human-chimpanzee differences. One influential idea holds that such differences depend, to a large extent, on adaptive changes in gene expression. An important step in assessing this hypothesis involves gaining a better understanding of selective constraint on noncoding regions of hominid genomes. In noncoding sequence, functional elements are frequently small and can be separated by large nonfunctional regions. For this reason, constraint in hominid genomes is likely to be patchy. Here we use conservation in more distantly related mammals and amniotes as a way of identifying small sequence windows that are likely to be functional. We find that putatively functional noncoding elements defined in this manner are subject to significant selective constraint in hominids.

  4. DNA methylation mediated up-regulation of TERRA non-coding RNA is coincident with elongated telomeres in the human placenta.


    Novakovic, Boris; Napier, Christine E; Vryer, Regan; Dimitriadis, Eva; Manuelpillai, Ursula; Sharkey, Andrew; Craig, Jeffrey M; Reddel, Roger R; Saffery, Richard


    What factors regulate elongated telomere length in the human placenta? Hypomethylation of TERRA promoters in the human placenta is associated with high TERRA expression, however, no clear mechanistic link between these phenomena and elongated telomere length in the human placenta was found. Human placenta tissue and trophoblasts show longer telomere lengths compared to gestational age-matched somatic cells. However, telomerase (hTERT) expression and activity in the placenta is low, suggesting a role for an alternative lengthening of telomeres (ALT). While ALT is observed in 10-15% of human cancers and in some mouse stem cells, ALT has never been reported in non-cancerous human tissues. Human term placental tissue and matched cord blood mononuclear cells (CBMCs) were collected as part of the Peri/Postnatal Epigenetic Twins study (PETS). In addition, first trimester placental villi, purified cytotrophoblasts, choriocarcinoma cell lines and a panel of ALT-positive cancer cell lines were tested. Telomere length was determined using the Terminal Restriction Fragment (TRF) assay and a relative quantitative PCR method. DNA methylation levels at several CpG rich subtelomeric TERRA promoters were determined using bisulfite conversion and the SEQUENOM EpiTYPER platform. Expression of TERRA and hTERT was determined using quantitative RT-PCR. ALT was assessed using the C-circle assay (CCA). The human placenta tissue and purified first trimester trophoblasts showed low subtelomeric (TERRA) DNA methylation compared to matched CBMCs and other somatic cells. Interestingly placental TERRA methylation was lower than ALT-cancer cell lines, previously reported to be hypomethylated at these loci. Low TERRA methylation was associated with higher expression of TERRA RNA in placenta compared to matched CBMCs. Detectable levels of C-circles were observed in first trimester placental villi, but not term placenta, suggesting that the ALT mechanism may be active in specific placental cells in

  5. Phylogenetic relationships of Aristida and relatives (Poaceae, Aristidoideae) based on noncoding chloroplast (trnL-F, rpl16) and nuclear (ITS) DNA sequences.


    Cerros-Tlatilpa, Rosa; Columbus, J Travis; Barker, Nigel P


    The cosmopolitan and ecologically important grass subfamily Aristidoideae comprises the widely distributed genus Aristida (250-290 species), Stipagrostis (50 species, with an African-Asian distribution), and Sartidia (five species, Africa and Madagascar). The subfamily includes species with C(3) (Sartidia and a single species of Aristida) and C(4) photosynthetic pathways. Rigorous phylogenetic reconstructions of species relationships are required to explain the biogeographic, physiological, and ecological diversity within this subfamily. Chloroplast (trnL-F, rpl16) and nuclear (ITS) DNA sequences were obtained from 198 accessions, and the combined data set was subjected to parsimony, maximum likelihood, and Bayesian inference analyses. Dating analyses calibrated using previously published node ages were conducted to determine the ages of major radiations. The C(3) Sartidia is sister to a monophyletic Stipagrostis, and the (Sartidia, Stipagrostis) clade is sister to Aristida. Within Aristida, the only known C(3) species, A. longifolia, is sister to the remainder of the genus. Infrageneric sections of Aristida were not supported, and there are no synapomorphic morphological characters for the clades retrieved. Within Aristida, monophyletic Australian, African, North American, and South American clades are retrieved. The subfamily dates back to the late Miocene, with the major lineages present by the Pliocene. With one exception, regional clades of Aristida evolved in the Pliocene. The C(3) photosynthetic pathway is hypothesized to be the pleisomorphic condition for the subfamily, wherein two independent C(4) pathways (each with unique anatomical and genetic features) evolved, one within Aristida and one in Stipagrostis.

  6. A Land Plant-Specific Transcription Factor Directly Enhances Transcription of a Pathogenic Noncoding RNA Template by DNA-Dependent RNA Polymerase II[OPEN

    PubMed Central

    Qu, Jie; Ji, Shaoyi; Wallace, Andrew J.; Wu, Jian; Li, Yi; Gopalan, Venkat; Ding, Biao


    Some DNA-dependent RNA polymerases (DdRPs) possess RNA-dependent RNA polymerase activity, as was first discovered in the replication of Potato spindle tuber viroid (PSTVd) RNA genome in tomato (Solanum lycopersicum). Recent studies revealed that this activity in bacteria and mammals is important for transcriptional and posttranscriptional regulatory mechanisms. Here, we used PSTVd as a model to uncover auxiliary factors essential for RNA-templated transcription by DdRP. PSTVd replication in the nucleoplasm generates (−)-PSTVd intermediates and (+)-PSTVd copies. We found that the Nicotiana benthamiana canonical 9-zinc finger (ZF) Transcription Factor IIIA (TFIIIA-9ZF) as well as its variant TFIIIA-7ZF interacted with (+)-PSTVd, but only TFIIIA-7ZF interacted with (−)-PSTVd. Suppression of TFIIIA-7ZF reduced PSTVd replication, and overexpression of TFIIIA-7ZF enhanced PSTVd replication in planta. Consistent with the locale of PSTVd replication, TFIIIA-7ZF was found in the nucleoplasm and nucleolus, in contrast to the strictly nucleolar localization of TFIIIA-9ZF. Footprinting assays revealed that only TFIIIA-7ZF bound to a region of PSTVd critical for initiating transcription. Furthermore, TFIIIA-7ZF strongly enhanced the in vitro transcription of circular (+)-PSTVd by partially purified Pol II. Together, our results identify TFIIIA-7ZF as a dedicated cellular transcription factor that acts in DdRP-catalyzed RNA-templated transcription, highlighting both the extraordinary evolutionary adaptation of viroids and the potential of DdRPs for a broader role in cellular processes. PMID:27113774

  7. Chilean Pitavia more closely related to Oceania and Old World Rutaceae than to Neotropical groups: evidence from two cpDNA non-coding regions, with a new subfamilial classification of the family

    PubMed Central

    Groppo, Milton; Kallunki, Jacquelyn A.; Pirani, José Rubens; Antonelli, Alexandre


    Abstract The position of the plant genus Pitavia within an infrafamilial phylogeny of Rutaceae (rue, or orange family) was investigated with the use of two non-coding regions from cpDNA, the trnL-trnF region and the rps16 intron. The only species of the genus, Pitavia punctata Molina, is restricted to the temperate forests of the Coastal Cordillera of Central-Southern Chile and threatened by loss of habitat. The genus traditionally has been treated as part of tribe Zanthoxyleae (subfamily Rutoideae) where it constitutes the monogeneric tribe Pitaviinae. This tribe and genus are characterized by fruits of 1 to 4 fleshy drupelets, unlike the dehiscent fruits typical of the subfamily. Fifty-five taxa of Rutaceae, representing 53 genera (nearly one-third of those in the family) and all subfamilies, tribes, and almost all subtribes of the family were included. Parsimony and Bayesian inference were used to infer the phylogeny; six taxa of Meliaceae, Sapindaceae, and Simaroubaceae, all members of Sapindales, were also used as out-groups. Results from both analyses were congruent and showed Pitavia as sister to Flindersia and Lunasia, both genera with species scattered through Australia, Philippines, Moluccas, New Guinea and the Malayan region, and phylogenetically far from other Neotropical Rutaceae, such as the Galipeinae (Galipeeae, Rutoideae) and Pteleinae (Toddalieae, former Toddalioideae). Additionally, a new circumscription of the subfamilies of Rutaceae is presented and discussed. Only two subfamilies (both monophyletic) are recognized: Cneoroideae (including Dictyolomatoideae, Spathelioideae, Cneoraceae, and Ptaeroxylaceae) and Rutoideae (including not only traditional Rutoideae but also Aurantioideae, Flindersioideae, and Toddalioideae). As a consequence, Aurantioideae (Citrus and allies) is reduced to tribal rank as Aurantieae. PMID:23717188

  8. A positive cis-acting DNA element is required for high-level transcription in Chlamydia.


    Schaumburg, C S; Tan, M


    The spacer A/T region is a positive cis-acting DNA element that was identified in the Chlamydia trachomatis rRNA promoter region. We have now demonstrated that similar sequences in other chlamydial promoters are important for transcription. Substitution of candidate spacer A/T regions in four chlamydial promoters decreased transcription by partially purified C. trachomatis RNA polymerase in an in vitro transcription assay. Addition of a spacer A/T region to the dnaK promoter, which does not contain an identifiable spacer A/T region, increased transcription 16-fold. Transcription of Escherichia coli promoters by C. trachomatis RNA polymerase also appeared to be dependent on the spacer A/T region. However, the effect of the spacer A/T region on transcription by E. coli RNA polymerase was small. In summary, the spacer A/T region is a novel DNA element that is required for high-level transcription of many promoters by chlamydial RNA polymerase.

  9. A Positive cis-Acting DNA Element Is Required for High-Level Transcription in Chlamydia

    PubMed Central

    Schaumburg, Chris S.; Tan, Ming


    The spacer A/T region is a positive cis-acting DNA element that was identified in the Chlamydia trachomatis rRNA promoter region. We have now demonstrated that similar sequences in other chlamydial promoters are important for transcription. Substitution of candidate spacer A/T regions in four chlamydial promoters decreased transcription by partially purified C. trachomatis RNA polymerase in an in vitro transcription assay. Addition of a spacer A/T region to the dnaK promoter, which does not contain an identifiable spacer A/T region, increased transcription 16-fold. Transcription of Escherichia coli promoters by C. trachomatis RNA polymerase also appeared to be dependent on the spacer A/T region. However, the effect of the spacer A/T region on transcription by E. coli RNA polymerase was small. In summary, the spacer A/T region is a novel DNA element that is required for high-level transcription of many promoters by chlamydial RNA polymerase. PMID:10960101

  10. Menin and JunD regulate gastrin gene expression through proximal DNA elements.


    Mensah-Osman, Edith J; Veniaminova, Natalia A; Merchant, Juanita L


    Mutations in the MEN1 gene correlate with multiple endocrine neoplasia I (MEN1). Gastrinomas are the most malignant of the neuroendocrine tumors associated with MEN1. Because menin and JunD proteins interact, we examined whether JunD binds to and regulates the gastrin gene promoter. Both menin and JunD are ubiquitous nuclear proteins that we showed colocalize in the gastrin-expressing G cells of the mouse antrum. Transfection with a JunD expression vector alone induced endogenous gastrin mRNA in AGS human gastric cells, and the induction was blocked by menin overexpression. We mapped repression by menin to both a nonconsensus AP-1 site and proximal GC-rich elements within the human gastrin promoter. Chromatin immunoprecipitation assays, EMSAs, and DNA affinity precipitation assays documented that JunD and Sp1 proteins bind these two elements and are both targets for menin regulation. Consistent with menin forming a complex with histone deacetylases, we found that repression of gastrin gene expression by menin was reversed by trichostatin A. In conclusion, proximal DNA elements within the human gastrin gene promoter mediate interactions between JunD, which induces gastrin gene expression and menin, which suppresses JunD-mediated activation.

  11. Long noncoding RNAs in hematopoiesis

    PubMed Central

    Zhang, Xu; Hu, Wenqian


    Mammalian development is under tight control to ensure precise gene expression. Recent studies reveal a new layer of regulation of gene expression mediated by long noncoding RNAs. These transcripts are longer than 200nt that do not have functional protein coding capacity. Interestingly, many of these long noncoding RNAs are expressed with high specificity in different types of cells, tissues, and developmental stages in mammals, suggesting that they may have functional roles in diverse biological processes. Here, we summarize recent findings of long noncoding RNAs in hematopoiesis, which is one of the best-characterized mammalian cell differentiation processes. Then we provide our own perspectives on future studies of long noncoding RNAs in this field. PMID:27508063

  12. Long noncoding RNA and epigenomics.


    Kanduri, Chandrasekhar


    Accumulating evidence over the last decade has presented us with the intriguing observation that the majority of eukaryotic genomes are pervasively transcribed to encode a complex network of small and long noncoding RNAs. Long noncoding RNAs are of particular interest, as they were once thought to be restricted to housekeeping functions and are now linked to a wide variety of biological functions related to physiology, embryology and development. Emerging evidence indicates that a subset of long noncoding RNAs mediate their biological functions by using chromatin as a substrate, to index the genetic information encoded in the genome. This chapter will discuss how noncoding RNAs and the processes underlying their transcription mediate transcriptional regulation, by epigenetically regulating the structure of chromatin in various biological contexts.

  13. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine

    PubMed Central

    Williams, Ryan M.; Crihfield, Cassandra L.; Gattu, Srikanth; Holland, Lisa A.; Sooter, Letha J.


    Widespread use of the chlorotriazine herbicide, atrazine, has led to serious environmental and human health consequences. Current methods of detecting atrazine contamination are neither rapid nor cost-effective. In this work, atrazine-specific single-stranded DNA (ssDNA) molecular recognition elements (MRE) were isolated. We utilized a stringent Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology that placed the greatest emphasis on what the MRE should not bind to. After twelve rounds of SELEX, an atrazine-specific MRE with high affinity was obtained. The equilibrium dissociation constant (Kd) of the ssDNA sequence is 0.62 ± 0.21 nM. It also has significant selectivity for atrazine over atrazine metabolites and other pesticides found in environmentally similar locations and concentrations. Furthermore, we have detected environmentally relevant atrazine concentrations in river water using this MRE. The strong affinity and selectivity of the selected atrazine-specific ssDNA validated the stringent SELEX methodology and identified a MRE that will be useful for rapid atrazine detection in environmental samples. PMID:25196435

  14. Epigenomic annotation of noncoding mutations identifies mutated pathways in primary liver cancer

    PubMed Central

    Lowdon, Rebecca F.


    Evidence that noncoding mutation can result in cancer driver events is mounting. However, it is more difficult to assign molecular biological consequences to noncoding mutations than to coding mutations, and a typical cancer genome contains many more noncoding mutations than protein-coding mutations. Accordingly, parsing functional noncoding mutation signal from noise remains an important challenge. Here we use an empirical approach to identify putatively functional noncoding somatic single nucleotide variants (SNVs) from liver cancer genomes. Annotation of candidate variants by publicly available epigenome datasets finds that 40.5% of SNVs fall in regulatory elements. When assigned to specific regulatory elements, we find that the distribution of regulatory element mutation mirrors that of nonsynonymous coding mutation, where few regulatory elements are recurrently mutated in a patient population but many are singly mutated. We find potential gain-of-binding site events among candidate SNVs, suggesting a mechanism of action for these variants. When aggregating noncoding somatic mutation in promoters, we find that genes in the ERBB signaling and MAPK signaling pathways are significantly enriched for promoter mutations. Altogether, our results suggest that functional somatic SNVs in cancer are sporadic, but occasionally occur in regulatory elements and may affect phenotype by creating binding sites for transcriptional regulators. Accordingly, we propose that noncoding mutation should be formally accounted for when determining gene- and pathway-mutation burden in cancer. PMID:28333948

  15. Accelerated Evolution of Conserved Noncoding Sequences in theHuman Genome

    SciTech Connect

    Prambhakar, Shyam; Noonan, James P.; Paabo, Svante; Rubin, EdwardM.


    Genomic comparisons between human and distant, non-primatemammals are commonly used to identify cis-regulatory elements based onconstrained sequence evolution. However, these methods fail to detect"cryptic" functional elements, which are too weakly conserved amongmammals to distinguish from nonfunctional DNA. To address this problem,we explored the potential of deep intra-primate sequence comparisons. Wesequenced the orthologs of 558 kb of human genomic sequence, coveringmultiple loci involved in cholesterol homeostasis, in 6 nonhumanprimates. Our analysis identified 6 noncoding DNA elements displayingsignificant conservation among primates, but undetectable in more distantcomparisons. In vitro and in vivo tests revealed that at least three ofthese 6 elements have regulatory function. Notably, the mouse orthologsof these three functional human sequences had regulatory activity despitetheir lack of significant sequence conservation, indicating that they arecryptic ancestral cis-regulatory elements. These regulatory elementscould still be detected in a smaller set of three primate speciesincluding human, rhesus and marmoset. Since the human and rhesus genomesequences are already available, and the marmoset genome is activelybeing sequenced, the primate-specific conservation analysis describedhere can be applied in the near future on a whole-genome scale, tocomplement the annotation provided by more distant speciescomparisons.

  16. DANIO-CODE: Toward an Encyclopedia of DNA Elements in Zebrafish.


    Tan, Haihan; Onichtchouk, Daria; Winata, Cecilia


    The zebrafish has emerged as a model organism for genomics studies. The symposium "Toward an encyclopedia of DNA elements in zebrafish" held in London in December 2014, was coorganized by Ferenc Müller and Fiona Wardle. This meeting is a follow-up of a similar previous workshop held 2 years earlier and represents a push toward the formalization of a community effort to annotate functional elements in the zebrafish genome. The meeting brought together zebrafish researchers, bioinformaticians, as well as members of established consortia, to exchange scientific findings and experience, as well as to discuss the initial steps toward the formation of a DANIO-CODE consortium. In this study, we provide the latest updates on the current progress of the consortium's efforts, opening up a broad invitation to researchers to join in and contribute to DANIO-CODE.

  17. DANIO-CODE: Toward an Encyclopedia of DNA Elements in Zebrafish

    PubMed Central


    Abstract The zebrafish has emerged as a model organism for genomics studies. The symposium “Toward an encyclopedia of DNA elements in zebrafish” held in London in December 2014, was coorganized by Ferenc Müller and Fiona Wardle. This meeting is a follow-up of a similar previous workshop held 2 years earlier and represents a push toward the formalization of a community effort to annotate functional elements in the zebrafish genome. The meeting brought together zebrafish researchers, bioinformaticians, as well as members of established consortia, to exchange scientific findings and experience, as well as to discuss the initial steps toward the formation of a DANIO-CODE consortium. In this study, we provide the latest updates on the current progress of the consortium's efforts, opening up a broad invitation to researchers to join in and contribute to DANIO-CODE. PMID:26671609

  18. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.


    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  19. The development of non-coding RNA ontology.


    Huang, Jingshan; Eilbeck, Karen; Smith, Barry; Blake, Judith A; Dou, Dejing; Huang, Weili; Natale, Darren A; Ruttenberg, Alan; Huan, Jun; Zimmermann, Michael T; Jiang, Guoqian; Lin, Yu; Wu, Bin; Strachan, Harrison J; de Silva, Nisansa; Kasukurthi, Mohan Vamsi; Jha, Vikash Kumar; He, Yongqun; Zhang, Shaojie; Wang, Xiaowei; Liu, Zixing; Borchert, Glen M; Tan, Ming


    Identification of non-coding RNAs (ncRNAs) has been significantly improved over the past decade. On the other hand, semantic annotation of ncRNA data is facing critical challenges due to the lack of a comprehensive ontology to serve as common data elements and data exchange standards in the field. We developed the Non-Coding RNA Ontology (NCRO) to handle this situation. By providing a formally defined ncRNA controlled vocabulary, the NCRO aims to fill a specific and highly needed niche in semantic annotation of large amounts of ncRNA biological and clinical data.

  20. The development of non-coding RNA ontology

    PubMed Central

    Eilbeck, Karen; Smith, Barry; Blake, Judith A.; Dou, Dejing; Huang, Weili; Natale, Darren A.; Ruttenberg, Alan; Huan, Jun; Zimmermann, Michael T.; Jiang, Guoqian; Lin, Yu; Wu, Bin; Strachan, Harrison J.; de Silva, Nisansa; Kasukurthi, Mohan Vamsi; Jha, Vikash Kumar; He, Yongqun; Zhang, Shaojie; Wang, Xiaowei; Liu, Zixing; Borchert, Glen M.; Tan, Ming


    Identification of non-coding RNAs (ncRNAs) has been significantly improved over the past decade. On the other hand, semantic annotation of ncRNA data is facing critical challenges due to the lack of a comprehensive ontology to serve as common data elements and data exchange standards in the field. We developed the Non-Coding RNA Ontology (NCRO) to handle this situation. By providing a formally defined ncRNA controlled vocabulary, the NCRO aims to fill a specific and highly needed niche in semantic annotation of large amounts of ncRNA biological and clinical data. PMID:27990175

  1. Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.


    Kijima, T E; Innan, Hideki


    A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

  2. Chemical Elemental Distribution and Soil DNA Fingerprints Provide the Critical Evidence in Murder Case Investigation

    PubMed Central

    Concheri, Giuseppe; Bertoldi, Daniela; Polone, Elisa; Otto, Stefan; Larcher, Roberto; Squartini, Andrea


    Background The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. Methodology/Principal Findings The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a) elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS) and optical emission spectrometry (ICP-OES) approaches, and b) amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA). Conclusions Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping. PMID:21674041

  3. Chemical elemental distribution and soil DNA fingerprints provide the critical evidence in murder case investigation.


    Concheri, Giuseppe; Bertoldi, Daniela; Polone, Elisa; Otto, Stefan; Larcher, Roberto; Squartini, Andrea


    The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a) elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS) and optical emission spectrometry (ICP-OES) approaches, and b) amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA). Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping.

  4. Fast and reliable prediction of noncoding RNAs

    PubMed Central

    Washietl, Stefan; Hofacker, Ivo L.; Stadler, Peter F.


    We report an efficient method for detecting functional RNAs. The approach, which combines comparative sequence analysis and structure prediction, already has yielded excellent results for a small number of aligned sequences and is suitable for large-scale genomic screens. It consists of two basic components: (i) a measure for RNA secondary structure conservation based on computing a consensus secondary structure, and (ii) a measure for thermodynamic stability, which, in the spirit of a z score, is normalized with respect to both sequence length and base composition but can be calculated without sampling from shuffled sequences. Functional RNA secondary structures can be identified in multiple sequence alignments with high sensitivity and high specificity. We demonstrate that this approach is not only much more accurate than previous methods but also significantly faster. The method is implemented in the program rnaz, which can be downloaded from We screened all alignments of length n ≥ 50 in the Comparative Regulatory Genomics database, which compiles conserved noncoding elements in upstream regions of orthologous genes from human, mouse, rat, Fugu, and zebrafish. We recovered all of the known noncoding RNAs and cis-acting elements with high significance and found compelling evidence for many other conserved RNA secondary structures not described so far to our knowledge. PMID:15665081

  5. Poly(dA-dT) promoter elements increase the equilibrium accessibility of nucleosomal DNA target sites.


    Anderson, J D; Widom, J


    Polypurine tracts are important elements of eukaryotic promoters. They are believed to somehow destabilize chromatin, but the mechanism of their action is not known. We show that incorporating an A(16) element at an end of the nucleosomal DNA and further inward destabilizes histone-DNA interactions by 0.1 +/- 0.03 and 0.35 +/- 0.04 kcal mol(-1), respectively, and is accompanied by 1.5- +/- 0.1-fold and 1.7- +/- 0.1-fold increases in position-averaged equilibrium accessibility of nucleosomal DNA target sites. These effects are comparable in magnitude to effects of A(16) elements that correlate with transcription in vivo, suggesting that our system may capture most of their physiological role. These results point to two distinct but interrelated models for the mechanism of action of polypurine tract promoter elements in vivo. Given a nucleosome positioned over a promoter region, the presence of a polypurine tract in that nucleosome's DNA decreases the stability of the DNA wrapping, increasing the equilibrium accessibility of other DNA target sites buried inside that nucleosome. Alternatively (if nucleosomes are freely mobile), the presence of a polypurine tract provides a free energy bias for the nucleosome to move to alternative locations, thereby changing the equilibrium accessibilities of other nearby DNA target sites.

  6. Nucleosomal signatures impose nucleosome positioning in coding and noncoding sequences in the genome

    PubMed Central

    González, Sara; García, Alicia; Vázquez, Enrique; Serrano, Rebeca; Sánchez, Mar; Quintales, Luis; Antequera, Francisco


    In the yeast genome, a large proportion of nucleosomes occupy well-defined and stable positions. While the contribution of chromatin remodelers and DNA binding proteins to maintain this organization is well established, the relevance of the DNA sequence to nucleosome positioning in the genome remains controversial. Through quantitative analysis of nucleosome positioning, we show that sequence changes distort the nucleosomal pattern at the level of individual nucleosomes in three species of Schizosaccharomyces and in Saccharomyces cerevisiae. This effect is equally detected in transcribed and nontranscribed regions, suggesting the existence of sequence elements that contribute to positioning. To identify such elements, we incorporated information from nucleosomal signatures into artificial synthetic DNA molecules and found that they generated regular nucleosomal arrays indistinguishable from those of endogenous sequences. Strikingly, this information is species-specific and can be combined with coding information through the use of synonymous codons such that genes from one species can be engineered to adopt the nucleosomal organization of another. These findings open the possibility of designing coding and noncoding DNA molecules capable of directing their own nucleosomal organization. PMID:27662899

  7. Molecular Design of Ionization-Induced Proton Switching Element Based on Fluorinated DNA Base Pair.


    Tachikawa, Hiroto; Kawabata, Hiroshi


    To design theoretically the high-performance proton switching element based on DNA base pair, the effects of fluorine substitution on the rate of proton transfer (PT) in the DNA model base pair have been investigated by means of direct ab initio molecular dynamics (AIMD) method. The 2-aminopyridine dimer, (AP)2, was used as the model of the DNA base pair. One of the hydrogen atoms of the AP molecule in the dimer was substituted by a fluorine (F) atom, and the structures of the dimer, expressed by F-(AP)2, were fully optimized at the MP2/6-311++G(d,p) level. The direct AIMD calculations showed that the proton is transferred within the base pair after the vertical ionization. The rates of PT in F-(AP)2(+) were calculated and compared with that of (AP)2(+) without an F atom. It was found that PT rate is accelerated by the F-substitution. Also, the direction of PT between F-AP and AP molecules can be clearly controlled by the position of F-substitution (AP)2 in the dimer.

  8. Structural optimization for heat detection of DNA thermosequencing platform using finite element analysis

    PubMed Central

    Esfandyarpour, Hesaam; Zheng, Bo; Pease, R. Fabian W.; Davis, Ronald W.


    For the past three decades, Sanger’s method has been the primary DNA sequencing technology; however, inherent limitations in cost and complexity have limited its usage in personalized medicine and ecological studies. A new technology called “thermosequencing” can potentially reduce both the cost and complexity of DNA sequencing by using a microfluidic platform [Esfandyarpour, Pease, and Davis, J. Vac. Sci. Technol. B26, 661 (2008)]. To optimize the efficiency of the technology, finite element analysis was used to model the thermosequencing system by simulating the DNA incorporation reaction series and the resulting product concentration and heat production. Different models of the thermosequencing platform were created to simulate the effects of the materials surrounding the system, to optimize the geometry of the system, and to concentrate reaction heat into specific regions for detection in the real system. The resulting concentrations of reaction products were used to calibrate the reaction speed and to design the heat sensors in the thermosequencing technology. We recommend a modified gated structure for the microfluidic detection platform by using control valves and show how this new platform could dramatically improve the detection efficiency. PMID:19693405

  9. Calculations of the exciton coupling elements between the DNA bases using the transition density cube method.


    Czader, Arkadiusz; Bittner, Eric R


    Excited states of the double-stranded DNA model (A)12.(T)12 were calculated in the framework of the Frenkel exciton theory. The off-diagonal elements of the exciton matrix were calculated using the transition densities and ideal dipole approximation associated with the lowest energy pipi* excitations of the individual nucleobases as obtained from time-dependent density functional theory calculations. The values of the coupling calculated with the transition density cubes (TDC) and ideal dipole approximation (IDA) methods were found to be significantly different for the small interchromophore distances. It was shown that the IDA overestimates the coupling significantly. The effects of structural fluctuations of the DNA chain on the magnitude of dipolar coupling were also found to be very significant. The difference between the maximum and minimum values was as large as 1000 and 300 cm(-1) for the IDA and TDC methods, respectively. To account for these effects, the properties of the excited states were averaged over a large number of conformations obtained from the molecular dynamics simulations. Our calculations using the TDC method indicate that the absorption of the UV light creates exciton states carrying the majority of the oscillator strength that are delocalized over at least six DNA bases. Upon relaxation, the excitation states localize over at least four contiguous bases.

  10. Effect of Regulatory Element DNA Methylation on Tissue-Type Plasminogen Activator Gene Expression

    PubMed Central

    Rivier-Cordey, Anne-Sophie; Caetano, Carlos; Fish, Richard J.; Kruithof, Egbert K. O.


    Expression of the tissue-type plasminogen activator gene (t-PA; gene name PLAT) is regulated, in part, by epigenetic mechanisms. We investigated the relationship between PLAT methylation and PLAT expression in five primary human cell types and six transformed cell lines. CpG methylation was analyzed in the proximal PLAT gene promoter and near the multihormone responsive enhancer (MHRE) -7.3 kilobase pairs upstream of the PLAT transcriptional start site (TSS, -7.3 kb). In Bowes melanoma cells, the PLAT promoter and the MHRE were fully unmethylated and t-PA secretion was extremely high. In other cell types the region from -647 to -366 was fully methylated, whereas an unmethylated stretch of DNA from -121 to +94 was required but not sufficient for detectable t-PA mRNA and t-PA secretion. DNA methylation near the MHRE was not correlated with t-PA secretion. Specific methylation of the PLAT promoter region -151 to +151, inserted into a firefly luciferase reporter gene, abolished reporter gene activity. The region -121 to + 94 contains two well-described regulatory elements, a PMA-responsive element (CRE) near -106 and a GC-rich region containing an Sp1 binding site near +59. Methylation of double-stranded DNA oligonucleotides containing the CRE or the GC-rich region had little or no effect on transcription factor binding. Methylated CpGs may attract co-repressor complexes that contain histone deacetylases (HDAC). However, reporter gene activity of methylated plasmids was not restored by the HDAC inhibitor trichostatin. In conclusion, efficient PLAT gene expression requires a short stretch of unmethylated CpG sites in the proximal promoter. PMID:27973546

  11. Endogenous sex hormone exposure and repetitive element DNA methylation in healthy postmenopausal women.


    Boyne, Devon J; Friedenreich, Christine M; McIntyre, John B; Stanczyk, Frank Z; Courneya, Kerry S; King, Will D


    Epigenetic mechanisms may help to explain the complex and heterogeneous relation between sex hormones and cancer. Few studies have investigated the effects of sex hormones on epigenetic markers related to cancer risk such as levels of methylation within repetitive DNA elements. Our objective was to describe the association between endogenous sex hormone exposure and levels of LINE-1 and Alu methylation in healthy postmenopausal women. We nested a cross-sectional study within the Alberta Physical Activity and Breast Cancer Prevention Trial (2003-2006). Study participants consisted of healthy postmenopausal women who had never been diagnosed with cancer (n = 289). Sex hormone exposures included serum concentrations of estradiol, estrone, testosterone, androstenedione, and sex hormone-binding globulin. We estimated the participants' lifetime number of menstrual cycles (LNMC) as a proxy for cumulative exposure to ovarian sex hormones. Buffy coat samples were assessed for DNA methylation. Linear regression was used to model the associations of interest and to control for confounding. Both estradiol and estrone had a significant positive dose-response association with LINE-1 methylation. LNMC was associated with both LINE-1 and Alu methylation. Specifically, LNMC had a non-linear "U-shaped" association with LINE-1 methylation regardless of folate intake and a negative linear association with Alu methylation, but only amongst low folate consumers. Androgen exposure was not associated with either outcome. Current and cumulative estrogen exposure was associated with repetitive element DNA methylation in a group of healthy postmenopausal women. LINE-1 and Alu methylation may be epigenetic mechanisms through which estrogen exposure impacts cancer risk.

  12. Altered Response Hierarchy and Increased T-Cell Breadth upon HIV-1 Conserved Element DNA Vaccination in Macaques

    PubMed Central

    Kulkarni, Viraj; Valentin, Antonio; Rosati, Margherita; Alicea, Candido; Singh, Ashish K.; Jalah, Rashmi; Broderick, Kate E.; Sardesai, Niranjan Y.; Le Gall, Sylvie; Mothe, Beatriz; Brander, Christian; Rolland, Morgane; Mullins, James I.; Pavlakis, George N.; Felber, Barbara K.


    HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24gag elements (CE) induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist. PMID:24465991

  13. The plasmid replicon of EBV consists of multiple cis-acting elements that facilitate DNA synthesis by the cell and a viral maintenance element.

    PubMed Central

    Aiyar, A; Tyree, C; Sugden, B


    Plasmids containing oriP, the plasmid origin of Epstein-Barr virus (EBV), are replicated stably in human cells that express a single viral trans-acting factor, EBNA-1. Unlike plasmids of other viruses, but akin to human chromosomes, oriP plasmids are synthesized once per cell cycle, and are partitioned faithfully to daughter cells during mitosis. Although EBNA-1 binds multiple sites within oriP, its role in DNA synthesis and partitioning has been obscure. EBNA-1 lacks enzymatic activities that are present in the origin-binding proteins of other mammalian viruses, and does not interact with human cellular proteins that provide equivalent enzymatic functions. We demonstrate that plasmids with oriP or its constituent elements are synthesized efficiently in human cells in the absence of EBNA-1. Further, we show that human cells rapidly eliminate or destroy newly synthesized plasmids, and that both EBNA-1 and the family of repeats of oriP are required for oriP plasmids to escape this catastrophic loss. These findings indicate that EBV's plasmid replicon consists of genetic elements with distinct functions, multiple cis-acting elements that facilitate DNA synthesis and viral cis/trans elements that permit retention of replicated DNA in daughter cells. They also explain historical failures to identify mammalian origins of DNA synthesis as autonomously replicating sequences. PMID:9799247

  14. GAGA factor binding to DNA via a single trinucleotide sequence element.

    PubMed Central

    Wilkins, R C; Lis, J T


    GAGA transcription factor (GAF) is an essential protein in Drosophila , important for the transcriptional regulation of numerous genes. GAF binds to GA repeats in the promoters of these genes via a DNA-binding domain containing a single zinc finger. While GAF binding sites are typically composed of 3.5 GA repeats, the Drosophila hsp70 gene contains much smaller elements, some of which are as little as three bases (GAG) in length. Interestingly, the binding of GAF to more distant trinucleotide elements is relatively strong and not appreciably affected by the removal of larger GA arrays in the promoter. Moreover, a simple synthetic GAG sequence is sufficient to bind GAF in vitro . Here we directly compare the affinity of GAF for different sequence elements by immunoprecipitation and gel mobility shift analysis. Furthermore, our measures of the concentration of GAF in vivo indicate that it is a highly abundant nuclear protein, prevalent enough to occupy a sizable fraction of correspondingly abundant trinucleotide sites. PMID:9592153

  15. Noncoding DNA, Zipf's law, and language.


    Konopka, A K; Martindale, C


    In the report "Continent-ocean chemical heterogeneity in the mantle based on seismic tomography" by Alessandro M. Forte et al. (21 Apr., p. 386), note 14 (p. 388) should have included the following sentence at the end. "We note, however, that this classical measure of significance does not take into account the red spectrum of the observed nonhydrostatic geoid, whose harmonic coefficients cannot be properly regarded as a random distribution; therefore, the statistical significance of the measured correlation coefficient is possibly less than 99%.

  16. Single-pass classification of all noncoding sequences in a bacterial genome using phylogenetic profiles.


    Marchais, Antonin; Naville, Magali; Bohn, Chantal; Bouloc, Philippe; Gautheret, Daniel


    Identification and characterization of functional elements in the noncoding regions of genomes is an elusive and time-consuming activity whose output does not keep up with the pace of genome sequencing. Hundreds of bacterial genomes lay unexploited in terms of noncoding sequence analysis, although they may conceal a wide diversity of novel RNA genes, riboswitches, or other regulatory elements. We describe a strategy that exploits the entirety of available bacterial genomes to classify all noncoding elements of a selected reference species in a single pass. This method clusters noncoding elements based on their profile of presence among species. Most noncoding RNAs (ncRNAs) display specific signatures that enable their grouping in distinct clusters, away from sequence conservation noise and other elements such as promoters. We submitted 24 ncRNA candidates from Staphylococcus aureus to experimental validation and confirmed the presence of seven novel small RNAs or riboswitches. Besides offering a powerful method for de novo ncRNA identification, the analysis of phylogenetic profiles opens a new path toward the identification of functional relationships between co-evolving coding and noncoding elements.

  17. Single-pass classification of all noncoding sequences in a bacterial genome using phylogenetic profiles

    PubMed Central

    Marchais, Antonin; Naville, Magali; Bohn, Chantal; Bouloc, Philippe; Gautheret, Daniel


    Identification and characterization of functional elements in the noncoding regions of genomes is an elusive and time-consuming activity whose output does not keep up with the pace of genome sequencing. Hundreds of bacterial genomes lay unexploited in terms of noncoding sequence analysis, although they may conceal a wide diversity of novel RNA genes, riboswitches, or other regulatory elements. We describe a strategy that exploits the entirety of available bacterial genomes to classify all noncoding elements of a selected reference species in a single pass. This method clusters noncoding elements based on their profile of presence among species. Most noncoding RNAs (ncRNAs) display specific signatures that enable their grouping in distinct clusters, away from sequence conservation noise and other elements such as promoters. We submitted 24 ncRNA candidates from Staphylococcus aureus to experimental validation and confirmed the presence of seven novel small RNAs or riboswitches. Besides offering a powerful method for de novo ncRNA identification, the analysis of phylogenetic profiles opens a new path toward the identification of functional relationships between co-evolving coding and noncoding elements. PMID:19237465

  18. Gene regulation by noncoding RNAs

    PubMed Central

    Patil, Veena S.; Zhou, Rui; Rana, Tariq M.


    The past two decades have seen an explosion in research on noncoding RNAs and their physiological and pathological functions. Several classes of small (20–30 nucleotides) and long (>200 nucleotides) noncoding RNAs have been firmly established as key regulators of gene expression in myriad processes ranging from embryonic development to innate immunity. In this review, we focus on our current understanding of the molecular mechanisms underlying the biogenesis and function of small interfering RNAs (siRNAs), microRNAs (miRNAs), and Piwi-interacting RNAs (piRNAs). In addition, we briefly review the relevance of small and long noncoding RNAs to human physiology and pathology and their potential to be exploited as therapeutic agents. PMID:24164576

  19. Increased methylation of repetitive elements and DNA repair genes is associated with higher DNA oxidation in children in an urbanized, industrial environment.


    Alvarado-Cruz, Isabel; Sánchez-Guerra, Marco; Hernández-Cadena, Leticia; De Vizcaya-Ruiz, Andrea; Mugica, Violeta; Pelallo-Martínez, Nadia Azenet; Solís-Heredia, María de Jesús; Byun, Hyang-Min; Baccarelli, Andrea; Quintanilla-Vega, Betzabet


    DNA methylation in DNA repair genes participates in the DNA damage regulation. Particulate matter (PM), which has metals and polycyclic aromatic hydrocarbons (PAHs) adsorbed, among others has been linked to adverse health outcomes and may modify DNA methylation. To evaluate PM exposure impact on repetitive elements and gene-specific DNA methylation and DNA damage, we conducted a cross-sectional study in 150 schoolchildren (7-10 years old) from an urbanized, industrial area of the metropolitan area of Mexico City (MAMC), which frequently exhibits PM concentrations above safety standards. Methylation (5mC) of long interspersed nuclear element-1 (LINE1) and DNA repair gene (OGG1, APEX, and PARP1) was assessed by pyrosequencing in peripheral mononuclear cells, DNA damage by comet assay and DNA oxidation by 8-OHdG content. PAH and metal contents in PM10 (≤10μm aerodynamic diameter) were determined by HPLC-MS and ICP-AES, respectively. Multiple regression analysis between DNA methylation, DNA damage, and PM10 exposure showed that PM10 was significantly associated with oxidative DNA damage; a 1% increase in 5mC at all CpG sites in PARP1 promoter was associated with a 35% increase in 8-OHdG, while a 1% increase at 1, 2, and 3 CpG sites resulted in 38, 9, and 56% increments, respectively. An increase of 10pg/m(3) in benzo[b]fluoranthene content of PM10 was associated with a 6% increase in LINE1 methylation. Acenaphthene, indene [1,2,3-cd] pyrene, and pyrene concentrations correlated with higher dinucleotide methylation in OGG1, APEX and PARP1 genes, respectively. Vanadium concentration correlated with increased methylation at selected APEX and PARP1 CpG sites. DNA repair gene methylation was significantly correlated with DNA damage and with specific PM10-associated PAHs and Vanadium. Data suggest that exposure to PM and its components are associated with differences in DNA methylation of repair genes in children, which may contribute to DNA damage. Copyright © 2016

  20. Various expression-augmenting DNA elements benefit from STAR-Select, a novel high stringency selection system for protein expression.


    Otte, Arie P; Kwaks, Ted H J; van Blokland, Rik J M; Sewalt, Richard G A B; Verhees, John; Klaren, Vincent N A; Siersma, Tjalling K; Korse, Hans W M; Teunissen, Nannette C; Botschuijver, Sara; van Mer, Charl; Man, Sue Y


    The creation of highly productive mammalian cell lines often requires the screening of large numbers of clones, and even then expression levels are often low. Previously, we identified DNA elements, anti-repressor or STAR elements, that increase protein expression levels. These positive effects of STAR elements are most apparent when stable clones are established under high selection stringency. We therefore developed a very high selection system, STAR-Select, that allows the formation of few but highly productive clones. Here we compare the influence of STAR and other expression-augmenting DNA elements on protein expression levels in CHO-K1 cells. The comparison is done in the context of the often-used cotransfection selection procedure and in the context of the STAR-Select system. We show that STAR elements, as well as MAR elements induce the highest protein expression levels with both selection systems. Furthermore, in trans cotransfection of multiple copies of STAR and MAR elements also results in higher protein expression levels. However, highest expression levels are achieved with the STAR-Select selection system, when STAR elements or MARs are incorporated in a single construct. Our results also show that the novel STAR-Select selection system, which was developed in the context of STAR elements, is also very beneficial for the use of MAR elements.

  1. Small non-coding RNA and cancer.


    Romano, Giulia; Veneziano, Dario; Acunzo, Mario; Croce, Carlo M


    The ENCODE project has reported that at least 80% of the human genome is biologically active, yet only a small part of human DNA encodes for protein. The massive amount of RNA transcribed but not translated into protein can be classified as housekeeping RNA (such as rRNA, tRNA) and regulatory RNA (such as miRNA, piRNA, lncRNA). Small non-coding RNAs, in particular, have been the focus of many studies in the last 20 years and their fundamental role in many human diseases is currently well established. Inter alia, their role in cancer development and progression, as well as in drug resistance, is being increasingly investigated. In this review, focusing our attention on recent research results, we provide an overview of the four large classes of small non-coding RNAs, namely, miRNAs, piRNAs, snoRNA and the new class of tRNA-derived fragments, highlighting their fundamental role in cancer and their potential as diagnostic and prognostic biomarkers. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  2. Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes

    PubMed Central

    Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady


    Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. PMID:28057732

  3. TTS Mapping: integrative WEB tool for analysis of triplex formation target DNA Sequences, G-quadruplets and non-protein coding regulatory DNA elements in the human genome

    PubMed Central


    Background DNA triplexes can naturally occur, co-localize and interact with many other regulatory DNA elements (e.g. G-quadruplex (G4) DNA motifs), specific DNA-binding proteins (e.g. transcription factors (TFs)), and micro-RNA (miRNA) precursors. Specific genome localizations of triplex target DNA sites (TTSs) may cause abnormalities in a double-helix DNA structure and can be directly involved in some human diseases. However, genome localization of specific TTSs, their interconnection with regulatory DNA elements and physiological roles in a cell are poor defined. Therefore, it is important to identify comprehensive and reliable catalogue of specific potential TTSs (pTTSs) and their co-localization patterns with other regulatory DNA elements in the human genome. Results "TTS mapping" database is a web-based search engine developed here, which is aimed to find and annotate pTTSs within a region of interest of the human genome. The engine provides descriptive statistics of pTTSs in a given region and its sequence context. Different annotation tracks of TTS-overlapping gene region(s), G4 motifs, CpG Island, miRNA precursors, miRNA targets, transcription factor binding sites (TFBSs), Single Nucleotide Polymorphisms (SNPs), small nucleolar RNAs (snoRNA), and repeat elements are also mapped based onto a sequence location provided by UCSC genome browser, G4 database and several other datasets. The results pages provide links to UCSC genome browser annotation tracks and relative DBs. BLASTN program was included to check the uniqueness of a given pTTS in the human genome. Recombination- and mutation-prone genes (e.g. EVI-1, MYC) were found to be significantly enriched by TTSs and multiple co-occurring with our regulatory DNA elements. TTS mapping reveals that a high-complementary and evolutionarily conserved polypurine and polypyrimidine DNA sequence pair linked by a non-conserved short DNA sequence can form miR-483 transcribed from intron 2 of

  4. TTS mapping: integrative WEB tool for analysis of triplex formation target DNA sequences, G-quadruplets and non-protein coding regulatory DNA elements in the human genome.


    Jenjaroenpun, Piroon; Kuznetsov, Vladimir A


    DNA triplexes can naturally occur, co-localize and interact with many other regulatory DNA elements (e.g. G-quadruplex (G4) DNA motifs), specific DNA-binding proteins (e.g. transcription factors (TFs)), and micro-RNA (miRNA) precursors. Specific genome localizations of triplex target DNA sites (TTSs) may cause abnormalities in a double-helix DNA structure and can be directly involved in some human diseases. However, genome localization of specific TTSs, their interconnection with regulatory DNA elements and physiological roles in a cell are poor defined. Therefore, it is important to identify comprehensive and reliable catalogue of specific potential TTSs (pTTSs) and their co-localization patterns with other regulatory DNA elements in the human genome. "TTS mapping" database is a web-based search engine developed here, which is aimed to find and annotate pTTSs within a region of interest of the human genome. The engine provides descriptive statistics of pTTSs in a given region and its sequence context. Different annotation tracks of TTS-overlapping gene region(s), G4 motifs, CpG Island, miRNA precursors, miRNA targets, transcription factor binding sites (TFBSs), Single Nucleotide Polymorphisms (SNPs), small nucleolar RNAs (snoRNA), and repeat elements are also mapped based onto a sequence location provided by UCSC genome browser, G4 database and several other datasets. The results pages provide links to UCSC genome browser annotation tracks and relative DBs. BLASTN program was included to check the uniqueness of a given pTTS in the human genome. Recombination- and mutation-prone genes (e.g. EVI-1, MYC) were found to be significantly enriched by TTSs and multiple co-occurring with our regulatory DNA elements. TTS mapping reveals that a high-complementary and evolutionarily conserved polypurine and polypyrimidine DNA sequence pair linked by a non-conserved short DNA sequence can form miR-483 transcribed from intron 2 of IGF2 gene and bound

  5. Positive and negative regulatory elements in the dnaA-dnaN-recF operon of Escherichia coli.


    Pérez-Roger, I; García-Sogo, M; Navarro-Aviñó, J P; López-Acedo, C; Macián, F; Armengod, M E


    The recF gene of E coli lies within a cluster of genes which play essential roles in DNA replication; the gene order is dnaA dnaN recF gyrB. Each of these genes has its own promoters which, with the exception of dnaA promoters, reside entirely within the translated region of the respective preceding gene. In this report, we analyze the effect of the dnaA and dnaN promoters on recF expression by translational fusions between recF and the lacZ reporter gene. Our results indicate that recF is a distal gene of the dnaA operon, and support the previous proposal that dnaN and recF constitute a transcriptional unit under control of the dnaN promoters. They also suggest that dnaA, dnaN and recF are predominantly expressed from the same mRNA although transcriptional and/or post-transcriptional mechanisms should be specifically involved in lowering expression of the recF gene. Recently, we have localized 3 tandem transcription termination sites in the second half of the dnaN gene, downstream from the recF promoters. Neither of them shows the typical features of simple terminators and apparently they do not work in a minimal system of in vitro transcription. In this report, we present evidence that only one of them is dependent on the Rho protein. Although the operon structure allows coordinate expression of dnaA, dnaN and recF, the presence of internal promoters (the dnaN and recF promoters), which appear to be inducible by DNA damage, and intracistronic terminators, whose activity is inversely proportional to the efficiency of translation, permits expression of individual genes to be independently regulated in response to altered growth conditions.

  6. Crystal structure of a DNA aptamer bound to PvLDH elucidates novel single-stranded DNA structural elements for folding and recognition

    PubMed Central

    Choi, Sung-Jin; Ban, Changill


    Structural elements are key elements for understanding single-stranded nucleic acid folding. Although various RNA structural elements have been documented, structural elements of single-stranded DNA (ssDNA) have rarely been reported. Herein, we determined a crystal structure of PvLDH in complex with a DNA aptamer called pL1. This aptamer folds into a hairpin-bulge contact by adopting three novel structural elements, viz, DNA T-loop-like motif, base–phosphate zipper, and DNA G·G metal ion zipper. Moreover, the pL1:PvLDH complex shows unique properties compared with other protein:nucleic acid complexes. Generally, extensive intermolecular hydrogen bonds occur between unpaired nucleotides and proteins for specific recognitions. Although most protein-interacting nucleotides of pL1 are unpaired nucleotides, pL1 recognizes PvLDH by predominant shape complementarity with many bridging water molecules owing to the combination of three novel structural elements making protein-binding unpaired nucleotides stable. Moreover, the additional set of Plasmodium LDH residues which were shown to form extensive hydrogen bonds with unpaired nucleotides of 2008s does not participate in the recognition of pL1. Superimposition of the pL1:PvLDH complex with hLDH reveals steric clashes between pL1 and hLDH in contrast with no steric clashes between 2008s and hLDH. Therefore, specific protein recognition mode of pL1 is totally different from that of 2008s. PMID:27725738

  7. Common architecture of nuclear receptor heterodimers on DNA direct repeat elements with different spacings.


    Rochel, Natacha; Ciesielski, Fabrice; Godet, Julien; Moman, Edelmiro; Roessle, Manfred; Peluso-Iltis, Carole; Moulin, Martine; Haertlein, Michael; Callow, Phil; Mély, Yves; Svergun, Dmitri I; Moras, Dino


    Nuclear hormone receptors (NHRs) control numerous physiological processes through the regulation of gene expression. The present study provides a structural basis for understanding the role of DNA in the spatial organization of NHR heterodimers in complexes with coactivators such as Med1 and SRC-1. We have used SAXS, SANS and FRET to determine the solution structures of three heterodimer NHR complexes (RXR-RAR, PPAR-RXR and RXR-VDR) coupled with the NHR interacting domains of coactivators bound to their cognate direct repeat elements. The structures show an extended asymmetric shape and point to the important role played by the hinge domains in establishing and maintaining the integrity of the structures. The results reveal two additional features: the conserved position of the ligand-binding domains at the 5' ends of the target DNAs and the binding of only one coactivator molecule per heterodimer, to RXR's partner.

  8. The role of the largest RNA polymerase subunit lid element in preventing the formation of extended RNA-DNA hybrid.


    Naryshkina, Tatyana; Kuznedelov, Konstantin; Severinov, Konstantin


    Analysis of multi-subunit RNA polymerase (RNAP) structures revealed several distinct elements that may perform partial functions of the enzyme. One such element, the "lid", is formed by an evolutionarily conserved segment of the RNAP largest subunit (beta' in bacterial RNAP). The beta' lid contacts the nascent RNA at the upstream edge of the RNA-DNA hybrid, where the RNA gets separated from the DNA template-strand and double-stranded upstream DNA is formed. To test the beta' lid functions, we generated bacterial RNAP lacking the lid and studied the mutant enzyme's properties in vitro. Our results demonstrate that removal of the lid has minimal consequences on transcription elongation from double-stranded DNA. On single-stranded DNA, the mutant RNAP generates full-sized transcripts that remain annealed to the DNA throughout their length. In contrast, the wild-type enzyme produces short, 18-22 nucleotide transcripts that remain part of the transcription complex but cannot be further elongated. The cessation of transcription is apparently triggered by a clash between the lid and the nascent RNA 5' end. The results show that the lid's function is redundant in the presence of the non-template DNA strand, which alone can control the proper geometry of nucleic acids at the upstream edge of the transcription complex. Structural considerations suggest that in the absence of the non-template strand and the lid, a new channel opens within the RNAP molecule that allows continuous DNA-RNA hybrid to exit RNAP.

  9. Integrated genome analysis suggests that most conserved non-coding sequences are regulatory factor binding sites

    PubMed Central

    Hemberg, Martin; Gray, Jesse M.; Cloonan, Nicole; Kuersten, Scott; Grimmond, Sean; Greenberg, Michael E.; Kreiman, Gabriel


    More than 98% of a typical vertebrate genome does not code for proteins. Although non-coding regions are sprinkled with short (<200 bp) islands of evolutionarily conserved sequences, the function of most of these unannotated conserved islands remains unknown. One possibility is that unannotated conserved islands could encode non-coding RNAs (ncRNAs); alternatively, unannotated conserved islands could serve as promoter-distal regulatory factor binding sites (RFBSs) like enhancers. Here we assess these possibilities by comparing unannotated conserved islands in the human and mouse genomes to transcribed regions and to RFBSs, relying on a detailed case study of one human and one mouse cell type. We define transcribed regions by applying a novel transcript-calling algorithm to RNA-Seq data obtained from total cellular RNA, and we define RFBSs using ChIP-Seq and DNAse-hypersensitivity assays. We find that unannotated conserved islands are four times more likely to coincide with RFBSs than with unannotated ncRNAs. Thousands of conserved RFBSs can be categorized as insulators based on the presence of CTCF or as enhancers based on the presence of p300/CBP and H3K4me1. While many unannotated conserved RFBSs are transcriptionally active to some extent, the transcripts produced tend to be unspliced, non-polyadenylated and expressed at levels 10 to 100-fold lower than annotated coding or ncRNAs. Extending these findings across multiple cell types and tissues, we propose that most conserved non-coding genomic DNA in vertebrate genomes corresponds to promoter-distal regulatory elements. PMID:22684627

  10. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  11. Proteins and DNA elements essential for the CRISPR adaptation process in Escherichia coli.


    Yosef, Ido; Goren, Moran G; Qimron, Udi


    The clustered regularly interspaced short palindromic repeats and their associated proteins (CRISPR/Cas) constitute a recently identified prokaryotic defense mechanism against invading nucleic acids. Activity of the CRISPR/Cas system comprises of three steps: (i) insertion of alien DNA sequences into the CRISPR array to prevent future attacks, in a process called 'adaptation', (ii) expression of the relevant proteins, as well as expression and processing of the array, followed by (iii) RNA-mediated interference with the alien nucleic acid. Here we describe a robust assay in Escherichia coli to explore the hitherto least-studied process, adaptation. We identify essential genes and DNA elements in the leader sequence and in the array which are essential for the adaptation step. We also provide mechanistic insights on the insertion of the repeat-spacer unit by showing that the first repeat serves as the template for the newly inserted repeat. Taken together, our results elucidate fundamental steps in the adaptation process of the CRISPR/Cas system.

  12. A novel transcriptional element in circular DNA monomers of the duck hepatitis B virus.

    PubMed Central

    Beckel-Mitchener, A; Summers, J


    We report the presence of two elements, pet and net, that are required for proper transcription of the duck hepatitis B virus (DHBV). These regions were previously identified by using plasmid clones of the virus in transient expression assays (M. Huang and J. Summers, J. Virol. 68:1564-1572, 1994). In this study, we further analyzed these regions by using in vitro-synthesized circular DHBV DNA monomers to mimic the authentic transcriptional template. We observed that pet was required for pregenome transcription from circular viral monomers, and in the absence of pet-dependent transcription, expression of the viral envelope genes was increased. We found that deletion of net in circularized DNA monomers led to the production of abnormally long transcripts due to a failure to form 3' ends during transcription. In addition, we report the presence of a net-like region in the mammalian hepadnavirus woodchuck hepatitis virus. These results are consistent with a model that net is a region involved in transcription termination and that in DHBV, pet is required for transcription complexes to read through this region during the first pass through net. PMID:9311882

  13. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.


    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko


    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  14. Long non-coding RNAs: spatial amplifiers that control nuclear structure and gene expression.


    Engreitz, Jesse M; Ollikainen, Noah; Guttman, Mitchell


    Over the past decade, it has become clear that mammalian genomes encode thousands of long non-coding RNAs (lncRNAs), many of which are now implicated in diverse biological processes. Recent work studying the molecular mechanisms of several key examples - including Xist, which orchestrates X chromosome inactivation - has provided new insights into how lncRNAs can control cellular functions by acting in the nucleus. Here we discuss emerging mechanistic insights into how lncRNAs can regulate gene expression by coordinating regulatory proteins, localizing to target loci and shaping three-dimensional (3D) nuclear organization. We explore these principles to highlight biological challenges in gene regulation, in which lncRNAs are well-suited to perform roles that cannot be carried out by DNA elements or protein regulators alone, such as acting as spatial amplifiers of regulatory signals in the nucleus.

  15. Widespread noncoding circular RNAs in plants.


    Ye, Chu-Yu; Chen, Li; Liu, Chen; Zhu, Qian-Hao; Fan, Longjiang


    A large number of noncoding circular RNAs (circRNAs) with regulatory potency have been identified in animals, but little attention has been given to plant circRNAs. We performed genome-wide identification of circRNAs in Oryza sativa and Arabidopsis thaliana using publically available RNA-Seq data, analyzed and compared features of plant and animal circRNAs. circRNAs (12037 and 6012) were identified in Oryza sativa and Arabidopsis thaliana, respectively, with 56% (10/18) of the sampled rice exonic circRNAs validated experimentally. Parent genes of over 700 exonic circRNAs were orthologues between rice and Arabidopsis, suggesting conservation of circRNAs in plants. The introns flanking plant circRNAs were much longer than introns from linear genes, and possessed less repetitive elements and reverse complementary sequences than the flanking introns of animal circRNAs. Plant circRNAs showed diverse expression patterns, and 27 rice exonic circRNAs were found to be differentially expressed under phosphate-sufficient and -starvation conditions. A significantly positive correlation was observed for the expression profiles of some circRNAs and their parent genes. Our results demonstrated that circRNAs are widespread in plants, revealed the common and distinct features of circRNAs between plants and animals, and suggested that circRNAs could be a critical class of noncoding regulators in plants. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  16. Repetitive genomic elements and overall DNA methylation changes in acute myeloid and childhood B-cell lymphoblastic leukemia patients.


    Bujko, Mateusz; Musialik, Ewa; Olbromski, Rafał; Przestrzelska, Marta; Libura, Marta; Pastwińska, Anna; Juszczyński, Przemysław; Zwierzchowski, Lech; Baranowski, Paweł; Siedlecki, Janusz Aleksander


    Aberrant epigenetic regulation is a hallmark of neoplastic cells. Increased DNA methylation of individual genes' promoter regions and decreases in overall DNA methylation level are both generally observed in cancer. In solid tumors, this global DNA hypomethylation is related to reduced methylation of repeated DNA elements (REs) and contributes to genome instability. The aim of the present study was to assess methylation level of LINE-1 and ALU REs and total 5-methylcytosine (5metC) content in adult acute myeloid leukemia (AML) (n = 58), childhood B-cell acute lymphoblastic leukemia (ALL) (n = 32), as the most frequent acute leukemias in two age categories and in normal adult bone marrow and children's blood samples. DNA pyrosequencing and ELISA assays were used, respectively. Global DNA hypomethylation was not observed in leukemia patients. Results revealed higher DNA methylation of LINE-1 in AML and ALL samples compared to corresponding normal controls. Elevated methylation of ALU and overall 5metC level were also observed in B-cell ALL patients. Differences of REs and global DNA methylation between AML cytogenetic-risk groups were observed, with the lowest methylation levels in intermediate-risk/cytogenetically normal patients. B-cell ALL is characterized by the highest DNA methylation level compared to AML and controls and overall DNA methylation is correlated with leukocyte count.

  17. Repetitive element DNA methylation levels in white blood cell DNA from sisters discordant for breast cancer from the New York site of the Breast Cancer Family Registry.


    Wu, Hui-Chen; Delgado-Cruzata, Lissette; Flom, Julie D; Perrin, Mary; Liao, Yuyan; Ferris, Jennifer S; Santella, Regina M; Terry, Mary Beth


    Global decreases in DNA methylation, particularly in repetitive elements, have been associated with genomic instability and human cancer. Emerging, though limited, data suggest that in white blood cell (WBC) DNA levels of methylation, overall or in repetitive elements, may be associated with cancer risk. We measured methylation levels of three repetitive elements [Satellite 2 (Sat2)], long interspersed nuclear element-1 (LINE-1) and Alu) by MethyLight, and LINE-1 by pyrosequencing in a total of 282 breast cancer cases and 347 unaffected sisters from the New York site of the Breast Cancer Family Registry (BCFR) using DNA from both granulocytes and total WBC. We found that methylation levels in all markers were correlated between sisters (Spearman correlation coefficients ranged from 0.17 to 0.55). Sat2 methylation was statistically significantly associated with increased breast cancer risk [odds ratio (OR) = 2.09, 95% confidence interval (CI) = 1.09-4.03; for each unit decrease in the natural log of the methylation level, OR = 2.12, 95% CI = 0.88-5.11 for the lowest quartile compared with the highest quartile]. These associations were only observed in total WBC but not granulocyte DNA. There was no association between breast cancer and LINE-1 and Alu methylation. If replicated in larger prospective studies, these findings support that selected markers of epigenetic changes measured in WBC, such as Sat2, may be potential biomarkers of breast cancer risk.

  18. Repetitive element DNA methylation levels in white blood cell DNA from sisters discordant for breast cancer from the New York site of the Breast Cancer Family Registry

    PubMed Central

    Terry, Mary Beth


    Global decreases in DNA methylation, particularly in repetitive elements, have been associated with genomic instability and human cancer. Emerging, though limited, data suggest that in white blood cell (WBC) DNA levels of methylation, overall or in repetitive elements, may be associated with cancer risk. We measured methylation levels of three repetitive elements [Satellite 2 (Sat2)], long interspersed nuclear element-1 (LINE-1) and Alu) by MethyLight, and LINE-1 by pyrosequencing in a total of 282 breast cancer cases and 347 unaffected sisters from the New York site of the Breast Cancer Family Registry (BCFR) using DNA from both granulocytes and total WBC. We found that methylation levels in all markers were correlated between sisters (Spearman correlation coefficients ranged from 0.17 to 0.55). Sat2 methylation was statistically significantly associated with increased breast cancer risk [odds ratio (OR) = 2.09, 95% confidence interval (CI) = 1.09–4.03; for each unit decrease in the natural log of the methylation level, OR = 2.12, 95% CI = 0.88–5.11 for the lowest quartile compared with the highest quartile]. These associations were only observed in total WBC but not granulocyte DNA. There was no association between breast cancer and LINE-1 and Alu methylation. If replicated in larger prospective studies, these findings support that selected markers of epigenetic changes measured in WBC, such as Sat2, may be potential biomarkers of breast cancer risk. PMID:22678115

  19. cis-acting translational effects of the 5' noncoding region of c-myc mRNA.

    PubMed Central

    Parkin, N; Darveau, A; Nicholson, R; Sonenberg, N


    We have previously shown that the 5' noncoding region of mouse c-myc mRNA has a negative effect on translational efficiency in a rabbit reticulocyte lysate (A. Darveau, J. Pelletier, and N. Sonenberg, Proc. Natl. Acad. Sci. USA 82:2315-2319, 1985). We wanted to localize and characterize the inhibitory translational element(s) in the mRNA and to study its effect in other in vitro and in vivo systems. Here we report that the restrictive element is confined to a 240-nucleotide sequence of the 5' noncoding region of mouse c-myc mRNA and that this sequence acts in cis to inhibit the translation of a heterologous mRNA. In addition, we report that the cis-inhibitory effect is also exhibited in microinjected Xenopus oocytes and wheat-germ extracts but not in HeLa cell extracts. Transfection of corresponding plasmid DNA constructs into several established cell lines did not produce the cis-inhibitory effect. A model to explain these results is presented. Images PMID:3043198

  20. Noncoding RNAs in endocrine malignancy.


    Kentwell, Jessica; Gundara, Justin S; Sidhu, Stan B


    Only recently has it been uncovered that the mammalian transcriptome includes a large number of noncoding RNAs (ncRNAs) that play a variety of important regulatory roles in gene expression and other biological processes. Among numerous kinds of ncRNAs, short noncoding RNAs, such as microRNAs, have been extensively investigated with regard to their biogenesis, function, and importance in carcinogenesis. Long noncoding RNAs (lncRNAs) have only recently been implicated in playing a key regulatory role in cancer biology. The deregulation of ncRNAs has been demonstrated to have important roles in the regulation and progression of cancer development. In this review, we describe the roles of both short noncoding RNAs (including microRNAs, small nuclear RNAs, and piwi-interacting RNAs) and lncRNAs in carcinogenesis and outline the possible underlying genetic mechanisms, with particular emphasis on clinical applications. The focus of our review includes studies from the literature on ncRNAs in traditional endocrine-related cancers, including thyroid, parathyroid, adrenal gland, and gastrointestinal neuroendocrine malignancies. The current and potential future applications of ncRNAs in clinical cancer research is also discussed, with emphasis on diagnosis and future treatment.

  1. Validation of an entirely in vitro approach for rapid prototyping of DNA regulatory elements for synthetic biology

    PubMed Central

    Chappell, James; Jensen, Kirsten; Freemont, Paul S.


    A bottleneck in our capacity to rationally and predictably engineer biological systems is the limited number of well-characterized genetic elements from which to build. Current characterization methods are tied to measurements in living systems, the transformation and culturing of which are inherently time-consuming. To address this, we have validated a completely in vitro approach for the characterization of DNA regulatory elements using Escherichia coli extract cell-free systems. Importantly, we demonstrate that characterization in cell-free systems correlates and is reflective of performance in vivo for the most frequently used DNA regulatory elements. Moreover, we devise a rapid and completely in vitro method to generate DNA templates for cell-free systems, bypassing the need for DNA template generation and amplification from living cells. This in vitro approach is significantly quicker than current characterization methods and is amenable to high-throughput techniques, providing a valuable tool for rapidly prototyping libraries of DNA regulatory elements for synthetic biology. PMID:23371936

  2. Relaxase DNA Binding and Cleavage Are Two Distinguishable Steps in Conjugative DNA Processing That Involve Different Sequence Elements of the nic Site*

    PubMed Central

    Lucas, María; González-Pérez, Blanca; Cabezas, Matilde; Moncalian, Gabriel; Rivas, Germán; de la Cruz, Fernando


    TrwC, the relaxase of plasmid R388, catalyzes a series of concerted DNA cleavage and strand transfer reactions on a specific site (nic) of its origin of transfer (oriT). nic contains the cleavage site and an adjacent inverted repeat (IR2). Mutation analysis in the nic region indicated that recognition of the IR2 proximal arm and the nucleotides located between IR2 and the cleavage site were essential for supercoiled DNA processing, as judged either by in vitro nic cleavage or by mobilization of a plasmid containing oriT. Formation of the IR2 cruciform and recognition of the distal IR2 arm and loop were not necessary for these reactions to take place. On the other hand, IR2 was not involved in TrwC single-stranded DNA processing in vitro. For single-stranded DNA nic cleavage, TrwC recognized a sequence embracing six nucleotides upstream of the cleavage site and two nucleotides downstream. This suggests that TrwC DNA binding and cleavage are two distinguishable steps in conjugative DNA processing and that different sequence elements are recognized by TrwC in each step. IR2-proximal arm recognition was crucial for the initial supercoiled DNA binding. Subsequent recognition of the adjacent single-stranded DNA binding site was required to position the cleavage site in the active center of the protein so that the nic cleavage reaction could take place. PMID:20061574

  3. Relaxase DNA binding and cleavage are two distinguishable steps in conjugative DNA processing that involve different sequence elements of the nic site.


    Lucas, María; González-Pérez, Blanca; Cabezas, Matilde; Moncalian, Gabriel; Rivas, Germán; de la Cruz, Fernando


    TrwC, the relaxase of plasmid R388, catalyzes a series of concerted DNA cleavage and strand transfer reactions on a specific site (nic) of its origin of transfer (oriT). nic contains the cleavage site and an adjacent inverted repeat (IR(2)). Mutation analysis in the nic region indicated that recognition of the IR(2) proximal arm and the nucleotides located between IR(2) and the cleavage site were essential for supercoiled DNA processing, as judged either by in vitro nic cleavage or by mobilization of a plasmid containing oriT. Formation of the IR(2) cruciform and recognition of the distal IR(2) arm and loop were not necessary for these reactions to take place. On the other hand, IR(2) was not involved in TrwC single-stranded DNA processing in vitro. For single-stranded DNA nic cleavage, TrwC recognized a sequence embracing six nucleotides upstream of the cleavage site and two nucleotides downstream. This suggests that TrwC DNA binding and cleavage are two distinguishable steps in conjugative DNA processing and that different sequence elements are recognized by TrwC in each step. IR(2)-proximal arm recognition was crucial for the initial supercoiled DNA binding. Subsequent recognition of the adjacent single-stranded DNA binding site was required to position the cleavage site in the active center of the protein so that the nic cleavage reaction could take place.

  4. Long noncoding RNA in hematopoiesis and immunity.


    Satpathy, Ansuman T; Chang, Howard Y


    Dynamic gene expression during cellular differentiation is tightly coordinated by transcriptional and post-transcriptional mechanisms. An emerging theme is the central role of long noncoding RNAs (lncRNAs) in the regulation of this specificity. Recent advances demonstrate that lncRNAs are expressed in a lineage-specific manner and control the development of several cell types in the hematopoietic system. Moreover, specific lncRNAs are induced to modulate innate and adaptive immune responses. lncRNAs can function via RNA-DNA, RNA-RNA, and RNA-protein target interactions. As a result, they affect several stages of gene regulation, including chromatin modification, mRNA biogenesis, and protein signaling. We discuss recent advances, future prospects, and challenges in understanding the roles of lncRNAs in immunity and immune-mediated diseases.

  5. Dead Element Replicating: Degenerate R2 Element Replication and rDNA Genomic Turnover in the Bacillus rossius Stick Insect (Insecta: Phasmida)

    PubMed Central

    Martoni, Francesco; Eickbush, Danna G.; Scavariello, Claudia; Luchetti, Andrea; Mantovani, Barbara


    R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5’ end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s). Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun) as well as a full-length but degenerate element (R2Brdeg). An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements) are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution. PMID:25799008

  6. Dead element replicating: degenerate R2 element replication and rDNA genomic turnover in the Bacillus rossius stick insect (Insecta: Phasmida).


    Martoni, Francesco; Eickbush, Danna G; Scavariello, Claudia; Luchetti, Andrea; Mantovani, Barbara


    R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5' end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s). Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun) as well as a full-length but degenerate element (R2Brdeg). An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements) are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution.

  7. A common element involved in transcriptional regulation of two DNA alkylation repair genes (MAG and MGT1) of Saccharomyces cerevisiae.

    PubMed Central

    Xiao, W; Singh, K K; Chen, B; Samson, L


    The Saccharomyces cerevisiae MAG gene encodes a 3-methyladenine DNA glycosylase that protects cells from killing by alkylating agents. MAG mRNA levels are induced not only by alkylating agents but also by DNA-damaging agents that do not produce alkylated DNA. We constructed a MAG-lacZ gene fusion to help identify the cis-acting promoter elements involved in regulating MAG expression. Deletion analysis defined the presence of one upstream activating sequence and one upstream repressing sequence (URS) and suggested the presence of a second URS. One of the MAG URS elements matches a decamer consensus sequence present in the promoters of 11 other S. cerevisiae DNA repair and metabolism genes, including the MGT1 gene, which encodes an O6-methylguanine DNA repair methyltransferase. Two proteins of 26 and 39 kDa bind specifically to the MAG and MGT1 URS elements. We suggest that the URS-binding proteins may play an important role in the coordinate regulation of these S. cerevisiae DNA repair genes. Images PMID:8246943

  8. A possible aid in targeted insertion of large DNA elements by CRISPR/Cas in mouse zygotes.


    Nakao, Harumi; Harada, Takeshi; Nakao, Kazuki; Kiyonari, Hiroshi; Inoue, Kenichi; Furuta, Yasuhide; Aiba, Atsu


    The CRISPR/Cas system has rapidly emerged recently as a new tool for genome engineering, and is expected to allow for controlled manipulation of specific genomic elements in a variety of species. A number of recent studies have reported the use of CRISPR/Cas for gene disruption (knockout) or targeted insertion of foreign DNA elements (knock-in). Despite the ease of simple gene knockout and small insertions or nucleotide substitutions in mouse zygotes by the CRISPR/Cas system, targeted insertion of large DNA elements remains an apparent challenge. Here the generation of knock-in mice with successful targeted insertion of large donor DNA elements ranged from 3.0 to 7.1 kb at the ROSA26 locus using the CRISPR/Cas system was achieved. Multiple independent knock-in founder mice were obtained by injection of hCas9 mRNA/sgRNA/donor vector mixtures into the cytoplasm of C57BL/6N zygotes when the injected zygotes were treated with an inhibitor of actin polymerization, cytochalasin. Successful germ line transmission of three of these knock-in alleles was also confirmed. The results suggested that treatment of zygotes with actin polymerization inhibitors following microinjection could be a viable method to facilitate targeted insertion of large DNA elements by the CRISPR/Cas system, enabling targeted knock-in readily attainable in zygotes.

  9. Flow cytometry sorting of nuclei enables the first global characterization of Paramecium germline DNA and transposable elements.


    Guérin, Frédéric; Arnaiz, Olivier; Boggetto, Nicole; Denby Wilkes, Cyril; Meyer, Eric; Sperling, Linda; Duharcourt, Sandra


    DNA elimination is developmentally programmed in a wide variety of eukaryotes, including unicellular ciliates, and leads to the generation of distinct germline and somatic genomes. The ciliate Paramecium tetraurelia harbors two types of nuclei with different functions and genome structures. The transcriptionally inactive micronucleus contains the complete germline genome, while the somatic macronucleus contains a reduced genome streamlined for gene expression. During development of the somatic macronucleus, the germline genome undergoes massive and reproducible DNA elimination events. Availability of both the somatic and germline genomes is essential to examine the genome changes that occur during programmed DNA elimination and ultimately decipher the mechanisms underlying the specific removal of germline-limited sequences. We developed a novel experimental approach that uses flow cell imaging and flow cytometry to sort subpopulations of nuclei to high purity. We sorted vegetative micronuclei and macronuclei during development of P. tetraurelia. We validated the method by flow cell imaging and by high throughput DNA sequencing. Our work establishes the proof of principle that developing somatic macronuclei can be sorted from a complex biological sample to high purity based on their size, shape and DNA content. This method enabled us to sequence, for the first time, the germline DNA from pure micronuclei and to identify novel transposable elements. Sequencing the germline DNA confirms that the Pgm domesticated transposase is required for the excision of all ~45,000 Internal Eliminated Sequences. Comparison of the germline DNA and unrearranged DNA obtained from PGM-silenced cells reveals that the latter does not provide a faithful representation of the germline genome. We developed a flow cytometry-based method to purify P. tetraurelia nuclei to high purity and provided quality control with flow cell imaging and high throughput DNA sequencing. We identified 61

  10. Noncoding RNA Gas5 Is a Growth Arrest and Starvation-Associated Repressor of the Glucocorticoid Receptor

    PubMed Central

    Kino, Tomoshige; Hurt, Darrell E.; Ichijo, Takamasa; Nader, Nancy; Chrousos, George P.


    The availability of nutrients influences cellular growth and survival by affecting gene transcription. Glucocorticoids also influence gene transcription and have diverse activities on cell growth, energy expenditure, and survival. We found that the growth arrest-specific 5 (Gas5) noncoding RNA, which is abundant in cells whose growth has been arrested due to lack of nutrients or growth factors, sensitized cells to apoptosis by suppressing glucocorticoid-mediated induction of several responsive genes, including the one encoding cellular inhibitor of apoptosis 2. Gas5 bound to the DNA-binding domain of the glucocorticoid receptor (GR) by acting as a decoy “glucocorticoid response element (GRE)”, thus, competing with DNA GREs for binding to the GR. We conclude that Gas5 is a ribo-repressor of the GR, influencing cell survival and metabolic activities during starvation by modulating the transcriptional activity of the GR. PMID:20124551

  11. Noncoding RNA gas5 is a growth arrest- and starvation-associated repressor of the glucocorticoid receptor.


    Kino, Tomoshige; Hurt, Darrell E; Ichijo, Takamasa; Nader, Nancy; Chrousos, George P


    The availability of nutrients influences cellular growth and survival by affecting gene transcription. Glucocorticoids also influence gene transcription and have diverse activities on cell growth, energy expenditure, and survival. We found that the growth arrest-specific 5 (Gas5) noncoding RNA, which is abundant in cells whose growth has been arrested because of lack of nutrients or growth factors, sensitized cells to apoptosis by suppressing glucocorticoid-mediated induction of several responsive genes, including the one encoding cellular inhibitor of apoptosis 2. Gas5 bound to the DNA-binding domain of the glucocorticoid receptor (GR) by acting as a decoy glucocorticoid response element (GRE), thus competing with DNA GREs for binding to the GR. We conclude that Gas5 is a "riborepressor" of the GR, influencing cell survival and metabolic activities during starvation by modulating the transcriptional activity of the GR.

  12. A Collection of Conserved Noncoding Sequences to Study Gene Regulation in Flowering Plants1[OPEN

    PubMed Central


    Transcription factors (TFs) regulate gene expression by binding cis-regulatory elements, of which the identification remains an ongoing challenge owing to the prevalence of large numbers of nonfunctional TF binding sites. Powerful comparative genomics methods, such as phylogenetic footprinting, can be used for the detection of conserved noncoding sequences (CNSs), which are functionally constrained and can greatly help in reducing the number of false-positive elements. In this study, we applied a phylogenetic footprinting approach for the identification of CNSs in 10 dicot plants, yielding 1,032,291 CNSs associated with 243,187 genes. To annotate CNSs with TF binding sites, we made use of binding site information for 642 TFs originating from 35 TF families in Arabidopsis (Arabidopsis thaliana). In three species, the identified CNSs were evaluated using TF chromatin immunoprecipitation sequencing data, resulting in significant overlap for the majority of data sets. To identify ultraconserved CNSs, we included genomes of additional plant families and identified 715 binding sites for 501 genes conserved in dicots, monocots, mosses, and green algae. Additionally, we found that genes that are part of conserved mini-regulons have a higher coherence in their expression profile than other divergent gene pairs. All identified CNSs were integrated in the PLAZA 3.0 Dicots comparative genomics platform ( together with new functionalities facilitating the exploration of conserved cis-regulatory elements and their associated genes. The availability of this data set in a user-friendly platform enables the exploration of functional noncoding DNA to study gene regulation in a variety of plant species, including crops. PMID:27261064

  13. Structure and function of the c-myc DNA-unwinding element-binding protein DUE-B.


    Kemp, Michael; Bae, Brian; Yu, John Paul; Ghosh, Maloy; Leffak, Michael; Nair, Satish K


    Local zones of easily unwound DNA are characteristic of prokaryotic and eukaryotic replication origins. The DNA-unwinding element of the human c-myc replication origin is essential for replicator activity and is a target of the DNA-unwinding element-binding protein DUE-B in vivo. We present here the 2.0A crystal structure of DUE-B and complementary biochemical characterization of its biological activity. The structure corresponds to a dimer of the N-terminal domain of the full-length protein and contains many of the structural elements of the nucleotide binding fold. A single magnesium ion resides in the putative active site cavity, which could serve to facilitate ATP hydrolytic activity of this protein. The structure also demonstrates a notable similarity to those of tRNA-editing enzymes. Consistent with this structural homology, the N-terminal core of DUE-B is shown to display both D-aminoacyl-tRNA deacylase activity and ATPase activity. We further demonstrate that the C-terminal portion of the enzyme is disordered and not essential for dimerization. However, this region is essential for DNA binding in vitro and becomes ordered in the presence of DNA.

  14. Nucleosome core particles containing a poly(dA.dT) sequence element exhibit a locally distorted DNA structure.


    Bao, Yunhe; White, Cindy L; Luger, Karolin


    Poly(dA.dT) DNA sequence elements are thought to promote transcription by either excluding nucleosomes or by altering their structural or dynamic properties. Here, the stability and structure of a defined nucleosome core particle containing a 16 base-pair poly(dA.dT) element (A16 NCP) was investigated. The A16 NCP requires a significantly higher temperature for histone octamer sliding in vitro compared to comparable nucleosomes that do not contain a poly(dA.dT) element. Fluorescence resonance energy transfer showed that the interactions between the nucleosomal DNA ends and the histone octamer were destabilized in A16 NCP. The crystal structure of A16 NCP was determined to a resolution of 3.2 A. The overall structure was maintained except for local deviations in DNA conformation. These results are consistent with previous in vivo and in vitro observations that poly(dA.dT) elements cause only modest changes in DNA accessibility and modest increases in steady-state transcription levels.

  15. cis-acting DNA regulatory elements, including the retinoic acid response element, are required for tissue specific laminin B1 promoter/lacZ expression in transgenic mice.


    Sharif, K A; Li, C; Gudas, L J


    The LAMB1 gene encodes the laminin beta1 subunit of laminin, an extracellular matrix protein. Using several transgenic mouse lines containing various lengths of the LAMB1 promoter driving lacZ reporter gene expression, regions of LAMB1 promoter that contain cis-acting DNA regulatory element(s) have been identified. The 3.9LAMB1betagal transgene is expressed in various tissues during development. LAMB1 transgene expression is observed in a selective set of nephrons of the neonatal and adult kidneys. The cis-acting DNA regulatory elements responsible for LAMB1 transgene expression in ovaries and in juvenile kidneys are present between -'1.4 and -0.7 kb relative to the transcription start site, while those of adult kidneys are located between -2.5 and -1.4 kb. The LAMB1 transgene is also expressed in the epididymis of 1 week old transgenic mice. Mutation of the retinoic acid response element (RARE) in the context of the 3.9LAMB1betagal transgene results in loss of LAMB1 transgene expression in all tissues. Thus, sequences between -2.5 and -0.7 kb plus the RARE are required for appropriate expression of the LAMB1 transgene in mice.

  16. Capicua DNA-binding sites are general response elements for RTK signaling in Drosophila.


    Ajuria, Leiore; Nieva, Claudia; Winkler, Clint; Kuo, Dennis; Samper, Núria; Andreu, María José; Helman, Aharon; González-Crespo, Sergio; Paroush, Ze'ev; Courey, Albert J; Jiménez, Gerardo


    RTK/Ras/MAPK signaling pathways play key functions in metazoan development, but how they control expression of downstream genes is not well understood. In Drosophila, it is generally assumed that most transcriptional responses to RTK signal activation depend on binding of Ets-family proteins to specific cis-acting sites in target enhancers. Here, we show that several Drosophila RTK pathways control expression of downstream genes through common octameric elements that are binding sites for the HMG-box factor Capicua, a transcriptional repressor that is downregulated by RTK signaling in different contexts. We show that Torso RTK-dependent regulation of terminal gap gene expression in the early embryo critically depends on Capicua octameric sites, and that binding of Capicua to these sites is essential for recruitment of the Groucho co-repressor to the huckebein enhancer in vivo. We then show that subsequent activation of the EGFR RTK pathway in the neuroectodermal region of the embryo controls dorsal-ventral gene expression by downregulating the Capicua protein, and that this control also depends on Capicua octameric motifs. Thus, a similar mechanism of RTK regulation operates during subdivision of the anterior-posterior and dorsal-ventral embryonic axes. We also find that identical DNA octamers mediate Capicua-dependent regulation of another EGFR target in the developing wing. Remarkably, a simple combination of activator-binding sites and Capicua motifs is sufficient to establish complex patterns of gene expression in response to both Torso and EGFR activation in different tissues. We conclude that Capicua octamers are general response elements for RTK signaling in Drosophila.

  17. Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans.

    PubMed Central

    Pérez-González, C E; Eickbush, T H


    The mobile elements R1 and R2 insert specifically into the rRNA gene locus (rDNA locus) of arthropods, a locus known to undergo concerted evolution, the recombinational processes that preserve the sequence homogeneity of all repeats. To monitor how rapidly individual R1 and R2 insertions are turned over in the rDNA locus by these processes, we have taken advantage of the many 5' truncation variants that are generated during the target-primed reverse transcription mechanism used by these non-LTR retrotransposons for their integration. A simple PCR assay was designed to reveal the pattern of the 5' variants present in the rDNA loci of individual X chromosomes in a population of Drosophila simulans. Each rDNA locus in this population was found to have a large, unique collection of 5' variants. Each variant was present at low copy number, usually one copy per chromosome, and was seldom distributed to other chromosomes in the population. The failure of these variants to spread to other units in the same rDNA locus suggests a strong recombinational bias against R1 and R2 that results in the individual copies of these elements being rapidly lost from the rDNA locus. This bias suggests a significantly higher frequency of R1 and R2 retrotransposition than we have previously suggested. PMID:11514447

  18. Identification of the DNA damage-responsive element of RNR2 and evidence that four distinct cellular factors bind it.

    PubMed Central

    Elledge, S J; Davis, R W


    The RNR2 gene encodes the small subunit of ribonucleotide reductase, the enzyme that catalyzes the first step in the pathway for the production of the deoxyribonucleotides needed for DNA synthesis. Transcription of this gene is induced approximately 20-fold in response to environmental stimuli that damage DNA or block DNA replication. Deletion and subcloning analysis identified two, and possibly three, upstream activating sequences (UAS) and one repressing (URS) element in the RNR2 regulatory region. A 42-base-pair (bp) fragment from this region was found to be necessary for proper regulation of RNR2 and to be capable of conferring DNA damage inducibility upon a heterologous promoter. This fragment contained both positively and negatively acting sequences. Four DNA-binding factors interacted with the RNR2 regulatory region. One factor was identified as the GRF1 protein, the product of the RAP1 gene. GRF1 bound to the UAS2 element of RNR2, which was found to be directly adjacent to the 42-bp fragment. UAS2 activity was repressed by the 42-bp fragment. Three other factors bound to the 42-bp fragment; one of these factors, RRF3, had a second binding site in the RNR2 promoter. These factors are likely to mediate the response of RNR2 to DNA damage. Images PMID:2685561

  19. An active DNA transposon nDart causing leaf variegation and mutable dwarfism and its related elements in rice.


    Tsugane, Kazuo; Maekawa, Masahiko; Takagi, Kyoko; Takahara, Hiroyuki; Qian, Qian; Eun, Chang-Ho; Iida, Shigeru


    While characterized mutable alleles caused by DNA transposons have been abundant in maize since the discovery of Dissociation conferring variegation by Barbara McClintock, only a few mutable alleles have been described in rice even though the rice genome contains various transposons. Here, we show that a spontaneous mutable virescent allele, pyl-v, is caused by the disruption of the nuclear-coded essential chloroplast protease gene, OsClpP5, due to insertion of a 607-bp non-autonomous DNA transposon, non-autonomous DNA-based active rice transposon one (nDart1), belonging to the hAT superfamily. The transposition of nDart1 can be induced by crossing with a line containing an autonomous element, aDart, and stabilized by segregating out of aDart. We also identified a novel mutable dwarf allele thl-m caused by an insertion of nDart1. The japonica cultivar Nipponbare carries no aDart, although it contains epigenetically silenced Dart element(s), which can be activated by 5-azacytidine. Nipponbare bears four subgroups of about 3.6-kb Dart-like sequences, three of which contain potential transposase genes, and around 3.6-kb elements without an apparent transposase gene, as well as three subgroups of about 0.6-kb nDart1-related elements that are all internal deletions of the Dart-like sequences. Both nDart1 and 3.6-kb Dart-like elements were also present in indica varieties 93-11 and Kasalath. nDart1 appears to be the most active mutagen among nDart1-related elements contributing to generating natural variations. A candidate for an autonomous element, aDart, and a possible application of nDart1 for transposon tagging are discussed.

  20. cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

    SciTech Connect

    Hoefler, G.; Forstner, M.; Hulla, W.; Hiden, M.; Krisper, P.; Kenner, L.; Zechner, R. ); McGuinness, M.C. ); Ried, T.; Lengauer, C. )


    Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison, they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.

  1. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.


    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang


    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS.

  2. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9

    PubMed Central

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang


    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  3. Hundreds of Circular Novel Plasmids and DNA Elements Identified in a Rat Cecum Metamobilome

    PubMed Central

    Jørgensen, Tue Sparholt; Xu, Zhuofei; Hansen, Martin Asser; Sørensen, Søren Johannes; Hansen, Lars Hestbjerg


    Metagenomic approaches are widespread in microbiological research, but so far, the knowledge on extrachromosomal DNA diversity and composition has largely remained dependant on cultivating host organisms. Even with the emergence of metagenomics, complete circular sequences are rarely identified, and have required manual curation. We propose a robust in silico procedure for identifying complete small plasmids in metagenomic datasets from whole genome shotgun sequencing. From one very pure and exhaustively sequenced metamobilome from rat cecum, we identified a total of 616 circular sequences, 160 of which were carrying a gene with plasmid replication domain. Further homology analyses indicated that the majority of these plasmid sequences are novel. We confirmed the circularity of the complete plasmid candidates using an inverse-type PCR approach on a subset of sequences with 95% success, confirming the existence and length of discrete sequences. The implication of these findings is a broadened understanding of the traits of circular elements in nature and the possibility of massive data mining in existing metagenomic datasets to discover novel pools of complete plasmids thus vastly expanding the current plasmid database. PMID:24503942

  4. Fine-scale map of encyclopedia of DNA elements regions in the Korean population.


    Yoo, Yeon-Kyeong; Ke, Xiayi; Hong, Sungwoo; Jang, Hye-Yoon; Park, Kyunghee; Kim, Sook; Ahn, TaeJin; Lee, Yeun-Du; Song, Okryeol; Rho, Na-Young; Lee, Moon Sue; Lee, Yeon-Su; Kim, Jaeheup; Kim, Young J; Yang, Jun-Mo; Song, Kyuyoung; Kimm, Kyuchan; Weir, Bruce; Cardon, Lon R; Lee, Jong-Eun; Hwang, Jung-Joo


    The International HapMap Project aims to generate detailed human genome variation maps by densely genotyping single-nucleotide polymorphisms (SNPs) in CEPH, Chinese, Japanese, and Yoruba samples. This will undoubtedly become an important facility for genetic studies of diseases and complex traits in the four populations. To address how the genetic information contained in such variation maps is transferable to other populations, the Korean government, industries, and academics have launched the Korean HapMap project to genotype high-density Encyclopedia of DNA Elements (ENCODE) regions in 90 Korean individuals. Here we show that the LD pattern, block structure, haplotype diversity, and recombination rate are highly concordant between Korean and the two HapMap Asian samples, particularly Japanese. The availability of information from both Chinese and Japanese samples helps to predict more accurately the possible performance of HapMap markers in Korean disease-gene studies. Tagging SNPs selected from the two HapMap Asian maps, especially the Japanese map, were shown to be very effective for Korean samples. These results demonstrate that the HapMap variation maps are robust in related populations and will serve as an important resource for the studies of the Korean population in particular.

  5. Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements.


    Telorac, Jonas; Prykhozhij, Sergey V; Schöne, Stefanie; Meierhofer, David; Sauer, Sascha; Thomas-Chollier, Morgane; Meijsing, Sebastiaan H


    Out of the myriad of potential DNA binding sites of the glucocorticoid receptor (GR) found in the human genome, only a cell-type specific minority is actually bound, indicating that the presence of a recognition sequence alone is insufficient to specify where GR binds. Cooperative interactions with other transcription factors (TFs) are known to contribute to binding specificity. Here, we reasoned that sequence signals preventing GR recruitment to certain loci provide an alternative means to confer specificity. Motif analyses uncovered candidate Negative Regulatory Sequences (NRSs) that interfere with genomic GR binding. Subsequent functional analyses demonstrated that NRSs indeed prevent GR binding to nearby response elements. We show that NRS activity is conserved across species, found in most tissues and that they also interfere with the genomic binding of other TFs. Interestingly, the effects of NRSs appear not to be a simple consequence of changes in chromatin accessibility. Instead, we find that NRSs interact with proteins found at sub-nuclear structures called paraspeckles and that these proteins might mediate the repressive effects of NRSs. Together, our studies suggest that the joint influence of positive and negative sequence signals partition the genome into regions where GR can bind and those where it cannot.

  6. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    SciTech Connect

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng


    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage.

  7. UpSETing chromatin during non-coding RNA production

    PubMed Central


    The packaging of eukaryotic DNA into nucleosomal arrays permits cells to tightly regulate and fine-tune gene expression. The ordered disassembly and reassembly of these nucleosomes allows RNA polymerase II (RNAPII) conditional access to the underlying DNA sequences. Disruption of nucleosome reassembly following RNAPII passage results in spurious transcription initiation events, leading to the production of non-coding RNA (ncRNA). We review the molecular mechanisms involved in the suppression of these cryptic initiation events and discuss the role played by ncRNAs in regulating gene expression. PMID:23738864

  8. A Molecular Chipper technology for CRISPR sgRNA library generation and functional mapping of noncoding regions

    PubMed Central

    Cheng, Jijun; Roden, Christine A.; Pan, Wen; Zhu, Shu; Baccei, Anna; Pan, Xinghua; Jiang, Tingting; Kluger, Yuval; Weissman, Sherman M.; Guo, Shangqin; Flavell, Richard A.; Ding, Ye; Lu, Jun


    Clustered regularly-interspaced palindromic repeats (CRISPR)-based genetic screens using single-guide-RNA (sgRNA) libraries have proven powerful to identify genetic regulators. Applying CRISPR screens to interrogate functional elements in noncoding regions requires generating sgRNA libraries that are densely covering, and ideally inexpensive, easy to implement and flexible for customization. Here we present a Molecular Chipper technology for generating dense sgRNA libraries for genomic regions of interest, and a proof-of-principle screen that identifies novel cis-regulatory domains for miR-142 biogenesis. The Molecular Chipper approach utilizes a combination of random fragmentation and a type III restriction enzyme to derive a densely covering sgRNA library from input DNA. Applying this approach to 17 microRNAs and their flanking regions and with a reporter for miR-142 activity, we identify both the pre-miR-142 region and two previously unrecognized cis-domains important for miR-142 biogenesis, with the latter regulating miR-142 processing. This strategy will be useful for identifying functional noncoding elements in mammalian genomes. PMID:27025950

  9. Examining the contribution of a dA+dT element to the conformation of Escherichia coli integration host factor-DNA complexes.

    PubMed Central

    Hales, L M; Gumport, R I; Gardner, J F


    DNA binding proteins that induce structural changes in DNA are common in both prokaryotes and eukaryotes. Integration host factor (IHF) is a multi-functional DNA binding and bending protein of Escherichia coli that can mediate protein-protein and protein-DNA interactions by bending DNA. Previously we have shown that the presence of a dA+dT element 5'-proximal to an IHF consensus sequence can affect the binding of IHF to a particular site. In this study the contribution of various sequence elements to the formation of IHF-DNA complexes was examined. We show that IHF bends DNA more when it binds to a site containing a dA+dT element upstream of its core consensus element than to a site lacking a dA+dT element. We demonstrate that IHF can be specifically crosslinked to DNA with binding sites either containing or lacking this dA+dT element. These results indicate the importance of flanking DNA and a dA+dT element in the binding and bending of a site by IHF. PMID:8650000

  10. Examining the contribution of a dA+dT element to the conformation of Escherichia coli integration host factor-DNA complexes.


    Hales, L M; Gumport, R I; Gardner, J F


    DNA binding proteins that induce structural changes in DNA are common in both prokaryotes and eukaryotes. Integration host factor (IHF) is a multi-functional DNA binding and bending protein of Escherichia coli that can mediate protein-protein and protein-DNA interactions by bending DNA. Previously we have shown that the presence of a dA+dT element 5'-proximal to an IHF consensus sequence can affect the binding of IHF to a particular site. In this study the contribution of various sequence elements to the formation of IHF-DNA complexes was examined. We show that IHF bends DNA more when it binds to a site containing a dA+dT element upstream of its core consensus element than to a site lacking a dA+dT element. We demonstrate that IHF can be specifically crosslinked to DNA with binding sites either containing or lacking this dA+dT element. These results indicate the importance of flanking DNA and a dA+dT element in the binding and bending of a site by IHF.

  11. NMR characterization of a kissing complex formed between the TAR RNA element of HIV-1 and a DNA aptamer

    PubMed Central

    Collin, D.; van Heijenoort, C.; Boiziau, C.; Toulmé, J.-J.; Guittet, E.


    This work presents the first structural analysis of an RNA–DNA complex consisting of an 18 nt RNA hairpin and a 20 nt DNA aptamer. The DNA molecule was previously selected, from a randomly synthesized library, against the transactivation response element (TAR) involved in transcriptional regulation of the HIV genome. The DNA aptamer used in the present study is an imperfect stem–loop with the sequence 5′-ACTCCCAT-3′, characteristic of the selected candidates, in the apical loop. This octameric motif contains five bases complementary to the TAR loop sequence 5′-CUGGGA-3′. The use of homo- and heteronuclear NMR spectroscopy allowed assignment of the complex resonances and resolution of its secondary structure. Evidence is given for a kissing complex fold, which consists of a quasi-continuous helix formed by one stem of DNA, one stem of RNA and a central hybrid helix comprising 5 bp. Two out of helices residues of DNA and one of RNA connect the DNA–RNA loop–loop helix to the stem of either partner in the complex. In addition, two thymines of the DNA stem are engaged in a non-canonical T·T base pair. PMID:10954609

  12. Development of two highly sensitive forensic sex determination assays based on human DYZ1 and Alu repetitive DNA elements.


    Fazi, Amanda; Gobeski, Brianne; Foran, David


    Sex determination is a critical component of forensic identification, the standard genetic method for which is detection of the single copy amelogenin gene that has differing homologues on the X and Y chromosomes. However, this assay may not be sensitive enough when DNA samples are minute or highly compromised, thus other strategies for sex determination are needed. In the current research, two ultrasensitive sexing assays, based on real-time PCR and pyrosequencing, were developed targeting the highly repetitive elements DYZ1 on the Y chromosome and Alu on the autosomes. The DYZ1/Alu strategy was compared to amelogenin for overall sensitivity based on high molecular weight and degraded DNA, followed by assaying the sex of 34 touch DNA samples and DNA from 30 hair shafts. The real-time DYZ1/Alu assay proved to be approximately 1500 times more sensitive than its amelogenin counterpart based on high molecular weight DNA, and even more sensitive when sexing degraded DNA. The pyrosequencing DYZ1/Alu assay correctly sexed 26 of the touch DNAs, compared to six using amelogenin. Hair shaft DNAs showed equally improved sexing results using the DYZ1/Alu assays. Overall, both DYZ1/Alu assays were far more sensitive and accurate than was the amelogenin assay, and thus show great utility for sexing poor quality and low quantity DNA evidence.

  13. YY1 and a unique DNA repeat element regulates the transcription of mouse CS1 (CD319, SLAMF7) gene.


    Dongre, Prachi; Mathew, Stephen; Akopova, Irina; Gryczynski, Ignacy; Mathew, Porunelloor


    CS1 (CD319, CRACC, SLAMF7, novel Ly9) activates NK cell-mediated cytotoxicity and proliferation of B lymphocytes during immune responses. The expression of CS1 is up regulated on B cells in multiple myeloma and systemic lupus erythematosus. In this study we describe the transcriptional regulation of mouse CS1 (mCS1) gene. We show that mCS1 gene transcription is regulated by YY1 (Ying Yang 1) and a unique (AG)n=36 DNA repeat element. YY1 is known to play a significant role in B cell development by regulating the pro B cell to pre B cell transition. The consensus DNA binding site for YY1 was detected using TRANSFAQ on the mCS1 promoter region. Mutations in the YY1 site led to a significant increase in mCS1 promoter activity indicating that YY1 represses mCS1 transcription. YY1 binds to the mCS1 promoter at the expected site in vivo and in vitro as tested by chromatin immunoprecipitation assays and super-shift EMSA assays respectively. Unique (CT)n=24 and (AG)n=36 DNA repeat elements are present on mCS1 promoter that are sensitive to S1 nuclease and engage in DNA triplex structure as confirmed by AFM (atomic force microscopy) imaging. Interestingly, the (AG)n=36 repeat element enhances mCS1 promoter activity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    SciTech Connect

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.


    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  15. Identification and analysis of mouse non-coding RNA using transcriptome data.


    Zhao, Yuhui; Liu, Wanfei; Zeng, Jingyao; Liu, Shoucheng; Tan, Xinyu; Aljohi, Hasanawad; Hu, Songnian


    Transcripts are expressed spatially and temporally and they are very complicated, precise and specific; however, most studies are focused on protein-coding related genes. Recently, massively parallel cDNA sequencing (RNA-seq) has emerged to be a new and promising tool for transcriptome research, and numbers of non-coding RNAs, especially lincRNAs, have been widely identified and well characterized as important regulators of diverse biological processes. In this study, we used ultra-deep RNA-seq data from 15 mouse tissues to study the diversity and dynamic of non-coding RNAs in mouse. Using our own criteria, we identified totally 16,249 non-coding genes (21,569 non-coding RNAs) in mouse. We annotated these non-coding RNAs by diverse properties and found non-coding RNAs are generally shorter, have fewer exons, express in lower level and are more strikingly tissue-specific compared with protein-coding genes. Moreover, these non-coding RNAs show significant enrichment with transcriptional initiation and elongation signals including histone modifications (H3K4me3, H3K27me3 and H3K36me3), RNAPII binding sites and CAGE tags. The gene set enrichment analysis (GSEA) result revealed several sets of lincRNAs associated with diverse biological processes such as immune effector process, muscle development and sexual reproduction. Taken together, this study provides a more comprehensive annotation of mouse non-coding RNAs and gives an opportunity for future functional and evolutionary study of mouse non-coding RNAs.

  16. Control of chromatin structure by long noncoding RNA

    PubMed Central

    Böhmdorfer, Gudrun; Wierzbicki, Andrzej T.


    Long noncoding RNA (lncRNA) is a pivotal factor regulating various aspects of genome activity. Genome regulation via DNA methylation and posttranslational histone modifications is a well-documented function of lncRNA in plants, fungi, and animals. Here, we summarize evidence showing that lncRNA also controls chromatin structure including nucleosome positioning and chromosome looping. We focus on data from plant experimental systems, discussed in the context of other eukaryotes. We explain the mechanisms of lncRNA-controlled chromatin remodeling and the implications of the functional interplay between noncoding transcription and several different chromatin remodelers. We propose that the unique properties of RNA make it suitable for controlling chromatin modifications and structure. PMID:26410408

  17. Long non-coding RNA CASC2 in human cancer.


    Palmieri, Giuseppe; Paliogiannis, Panagiotis; Sini, Maria Cristina; Manca, Antonella; Palomba, Grazia; Doneddu, Valentina; Tanda, Francesco; Pascale, Maria Rosa; Cossu, Antonio


    Long non-coding RNAs cover large part of the non-coding information of the human DNA, which represents more than 90% of the whole genome. They constitute a wide and complex group of molecules with more than 200 nucleotides, which generally lack an open reading frame, and are involved in various ways in the pathophysiology of cancer. Their roles in the regulation of gene expression, imprinting, transcription, and post-translational processing have been described in several types of cancer. CASC2 was discovered in 2004 in patients with endometrial carcinoma as a potential tumor suppressor. Since then, additional studies in other types of neoplasia have been carried out, and both mechanisms and interactions of CASC2 in cancer have been better elucidated. In this review, we summarize the current knowledge on the role of CASC2 in the genesis, progression, and clinical management of human cancer.

  18. RNA exosome regulated long non-coding RNA transcription controls super-enhancer activity

    PubMed Central

    Pefanis, Evangelos; Wang, Jiguang; Rothschild, Gerson; Lim, Junghyun; Kazadi, David; Sun, Jianbo; Federation, Alexander; Chao, Jaime; Elliott, Oliver; Liu, Zhi-Ping; Economides, Aris N.; Bradner, James E.; Rabadan, Raul; Basu, Uttiya


    We have ablated the cellular RNA degradation machinery in differentiated B cells and pluripotent embryonic stem (ES) cells by conditional mutagenesis of core (Exosc3) and nuclear RNase (Exosc10) components of RNA exosome and identified a vast number of long non-coding RNAs (lncRNAs) and enhancer RNAs (eRNAs) with emergent functionality. Unexpectedly, eRNA-expressing regions accumulate R-loop structures upon RNA exosome ablation, thus demonstrating the role of RNA exosome in resolving deleterious DNA/RNA hybrids arising from active enhancers. We have uncovered a distal divergent eRNA-expressing element (lncRNA-CSR) engaged in long-range DNA interactions and regulating IgH 3′ regulatory region super-enhancer function. CRISPR-Cas9 mediated ablation of lncRNA-CSR transcription decreases its chromosomal looping-mediated association with the IgH 3′regulatory region super-enhancer and leads to decreased class switch recombination efficiency. We propose that the RNA exosome protects divergently transcribed lncRNA expressing enhancers, by resolving deleterious transcription-coupled secondary DNA structures, while also regulating long-range super-enhancer chromosomal interactions important for cellular function. PMID:25957685

  19. Novel classes of non-coding RNAs and cancer

    PubMed Central


    For the many years, the central dogma of molecular biology has been that RNA functions mainly as an informational intermediate between a DNA sequence and its encoded protein. But one of the great surprises of modern biology was the discovery that protein-coding genes represent less than 2% of the total genome sequence, and subsequently the fact that at least 90% of the human genome is actively transcribed. Thus, the human transcriptome was found to be more complex than a collection of protein-coding genes and their splice variants. Although initially argued to be spurious transcriptional noise or accumulated evolutionary debris arising from the early assembly of genes and/or the insertion of mobile genetic elements, recent evidence suggests that the non-coding RNAs (ncRNAs) may play major biological roles in cellular development, physiology and pathologies. NcRNAs could be grouped into two major classes based on the transcript size; small ncRNAs and long ncRNAs. Each of these classes can be further divided, whereas novel subclasses are still being discovered and characterized. Although, in the last years, small ncRNAs called microRNAs were studied most frequently with more than ten thousand hits at PubMed database, recently, evidence has begun to accumulate describing the molecular mechanisms by which a wide range of novel RNA species function, providing insight into their functional roles in cellular biology and in human disease. In this review, we summarize newly discovered classes of ncRNAs, and highlight their functioning in cancer biology and potential usage as biomarkers or therapeutic targets. PMID:22613733

  20. Plasticity in cell defence: access to and reactivity of critical protein residues and DNA response elements.


    Goldring, Chris; Kitteringham, Neil; Jenkins, Rosalind; Copple, Ian; Jeannin, Jean-Francois; Park, B Kevin


    Cellular and whole organ defence against pathogenic or chemical challenge is manifest as an adaptive response. Where appropriate, this may lead to induction of a cellular defence programme, thereby enhancing cell survival. When the challenge is overwhelming, the defence is breached and a switch is made to yield cell death, either by apoptosis or necrosis. Thus, a cell will defend itself where possible, but in extremis, it may recognise the futility of its resistance and allow itself to die. Transcription factor activation and access to the DNA regulatory elements that control a particular pattern of expression of defence genes is a major issue that may ultimately decide the fate of a cell in a changed environment. It is possible to visualise the access to the nucleus and to the genome, of paradigm gene loci or transcription factors, using a number of molecular techniques such as chromatin immunoprecipitation, in vivo footprinting and live/whole cell imaging. These methods are informative as to the array of transcription factors that may regulate a given gene, as well as the transitory nature of the transcriptional activation. The initial triggering of active transcription factor complexes typically occurs within the cytoplasm of the cell. Protein-protein interactions and signal transduction pathways, elucidated using a classical molecular genetics approach, have long been recognised as pivotal to the initial control of the levels and activity of transcription factors. We can now visualise modifications in critical residues of transcription factors and regulators during cellular response to chemical stress. These modifications may yield enhanced or repressed activity of transcription factors, they may be non-covalent or covalent, and they may occur in response to a variety of classes of chemicals. Such promiscuous signalling can provide plasticity in the cellular response to a wide array of chemical agents.

  1. The bcr1 DNA Repeat Element Is Specific to the Bacillus cereus Group and Exhibits Mobile Element Characteristics

    PubMed Central

    Økstad, Ole Andreas; Tourasse, Nicolas J.; Stabell, Fredrik B.; Sundfær, Cathrine K.; Egge-Jacobsen, Wolfgang; Risøen, Per Arne; Read, Timothy D.; Kolstø, Anne-Brit


    Bacillus cereus strains ATCC 10987 and ATCC 14579 harbor a ∼155-bp repeated element, bcr1, which is conserved in B. cereus, B. anthracis, B. thuringiensis, and B. mycoides but not in B. subtilis and B. licheniformis. In this study, we show by Southern blot hybridizations that bcr1 is present in all 54 B. cereus group strains tested but absent in 11 Bacillus strains outside the group, suggesting that bcr1 may be specific and ubiquitous to the B. cereus group. By comparative analysis of the complete genome sequences of B. cereus ATCC 10987, B. cereus ATCC 14579, and B. anthracis Ames, we show that bcr1 is exclusively present in the chromosome but absent from large plasmids carried by these strains and that the numbers of full-length bcr1 repeats for these strains are 79, 54, and 12, respectively. Numerous copies of partial bcr1 elements are also present in the three genomes (91, 128, and 53, respectively). Furthermore, the genomic localization of bcr1 is not conserved between strains with respect to chromosomal position or organization of gene neighbors, as only six full-length bcr1 loci are common to at least two of the three strains. However, the intergenic sequence surrounding a specific bcr1 repeat in one of the three strains is generally strongly conserved in the other two, even in loci where bcr1 is found exclusively in one strain. This finding indicates that bcr1 either has evolved by differential deletion from a very high number of repeats in a common ancestor to the B. cereus group or is moving around the chromosome. The identification of bcr1 repeats interrupting genes in B. cereus ATCC 10987 and ATCC 14579 and the presence of a flanking TTTAT motif in each end show that bcr1 exhibits features characteristic of a mobile element. PMID:15516586

  2. Trans-acting factors and properly positioned DNA elements repress mating-type genes in fission yeast.


    Ekwall, K; Olsson, T; Ruusala, T


    Repression of the mating-type P genes at the silent mat2-P locus in fission yeast is dependent on four cis-acting DNA elements, two on each side of the coding sequences. The mechanism by which these elements exert their influence on the mating-type promoter is studied here by insertion of a bacterial antibiotic resistance gene at several positions in the silent region. The behavior of the resistance gene itself, and the changes its insertion causes in mating-type expression, reveal that the repressive elements have a limited range of action and that the four elements have unequal effects on gene expression. Repression of the antibiotic resistance gene inside the silent region leads to an antibiotic-sensitive phenotype and facilitates the selection of resistant mutants. These mutants can de-repress the resistance gene at other positions than the one used for their selection. Strong antibiotic resistance correlates with derepression of the plasmid-borne mating-type cassette. These data argue that mat2-P repression is dependent on trans-acting factors and the positioning of the repressive DNA elements, but less dependent on the nature of the affected promoter.

  3. A view of an elemental naturalist at the DNA world (base composition, sequences, methylation).


    Vanyushin, B F


    The pioneering data on base composition and pyrimidine sequences in DNA of pro- and eukaryotes are considered, and their significance for the origin of genosystematics is discussed. The modern views on specificity and functional role of enzymatic DNA methylation in eukaryotes are described. DNA methylation controls all genetic functions and is a mechanism of cellular differentiation and gene silencing. A model of regulation of DNA replication by methylation is suggested. Adenine DNA methylation in higher eukaryotes (higher plants) was first observed, and it was established that one and the same gene can be methylated at both cytosine and adenine moieties. Thus, there are at least two different and seemingly interdependent DNA methylation systems present in eukaryotic cells. The first eukaryotic adenine DNA-methyltransferase is isolated from wheat seedlings and described: the enzyme methylates DNA with formation of N6-methyladenine in the sequence TGATCA-->TGm6ATCA. It is found that higher plants have endonucleases that are dependent on S-adenosyl-L-methionine (SAM) and sensitive to DNA methylation status. Therefore, as in bacteria, plants seem to have a restriction-modification (R-M) system. A system of conjugated up- and down-regulation of SAM-dependent endonucleases by SAM modulations is found in plants. Revelation of an essential role of DNA methylation in regulation of genetic processes is a fundament of materialization of epigenetics and epigenomics.

  4. Determination of specific DNA sequences and their hybridisation processes by elemental labelling followed by SEC-ICP-MS detection.


    López-Fernández, Lucía; Blanco-González, Elisa; Bettmer, Jörg


    Detection of specific DNA sequences is nowadays an important tool in many scientific areas such as forensic science or clinical diagnosis. Although numerous approaches have been suggested for this challenging analysis, certain limitations still remain. In order to overcome these disadvantages, novel and alternative methodologies are required. In this work, we present a strategy based on elemental (lanthanide) labelling of DNA probes followed by size-exclusion chromatography (SEC) coupled with inductively coupled plasma-mass spectrometry (ICP-MS) for monitoring and determining complementary oligonucleotide sequences (oligonucleotide targets) and for visualising the corresponding hybridisation processes. The synthesis and characterisation of the DNA probes are described in detail. SEC was found to be suitable to discriminate between the DNA probe and the hybridised product. Using labelling of different probes with different lanthanides, multiplexed detection of the sought DNA sequences was possible as demonstrated here on three DNA probes (derivatised with Eu, Tb, and Ho, respectively). The achievable detection limits were in the range between 5 and 11 fmol absolute.

  5. Long noncoding RNAs and atherosclerosis.


    Zhou, Tian; Ding, Jia-wang; Wang, Xin-an; Zheng, Xia-xia


    Atherosclerosis is universally recognized as a chronic lipid-induced inflammation of the vessel wall in response to dyslipidemia and haemodynamic stress involving dysfunction and activation of resident vascular cells as well as infiltration of leukocytes. As members of nonprotein-coding RNAs, the long noncoding RNAs (lncRNAs) are implicated in various biological processes. Accumulating evidences suggest that lncRNAs regulate the function of vascular wall, activation of macrophages, lipid metabolism and immune response. Here, we review the effects of lncRNAs on the progress of atherosclerosis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. Noncoding RNAs and enhancers: complications of a long-distance relationship

    PubMed Central

    Ørom, Ulf Andersson; Shiekhattar, Ramin


    Spatial and temporal regulation of gene expression is achieved through instructions provided by the distal transcriptional regulatory elements known as enhancers. How enhancers transmit such information to their targets has been the subject of intense investigation. Recent advances in high throughput analysis of the mammalian transcriptome have revealed a surprising result indicating that a large number of enhancers are transcribed to noncoding RNAs. Although long noncoding RNAs were initially shown to confer epigenetic transcriptional repression, recent studies have uncovered a role for a class of such transcripts in gene-specific activation, often from distal genomic regions. In this review, we discuss recent findings on the role of long noncoding RNAs in transcriptional regulation, with an emphasis on new developments on the functional links between long noncoding RNAs and enhancers. PMID:21831473

  7. Hormone stimulation of androgen receptor mediates dynamic changes in DNA methylation patterns at regulatory elements

    PubMed Central

    Dhiman, Vineet K.; Attwood, Kristopher; Campbell, Moray J.; Smiraglia, Dominic J.


    DNA methylation is an epigenetic modification that contributes to stable gene silencing by interfering with the ability of transcriptional regulators to bind to DNA. Recent findings have revealed that hormone stimulation of certain nuclear receptors induces rapid, dynamic changes in DNA methylation patterns alongside transcriptional responses at a subset of target loci, over time. However, the ability of androgen receptor (AR) to dynamically regulate gene transcription is relatively under-studied and its role in the regulation of DNA methylation patterns remains to be elucidated. Here we demonstrate in normal prostate cells that hormone stimulated AR activity results in dynamic changes in the transcription rate and DNA methylation patterns at the AR target genes, TIPARP and SGK1. Time-resolved chromatin immunoprecipitation experiments on the SGK1 locus reveals dynamic recruitment of AR and RNA Polymerase II, as well as the recruitment of proteins involved in the DNA demethylation process, TET1 and TDG. Furthermore, the presence of DNA methylation at dynamic regions inhibits protein binding and transcriptional activity of SGK1. These findings establish AR activity as a contributing factor to the dynamic regulation of DNA methylation patterns at target genes in prostate biology and infer further complexity involved in nuclear receptor mediation of transcriptional regulation. PMID:26646795

  8. Differential distribution and association of repeat DNA sequences in the lateral element of the synaptonemal complex in rat spermatocytes.


    Hernández-Hernández, Abrahan; Rincón-Arano, Héctor; Recillas-Targa, Félix; Ortiz, Rosario; Valdes-Quezada, Christian; Echeverría, Olga M; Benavente, Ricardo; Vázquez-Nin, Gerardo H


    The synaptonemal complex (SC) is an evolutionarily conserved structure that mediates synapsis of homologous chromosomes during meiotic prophase I. Previous studies have established that the chromatin of homologous chromosomes is organized in loops that are attached to the lateral elements (LEs) of the SC. The characterization of the genomic sequences associated with LEs of the SC represents an important step toward understanding meiotic chromosome organization and function. To isolate these genomic sequences, we performed chromatin immunoprecipitation assays in rat spermatocytes using an antibody against SYCP3, a major structural component of the LEs of the SC. Our results demonstrated the reproducible and exclusive isolation of repeat deoxyribonucleic acid (DNA) sequences, in particular long interspersed elements, short interspersed elements, long terminal direct repeats, satellite, and simple repeats. The association of these repeat sequences to the LEs of the SC was confirmed by in situ hybridization of meiotic nuclei shown by both light and electron microscopy. Signals were also detected over the chromatin surrounding SCs and in small loops protruding from the lateral elements into the SC central region. We propose that genomic repeat DNA sequences play a key role in anchoring the chromosome to the protein scaffold of the SC.

  9. Generalized Levy-walk model for DNA nucleotide sequences

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Simons, M.; Stanley, H. E.


    We propose a generalized Levy walk to model fractal landscapes observed in noncoding DNA sequences. We find that this model provides a very close approximation to the empirical data and explains a number of statistical properties of genomic DNA sequences such as the distribution of strand-biased regions (those with an excess of one type of nucleotide) as well as local changes in the slope of the correlation exponent alpha. The generalized Levy-walk model simultaneously accounts for the long-range correlations in noncoding DNA sequences and for the apparently paradoxical finding of long subregions of biased random walks (length lj) within these correlated sequences. In the generalized Levy-walk model, the lj are chosen from a power-law distribution P(lj) varies as lj(-mu). The correlation exponent alpha is related to mu through alpha = 2-mu/2 if 2 < mu < 3. The model is consistent with the finding of "repetitive elements" of variable length interspersed within noncoding DNA.

  10. Surface Plasmon Resonance Study of Cooperative Interactions of Estrogen Receptor α and Specificity Protein 1 with Composite DNA Elements.


    Su, Xiaodi; Song, Hong Yan


    Estrogen receptor α (ERα) and Specificity protein 1 (Sp1) are transcription factors (TF) that are involved in regulating progesterone receptor (PR) gene expression through cooperative interactions with DNA. The natural composite DNA +571 ERE/Sp1 site in promoter A of the progesterone receptor contains a half-site of estrogen response elements (½ERE) upstream of two Sp1 binding sites (the proximal Sp1 (Sp1/P) and distal Sp1 (Sp1/D)) with a 4 bp spacer. Here, we have developed a protocol for studying the cooperative interaction of Sp1 and ERα with the composite DNA of +571 ERE/Sp1 site using Biacore T200, a high sensitivity surface plasmon resonance spectroscopy. With this protocol, we have concluded that Sp1 binding enhances the overall ERα binding to the composite DNA. We have also determined the optimal spacer distance between the ½ERE and Sp1/D for the best cooperative protein binding. This study is pivotal in guiding the bioinformatics simulation to yield an exact model of the spacer dependency of the transcription factor/cofactor-DNA interactions, which is important for understanding the nuclear receptor regulating activity through other coactivators.

  11. Impact of CpG methylation on structure, dynamics and solvation of cAMP DNA responsive element

    PubMed Central

    Derreumaux, Sylvie; Chaoui, Mounia; Tevanian, Georges; Fermandjian, Serge


    Methylation of CpG motifs in DNA is involved in the control of gene expression and in several other epigenic effects. It suppresses also the immuno-stimulation properties of bacterial or viral DNAs that contain CpGs. However, effects of methylation on the DNA structure and dynamics are not clear. Here we carried out a 10 ns MD simulation, confronted to an NMR analysis, of a hexadecanucleotide with the cAMP responsive element (CRE) DNA methylated at its center: d(GAGATGAmCGTCATCTC)2 (CREmet). Methylation does not introduce significant structure modification but reduces the dynamics. Molecular mechanics and generalized Born solvation energy calculations showed that the stiffness of CREmet arises from both a restriction of the conformational space by the bulky methyl groups and a folding of DNA around the hydrophobic methyls. The latter effect is favored when the GpA steps belonging to the TGA binding half-sites adopt the BII conformation. The inability of the methylated DNAs to interact with their protein partners—either transcription factors for gene regulation or a Toll-like receptor for immunostimulation—could result from both the obstacle created by methyls, preventing crucial interactions, and the loss of DNA flexibility, reducing its adaptability. Results are discussed in the light of NMR and crystallographic data. PMID:11376150

  12. Reconfiguration of nucleosome-depleted regions at distal regulatory elements accompanies DNA methylation of enhancers and insulators in cancer

    PubMed Central

    Taberlay, Phillippa C.; Statham, Aaron L.; Kelly, Theresa K.


    It is well established that cancer-associated epigenetic repression occurs concomitant with CpG island hypermethylation and loss of nucleosomes at promoters, but the role of nucleosome occupancy and epigenetic reprogramming at distal regulatory elements in cancer is still poorly understood. Here, we evaluate the scope of global epigenetic alterations at enhancers and insulator elements in prostate and breast cancer cells using simultaneous genome-wide mapping of DNA methylation and nucleosome occupancy (NOMe-seq). We find that the genomic location of nucleosome-depleted regions (NDRs) is mostly cell type specific and preferentially found at enhancers in normal cells. In cancer cells, however, we observe a global reconfiguration of NDRs at distal regulatory elements coupled with a substantial reorganization of the cancer methylome. Aberrant acquisition of nucleosomes at enhancer-associated NDRs is associated with hypermethylation and epigenetic silencing marks, and conversely, loss of nucleosomes with demethylation and epigenetic activation. Remarkably, we show that nucleosomes remain strongly organized and phased at many facultative distal regulatory elements, even in the absence of a NDR as an anchor. Finally, we find that key transcription factor (TF) binding sites also show extensive peripheral nucleosome phasing, suggesting the potential for TFs to organize NDRs genome-wide and contribute to deregulation of cancer epigenomes. Together, our findings suggest that “decommissioning” of NDRs and TFs at distal regulatory elements in cancer cells is accompanied by DNA hypermethylation susceptibility of enhancers and insulator elements, which in turn may contribute to an altered genome-wide architecture and epigenetic deregulation in malignancy. PMID:24916973

  13. Architecture and DNA Recognition Elements of the Fanconi Anemia FANCM-FAAP24 Complex

    PubMed Central

    Coulthard, Rachel; Deans, Andrew J.; Swuec, Paolo; Bowles, Maureen; Costa, Alessandro; West, Stephen C.; McDonald, Neil Q.


    Summary Fanconi anemia (FA) is a disorder associated with a failure in DNA repair. FANCM (defective in FA complementation group M) and its partner FAAP24 target other FA proteins to sites of DNA damage. FANCM-FAAP24 is related to XPF/MUS81 endonucleases but lacks endonucleolytic activity. We report a structure of an FANCM C-terminal fragment (FANCMCTD) bound to FAAP24 and DNA. This S-shaped structure reveals the FANCM (HhH)2 domain is buried, whereas the FAAP24 (HhH)2 domain engages DNA. We identify a second DNA contact and a metal center within the FANCM pseudo-nuclease domain and demonstrate that mutations in either region impair double-stranded DNA binding in vitro and FANCM-FAAP24 function in vivo. We show the FANCM translocase domain lies in proximity to FANCMCTD by electron microscopy and that binding fork DNA structures stimulate its ATPase activity. This suggests a tracking model for FANCM-FAAP24 until an encounter with a stalled replication fork triggers ATPase-mediated fork remodeling. PMID:23932590

  14. Heavy-ion radiation induces both activation of multiple endogenous transposable elements and alterations in DNA methylation in rice

    NASA Astrophysics Data System (ADS)

    Zhang, Meng; Sun, Yeqing; Li, Xishan; Xiaolin, Cui; Li, Xiang


    Space radiation represents a complex environmental condition in which several interacting factors such as electron, neutron, proton, heavy-ion are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic aswell as external perturbations, it is conceivable that epigenetic markers like DNA methylation and transposition may undergo alterations in response to space radiation. Cytosine DNA methylation plays important roles in maintaining genome stability and controlling gene expression. A predominant means for Transposable elements (TEs) to cause genetic instability is via their transpositional activation. To find the detailed molecular characterization of the nature of genomic changes induced by space radiation, the seeds of rice were exposed to 0.02, 0.2, 1, 2 and 20 Gy dose of ^{12}C heavy-ion radiation, respectively. We found that extensive alteration in both DNA methylation and gene expression occurred in rice plants after different dose of heavy-ion radiation. Here we shown that heavy-ion radiation has induced transposition of mPing and Tos17 in rice, which belong to distinct classes including the miniature inverted terminal repeat TEs (MITEs) and long-terminal repeat (LTR) retrotransposons, respectively. mPing and Tos17 mobility were found to correlate with cytosine methylation alteration detected by MSAP and genetic variation detected by AFLP. The result showed that at least in some cases transposition of TEs was associated with cytosine demethylation within the elements. Our results implicate that the heavy-ion radiation represents a potent mutagenic agent that can cause genomic instabilities by eliciting transposition of endogenous TEs in rice. Keywords: Heavy-ion radiation, DNA methylation, Transposable elements, mPing, Tos17

  15. DNA methylation of stress-related genes and LINE-1 repetitive elements across the healthy human placenta

    PubMed Central

    Non, Amy L.; Binder, Alexandra M.; Barault, Ludovic; Rancourt, Rebecca C.; Kubzansky, Laura D.; Michels, Karin B.


    Objectives DNA methylation is known to play a critical role in regulating development of placental morphology and physiology. The methylation of genes mediated by glucocorticoid hormones may be particularly vulnerable to intrauterine stress in the placenta. However little is known about DNA methylation of stress-related genes within a healthy placenta, and particularly whether methylation occurs uniformly across different regions of the placenta, which is a critical question for researchers seeking to analyze methylation patterns. We examined DNA methylation across four regions of the placenta to evaluate methylation levels of stress-related genes within a healthy placenta, and to evaluate whether methylation patterns vary by sampling location. Study Design We evaluated levels of DNA methylation of three stress-related genes: NR3C1, BDNF, and 11B-HSD2 and of the repetitive element, LINE-1, in four different sample locations of 20 healthy placentas. Main Outcome Measures Pyrosequencing was used to quantify levels of methylation at CpG sites within the promoter regions of each of the three stress-related genes, and global methylation of LINE-1. Results Very low levels of methylation were found across all three stress-related genes; no gene showed a median methylation level greater than 4.20% across placental regions. Variation in methylation between placental regions for stress-related genes and for LINE-1 was minimal. Conclusions Our data suggest that these frequently studied stress-related genes have low levels of methylation in healthy placenta tissue. Minimal variation between sites suggests that sampling location does not affect DNA methylation analyses of these genes or of LINE-1 repetitive elements. PMID:22222044

  16. DNA methylation of stress-related genes and LINE-1 repetitive elements across the healthy human placenta.


    Non, A L; Binder, A M; Barault, L; Rancourt, R C; Kubzansky, L D; Michels, K B


    DNA methylation is known to play a critical role in regulating development of placental morphology and physiology. The methylation of genes mediated by glucocorticoid hormones may be particularly vulnerable to intrauterine stress in the placenta. However little is known about DNA methylation of stress-related genes within a healthy placenta, and particularly whether methylation occurs uniformly across different regions of the placenta, which is a critical question for researchers seeking to analyze methylation patterns. We examined DNA methylation across four regions of the placenta to evaluate methylation levels of stress-related genes within a healthy placenta, and to evaluate whether methylation patterns vary by sampling location. We evaluated levels of DNA methylation of three stress-related genes: NR3C1, BDNF, and 11B-HSD2 and of the repetitive element, LINE-1, in four different sample locations of 20 healthy placentas. Pyrosequencing was used to quantify levels of methylation at CpG sites within the promoter regions of each of the three stress-related genes, and global methylation of LINE-1. Very low levels of methylation were found across all three stress-related genes; no gene showed a median methylation level greater than 4.20% across placental regions. Variation in methylation between placental regions for stress-related genes and for LINE-1 was minimal. Our data suggest that these frequently studied stress-related genes have low levels of methylation in healthy placenta tissue. Minimal variation between sites suggests that sampling location does not affect DNA methylation analyses of these genes or of LINE-1 repetitive elements. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

    PubMed Central

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.


    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  18. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation.


    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J; Fox, Catherine A


    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  19. [Genomic noncoding sequences and the size of eukaryotic cell nucleus as important factors of gene protection from chemical mutagens].


    Minkevich, I G; Patrushev, L I


    An improved quantitative model describing a protective function of eukaryotic genomic noncoding sequences was developed. In this new model, two factors affecting gene protection from chemical mutagens are considered: (1) the ratio of the total lengths of coding and noncoding genomic sequences and (2) the volume of the cell nucleus. An increase in the noncoding DNA in the genome reduces the number of mutagen-damaged nucleotides in the coding region, whereas an increase in the volume of the nucleus decreases the flow of mutagens per unit of nuclear volume that attacks its surface.

  20. Distribution of ions around thymine dimer containing DNA: A possible recognition element for endonuclease V

    SciTech Connect

    Osman, R.; Luo, N.; Miaskiewicz, K.; Miller, J.


    In spite of the high resolution X-ray crystal structure of endonuclease V and numerous site directed mutagenesis studies, the mechanism by which it recognizes the pyrimidine dimer lesion in DNA is still obscure. NMR studies performed on DNA oligonucleotides containing cis,syn-pyrimidine dimers showed that the distortions caused by the lesion are surprisingly small. Nevertheless, endonuclease V is able to recognize this change with very high fidelity. Since distortions of DNA structure are usually associated with changes in the electrostatic shielding by counterions and in solvation of DNA it is possible that the enzyme is acutely sensitive to this property, as is demonstrated by the dependence of the scanning ability on ionic strength. This paper presents the results of a 200 ps molecular dynamics simulation on the dodecamer d(CGCGAATTCGCG){sub 2} containing a cis,syn-cyclobutane thymine dimer, explicit water and counterions. The averaged structure calculated from the simulation shows good agreement with the available NMR data. The distribution of counterions around the damaged DNA is different from that around a non-damaged DNA and suggests a possible mechanism of damage recognition by the enzyme.

  1. Heritable alteration in DNA methylation pattern occurred specifically at mobile elements in rice plants following hydrostatic pressurization.


    Long, Likun; Lin, Xiuyun; Zhai, Jinzuo; Kou, Hongping; Yang, Wei; Liu, Bao


    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. Exploring the extent to which DNA methylation patterns can be altered under a specific condition is important for elucidating the biological functions of this epigenetic modification. This is of added significance in plants wherein the newly acquired methylation patterns can be inherited through organismal generations. We report here that DNA methylation patterns of mobile elements but not of cellular genes were specifically altered in rice plants following hydrostatic pressurization. This was evidenced by methylation-sensitive gel-blot analysis, which showed that 10 out of 10 studied low-copy transposons and retrotransposons manifested methylation alteration in at least one of the 8 randomly chosen pressure-treated plants, whereas none of the 16 studied low-copy cellular genes showed any change. Both gel-blotting and genome-wide fingerprinting indicated that the methylation alteration in mobile elements was not accompanied by a general genetic instability. Progeny analysis indicated retention of the altered methylation patterns in most progeny plants, underscoring early occurrence of the alterations, and their faithful epigenetic inheritance.

  2. Robust Identification of Noncoding RNA from Transcriptomes Requires Phylogenetically-Informed Sampling

    PubMed Central

    Lai, Alicia Sook-Wei; Eldai, Hisham; Liu, Wenting; McGimpsey, Stephanie; Wheeler, Nicole E.; Biggs, Patrick J.; Thomson, Nick R.; Barquist, Lars; Poole, Anthony M.; Gardner, Paul P.


    Noncoding RNAs are integral to a wide range of biological processes, including translation, gene regulation, host-pathogen interactions and environmental sensing. While genomics is now a mature field, our capacity to identify noncoding RNA elements in bacterial and archaeal genomes is hampered by the difficulty of de novo identification. The emergence of new technologies for characterizing transcriptome outputs, notably RNA-seq, are improving noncoding RNA identification and expression quantification. However, a major challenge is to robustly distinguish functional outputs from transcriptional noise. To establish whether annotation of existing transcriptome data has effectively captured all functional outputs, we analysed over 400 publicly available RNA-seq datasets spanning 37 different Archaea and Bacteria. Using comparative tools, we identify close to a thousand highly-expressed candidate noncoding RNAs. However, our analyses reveal that capacity to identify noncoding RNA outputs is strongly dependent on phylogenetic sampling. Surprisingly, and in stark contrast to protein-coding genes, the phylogenetic window for effective use of comparative methods is perversely narrow: aggregating public datasets only produced one phylogenetic cluster where these tools could be used to robustly separate unannotated noncoding RNAs from a null hypothesis of transcriptional noise. Our results show that for the full potential of transcriptomics data to be realized, a change in experimental design is paramount: effective transcriptomics requires phylogeny-aware sampling. PMID:25357249

  3. Tumour microvesicles contain retrotransposon elements and amplified oncogene sequences

    PubMed Central

    Balaj, Leonora; Lessard, Ryan; Dai, Lixin; Cho, Yoon-Jae; Pomeroy, Scott L.; Breakefield, Xandra O.; Skog, Johan


    Tumour cells release an abundance of microvesicles containing a selected set of proteins and RNAs. Here, we show that tumour microvesicles also carry DNA, which reflects the genetic status of the tumour, including amplification of the oncogene c-Myc. We also find amplified c-Myc in serum microvesicles from tumour-bearing mice. Further, we find remarkably high levels of retrotransposon RNA transcripts, especially for some human endogenous retroviruses, such as LINE-1 and Alu retrotransposon elements, in tumour microvesicles and these transposable elements could be transferred to normal cells. These findings expand the nucleic acid content of tumour microvesicles to include: elevated levels of specific coding and non-coding RNA and DNA, mutated and amplified oncogene sequences and transposable elements. Thus, tumour microvesicles contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer. PMID:21285958

  4. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio


    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  5. The long non-coding RNA Dali is an epigenetic regulator of neural differentiation.


    Chalei, Vladislava; Sansom, Stephen N; Kong, Lesheng; Lee, Sheena; Montiel, Juan F; Vance, Keith W; Ponting, Chris P


    Many intergenic long noncoding RNA (lncRNA) loci regulate the expression of adjacent protein coding genes. Less clear is whether intergenic lncRNAs commonly regulate transcription by modulating chromatin at genomically distant loci. Here, we report both genomically local and distal RNA-dependent roles of Dali, a conserved central nervous system expressed intergenic lncRNA. Dali is transcribed downstream of the Pou3f3 transcription factor gene and its depletion disrupts the differentiation of neuroblastoma cells. Locally, Dali transcript regulates transcription of the Pou3f3 locus. Distally, it preferentially targets active promoters and regulates expression of neural differentiation genes, in part through physical association with the POU3F3 protein. Dali interacts with the DNMT1 DNA methyltransferase in mouse and human and regulates DNA methylation status of CpG island-associated promoters in trans. These results demonstrate, for the first time, that a single intergenic lncRNA controls the activity and methylation of genomically distal regulatory elements to modulate large-scale transcriptional programmes.

  6. Distribution of Unlinked Transpositions of a Ds Element from a T-DNA Locus on Tomato Chromosome 4

    PubMed Central

    Briza, J.; Carroll, B. J.; Klimyuk, V. I.; Thomas, C. M.; Jones, D. A.; Jones, JDG.


    In maize, receptor sites for unlinked transpositions of Activator (Ac) elements are not distributed randomly. To test whether the same is true in tomato, the receptor sites for a Dissociation (Ds) element derived from Ac, were mapped for 26 transpositions unlinked to a donor T-DNA locus on chromosome 4. Four independent transposed Dss mapped to sites on chromosome 4 genetically unlinked to the donor T-DNA, consistent with a preference for transposition to unlinked sites on the same chromosome as opposed to sites on other chromosomes. There was little preference among the nondonor chromosomes, except perhaps for chromosome 2, which carried seven transposed Dss, but these could not be proven to be independent. However, these data, when combined with those from other studies in tomato examining the distribution of transposed Acs or Dss among nondonor chromosomes, suggest there may be absolute preferences for transposition irrespective of the chromosomal location of the donor site. If true, transposition to nondonor chromosomes in tomato would differ from that in maize, where the preference seems to be determined by the spatial arrangement of chromosomes in the interphase nucleus. The tomato lines carrying Ds elements at known locations are available for targeted transposon tagging experiments. PMID:8536985

  7. Distribution of ions around thymine dimer containing DNA: A possible recognition element for endonuclease V

    SciTech Connect

    Osman, R.; Luo, N.; Miaskiewicz, K.; Miller, J.


    The molecular link between sunlight exposure and skin cancer can be traced to the formation of cyclobutane pyrimidine dimers together with (6-4) photoadducts of pyrimidines in DNA upon exposure to UV radiation. The mutagenicity of these lesions is frequently explained by miscoding during DNA replication due to perturbations of base-pairing interactions. However the mutagenicity of UV photoproducts depends of their sequence context, suggesting that more global structural changes in DNA contribute to mutation induction. One of the most effective protections against the deleterious effects of cyclobutane pyrimidine dimers is the wide range of repair of this lesion by different enzymatic pathways. This paper presents the results of a 200 ps molecular dynamics simulation on the dodecarner d(CGCGAATTCGCG){sub 2} containing a cis, syn-cyclobutane thymine dimer, explicit water and counterions. The averaged structure calculated from the simulation shows good agreement with the available NMR data. The distribution of counterions around the damaged DNA is different from that around a non damaged DNA and suggests a possible mechanism of damage recognition by the enzyme.

  8. Global long interspersed nuclear element 1 DNA methylation in a Colombian sample of patients with late-onset Alzheimer's disease.


    Hernández, Hernán G; Mahecha, María F; Mejía, Adriana; Arboleda, Humberto; Forero, Diego A


    Alterations in DNA methylation have implicated as an epigenetic event in the pathogenesis of late-onset Alzheimer's disease (LOAD). The objective of this work was to evaluate global DNA methylation levels for long interspersed nuclear element 1 (LINE-1) repetitive sequences in Colombian patients with LOAD and controls. The LINE-1 DNA methylation levels in peripheral blood samples from 28 Colombian patients with LOAD and 30 healthy participants were assessed using a methylation-sensitive high-resolution melting (MS-HRM) quantitative assay. We did not find differences in LINE-1 methylation levels between patients with Alzheimer's disease (AD; median 76.2%, interquartile range [IQR]: 69.8-81.9) and control participants (median 79.8%, IQR: 73.2-83.8; P = .3). Additional stratified analyses did not show differences in LINE-1 methylation levels for male or female patients versus controls nor for apolipoprotein E4 carriers and noncarriers. This is the first report of LINE-1 methylation levels in patients with LOAD using the cost-effective MS-HRM technique, and this is the first global DNA methylation study in Latin American patients with AD.

  9. Association between birth weight and DNA methylation of IGF2, glucocorticoid receptor and repetitive elements LINE-1 and Alu.


    Burris, Heather H; Braun, Joe M; Byun, Hyang-Min; Tarantini, Letizia; Mercado, Adriana; Wright, Rosalind J; Schnaas, Lourdes; Baccarelli, Andrea A; Wright, Robert O; Tellez-Rojo, Martha M


    We examined the association between birth weight and methylation in the imprinted IGF/H19 loci, the nonimprinted gene NR3C1 and repetitive element DNA (LINE-1 and Alu). We collected umbilical cord venous blood from 219 infants born in Mexico City (Mexico) as part of a prospective birth cohort study and analyzed DNA methylation using pyrosequencing. Birth weight was not associated with DNA methylation of the regions studied. One of the CpG dinucleotides in the IGF2 imprinting control region (ICR)1 includes a potential C-T SNP. Among individuals with an absence of methylation at this site, probably due to a paternally inherited T allele, birth weight was associated with mean methylation status of both IGF2 ICR1 and ICR2. However, this association would not have survived adjustment for multiple testing. While we did not detect an association between DNA methylation and birth weight, our study suggests a potential gene-epigene interaction between a T allele in the IGF2 ICR1 and methylation of ICRs of IGF2, and fetal growth.

  10. Analysis RNA-seq and Noncoding RNA.


    Arrigoni, Alberto; Ranzani, Valeria; Rossetti, Grazisa; Panzeri, Ilaria; Abrignani, Sergio; Bonnal, Raoul J P; Pagani, Massimiliano


    RNA-Seq is an approach to transcriptome profiling that uses deep-sequencing technologies to detect and accurately quantify RNA molecules originating from a genome at a given moment in time. In recent years, the advent of RNA-Seq has facilitated genome-wide expression profiling, including the identification of novel and rare transcripts like noncoding RNAs and novel alternative splicing isoforms.Here, we describe the analytical steps required for the identification and characterization of noncoding RNAs starting from RNA-Seq raw samples, with a particular emphasis on long noncoding RNAs (lncRNAs).

  11. Determining the DNA sequence elements required for binding integration host factor to two different target sites.

    PubMed Central

    Hales, L M; Gumport, R I; Gardner, J F


    Binding sites for the Escherichia coli protein integration host factor (IHF) include a set of conserved bases that can be summarized by the consensus sequence WATCAANNNNTTR (W is dA or dT, R is dA or dG, and N is any nucleotide). However, additional 5'-proximal bases, whose common feature is a high dA+dT content, are also thought to be required for binding at some sites. We examine the relative contribution of these two sequence elements to IHF binding to the H' and H1 sites in attP of bacteriophage lambda by using the bacteriophage P22-based challenge-phage system. IHF was unable to act as a repressor in the challenge-phage assay at H' sites containing the core consensus element but lacking the dA+dT-rich element. This indicates that both elements are required for IHF to bind to the H' site. In contrast, the core consensus determinant alone is sufficient for IHF binding to the H1 site, which lacks an upstream dA+dT-rich region. Fifty mutants that decreased or eliminated IHF binding to the H1 site were isolated. Sequence analysis showed changes in the bases in the core consensus element only, further indicating that this determinant is sufficient for IHF binding to the H1 site. We found that placement of a dA+dT-rich element upstream of the H1 core consensus element significantly increased the affinity, suggesting that the presence of a dA+dT-rich element enhances IHF binding. PMID:8188600

  12. Highly sensitive and reversible silicon nanowire biosensor to study nuclear hormone receptor protein and response element DNA interactions.


    Zhang, Guo-Jun; Huang, Min Joon; Luo, Zhan Hong Henry; Tay, Guang Kai Ignatius; Lim, Eu-Jin Andy; Liu, Edison T; Thomsen, Jane S


    To thoroughly understand the role that estrogen receptors partake in regulation of gene expression, characterization of estrogen receptors (ERs) and estrogen-response elements (EREs) interactions is essential. In the work, we present a highly sensitive and reusable silicon nanowire (SiNW) biosensor to study the interactions between human ER proteins (ER, α and β subtypes) and EREs (dsDNA). The proteins were covalently immobilized on the SiNW surface. Various EREs including wild-type, mutant and scrambled DNA sequences were then applied to the protein-functionalized SiNW surface. Due to negatively charged dsDNA, binding of the EREs to the ERs on the n-type SiNW biosensor leads to the accumulation of negative charges on the surface, thereby inducing increase in resistance. The results show that the specificity of the ERE-ERα binding is higher than that of the ERE-ERβ binding, what is more, the mutant ERE reduces the binding affinity for both ERα and ERβ. By applying various concentrations of wild-type ERE to the bound ERα, a very low concentration of 10 fM wild-type ERE was found to be able to bind to the ERα. The reversible association and dissociation between ERα and wt-ERE was achieved, pointing to a reusable biosensor for protein-DNA binding. Through the study, we have established the SiNW biosensor as a promising method in providing comprehensive study for hormone receptor-response element interactions. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. An amphipathic trans-acting phosphorothioate DNA element delivers uncharged PNA and PMO nucleic acid sequences in mammalian cells.


    Jain, Harsh V; Beaucage, Serge L

    An innovative approach to the delivery of uncharged peptide nucleic acids (PNA) and phosphorodiamidate morpholino (PMO) oligomers in mammalian cells is described and consists of extending the sequence of those oligomers with a short PNA-polyA or PMO-polyA tail. Recognition of the polyA-tailed PNA or PMO oligomers by an amphipathic trans-acting polythymidylic thiophosphate triester element (dTtaPS) results in efficient internalization of those oligomers in several cell lines. Our findings indicate that cellular uptake of the oligomers occurs through an energy-dependent mechanism and macropinocytosis appears to be the predo-minant endocytic pathway used for internalization. The functionality of the internalized oligomers is demonstrated by alternate splicing of the pre-mRNA encoding luciferase in HeLa pLuc 705 cells. Amphipathic phosphorothioate DNA elements may represent a unique class of cellular transporters for robust delivery of uncharged nucleic acid sequences in live mammalian cells.

  14. Molecular Cloning and Analysis of a DNA Repetitive Element from the Mouse Genome

    ERIC Educational Resources Information Center

    Geisinger, Adriana; Cossio, Gabriela; Wettstein, Rodolfo


    We report the development of a 3-week laboratory activity for an undergraduate molecular biology course. This activity introduces students to the practice of basic molecular techniques such as restriction enzyme digestion, agarose gel electrophoresis, cloning, plasmid DNA purification, Southern blotting, and sequencing. Students learn how to carry…

  15. [Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].


    Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing


    Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

  16. Molecular Cloning and Analysis of a DNA Repetitive Element from the Mouse Genome

    ERIC Educational Resources Information Center

    Geisinger, Adriana; Cossio, Gabriela; Wettstein, Rodolfo


    We report the development of a 3-week laboratory activity for an undergraduate molecular biology course. This activity introduces students to the practice of basic molecular techniques such as restriction enzyme digestion, agarose gel electrophoresis, cloning, plasmid DNA purification, Southern blotting, and sequencing. Students learn how to carry…

  17. Cooperativity between DNA Methyltransferases in the Maintenance Methylation of Repetitive Elements

    PubMed Central

    Liang, Gangning; Chan, Matilda F.; Tomigahara, Yoshitaka; Tsai, Yvonne C.; Gonzales, Felicidad A.; Li, En; Laird, Peter W.; Jones, Peter A.


    We used mouse embryonic stem (ES) cells with systematic gene knockouts for DNA methyltransferases to delineate the roles of DNA methyltransferase 1 (Dnmt1) and Dnmt3a and -3b in maintaining methylation patterns in the mouse genome. Dnmt1 alone was able to maintain methylation of most CpG-poor regions analyzed. In contrast, both Dnmt1 and Dnmt3a and/or Dnmt3b were required for methylation of a select class of sequences which included abundant murine LINE-1 promoters. We used a novel hemimethylation assay to show that even in wild-type cells these sequences contain high levels of hemimethylated DNA, suggestive of poor maintenance methylation. We showed that Dnmt3a and/or -3b could restore methylation of these sequences to pretreatment levels following transient exposure of cells to 5-aza-CdR, whereas Dnmt1 by itself could not. We conclude that ongoing de novo methylation by Dnmt3a and/or Dnmt3b compensates for inefficient maintenance methylation by Dnmt1 of these endogenous repetitive sequences. Our results reveal a previously unrecognized degree of cooperativity among mammalian DNA methyltransferases in ES cells. PMID:11756544

  18. Elements that Regulate the DNA Damage Response of Proteins Defective in Cockayne Syndrome

    PubMed Central

    Iyama, Teruaki; Wilson, David M.


    Cockayne syndrome (CS) is a premature aging disorder characterized by developmental defects, multisystem progressive degeneration, and sensitivity to ultraviolet light. CS is divided into two primary complementation groups, A and B, with the CSA and CSB proteins presumably functioning in DNA repair and transcription. Using laser microirradiation and confocal microscopy, we characterized the nature and regulation of the CS protein response to oxidative DNA damage, double-strand breaks (DSBs), angelicin monoadducts, and trioxsalen interstrand crosslinks (ICLs). Our data indicate that CSB recruitment is influenced by the type of DNA damage, and is most rapid and robust as follows: ICLs > DSBs > monoadducts > oxidative lesions. Transcription inhibition reduced accumulation of CSB at sites of monoadducts and ICLs, but did not affect recruitment to (although slightly affected retention at) oxidative damage. Inhibition of histone deacetylation altered the dynamics of CSB assembly, suggesting a role for chromatin status in the response to DNA damage, whereas the proteasome inhibitor MG132 had no effect. The C-terminus of CSB, and in particular its ubiquitin-binding domain, were critical to recruitment, while the N-terminus and a functional ATPase domain played a minor role at best in facilitating protein accumulation. Although the absence of CSA had no effect on CSB recruitment, CSA itself localized at sites of ICLs, DSBs and monoadducts, but not oxidative lesions. Our results reveal molecular components of the CS protein response and point to a major involvement of complex lesions in the pathology of CS. PMID:26616585

  19. Elements That Regulate the DNA Damage Response of Proteins Defective in Cockayne Syndrome.


    Iyama, Teruaki; Wilson, David M


    Cockayne syndrome (CS) is a premature aging disorder characterized by developmental defects, multisystem progressive degeneration and sensitivity to ultraviolet light. CS is divided into two primary complementation groups, A and B, with the CSA and CSB proteins presumably functioning in DNA repair and transcription. Using laser microirradiation and confocal microscopy, we characterized the nature and regulation of the CS protein response to oxidative DNA damage, double-strand breaks (DSBs), angelicin monoadducts and trioxsalen interstrand crosslinks (ICLs). Our data indicate that CSB recruitment is influenced by the type of DNA damage and is most rapid and robust as follows: ICLs>DSBs>monoadducts>oxidative lesions. Transcription inhibition reduced accumulation of CSB at sites of monoadducts and ICLs, but it did not affect recruitment to (although slightly affected retention at) oxidative damage. Inhibition of histone deacetylation altered the dynamics of CSB assembly, suggesting a role for chromatin status in the response to DNA damage, whereas the proteasome inhibitor MG132 had no effect. The C-terminus of CSB and, in particular, its ubiquitin-binding domain were critical to recruitment, while the N-terminus and a functional ATPase domain played a minor role at best in facilitating protein accumulation. Although the absence of CSA had no effect on CSB recruitment, CSA itself localized at sites of ICLs, DSBs and monoadducts but not at oxidative lesions. Our results reveal molecular components of the CS protein response and point to a major involvement of complex lesions in the pathology of CS. Published by Elsevier Ltd.

  20. Strain Identification of Trichophyton rubrum by Specific Amplification of Subrepeat Elements in the Ribosomal DNA Nontranscribed Spacer

    PubMed Central

    Jackson, Colin J.; Barton, Richard C.; Kelly, Steven L.; Evans, E. Glyn V.


    Trichophyton rubrum is the commonest cause of dermatophytosis of skin and nail tissue. Molecular characterization of the T. rubrum ribosomal DNA nontranscribed-spacer region revealed two novel tandemly repetitive subelements (TRSs): TRS-1, containing a 27-bp palindromic sequence, and TRS-2. Specific amplification of TRS-1 produced strain-characteristic banding patterns (PCR types), with 21 TRS-1 PCR types recognized from 101 clinical isolates. Four simple patterns representing 1 to 4 copies of TRS-1 accounted for 75 (75%) of all 101 strains, whereas more complex patterns were observed for 21 (20%) of the 101 isolates. The copy number of TRS-2 was 0 to 3 repeats per cistron, with a majority of isolates having two copies of this element. Eleven isolates were polymorphic for TRS-2, and in combination, 23 separate PCR types were recognized by amplification of both TRS-1 and TRS-2. The PCR patterns from both elements were stable and reproducible. Elements with homology to TRS-1 were present in three phylogenetically related species, Trichophyton violaceum, Trichophyton gourvilii, and Trichophyton soudanense, but these elements were not identified in other dermatophyte taxa. There was no clear correlation of PCR type with specimen (skin or nail tissue), but certain PCR types appeared to show a bias in geographic distribution. This new method of typing T. rubrum will enable important questions about pathogenesis and epidemiology of this fungus to be addressed. PMID:11101591

  1. Survey of chimeric IStron elements in bacterial genomes: multiple molecular symbioses between group I intron ribozymes and DNA transposons

    PubMed Central

    Tourasse, Nicolas J.; Stabell, Fredrik B.; Kolstø, Anne-Brit


    IStrons are chimeric genetic elements composed of a group I intron associated with an insertion sequence (IS). The group I intron is a catalytic RNA providing the IStron with self-splicing ability, which renders IStron insertions harmless to the host genome. The IS element is a DNA transposon conferring mobility, and thus allowing the IStron to spread in genomes. IStrons are therefore a striking example of a molecular symbiosis between unrelated genetic elements endowed with different functions. In this study, we have conducted the first comprehensive survey of IStrons in sequenced genomes that provides insights into the distribution, diversity, origin and evolution of IStrons. We show that IStrons have a restricted phylogenetic distribution limited to two bacterial phyla, the Firmicutes and the Fusobacteria. Nevertheless, diverse IStrons representing two major groups targeting different insertion site motifs were identified. This taken with the finding that while the intron components of all IStrons belong to the same structural class, they are fused to different IS families, indicates that multiple intron–IS symbioses have occurred during evolution. In addition, introns and IS elements related to those that were at the origin of IStrons were also identified. PMID:25324310

  2. LARVA: an integrative framework for large-scale analysis of recurrent variants in noncoding annotations

    PubMed Central

    Lochovsky, Lucas; Zhang, Jing; Fu, Yao; Khurana, Ekta; Gerstein, Mark


    In cancer research, background models for mutation rates have been extensively calibrated in coding regions, leading to the identification of many driver genes, recurrently mutated more than expected. Noncoding regions are also associated with disease; however, background models for them have not been investigated in as much detail. This is partially due to limited noncoding functional annotation. Also, great mutation heterogeneity and potential correlations between neighboring sites give rise to substantial overdispersion in mutation count, resulting in problematic background rate estimation. Here, we address these issues with a new computational framework called LARVA. It integrates variants with a comprehensive set of noncoding functional elements, modeling the mutation counts of the elements with a β-binomial distribution to handle overdispersion. LARVA, moreover, uses regional genomic features such as replication timing to better estimate local mutation rates and mutational hotspots. We demonstrate LARVA's effectiveness on 760 whole-genome tumor sequences, showing that it identifies well-known noncoding drivers, such as mutations in the TERT promoter. Furthermore, LARVA highlights several novel highly mutated regulatory sites that could potentially be noncoding drivers. We make LARVA available as a software tool and release our highly mutated annotations as an online resource ( PMID:26304545

  3. Association of hypomethylation of LINE-1 repetitive element in blood leukocyte DNA with an increased risk of hepatocellular carcinoma

    PubMed Central

    Di, Jian-zhong; Han, Xiao-dong; Gu, Wen-ye; Wang, Yu; Zheng, Qi; Zhang, Pin; Wu, Hui-min; Zhu, Zhong-zheng


    Global DNA hypomethylation has been associated with increased risk for cancers of the colorectum, bladder, breast, head and neck, and testicular germ cells. The aim of this study was to examine whether global hypomethylation in blood leukocyte DNA is associated with the risk of hepatocellular carcinoma (HCC). A total of 315 HCC cases and 356 age-, sex- and HBsAg status-matched controls were included. Global methylation in blood leukocyte DNA was estimated by analyzing long interspersed element-1 (LINE-1) repeats using bisulfite-polymerase chain reaction (PCR) and pyrosequencing. We observed that the median methylation level in HCC cases (percentage of 5-methylcytosine (5mC)=77.7%) was significantly lower than that in controls (79.5% 5mC) (P=0.004, Wilcoxon rank-sum test). The odds ratios (ORs) of HCC for individuals in the third, second, and first (lowest) quartiles of LINE-1 methylation were 1.1 (95% confidence interval (CI) 0.7–1.8), 1.4 (95% CI 0.8–2.2), and 2.6 (95% CI 1.7–4.1) (P for trend <0.001), respectively, compared to individuals in the fourth (highest) quartile. A 1.9-fold (95% CI 1.4–2.6) increased risk of HCC was observed among individuals with LINE-1 methylation below the median compared to individuals with higher (>median) LINE-1 methylation. Our results demonstrate for the first time that individuals with global hypomethylation measured in LINE-1 repeats in blood leukocyte DNA have an increased risk for HCC. Our data provide the evidence that global hypomethylation detected in the easily obtainable DNA source of blood leukocytes may help identify individuals at risk of HCC. PMID:21960343

  4. Mutation in a primate-conserved retrotransposon reveals a noncoding RNA as a mediator of infantile encephalopathy

    PubMed Central

    Cartault, François; Munier, Patrick; Benko, Edgar; Desguerre, Isabelle; Hanein, Sylvain; Boddaert, Nathalie; Bandiera, Simonetta; Vellayoudom, Jeanine; Krejbich-Trotot, Pascale; Bintner, Marc; Hoarau, Jean-Jacques; Girard, Muriel; Génin, Emmanuelle; de Lonlay, Pascale; Fourmaintraux, Alain; Naville, Magali; Rodriguez, Diana; Feingold, Josué; Renouil, Michel; Munnich, Arnold; Westhof, Eric; Fähling, Michael; Lyonnet, Stanislas; Henrion-Caude, Alexandra


    The human genome is densely populated with transposons and transposon-like repetitive elements. Although the impact of these transposons and elements on human genome evolution is recognized, the significance of subtle variations in their sequence remains mostly unexplored. Here we report homozygosity mapping of an infantile neurodegenerative disease locus in a genetic isolate. Complete DNA sequencing of the 400-kb linkage locus revealed a point mutation in a primate-specific retrotransposon that was transcribed as part of a unique noncoding RNA, which was expressed in the brain. In vitro knockdown of this RNA increased neuronal apoptosis, consistent with the inappropriate dosage of this RNA in vivo and with the phenotype. Moreover, structural analysis of the sequence revealed a small RNA-like hairpin that was consistent with the putative gain of a functional site when mutated. We show here that a mutation in a unique transposable element-containing RNA is associated with lethal encephalopathy, and we suggest that RNAs that harbor evolutionarily recent repetitive elements may play important roles in human brain development. PMID:22411793

  5. Non-coding RNAs in cardiac hypertrophy.


    Ottaviani, Lara; da Costa Martins, Paula A


    Heart Failure is one of the largest contributors to disease burden and healthcare outflow in the Western world. Despite significant progress in the treatment of heart failure, disease prognosis remains very poor with the only curative therapy still being heart transplantation. To counteract the current situation, efforts have been made to better understand the underlying molecular pathways in the progression of cardiac disease towards heart failure, and to link the disease to novel therapeutic targets such as non-coding RNAs. The non-coding part of the genome has gained prominence over the last couple of decades by opening a completely new research field and having established different non-coding RNAs species as fundamental regulators of cellular functions. Not surprisingly, their dysregulation is increasingly being linked to pathology, including to cardiac disease. Pre-clinically, non-coding RNAs have been shown to be of great value as therapeutic targets in pathological cardiac remodelling and also as diagnostic/prognostic biomarkers for heart failure. Therefore, it is to expect that non-coding RNA-based therapeutic strategies will reach the bedside in the future and provide new and more efficient treatments for heart failure. Here, we review recent discoveries linking the function and molecular interactions of non-coding RNAs with the pathophysiology of cardiac hypertrophy and heart failure. This article is protected by copyright. All rights reserved.

  6. Promoter elements of the PHR1 gene of Saccharomyces cerevisiae and their roles in the response to DNA damage.

    PubMed Central

    Sancar, G B; Ferris, R; Smith, F W; Vandeberg, B


    The PHR1 gene of Saccharomyces cerevisiae encodes the apoenzyme for the DNA repair enzyme photolyase. PHR1 transcription is induced in response to 254 nm radiation and a variety of chemical damaging agents. We report here the identification of promoter elements required for PHR1 expression. Transcription is regulated primarily through three sequence elements clustered within a 120 bp region immediately upstream of the translational start site. A 20 bp interrupted palindrome comprises UASPHR1 and is responsible for 80-90% of basal and induced expression. UASPHR1 alone can activate transcription of a CYC1 minimal promoter but does not confer damage responsiveness. In the intact PHR1 promoter UAS function is dependent upon an upstream essential sequence (UES). URSPHR1 contains a binding site for the damage-responsive repressor Prp; consistent with this role, deletion or specific mutations of the URS increase basal level expression and decrease the induction ratio. Deletion of URSPHR1 also eliminates the requirement for UESPHR1 for promoter activation, indicating that the UES attenuates Prp-mediated repression. Sequences within UASPHR1 are similar to regulatory sequences found upstream of both damage responsive and nonresponsive genes involved in DNA repair and metabolism. PMID:7501452

  7. DNA sequences of Alu elements indicate a recent replacement of the human autosomal genetic complement

    SciTech Connect

    Knight, A.; Deininger, P.L.; Batzer, M.A.


    DNA sequences of neutral nuclear autosomal loci, compared across diverse human populations, provide a previously untapped perspective into the mode and tempo of the emergence of modern humans and a critical comparison with published clonally inherited mitochondrial DNA and Y chromosome measurements of human diversity. We obtained over 55 kilobases of sequence from three autosomal loci encompassing Alu repeats for representatives of diverse human populations as well as orthologous sequences for other hominoid species at one of these loci. Nucleotide diversity was exceedingly low. Most individuals and populations were identical. Only a single nucleotide difference distinguished presumed ancestral alleles from descendants. These results differ from those expected if alleles from divergent archaic populations were maintained through multiregional continuity. The observed virtual lack of sequence polymorphism is the signature of a recent single origin for modern humans, with general replacement of archaic populations. 47 refs., 2 figs., 1 tab.

  8. Long noncoding RNAs and neuroblastoma

    PubMed Central

    Pandey, Gaurav Kumar; Kanduri, Chandrasekhar


    Neuroblastoma is a disease that affects infants and despite intense multimodal therapy, high-risk patients have low survival rates (<50%). In recent years long noncoding RNAs (lncRNAs) have become the cutting edge of cancer research with inroads made in understanding their roles in multiple cancer types, including prostate and breast cancers. The roles of lncRNAs in neuroblastoma have just begun to be elucidated. This review summarises where we are with regards to lncRNAs in neuroblastoma. The known mechanistic roles of lncRNAs during neuroblastoma pathogenesis are discussed, as well as the relationship between lncRNA expression and the differentiation capacity of neuroblastoma cells. We speculate about the use of some of these lncRNAs, such as those mapping to the 6p22 hotspot, as biomarkers for neuroblastoma prognosis and treatment. This novel way of thinking about both neuroblastoma and lncRNAs brings a new perspective to the prognosis and treatment of high-risk patients. PMID:26087192

  9. Long noncoding RNAs and neuroblastoma.


    Pandey, Gaurav Kumar; Kanduri, Chandrasekhar


    Neuroblastoma is a disease that affects infants and despite intense multimodal therapy, high-risk patients have low survival rates (<50%). In recent years long noncoding RNAs (lncRNAs) have become the cutting edge of cancer research with inroads made in understanding their roles in multiple cancer types, including prostate and breast cancers. The roles of lncRNAs in neuroblastoma have just begun to be elucidated. This review summarises where we are with regards to lncRNAs in neuroblastoma. The known mechanistic roles of lncRNAs during neuroblastoma pathogenesis are discussed, as well as the relationship between lncRNA expression and the differentiation capacity of neuroblastoma cells. We speculate about the use of some of these lncRNAs, such as those mapping to the 6p22 hotspot, as biomarkers for neuroblastoma prognosis and treatment. This novel way of thinking about both neuroblastoma and lncRNAs brings a new perspective to the prognosis and treatment of high-risk patients.

  10. Isolation and Characterization of Linear DNA Elements from the Mitochondria of Gaeumannomyces graminis.


    Honeyman, A L; Currier, T C


    Different Gaeumannomyces graminis strains of diverse geographic origin contain one or two small DNAs ranging in size from 7.2 to 10 kilobases. These DNAs exhibit different degrees of homology with each other. We have characterized these low-molecular-weight DNAs from one strain, Ha-01. These small DNAs, E1 and E2, are mitochondrial in origin and were isolated as linear molecules which exhibited an intrinsic difference in density from the high-molecular-weight DNA.

  11. Regulation of Metastasis and DNA Damage Resistance Pathways by Transposable Elements

    DTIC Science & Technology


    7. Cho NW, Dilley RL, Lampson MA, Greenberg RA: Interchromosomal Homology Searches Drive Directional ALT Telomere Movement and Synapsis. Cell 159(1...108-121, October 2014. Highlighted in Cell 2014, Arnoult N and Karlseder J. ALT Telomeres Borrow from Meiosis to Get Moving. 8. Sawyer SL, Tian L...China Nov, 2013 " Telomere Dynamics and Cancer" New York University School of Medicine, NY, NY Nov, 2013 "Nuclear architecture and DNA repair" NIH

  12. Deep Investigation of Arabidopsis thaliana Junk DNA Reveals a Continuum between Repetitive Elements and Genomic Dark Matter

    PubMed Central

    Maumus, Florian; Quesneville, Hadi


    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant. PMID:24709859

  13. Deep investigation of Arabidopsis thaliana junk DNA reveals a continuum between repetitive elements and genomic dark matter.


    Maumus, Florian; Quesneville, Hadi


    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant.

  14. A Ubiquitous Chromatin Opening Element (UCOE) Confers Resistance to DNA Methylation–mediated Silencing of Lentiviral Vectors

    PubMed Central

    Zhang, Fang; Frost, Amy R; Blundell, Mike P; Bales, Olivia; Antoniou, Michael N; Thrasher, Adrian J


    DNA methylation may restrict the activity of gene transfer vectors due to inadvertent silencing. In P19 embryonic carcinoma cells in vitro, we found that transgene expression regulated by the SFFV LTR and EF1α promoter declined rapidly within 16 days, but for A2UCOE derived from the human HNRPA2B1-CBX3 housekeeping gene locus, remained completely stable. Silencing correlated with extensive epigenetic methylation of CpG sites, whereas the A2UCOE was almost completely resistant. Linking of the A2UCOE upstream of the SFFV LTR protected this element from both DNA methylation and silencing. Analysis of engrafted hematopoietic cells in vivo transduced with the same vectors revealed a similar pattern. The A2UCOE displayed little or no methylation in either primary or secondary graft recipients, and gene expression profiles were highly conserved between the two groups. These studies provide convincing evidence that DNA methylation plays a direct role in regulating self-inactivating (SIN) lentiviral transgene expression, and that the stability of expression from the A2UCOE is, at least in part, due to methylation resistance. The A2UCOE therefore has considerable utility for gene therapy applications where reliable and sustained gene expression is desirable. PMID:20588258

  15. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    NASA Astrophysics Data System (ADS)

    Štísová, Viktorie; Goffinont, Stephane; Spotheim-Maurizot, Melanie; Davídková, Marie


    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERα, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with γ rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  16. LINE1 and Alu repetitive element DNA methylation in tumors and white blood cells from epithelial ovarian cancer patients

    PubMed Central

    Akers, Stacey N.; Moysich, Kirsten; Zhang, Wa; Lai, Golda Collamat; Miller, Austin; Lele, Shashikant; Odunsi, Kunle; Karpf, Adam R.


    Objective We determined whether DNA methylation of repetitive elements (RE) is altered in epithelial ovarian cancer (EOC) patient tumors and white blood cells (WBC), compared to normal tissue controls. Methods Two different quantitative measures of RE methylation (LINE1 and Alu bisulfite pyrosequencing) were used in normal and tumor tissues from EOC cases and controls. Tissues analyzed included: i) EOC, ii) normal ovarian surface epithelia (OSE), iii) normal fallopian tube surface epithelia (FTE), iv) WBC from EOC patients, obtained before and after treatment, and v) WBC from demographically-matched controls. Results REs were significantly hypomethylated in EOC compared to OSE and FTE, and LINE1 and Alu methylation showed a significant direct association in these tissues. In contrast, WBC RE methylation was significantly higher in EOC cases compared to controls. RE methylation in patient-matched EOC tumors and pre-treatment WBC did not correlate. Conclusions EOC shows robust RE hypomethylation compared to normal tissues from which the disease arises. In contrast, RE are generally hypermethylated in EOC patient WBC compared to controls. EOC tumor and WBC methylation did not correlate in matched patients, suggesting that RE methylation is independently controlled in tumor and normal tissues. Despite the significant differences observed over the population, the range of RE methylation in patient and control WBC overlapped, limiting their specific utility as an EOC biomarker. However, our data demonstrate that DNA methylation is deranged in normal tissues from EOC patients, supporting further investigation of WBC DNA methylation biomarkers suitable for EOC risk assessment. PMID:24374023

  17. The mouse albumin enhancer contains a negative regulatory element that interacts with a novel DNA-binding protein.

    PubMed Central

    Herbst, R S; Boczko, E M; Darnell, J E; Babiss, L E


    The far-upstream mouse albumin enhancer (-10.5 to -8.43 kilobases) has both positive and negative regulatory domains which contribute to the rate and tissue specificity of albumin gene transcription. (R. S. Herbst, N. Friedman, J. E. Darnell, Jr., and L. E. Babiss, Proc. Natl. Acad. Sci. USA 86:1553-1557). In this work, the negative regulatory region has been functionally localized to sequences -8.7 to -8.43 kilobases upstream of the albumin gene cap site. In the absence of the albumin-modulating region (in which there are binding sites for the transcription factor C/EBP), the negative region can suppress a neighboring positive-acting element, thereby interfering with albumin enhancer function. The negative region is also capable of negating the positive action of the heterologous transthyretin enhancer in an orientation-independent fashion. Within this negative-acting region we can detect two DNA-binding sites, both of which are recognized by a protein present in all cell types tested. This DNA-binding activity is not competed for by any of a series of known DNA-binding sites, and hence this new protein is a candidate for a role in suppressing the albumin gene in nonhepatic cells. Images PMID:2370857

  18. Long noncoding RNAs, chromatin, and development.


    Caley, Daniel P; Pink, Ryan C; Trujillano, Daniel; Carter, David R F


    The way in which the genome of a multicellular organism can orchestrate the differentiation of trillions of cells and many organs, all from a single fertilized egg, is the subject of intense study. Different cell types can be defined by the networks of genes they express. This differential expression is regulated at the epigenetic level by chromatin modifications, such as DNA and histone methylation, which interact with structural and enzymatic proteins, resulting in the activation or silencing of any given gene. While detailed mechanisms are emerging on the role of different chromatin modifications and how these functions are effected at the molecular level, it is still unclear how their deposition across the epigenomic landscape is regulated in different cells. A raft of recent evidence is accumulating that implicates long noncoding RNAs (lncRNAs) in these processes. Most genomes studied to date undergo widespread transcription, the majority of which is not translated into proteins. In this review, we will describe recent work suggesting that lncRNAs are more than transcriptional "noise", but instead play a functional role by acting as tethers and guides to bind proteins responsible for modifying chromatin and mediating their deposition at specific genomic locations. We suggest that lncRNAs are at the heart of developmental regulation, determining the epigenetic status and transcriptional network in any given cell type, and that they provide a means to integrate external differentiation cues with dynamic nuclear responses through the regulation of a metastable epigenome. Better characterization of the lncRNA-protein "interactome" may eventually lead to a new molecular toolkit, allowing researchers and clinicians to modulate the genome at the epigenetic level to treat conditions such as cancer.

  19. Cell cycle regulation by long non-coding RNAs.


    Kitagawa, Masatoshi; Kitagawa, Kyoko; Kotake, Yojiro; Niida, Hiroyuki; Ohhata, Tatsuya


    The mammalian cell cycle is precisely controlled by cyclin-dependent kinases (CDKs) and related pathways such as the RB and p53 pathways. Recent research on long non-coding RNAs (lncRNAs) indicates that many lncRNAs are involved in the regulation of critical cell cycle regulators such as the cyclins, CDKs, CDK inhibitors, pRB, and p53. These lncRNAs act as epigenetic regulators, transcription factor regulators, post-transcription regulators, and protein scaffolds. These cell cycle-regulated lncRNAs mainly control cellular levels of cell cycle regulators via various mechanisms, and may provide diversity and reliability to the general cell cycle. Interestingly, several lncRNAs are induced by DNA damage and participate in cell cycle arrest or induction of apoptosis as DNA damage responses. Therefore, deregulations of these cell cycle regulatory lncRNAs may be involved in tumorigenesis, and they are novel candidate molecular targets for cancer therapy and diagnosis.

  20. From adjacent activation in Escherichia coli and DNA cyclization to eukaryotic enhancers: the elements of a puzzle.


    Amouyal, Michèle


    Deoxyribonucleic acid cyclization, Escherichia coli lac repressor binding to two spaced lac operators and repression enhancement can be successfully used for a better understanding of the conditions required for interaction between eukaryotic enhancers and the machinery of transcription initiation. Chronologically, the DNA looping model has first accounted for the properties initially defining enhancers, i.e., independence of action with distance or orientation with respect to the start of transcription. It has also predicted enhancer activity or its disruption at short distance (site orientation, alignment between promoter and enhancer sites), with high-order complexes of protein, or with transcription factor concentrations close or different from the wild-type situation. In another step, histones have been introduced into the model to further adapt it to eukaryotes. They in fact favor DNA cyclization in vitro. The resulting DNA compaction might explain the difference counted in base pairs in the distance of action between eukaryotic transcription enhancers and prokaryotic repression enhancers. The lac looping system provides a potential tool for analysis of this discrepancy and of chromatin state directly in situ. Furthermore, as predicted by the model, the contribution of operators O2 and O3 to repression of the lac operon clearly depends on the lac repressor level in the cell and is prevented in strains overproducing lac repressor. By extension, gene regulation especially that linked to cell fate, should also depend on transcription factor levels, providing a potential tool for cellular therapy. In parallel, a new function of the O1-O3 loop completes the picture of lac repression. The O1-O3 loop would at the same time ensure high efficiency of repression, inducibility through the low-affinity sites and limitation of the level of repressor through self-repression of the lac repressor. Last, the DNA looping model can be successfully adapted to the enhancer

  1. From adjacent activation in Escherichia coli and DNA cyclization to eukaryotic enhancers: the elements of a puzzle

    PubMed Central

    Amouyal, Michèle


    Deoxyribonucleic acid cyclization, Escherichia coli lac repressor binding to two spaced lac operators and repression enhancement can be successfully used for a better understanding of the conditions required for interaction between eukaryotic enhancers and the machinery of transcription initiation. Chronologically, the DNA looping model has first accounted for the properties initially defining enhancers, i.e., independence of action with distance or orientation with respect to the start of transcription. It has also predicted enhancer activity or its disruption at short distance (site orientation, alignment between promoter and enhancer sites), with high-order complexes of protein, or with transcription factor concentrations close or different from the wild-type situation. In another step, histones have been introduced into the model to further adapt it to eukaryotes. They in fact favor DNA cyclization in vitro. The resulting DNA compaction might explain the difference counted in base pairs in the distance of action between eukaryotic transcription enhancers and prokaryotic repression enhancers. The lac looping system provides a potential tool for analysis of this discrepancy and of chromatin state directly in situ. Furthermore, as predicted by the model, the contribution of operators O2 and O3 to repression of the lac operon clearly depends on the lac repressor level in the cell and is prevented in strains overproducing lac repressor. By extension, gene regulation especially that linked to cell fate, should also depend on transcription factor levels, providing a potential tool for cellular therapy. In parallel, a new function of the O1–O3 loop completes the picture of lac repression. The O1–O3 loop would at the same time ensure high efficiency of repression, inducibility through the low-affinity sites and limitation of the level of repressor through self-repression of the lac repressor. Last, the DNA looping model can be successfully adapted to the enhancer

  2. Rotifer rDNA-specific R9 retrotransposable elements generate an exceptionally long target site duplication upon insertion.


    Gladyshev, Eugene A; Arkhipova, Irina R


    Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.

  3. The Hinge Region as a Key Regulatory Element of Androgen Receptor Dimerization, DNA Binding, and Transactivation

    DTIC Science & Technology


    led to a structure depicted in figure 1A. Two zinc coordinating modules that constitute the receptors DNA-binding domain, are involved in the...expression plasmid (reviewed in Claessens et al. 2001). This led first to the description of the PB-ARE-2 (Claessens et al. 1996), later of scARE and...constructs for specific mutants: has been done and is ongoing. This has led to most of the observations reported in section II of this report. iii.c

  4. Small polydispersed circular DNA contains strains of mobile genetic elements and occurs more frequently in permanent cell lines of malignant tumors than in normal lymphocytes.


    Schmidt, Hannelore; Taubert, Helge; Lange, Heidemarie; Kriese, Karen; Schmitt, Wolfgang Daniel; Hoffmann, Steve; Bartel, Frank; Hauptmann, Steffen


    Small polydispersed circular DNA (spcDNA) belongs to the extrachromosomal pool of DNA and is composed of heterogeneous DNA circles. Whether spcDNA has a special function is currently unclear but their occurrence was suggested to be linked to genetic instability. In this study we investigated as to whether human lymphocytes from healthy volunteers also harbour spcDNA and whether spcDNA is present in all permanent cell lines from human normal and malignant tissues. Moreover, we were interested to see whether spcDNA contains sequences of mobile genetic elements. Our results show that spcDNA is present in all samples investigated yet the amount is lower in normal lymphocytes when compared to cancer cell lines (5.4 vs. 17.8%). Alu sequences were present in 12/16 cancer cell lines whereas LINE-1 (L1) sequences were present in 15 of them. Six tumor cell lines also contained telomeric sequences. In contrast to that, spcDNA of normal lymphocytes contains Alu and L1 sequences only in 3/16 cases and no telomeric sequences at all. Our findings suggest a direct dependency of the amount of Alu and L1 sequences on that of spcDNA. Beside these repetitive sequences, sequencing of spcDNA revealed in most cases chromosomal sequences of almost all chromosomes without an increased frequency of single regions. We suggest that the whole spcDNA including retrotranspositional elements and telomeric sequences may play a role for chromosomal rearrangements and genomic instability.

  5. Linear amplification mediated PCR--localization of genetic elements and characterization of unknown flanking DNA.


    Gabriel, Richard; Kutschera, Ina; Bartholomae, Cynthia C; von Kalle, Christof; Schmidt, Manfred


    Linear-amplification mediated PCR (LAM-PCR) has been developed to study hematopoiesis in gene corrected cells of patients treated by gene therapy with integrating vector systems. Due to the stable integration of retroviral vectors, integration sites can be used to study the clonal fate of individual cells and their progeny. LAM- PCR for the first time provided evidence that leukemia in gene therapy treated patients originated from provirus induced overexpression of a neighboring proto-oncogene. The high sensitivity and specificity of LAM-PCR compared to existing methods like inverse PCR and ligation mediated (LM)-PCR is achieved by an initial preamplification step (linear PCR of 100 cycles) using biotinylated vector specific primers which allow subsequent reaction steps to be carried out on solid phase (magnetic beads). LAM-PCR is currently the most sensitive method available to identify unknown DNA which is located in the proximity of known DNA. Recently, a variant of LAM-PCR has been developed that circumvents restriction digest thus abrogating retrieval bias of integration sites and enables a comprehensive analysis of provirus locations in host genomes. The following protocol explains step-by-step the amplification of both 3'- and 5'- sequences adjacent to the integrated lentiviral vector.

  6. Key Structural Elements of Unsymmetrical Cyanine Dyes for Highly Sensitive Fluorescence Turn-On DNA Probes.


    Uno, Kakishi; Sasaki, Taeko; Sugimoto, Nagisa; Ito, Hideto; Nishihara, Taishi; Hagihara, Shinya; Higashiyama, Tetsuya; Sasaki, Narie; Sato, Yoshikatsu; Itami, Kenichiro


    Unsymmetrical cyanine dyes, such as thiazole orange, are useful for the detection of nucleic acids with fluorescence because they dramatically enhance the fluorescence upon binding to nucleic acids. Herein, we synthesized a series of unsymmetrical cyanine dyes and evaluated their fluorescence properties. A systematic structure-property relationship study has revealed that the dialkylamino group at the 2-position of quinoline in a series of unsymmetrical cyanine dyes plays a critical role in the fluorescence enhancement. Four newly designed unsymmetrical cyanine dyes showed negligible intrinsic fluorescence in the free state and strong fluorescence upon binding to double-stranded DNA (dsDNA) with a quantum yield of 0.53 to 0.90, which is 2 to 3 times higher than previous unsymmetrical cyanine dyes. A detailed analysis of the fluorescence lifetime revealed that the dialkylamino group at the 2-position of quinoline suppressed nonradiative decay in favor of increased fluorescence quantum yield. Moreover, these newly developed dyes were able to stain the nucleus specifically in fixed HeLa cells examined by using a confocal laser-scanning microscope.

  7. A role for non-coding variation in schizophrenia

    PubMed Central

    Roussos, Panos; Mitchell, Amanda C.; Voloudakis, Georgios; Fullard, John F.; Pothula, Venu M.; Tsang, Jonathan; Stahl, Eli A.; Georgakopoulos, Anastasios; Ruderfer, Douglas M.; Charney, Alexander; Okada, Yukinori; Siminovitch, Katherine A.; Worthington, Jane; Padyukov, Leonid; Klareskog, Lars; Gregersen, Peter K.; Plenge, Robert M.; Raychaudhuri, Soumya; Fromer, Menachem; Purcell, Shaun M.; Brennand, Kristen J.; Robakis, Nikolaos K.; Schadt, Eric E.; Akbarian, Schahram; Sklar, Pamela


    SUMMARY A large portion of common variant loci associated with genetic risk for schizophrenia reside within non-coding sequence of unknown function. Here, we demonstrate promoter and enhancer enrichment in schizophrenia variants associated with expression quantitative trait loci (eQTL). The enrichment is greater when functional annotations derived from human brain are used relative to peripheral tissues. Regulatory trait concordance analysis ranked genes within schizophrenia genome-wide significant loci for a potential functional role, based on co-localization of a risk SNP, eQTL and regulatory element sequence. We identified potential physical interactions of non-contiguous proximal and distal regulatory elements. This was verified in prefrontal cortex and induced pluripotent stem cell-derived neurons for the L-type calcium channel (CACNA1C) risk locus. Our findings point to a functional link between schizophrenia-associated non-coding SNPs and 3-dimensional genome architecture associated with chromosomal loopings and transcriptional regulation in the brain. PMID:25453756

  8. Repetitive elements and enforced transcriptional repression co-operate to enhance DNA methylation spreading into a promoter CpG-island

    PubMed Central

    Zhang, Yan; Shu, Jingmin; Si, Jiali; Shen, Lanlan; Estecio, Marcos R.H.; Issa, Jean-Pierre J.


    Repression of many tumor suppressor genes in cancer is concurrent with aberrantly increased DNA methylation levels at promoter CpG islands (CGIs). About one-fourth of empirically defined human promoters are surrounded by or contain clustered repetitive elements. It was previously observed that a sharp transition of methylation exists between highly methylated repetitive elements and unmethylated promoter-CGIs in normal tissues. The factors that lead to aberrant CGI hypermethylation in cancer remain poorly understood. Here, we established a site-specific integration system with enforced local transcriptional repression in colorectal cancer cells and monitored the occurrence of initial de novo methylation at specific CG sites adjacent to the CGI of the INSL6 promoter, which could be accelerated by binding a KRAB-containing transcriptional factor. Additional repetitive elements from P16 and RIL (PDLIM4), if situated adjacent to the promoter of INSL6, could confer DNA methylation spreading into the CGI particularly in the setting of KRAB-factor binding. However, a repressive chromatin alone was not sufficient to initiate DNA methylation, which required specific DNA sequences and was integration-site (and/or cell-line) specific. Overall, these results demonstrate a requirement for specific DNA sequences to trigger de novo DNA methylation, and repetitive elements as cis-regulatory factors to cooperate with advanced transcriptional repression in promoting methylation spreading. PMID:22600741

  9. [DNA sequences from mobile genetic elements, a hidden half of the human genome].


    Medina, Julie; Perron, Hervé


    Current data estimate that mobile genetic elements represent more than one-half of the human genome. The literature is constantly updating data following the evolution of sequencing techniques and of algorithms for genome analyses. This review aims to provide an overview of the topic showing the complexity given by the various designations and classifications found in scientific papers. A particular focus is made on retrotransposons, including Endogenous RetroViruses (ERV), to introduce a second article focusing on their activation and their involvement in physiological functions and/or pathological mechanisms associated with diseases like multiple sclerosis (MS) or amyotrophic lateral sclerosis (ALS). © 2017 médecine/sciences – Inserm.

  10. Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

    SciTech Connect

    Li, Yue; Xie, Changchun; Murphy, Susan K.; Skaar, David; Nye, Monica; Vidal, Adriana C.; Cecil, Kim M.; Dietrich, Kim N.; Puga, Alvaro; Jirtle, Randy L.; Hoyo, Cathrine


    Here, lead exposure during early development causes neurodevelopmental disorders by unknown mechanisms. Epidemiologic studies have focused recently on determining associations between lead exposure and global DNA methylation; however, such approaches preclude the identification of loci that may alter human disease risk. The objective of this study was to determine whether maternal, postnatal, and early childhood lead exposure can alter the differentially methylated regions (DMRs) that control the monoallelic expression of imprinted genes involved in metabolism, growth, and development. Questionnaire data and serial blood lead levels were obtained from 105 participants (64 females, 41 males) of the Cincinnati Lead Study from birth to 78 months. When participants were adults, we used Sequenom EpiTYPER assays to test peripheral blood DNA to quantify CpG methylation in peripheral blood leukocytes at DMRs of 22 human imprinted genes. Statistical analyses were conducted using linear regression. Mean blood lead concentration from birth to 78 months was associated with a significant decrease in PEG3 DMR methylation (β = –0.0014; 95% CI: –0.0023, –0.0005, p = 0.002), stronger in males (β = –0.0024; 95% CI: –0.0038, –0.0009, p = 0.003) than in females (β = –0.0009; 95% CI: –0.0020, 0.0003, p = 0.1). Elevated mean childhood blood lead concentration was also associated with a significant decrease in IGF2/H19 (β = –0.0013; 95% CI: –0.0023, –0.0003, p = 0.01) DMR methylation, but primarily in females, (β = –0.0017; 95% CI: –0.0029, –0.0006, p = 0.005) rather than in males, (β = –0.0004; 95% CI: –0.0023, 0.0015, p = 0.7). Elevated blood lead concentration during the neonatal period was associated with higher PLAGL1/HYMAI DMR methylation regardless of sex (β = 0.0075; 95% CI: 0.0018, 0.0132, p = 0.01). The magnitude of associations between cumulative lead exposure and CpG methylation remained unaltered from 30 to 78 months. Our findings

  11. Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood


    Li, Yue; Xie, Changchun; Murphy, Susan K.; ...


    Here, lead exposure during early development causes neurodevelopmental disorders by unknown mechanisms. Epidemiologic studies have focused recently on determining associations between lead exposure and global DNA methylation; however, such approaches preclude the identification of loci that may alter human disease risk. The objective of this study was to determine whether maternal, postnatal, and early childhood lead exposure can alter the differentially methylated regions (DMRs) that control the monoallelic expression of imprinted genes involved in metabolism, growth, and development. Questionnaire data and serial blood lead levels were obtained from 105 participants (64 females, 41 males) of the Cincinnati Lead Study frommore » birth to 78 months. When participants were adults, we used Sequenom EpiTYPER assays to test peripheral blood DNA to quantify CpG methylation in peripheral blood leukocytes at DMRs of 22 human imprinted genes. Statistical analyses were conducted using linear regression. Mean blood lead concentration from birth to 78 months was associated with a significant decrease in PEG3 DMR methylation (β = –0.0014; 95% CI: –0.0023, –0.0005, p = 0.002), stronger in males (β = –0.0024; 95% CI: –0.0038, –0.0009, p = 0.003) than in females (β = –0.0009; 95% CI: –0.0020, 0.0003, p = 0.1). Elevated mean childhood blood lead concentration was also associated with a significant decrease in IGF2/H19 (β = –0.0013; 95% CI: –0.0023, –0.0003, p = 0.01) DMR methylation, but primarily in females, (β = –0.0017; 95% CI: –0.0029, –0.0006, p = 0.005) rather than in males, (β = –0.0004; 95% CI: –0.0023, 0.0015, p = 0.7). Elevated blood lead concentration during the neonatal period was associated with higher PLAGL1/HYMAI DMR methylation regardless of sex (β = 0.0075; 95% CI: 0.0018, 0.0132, p = 0.01). The magnitude of associations between cumulative lead exposure and CpG methylation remained unaltered from 30 to 78 months. Our

  12. Trace element contamination differentiates the natural population of Scots pine: evidence from DNA microsatellites and needle morphology.


    Chudzińska, Ewa; Celiński, Konrad; Pawlaczyk, Ewa M; Wojnicka-Półtorak, Aleksandra; Diatta, Jean B


    The Scots pine is often used in the biomonitoring of forests. Studies on the chemical composition plus variability of its needles morphological structure allow for an assessment of the state of environmental pollution. However, in their natural populations, the response of individual trees to stress differs. This study reports on the influence of long-term soil contamination with trace elements on the morphology of the needles, its possible relation to the differentiation of the genetic pool, and their implications for biomonitoring. In the natural and self-renewable pine stand growing near the point polluter (zinc smelter, Upper Silesia, Poland), two categories of trees are observed with respect to their health status: pollution-tolerant (T) and pollution-sensitive (S). A detailed analysis of the trace element content of the needles reveals that the concentration of Cd, Zn, Pb, and Cu in the needles is significantly higher in S as compared to T individuals. The metal accumulation pattern decidedly follows the sequence Pb > Cd > Cu > Zn. An analysis of the fluctuating asymmetry (FA) of the needles reveals that sensitive trees showed an FA index ten times higher in comparison to tolerant ones. Moreover, the high differences between these S and T tree groups are also observed in the basic genetic diversity parameters investigated by an analysis of DNA simple sequence repeats (SSR). The concentration of trace elements in pine needles, distinct in sensitive and tolerant trees and in connection with their morphological and genetic characteristics, may reflect an adaptation process. The level of Mg and Fe content in the needles could be a physiological-toxicological index for evaluating trace element "lethality" expressed as Mg and Fe mineral-survival strategies. The example of differences described in this Scots pine population should be taken into consideration in ecotoxicological research to better interpret the obtained results.

  13. A dispersed family of repetitive DNA sequences exhibits characteristics of a transposable element in the genus Lycopersicon.


    Young, R J; Francis, D M; St Clair, D A; Taylor, B H


    A segment of DNA 5' to the transcribed region of an auxin-regulated gene, ARPI, from Lycopersicon esculentum Mill. cv. VFN8 contains a sequence with the structural characteristics of a transposable element. The putative element (Lyt1) is 1340 bp long, has terminal inverted repeats of approximately 235 bp and is flanked by 9-bp direct repeats. Lyt1 has a structure similar to the Robertson's Mutator (Mu) family from maize. The terminal inverted repeats are 80% AT-rich, are 96.6% identical, and define a larger family of repetitive elements. Southern analysis and genomic dot-blot reconstructions detected at least 41 copies of Lyt1-hybridizing sequences in red-fruited Lycopersicon spp. (L. esculentum, L. pimpinellifolium and L. cheesmanii), and 2-8 copies in the green-fruited species (L. hirsutum, L. pennellii, L. peruvianum, L. chilense and L. chmielewskii). There were two to four copies in the Solanum spp. closely allied with the genus Lycopersicon (S. lycopersicoides, S. ochranthum and S. juglandifolium), while the more distantly related Solanum spp. showed little (one to two copies in S. tuberosum) to no (S. quitoense) detectable hybridization under stringent conditions. Linkage analysis in the F2 progeny of a cross between L. esculentum and L. cheesmanii indicated that at least six loci that hybridize to the Lyt1 sequence are dispersed in the genome. Polymerase chain reaction and Southern analyses revealed that some red-fruited accessions and L. chmielewskii lacked Lyt1 5' to the transcribed region of ARPI. Subsequent sequence analysis indicated that only one copy of the 9-bp direct repeat (target site) was present, suggesting that transposition of the element into the ARPI gene occurred after the divergence of the red-fruited and green-fruited Lycopersicon species.

  14. Mining the coding and non-coding genome for cancer drivers.


    Li, Jia; Drubay, Damien; Michiels, Stefan; Gautheret, Daniel


    Progress in next-generation sequencing provides unprecedented opportunities to fully characterize the spectrum of somatic mutations of cancer genomes. Given the large number of somatic mutations identified by such technologies, the prioritization of cancer-driving events is a consistent bottleneck. Most bioinformatics tools concentrate on driver mutations in the coding fraction of the genome, those causing changes in protein products. As more non-coding pathogenic variants are identified and characterized, the development of computational approaches to effectively prioritize cancer-driving variants within the non-coding fraction of human genome is becoming critical. After a short summary of methods for coding variant prioritization, we here review the highly diverse non-coding elements that may act as cancer drivers and describe recent methods that attempt to evaluate the deleteriousness of sequence variation in these elements. With such tools, the prioritization and identification of cancer-implicated regulatory elements and non-coding RNAs is becoming a reality. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Identification of critical elements within the JC virus DNA replication origin.

    PubMed Central

    Lynch, K J; Frisque, R J


    The T antigen of JC virus (JCV) does not interact productively with the simian virus 40 (SV40) origin of replication. In contrast, the SV40 T antigen does drive replication from the JCV origin as well as from its own. The basis for this restricted interaction was investigated by analyzing the structure of the JCV replication origin. The replication activities of JCV-SV40 hybrid origin plasmids were tested in cells constitutively producing either the JCV or SV40 T antigen. Results indicated that a region of the JCV origin critical for interaction with the JCV T antigen was positioned to the late side of the central palindrome of the putative core origin. A mutational analysis of this region indicated that the sequence of the A + T-rich tract was primarily responsible for determining the efficiency with which JCV can initiate replication from its origin. The tandemly repeated pentameric sequence AGGGA located proximal to the A + T-rich tract in the JCV enhancer element was found to stimulate JCV, but not SV40, T antigen-mediated replication. The effect on replication of other elements within the JCV enhancer was also dependent on the T antigen employed for initiation. A plasmid containing the replication origin of prototype BK virus was unable to replicate in cells containing JCV T antigen, again indicating the inflexibility of the JCV T antigen in interacting with heterologous origins. Images PMID:2173768

  16. Exploration of Noncoding Sequences in Metagenomes

    PubMed Central

    Tobar-Tosse, Fabián; Rodríguez, Adrián C.; Vélez, Patricia E.; Zambrano, María M.; Moreno, Pedro A.


    Environment-dependent genomic features have been defined for different metagenomes, whose genes and their associated processes are related to specific environments. Identification of ORFs and their functional categories are the most common methods for association between functional and environmental features. However, this analysis based on finding ORFs misses noncoding sequences and, therefore, some metagenome regulatory or structural information could be discarded. In this work we analyzed 23 whole metagenomes, including coding and noncoding sequences using the following sequence patterns: (G+C) content, Codon Usage (Cd), Trinucleotide Usage (Tn), and functional assignments for ORF prediction. Herein, we present evidence of a high proportion of noncoding sequences discarded in common similarity-based methods in metagenomics, and the kind of relevant information present in those. We found a high density of trinucleotide repeat sequences (TRS) in noncoding sequences, with a regulatory and adaptive function for metagenome communities. We present associations between trinucleotide values and gene function, where metagenome clustering correlate with microorganism adaptations and kinds of metagenomes. We propose here that noncoding sequences have relevant information to describe metagenomes that could be considered in a whole metagenome analysis in order to improve their organization, classification protocols, and their relation with the environment. PMID:23536879

  17. The expanding universe of noncoding RNAs.


    Hannon, G J; Rivas, F V; Murchison, E P; Steitz, J A


    The 71st Cold Spring Harbor Symposium on Quantitative Biology celebrated the numerous and expanding roles of regulatory RNAs in systems ranging from bacteria to mammals. It was clearly evident that noncoding RNAs are undergoing a renaissance, with reports of their involvement in nearly every cellular process. Previously known classes of longer noncoding RNAs were shown to function by every possible means-acting catalytically, sensing physiological states through adoption of complex secondary and tertiary structures, or using their primary sequences for recognition of target sites. The many recently discovered classes of small noncoding RNAs, generally less than 35 nucleotides in length, most often exert their effects by guiding regulatory complexes to targets via base-pairing. With the ability to analyze the RNA products of the genome in ever greater depth, it has become clear that the universe of noncoding RNAs may extend far beyond the boundaries we had previously imagined. Thus, as much as the Symposium highlighted exciting progress in the field, it also revealed how much farther we must go to understand fully the biological impact of noncoding RNAs.

  18. Systematic tissue-specific functional annotation of the human genome highlights immune-related DNA elements for late-onset Alzheimer's disease.


    Lu, Qiongshi; Powles, Ryan L; Abdallah, Sarah; Ou, Derek; Wang, Qian; Hu, Yiming; Lu, Yisi; Liu, Wei; Li, Boyang; Mukherjee, Shubhabrata; Crane, Paul K; Zhao, Hongyu


    Continuing efforts from large international consortia have made genome-wide epigenomic and transcriptomic annotation data publicly available for a variety of cell and tissue types. However, synthesis of these datasets into effective summary metrics to characterize the functional non-coding genome remains a challenge. Here, we present GenoSkyline-Plus, an extension of our previous work through integration of an expanded set of epigenomic and transcriptomic annotations to produce high-resolution, single tissue annotations. After validating our annotations with a catalog of tissue-specific non-coding elements previously identified in the literature, we apply our method using data from 127 different cell and tissue types to present an atlas of heritability enrichment across 45 different GWAS traits. We show that broader organ system categories (e.g. immune system) increase statistical power in identifying biologically relevant tissue types for complex diseases while annotations of individual cell types (e.g. monocytes or B-cells) provide deeper insights into disease etiology. Additionally, we use our GenoSkyline-Plus annotations in an in-depth case study of late-onset Alzheimer's disease (LOAD). Our analyses suggest a strong connection between LOAD heritability and genetic variants contained in regions of the genome functional in monocytes. Furthermore, we show that LOAD shares a similar localization of SNPs to monocyte-functional regions with Parkinson's disease. Overall, we demonstrate that integrated genome annotations at the single tissue level provide a valuable tool for understanding the etiology of complex human diseases. Our GenoSkyline-Plus annotations are freely available at

  19. Transposable Elements in Human Cancer: Causes and Consequences of Deregulation

    PubMed Central

    Anwar, Sumadi Lukman; Wulaningsih, Wahyu; Lehmann, Ulrich


    Transposable elements (TEs) comprise nearly half of the human genome and play an essential role in the maintenance of genomic stability, chromosomal architecture, and transcriptional regulation. TEs are repetitive sequences consisting of RNA transposons, DNA transposons, and endogenous retroviruses that can invade the human genome with a substantial contribution in human evolution and genomic diversity. TEs are therefore firmly regulated from early embryonic development and during the entire course of human life by epigenetic mechanisms, in particular DNA methylation and histone modifications. The deregulation of TEs has been reported in some developmental diseases, as well as for different types of human cancers. To date, the role of TEs, the mechanisms underlying TE reactivation, and the interplay with DNA methylation in human cancers remain largely unexplained. We reviewed the loss of epigenetic regulation and subsequent genomic instability, chromosomal aberrations, transcriptional deregulation, oncogenic activation, and aberrations of non-coding RNAs as the potential mechanisms underlying TE deregulation in human cancers. PMID:28471386

  20. Exotic Archaeology:. Searching for Superheavy Elements in Nature and Dating Human DNA with the 14C Bomb Peak

    NASA Astrophysics Data System (ADS)

    Kutschera, Walter; Dellinger, Franz; Liebl, Jakob; Steier, Peter


    This contribution conveys the power of accelerator mass spectrometry (AMS) to measure ultra-low traces of long-lived radionuclides in two highly divers fields: Astrophysics and molecular biology. Our search for nuclides of superheavy elements (SHE) in several natural materials did not confirm the claims of positive evidence for SHEs reported by the group of Amnon Marinov from Jerusalem, even though the sensitivity of our AMS measurements were several orders of magnitude higher. We also report on the investigation by the group of Kirsty Spalding from Stockholm to date human DNA with the 14C bomb peak. This allows one to determine retrospectively the birth date of cells in sections of the human body. Ongoing efforts to miniaturize carbon samples down to the level of 10 μg C for AMS measurements will allow one to venture into ever smaller subsections of the human brain.

  1. Exceptional structured noncoding RNAs revealed by bacterial metagenome analysis.


    Weinberg, Zasha; Perreault, Jonathan; Meyer, Michelle M; Breaker, Ronald R


    Estimates of the total number of bacterial species indicate that existing DNA sequence databases carry only a tiny fraction of the total amount of DNA sequence space represented by this division of life. Indeed, environmental DNA samples have been shown to encode many previously unknown classes of proteins and RNAs. Bioinformatics searches of genomic DNA from bacteria commonly identify new noncoding RNAs (ncRNAs) such as riboswitches. In rare instances, RNAs that exhibit more extensive sequence and structural conservation across a wide range of bacteria are encountered. Given that large structured RNAs are known to carry out complex biochemical functions such as protein synthesis and RNA processing reactions, identifying more RNAs of great size and intricate structure is likely to reveal additional biochemical functions that can be achieved by RNA. We applied an updated computational pipeline to discover ncRNAs that rival the known large ribozymes in size and structural complexity or that are among the most abundant RNAs in bacteria that encode them. These RNAs would have been difficult or impossible to detect without examining environmental DNA sequences, indicating that numerous RNAs with extraordinary size, structural complexity, or other exceptional characteristics remain to be discovered in unexplored sequence space.

  2. Transcription of Satellite III non-coding RNAs is a general stress response in human cells.


    Valgardsdottir, Rut; Chiodi, Ilaria; Giordano, Manuela; Rossi, Antonio; Bazzini, Silvia; Ghigna, Claudia; Riva, Silvano; Biamonti, Giuseppe


    In heat-shocked human cells, heat shock factor 1 activates transcription of tandem arrays of repetitive Satellite III (SatIII) DNA in pericentromeric heterochromatin. Satellite III RNAs remain associated with sites of transcription in nuclear stress bodies (nSBs). Here we use real-time RT-PCR to study the expression of these genomic regions. Transcription is highly asymmetrical and most of the transcripts contain the G-rich strand of the repeat. A low level of G-rich RNAs is detectable in unstressed cells and a 10(4)-fold induction occurs after heat shock. G-rich RNAs are induced by a wide range of stress treatments including heavy metals, UV-C, oxidative and hyper-osmotic stress. Differences exist among stressing agents both for the kinetics and the extent of induction (>100- to 80.000-fold). In all cases, G-rich transcripts are associated with nSBs. On the contrary, C-rich transcripts are almost undetectable in unstressed cells and modestly increase after stress. Production of SatIII RNAs after hyper-osmotic stress depends on the Tonicity Element Binding Protein indicating that activation of the arrays is triggered by different transcription factors. This is the first example of a non-coding RNA whose transcription is controlled by different transcription factors under different growth conditions.

  3. Transcription of Satellite III non-coding RNAs is a general stress response in human cells

    PubMed Central

    Valgardsdottir, Rut; Chiodi, Ilaria; Giordano, Manuela; Rossi, Antonio; Bazzini, Silvia; Ghigna, Claudia; Riva, Silvano; Biamonti, Giuseppe


    In heat-shocked human cells, heat shock factor 1 activates transcription of tandem arrays of repetitive Satellite III (SatIII) DNA in pericentromeric heterochromatin. Satellite III RNAs remain associated with sites of transcription in nuclear stress bodies (nSBs). Here we use real-time RT-PCR to study the expression of these genomic regions. Transcription is highly asymmetrical and most of the transcripts contain the G-rich strand of the repeat. A low level of G-rich RNAs is detectable in unstressed cells and a 104-fold induction occurs after heat shock. G-rich RNAs are induced by a wide range of stress treatments including heavy metals, UV-C, oxidative and hyper-osmotic stress. Differences exist among stressing agents both for the kinetics and the extent of induction (>100- to 80.000-fold). In all cases, G-rich transcripts are associated with nSBs. On the contrary, C-rich transcripts are almost undetectable in unstressed cells and modestly increase after stress. Production of SatIII RNAs after hyper-osmotic stress depends on the Tonicity Element Binding Protein indicating that activation of the arrays is triggered by different transcription factors. This is the first example of a non-coding RNA whose transcription is controlled by different transcription factors under different growth conditions. PMID:18039709

  4. Effect of Environmental Chemical Stress on Nuclear Noncoding RNA Involved in Epigenetic Control

    PubMed Central

    Arrigo, Patrizio


    In the last decade the role of noncoding RNAs (ncRNAs) emerges not only as key elements of posttranscriptional gene silencing, but also as important players of epigenetic regulation. New kind and new functions of ncRNAs are continuously discovered and one of their most important roles is the mediation of environmental signals, both physical and chemical. The activity of cytoplasmic short ncRNA is extensively studied, in spite of the fact that their function and role in the nuclear compartment are not yet completely unraveled. Cellular nucleus contains a multiplicity of long and short ncRNAs controlling at different levels transcriptional and epigenetic processes. In addition, some ncRNAs are involved in RNA editing and quality control. In this paper we review the existing knowledge dealing with how chemical stressors can influence the functionality of short nuclear ncRNAs. Furthermore, we perform bioinformatics analyses indicating that chemical environmental stressors not only induce DNA damage but also influence the mechanism of ncRNAs production and control. PMID:26339639

  5. Monomethylated trivalent arsenic species disrupt steroid receptor interactions with their DNA response elements at non-cytotoxic cellular concentrations

    PubMed Central

    Gosse, Julie A.; Taylor, Vivien F.; Jackson, Brian P.; Hamilton, Joshua W.; Bodwell, Jack E.


    Arsenic (As) is considered a top environmental chemical of human health because it has been linked to adverse health effects including cancer, diabetes, cardiovascular disease, and reproductive and developmental problems. In several cell culture and animal models, As acts as an endocrine disruptor, which may underlie many of its health effects. Previous work showed that steroid receptor (SR)-driven gene expression is disrupted in cells treated with inorganic As (arsenite, iAs+3). In those studies, low iAs+3 concentrations (0.1–0.7 μM) stimulated hormone-inducible transcription, whereas somewhat higher but still non-cytotoxic levels (1–3 μM) inhibited transcription. This investigation focuses on the mechanisms underlying these inhibitory effects and evaluates the role of methylated trivalent As metabolites on SR function. Recent evidence suggests that, compared with iAs, methylated forms may have distinct biochemical effects. Here, fluorescence polarization (FP) experiments utilizing purified, hormone-bound human glucocorticoid (GR) and progesterone receptor (PR) have demonstrated that neither inorganic (iAs+3) nor dimethylated (DMA+3) species of trivalent As affect receptor interactions with glucocorticoid DNA response elements (GREs). However, monomethylated forms (monomethylarsenite, MMA+3 and monomethylarsonic diglutathione, MADG) strongly inhibit GR-GRE and PR-GRE binding. Additionally, speciation studies of iAs+3-treated H4IIE rat hepatoma cells show that, under treatment conditions that cause inhibition of hormone-inducible gene transcription, the intracellular concentration of MADG is sufficient to inhibit GR-GRE and PR-GRE interactions in vivo. These results indicate that arsenic’s inhibitory endocrine disruption effects are probably caused in part by methylated metabolites’ disruption of SR ability to bind DNA response elements that are crucial to hormone-driven gene transcription. PMID:23765520

  6. Short interspersed DNA elements and miRNAs: a novel hidden gene regulation layer in zebrafish?


    Scarpato, Margherita; Angelini, Claudia; Cocca, Ennio; Pallotta, Maria M; Morescalchi, Maria A; Capriglione, Teresa


    In this study, we investigated by in silico analysis the possible correlation between microRNAs (miRNAs) and Anamnia V-SINEs (a superfamily of short interspersed nuclear elements), which belong to those retroposon families that have been preserved in vertebrate genomes for millions of years and are actively transcribed because they are embedded in the 3' untranslated region (UTR) of several genes. We report the results of the analysis of the genomic distribution of these mobile elements in zebrafish (Danio rerio) and discuss their involvement in generating miRNA gene loci. The computational study showed that the genes predicted to bear V-SINEs can be targeted by miRNAs with a very high hybridization E-value. Gene ontology analysis indicates that these genes are mainly involved in metabolic, membrane, and cytoplasmic signaling pathways. Nearly all the miRNAs that were predicted to target the V-SINEs of these genes, i.e., miR-338, miR-9, miR-181, miR-724, miR-735, and miR-204, have been validated in similar regulatory roles in mammals. The large number of genes bearing a V-SINE involved in metabolic and cellular processes suggests that V-SINEs may play a role in modulating cell responses to different stimuli and in preserving the metabolic balance during cell proliferation and differentiation. Although they need experimental validation, these preliminary results suggest that in the genome of D. rerio, as in other TE families in vertebrates, the preservation of V-SINE retroposons may also have been favored by their putative role in gene network modulation.

  7. Structural polymorphism within a regulatory element of the human KRAS promoter: formation of G4-DNA recognized by nuclear proteins

    PubMed Central

    Cogoi, Susanna; Paramasivam, Manikandan; Spolaore, Barbara; Xodo, Luigi E.


    The human KRAS proto-oncogene contains a critical nuclease hypersensitive element (NHE) upstream of the major transcription initiation site. In this article, we demonstrate by primer-extension experiments, PAGE, chemical footprinting, CD, UV and FRET experiments that the G-rich strand of NHE (32R) folds into intra-molecular G-quadruplex structures. Fluorescence data show that 32R in 100 mM KCl melts with a biphasic profile, showing the formation of two distinct G-quadruplexes with Tm of ∼55°C (Q1) and ∼72°C (Q2). DMS-footprinting and CD suggest that Q1 can be a parallel and Q2 a mixed parallel/antiparallel G-quadruplex. When dsNHE (32R hybridized to its complementary) is incubated with a nuclear extract from Panc-1 cells, three DNA–protein complexes are observed by EMSA. The complex of slower mobility is competed by quadruplex 32R, but not by mutant oligonucleotides, which cannot form a quadruplex structure. Using paramagnetic beads coupled with 32R, we pulled down from the Panc-1 extract proteins with affinity for quadruplex 32R. One of these is the heterogeneous nuclear ribonucleoprotein A1, which was previously reported to unfold quadruplex DNA. Our study suggests a role of quadruplex DNA in KRAS transcription and provides the basis for the rationale design of molecular strategies to inhibit the expression of KRAS. PMID:18490377

  8. Genomic Organization of Repetitive DNA Elements and Its Implications for the Chromosomal Evolution of Channid Fishes (Actinopterygii, Perciformes)

    PubMed Central

    Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Villa, Mateo Andres; de Oliveira, Ezequiel Aguiar; Tanomtong, Alongklod; Yano, Cassia Fernanda; Supiwong, Weerayuth; Chaveerach, Arunrat


    Channid fishes, commonly referred to as “snakeheads”, are currently very important in Asian fishery and aquaculture due to the substantial decline in natural populations because of overexploitation. A large degree of chromosomal variation has been found in this family, mainly through the use of conventional cytogenetic investigations. In this study, we analyzed the karyotype structure and the distribution of 7 repetitive DNA sequences in several Channa species from different Thailand river basins. The aim of this study was to investigate the chromosomal differentiation among species and populations to improve upon the knowledge of its biodiversity and evolutionary history. Rearrangements, such as pericentric inversions, fusions and polyploidization, appear to be important events during the karyotypic evolution of this genus, resulting in the chromosomal diversity observed among the distinct species and even among populations of the same species. In addition, such variability is also increased by the genomic dynamism of repetitive elements, particularly by the differential distribution and accumulation of rDNA sequences on chromosomes. This marked diversity is likely linked to the lifestyle of the snakehead fishes and their population fragmentation, as already identified for other fish species. The karyotypic features highlight the biodiversity of the channid fishes and justify a taxonomic revision of the genus Channa, as well as of the Channidae family as a whole, as some nominal species may actually constitute species complexes. PMID:26067030

  9. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.


    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W


    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  10. The DNA unwinding element binding protein DUE-B interacts with Cdc45 in preinitiation complex formation.


    Chowdhury, A; Liu, G; Kemp, M; Chen, X; Katrangi, N; Myers, S; Ghosh, M; Yao, J; Gao, Y; Bubulya, P; Leffak, M


    Template unwinding during DNA replication initiation requires the loading of the MCM helicase activator Cdc45 at replication origins. We show that Cdc45 interacts with the DNA unwinding element (DUE) binding protein DUE-B and that these proteins localize to the DUEs of active replication origins. DUE-B and Cdc45 are not bound at the inactive c-myc replicator in the absence of a functional DUE or at the recently identified ataxin 10 (ATX10) origin, which is silent before disease-related (ATTCT)(n) repeat length expansion of its DUE sequence, despite the presence of the origin recognition complex (ORC) and MCM proteins at these origins. Addition of a heterologous DUE to the ectopic c-myc origin, or expansion of the ATX10 DUE, leads to origin activation, DUE-B binding, and Cdc45 binding. DUE-B, Cdc45, and topoisomerase IIbeta binding protein 1 (TopBP1) form complexes in cell extracts and when expressed from baculovirus vectors. During replication in Xenopus egg extracts, DUE-B and Cdc45 bind to chromatin with similar kinetics, and DUE-B immunodepletion blocks replication and the loading of Cdc45 and a fraction of TopBP1. The coordinated binding of DUE-B and Cdc45 to origins and the physical interactions of DUE-B, Cdc45, and TopBP1 suggest that complexes of these proteins are necessary for replication initiation.

  11. Comparative Analysis of Noncoding Regions of 77 Orthologous Mouse and Human Gene Pairs

    PubMed Central

    Jareborg, Niclas; Birney, Ewan; Durbin, Richard


    A data set of 77 genomic mouse/human gene pairs has been compiled from the EMBL nucleotide database, and their corresponding features determined. This set was used to analyze the degree of conservation of noncoding sequences between mouse and human. A new alignment algorithm was developed to cope with the fact that large parts of noncoding sequences are not alignable in a meaningful way because of genetic drift. This new algorithm, DNA Block Aligner (DBA), finds colinear-conserved blocks that are flanked by nonconserved sequences of varying lengths. The noncoding regions of the data set were aligned with DBA. The proportion of the noncoding regions covered by blocks >60% identical was 36% for upstream regions, 50% for 5′ UTRs, 23% for introns, and 56% for 3′ UTRs. These blocks of high identity were more or less evenly distributed across the length of the features, except for upstream regions in which the first 100 bp upstream of the transcription start site was covered in up to 70% of the gene pairs. This data set complements earlier sets on the basis of cDNA sequences and will be useful for further comparative studies. [This paper contains supplementary data that can be found at] PMID:10508839

  12. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.


    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  13. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.


    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correl