Rajaretnam, T; Deshpande, R V
1991-01-01
This paper presents the results of an evaluation undertaken by the Population Research Centre of the India Population Project-III in two districts of Karnataka state in late 1990. "The evaluation study revealed that mass media type...programmes such as...films...were carried out satisfactorily. But inter-[personal] communication type...programmes such as group meetings...were rarely conducted and people's participation was not sufficiently ensured." Recommendations for improvements are included. excerpt
NASA Astrophysics Data System (ADS)
Chilur, Rudragouda; Kumar, Sushilendra
2018-06-01
The Maize ( Zea mays L.) crop is one of the most important cereal in agricultural production systems of Northern Transition Zone (Hyderabad-Karnataka region) in India. These Hyderabad Karnataka farmers (small-medium) are lack of economic technologies with maize dehusking and shelling, which fulfils the two major needs as crops and as livestock in farming. The portable medium size (600 kg/h capacity) electric motor (2.23 kW) operated Maize Dehusker cum Sheller (MDS) was designed to resolve the issue by considering engineering properties of maize. The developed trapezium shaped MDS machine having overall dimensions (length × (top and bottom) × height) of 1200 × (500 and 610) × 810 mm. The selected operational parameters viz, cylinder peripheral speed (7.1 m/s), concave clearance (25 mm) and feed rate (600 kg/h) were studied for machine-performance and seed-quality parameters. The performance of machine under these parameters showed the dehusking efficiency of 99.56%, shelling efficiency of 98.01%, cleaning efficiency of 99.11%, total loss of 3.63% machine capacity of 527.11 kg/kW-h and germination percentage of 98.93%. Overall machine performance was found satisfactory for maize dehusking cum shelling operation as well as to produce the maize grains for seeding purpose.
NASA Astrophysics Data System (ADS)
Chilur, Rudragouda; Kumar, Sushilendra
2018-02-01
The Maize (Zea mays L.) crop is one of the most important cereal in agricultural production systems of Northern Transition Zone (Hyderabad-Karnataka region) in India. These Hyderabad Karnataka farmers (small-medium) are lack of economic technologies with maize dehusking and shelling, which fulfils the two major needs as crops and as livestock in farming. The portable medium size (600 kg/h capacity) electric motor (2.23 kW) operated Maize Dehusker cum Sheller (MDS) was designed to resolve the issue by considering engineering properties of maize. The developed trapezium shaped MDS machine having overall dimensions (length × (top and bottom) × height) of 1200 × (500 and 610) × 810 mm. The selected operational parameters viz, cylinder peripheral speed (7.1 m/s), concave clearance (25 mm) and feed rate (600 kg/h) were studied for machine-performance and seed-quality parameters. The performance of machine under these parameters showed the dehusking efficiency of 99.56%, shelling efficiency of 98.01%, cleaning efficiency of 99.11%, total loss of 3.63% machine capacity of 527.11 kg/kW-h and germination percentage of 98.93%. Overall machine performance was found satisfactory for maize dehusking cum shelling operation as well as to produce the maize grains for seeding purpose.
Trend of human brucellosis over a decade at tertiary care centre in North Karnataka.
Patil, D P; Ajantha, G S; Shubhada, C; Jain, P A; Kalabhavi, A; Shetty, P C; Hosamani, M; Appannanavar, S; Kulkarni, R D
2016-01-01
Brucellosis is an important zoonotic disease. India having a major agrarian population is expected to have a higher prevalence. However, due to lack of laboratory facility or awareness among clinicians, the disease is largely underreported. The aim of this study was to know the prevalence and trend of human brucellosis over a decade, in patients attending a teaching hospital in North Karnataka, and to understand their geographical distribution. The study was conducted from January 2006 to December 2015 at a tertiary care teaching hospital in North Karnataka. A total of 3610 serum samples were evaluated from suspected cases of brucellosis. All serum samples were initially screened by Rose Bengal plate test, and positive samples were further analysed by Serum agglutination test (SAT) using standard Brucella abortus antigen from Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, India. A titre above or equal to 1:80 IU/ml was considered as positive. Demographic data such as age, sex and native place of these patients were also analysed. We observed that human brucellosis is present in North Karnataka. The overall seropositivity of brucellosis in suspected cases was 5.1%. The positive titres ranged from 1:80 to 163,840 IU/ml. The majority of the patients were from Gadag, Koppal and Haveri districts of North Karnataka. Our study confirms the presence of human brucellosis in the northern part of Karnataka. Further studies to understand the prevalence of animal brucellosis in these areas will help in implementing prevention measures.
Rahangdale, Lisa; Banandur, Pradeep; Sreenivas, Amita; Turan, Janet; Washington, Reynold; Cohen, Craig R.
2010-01-01
In Karnataka, India only one-third of HIV-infected pregnant women received antiretroviral prophylaxis at delivery in 2007 through the state government’s prevention of parent-to-child HIV transmission (PPTCT) program. The current qualitative study explored the role of HIV-associated stigma as a barrier to accessing PPTCT services in the rural northern Karnataka district of Bagalkot using in depth interviews and focus group discussions with HIV-infected women who had participated in the PPTCT program, male and female family members, and HIV service providers. Participants discussed personal experiences, community perceptions of HIV, and decision-making related to accessing PPTCT services. They described stigma towards HIV-infected individuals from multiple sources: healthcare workers, community members, family and self. Stigma-related behaviors were based on fears of HIV transmission through personal contact and moral judgment. Experience and/or fears of discrimination led pregnant women to avoid using PPTCT interventions. Government, cultural and historical factors are described as the roots of much the stigma-related behavior in this setting. Based on these formative data, PPTCT program planners should consider further research and interventions aimed at diminishing institutional and interpersonal HIV-associated stigma experienced by pregnant women. PMID:20635247
Khan, Shamshad; Lorway, Robert; Chevrier, Claudyne; Dutta, Sumit; Ramanaik, Satyanarayana; Roy, Anu; Bhattacharjee, Parinita; Mishra, Sharmistha; Moses, Stephen; Blanchard, James; Becker, Marissa
2017-01-19
Decades of research have documented how sex workers worldwide, particularly female sex workers (FSWs), shoulder a disproportionate burden of the HIV epidemic. In India, although a substantial progress has been made in controlling the epidemic, its prevalence among FSWs and the Devadasis (also called traditional sex workers) in northern Karnataka is still significantly high. On the other hand, much of the HIV prevention research has focused on their mapping and size estimation, typologies, bio-behavioural surveillance, condom use and other prevention technologies. In this article, drawing on critical theoretical perspectives, secondary historical sources and in-depth interviews, we unravel wider social, cultural and political economic complexities surrounding the lives of Devadasis, and specifically illuminate the moral pragmatics that shed light on their entry into sex trade and vulnerability to HIV. Findings from this research are extremely important since while much is known about Devadasis in social sciences and humanities, relatively little is known about the complexities of their lives within public health discourses related to HIV. Our work has direct implications for ongoing HIV prevention and health promotion efforts in the region and beyond.
Sm-Nd isotopic data from Archean metavolcanic rocks at Holenarsipur, South India
DOE Office of Scientific and Technical Information (OSTI.GOV)
Drury, S.A.; Van Calsteren, P.C.; Reeves-Smith, G.J.
1987-11-01
Results of a Sm-Nd isotopic analysis of Archean metavolcanics in the Holenarsipur greenstone belt, Karnataka, South India, give a whole-rock isochron age of 2.62 Ga for lightly deformed metabasaltic amphibolites in the northern part of the belt. This is within error of the age of high-grade metamorphism and crustal thickening which affected areas further to the south during the late Archean. Together with the geochemical affinities of these and other metavolcanics in Karnataka, and results of regional structural analysis, this unexpected age supports a model relating volcanism and crustal thickening to northward subduction and crustal accretion during the late Archean.more » Data from basic and ultrabasic metavolcanics from the more strongly deformed and higher-grade southern arm of the Holenarsipur belt do not permit an age greater than 3.0 Ga. Previously, these rocks were regarded as part of an older supracrustal sequence that predated the local 3.0 to 3.3 Ga gneissic complex. The new dates therefore considerably simplify attempts at accounting for greenstone evolution in South India.« less
ERIC Educational Resources Information Center
Tooley, James
2005-01-01
The Grant-in-Aid (GIA) higher education sector in Karnataka, India, is examined as an example of a well-established public-private partnership (PPP). Interviews with senior officials in the Government of Karnataka, and in two contrasting Regions, centred around Gulbarga and Mysore, together with visits to GIA and private-unaided (PUA) colleges…
Appearance of E1: A226V mutant Chikungunya virus in Coastal Karnataka, India during 2008 outbreak
Santhosh, SR; Dash, Paban Kumar; Parida, Manmohan; Khan, Mohasin; Rao, Putcha VL
2009-01-01
Chikungunya has resurged in the form of unprecedented explosive epidemic in 2006 after a long gap in India affecting 1.39 million of persons. The disease continued for the next two consecutive years affecting 59,535 and 64,548 persons during 2007 and 2008 respectively. The 2008 outbreak being the second largest among these three years the information regarding the etiology and the mutations involved are useful for further control measures. Among the 2008 outbreaks the Coastal Karnataka accounts for the 46,510 persons. An in-depth investigation of Chikungunya epidemic of Coastal Karnataka, India, 2008 by serology, virus isolation, RT-PCR and genome sequencing revealed the presence and continued circulation of A226V mutant Chikungunya virus. The appearance of this mutant virus was found to be associated with higher prevalence of vector Aedes albopictus and the geographical proximity of coastal Karnataka with the adjoining Kerala state. This is the first report regarding the appearance of this mutation in Karnataka state of India. The present study identified the presence and association of A226V mutant virus with Chikungunya outbreak in India during 2008. PMID:19857273
Understanding out-migration among female sex workers in South India
Banandur, Pradeep; Ramnaik, Satyanarayana; Manhart, Lisa E.; Buzdugan, Raluca; Mahapatra, Bidhubhushan; Isac, Shajy; Halli, Shiva S; Washington, Reynold G; Moses, Stephen; Blanchard, James F
2012-01-01
BACKGROUND Migrant sex workers are known to be vulnerable to HIV. There is substantial female sex worker (FSW) mobility between the borders of Maharashtra and Karnataka, but little programming emphasis on migrant FSWs in India. We sought to understand the individual/cultural, structural and contextual determinants of migration among FSWs from Karnataka. METHODS A cross sectional face-to-face interview of 1567FSWs from 142 villages in 3 districts of northern Karnataka, India was conducted from January–June 2008. Villages having 10+FSWs, a large number of whom were migrant, were selected following mapping of FSWs. Multinomial logistic regression was conducted to identify characteristics associated with migrant (travelled for ≥2weeks outside the district past year) and mobile (travelled for <2weeks outside the district past year) FSWs; adjusting for age and district. RESULTS Compared to non-migrants, migrant FSWs were more likely to be brothel than street-based (AOR 5.7; 95%CI 1.6–20.0), have higher income from sex work (AOR 42.2; 12.6–142.1), speak >2languages (AOR 5.6%; 2.6–12.0), have more clients (AORper client 2.9; 1.2–7.2) and have more sex acts/day (AORper sex act 3.5; 1.3–9.3). Mobile FSWs had higher income from sex work (AOR=13.2; 3.9–44.6) relative to non-migrants, but not as strongly as for migrant FSWs. CONCLUSION Out-migration of FSWs in Karnataka was strongly tied to sex work characteristics; thus, the structure inherent in sex work should be capitalized on when developing HIV preventive interventions. The important role of FSWs in HIV epidemics, coupled with the potential for rapid spread of HIV with migration, requires the most effective interventions possible for mobile and migrant FSWs. PMID:23001264
Blanchard, Andrea Katryn; Bruce, Sharon Gail; Jayanna, Krishnamurthy; Gurav, Kaveri; Mohan, Haranahalli L; Avery, Lisa; Moses, Stephen; Blanchard, James Frederick; Ramesh, Banadakoppa M
2015-09-01
This study was conducted to explore the decision-making processes regarding sites for delivery of infants among women, their husbands, and mothers-in-law in a rural area of northern Karnataka state, south India. Qualitative semi-structured, individual in-depth interviews were conducted in 2010 among 110 pregnant women, new mothers, husbands and mothers-in-law. Interviews were conducted by trained local researchers in participants' languages and then translated into English. Decisions were made relationally, as family members weighed their collective attitudes and experiences towards a home, private or public delivery. Patterns of both concordance and discordance between women and their families' preferences for delivery site were present. The voice of pregnant women and new mothers was not always subordinate to that of other family members. Still, the involvement of husbands and mothers-in-law was important in decision-making, indicating the need to consider the influence of household gender and power dynamics. All respondent types also expressed shifts in social context and cultural attitudes towards increasing preference for hospital delivery. An appreciation of the interdependence of family members' roles in delivery site decision-making, and how they are influenced by the socio-cultural context, must be considered in frameworks used to guide the development of relevant interventions to improve the utilization and quality of maternal, neonatal and child health services.
Use of ICT in College Libraries in Karnataka, India: A Survey
ERIC Educational Resources Information Center
Kumar, B. T. Sampath; Biradar, B. S.
2010-01-01
Purpose; The purpose of this paper is to examine the use of information communication technology (ICT) in 31 college libraries in Karnataka, India by investigating the ICT infrastructure, current status of library automation, barriers to implementation of library automation and also librarians' attitudes towards the use of ICT.…
India--Karnataka: Secondary Education and The New Agenda for Economic Growth.
ERIC Educational Resources Information Center
Bashir, Sajitha
Karnataka (India) recorded impressive growth in the 1990s, with state income growing at 8% per annum, driven largely by expansion of the industrial and service sectors. However, this impressive performance has not reduced rural poverty levels or regional disparities to a great extent. This report addresses three major concerns of policy makers in…
Facilities at Indian Institute of Astrophysics and New Initiatives
NASA Astrophysics Data System (ADS)
Bhatt, Bhuwan Chandra
2018-04-01
The Indian Institute of Astrophysics is a premier national institute of India for the study of and research into topics pertaining to astronomy, astrophysics and related subjects. The Institute's main campus in Bangalore city in southern India houses the main administrative set up, library and computer center, photonics lab and state of art mechanical workshop. IIA has a network of laboratories and observatories located in various places in India, including Kodaikanal (Tamilnadu), Kavalur (Tamilnadu), Gauribidanur (Karnataka), Leh & Hanle (Jammu & Kashmir) and Hosakote (Karnataka).
George, Asha
2009-01-01
Although accountability drives in the Indian health sector sporadically highlight egregious behaviour of individual health providers, accountability needs to be understood more broadly. From a managerial perspective, while accountability functions as a control mechanism that involves reviews and sanctions, it also has a constructive side that encourages learning from errors and discretion to support innovation. This points to social relationships: how formal rules and hierarchies combine with informal norms and processes and more fundamentally how power relations are negotiated. Drawing from this conceptual background and based on qualitative research, this article analyses the views of government primary health care administrators and workers from Koppal district, northern Karnataka, India. In particular, the article details how these actors view two management functions concerned with internal accountability: supervision and disciplinary action. A number of disjunctures are revealed. Although extensive information systems exist, they do not guide responsiveness or planning. While supportive supervision efforts are acknowledged and practiced, implicit quid-pro-quo bargains that justify poor service delivery performance are more prevalent. Despite the enactment of numerous disciplinary measures, little discipline is observed. These disjunctures reflect nuanced and layered relationships between health administrators and workers, as well as how power is negotiated through corruption and elected representatives within the broader political economy context of health systems in northern Karnataka, India. These various dimensions of accountability need to be addressed if it is to be used more equitably and effectively.
Association of Malassezia species with dandruff.
Rudramurthy, Shivaprakash M; Honnavar, Prasanna; Dogra, Sunil; Yegneswaran, Prakash P; Handa, Sanjeev; Chakrabarti, Arunaloke
2014-03-01
Malassezia species implicated with dandruff vary at different geographical locations. The present study was conducted to determine the spectrum and distribution of Malassezia species in dandruff patients and healthy individuals. Patients with dandruff from northern (Chandigarh) and southern (Manipal, Karnataka) parts of India (50 each) and healthy individuals (20) were included in the study. Dandruff severity was graded as mild, moderate and severe. Malassezia spp. isolated were quantified and identified by phenotypic characters and molecular methods including PCR-RFLP and DNA sequencing. Number of Malassezia spp. retrieved was significantly higher (P<0.001) in dandruff cases (84%) as compared to healthy individuals (30%). Isolation of Malassezia spp. was significantly higher (P<0.01) in patients from southern India. In moderately severe cases M. restricta was single most predominant (37.8%) isolate from patients of northern part of India and M. furfur (46.4%) from patients of southern part of India. Malassezia density was significantly associated with the severity of dandruff (P<0.001). Our results on a limited number of individuals show that Malassezia spp. associated with dandruff varies in different regions of the country and the density of yeasts increases with severity of disease.
Association of Malassezia species with dandruff
Rudramurthy, Shivaprakash M.; Honnavar, Prasanna; Dogra, Sunil; Yegneswaran, Prakash P.; Handa, Sanjeev; Chakrabarti, Arunaloke
2014-01-01
Background & objectives: Malassezia species implicated with dandruff vary at different geographical locations. The present study was conducted to determine the spectrum and distribution of Malassezia species in dandruff patients and healthy individuals. Methods: Patients with dandruff from northern (Chandigarh) and southern (Manipal, Karnataka) parts of India (50 each) and healthy individuals (20) were included in the study. Dandruff severity was graded as mild, moderate and severe. Malassezia spp. isolated were quantified and identified by phenotypic characters and molecular methods including PCR-RFLP and DNA sequencing. Results: Number of Malassezia spp. retrieved was significantly higher (P<0.001) in dandruff cases (84%) as compared to healthy individuals (30%). Isolation of Malassezia spp. was significantly higher (P<0.01) in patients from southern India. In moderately severe cases M. restricta was single most predominant (37.8%) isolate from patients of northern part of India and M. furfur (46.4%) from patients of southern part of India. Malassezia density was significantly associated with the severity of dandruff (P<0.001). Interpretation & conclusions: Our results on a limited number of individuals show that Malassezia spp. associated with dandruff varies in different regions of the country and the density of yeasts increases with severity of disease. PMID:24820838
Water quality studies of TV station reservoir at Davangere City, Karnataka (India).
Begum, Nafeesa; Purushothama, R; Narayana, J; Kumar, K P Ravindra
2006-10-01
Studies were carried out to assess the water quality of TV station reservoir at Davangere City, Karnataka (India). The study revealed that there were variations in physico-chemical concentrations during the rainy season. Except turbidity, all the other physico-chemical characteristics were found within the permissible limits. The results were compared with the standards given by ISI for water quality.
Bloom, Shelah S; Griffiths, Paula L
2007-07-01
Factors contributing to India's vulnerability to the AIDS epidemic include pervasive poverty, low levels of education and high gender stratification. This study uses data collected in the 1998-99 National Family Health Survey-2 (NFHS-2) to investigate the relationship between aspects of women's autonomy and four measures of HIV-related knowledge and behaviour--awareness and knowledge of HIV/AIDS, condom awareness and condom use--in three culturally contrasting states in India: Kerala (n=2884), Karnataka (n=4357) and Uttar Pradesh (n=8981). The NFHS-2 is a nationally representative survey of India, with a sampling scheme that was designed such that each state sample can be generalized back to represent ever-married women aged 15-49 living in the state. Kerala scores highest in the four health outcome measures, followed by Karnataka and then Uttar Pradesh, but condom use is lowest in Karnataka. Kerala also leads in the four dimensions of autonomy examined and in socio-demographic status, followed again by Karnataka and Uttar Pradesh. Despite these observed differences, in all three states, women with greater autonomy as measured by this study were more likely to be knowledgeable about AIDS and condoms and to use condoms, after controlling for socio-demographic factors. These results concur with other studies focusing on women's autonomy and health outcomes around the world, and point to the importance of incorporating a gender-based approach to AIDS prevention programmes in India.
Bruce, Sharon G; Blanchard, Andrea K; Gurav, Kaveri; Roy, Anuradha; Jayanna, Krishnamurthy; Mohan, Haranahalli L; Ramesh, Banadakoppa M; Blanchard, James F; Moses, Stephen; Avery, Lisa
2015-02-27
The National Rural Health Mission (NRHM) of India aims to increase the uptake of safe and institutional delivery among rural communities to improve maternal, neonatal and child health (MNCH) outcomes. Previous studies in India have found that while there have been increasing numbers of institutional deliveries there are still considerable barriers to utilization and quality of services, particularly in rural areas, that may mitigate improvements achieved by MNCH interventions. This paper aims to explore the factors influencing preference for home, public or private hospital delivery among rural pregnant and new mothers in three northern districts of Karnataka state, South India. In-depth qualitative interviews were conducted in 2010 among 110 pregnant women, new mothers (infants born within past 3 months), their husbands and mothers-in-law. Interviews were conducted in the local language (Kannada) and then translated to English for analysis. The interviews of pregnant women and new mothers were used for analysis to ultimately develop broader themes around definitions of quality care from the perspective of service users, and the influence this had on their delivery site preferences. Geographical and financial access were important barriers to accessing institutional delivery services in all districts, and among those both above and below the poverty line. Access issues of greatest concern were high costs at private institutions, continuing fees at public hospitals and the inconsistent receipt of government incentives. However, views on quality of care that shaped delivery site preferences were deeply rooted in socio-cultural expectations for comfortable, respectful and safe care that must ultimately be addressed to change negative perceptions about institutional, and particularly public hospital, care at delivery. In the literature, quality of care beyond access has largely been overlooked in favour of support for incentives on the demand side, and more trained doctors, facilities and equipment on the supply side. Taking a comprehensive approach to quality of care in line with cultural values and community needs is imperative for improving experiences, utilization, and ultimately maternal and neonatal health outcomes at the time of delivery.
Devang Divakar, Darshan; John, Jacob; Al Kheraif, Abdulaziz Abdullah; Mavinapalla, Seema; Ramakrishnaiah, Ravikumar; Vellappally, Sajith; Hashem, Mohamed Ibrahim; Dalati, M H N; Durgesh, B H; Safadi, Rima A; Anil, Sukumaran
2016-11-01
Aim: To test the validity of sex discrimination using lateral cephalometric radiograph and discriminant function analysis in Indigenous (Kuruba) children and adolescents of Coorg, Karnataka, India. Methods and materials: Six hundred and sixteen lateral cephalograms of 380 male and 236 females of age ranging from 6.5 to 18 years of Indigenous population of Coorg, Karnataka, India called Kurubas having a normal occlusion were included in the study. Lateral cephalograms were obtained in a standard position with teeth in centric occlusion and lips relaxed. Each radiograph was traced and cephalometric landmarks were measured using digital calliper. Calculations of 24 cephalometric measurements were performed. Results: Males exhibited significantly greater mean angular and linear cephalometric measurements as compared to females ( p < 0.05) (Table 5). Also, significant differences ( p < 0.05) were observed in all the variables according to age (Table 6). Out of 24 variables, only ULTc predicts the gender. The reliability of the derived discriminant function was assessed among study subjects; 100% of males and females were recognized correctly. Conclusion: The final outcome of this study validates the existence of sexual dimorphism in the skeleton as early as 6.5 years of age. There is a need for further research to determine other landmarks that can help in sex determination and norms for Indigenous (Kuruba) population and also other Indigenous population of Coorg, Karnataka, India.
Community health worker knowledge and management of pre-eclampsia in rural Karnataka State, India.
Ramadurg, Umesh; Vidler, Marianne; Charanthimath, Umesh; Katageri, Geetanjali; Bellad, Mrutyunjaya; Mallapur, Ashalata; Goudar, Shivaprasad; Bannale, Shashidhar; Karadiguddi, Chandrashekhar; Sawchuck, Diane; Qureshi, Rahat; von Dadelszen, Peter; Derman, Richard
2016-09-30
In India, the hypertensive disorders of pregnancy and postpartum haemorrhage are responsible for nearly 40 % of all maternal deaths. Most of these deaths occur in primary health settings which frequently lack essential equipment and medication, are understaffed, and have limited or no access to specialist care. Community health care workers are regarded as essential providers of basic maternity care; and the quality of care they provide is dependent on the level of knowledge and skills they possess. However, there is limited research regarding their ability to manage pregnancy complications. This study aims to describe the current state of knowledge regarding pre-eclampsia and eclampsia among community health care workers (auxiliary nurse midwives, accredited social health activists, staff nurses) in northern Karnataka, India. Furthermore, this study describes the treatment approaches used by various cadres of community health workers for these conditions. The findings of this study can help plan focussed training sessions to build upon their strengths and to address the identified gaps. Data were collected as part of a larger study aimed at assessing the feasibility of community-based treatment for pre-eclampsia. Eight focus group discussions were conducted in 2012-2013 in northern Karnataka State: four with staff nurses and auxiliary nurse midwives and four with accredited social health activists. In addition, twelve auxiliary nurse midwives and staff nurses completed questionnaires to explore their competence and self-efficacy in managing pre-eclampsia. Qualitative data were audio-recorded, transcribed verbatim and translated for thematic analysis using NVivo 10. Community health workers described their understanding of the origins of hypertension and seizures in pregnancy. Psychological explanations of hypertension were most commonly reported: stress, tension, and fear. The most common explanation for eclampsia was not receiving a tetanus vaccination. Despite some common misperceptions regarding aetiology, these community health workers demonstrated a good grasp of the potential consequences of hypertension in pregnancy. According to auxiliary nurse midwives and staff nurses, if hypertension was detected they encouraged rest, decreased salt intake, iron supplementation and tetanus vaccination. In addition, some staff nurses administered antihypertensives, MgSO 4 , or other anticonvulsants. All auxiliary nurse midwives had some awareness of MgSO 4 , but none had administered it themselves. This study showed that knowledge regarding the aetiology of pre-eclampsia was limited. Nevertheless, their basic knowledge and skills could be strengthened to more effectively manage the hypertensive disorders of pregnancy in their communities. NCT01911494.
Beattie, Tara S; Bhattacharjee, Parinita; Isac, Shajy; Davey, Calum; Javalkar, Prakash; Nair, Sapna; Thalinja, Raghavendra; Sudhakar, Gautam; Collumbien, Martine; Blanchard, James F; Watts, Charlotte; Moses, Stephen; Heise, Lori
2015-03-25
Low caste adolescent girls living in rural northern Karnataka are at increased risk of school drop-out, child marriage, and entry into sex-work, which enhances their vulnerability to HIV, early pregnancy and adverse maternal and child health outcomes. This protocol describes the evaluation of Samata, a comprehensive, multi-level intervention designed to address these structural drivers of HIV risk and vulnerability. The Samata study is a cluster randomised controlled trial that will be conducted in eighty village clusters (40 intervention; 40 control) in Bijapur and Bagalkot districts in northern Karnataka. The intervention seeks to reach low caste girls and their families; adolescent boys; village communities; high school teachers and school governing committees; and local government officials. All low caste (scheduled caste/tribe) adolescent girls attending 7th standard (final year of primary school) will be recruited into the study in two consecutive waves, one year apart. Girls (n = 2100), their families (n = 2100) and school teachers (n = 650) will be interviewed at baseline and at endline. The study is designed to assess the impact of the intervention on four primary outcomes: the proportion of low caste girls who (i) enter into secondary school; (ii) complete secondary school; (iii) marry before age 15; and (iv) engage in sex before age 15. Observers assessing the outcomes will be blinded to group assignment. The primary outcome will be an adjusted, cluster-level intention to treat analysis, comparing outcomes in intervention and control villages at follow-up. We will also conduct survival analyses for the following secondary outcomes: marriage, sexual debut, pregnancy and entry into sex work. Complementary monitoring and evaluation, qualitative and economic research will be used to explore and describe intervention implementation, the pathways through which change occurs, and the cost-effectiveness of the intervention. This is an innovative trial of a comprehensive intervention to improve the quality of life and reduce HIV vulnerability among marginalised girls in northern Karnataka. The findings will be of interest to programme implementers, policy makers and evaluation researchers working in the development, education, and sexual and reproductive health fields. ClinicalTrials.Gov NCT01996241 . 16th November 2013.
Rajkumar, Revathi; Kashyap, V K
2004-08-19
A large number of microsatellites have been extensively used to comprehend the genetic diversity of different global groups. This paper entails polymorphism at 15 STR in four predominant and endogamous populations representing Karnataka, located on the southwest coast of India. The populations residing in this region are believed to have received gene flow from south Indian populations and world migrants, hence, we carried out a detailed study on populations inhabiting this region to understand their genetic structure, diversity related to geography and linguistic affiliation and relatedness to other Indian and global migrant populations. Various statistical analyses were performed on the microsatellite data to accomplish the objectives of the paper. The heretozygosity was moderately high and similar across the loci, with low average GST value. Iyengar and Lyngayat were placed above the regression line in the R-matrix analysis as opposed to the Gowda and Muslim. AMOVA indicated that majority of variation was confined to individuals within a population, with geographic grouping demonstrating lesser genetic differentiation as compared to linguistic clustering. DA distances show the genetic affinity among the southern populations, with Iyengar, Lyngayat and Vanniyar displaying some affinity with northern Brahmins and global migrant groups from East Asia and Europe. The microsatellite study divulges a common ancestry for the four diverse populations of Karnataka, with the overall genetic differentiation among them being largely confined to intra-population variation. The practice of consanguineous marriages might have attributed to the relatively lower gene flow displayed by Gowda and Muslim as compared to Iyengar and Lyngayat. The various statistical analyses strongly suggest that the studied populations could not be differentiated on the basis of caste or spatial location, although, linguistic affinity was reflected among the southern populations, distinguishing them from the northern groups. Our study also indicates a heterogeneous origin for Lyngayat and Iyengar owing to their genetic proximity with southern populations and northern Brahmins. The high-ranking communities, in particular, Iyengar, Lyngayat, Vanniyar and northern Brahmins might have experienced genetic admixture from East Asian and European ethnic groups.
Rajkumar, Revathi; Kashyap, VK
2004-01-01
Background A large number of microsatellites have been extensively used to comprehend the genetic diversity of different global groups. This paper entails polymorphism at 15 STR in four predominant and endogamous populations representing Karnataka, located on the southwest coast of India. The populations residing in this region are believed to have received gene flow from south Indian populations and world migrants, hence, we carried out a detailed study on populations inhabiting this region to understand their genetic structure, diversity related to geography and linguistic affiliation and relatedness to other Indian and global migrant populations. Results Various statistical analyses were performed on the microsatellite data to accomplish the objectives of the paper. The heretozygosity was moderately high and similar across the loci, with low average GST value. Iyengar and Lyngayat were placed above the regression line in the R-matrix analysis as opposed to the Gowda and Muslim. AMOVA indicated that majority of variation was confined to individuals within a population, with geographic grouping demonstrating lesser genetic differentiation as compared to linguistic clustering. DA distances show the genetic affinity among the southern populations, with Iyengar, Lyngayat and Vanniyar displaying some affinity with northern Brahmins and global migrant groups from East Asia and Europe. Conclusion The microsatellite study divulges a common ancestry for the four diverse populations of Karnataka, with the overall genetic differentiation among them being largely confined to intra-population variation. The practice of consanguineous marriages might have attributed to the relatively lower gene flow displayed by Gowda and Muslim as compared to Iyengar and Lyngayat. The various statistical analyses strongly suggest that the studied populations could not be differentiated on the basis of caste or spatial location, although, linguistic affinity was reflected among the southern populations, distinguishing them from the northern groups. Our study also indicates a heterogeneous origin for Lyngayat and Iyengar owing to their genetic proximity with southern populations and northern Brahmins. The high-ranking communities, in particular, Iyengar, Lyngayat, Vanniyar and northern Brahmins might have experienced genetic admixture from East Asian and European ethnic groups. PMID:15317657
Unfree markets: socially embedded informal health providers in northern Karnataka, India.
George, Asha; Iyer, Aditi
2013-11-01
The dynamics of informal health markets in marginalised regions are relevant to policy discourse in India, but are poorly understood. We examine how informal health markets operate from the viewpoint of informal providers (those without any government-recognised medical degrees, otherwise known as RMPs) by drawing upon data from a household survey in 2002, a provider census in 2004 and ongoing field observations from a research site in Koppal district, Karnataka, India. We find that despite their illegality, RMPs depend on government and private providers for their training and referral networks. Buffeted by unregulated market pressures, RMPs are driven to provide allopathic commodities regardless of need, but can also be circumspect in their practice. Though motivated by profit, their socially embedded practice at community level at times undermines their ability to ensure payment of fees for their services. In addition, RMPs feel that communities can threaten them via violence or malicious rumours, leading them to seek political favour and social protection from village elites and elected representatives. RMPs operate within negotiated quid pro quo bargains that lead to tenuous reciprocity or fragile trust between them and the communities in which they practise. In the context of this 'unfree' market, some RMPs reported being more embedded in health systems, more responsive to communities and more vulnerable to unregulated market pressures than others. Understanding the heterogeneity, nuanced motivations and the embedded social relations that mark informal providers in the health systems, markets and communities they work in, is critical for health system reforms. Copyright © 2013 Elsevier Ltd. All rights reserved.
Isolation of Cryptococcus neoformans var. gattii from Eucalyptus camaldulensis in India.
Chakrabarti, A; Jatana, M; Kumar, P; Chatha, L; Kaushal, A; Padhye, A A
1997-01-01
Cryptococcus neoformans var. gattii has an ecological association with five Eucalyptus species: E. blakelyi, E. camaldulensis, E. gomphocephala, E. rudis, and E. tereticornis. After human infections due to C. neoformans var. gattii were diagnosed in the states of Punjab, Himachal Pradesh, and Karnataka, India, a study was undertaken to investigate the association of C. neoformans var. gattii with Indian eucalypts, especially in the state of Punjab. A total of 696 specimens collected from E. camaldulensis, E. citriodora and E. tereticornis (hybrid) trees were examined for the presence of C. neoformans var. gattii. Flowers from two trees of E. camaldulensis in the Chak Sarkar forest and one from the village of Periana near the Ferozepur area yielded five isolates of C. neoformans var. gattii. The origin of the trees could be traced to Australia, thus providing evidence that the distribution of E. camaldulensis correlated with the distribution of human cryptococcosis cases caused by C. neoformans var. gattii in northern India. PMID:9399553
"India Population Projects" in Karnataka.
Reddy, P H; Badari, V S
1991-12-01
An overview, objectives, implementation, and research and evaluation studies of 2 India Population Projects in Karnataka are presented. The India Population Project I (IPP-I) was conducted in Karnataka and Uttar Pradesh. India Population Project III (IPP-III) took place between 1984-92 in 6 districts of Karnataka: Belgaum, Bijapur, Dharwad, Bidar, Gulbarga, and Raichur, and 4 districts in Kerala. The 6 districts in Karnataka accounted for 36% (13.2 million) of the total national population. The project cost was Rs. 713.1 million which was shared by the World Bank, and the Indian national and regional government. Due to poor past performance, these projects were undertaken to improve health and family welfare status. Specific project objectives are outlined. IPP-I included an urban component, and optimal Government of India program, and an intensive rural initiative. The urban program aimed to improved pre- and postnatal services and facilities, and the family planning (FP) in Bangalore city. The rural program was primarily to provide auxiliary nurse-midwives and hospitals and clinics, and also supplemental feeding program for pregnant and nursing mothers and children up to 2 years. The government program provided FP staff and facilities. IPP-I had 3 units to oversee building construction, to recruit staff and provide supplies and equipment, and to establish a Population Center. IPP-III was concerned with service delivery; information, education, and communication efforts (IEC) and population education; research and evaluation; and project management. Both projects contributed significantly to improving the infrastructure. A brief account of the types and kinds of studies undertaken is given. Studies were grouped into longitudinal studies of fertility, mortality, and FP; management information and evaluation systems for health and family welfare programs; experimental strategies; and other studies. Research and evaluation studies in IPP-III encompassed studies in gaps in knowledge, skills, and practice of health and FP personnel; baseline and endline surveys; and operational evaluation of the management information and evaluation system; factors affecting primary health care in Gulbarga district; evaluation of radio health lessons and the impact of the Kalyana Matha Program; and studies of vaccination and child survival and maternal mortality. Training programs were also undertaken.
Shih, Regina; Feeney, Kevin; Langa, Kenneth M.
2014-01-01
Objectives. To examine gender disparities in cognitive functioning in India and the extent to which education explains this disparity in later life. Methods. This study uses baseline interviews of a prospective cohort study of 1,451 community-residing adults 45 years of age or older in four geographically diverse states of India (Karnataka, Kerala, Punjab, Rajasthan). Data collected during home visits includes cognitive performance tests, and rich sociodemographic, health, and psychosocial variables. The cognitive performance tests include episodic memory, numeracy, and a modified version of the Mini-Mental State Examination. Results. We find gender disparity in cognitive function in India, and this disparity is greater in the north than the south. We also find that gender disparities in educational attainment, health, and social and economic activity explain the female cognitive disadvantage in later life. Discussion. We report significant gender disparities in cognitive functioning among older Indian adults, which differ from gender disparities in cognition encountered in developed countries. Our models controlling for education, health status, and social and economic activity explain the disparity in southern India but not the region-specific disparity in the northern India. North Indian women may face additional sources of stress associated with discrimination against women that contribute to persistent disadvantages in cognitive functioning at older ages. PMID:24622150
Applying appropriate-use criteria to cardiac revascularisation in India.
Sood, Neeraj; Ugargol, Allen P; Barnes, Kayleigh; Mahajan, Anish
2016-03-30
The high prevalence of coronary heart disease and dramatic growth of cardiac interventions in India motivate an evaluation of the appropriateness of coronary revascularisation procedures in India. Although, appropriate-use criteria (AUC) have been used to analyse the appropriateness of cardiovascular care in the USA, they are yet to be applied to care in India. In our study, we apply AUC to cardiac care in Karnataka, India, compare our results to international applications of AUC, and suggest ways to improve the appropriateness of care in India. Data were collected from the Vajpayee Arogyashree Scheme, a government-sponsored health insurance scheme in Karnataka, India. These data were collected as part of the preauthorisation process for cardiac procedures. The final data included a random sample of 600 patients from 28 hospitals in Karnataka, who obtained coronary artery bypass grafting or percutaneous coronary intervention between 1 October 2014 and 31 December 2014. We obtained our primary baseline results using a random imputation simulation to fill in missing data. Our secondary outcome measure was a best case-worst case scenario where missing data were filled to give the lowest or highest number of appropriate cases. Of the cases, 86.7% (CI 0.837% to 0.892%) were deemed appropriate, 3.65% (CI 0.023% to 0.055%) were inappropriate and 9.63% (CI 0.074% to 0.123%) were uncertain. The vast majority of cardiac revascularisation procedures performed on beneficiaries of a government-sponsored insurance programme in India were found to be appropriate. These results meet or exceed levels of appropriate use of cardiac care in the USA. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Hanumaiah, H; Raut, C G; Sinha, D P; Yergolkar, P N
2016-01-01
Since 1997 National Institute of Virology, Bangalore Unit involved in WHO's Acute flaccid paralysis paediatric cases surveillance programme to isolate and detect polioviruses. Stool samples yielded not only polioviruses but also Non-Polio enteroviruses. This report is an overview of non-polio Enterovirus (NPEV) epidemiology in Karnataka state, India for the period of 16-years and 6 months from July 1997-2013. A total of 19,410 clinical samples were processed for virus isolation as a part of acute flaccid paralysis (AFP) surveillance for Global Polio Eradication Programme in India at National Polio Laboratory, at Bengaluru. NPEV detection was performed by virus isolation on cell culture according to World Health Organisation recommended protocols. A total of 4152 NPEV isolates were obtained. The NPEV isolation rate varied from year to year but with a total NPEV rate of 21.39%. A seasonal variation was noted with high transmission period between April and October with peaks in June-July. The male to female ratio was 1:1.2. The isolation of NPEV decreased significantly with the increase in age. Epidemiology of NPEVs from AFP cases in Karnataka is described.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-04-15
...; Strengthening Surveillance for Japanese Encephalitis in India, FOA GH13-004; and Research and Technical... GH13-003; Strengthening Surveillance for Japanese Encephalitis in India, FOA GH13-004; and Research and... of Karnataka and Kerala, India, FOA GH13-003; Strengthening Surveillance for Japanese Encephalitis in...
Socio-economic variables influencing mean age at marriage in Karnataka and Kerala.
Prakasam, C P; Upadhyay, R B
1985-01-01
"In this paper an attempt was made to study the influence of certain socio-economic variables on the male and the female age at marriage in Karnataka and Kerala [India] for the year 1971. Step-wise regression method has been used to select the predictor variables influencing mean age at marriage. The results reveal that percent female literate...and percent female in labour force...are found to influence female mean age at marriage in Kerala, while the variables for Karnataka were percent female literate..., percent male literate..., and percent urban male population...." excerpt
ERIC Educational Resources Information Center
Mahal, Ajay
2005-01-01
This article has two primary objectives. The first objective is to assess the manner in which public subsidies for health and education are distributed among people of different socioeconomic standing in the Indian state of Karnataka. The second purpose is to highlight the policy lessons that follow from it. In undertaking these tasks, the author…
Shekhar, S; Yoo, E-H; Ahmed, S A; Haining, R; Kadannolly, S
2017-02-01
Spatial decision support systems have already proved their value in helping to reduce infectious diseases but to be effective they need to be designed to reflect local circumstances and local data availability. We report the first stage of a project to develop a spatial decision support system for infectious diseases for Karnataka State in India. The focus of this paper is on malaria incidence and we draw on small area data on new cases of malaria analysed in two-monthly time intervals over the period February 2012 to January 2016 for Kalaburagi taluk, a small area in Karnataka. We report the results of data mapping and cluster detection (identifying areas of excess risk) including evaluating the temporal persistence of excess risk and the local conditions with which high counts are statistically associated. We comment on how this work might feed into a practical spatial decision support system. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fischer, Elizabeth A; Jayana, Krishnamurthy; Cunningham, Troy; Washington, Maryann; Mony, Prem; Bradley, Janet; Moses, Stephen
2015-12-01
High-quality care during labor, delivery, and the postpartum period is critically important since maternal and child morbidity and mortality are linked to complications that arise during these stages. A nurse mentoring program was implemented in northern Karnataka, India, to improve quality of services at primary health centers (PHCs), the lowest level in the public health system that offers basic obstetric care. The intervention, conducted between August 2012 and July 2014, employed 53 full-time nurse mentors and was scaled-up in 385 PHCs in 8 poor rural districts. Each mentor was responsible for 6 to 8 PHCs and conducted roughly 6 mentoring visits per PHC in the first year. This paper reports the results of a qualitative inquiry, conducted between September 2012 and April 2014, assessing the program's successes and challenges from the perspective of mentors and PHC teams. Data were gathered through 13 observations, 9 focus group discussions with mentors, and 25 individual and group interviews with PHC nurses, medical officers, and district health officers. Mentors and PHC staff and leaders reported a number of successes, including development of rapport and trust between mentors and PHC staff, introduction of team-based quality improvement processes, correct and consistent use of a new case sheet to ensure adherence to clinical guidelines, and increases in staff nurses' knowledge and skills. Overall, nurses in many PHCs reported an increased ability to provide care according to guidelines and to handle maternal and newborn complications, along with improvements in equipment and supplies and referral management. Challenges included high service delivery volumes and/or understaffing at some PHCs, unsupportive or absent PHC leadership, and cultural practices that impacted quality. Comprehensive mentoring can build competence and improve performance by combining on-the-job clinical and technical support, applying quality improvement principles, and promoting team-based problem solving. © Fischer et al.
Fischer, Elizabeth A; Jayana, Krishnamurthy; Cunningham, Troy; Washington, Maryann; Mony, Prem; Bradley, Janet; Moses, Stephen
2015-01-01
High-quality care during labor, delivery, and the postpartum period is critically important since maternal and child morbidity and mortality are linked to complications that arise during these stages. A nurse mentoring program was implemented in northern Karnataka, India, to improve quality of services at primary health centers (PHCs), the lowest level in the public health system that offers basic obstetric care. The intervention, conducted between August 2012 and July 2014, employed 53 full-time nurse mentors and was scaled-up in 385 PHCs in 8 poor rural districts. Each mentor was responsible for 6 to 8 PHCs and conducted roughly 6 mentoring visits per PHC in the first year. This paper reports the results of a qualitative inquiry, conducted between September 2012 and April 2014, assessing the program's successes and challenges from the perspective of mentors and PHC teams. Data were gathered through 13 observations, 9 focus group discussions with mentors, and 25 individual and group interviews with PHC nurses, medical officers, and district health officers. Mentors and PHC staff and leaders reported a number of successes, including development of rapport and trust between mentors and PHC staff, introduction of team-based quality improvement processes, correct and consistent use of a new case sheet to ensure adherence to clinical guidelines, and increases in staff nurses’ knowledge and skills. Overall, nurses in many PHCs reported an increased ability to provide care according to guidelines and to handle maternal and newborn complications, along with improvements in equipment and supplies and referral management. Challenges included high service delivery volumes and/or understaffing at some PHCs, unsupportive or absent PHC leadership, and cultural practices that impacted quality. Comprehensive mentoring can build competence and improve performance by combining on-the-job clinical and technical support, applying quality improvement principles, and promoting team-based problem solving. PMID:26681711
Rosendahl Appelquist, Lars; Balstrøm, Thomas
2015-04-01
This paper presents the application of a new methodology for coastal multi-hazard assessment & management under a changing global climate on the state of Karnataka, India. The recently published methodology termed the Coastal Hazard Wheel (CHW) is designed for local, regional and national hazard screening in areas with limited data availability, and covers the hazards of ecosystem disruption, gradual inundation, salt water intrusion, erosion and flooding. The application makes use of published geophysical data and remote sensing information and is showcasing how the CHW framework can be applied at a scale relevant for regional planning purposes. It uses a GIS approach to develop regional and sub-regional hazard maps as well as to produce relevant hazard risk data, and includes a discussion of uncertainties, limitations and management perspectives. The hazard assessment shows that 61 percent of Karnataka's coastline has a high or very high inherent hazard of erosion, making erosion the most prevalent coastal hazard. The hazards of flooding and salt water intrusion are also relatively widespread as 39 percent of Karnataka's coastline has a high or very high inherent hazard for both of these hazard types. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Salient Ecological Sensitive Regions of Central Western Ghats, India
NASA Astrophysics Data System (ADS)
Ramachandra, T. V.; Bharath, Setturu; Subash Chandran, M. D.; Joshi, N. V.
2018-05-01
Ecologically sensitive regions (ESRs) are the `ecological units' with the exceptional biotic and abiotic elements. Identification of ESRs considering spatially both ecological and social dimensions of environmental variables helps in ecological and conservation planning as per Biodiversity Act, 2002, Government of India. The current research attempts to integrate ecological and environmental considerations into administration, and prioritizes regions at Panchayat levels (local administrative unit) in Uttara Kannada district, Central Western Ghats, Karnataka state considering attributes (biological, Geo-climatic, Social, etc.) as ESR (1-4) through weightage score metrics. The region has the distinction of having highest forest area (80.48%) in Karnataka State, India and has been undergoing severe anthropogenic pressures impacting biogeochemistry, hydrology, food security, climate and socio-economic systems. Prioritisation of ESRs helps in the implementation of the sustainable developmental framework with the appropriate conservation strategies through the involvement of local stakeholders.
Salient Ecological Sensitive Regions of Central Western Ghats, India
NASA Astrophysics Data System (ADS)
Ramachandra, T. V.; Bharath, Setturu; Subash Chandran, M. D.; Joshi, N. V.
2018-02-01
Ecologically sensitive regions (ESRs) are the `ecological units' with the exceptional biotic and abiotic elements. Identification of ESRs considering spatially both ecological and social dimensions of environmental variables helps in ecological and conservation planning as per Biodiversity Act, 2002, Government of India. The current research attempts to integrate ecological and environmental considerations into administration, and prioritizes regions at Panchayat levels (local administrative unit) in Uttara Kannada district, Central Western Ghats, Karnataka state considering attributes (biological, Geo-climatic, Social, etc.) as ESR (1-4) through weightage score metrics. The region has the distinction of having highest forest area (80.48%) in Karnataka State, India and has been undergoing severe anthropogenic pressures impacting biogeochemistry, hydrology, food security, climate and socio-economic systems. Prioritisation of ESRs helps in the implementation of the sustainable developmental framework with the appropriate conservation strategies through the involvement of local stakeholders.
Nair, Sreejith S.; Raghunath, Pooja; Nair, Sreekanth S.
2015-01-01
Background: Increasing life expectancy around the world, an outstanding achievement of our century, has brought with it new public health challenges. India is the second most populous country in the world, with over 72 million inhabitants above 60 years of age as of 2001. The life expectancy in India increased from 32 years in 1947 to over 66 years in 2010, with 8.0% of the population now reaching over 60 years of age. Few studies in India target the health, especially mental health, of this geriatric population. This study aims to estimate the current prevalence of psychiatric disorders in the geriatric population of the rural area of Singanodi,Karnataka, India. Methods: This cross sectional, epidemiological, community-based study was conducted in a rural health training area of Singanodi, Raichur District, Karnataka, India.The General Health Questionnaire-12, Mini Mental State Examination, and Geriatric Depression Scale were administered to 366 participants. Chi square tests with Yates correction were utilized for statistical analysis using SPSS 19.0 software. Results: We found that 33.9% of the geriatric population in the selected province were above the threshold for mental illness based on the GHQ-12 questionnaire. Females had a higher prevalence of mental disorder at 77.6% (152 out of 196) as compared to males who had a prevalence of 42.4% (72 out of 170). The most common psychiatric disorder was depression (21.9%), and generalized anxiety was present in 10.7% of the study population. Prevalence of cognitive impairment was 16.3%, with a significantly higher percentage of affected individuals in 80+ age group. Conclusion: Mental disorders are common among elderly people, but they are not well documented in rural India. The assessment of psychiatric disorder prevalence will help strengthen psycho-geriatric services and thus improve the quality of life of the elderly. A system that ensures comprehensive health care will have to be developed for this purpose as part of our future efforts. PMID:29138712
Nair, Sreejith S; Raghunath, Pooja; Nair, Sreekanth S
2015-01-01
Increasing life expectancy around the world, an outstanding achievement of our century, has brought with it new public health challenges. India is the second most populous country in the world, with over 72 million inhabitants above 60 years of age as of 2001. The life expectancy in India increased from 32 years in 1947 to over 66 years in 2010, with 8.0% of the population now reaching over 60 years of age. Few studies in India target the health, especially mental health, of this geriatric population. This study aims to estimate the current prevalence of psychiatric disorders in the geriatric population of the rural area of Singanodi,Karnataka, India. This cross sectional, epidemiological, community-based study was conducted in a rural health training area of Singanodi, Raichur District, Karnataka, India.The General Health Questionnaire-12, Mini Mental State Examination, and Geriatric Depression Scale were administered to 366 participants. Chi square tests with Yates correction were utilized for statistical analysis using SPSS 19.0 software. We found that 33.9% of the geriatric population in the selected province were above the threshold for mental illness based on the GHQ-12 questionnaire. Females had a higher prevalence of mental disorder at 77.6% (152 out of 196) as compared to males who had a prevalence of 42.4% (72 out of 170). The most common psychiatric disorder was depression (21.9%), and generalized anxiety was present in 10.7% of the study population. Prevalence of cognitive impairment was 16.3%, with a significantly higher percentage of affected individuals in 80+ age group. Mental disorders are common among elderly people, but they are not well documented in rural India. The assessment of psychiatric disorder prevalence will help strengthen psycho-geriatric services and thus improve the quality of life of the elderly. A system that ensures comprehensive health care will have to be developed for this purpose as part of our future efforts.
The Resin and Carder bees of south India (Hymenoptera: Megachilidae: Anthidiini)
USDA-ARS?s Scientific Manuscript database
Little is known about the Anthidiini of southern India. A study focused on the state of Karnataka found a hitherto unknown diversity of thirteen species. Though the number of species is not large, the generic diversity is noteworthy (eight genera represented): Anthidiellum (2 species), Anthidium (2 ...
Sriram, Veena M; Gururaj, Gopalkrishna; Hyder, Adnan A
2017-12-01
Emergency medical services are important to the functioning of health systems, but these services tend to be neglected in low- and middle-income countries, such as India. In recent years, several models of pre-hospital emergency medical services have emerged in India. Research on these models holds important lessons for existing and future emergency medical service programs in low- and middle-income countries. Our objective was to provide a comprehensive description of the organizational structure and service delivery model of a public-private partnership in the southern Indian state of Karnataka, GVK Emergency Management and Research Institute, with a particular focus on its operations in Bengaluru. A case study methodology was used to explore systematically the organizational model of GVK Emergency Management and Research Institute in Karnataka. Qualitative data were collected through an in-person site visit to GVK Emergency Management and Research Institute headquarters in Bengaluru in July 2013. Three sources were used: in-depth, semistructured interviews, document review, and nonparticipant observation. Data were analyzed according to the health system "building blocks" proposed by the World Health Organization. The organization follows a standardized model across the states and union territories where they have contractual arrangements, including Karnataka. Processes for fleet maintenance, information systems/information technology and training, and deployment were well structured at the organizational level. The public-private partnership appears pro-poor in orientation; however, further demand-side research is required on the perspective of patients. Our study reveals a functional structure at the organizational level, which provides a key service at no cost to users. Detailed analyses of this nature can help inform global efforts for the development and strengthening of emergency medical services systems. Copyright © 2017 Elsevier Inc. All rights reserved.
Lee, Jinkook; Shih, Regina; Feeney, Kevin; Langa, Kenneth M
2014-07-01
To examine gender disparities in cognitive functioning in India and the extent to which education explains this disparity in later life. This study uses baseline interviews of a prospective cohort study of 1,451 community-residing adults 45 years of age or older in four geographically diverse states of India (Karnataka, Kerala, Punjab, Rajasthan). Data collected during home visits includes cognitive performance tests, and rich sociodemographic, health, and psychosocial variables. The cognitive performance tests include episodic memory, numeracy, and a modified version of the Mini-Mental State Examination. We find gender disparity in cognitive function in India, and this disparity is greater in the north than the south. We also find that gender disparities in educational attainment, health, and social and economic activity explain the female cognitive disadvantage in later life. We report significant gender disparities in cognitive functioning among older Indian adults, which differ from gender disparities in cognition encountered in developed countries. Our models controlling for education, health status, and social and economic activity explain the disparity in southern India but not the region-specific disparity in the northern India. North Indian women may face additional sources of stress associated with discrimination against women that contribute to persistent disadvantages in cognitive functioning at older ages. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Prakash, Ravi; Beattie, Tara; Javalkar, Prakash; Bhattacharjee, Parinita; Ramanaik, Satyanarayana; Thalinja, Raghavendra; Murthy, Srikanta; Davey, Calum; Blanchard, James; Watts, Charlotte; Collumbien, Martine; Moses, Stephen; Heise, Lori; Isac, Shajy
2017-12-01
Secondary education among lower caste adolescent girls living in rural Karnataka, South India, is characterized by high rates of school drop-out and absenteeism. A cross-sectional baseline survey (N=2275) was conducted in 2014 as part of a cluster-randomized control trial among adolescent girls (13-14 year) and their families from marginalized communities in two districts of north Karnataka. Bivariate and multivariate logistic regression models were used. Overall, 8.7% girls reported secondary school dropout and 8.1% reported frequent absenteeism (past month). In adjusted analyses, economic factors (household poverty; girls' work-related migration), social norms and practices (child marriage; value of girls' education), and school-related factors (poor learning environment and bullying/harassment at school) were associated with an increased odds of school dropout and absenteeism. Interventions aiming to increase secondary school retention among marginalized girls may require a multi-level approach, with synergistic components that address social, structural and economic determinants of school absenteeism and dropout. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Health seeking behavior in karnataka: does micro-health insurance matter?
Savitha, S; Kiran, Kb
2013-10-01
Health seeking behaviour in the event of illness is influenced by the availability of good health care facilities and health care financing mechanisms. Micro health insurance not only promotes formal health care utilization at private providers but also reduces the cost of care by providing the insurance coverage. This paper explores the impact of Sampoorna Suraksha Programme, a micro health insurance scheme on the health seeking behaviour of households during illness in Karnataka, India. The study was conducted in three randomly selected districts in Karnataka, India in the first half of the year 2011. The hypothesis was tested using binary logistic regression analysis on the data collected from randomly selected 1146 households consisting of 4961 individuals. Insured individuals were seeking care at private hospitals than public hospitals due to the reduction in financial barrier. Moreover, equity in health seeking behaviour among insured individuals was observed. Our finding does represent a desirable result for health policy makers and micro finance institutions to advocate for the inclusion of health insurance in their portfolio, at least from the HSB perspective.
Jayanna, Krishnamurthy; Mony, Prem; B M, Ramesh; Thomas, Annamma; Gaikwad, Ajay; H L, Mohan; Blanchard, James F; Moses, Stephen; Avery, Lisa
2014-09-04
The maternal mortality ratio in India has been declining over the past decade, but remains unacceptably high at 212 per 100,000 live births. Postpartum haemorrhage (PPH) and pre- eclampsia/eclampsia contribute to 40% of all maternal deaths. We assessed facility readiness and provider preparedness to deal with these two maternal complications in public and private health facilities of northern Karnataka state, south India. We undertook a cross-sectional study of 131 primary health centres (PHCs) and 148 higher referral facilities (74 public and 74 private) in eight districts of the region. Facility infrastructure and providers' knowledge related to screening and management of complications were assessed using facility checklists and test cases, respectively. We also attempted an audit of case sheets to assess provider practice in the management of complications. Chi square tests were used for comparing proportions. 84.5% and 62.9% of all facilities had atleast one doctor and three nurses, respectively; only 13% of higher facilities had specialists. Magnesium sulphate, the drug of choice to control convulsions in eclampsia was available in 18% of PHCs, 48% of higher public facilities and 70% of private facilities. In response to the test case on eclampsia, 54.1% and 65.1% of providers would administer anti-hypertensives and magnesium sulphate, respectively; 24% would administer oxygen and only 18% would monitor for magnesium sulphate toxicity. For the test case on PPH, only 37.7% of the providers would assess for uterine tone, and 40% correctly defined early PPH. Specialists were better informed than the other cadres, and the differences were statistically significant. We experienced generally poor response rates for audits due to non-availability and non-maintenance of case sheets. Addressing gaps in facility readiness and provider competencies for emergency obstetric care, alongside improving coverage of institutional deliveries, is critical to improve maternal outcomes. It is necessary to strengthen providers' clinical and problem solving skills through capacity building initiatives beyond pre-service training, such as through onsite mentoring and supportive supervision programs. This should be backed by a health systems response to streamline staffing and supply chains in order to improve the quality of emergency obstetric care.
Educational Services for Tibetan Students with Disabilities Living in India: A Case Study
ERIC Educational Resources Information Center
Barnes, Britany; Gibb, Gordon S.; Ashbaker, Betty Y.; Prater, Mary Anne
2014-01-01
This case study describes services for students with disabilities at Karuna Home in Bylakuppe, Karnataka, India, a residential facility established to address the needs of individuals whose parents are primarily Tibetan immigrants. Interview, observation, and document review data collected over three months were used to describe and explain…
Children as Catalysts of Change: Children's Participation in Rural Development in India.
ERIC Educational Resources Information Center
Wesley, Caroline
1995-01-01
Presents information on the participation of children in effecting change in their lives and their communities in The Concerned for Working Children rural project in Karnataka, India. Discusses the concept of a children's trade union and the nature of community participation in empowering children to lead self-reliant lives. (AIM)
A new rust disease on wild coffee (Psychotria nervosa) caused by Puccinia mysuruensis sp. nov
USDA-ARS?s Scientific Manuscript database
Psychotria nervosa, commonly called wild coffee (Rubiaceae) is an important ethno-medicinal plant in India. In 2010 a new rust disease of P. nervosa was observed in three regions of Mysore District, Karnataka (India) with disease incidence ranging from 58% to 63%. Typical symptoms of rust disease we...
Sexual Harassment and Abuse of Adolescent Schoolgirls in South India
ERIC Educational Resources Information Center
Leach, Fiona; Sitaram, Shashikala
2007-01-01
This article reports on a small exploratory study of adolescent girls' experiences of sexual harassment and abuse while attending secondary school in Karnataka State, South India. In South Asia, public discussion of sexual matters, especially relating to children, is largely taboo, and the study uncovers a hidden aspect of schooling, which…
The pattern of childhood blindness in Karnataka, South India.
Gogate, Parikshit; Kishore, H; Dole, Kuldeep; Shetty, Jyoti; Gilbert, Clare; Ranade, Satish; Kumar, Mohan; Srihari; Deshpande, Madan
2009-01-01
To determine the causes of severe visual impairment and blindness in children in schools for the blind in southern Karnataka state of India. Children aged less than 16 years with a visual acuity of < 6/60 in the better eye, attending the residential schools for the blind were examined in 2005-2006, in the Karnataka state in the south of India. History taking, visual acuity estimation, external ocular examination, retinoscopy, and fundoscopy were done on all students. Refraction and low vision work-up done where indicated. The anatomical and etiological causes of severe visual impairment (< 6/60-3/60) and blindness (< 3/60 in the better eye) were classified using the World Health Organization's prevention of blindness programs' record system. A total of 1,179 students were examined, 891 of whom fulfilled the eligibility criteria. The major anatomical sites of visual loss were congenital anomalies (microphthalmos, anophthalmos) (321, 35.7%), corneal conditions (mainly scarring due to vitamin A deficiency, measles, trauma) (133, 14.9%), cataract or aphakia in 102 (11.4%), and retinal disorders (mainly dystrophies) in 177 children (19.9%). Nearly one-fourth of children were blind from conditions which could have been prevented or treated (27.8%), 87 of whom were referred for surgery. Low vision devices improved near acuity in 27 children (3%), and 43 (4.8%) benefited from refraction. Congenital anomalies, cataract, and retinal conditions account for most of the blindness in children.
Resurgence of diphtheria in rural areas of North Karnataka, India.
Parande, Mahantesh V; Roy, Subarna; Mantur, B G; Parande, Aisha M; Shinde, Rupali S
2017-01-01
A diphtheria outbreak was identified from Vijayapura (formerly Bijapur) district in the South Indian state of Karnataka in 2011. There was a surge in the number of throat swab samples received under the Integrated Disease Surveillance Programme (IDSP) in North Karnataka since then. A microbiological study was undertaken to generate information on the status of resurgence of the disease in the region. Throat swabs from 432 suspected cases of diphtheria during 2012-2015 were obtained from government hospitals and primary health centres of 8 districts in North Karnataka and were processed for the culture and identification of Corynebacterium diphtheriae. Polymerase chain reaction for the presence of toxin gene (toxA and toxB) was carried out on the isolates. Antibiotic sensitivity tests were performed on the isolates with a panel of 14 antibiotics. Thirty-eight (8.79%) out of 432 samples yielded C. diphtheriae on culture. All isolates possessed the diphtheria toxin gene. Out of the 38 confirmed cases, whereas 21 (55.26%) were between 1 and 5 years of age, 14 (36.84%) were aged between 5 and 10 years. Male children were three times more than females in confirmed cases. No information was available on the immunisation status of the cases. Emergence of resistance to penicillin was found with minimum inhibitory concentration reaching up to 6.00 μg/ml. Our study identified an upsurge in cases of diphtheria in North Karnataka, particularly in Vijayapura District, and to the best of our knowledge, reports the emergence of penicillin resistance for the first time in India. The study calls for enhanced surveillance for the disease, making antidiphtheritic serum available in key hospitals in the region and serves to provide a baseline for future assessment of the impact of the recently launched 'Mission Indradhanush' programme in strengthening Universal Immunisation Programme (UIP).
Chitrachanchala (pictures of unstable mind): mental health themes in Kannada cinema.
Prasad, Chillal Guru; Babu, Girish N; Chandra, Prabha S; Chaturvedi, Santosh K
2009-06-01
Regional movies in India play an important role in portraying mental illness and also depict awareness and attitudes of society towards people with mental health problems. Kannada (the language spoken by 50 million people from the state of Karnataka in South India) cinema has produced a range of movies depicting conditions ranging from psychosis to personality disorders. However, the descriptions of mental illness in several of these movies is vague and often stigmatizing. Some landmark films have involved psychiatrists in producing and directing the movies, including helping with the story line, which have added value to these films. Despite Karnataka being home to some of the important psychiatrists in the country and to some of the most famous and advanced mental health training and treatment centres, depictions of treatment and the portrayal of psychiatrists continues to be caricatured. As is true of many parts of India, treatment methods are often magico-religious, which is what Kannada cinema also reflects.
The role of collectives in STI and HIV/AIDS prevention among female sex workers in Karnataka, India.
Halli, S S; Ramesh, B M; O'Neil, J; Moses, S; Blanchard, J F
2006-10-01
This paper evaluates the role of female sex worker (FSW) collectives in the state of Karnataka, India, regarding their facilitating effect in increasing knowledge and promoting change towards safer sexual behaviour. In 2002 a state-wide survey of FSWs was administered to a stratified sample of 1,512 women. Following the survey, a collectivization index was developed to measure the degree of involvement of FSWs in collective-related activities. The results indicate that a higher degree of collectivization was associated with increased knowledge and higher reported condom use. Reported condom use was higher with commercial clients than with regular partners or husbands among all women and a gradient was observed in most outcome variables between women with low, medium and high collectivization index scores. Collectivization seems to have a positive impact in increasing knowledge and in empowering FSWs in Karnataka to adopt safer sex practices, particularly with commercial clients. While these results are encouraging, they may be confounded by social desirability, selection and other biases. More longitudinal and qualitative studies are required to better understand the nature of sex worker collectives and the benefits that they can provide.
ERIC Educational Resources Information Center
Narayana, M. R.
2006-01-01
This article focuses on economic analysis of privatisation policies and postprivatisation control devices in India's higher education. As a case study, the experiences of Karnataka State in collegiate education under general higher education are emphasised. A change in public financing, rather than a shift of public ownership and management to…
Mumps disease outbreak in Davangere district of Karnataka, India.
Raut, C G; Sinha, D P; Jayaprakash, H; Hanumiah, H; Manjunatha, M J
2015-01-01
Mumps is a vaccine-preventable disease that usually occurs as a parotitis, but it can also lead to several life- threatening complications, including pancreatitis, meningitis and encephalitis. To determine and diagnosis of mumps disease, which is communicable disease usually affects childrens. Although it is seen worldwide, but outbreaks not common in India. Thirty one suspected mumps cases, who presented to the unimmunized population of Chikkahallivana village in Davangere district of Karnataka, India in January 2014, with clinical evidence of fever, cervical lymphadenitis and ear pain, manifest with self-limited uni-or bilateral parotitis. A total of 31 cases consisting of 31 blood and 31 throat swabs were tested for diagnosis of mumps disease. Of the 31 suspected cases, laboratory results showed 18 positive for mumps IgM antibodies and 7 cases showed presence of mumps virus RNA by RT-PCR using MV specific nested primers. From 31 cases, 5 were positive with both the methods. We confirmed the cases by serological as well as a sensitive RT-nested PCR-based method and sequencing results for the molecular identification of mumps infection. Sequencing results of the SH gene identified outbreak strain as genotype C, which was consistent with other outbreaks in India.
Bhat, Prashant G.; Kumar, Ajay M. V.; Naik, Balaji; Satyanarayana, Srinath; KG, Deepak; Nair, Sreenivas A.; MD, Suryakanth; Heldal, Einar; Enarson, Donald A.; Reid, Anthony J.
2013-01-01
Background Severe acute malnutrition (SAM) is the most serious form of malnutrition affecting children under-five and is associated with many infectious diseases including Tuberculosis (TB). In India, nutritional rehabilitation centres (NRCs) have been recently established for the management of SAM including TB. The National TB Programme (NTP) in India has introduced a revised algorithm for diagnosing paediatric TB. We aimed to examine whether NRCs adhered to these guidelines in diagnosing TB among SAM children. Methods A cross-sectional study involving review of records of all SAM children identified by health workers during 2012 in six tehsils (sub-districts) with NRCs (population: 1.8 million) of Karnataka, India. Results Of 1927 identified SAM children, 1632 (85%) reached NRCs. Of them, 1173 (72%) were evaluated for TB and 19(2%) were diagnosed as TB. Of 1173, diagnostic algorithm was followed in 460 (37%). Among remaining 763 not evaluated as per algorithm, tuberculin skin test alone was conducted in 307 (41%), chest radiography alone in 99 (13%) and no investigations in 337 (45%). The yield of TB was higher among children evaluated as per algorithm (4%) as compared to those who were not (0.3%) (OR: 15.3 [95%CI: 3.5-66.3]). Several operational challenges including non-availability of a full-time paediatrician, non-functioning X-ray machine due to frequent power cuts, use of tuberculin with suboptimal strength and difficulties in adhering to a complex diagnostic algorithm were observed. Conclusion This study showed that TB screening in NRCs was sub-optimal in Karnataka. Some children did not reach the NRC, while many of those who did were either not or sub-optimally evaluated for TB. This study pointed to a number of operational issues that need to be addressed if this collaborative strategy is to identify more TB cases amongst malnourished children in India. PMID:24358350
Dual Infection with Bluetongue Virus Serotypes and First-Time Isolation of Serotype 5 in India.
Hemadri, D; Maan, S; Chanda, M M; Rao, P P; Putty, K; Krishnajyothi, Y; Reddy, G H; Kumar, V; Batra, K; Reddy, Y V; Maan, N S; Reddy, Y N; Singh, K P; Shivachandra, S B; Hegde, N R; Rahman, H; Mertens, P P C
2017-12-01
Bluetongue is endemic in India and has been reported from most Indian states. Of late, the clinical disease is most frequently seen in the states of Andhra Pradesh, Telangana (erstwhile Andhra Pradesh state), Tamil Nadu and Karnataka. Our analysis of diagnostic samples from bluetongue outbreaks during 2010-2011 from the state of Karnataka identified bluetongue virus (BTV) serotype 5 (BTV-5) for the first time in India. One of the diagnostic samples (CH1) and subsequent virus isolate (IND2010/02) contained both BTV-2 and BTV-5. Segment 2 (seg-2) sequence data (400 bp: nucleotides 2538-2921) for IND2010/02-BTV5, showed 94.3% nucleotide identity to BTV-5 from South Africa (Accession no. AJ585126), confirming the virus serotype and also indicating that Seg-2 was derived from a Western topotype, which is in contrast to serotype 2, that belongs to an Eastern topotype. BTV-5 has been recently reported from Africa, China, French islands and the Americas. Although the exact source of the Indian BTV-5 isolate is still to be confirmed, recent identification of additional exotic serotypes in India is of real concern and might add to the severity of the disease seen in these outbreaks. © 2016 Blackwell Verlag GmbH.
Sood, Neeraj; Wagner, Zachary
2016-01-06
To evaluate the effects of a government insurance programme covering tertiary care for the poor in Karnataka, India--Vajpayee Arogyashree Scheme (VAS)--on treatment seeking and postoperative outcomes. Geographic regression discontinuity. 572 villages in Karnataka, India. 3478 households in 300 villages where VAS was implemented and 3486 households in 272 neighbouring matched villages ineligible for VAS. A government insurance programme that provided free tertiary care to households below the poverty line in half of villages in Karnataka from February 2010 to August 2012. Seeking treatment for symptoms, posthospitalisation well-being, occurrence of infections during hospitalisation and need for rehospitalisation. The prevalence of symptoms was nearly identical for households in VAS-eligible villages compared with households in VAS-ineligible villages. However, households eligible for VAS were 4.96 percentage points (95% CI 1 to 8.9; p=0.014) more likely to seek treatment for their symptoms. The increase in treatment seeking was more pronounced for symptoms of cardiac conditions, the condition most frequently covered by VAS. Respondents from VAS-eligible villages reported greater improvements in well-being after a hospitalisation in all categories assessed and they were statistically significant in 3 of the 6 categories (walking ability, pain and anxiety). Respondents eligible for VAS were 9.4 percentage points less likely to report any infection after their hospitalisation (95% CI -20.2 to 1.4; p=0.087) and 16.5 percentage points less likely to have to be rehospitalised after the initial hospitalisation (95% CI -28.7 to -4.3; p<0.01). Insurance for tertiary care increased treatment seeking among eligible households. Moreover, insured patients experienced better posthospitalisation outcomes, suggesting better quality of care received. These results suggest that there are several pathways through which tertiary care insurance could improve health, aside from increasing utilisation of the services that the programme directly subsidises. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Mohan, Harnalli L.; Bhattacharjee, Parinita; Chandrashekar, Sudha; Isac, Shajy; Wheeler, Tisha; Prakash, Ravi; Ramesh, Banadakoppa M.; Blanchard, James F.; Heise, Lori; Vickerman, Peter; Moses, Stephen; Watts, Charlotte
2014-01-01
Objectives. We examined the impact of community mobilization (CM) on the empowerment, risk behaviors, and prevalence of HIV and sexually transmitted infection in female sex workers (FSWs) in Karnataka, India. Methods. We conducted behavioral–biological surveys in 2008 and 2011 in 4 districts of Karnataka, India. We defined exposure to CM as low, medium (attended nongovernmental organization meeting or drop-in centre), or high (member of collective or peer group). We used regression analyses to explore whether exposure to CM was associated with the preceding outcomes. Pathway analyses explored the degree to which effects could be attributable to CM. Results. By the final survey, FSWs with high CM exposure were more likely to have been tested for HIV (adjusted odd ratio [AOR] = 25.13; 95% confidence interval [CI] = 13.07, 48.34) and to have used a condom at last sex with occasional clients (AOR = 4.74; 95% CI = 2.17, 10.37), repeat clients (AOR = 4.29; 95% CI = 2.24, 8.20), and regular partners (AOR = 2.80; 95% CI = 1.43, 5.45) than FSWs with low CM exposure. They were also less likely to be infected with gonorrhea or chlamydia (AOR = 0.53; 95% CI = 0.31, 0.87). Pathway analyses suggested CM acted above and beyond peer education; reduction in gonorrhea or chlamydia was attributable to CM. Conclusions. CM is a central part of HIV prevention programming among FSWs, empowering them to better negotiate condom use and access services, as well as address other concerns in their lives. PMID:24922143
Beattie, Tara S H; Mohan, Harnalli L; Bhattacharjee, Parinita; Chandrashekar, Sudha; Isac, Shajy; Wheeler, Tisha; Prakash, Ravi; Ramesh, Banadakoppa M; Blanchard, James F; Heise, Lori; Vickerman, Peter; Moses, Stephen; Watts, Charlotte
2014-08-01
We examined the impact of community mobilization (CM) on the empowerment, risk behaviors, and prevalence of HIV and sexually transmitted infection in female sex workers (FSWs) in Karnataka, India. We conducted behavioral-biological surveys in 2008 and 2011 in 4 districts of Karnataka, India. We defined exposure to CM as low, medium (attended nongovernmental organization meeting or drop-in centre), or high (member of collective or peer group). We used regression analyses to explore whether exposure to CM was associated with the preceding outcomes. Pathway analyses explored the degree to which effects could be attributable to CM. By the final survey, FSWs with high CM exposure were more likely to have been tested for HIV (adjusted odd ratio [AOR] = 25.13; 95% confidence interval [CI] = 13.07, 48.34) and to have used a condom at last sex with occasional clients (AOR = 4.74; 95% CI = 2.17, 10.37), repeat clients (AOR = 4.29; 95% CI = 2.24, 8.20), and regular partners (AOR = 2.80; 95% CI = 1.43, 5.45) than FSWs with low CM exposure. They were also less likely to be infected with gonorrhea or chlamydia (AOR = 0.53; 95% CI = 0.31, 0.87). Pathway analyses suggested CM acted above and beyond peer education; reduction in gonorrhea or chlamydia was attributable to CM. CM is a central part of HIV prevention programming among FSWs, empowering them to better negotiate condom use and access services, as well as address other concerns in their lives.
Chakraborti, Dipankar; Rahman, Mohammad Mahmudur; Murrill, Matthew; Das, Reshmi; Siddayya; Patil, S.G.; Sarkar, Atanu; Dadapeer, H.J.; Yendigeri, Saeed; Ahmed, Rishad; Das, Kusal K.
2014-01-01
This report summarizes recent findings of environmental arsenic (As) contamination and the consequent health effects in a community located near historic gold mining activities in the Mangalur greenstone belt of Karnataka, India. Arsenic contents in water, hair, nail, soil and food were measured by FI-HG-AAS. Elemental analyses of soils were determined by ICP-MS (inductively coupled plasma-mass spectrometry). Of 59 tube-well water samples, 79% had As above 10 μg L−1 (maximum 303 μg L−1). Of 12 topsoil samples, six were found to contain As greater than 2000 mg kg−1 possibly indicating the impact of mine tailings on the area. All hair and nail samples collected from 171 residents contained elevated As. Arsenical skin lesions were observed among 58.6% of a total 181 screened individuals. Histopathological analysis of puncture biopsies of suspected arsenical dermatological symptoms confirmed the diagnosis in 3 out of 4 patients. Based on the time-course of arsenic-like symptoms reported by the community as well as the presence of overt arsenicosis, it is hypothesized that the primary route of exposure in the study area was via contaminated groundwater; however, the identified high As content in residential soil could also be a significant source of As exposure via ingestion. Additional studies are required to determine the extent as well as the relative contribution of geologic and anthropogenic factors in environmental As contamination in the region. This study report is to our knowledge one of the first to describe overt arsenicosis in this region of Karnataka, India as well as more broadly an area with underlying greenstone geology and historic mining activity. PMID:23228450
Skariyachan, Sinosh; Garka, Shruthi; Puttaswamy, Sushmitha; Shanbhogue, Shobitha; Devaraju, Raksha; Narayanappa, Rajeswari
2017-06-01
Assessment of the therapeutic potential of secondary metabolite producing microorganisms from the marine coastal areas imparts scope and application in the field of environmental monitoring. The present study aims to screen metabolites with antibacterial potential from actionbacteria associated with marine sediments collected from south coastal regions of Karnataka, India. The actinobacteria were isolated and characterized from marine sediments by standard protocol. The metabolites were extracted, and antibacterial potential was analyzed against eight hospital associated bacteria. The selected metabolites were partially characterized by proximate analysis, SDS-PAGE, and FTIR-spectroscopy. The antibiogram of the test clinical isolates revealed that they were emerged as multidrug-resistant strains (P ≤ 0.05). Among six actinobacteria (IS1-1S6) screened, 100 μl -1 metabolite from IS1 showed significant antibacterial activities against all the clinical isolates except Pseudomonas aeruginosa. IS2 demonstrated antimicrobial potential towards Proteus mirabilis, Streptococcus pyogenes, and Escherichia coli. The metabolite from IS3 showed activity against Strep. pyogenes and E. coli. The metabolites from IS4, IS5, and IS6 exhibited antimicrobial activities against Ps. aeruginosa (P ≤ 0.05). The two metabolites that depicted highest antibacterial activities against the test strains were suggested to be antimicrobial peptides with low molecular weight. These isolates were characterized and designated as Streptomyces sp. strain mangaluru01 and Streptomyces sp. mangaloreK01 by 16S ribosomal DNA (rDNA) sequencing. This study suggests that south coastal regions of Karnataka, India, are one of the richest sources of antibacterial metabolites producing actinobacteria and monitoring of these regions for therapeutic intervention plays profound role in healthcare management.
Maternal and congenital syphilis in Karnataka, India.
Archana, B R; Prasad, S R; Beena, P M; Okade, R; Sheela, S R; Beeregowda, Y C
2014-03-01
Screening women for syphilis during pregnancy and providing proper treatment are the cornerstones of congenital syphilis prevention. During 2008-2011, 6,221 pregnant women were screened for syphilis using the Rapid Plasma Reagin (RPR) and Treponema Pallidum Hemagglutination (TPHA) tests at R.L. Jalappa Hospital, Kolar, Karnataka, India. The seroprevalence of syphilis during pregnancy ranged from 0.57% to 0.78% during the study. Of the 35 women with a positive test, 26 (74.28%) were detected at the time of labor and 9 (25.71%) were detected during antenatal care. None of the women detected at the time of labor received penicillin therapy for syphilis. Adverse fetal outcomes due to untreated syphilis during pregnancy were seen in many of the cases. During the study 26 infants (3.69/1,000) were diagnosed with congenital syphilis. Our findings show detection and treatment of syphilis during pregnancy needs to be strengthened in the study area to reduce the incidence of congenital syphilis.
NASA Astrophysics Data System (ADS)
Dhorde, Amit G.; Korade, Mahendra S.; Dhorde, Anargha A.
2017-10-01
Earth surface temperatures are changing worldwide together with the changes in the extreme temperatures. The present study investigates trends and variations of monthly maximum and minimum temperatures and their effects on seasonal fluctuations at different climatological stations of Maharashtra and Karnataka states of India. Trend analysis was performed on annual and seasonal mean maximum temperature (TMAX) and mean minimum temperature (TMIN) for the period 1969 to 2006. During the last 38 years, an increase in annual TMAX and TMIN has occurred. At most of the locations, the increase in TMAX was faster than the TMIN, resulting in an increase in diurnal temperature range. At the same time, annual mean temperature (TM) showed a significant increase over the study area. Percentiles were used to identify extreme temperature indices. An increase in occurrence of warm extremes was observed at southern locations, and cold extremes increased over the central and northeastern part of the study area. Occurrences of cold wave conditions have decreased rapidly compared to heat wave conditions.
Blanchard, Andrea Katryn; Sangha, Chaitanya AIDS Tadegattuva Mahila; Nair, Sapna G.; Thalinja, Raghavendra; Srikantamurthy, H.S.; Ramanaik, Satyanaryana; Javalkar, Prakash; Pillai, Priya; Isac, Shajy; Collumbien, Martine; Heise, Lori; Bhattacharjee, Parinita; Bruce, Sharon Gail
2016-01-01
Community-based participatory research has been seen to hold great promise by researchers aiming to bridge research and action in global health programs and practice. However, there is still much debate around whether achieving authenticity in terms of in-depth collaboration between community and academic partners is possible while pursuing academic expectations for quality. This article describes the community-based methodology for a qualitative study to explore intimate partner violence and HIV/AIDS among women in sex work, or female sex workers, and their male partners in Karnataka, South India. Developed through collaborative processes, the study methodology followed an interpretive approach to qualitative inquiry, with three key components including long-term partnerships, knowledge exchange, and orientation toward action. We then discuss lessons learned on how to pursue authenticity in terms of truly collaborative processes with inherent value that also contribute to, rather than hinder, the instrumental goal of enhancing the quality and relevance of the research outcomes. PMID:27378133
"Heart Shots": A Classroom Activity to Instigate Active Learning
ERIC Educational Resources Information Center
Abraham, Reem Rachel; Vashe, Asha; Torke, Sharmila
2015-01-01
The present study aimed to provide undergraduate medical students at Melaka Manipal Medical College (Manipal Campus), Manipal University, in Karnataka, India, an opportunity to apply their knowledge in cardiovascular concepts to real-life situations. A group activity named "Heart Shots" was implemented for a batch of first-year…
NASA Technical Reports Server (NTRS)
Condie, K. C.; Allen, P.
1983-01-01
In southern India, it is possible to study the transition from an Archean granite-greenstone terrain (the Karnataka province) into high grade charnockites. The transition occurs over an outcrop width of 20-35 km and appears to represent burial depths ranging from 15 to 20 km. Field and geochemical studies indicate that the charnockites developed at the expense of tonalites, granites, and greenstones. South of the transition zone, geobarometer studies indicate burial depths of 7-9 kb.
Ugran, Vidyavati; Desai, Naveen N; Chakraborti, Dipankar; Masali, Kallappa A; Mantur, Prakash; Kulkarni, Shreepad; Deshmukh, Niranjan; Chadchan, Kailash S; Das, Swastika N; Tanksali, Anuradha S; Arwikar, Asha S; Guggarigoudar, Suresh P; Vallabha, Tejaswini; Patil, Shailaja S; Das, Kusal K
2017-10-01
Groundwater fluoride concentration and fluoride-related health problems were studied in twenty-two villages of Indi taluk of Vijayapura district, Karnataka, India. Present study (2015) was also used to compare groundwater fluoride concentration in same 22 villages with previous government report (2000). Groundwater fluoride concentrations of 62 bore wells of 22 villages were analyzed by using an ion-sensitive electrode. A total of 660 adults and 600 children were screened for fluorosis symptoms and signs. Sixty clinically suspected fluorosis patients' urine samples were further analyzed for fluoride. The mean value (1.22 ± 0.75 mg/L) of fluoride concentration of 62 bore wells and 54.83 % bore wells with ≥1.0 mg/L of fluoride concentrations in Indi taluk indicates higher than the permissible limit of drinking water fluoride concentration recommended for India. Clinical symptoms like arthritis, joint pains, gastrointestinal discomfort and lower limb deformities with high urinary fluoride concentrations in some subjects suggest fluorosis. Results also showed an increase in groundwater fluoride concentration of the same 22 villages between previous and present study. Preliminary arthritis symptom of the villagers could be due to drinking fluoride-contaminated water. Increase in fluoride concentration with time to the bore wells definitely indicates future danger.
Knowledge and attitudes of dental interns in Karnataka state, India, regarding implants.
Chaudhary, Sohini; Gowda, Triveni M; Kumar, Tarun A B; Mehta, Dhoom S
2013-10-01
Implant treatment today is highly reliable as a valid restorative option for missing teeth. As more patients worldwide opt for implant treatment, it is now imperative for dental practitioners to have sound information about dental implants so they can help patients make informed decisions. This study sought to define the knowledge and attitudes regarding dental implants of dental interns in the state of Karnataka, India, and to evaluate the dental implant curriculum structure at the undergraduate level. A survey was conducted of dental interns (students in their fifth, clinical year of undergraduate study) in seven of the forty-five academic dental institutions in this state. The questionnaire consisted of fifteen questions that assessed the respondents' level of knowledge and source of information regarding implants. A total of 500 questionnaires were distributed, and 417 interns responded for a response rate of 83.4 percent. In the results, 73.3 percent reported they were not provided sufficient information about implants in their undergraduate curriculum, and 95.7 percent of them wanted more. Also, 63.5 percent of the respondents believed that high costs could limit the use of dental implants as a tooth replacement modality in India. This study concludes that revision in the undergraduate dental curricula at these schools is needed to better prepare students for practicing implant dentistry.
Sood, Neeraj; Bendavid, Eran; Mukherji, Arnab; Wagner, Zachary; Nagpal, Somil; Mullen, Patrick
2014-09-11
To evaluate the effects of a government insurance program covering tertiary care for people below the poverty line in Karnataka, India, on out-of-pocket expenditures, hospital use, and mortality. Geographic regression discontinuity study. 572 villages in Karnataka, India. 31,476 households (22,796 below poverty line and 8680 above poverty line) in 300 villages where the scheme was implemented and 28,633 households (21,767 below poverty line and 6866 above poverty line) in 272 neighboring matched villages ineligible for the scheme. A government insurance program (Vajpayee Arogyashree scheme) that provided free tertiary care to households below the poverty line in about half of villages in Karnataka from February 2010 to August 2012. Out-of-pocket expenditures, hospital use, and mortality. Among households below the poverty line, the mortality rate from conditions potentially responsive to services covered by the scheme (mostly cardiac conditions and cancer) was 0.32% in households eligible for the scheme compared with 0.90% among ineligible households just south of the eligibility border (difference of 0.58 percentage points, 95% confidence interval 0.40 to 0.75; P<0.001). We found no difference in mortality rates for households above the poverty line (households above the poverty line were not eligible for the scheme), with a mortality rate from conditions covered by the scheme of 0.56% in eligible villages compared with 0.55% in ineligible villages (difference of 0.01 percentage points, -0.03 to 0.03; P=0.95). Eligible households had significantly reduced out-of-pocket health expenditures for admissions to hospitals with tertiary care facilities likely to be covered by the scheme (64% reduction, 35% to 97%; P<0.001). There was no significant increase in use of covered services, although the point estimate of a 44.2% increase approached significance (-5.1% to 90.5%; P=0.059). Both reductions in out-of-pocket expenditures and potential increases in use might have contributed to the observed reductions in mortality. Insuring poor households for efficacious but costly and underused health services significantly improves population health in India. © Sood et al 2014.
Sood, Neeraj; Wagner, Zachary
2016-01-01
Objectives To evaluate the effects of a government insurance programme covering tertiary care for the poor in Karnataka, India—Vajpayee Arogyashree Scheme (VAS)—on treatment seeking and postoperative outcomes. Design Geographic regression discontinuity. Setting 572 villages in Karnataka, India. Participants 3478 households in 300 villages where VAS was implemented and 3486 households in 272 neighbouring matched villages ineligible for VAS. Intervention A government insurance programme that provided free tertiary care to households below the poverty line in half of villages in Karnataka from February 2010 to August 2012. Main outcome measure Seeking treatment for symptoms, posthospitalisation well-being, occurrence of infections during hospitalisation and need for rehospitalisation. Results The prevalence of symptoms was nearly identical for households in VAS-eligible villages compared with households in VAS-ineligible villages. However, households eligible for VAS were 4.96 percentage points (95% CI 1 to 8.9; p=0.014) more likely to seek treatment for their symptoms. The increase in treatment seeking was more pronounced for symptoms of cardiac conditions, the condition most frequently covered by VAS. Respondents from VAS-eligible villages reported greater improvements in well-being after a hospitalisation in all categories assessed and they were statistically significant in 3 of the 6 categories (walking ability, pain and anxiety). Respondents eligible for VAS were 9.4 percentage points less likely to report any infection after their hospitalisation (95% CI −20.2 to 1.4; p=0.087) and 16.5 percentage points less likely to have to be rehospitalised after the initial hospitalisation (95% CI −28.7 to −4.3; p<0.01). Conclusions Insurance for tertiary care increased treatment seeking among eligible households. Moreover, insured patients experienced better posthospitalisation outcomes, suggesting better quality of care received. These results suggest that there are several pathways through which tertiary care insurance could improve health, aside from increasing utilisation of the services that the programme directly subsidises. PMID:26739744
Exploring First-Year Undergraduate Medical Students' Self-Directed Learning Readiness to Physiology
ERIC Educational Resources Information Center
Abraham, Reem Rachel; Fisher, Murray; Kamath, Asha; Izzati, T. Aizan; Nabila, Saidatul; Atikah, Nik Nur
2011-01-01
Medical students are expected to possess self-directed learning skills to pursue lifelong learning. Previous studies have reported that the readiness for self-directed learning depends on personal attributes as well as the curriculum followed in institutions. Melaka Manipal Medical College of Manipal University (Karnataka, India) offers a Bachelor…
Blanchard, Andrea Katryn; Sangha, Chaitanya Aids Tadegattuva Mahila; Nair, Sapna G; Thalinja, Raghavendra; Srikantamurthy, H S; Ramanaik, Satyanaryana; Javalkar, Prakash; Pillai, Priya; Isac, Shajy; Collumbien, Martine; Heise, Lori; Bhattacharjee, Parinita; Bruce, Sharon Gail
2017-01-01
Community-based participatory research has been seen to hold great promise by researchers aiming to bridge research and action in global health programs and practice. However, there is still much debate around whether achieving authenticity in terms of in-depth collaboration between community and academic partners is possible while pursuing academic expectations for quality. This article describes the community-based methodology for a qualitative study to explore intimate partner violence and HIV/AIDS among women in sex work, or female sex workers, and their male partners in Karnataka, South India. Developed through collaborative processes, the study methodology followed an interpretive approach to qualitative inquiry, with three key components including long-term partnerships, knowledge exchange, and orientation toward action. We then discuss lessons learned on how to pursue authenticity in terms of truly collaborative processes with inherent value that also contribute to, rather than hinder, the instrumental goal of enhancing the quality and relevance of the research outcomes. © The Author(s) 2016.
M Badakar, Chandrashekhar; M Hugar, Shivayogi; Kukreja, Pratibha; G Assudani, Harsha; Gokhale, Niraj
2017-01-01
Aim To determine and compare the relevance of Piaget’s cognitive principles among 4- to 7-year-old parented and orphan children in Belagavi City, Karnataka, India. Materials and methods This study was conducted on 240 children between the ages of 4 to 7 years who were equally divided into two groups of 120 parented and 120 orphan children. These were subdivided into four groups of 30 children each. Various characteristics like egocentrism, concept of cardinal numbers based on centration, lack of conservation, and reversibility were assessed, using experiments and comparison of their prevalence between two groups was carried out. Results There is a statistically significant difference in the cognitive development among parented and orphan children age 4 to 7 years. Conclusion There is a significantly better cognitive development among parented children as compared with orphan children in Belagavi city. Clinical significance A child is not a miniature adult but rather can think and perceive the world differently from an adult. Understanding a child’s intellectual level can enable a pedodontist to deliver improved quality care to children. According to Jean Piaget, in the preoperational period, children think symbolically and their reasoning is based more on appearance rather than logic. It is often rightly said that a child’s behavior is a reflection of his parents. However, Piaget did not consider the effect of social setting and culture on the cognitive development. This study was carried out as there is not much literature available to describe the cognitive development of children in the Indian scenario and the influence of parental presence on the same. How to cite this article: Badakar CM, Thakkar PJ, Hugar SM, Kukreja P, Assudani HG, Gokhale N. Evaluation of the Relevance of Piaget’s Cognitive Principles among Parented and Orphan Children in Belagavi City, Karnataka, India: A Comparative Study. Int J Clin Pediatr Dent 2017;10(4):346-350. PMID:29403227
Vinekar, Anand; Jayadev, Chaitra; Kumar, Siddesh; Mangalesh, Shwetha; Dogra, Mangat Ram; Bauer, Noel J; Shetty, Bhujang
2016-01-01
To report the reduction in the incidence and severity of retinopathy of prematurity (ROP) in rural India over a 4-year period following the introduction of improved neonatal care practices. The Karnataka Internet Diagnosis of Retinopathy of Prematurity program (KIDROP), is a tele-medicine network that screens for ROP in different zones of Karnataka state in rural India. North Karnataka is the most underdeveloped and remote zone of this program and did not have any ROP screening programs before the intervention of the KIDROP in 2011. Six government and eleven private neonatal centers in this zone were screened weekly. Specific neonatal guidelines for ROP were developed and introduced in these centers. They included awareness about risk factors, oxygen regulation protocols, use of pulse oxymetry, monitoring postnatal weight gain, nutritional best practices, and management of sepsis. The incidence and severity of ROP were compared before the guidelines were introduced (Jan 2011 to Dec 2012) and after the guidelines were introduced (July 2013 to June 2015). During this 4-year period, 4,167 infants were screened over 11,390 imaging sessions. The number of enrolled infants increased from 1,825 to 2,342 between the two periods ( P <0.001). The overall incidence of any stage ROP reduced significantly from 26.8% to 22.4% ( P <0.001). The incidence of treatment-requiring ROP reduced from 20.7% to 16% ( P =0.06), and of the treated disease, aggressive posterior ROP reduced from 20.8% to 13.1% ( P =0.23) following introduction of the guidelines. Rural neonatal centers in middle-income countries have a large, unscreened burden of ROP. Improving neonatal care in these centers can positively impact the incidence and severity of ROP even in a relatively short period. A combined approach of a robust ROP screening program and improved neonatal care practices is required to address the challenge.
Vinekar, Anand; Jayadev, Chaitra; Kumar, Siddesh; Mangalesh, Shwetha; Dogra, Mangat Ram; Bauer, Noel J; Shetty, Bhujang
2016-01-01
Purpose To report the reduction in the incidence and severity of retinopathy of prematurity (ROP) in rural India over a 4-year period following the introduction of improved neonatal care practices. Methods The Karnataka Internet Diagnosis of Retinopathy of Prematurity program (KIDROP), is a tele-medicine network that screens for ROP in different zones of Karnataka state in rural India. North Karnataka is the most underdeveloped and remote zone of this program and did not have any ROP screening programs before the intervention of the KIDROP in 2011. Six government and eleven private neonatal centers in this zone were screened weekly. Specific neonatal guidelines for ROP were developed and introduced in these centers. They included awareness about risk factors, oxygen regulation protocols, use of pulse oxymetry, monitoring postnatal weight gain, nutritional best practices, and management of sepsis. The incidence and severity of ROP were compared before the guidelines were introduced (Jan 2011 to Dec 2012) and after the guidelines were introduced (July 2013 to June 2015). Results During this 4-year period, 4,167 infants were screened over 11,390 imaging sessions. The number of enrolled infants increased from 1,825 to 2,342 between the two periods (P<0.001). The overall incidence of any stage ROP reduced significantly from 26.8% to 22.4% (P<0.001). The incidence of treatment-requiring ROP reduced from 20.7% to 16% (P=0.06), and of the treated disease, aggressive posterior ROP reduced from 20.8% to 13.1% (P=0.23) following introduction of the guidelines. Discussion Rural neonatal centers in middle-income countries have a large, unscreened burden of ROP. Improving neonatal care in these centers can positively impact the incidence and severity of ROP even in a relatively short period. A combined approach of a robust ROP screening program and improved neonatal care practices is required to address the challenge. PMID:28539801
M Badakar, Chandrashekhar; J Thakkar, Prachi; M Hugar, Shivayogi; Kukreja, Pratibha; G Assudani, Harsha; Gokhale, Niraj
2017-01-01
To determine and compare the relevance of Piaget's cognitive principles among 4- to 7-year-old parented and orphan children in Belagavi City, Karnataka, India. This study was conducted on 240 children between the ages of 4 to 7 years who were equally divided into two groups of 120 parented and 120 orphan children. These were subdivided into four groups of 30 children each. Various characteristics like egocentrism, concept of cardinal numbers based on centration, lack of conservation, and reversibility were assessed, using experiments and comparison of their prevalence between two groups was carried out. There is a statistically significant difference in the cognitive development among parented and orphan children age 4 to 7 years. There is a significantly better cognitive development among parented children as compared with orphan children in Belagavi city. A child is not a miniature adult but rather can think and perceive the world differently from an adult. Understanding a child's intellectual level can enable a pedodontist to deliver improved quality care to children. According to Jean Piaget, in the preoperational period, children think symbolically and their reasoning is based more on appearance rather than logic. It is often rightly said that a child's behavior is a reflection of his parents. However, Piaget did not consider the effect of social setting and culture on the cognitive development. This study was carried out as there is not much literature available to describe the cognitive development of children in the Indian scenario and the influence of parental presence on the same. How to cite this article: Badakar CM, Thakkar PJ, Hugar SM, Kukreja P, Assudani HG, Gokhale N. Evaluation of the Relevance of Piaget's Cognitive Principles among Parented and Orphan Children in Belagavi City, Karnataka, India: A Comparative Study. Int J Clin Pediatr Dent 2017;10(4):346-350.
Sheet, Debdoot
2016-01-01
How would you provide effective and affordable health care in a country of more than 1.25 billion where there are only 0.7 physicians for every 1,000 people [1]? The Revised National Tuberculosis Control Program (RNTCP) and the Karnataka Internet-Assisted Diagnosis of Retinopathy of Prematurity (KIDROP) service are two notable efforts designed to deliver care across India, in both urban and rural areas and from the country?s flat plains to its rugged mountainous and desert regions.
Bhattacharjee, Parinita; Prakash, Ravi; Pillai, Priya; Isac, Shajy; Haranahalli, Mohan; Blanchard, Andrea; Shahmanesh, Maryam; Blanchard, James; Moses, Stephen
2013-01-01
In Karnataka state, South India, we analyzed the role of membership in peer groups in reducing HIV-related risk and vulnerability among female sex workers (FSWs). Data from three surveys conducted in Karnataka, a behavioral tracking survey and two rounds of integrated biological and behavioral assessments (IBBAs), were analyzed. Using propensity score matching, we examined the impact of group membership on selected outcomes, including condom use, experience of violence, access to entitlements, and the prevalence of sexually transmitted infections, including HIV infection. Focus group discussions were conducted with the FSWs to better understand their perceptions regarding membership in peer groups. Peer group members participating in the IBBAs had a lower prevalence of gonorrhea and/or chlamydia (5.2 vs 9.6%, p<0.001), and of syphilis (8.2 vs 10.3%, p<0.05), compared to non-members. The average treatment effect for selected outcome measures, from the propensity score matching, showed that FSWs who were members of any peer group reported significantly less experience of violence in the past six months, were less likely to have bribed police to avoid trouble in the past six months, and were more likely to have obtained at least one formal identification document in the past five years, compared to non-members. In focus group discussions, group members indicated that they had more confidence in dealing with situations of forced sex and violence. Including community mobilization and peer group formation in the context of HIV prevention programing can reduce HIV-related risk and vulnerability among FSWs.
ERIC Educational Resources Information Center
Abraham, R. R.; Vinod, P.; Kamath, M. G.; Asha, K.; Ramnarayan, K.
2008-01-01
Melaka Manipal Medical College (Manipal Campus; Manipal, Karnataka, India) conducts the Bachelor of Medicine and Bachelor of Surgery program, for which the admission intakes are during the months of March and September. The present study was undertaken to study the differences in learning approaches to physiology of undergraduate medical students…
Shaw, Souradet Y.; Lorway, Robert R.; Deering, Kathleen N.; Avery, Lisa; Mohan, H. L.; Bhattacharjee, Parinita; Reza-Paul, Sushena; Isac, Shajy; Ramesh, Banadakoppa M.; Washington, Reynold; Moses, Stephen; Blanchard, James F.
2012-01-01
Objectives There is a lack of information on sexual violence (SV) among men who have sex with men and transgendered individuals (MSM-T) in southern India. As SV has been associated with HIV vulnerability, this study examined health related behaviours and practices associated with SV among MSM-T. Design Data were from cross-sectional surveys from four districts in Karnataka, India. Methods Multivariable logistic regression models were constructed to examine factors related to SV. Multivariable negative binomial regression models examined the association between physician visits and SV. Results A total of 543 MSM-T were included in the study. Prevalence of SV was 18% in the past year. HIV prevalence among those reporting SV was 20%, compared to 12% among those not reporting SV (p = .104). In multivariable models, and among sex workers, those reporting SV were more likely to report anal sex with 5+ casual sex partners in the past week (AOR: 4.1; 95%CI: 1.2–14.3, p = .029). Increased physician visits among those reporting SV was reported only for those involved in sex work (ARR: 1.7; 95%CI: 1.1–2.7, p = .012). Conclusions These results demonstrate high levels of SV among MSM-T populations, highlighting the importance of integrating interventions to reduce violence as part of HIV prevention programs and health services. PMID:22448214
NASA Astrophysics Data System (ADS)
Srivastav, R. K.; Chinnapa Reddy, A. R.
2015-12-01
Recent trends in climate, land-use pattern and population has affected almost every portable water resources in the world. Due to depleting surface water and untimely distribution of precipitation, the demand to use groundwater has increased considerably. Further recent studies have shown that the groundwater stress is more in developing countries like India. This study focuses on understanding the impacts of three major factors (i.e., rainfall, land-cover and population growth) effecting the groundwater levels. For this purpose, the correlation between the trends in groundwater time series is compared with trends in rainfall, land-cover and population growth. To detect the trends in time series, two statistical methods namely, least square method and Mann-Kendall method, are adopted. The results were analyzed based on the measurements from 1800 observation wells in the Karnataka state, India. The data is obtained for a total of 9 year time period ranging from 2005 to 2013. A gridded precipitation data of 0.5o× 0.5o over the entire region is used. The change in land-cover and population data was approximately obtained from the local governing bodies. The early results show significant correlation between rainfall and groundwater time series trends. The outcomes will assess the vulnerability of groundwater levels under changing physical and hydroclimatic conditions, especially under climate change.
Kumar, A. M. V.; Rewari, B.; Kumar, S.; Shastri, S.; Satyanarayana, S.; Ananthakrishnan, R.; Nagaraja, S. B.; Devi, M.; Bhargava, N.; Das, M.; Zachariah, R.
2014-01-01
Setting: Antiretroviral treatment (ART) Centre in Tumkur district of Karnataka State, India. There is no published information about pre-ART loss to follow-up from India. Objective: To assess the proportion lost to follow-up (defined as not visiting the ART Centre within 1 year of registration) and associated socio-demographic and immunological variables. Design: Retrospective cohort study involving a review of medical records of adult HIV-infected persons (aged ⩾15 years) registered in pre-ART care during January 2010–June 2012. Results: Of 3238 patients registered, 2519 (78%) were eligible for ART, while 719 (22%) were not. Four of the latter were transferred out; the remaining 715 individuals were enrolled in pre-ART care, of whom 290 (41%) were lost to follow-up. Factors associated with loss to follow-up on multivariate analysis included age group ⩾45 years, low educational level, not being married, World Health Organization Stage III or IV and rural residence. Conclusion: About four in 10 individuals in pre-ART care were lost to follow-up within 1 year of registration. This needs urgent attention. Routine cohort analysis in the national programme should include those in pre-ART care to enable improved review, monitoring and supervision. Further qualitative research to ascertain reasons for loss to follow-up is required to design future interventions. PMID:26400698
Tribes in Karnataka: Status of health research
Roy, Subarna; Hegde, Harsha V.; Bhattacharya, Debdutta; Upadhya, Vinayak; Kholkute, Sanjiva D.
2015-01-01
The south Indian State of Karnataka, once part of several kingdoms and princely states of repute in the Deccan peninsula, is rich in its historic, cultural and anthropological heritage. The State is the home to 42,48,987 tribal people, of whom 50,870 belong to the primitive group. Although these people represent only 6.95 per cent of the population of the State, there are as many as 50 different tribes notified by the Government of India, living in Karnataka, of which 14 tribes including two primitive ones, are primarily natives of this State. Extreme poverty and neglect over generations have left them in poor state of health and nutrition. Unfortunately, despite efforts from the Government and non-Governmental organizations alike, literature that is available to assess the state of health of these tribes of the region remains scanty. It is however, interesting to note that most of these tribes who had been original natives of the forests of the Western Ghats have been privy to an enormous amount of knowledge about various medicinal plants and their use in traditional/folklore medicine and these practices have been the subject matter of various scientific studies. This article is an attempt to list and map the various tribes of the State of Karnataka and review the studies carried out on the health of these ethnic groups, and the information obtained about the traditional health practices from these people. PMID:26139788
Tribes in Karnataka: Status of health research.
Roy, Subarna; Hegde, Harsha V; Bhattacharya, Debdutta; Upadhya, Vinayak; Kholkute, Sanjiva D
2015-05-01
The south Indian State of Karnataka, once part of several kingdoms and princely states of repute in the Deccan peninsula, is rich in its historic, cultural and anthropological heritage. The State is the home to 42,48,987 tribal people, of whom 50,870 belong to the primitive group. Although these people represent only 6.95 per cent of the population of the State, there are as many as 50 different tribes notified by the Government of India, living in Karnataka, of which 14 tribes including two primitive ones, are primarily natives of this State. Extreme poverty and neglect over generations have left them in poor state of health and nutrition. Unfortunately, despite efforts from the Government and non-Governmental organizations alike, literature that is available to assess the state of health of these tribes of the region remains scanty. It is however, interesting to note that most of these tribes who had been original natives of the forests of the Western Ghats have been privy to an enormous amount of knowledge about various medicinal plants and their use in traditional/folklore medicine and these practices have been the subject matter of various scientific studies. This article is an attempt to list and map the various tribes of the State of Karnataka and review the studies carried out on the health of these ethnic groups, and the information obtained about the traditional health practices from these people.
Chowdhury, Chitta R; Shahnawaz, Khijmatgar; Kumari, Divya; Chowdhury, Avidyuti; Bedi, Raman; Lynch, Edward; Harding, Stewart; Grootveld, Martin
2016-11-01
(1) To estimate the concentrations of fluoride in drinking water throughout different zones and districts of the state of Karnataka. (2) To investigate the variation of fluoride concentration in drinking water from different sources, and its relationships to daily temperature and rainfall status in the regional districts. (3) To develop an updated fluoride concentration intensity map of the state of Karnataka, and to evaluate these data in the context of fluoride-related health effects such as fluorosis and their prevalence. Aqueous standard solutions of 10, 100 and 1,000 ppm fluoride (F - ) were prepared with analytical grade Na + /F - and a buffer; TISAB II was incorporated in both calibration standard and analysis solutions in order to remove the potentially interfering effects of trace metal ions. This analysis was performed using an ion-selective electrode (ISE), and mean determination readings for n = 5 samples collected at each Karnataka water source were recorded. The F - concentration in drinking water in Karnataka state was found to vary substantially, with the highest mean values recorded being in the north-eastern zone (1.61 ppm), and the lowest in the south-western one (only 0.41 ppm). Analysis of variance (ANOVA) demonstrated that there were very highly significant 'between-zone' and 'between-districts-within-zones' sources of variation (p < 10 -5 -10 -9 ), results consistent with a substantial spatial variance of water source F - levels within this state. The southern part of Karnataka has low levels of F - in its drinking water, and may require fluoridation treatment in order to mitigate for dental caries and further ailments related to fluoride deficiency. However, districts within the north-eastern region have contrastingly high levels of fluoride, an observation which has been linked to dental and skeletal fluorosis. This highlights a major requirement for interventional actions in order to ensure maintenance of the recommended range of fluoride concentrations (0.8-1.5 ppm) in Karnataka's drinking water sources. © Royal Society for Public Health 2016.
Thapa, P; Kamath, R; Shetty, B K; Monteiro, A; Sekaran, V C
2014-01-01
Tuberculosis (TB) is a major public health problem in India. Several studies carried out in India have shown alcoholism as a risk factor for tuberculosis mortality, factor for default in TB and reason for non-compliance under the Revised National Tuberculosis Control Program (RNTCP). The aim of this study was to assess the prevalence, pattern and associated factors of alcohol use among tuberculosis patients in Udupi taluk, Karnataka, India. A cross-sectional study was conducted with the complete enumeration of all the cases undergoing Directly Observed Treatment Short-course (DOTS) treatment in Primary Health Centre and Community Health Centre of Udupi taluk from March to April 2013. Interview was conducted to obtain the socio-demographic and health information and participants were screened using WHO developed Alcohol Use Disorders Identification Test (AUDIT) for alcohol use. Out of 123 participants, 78% were males, 86.2% were Hindu, 79.7% were married and 88.6% were from low socio-economic status. About 20.3% (n=25) participants were alcoholic. Among them, 44% were low risk drinkers, 32% were hazardous drinkers, 4% were harmful drinkers and 20% were alcohol dependent. Age, sex, occupation, tobacco use, perceived health status and discrimination due to tuberculosis positive status were significantly associated with alcohol use. On logistic regression sex, tobacco use, perceived health status and facing discrimination due infection with tuberculosis were found to be factors associated with alcohol use. This study found a high prevalence of alcoholism among tuberculosis patients which is of concern and has to be addressed.
Is there an elephant in the room? Boundary violations in the doctor-patient relationship in India.
Kurpad, Sunita Simon; Machado, Tanya; Galgali, R B
2010-01-01
An anonymous postal survey on the awareness of the occurrence of nonsexual and sexual boundary violations (NSBV and SBV) in the doctor-patient relationship in India was conducted with psychiatrists and psychologists working in the state of Karnataka in India (n=51). Though this was not designed to be a prevalence study on violations, the results suggest that both NSBV and SBVdo occur and, more importantly, respondents felt that this is an area which needs urgent attention in India. There was disagreement on whether some behaviours in certain situations could be construed as NSBV in the Indian culture. Though several respondents agreed that there was a need to develop guidelines on this issue in India, there was a perception that the problem was not in the availability of guidelines but in their implementation. The ethical implications of the study are discussed.
Muthusubramanian, Venkateshwaran; Bandyopadhyay, Ranajit; Rajaram Reddy, Daram; Tooley, Paul W
2006-04-01
Sorghum ergot in India is caused by Claviceps africana and C. sorghi. The distributions of these two species in India is not known. Eighty-nine sorghum ergot isolates were cultured from young sphacelia obtained from male sterile sorghum plants artificially inoculated using inoculum collected in the field. Based on cultural characteristics, the isolates were separated into two groups which differed distinctly in the morphology of their sphacelia, conidia, and sclerotia. Marked differences also were observed in rates of secondary conidial production and disease spread between the groups. In combination with molecular evidence, our results confirm that the isolates placed in Group I represent C. africana and Group II isolates represent C. sorghi. C. africana was found to be widely distributed in all sorghum growing areas of India. The species first described as occuring in India, C. sorghi, appears to be restricted to a few locations in the states of Maharashtra, Andhra Pradesh, and Karnataka.
Bhattacharjee, Parinita; Isac, Shajy; McClarty, Leigh M; Mohan, Haranahalli L; Maddur, Srinath; Jagannath, Sunitha B; Venkataramaiah, Balasubramanya K; Moses, Stephen; Blanchard, James F; Gurnani, Vandana
2016-01-01
Female sex workers (FSWs) frequently experience violence in their work environments, violating their basic rights and increasing their vulnerability to HIV infection. Structural interventions addressing such violence are critical components of comprehensive HIV prevention programmes. We describe structural interventions developed to address violence against FSWs in the form of police arrest, in the context of the Bill and Melinda Gates Foundation's India AIDS Initiative (Avahan) in Karnataka, South India. We examine changes in FSW arrest between two consecutive time points during the intervention and identify characteristics that may increase FSW vulnerability to arrest in Karnataka. Structural interventions with police involved advocacy work with senior police officials, sensitization workshops, and integration of HIV and human rights topics in pre-service curricula. Programmes for FSWs aimed to enhance collectivization, empowerment and awareness about human rights and to introduce crisis response mechanisms. Three rounds of integrated behavioural and biological assessment surveys were conducted among FSWs from 2004 to 2011. We conducted bivariate and multivariate analyses using data from the second (R2) and third (R3) survey rounds to examine changes in arrests among FSWs over time and to assess associations between police arrest, and the sociodemographic and sex work-related characteristics of FSWs. Among 4110 FSWs surveyed, rates of ever being arrested by the police significantly decreased over time, from 9.9% in R2 to 6.1% in R3 (adjusted odds ratio (AOR) [95% CI]=0.63 [0.48 to 0.83]). Arrests in the preceding year significantly decreased, from 5.5% in R2 to 2.8% in R3 (AOR [95% CI]=0.59 [0.41 to 0.86]). FSWs arrested as part of arbitrary police raids also decreased from 49.6 to 19.5% (AOR [95% CI]=0.21 [0.11 to 0.42]). Certain characteristics, including financial dependency on sex work, street- or brothel-based solicitation and high client volumes, were found to significantly increase the odds of arrest for participants. Structural interventions addressing police arrest of FSWs are feasible to implement. Based on our findings, the design of violence prevention and response interventions in Karnataka can be tailored to focus on FSWs, who are disproportionately vulnerable to arrest by police. Context-specific structural interventions can reduce police arrests, create a safer work environment for FSWs and protect fundamental human rights.
Bhattacharjee, Parinita; Isac, Shajy; McClarty, Leigh M; Mohan, Haranahalli L; Maddur, Srinath; Jagannath, Sunitha B; Venkataramaiah, Balasubramanya K; Moses, Stephen; Blanchard, James F; Gurnani, Vandana
2016-01-01
Introduction Female sex workers (FSWs) frequently experience violence in their work environments, violating their basic rights and increasing their vulnerability to HIV infection. Structural interventions addressing such violence are critical components of comprehensive HIV prevention programmes. We describe structural interventions developed to address violence against FSWs in the form of police arrest, in the context of the Bill and Melinda Gates Foundation's India AIDS Initiative (Avahan) in Karnataka, South India. We examine changes in FSW arrest between two consecutive time points during the intervention and identify characteristics that may increase FSW vulnerability to arrest in Karnataka. Methods Structural interventions with police involved advocacy work with senior police officials, sensitization workshops, and integration of HIV and human rights topics in pre-service curricula. Programmes for FSWs aimed to enhance collectivization, empowerment and awareness about human rights and to introduce crisis response mechanisms. Three rounds of integrated behavioural and biological assessment surveys were conducted among FSWs from 2004 to 2011. We conducted bivariate and multivariate analyses using data from the second (R2) and third (R3) survey rounds to examine changes in arrests among FSWs over time and to assess associations between police arrest, and the sociodemographic and sex work-related characteristics of FSWs. Results Among 4110 FSWs surveyed, rates of ever being arrested by the police significantly decreased over time, from 9.9% in R2 to 6.1% in R3 (adjusted odds ratio (AOR) [95% CI]=0.63 [0.48 to 0.83]). Arrests in the preceding year significantly decreased, from 5.5% in R2 to 2.8% in R3 (AOR [95% CI]=0.59 [0.41 to 0.86]). FSWs arrested as part of arbitrary police raids also decreased from 49.6 to 19.5% (AOR [95% CI]=0.21 [0.11 to 0.42]). Certain characteristics, including financial dependency on sex work, street- or brothel-based solicitation and high client volumes, were found to significantly increase the odds of arrest for participants. Conclusion Structural interventions addressing police arrest of FSWs are feasible to implement. Based on our findings, the design of violence prevention and response interventions in Karnataka can be tailored to focus on FSWs, who are disproportionately vulnerable to arrest by police. Context-specific structural interventions can reduce police arrests, create a safer work environment for FSWs and protect fundamental human rights. PMID:27435708
Clinical profile and outcome of Dengue fever cases.
Ratageri, Vinod H; Shepur, T A; Wari, P K; Chavan, S C; Mujahid, I B; Yergolkar, P N
2005-08-01
Dengue fever is on rise globally. In India, Dengue epidemics are expanding geographically, even into the rural areas. Dengue can present with varied manifestations. The mortality rate has been brought down with high index of suspicion, strict monitoring and proper fluid resuscitation. Herewith, we are presenting clinical features and outcome of Dengue cases seen in and around Hubli (North Karnataka).
A Reference Grammar of Spoken Kannada.
ERIC Educational Resources Information Center
Schiffman, Harold
This reference grammar is a description of the speech of educated people of the Bangalore/Mysore area of Karnataka State in South India. This particular dialect is used in films and, to some extent, on the radio. The four sections of the book deal with: (1) phonology, (2) the noun phrase, (3) the verb phrase, and (4) syntax. Each item that is…
Sannappa, J; Ningappa, C
2014-03-01
An extensive studies on the indoor activity concentrations of thoron, radon and their progeny in the granite region in the state of Karnataka, India, has been carried out since, 2007 in the scope of a lung cancer epidemiological study using solid-state nuclear track detector-based double-chamber dosemeters (LR-115, type II plastic track detector). Seventy-four dwellings of different types were selected for the measurement. The dosemeters containing SSNTD detectors were fixed 2 m above the floor. After an exposure time of 3 months (90 d), films were etched to reveal tracks. From the track density, the concentrations of radon and thoron were evaluated. The value of the indoor concentration of thoron and radon in the study area varies from 16 to 170 Bq m(-3) and 18 to 300 Bq m(-3) with medians of 66 and 82.3 Bq m(-3), respectively, and that of their progeny varies from 1.8 to 24 mWL with a median of 3.6 mWL and 1.6 to 19.6 mWL, respectively. The concentrations of indoor thoron, radon and their progeny and their equivalent effective doses are discussed.
Bendavid, Eran; Mukherji, Arnab; Wagner, Zachary; Nagpal, Somil; Mullen, Patrick
2014-01-01
Objectives To evaluate the effects of a government insurance program covering tertiary care for people below the poverty line in Karnataka, India, on out-of-pocket expenditures, hospital use, and mortality. Design Geographic regression discontinuity study. Setting 572 villages in Karnataka, India. Participants 31 476 households (22 796 below poverty line and 8680 above poverty line) in 300 villages where the scheme was implemented and 28 633 households (21 767 below poverty line and 6866 above poverty line) in 272 neighboring matched villages ineligible for the scheme. Intervention A government insurance program (Vajpayee Arogyashree scheme) that provided free tertiary care to households below the poverty line in about half of villages in Karnataka from February 2010 to August 2012. Main outcome measure Out-of-pocket expenditures, hospital use, and mortality. Results Among households below the poverty line, the mortality rate from conditions potentially responsive to services covered by the scheme (mostly cardiac conditions and cancer) was 0.32% in households eligible for the scheme compared with 0.90% among ineligible households just south of the eligibility border (difference of 0.58 percentage points, 95% confidence interval 0.40 to 0.75; P<0.001). We found no difference in mortality rates for households above the poverty line (households above the poverty line were not eligible for the scheme), with a mortality rate from conditions covered by the scheme of 0.56% in eligible villages compared with 0.55% in ineligible villages (difference of 0.01 percentage points, −0.03 to 0.03; P=0.95). Eligible households had significantly reduced out-of-pocket health expenditures for admissions to hospitals with tertiary care facilities likely to be covered by the scheme (64% reduction, 35% to 97%; P<0.001). There was no significant increase in use of covered services, although the point estimate of a 44.2% increase approached significance (−5.1% to 90.5%; P=0.059). Both reductions in out-of-pocket expenditures and potential increases in use might have contributed to the observed reductions in mortality. Conclusions Insuring poor households for efficacious but costly and underused health services significantly improves population health in India. PMID:25214509
Nayak, N S; Annigeri, V B; Revankar, D R; Kenchaigol, S
2010-07-01
The Indian government enacted 'The cigarettes and other tobacco products act, 2003' (COTPA), which prohibits smoking in public places. To validate the efficacy of the Act of 2003, enacted by the Government of India, to prevent secondhand smoking in public places. The study is based on a non-random sample survey of 2,600 bus passengers carried out in the premises of three mega public road transport organizations in Karnataka state, India, in June 2007. The information was gathered through administration of structured schedules. A sample of 1,000 each for the terminus of Bangalore Metropolitan Transport Corporation (BMTC) and Karnataka State Road Transport Corporation (KSRTC) in Bangalore and, 600 for North West Karnataka Road Transport Corporation (NWKRTC) in Hubli-Dharwad city was distributed proportionately according to the number of platforms in each terminus. Simple Averages. There is some reduction in smoking in general as perceived by 69% of the passengers as compared to the scenario a year before the enactment of COTPA. The observed smoking is lower in the bus premises of BMTC where there is strict regulation, and higher in the bus premises of NWKRTC, which has not taken any regulatory measures. Knowing smoking is banned in public places can itself create awareness depending on the coverage extended by media and implementing an agency to reach the public. The implementation of an act depends on the willingness of stakeholders to act upon it. The implementation of COTPA as done by BMTC could well become a role model for replication elsewhere, if BMTC can strive harder to accomplish a 100% smoke-free zone.
Parsa, Soroush; Kondo, Takumasa; Winotai, Amporn
2012-01-01
Phenacoccus manihoti Matile-Ferrero (Hemiptera: Pseudococcidae), one of the most serious pests of cassava worldwide, has recently reached Asia, raising significant concern over its potential spread throughout the region. To support management decisions, this article reports recent distribution records, and estimates the climatic suitability for its regional spread using a CLIMEX distribution model. The article also presents a taxonomic key that separates P. manihoti from all other mealybug species associated with the genus Manihot. Model predictions suggest P. manihoti imposes an important, yet differential, threat to cassava production in Asia. Predicted risk is most acute in the southern end of Karnataka in India, the eastern end of the Ninh Thuan province in Vietnam, and in most of West Timor in Indonesia. The model also suggests P. manihoti is likely to be limited by cold stress across Vietnam's northern regions and in the entire Guangxi province in China, and by high rainfall across the wet tropics in Indonesia and the Philippines. Predictions should be particularly important to guide management decisions for high risk areas where P. manihoti is absent (e.g., India), or where it has established but populations remain small and localized (e.g., South Vietnam). Results from this article should help decision-makers assess site-specific risk of invasion, and develop proportional prevention and surveillance programs for early detection and rapid response. PMID:23077659
Prevalence of Dental Caries Among Primary School Children of India – A Cross-Sectional Study
Hiremath, Anand; Ankola, Anil V; Hebbal, Mamata; Mohandoss, Suganya; Pastay, Pratibha
2016-01-01
Introduction In India, the trend indicates an increase in oral health problems especially dental caries, which has been consistently increasing both in prevalence and in severity. Children of all age groups are affected by dental caries. It becomes imperative to collect the data on prevalence of dental caries and treatment needs to provide preventive care. Aim To assess the prevalence of dental caries and treatment needs of 6-11years old Indian school children. Materials and Methods This was a cross-sectional study. Sampling frame consisted of 6-11years old primary school children. Study sample consisted of 13,200 children selected from 10 talukas of Belgavi District, Karnataka, India. Clinical examination for dmft and DMFT was carried out in the school premises by five teams, each consisting of one faculty, three postgraduate students and five interns from the KLE VK Institute of Dental Sciences, Belagavi, Karnataka, India. The examiners were trained and calibrated by the principal investigator. Statistical analysis was done using Chi-square and t-test. Results The overall caries prevalence was 78.9%, mean dmft was 2.97±2.62 and mean DMFT was 0.17±0.53. The decayed teeth component was the principal component in both dmft and DMFT indices. The mean dmft in boys was higher compared to girls and it was found to be statistically significant (p<0.05). Conclusion This study provided us with the baseline data, using which treatment was provided to all the children screened. The children were provided treatment at the camp site/dental hospital/satellite centers and primary health care centers according to the facilities available. PMID:27891457
TB-HIV co-infection among pregnant women in Karnataka, South India: A case series.
Suresh, Shastri; Sharath, Burugina N; Anita, Shet; Lalitha, Ravindra; Prasad, Tripathy J; Rewari, Bharat B
2016-01-01
Tuberculosis (TB) is a significant contributor to mortality in HIV-infected patients. Concurrent TB infection is also a significant contributing factor to maternal mortality in human immunodeficiency virus (HIV)-infected pregnant women. Studies addressing the outcomes of TB and HIV co-infection among pregnant women are generally infrequent. Although limited, the records maintained by the Revised National Tuberculosis Control Programme (RNTCP) and the National AIDS Control Programme (NACP) in Karnataka State, Southern India provide information about the numbers of pregnant women who are co-infected with TB and HIV and their pregnancy outcomes. We reviewed the data and conducted this study to understand how TB-HIV co-infection influences the outcomes of pregnancy in this setting. We sought to determine the incidence and treatment and delivery outcomes of TB-HIV co-infected pregnant women in programmatic settings in Karnataka State in southern India. The study participants were all the HIV-infected pregnant women who were screened for tuberculosis under the NACP from 2008 to 2012. For the purposes of this study, the program staff in the field gathered the data regarding on treatment and delivery outcomes of pregnant women. A total of seventeen pregnant women with TB-HIV co-infection were identified among 3,165,729 pregnant women (for an incidence of 5.4 per million pregnancies). The median age of these pregnant women was 24 years, and majority were primiparous women with WHO HIV stage III disease and were on a stavudine-based ART regimen. The maternal mortality rates were 18% before delivery and 24% after delivery. The abortion rate was 24%, and the neonatal mortality rate was 10%. The anti-tuberculosis treatment and anti-retroviral treatment outcome mortality rates were 30% and 53%, respectively. Although the incidence of TB among the HIV-infected pregnant women was marginally less than that among the non-HIV-infected women, the delivery outcomes were relatively poorer. The current strategy for the management of TB among the HIV-positive pregnant women needs urgent review. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
Travers, Mark J; Nayak, Nayanatara S; Annigeri, Vinod B; Billava, N Narayan
2015-01-01
Tobacco smoke has compounds that are known as human carcinogens. With every breath of secondhand smoke we inhale thousands of chemicals. The Government of India in the interest of public health has enacted the Cigarette and Other Tobacco Products Act (COTPA), 2003, which bans smoking in all the public places including hotels and restaurants. The purpose of this study was to observe and record air pollution in smoke free and smoke observed locations and thereby find out whether the owners/managers of hotels, restaurants, and bars comply with rules of COTPA. The objectives of the study were to measure and compare the level of particulate air pollution from secondhand smoke (PM2.5) in smoking and nonsmoking venues. The study was conducted from September 2009 to March 2010 in Karnataka, India following a nonrandom sample of 79 locations, which included restaurants, bars, cafes, hotels, and tea stalls in two districts. The concentration of PM2.5 was measured using a TSI SidePak AM510 Personal Aerosol Monitor. In Karnataka out of the 79 hospitality locations, smoking was observed in 58% places and only 28% had displayed the required "No Smoking" signage. Places where indoor smoking was observed had high levels of air pollution with average 135 PM2.5, which were 3.1 times higher than the average 43 PM2.5 in smoke-free locations and 14 times higher than the World Health Organization (WHO) target air quality guideline for PM2.5. The average PM2.5 levels in different locations ranged from 11 to 417 μg/m(3) and was lower in the case of apparently compliant designated smoking area (DSR). The patrons and the workers in the hospitality sector continue to be exposed to secondhand smoke despite the enactment of COTPA, which bans smoking in public places. This situation demands stringent measures for effective implementation of the Smoke Free Act and negative response to smoking among civil society.
Coronal magnetic fields from multiple type II bursts
NASA Astrophysics Data System (ADS)
Honnappa, Vijayakumar; Raveesha, K. H.; Subramanian, K. R.
Coronal magnetic fields from multiple type II bursts Vijayakumar H Doddamani1*, Raveesha K H2 and Subramanian3 1Bangalore University, Bangalore, Karnataka state, India 2CMR Institute of Technology, Bangalore, Karnataka state, India 3 Retd, Indian Institute of Astrophysics, Bangalore, Karnataka state, India Abstract Magnetic fields play an important role in the astrophysical processes occurring in solar corona. In the solar atmosphere, magnetic field interacts with the plasma, producing abundant eruptive activities. They are considered to be the main factors for coronal heating, particle acceleration and the formation of structures like prominences, flares and Coronal Mass Ejections. The magnetic field in solar atmosphere in the range of 1.1-3 Rsun is especially important as an interface between the photospheric magnetic field and the solar wind. Its structure and time dependent change affects space weather by modifying solar wind conditions, Cho (2000). Type II doublet bursts can be used for the estimation of the strength of the magnetic field at two different heights. Two type II bursts occur sometimes in sequence. By relating the speed of the type II radio burst to Alfven Mach Number, the Alfven speed of the shock wave generating type II radio burst can be calculated. Using the relation between the Alfven speed and the mean frequency of emission, the magnetic field strength can be determined at a particular height. We have used the relative bandwidth and drift rate properties of multiple type II radio bursts to derive magnetic field strengths at two different heights and also the gradient of the magnetic field in the outer corona. The magnetic field strength has been derived for different density factors. It varied from 1.2 to 2.5 gauss at a solar height of 1.4 Rsun. The empirical relation of the variation of the magnetic field with height is found to be of the form B(R) = In the present case the power law index ‘γ’ varied from -3 to -2 for variation of density factor from 1 to 5. Key Words: Magnetic field, photosphere, corona, solar wind, bursts *Email:drvkdmani@gmail.com
Total and Free Fluoride Concentration in Various Brands of Toothpaste Marketed in India
Siddanna, Sunitha
2015-01-01
Background For fluoridated toothpaste to be effective in controlling dental caries, an adequate concentration of soluble fluoride must be available in the oral cavity. Aim To determine the total and free fluoride concentration in various brands of toothpaste marketed in India. Materials and Methods Three samples of 12 different toothpastes were purchased from supermarkets in Mysore city, Karnataka, India. Toothpastes were analysed in duplicate using a fluoride ion-specific electrode. The concentration of total fluoride (TF) and total soluble fluoride (TSF) were determined. Results Measured TF was consistent with that declared by the manufacturer in five products. Four toothpastes showed lower TF and two higher TF than declared. Most toothpastes exhibited TSF concentrations similar to the TF content except four samples that displayed considerably lower TSF than TF. Conclusion The measurement of total and free fluoride concentrations of toothpastes available in India showed inhomogenities. Therefore there is a need for stringent regulatory control measures for the determination of fluoride content in toothpastes in developing country like India. PMID:26557607
Patil, Vishal V; Shigli, Kamal; Hebbal, Mamata; Agrawal, Neha
2012-01-01
The health of industrial workers often goes uncared for due to their stressful working conditions, busy schedules and poor economic conditions. A cross-sectional survey was conducted to determine the prevalence of tooth loss, prosthetic status and treatment needs among industrial workers in Belgaum, Karnataka, India according to the criteria described in the World Health Organization (WHO) Oral Health Assessment form (1997). A total of 614 workers participated in the study. Information was obtained regarding their oral hygiene practice. The presence or absence of habits, and the frequency and duration since the last visit to a dentist were recorded followed by clinical examination. Chi-square test was used to determine the association between the variables and tooth loss. There was a statistically significant difference between the number of missing teeth in different age groups, methods of cleaning, smoking habits and visits to the dentist. Regarding prosthetic status, only one worker had a fixed prosthesis in the mandibular arch. The study revealed that tooth loss was associated with oral hygiene practices, habits and visits to the dentist. Poor prosthetic status and high treatment needs were observed. This study emphasized the need for improved dental health awareness and availability of dental facilities to industrial workers.
Thompson, Laura H; Khan, Shamshad; du Plessis, Elsabé; Lazarus, Lisa; Reza-Paul, Sushena; Hafeez Ur Rahman, Syed; Pasha, Akram; Lorway, Robert
2013-01-01
The Bill and Melinda Gates Foundation has poured a tremendous amount of resources into epidemic prevention in India's high HIV prevalence zones, through their Avahan initiative. These community-centred programmes operate under the assumption that fostering community-based organisational development and empowering the community to take charge of HIV prevention and education will help to transform the wider social inequalities that inhibit access to health services. Focusing on the South Indian state of Karnataka, this paper explores a troubling set of local narratives that, we contend, hold broader implications for future programme planning and implementation. Although confronting stigma and discrimination has become a hallmark in community mobilisation discourse, communities of self-identified kothis (feminine men) who were involved in Avahan programme activities continued to articulate highly negative attitudes about their own sexualities in relation to various spheres of social life. Rather than framing an understanding of these narratives in psychological terms of 'internalized stigma', we draw upon medical anthropological approaches to the study of stigma that emphasise how social, cultural and moral processes create stigmatising conditions in the everyday lives of people. The way stigma continues to manifest itself in the self-perceptions of participants points to an area that warrants critical public health attention.
Narayana, Y; Somashekarappa, H M; Karunakara, N; Avadhani, D N; Mahesh, H M; Siddappa, K
2000-09-01
Studies on radiation level and radionuclide distribution in the environment of coastal Karnataka were undertaken to provide baseline data for the future assessment of the impact of the nuclear and thermal power stations that are being set up in the region and to understand the behaviour of radionuclides in the environment. As part of the programme the concentrations of two important artificial radionuclides, namely 90Sr and 137Cs, have been measured in a number of environmental samples. The concentration of 90Sr is very low in most of the samples. Among the samples analysed for the concentration of 137Cs, soil samples showed elevated levels of activity in some sampling stations. Among the vegetables, brinjal (Solanum melongena. L) showed considerable activity. The internal dose due to intake of 90Sr through diet was 0.42 microSv year(-1) for the vegetarian population and 0.32 microSv year(-1) for the non-vegetarian population. The internal dose due to dietary intake of 137Cs was found to be 0.34 microSv year(-1) and 0.26 microSv year(-1) respectively for the vegetarian and non-vegetarian population. The results are discussed in the light of the literature values reported for other environs of India and abroad and appropriate inferences are drawn.
Sabeena, Sasidharanpillai; Bhat, Parvati V; Kamath, Veena; Aswathyraj, Sushama; Arunkumar, Govindakarnavar
2015-01-01
Cervical cancer is one of the commonest cancers among women all over the world. The association of cervical cancer with human papilloma virus (HPV) is well established. Knowledge about the causal relationship between HPV and cervical cancer is important to make appropriate, evidence-based health care choices. In this context we conducted a community based study among women about the knowledge, attitude and practice about HPV infections and their health effects. A cross sectional interview based house to house survey was conducted with a validated data collection tool covering sociodemographic factors, knowledge, attitude and practice about HPV and its health effects, among 1020 women from a rural village, Perdoor, in Udupi district, Karnataka, India in 2013-14. The mean age of participants was 38.9 years (SD=12.6). Study participants showed a high literacy rate (85.7%). Only 2.4% of sexually exposed women had undergone Pap smear testing. Partners of 4.4%women had undergone circumcision and they belonged to the Muslim community. Male condom usage was reported by 26 women (2.6%). However, none of the participants had heard of HPV and its health effects. This community based study found complete ignorance about HPV among rural South Indian women in spite of a high literacy level.
Halli, Shiva S; Buzdugan, Raluca; Ramesh, B M; Gurnani, Vandana; Sharma, Vivek; Moses, Stephen; Blanchard, James F
2009-09-01
To develop a model for prioritizing economic sectors for HIV preventive intervention programs in the workplace. This study was undertaken in Karnataka state, India. A 3-stage survey process was undertaken. In the first stage, we reviewed secondary data available from various government departments, identified industries in the private sector with large workforces, and mapped their geographical distribution. In the second stage, an initial rapid risk assessment of industrial sectors was undertaken, using key-informant interviews conducted in relation to a number of enterprises, and in consultation with stakeholders. In the third stage, we used both quantitative (polling booth survey) and qualitative methods (key informant interviews, in-depth interviews, focus group discussions) to study high-risk sectors in-depth, and assessed the need and feasibility of HIV workplace intervention programs. The highest risk sectors were found to be mining, garment/textile, sugar, construction/infrastructure, and fishing industries. Workers in all sectors had at best partial knowledge about HIV/AIDS, coupled with common misconceptions about HIV transmission. There were intersector and intrasector variations in risk and vulnerability across different geographical locations and across different categories of workers. This has implications for the design and implementation of workplace intervention programs. There is tremendous scope for HIV preventive interventions in workplaces in India. Given the variation in HIV risk across economic sectors and limited available resources, there will be increased pressure to prioritize intervention efforts towards high-risk sectors. This study offers a model for rapidly assessing the risk level of economic sectors for HIV intervention programs.
Ballal, Mamatha; Martena, Suganthi
2013-03-01
The authors report a rare case of diarrhea caused by Moraxella osloensis in a pediatric child with Hemolytic Uremic Syndrome/Acute Renal Failure (HUS/ARF). A 6-y-old boy was referred to the Pediatric Unit with a 3 d history of bloody diarrhea with mucus and fever and decreased urine output for 6 d. Microbiological investigations were done as per CLSI guidelines. His diarrhea, and the subsequent renal failure resolved with appropriate treatment. To the best of authors' knowledge and pubmed search, this is the first case of M. osloensis causing diarrhea in a HUS/ARF pediatric patient reported from India-Manipal.
Badis britzi, a new percomorph fish (Teleostei: Badidae) from the Western Ghats of India.
Dahanukar, Neelesh; Kumkar, Pradeep; Katwate, Unmesh; Raghavan, Rajeev
2015-04-01
Badis britzi, the first species of the genus endemic to southern India, is described from the Nagodi tributary of the west-flowing Sharavati River in Karnataka. It is distinguished from congeners by a combination of characters including a slender body, 21-24 pored lateral-line scales and a striking colour pattern consisting of 11 bars and a mosaic of black and red pigmentation on the side of the body including the end of caudal peduncle, and the absence of cleithral, opercular, or caudal-peduncle blotches, or an ocellus on the caudal-fin base. Badis triocellus Khynriam & Sen is considered a junior synonym of B. singenensis Geetakumari & Kadu.
Changing trends in barriers to cataract surgery in India.
Vaidyanathan, K; Limburg, H; Foster, A; Pandey, R M
1999-01-01
Cataract is a major cause of blindness in Asia. Efforts in India to provide cataract surgical services have had limited success in reaching the cataract-blind population. Earlier studies identified the major barriers to cataract surgery as poverty, lack of transportation or felt need, or sex related; and the critical barriers in rural areas as lack of awareness, difficult access, and cost. Compared with these earlier data, the results of the present study in Karnataka State indicate a shift in the character of the barriers. They now appear to be more related to case selection and service provision. These shifts are analysed and alternative strategies to increase the uptake to cataract surgery are recommended.
Automated Burned Area Delineation Using IRS AWiFS satellite data
NASA Astrophysics Data System (ADS)
Singhal, J.; Kiranchand, T. R.; Rajashekar, G.; Jha, C. S.
2014-12-01
India is endowed with a rich forest cover. Over 21% of country's area is covered by forest of varied composition and structure. Out of 67.5 million ha of Indian forests, about 55% of the forest cover is being subjected to fires each year, causing an economic loss of over 440 crores of rupees apart from other ecological effects. Studies carried out by Forest Survey of India reveals that on an average 53% forest cover of the country is prone to fires and 6.17% of the forests are prone to severe fire damage. Forest Survey of India in a countrywide study in 1995 estimated that about 1.45 million hectares of forest are affected by fire annually. According to Forest Protection Division of the Ministry of Environment and Forest (GOI), 3.73 million ha of forests are affected by fire annually in India. Karnataka is one of the southern states of India extending in between latitude 110 30' and 180 25' and longitudes 740 10' and 780 35'. As per Forest Survey of India's State of Forest Report (SFR) 2009, of the total geographic area of 191791sq.km, the state harbors 38284 sq.km of recorded forest area. Major forest types occurring in the study area are tropical evergreen and semi-evergreen, tropical moist and dry deciduous forests along with tropical scrub and dry grasslands. Typical forest fire season in the study area is from February-May with a peak during March-April every year, though sporadic fire episodes occur in other parts of the year sq.km, the state harbors 38284 sq.km of recorded forest area. Major forest types occurring in the study area are tropical evergreen and semi-evergreen, tropical moist and dry deciduous forests along with tropical scrub and dry grasslands. Significant area of the deciduous forests, scrub and grasslands is prone to recurrent forest fires every year. In this study we evaluate the feasibility of burned area mapping over a large area (Karnataka state, India) using a semi-automated detection algorithm applied to medium resolution multi spectral data from the IRS AWiFS sensor. The method is intended to be used by non-specialist users for diagnostic rapid burnt area mapping.
Ramesh, B M; Beattie, Tara S H; Shajy, Isac; Washington, Reynold; Jagannathan, Latta; Reza-Paul, Sushena; Blanchard, James F; Moses, Stephen
2010-02-01
To examine the impact of a large-scale HIV prevention programme for female sex workers (FSW) in Karnataka state, south India, on the prevalence of HIV/sexually transmitted infections (STI), condom use and programme coverage. Baseline and follow-up integrated biological and behavioural surveys were conducted on random samples of FSW in five districts in Karnataka between 2004 and 2009. 4712 FSW participated in the study (baseline 2312; follow-up 2400), with follow-up surveys conducted 28-37 months after baseline. By follow-up, over 85% of FSW reported contact by a peer educator and having visited a project STI clinic. Compared with baseline, there were reductions in the prevalence of HIV (19.6% vs 16.4%, adjusted odds ratio (AOR) 0.81, 95% CI 0.67 to 0.99, p=0.04); high-titre syphilis (5.9% vs 3.4%, AOR 0.53, 95% CI 0.37 to 0.77, p=0.001); and chlamydia and/or gonorrhoea (8.9% vs 7.0%, AOR 0.72, 95% CI 0.54 to 0.94, p=0.02). Reported condom use at last sex increased significantly for repeat clients (66.1% vs 84.1%, AOR 1.98, 95% CI 1.58 to 2.48, p<0.001) and marginally for occasional clients (82.9% vs 88.0%, AOR 1.22, 95% CI 0.89 to 1.66, p=0.2), but remained stable for regular partners (32%). Compared with street and home-based FSW, brothel-based FSW were at highest risk of HIV and STI, despite high levels of reported condom use. This large-scale HIV prevention programme for FSW achieved reductions in HIV and STI prevalence, high rates of condom use with clients and high rates of programme coverage. Improved strategies to increase condom use with regular partners and reduce the vulnerability of brothel-based FSW to HIV are required.
Deepak, Nitya Nand; Mirzabagi, Ellie; Koski, Alissa; Tripathi, Vandana
2013-01-01
India has the highest annual number of maternal deaths of any country. As obstetric hemorrhage is the leading cause of maternal death in India, numerous efforts are under way to promote access to skilled attendance at birth and emergency obstetric care. Current initiatives also seek to increase access to active management of the third stage of labor for postpartum hemorrhage prevention, particularly through administration of an uterotonic after delivery. However, prior research suggests widespread inappropriate use of uterotonics at facilities and in communities-for example, without adequate monitoring or referral support for complications. This qualitative study aimed to document health providers' and community members' current knowledge, attitudes, and practices regarding uterotonic use during labor and delivery in India's Karnataka state. 140 in-depth interviews were conducted from June to August 2011 in Bagalkot and Hassan districts with physicians, nurses, recently delivered women, mothers-in-law, traditional birth attendants (dais), unlicensed village doctors, and chemists (pharmacists). Many respondents reported use of uterotonics, particularly oxytocin, for labor augmentation in both facility-based and home-based deliveries. The study also identified contextual factors that promote inappropriate uterotonic use, including high value placed on pain during labor; perceived pressure to provide or receive uterotonics early in labor and delivery, perhaps leading to administration of uterotonics despite awareness of risks; and lack of consistent and correct knowledge regarding safe storage, dosing, and administration of oxytocin. These findings have significant implications for public health programs in a context of widespread and potentially increasing availability of uterotonics. Among other responses, efforts are needed to improve communication between community members and providers regarding uterotonic use during labor and delivery and to target training and other interventions to address identified gaps in knowledge and ensure that providers and pharmacists have up-to-date information regarding proper usage of uterotonic drugs.
Energy-microfinance intervention for low income households in India
NASA Astrophysics Data System (ADS)
Rao, P. Sharath Chandra
In India, limited energy access and energy inequity hamper the lives of low income households. Traditional fuels such as firewood and dung cake account for 84 percent and 32 percent of the rural and urban household cooking energy (NSSO, 2007). With 412 million people without access to electricity in 2005, India hosts the world's largest such population (IEA, 2007). But, low income households still spend 9 - 11.7 percent1 of their incomes on inefficient forms of energy while wealthy households spend less than 5 percent on better energy products (Saghir, 2005). Renewable energy technologies coupled with innovative financial products can address the energy access problem facing the low income households in India (MacLean & Siegel, 2007; REEEP, 2009). Nevertheless, the low income households continue to face low access to mainstream finance for purchasing renewable energy technology at terms that meet their monthly energy related expenditure (ESMAP, 2004a; SEEP, 2008a) and low or no access to energy services (Ailawadi & Bhattacharyya, 2006; Modi et. al., 2006). The lack of energy-finance options has left the marginalized population with little means to break the dependence on traditional fuels. This dissertation proposes an energy microfinance intervention to address the present situation. It designed a loan product dedicated to the purchase of renewable energy technologies while taking into account the low and irregular cash flows of the low income households. The arguments presented in this dissertation are based on a six-month pilot project using this product designed and developed by the author in conjunction with a microfinance institution and its low income clients and Energy Service Companies in the state of Karnataka. Finding the right stakeholders and establishing a joint agreement, obtaining grant money for conducting the technology dissemination workshops and forming a clear procedure for commissioning the project, are the key lessons learnt from this study. 1The study was conducted by the author across 32 households having a monthly income of 99-199 in the town of Shimoga, Karnataka.
Physico-chemical characteristics of water samples of Bantwal Taluk, south-western Karnataka, India.
Smitha, P G; Byrappa, K; Ramaswamy, S N
2007-07-01
Quality of water is an important criterion for evaluating the suitability of water for irrigation and drinking. In the present study the analysis of water samples from different sources like open wells, bore wells, farm ponds and streams/rivers of twenty villages of Bantwal taluk of Dakshina Kannada district, South-western Kamataka has been carried out. The physico-chemical characteristics of this water showed that it is suitable for irrigation and agricultural purposes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sudha, P.; Shubhashree, D.; Khan, H.
2007-06-01
Setting a baseline for carbon stock changes in forest andland use sector mitigation projects is an essential step for assessingadditionality of the project. There are two approaches for settingbaselines namely, project-specific and regional baseline. This paperpresents the methodology adopted for estimating the land available formitigation, for developing a regional baseline, transaction cost involvedand a comparison of project-specific and regional baseline. The studyshowed that it is possible to estimate the potential land and itssuitability for afforestation and reforestation mitigation projects,using existing maps and data, in the dry zone of Karnataka, southernIndia. The study adopted a three-step approach for developing a regionalbaseline,more » namely: i) identification of likely baseline options for landuse, ii) estimation of baseline rates of land-use change, and iii)quantification of baseline carbon profile over time. The analysis showedthat carbon stock estimates made for wastelands and fallow lands forproject-specific as well as the regional baseline are comparable. Theratio of wasteland Carbon stocks of a project to regional baseline is1.02, and that of fallow lands in the project to regional baseline is0.97. The cost of conducting field studies for determination of regionalbaseline is about a quarter of the cost of developing a project-specificbaseline on a per hectare basis. The study has shown the reliability,feasibility and cost-effectiveness of adopting regional baseline forforestry sectormitigation projects.« less
Laboratory confirmation of rubella infection in suspected measles cases.
Vaidya, Sunil R; Raut, Chandrashekhar G; Jadhav, Santoshkumar M
2016-10-01
As a part of measles outbreak based surveillance undertaken by the World Health Organization India, suspected measles cases were referred for the laboratory diagnosis at National Institute of Virology (NIV) Pune and NIV Unit Bengaluru. Altogether, 4,592 serum samples were referred during 2010-2015 from the States of Karnataka (n = 1,173), Kerala (n = 559), and Maharashtra (n = 2,860). Initially, serum samples were tested in measles IgM antibody EIA and samples with measles negative and equivocal results (n = 1,954) were subjected to rubella IgM antibody detection. Overall, 62.9% (2,889/4,592) samples were laboratory confirmed measles, 27.7% (542/1,954) were laboratory confirmed rubella and remaining 25.2% (1,161/4,592) were negative for measles and rubella. The measles vaccination status was available for 1,206 cases. Among the vaccinated individuals, 50.7% (612/1,206) were laboratory confirmed measles. The contribution of laboratory confirmed measles was 493 (40.8%) from Maharashtra, 90 (7.5%) from Karnataka, and 29 (2.4%) from Kerala. Since, 1/3rd of suspected measles cases were laboratory confirmed rubella, an urgent attention needed to build rubella surveillance in India. Additional efforts are required to rule out other exanthematous disease including Dengue and Chikungunya in measles and rubella negatives. J. Med. Virol. 88:1685-1689, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Bellad, M B; Goudar, S S; Edlavitch, S A; Mahantshetti, N S; Naik, V; Hemingway-Foday, J J; Gupta, M; Nalina, H R; Derman, R; Moss, N; Kodkany, B S
2012-06-01
To determine whether consanguinity adversely influences pregnancy outcome in South India, where consanguinity is a common means of family property retention. Data were collected from a prospective cohort of 647 consenting women, consecutively registered for antenatal care between 14 and 18 weeks gestation, in Belgaum district, Karnataka in 2005. Three-generation pedigree charts were drawn for consanguineous participants. χ (2)-Test and Student's t-test were used to assess categorical and continuous data, respectively, using SPSS version 14. Multivariate logistic regression adjusted for confounding variables. Overall, 24.1% of 601 women with singleton births and outcome data were consanguineous. Demographic characteristics between study groups were similar. Non-consanguineous couples had fewer stillbirths (2.6 vs 6.9% P=0.017; adjusted P=0.050), miscarriages (1.8 vs 4.1%, P=0.097; adjusted P=0.052) and lower incidence of birth weight <2500 g (21.8 vs 29.5%, P=0.071, adjusted P=0.044). Gestation <37 weeks was 6.2% in both the groups. Adjusted for consanguinity and other potential confounders, age <20 years was protective of stillbirth (P=0.01), pregnancy loss (P=0.023) and preterm birth (P=0.013), whereas smoking (P=0.015) and poverty (P=0.003) were associated with higher rates of low birth weight. Consanguinity significantly increases pregnancy loss and birth weight <2500 g.
Empirical Analysis of the Variability of Wind Generation in India: Implications for Grid Integration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Phadke, Amol; Abhyankar, NIkit; Rao, Poorvi
We analyze variability in load and wind generation in India to assess its implications for grid integration of large scale wind projects using actual wind generation and load data from two states in India, Karnataka and Tamil Nadu. We compare the largest variations in load and net load (load ?wind, i.e., load after integrating wind) that the generation fleet has to meet. In Tamil Nadu, where wind capacity is about 53percent of the peak demand, we find that the additional variation added due to wind over the current variation in load is modest; if wind penetration reaches 15percent and 30percentmore » by energy, the additional hourly variation is less than 0.5percent and 4.5percent of the peak demand respectively for 99percent of the time. For wind penetration of 15percent by energy, Tamil Nadu system is found to be capable of meeting the additional ramping requirement for 98.8percent of the time. Potential higher uncertainty in net load compared to load is found to have limited impact on ramping capability requirements of the system if coal plants can me ramped down to 50percent of their capacity. Load and wind aggregation in Tamil Nadu and Karnataka is found to lower the variation by at least 20percent indicating the benefits geographic diversification. These findings suggest modest additional flexible capacity requirements and costs for absorbing variation in wind power and indicate that the potential capacity support (if wind does not generate enough during peak periods) may be the issue that has more bearing on the economics of integrating wind« less
2010-01-01
Background There is little research on HIV awareness and practices of traditional birth attendants (TBA) in India. This study investigated knowledge and attitudes among rural TBA in Karnataka as part of a project examining how traditional birth attendants could be integrated into prevention-of-mother-to-child transmission of HIV (PMTCT) programs in India. Methods A cross-sectional survey was conducted between March 2008 and January 2009 among TBA in 144 villages in Mysore Taluk, Karnataka. Following informed consent, TBA underwent an interviewer-administered questionnaire in the local language of Kannada on practices and knowledge around birthing and HIV/PMTCT. Results Of the 417 TBA surveyed, the median age was 52 years and 96% were Hindus. A majority (324, 77.7%) had no formal schooling, 88 (21.1%) had up to 7 years and 5 (1%) had more than 7 yrs of education. Only 51 of the 417 TBA (12%) reported hearing about HIV/AIDS. Of those who had heard about HIV/AIDS, only 36 (72%) correctly reported that the virus could be spread from mother to child; 37 (74%) identified unprotected sex as a mode of transmission; and 26 (51%) correctly said healthy looking people could spread HIV. Just 22 (44%) knew that infected mothers could lower the risk of transmitting the virus to their infants. An overwhelming majority of TBA (401, 96.2%) did not provide antenatal care to their clients. Over half (254, 61%) said they would refer the woman to a hospital if she bled before delivery, and only 53 (13%) felt referral was necessary if excessive bleeding occurred after birth. Conclusions Traditional birth attendants will continue to play an important role in maternal child health in India for the foreseeable future. This study demonstrates that a majority of TBA lack basic information about HIV/AIDS and safe delivery practices. Given the ongoing shortage of skilled birth attendance in rural areas, more studies are needed to examine whether TBA should be trained and integrated into PMTCT and maternal child health programs in India. PMID:20860835
Madhivanan, Purnima; Kumar, Bhavana N; Adamson, Paul; Krupp, Karl
2010-09-22
There is little research on HIV awareness and practices of traditional birth attendants (TBA) in India. This study investigated knowledge and attitudes among rural TBA in Karnataka as part of a project examining how traditional birth attendants could be integrated into prevention-of-mother-to-child transmission of HIV (PMTCT) programs in India. A cross-sectional survey was conducted between March 2008 and January 2009 among TBA in 144 villages in Mysore Taluk, Karnataka. Following informed consent, TBA underwent an interviewer-administered questionnaire in the local language of Kannada on practices and knowledge around birthing and HIV/PMTCT. Of the 417 TBA surveyed, the median age was 52 years and 96% were Hindus. A majority (324, 77.7%) had no formal schooling, 88 (21.1%) had up to 7 years and 5 (1%) had more than 7 yrs of education. Only 51 of the 417 TBA (12%) reported hearing about HIV/AIDS. Of those who had heard about HIV/AIDS, only 36 (72%) correctly reported that the virus could be spread from mother to child; 37 (74%) identified unprotected sex as a mode of transmission; and 26 (51%) correctly said healthy looking people could spread HIV. Just 22 (44%) knew that infected mothers could lower the risk of transmitting the virus to their infants. An overwhelming majority of TBA (401, 96.2%) did not provide antenatal care to their clients. Over half (254, 61%) said they would refer the woman to a hospital if she bled before delivery, and only 53 (13%) felt referral was necessary if excessive bleeding occurred after birth. Traditional birth attendants will continue to play an important role in maternal child health in India for the foreseeable future. This study demonstrates that a majority of TBA lack basic information about HIV/AIDS and safe delivery practices. Given the ongoing shortage of skilled birth attendance in rural areas, more studies are needed to examine whether TBA should be trained and integrated into PMTCT and maternal child health programs in India.
SWOT Analysis of Dental Health Workforce in India: A Dental alarm.
Halappa, Mythri; B H, Naveen; Kumar, Santhosh; H, Sreenivasa
2014-11-01
India faces an acute shortage of health personnel. Together with inequalities in distribution of health workers, dental health workers also become a part contributing to it impeding the progress towards achievement of the Millennium Development Goals. To assess dental health-workforce distribution, identify inequalities in dental health-workers provision and report the impact of this mal distribution in India. Situational analysis done by using the primary data from the records of Dental Council of India. In India, 0.088% of dental health worker per 1000 population exists. Inequalities in the distribution of dentists exist in India. Certain states are experiencing an acute shortage of dental health personnel whereas certain cities are over fledged with dentists like Karnataka, Maharastra, Tamilnadu being states with high concentration & Jharkhand, Rajasthan, Uttaranchal being the least. Although the production of health workers has expanded greatly in recent years by increase in number of dental colleges the problems of imbalances in their distribution persist. In the race of increasing dentist population ratio in total, inequitable distribution of appropriately trained, motivated and supported dentists gives a mere feel of saturation in jobs making youngsters to not to choose dentistry as a career giving an alarm.
Human trafficking for organ removal in India: a victim-centered, evidence-based report.
Budiani-Saberi, Debra A; Raja, Kallakurichi Rajendiran; Findley, Katie C; Kerketta, Ponsian; Anand, Vijay
2014-02-27
Enhancements in the national transplant law to prohibit commercial transplants in India have curbed the trade. Yet, the human rights abuse of human trafficking for organ removal (HTOR) continues in various transplant centers throughout India. Beginning in September 2010 until May 2012, in-depth interviews were conducted with 103 victims of HTOR in India in which victims described their experiences of a commercial kidney removal in compelling detail. Victims were located in Tamil Nadu, and reference is made to the broader study that included 50 additional victims in small towns and villages in West Bengal and Karnataka. Fourteen cases (14%) in Tamil Nadu and an additional 20 cases (40%) from West Bengal and Karnataka occurred between 2009 to May 2012. The cases in Tamil Nadu ranged in age from 19 to 55 years, with an average age of 33 years in Erode and 36 years in Chennai. Fifty-seven percent of the victims in Erode are female, and 87% of the victims in Chennai are female. Twelve percent of the individuals were widowed or abandoned, 79% were married, and 91% were parents with an average of two kids. Of those interviewed, 28% had no formal education, 19% had some primary schooling, 22% had some secondary schooling, and no individuals reported schooling above high school. All victims interviewed lived in abject poverty with monthly income levels well below the national average. The majority of victims reported long lasting health, economic, social, and psychological consequences. No matter the reason expressed for an organ sale, all victims reported that they would not have agreed to the organ removal if their economic circumstances were not so dire. One hundred percent of the victims interviewed expressed that they need assistance to cope with these consequences. Human trafficking for an organ removal continues in private transplant centers throughout India, service to foreign patients is ongoing, and victims' consequences are long lasting. A rights-based response to HTOR that invokes a universal commitment to prevent, protect, and suppress its continued practice is recommended. The United Nations Trafficking Protocol is the key international instrument to address trafficking of persons, including for organ removal. India has signed the UN Trafficking Protocol and should ratify it to better address this form of human trafficking.
Studies On Marine Wood-Borers Of Kali Estuary, Karwar, Karnataka, India
NASA Astrophysics Data System (ADS)
Sanagoudra, S. N.; Neelakanton, K. B.
2008-05-01
The damage caused to underwater timber construction in Marine environment by Molluscan and Crustaceans borers is well known and is of great economic significance to all maritime countries having an expanding shipping and fishing industry. Biodeterioration of marine structure, fishing crafts and living in mangrove vegetation is quite severe along the Karwar coast. The destruction is caused by atleast 14 species and 1 variety of borers belonging to the moluscan and crustacean families of the Teredinidae, Pholadidae and Sphaeromatidae. The following species have been so far recorded: Dicyathifer manni, Lyrodus pedicellaatus, L.Massa, Bankia rochi, B. campanellata, Mausitora hedleyi,Martesia striata, M.NMairi,Sphaeroma terebrans, S.annandalei, S. annandalei travancorensis. These borers, particularly, the molluscs have prodigenous fecundity producing enormous number of young ones in one brood. They have unlimited appetite attacking any type woodly materials exposed in the sea. They attack in heavy intensity and, because of their fast rate of growth, destroy timber with in a short time of few months. All this together with their other highly specialized. Adaptations make marine wood borers man's number one enemy in the sea. Along Karwar costs borer damage to timber structure is heavy throughout the year, highest in September to November and lowest in June and July. Ecological and biological aspects of the borers are also discussed. Ref: L.N.Shantakumaran, Sawant S.G., Nair N.B., Anil Angre, Nagabhushanan R. STUDIES ON MARINE WOOD-BORERS OF KALI ESTUARY, KARWAR, KARNATAKA, INDIA
Muralidharan, Shrikanth; Acharya, Arun Kumar; Margabandu, Shanthi; Purushotaman, Shalini; Kannan, Ranjit; Mahendrakar, Sangeeta; Kulkarni, Dinraj
2017-09-01
The aim of this study was to evaluate the stress and discrimination faced by human immunodeficiency virus (HIV)-affected adult patients on antiretroviral therapy (ART) for more than 1 year. A cross-sectional study was carried out among 170 adults on ART, reporting to the ART center of the District Civil Hospital, for more than 1 year in Raichur Taluk, Karnataka, India. Convenience sampling technique was followed. Descriptive statistics was performed (Chi-square test) using Statistical Package for the Social Sciences version 16.0. A total of 156 (91.8%) patients' families had knowledge about their seropositive status. Seventeen (10.9%) HIV-positive patients reported of change in the attitude of their family members. The main reasons for not revealing the HIV status were the internalized stigma and fear of rejection. Women faced greater discrimination from family, friends, and neighbors than men. It is necessary to not undermine the effect of rejection due to HIV. It is the only infection that has so many associated social and psychological norms which we need to tend at the earnest. Till date, there is an existence of condescendence toward treatment approach. The presence of stigma and the fear of being discriminated could be a major hurdle in the rehabilitation of these patients into the mainstream society. Furthermore, it serves as an existing challenge to ascertain these individuals to achieve overall health.
Aruna, D S; Prasad, K V V; Shavi, Girish R; Ariga, Jitendra; Rajesh, G; Krishna, Madhusudan
2011-01-01
Retrospective studies on oral cancer patient profiles related to risk habits could provide etiologic clues for prevention in specific geographic areas. To study risk habit characteristics of oral cancer patients. A cross sectional retrospective case record study of oral cancer patients who reported during 1991-2000 to Karnataka Cancer Therapy and Research Institute, Hubli, India was conducted. Data on socio-demography, histopathology, site of cancer and risk habit profiles of the patients were recorded in a predesigned Performa by one calibrated examiner with internal validity checks. The 1,472 oral cancer patients constituted 11% of total cancer patients. Mean age of the patients was 55 years, ranging from 12-88, with a male: female ratio of 2:1. 1,110 (75%) oral cancer patients had risk habits, 55% were habituated for >10 years and 25% were habit free. 751(51%) patients had individual and 359(24%) had combined risk habits. Majority 59% were chewers of betel quid alone (17%)/betel quid with tobacco (42%); smokers were (31%) and alcohol users were (14%) of patients. Chewers of gutkha, khaini were more in <40 years and betel quid in >40 years. Risk habituates were highest (87%) in patients with cancer of buccal mucosa, commonly affected site attributed to chewing habit in (51%) of patients. The prevalence of oral cancer was higher among elderly males predominantly with risk habits of betel quid/tobacco chewing and smoking for more than 10 years.
Shaikh, Alfiya; Nayak, Priyanka; Navada, Rajesh
2017-01-01
Introduction Globalization and urbanization have resulted in an increased demand on sand dredging. Legal and environmental restrictions on automated dredging have led to a rise in manual technique. The working techniques and environment involved in manual sand dredging may expose the workers to multiple work related disorders. Aim To determine the health risks and occupational hazards involved in manual sand dredging. Materials and Methods An assessment schedule was developed and content was validated by five experts for the study. A cross-sectional study was then conducted using this assessment schedule. Thirty manual sand dredgers were recruited from three randomly selected docks on Swarna riverbed in Udupi district, Karnataka, India. A detailed work and worksite assessments were conducted using systematic observation and close-ended questions. Work-related health risk evaluation included onsite-evaluation and self-reported health complains. Results The prevalence of musculoskeletal pain and discomfort was 93.34% with lower back (70%), shoulder (56.7%) and neck (46.7%) involvements being most common regions. Prevalence of sensory deficits at multiple site and ear pain was 66.6% and 76.6% respectively. All the workers recruited, complained of dermatological and ophthalmic involvements. Also, lack of health and safety measures like personal protective devices and security schemes were identified. Conclusion This study shows a high prevalence of multiple work-related disorders and hazards involved in manual sand dredging, a highly demanding job in coastal Karnataka. Lack of health and safety measures were also identified. PMID:28892936
Joshi, Rajesh K
2014-01-01
Ocimum basilicum L. (Lamiaceae) commonly known as sweet basil, has been used as a traditional medicinal plant for the treatment of headaches, coughs, diarrhea, constipation, warts, worms, and kidney malfunctions. The essential oil of the flowering aerial parts of O. basilicum growing in the Western Ghats region of North West Karnataka, India, was obtained by hydro-distillation and analyzed by gas chromatography equipped with flame ionization detector and gas chromatography coupled to mass spectrometry (GC-MS). The oil was tested against six Gram-positive, eight Gram-negative bacteria, and three fungi by the tube-dilution method at a concentration range of 5.00-0.009 mg/mL. Twenty-five constituents were identified in the essential oil of O. basilicum. The major constituents were identified as methyl eugenol (39.3%) and methyl chavicol (38.3%), accounting for 98.6% of the total oil. The oil was found to be active against Gram-positive, Gram-negative bacteria, and fungi with minimal bactericidal concentration values in the range of 0.143 ± 0.031 to 0.572 ± 0.127 mg/mL, 0.781 ± 0.382 to 1.875 ± 0.684 mg/mL, and 0.312 ± 0.171 to 0.442 ± 0.207 mg/mL, respectively. The essential oil of O. basilicum of this region contains methyl eugenol/methyl chavicol chemotype and has bactericidal properties.
Joshi, Rajesh K.
2014-01-01
Context: Ocimum basilicum L. (Lamiaceae) commonly known as sweet basil, has been used as a traditional medicinal plant for the treatment of headaches, coughs, diarrhea, constipation, warts, worms, and kidney malfunctions. Materials and Methods: The essential oil of the flowering aerial parts of O. basilicum growing in the Western Ghats region of North West Karnataka, India, was obtained by hydro-distillation and analyzed by gas chromatography equipped with flame ionization detector and gas chromatography coupled to mass spectrometry (GC–MS). The oil was tested against six Gram-positive, eight Gram-negative bacteria, and three fungi by the tube-dilution method at a concentration range of 5.00-0.009 mg/mL. Results: Twenty-five constituents were identified in the essential oil of O. basilicum. The major constituents were identified as methyl eugenol (39.3%) and methyl chavicol (38.3%), accounting for 98.6% of the total oil. The oil was found to be active against Gram-positive, Gram-negative bacteria, and fungi with minimal bactericidal concentration values in the range of 0.143 ± 0.031 to 0.572 ± 0.127 mg/mL, 0.781 ± 0.382 to 1.875 ± 0.684 mg/mL, and 0.312 ± 0.171 to 0.442 ± 0.207 mg/mL, respectively. Conclusion: The essential oil of O. basilicum of this region contains methyl eugenol/methyl chavicol chemotype and has bactericidal properties. PMID:25538349
NASA Astrophysics Data System (ADS)
Oommen, T.; Chatterjee, S.
2017-12-01
NASA and the Indian Space Research Organization (ISRO) are generating Earth surface features data using Airborne Visible/Infrared Imaging Spectrometer-Next Generation (AVIRIS-NG) within 380 to 2500 nm spectral range. This research focuses on the utilization of such data to better understand the mineral potential in India and to demonstrate the application of spectral data in rock type discrimination and mapping for mineral exploration by using automated mapping techniques. The primary focus area of this research is the Hutti-Maski greenstone belt, located in Karnataka, India. The AVIRIS-NG data was integrated with field analyzed data (laboratory scaled compositional analysis, mineralogy, and spectral library) to characterize minerals and rock types. An expert system was developed to produce mineral maps from AVIRIS-NG data automatically. The ground truth data from the study areas was obtained from the existing literature and collaborators from India. The Bayesian spectral unmixing algorithm was used in AVIRIS-NG data for endmember selection. The classification maps of the minerals and rock types were developed using support vector machine algorithm. The ground truth data was used to verify the mineral maps.
Prakash, Ravi; Isac, Shajy; Washington, Reynold; Halli, Shiva S.
2016-01-01
Background In Indian context, limited attempts have been made to estimate the mortality risks among people living with HIV (PLHIV). We estimated the rates of mortality among PLHIV covered under an integrated HIV-prevention cum care and support programme implemented in Karnataka state, India, and attempted to identify the key programme components associated with the higher likelihood of their survival. Methods Retrospective programme data of 55,801 PLHIV registered with the Samastha programme implemented in Karnataka state during 2006–11 was used. Kaplan-Meier survival methods were used to estimate the ten years expected survival probabilities and Cox-proportional hazard model was used to examine the factors associated with risk of mortality among PLHIV. We also calculated mortality rates (per 1000 person-year) across selected demographic and clinical parameters. Results Of the total PLHIV registered with the programme, about nine percent died within the 5-years of programme period with an overall death rate of 38 per 1000 person-years. The mortality rate was higher among males, aged 18 and above, among illiterates, and those residing in rural areas. While the presence of co-infections such as Tuberculosis leads to higher mortality rate, adherence to ART was significantly associated with reduction in overall death rate. Cox proportional hazard model revealed that increase in CD4 cell counts and exposure to intensive care and support programme for at least two years can bring significant reduction in risk of death among PLHIV [(hazard ratio: 0.234; CI: 0.211–0.260) & (hazard ratio: 0.062; CI: 0.054–0.071), respectively] even after adjusting the effect of other socio-demographic, economic and health related confounders. Conclusion Study confirms that while residing in rural areas and presence of co-infection significantly increases the mortality risk among PLHIV, adherence to ART and improvement in CD4 counts led to significant reduction in their mortality risk. Longer exposure to the intervention contributed significantly to reduce mortality among PLHIV. PMID:27253974
Shobharani, M; Viraktamath, C A; Webb, M D
2018-01-02
Species of the leafhopper genus Penthimia Germar known from the Indian subcontinent are reviewed based on the examination of type specimens. Seven new species of the genus, Penthimia curvata sp. nov. (Karnataka: Bandipur), P. meghalayensis sp. nov. (Meghalaya: Nangpoh), P. neoattenuata sp. nov. (India: Tamil Nadu), P. ribhoi sp. nov. (India: Meghalaya), P. sahyadrica sp. nov. (Karnataka: Dharmasthala, Agumbe; Kerala: Thekkady), P. spiculata sp. nov. (Karnataka: Nagarahole) and P. tumida sp. nov. (Tamil Nadu: Ootacamund; Kerala: Munnar) are described. The following nomenclatorial changes are proposed: Penthimia alba Zahniser, McKamey Dmitriev, 2012 (replacement name for P. thoracica Distant, 1918, nec Panzer, 1799), syn. nov. of P. quadrinotata Distant, 1918; Neodartus scutellatus Distant, 1908 syn. nov. of Penthimia ereba Distant 1908; P. nilgiriensis Distant, 1918 syn. nov. of P. montana Distant, 1918; P. scutellata (Distant) comb. nov. (from genus Neodartus); a lectotype is designated for P. maculosa Distant, stat. revived, thereby removing its synonymy with P. scapularis Distant. The following other lectotypes are designated: P. attenuata Distant, P. subniger Distant, P. scapularis Distant, P. distanti Baker, P. ereba Distant, N. scutellatus Distant, P. fraterna Distant, P. funebris Distant, P. juno Distant, P. maculosa Distant, P. montana Distant, P. noctua Distant, P. quadrinotata Distant, P. alba Zahniser, McKamey Dmitriev. Examination of types of Penthimia rufopunctata Motschulsky revealed that it belongs to Penthimia and hence it is transferred back to that genus from Neodartus, revised placement. The following species previously included in the genus Penthimia are transferred to the genera Tambila Distant and Vulturnus Kirkaldy: Tambila badia (Distant) comb. nov., T. majuscula (Distant) comb. nov., T. vittatifrons (Distant) comb. nov., T. variabilis (Distant) comb. nov. and Vulturnus flavocapitata (Distant) comb. nov. Three species are treated in a new Penthimia compacta Walker complex, i.e., Penthimia compacta Walker 1851, Penthimia subniger Distant 1908 and Penthimia scapularis Distant 1908. All taxa are described and a key to Penthimiini genera found in the subcontinent and also a key to species of Penthimia are included.
Determinants of condom breakage among female sex workers in Karnataka, India.
Bradley, Janet; Rajaram, S; Alary, Michel; Isac, Shajy; Washington, Reynold; Moses, Stephen; Ramesh, B M
2011-12-29
Condoms are effective in preventing the transmission of HIV and other sexually transmitted infections, when properly used. However, recent data from surveys of female sex workers (FSWs) in Karnataka in south India, suggest that condom breakage rates may be quite high. It is important therefore to quantify condom breakage rates, and examine what factors might precipitate condom breakage, so that programmers can identify those at risk, and develop appropriate interventions. We explored determinants of reported condom breakage in the previous month among 1,928 female sex workers in four districts of Karnataka using data from cross-sectional surveys undertaken from July 2008 to February 2009. Using stepwise multivariate logistic regression, we examined the possible determinants of condom breakage, controlling for several independent variables including the district and client load. Overall, 11.4% of FSWs reported at least one condom break in the previous month. FSWs were much more likely to report breakage if under 20 years of age (AOR 3.43, p = 0.005); if divorced/ separated/widowed (AOR 1.52, p = 0.012); if they were regular alcohol users (AOR 1.63, p = 0.005); if they mostly entertained clients in lodges/rented rooms (AOR 2.99, p = 0.029) or brothels (AOR 4.77, p = 0.003), compared to street based sex workers; if they had ever had anal sex (AOR 2.03, p = 0.006); if the sex worker herself (as opposed to the client) applied the condom at last use (AOR 1.90, p < 0.001); if they were inconsistent condom users (AOR 2.77, p < 0.001); and if they had never seen a condom demonstration (AOR 2.37, p < 0.001). The reported incidence of condom breakage was high in this study, and this is a major concern for HIV/STI prevention programs, for which condom use is a key prevention tool. Younger and more marginalized female sex workers were most vulnerable to condom breakage. Special effort is therefore required to seek out such women and to provide information and skills on correct condom use. More research is also needed on what specific situational parameters might be important in predisposing women to condom breakage.
Govindaraj, G; Krishnamoorthy, P; Nethrayini, K R; Shalini, R; Rahman, H
2017-09-01
The epidemiological features and financial losses due to Haemorrhagic Septicemia (HS) in bovines were studied in Karnataka state using the primary data collected from 133 clinically diagnosed HS affected farms. The various losses due to HS and the Benefit- Cost of the vaccination programme in cattle and water buffaloes were studied using mathematical models. The number of HS outbreaks were higher during the year 2002 and peaked during 2005 and thereafter declined due to targeted vaccination against HS. The morbidity and mortality risks were lower in large farms than medium and small farms, and lower in indigenous cattle compared to high yielding crossbred cattle and water buffaloes. The disease occurrence was more in in-milk animals causing serious economic loss to the farmers. Most outbreaks were observed during monsoon season, though the disease was prevalent throughout the year. The mean milk loss per animal was $2, $11 and $50 in indigenous cattle, water buffaloes and crossbred cattle, respectively. In the case of draught animals, the average effective draught power was unavailable for 1.2days/outbreak resulting in a loss of $5 per affected oxen. The treatment and extra labor expenses incurred per animal were $24 and $7, respectively. The average loss per animal due to mortality loss was $275, $284 and $415 in case of indigenous cattle, water buffaloes and crossbred cattle, respectively. The projected loss for the state of Karnataka were $23.89, $17.92 and $11.95 million under high, medium and low HS incidence scenarios, respectively. The Benefit Cost Analysis (BCA) of the vaccination against HS has been estimated at 5.97:1, 4.48:1 and 2.98:1 under high, medium and low incidence scenarios, respectively. The results highlight the important epidemiological features and financial losses to the affected households and the state of Karnataka. Copyright © 2017 Elsevier B.V. All rights reserved.
The Female Sex Work Industry in a District of India in the Context of HIV Prevention
Buzdugan, Raluca; Halli, Shiva S.; Hiremath, Jyoti M.; Jayanna, Krishnamurthy; Raghavendra, T.; Moses, Stephen; Blanchard, James; Scambler, Graham; Cowan, Frances
2012-01-01
HIV prevalence in India remains high among female sex workers. This paper presents the main findings of a qualitative study of the modes of operation of female sex work in Belgaum district, Karnataka, India, incorporating fifty interviews with sex workers. Thirteen sex work settings (distinguished by sex workers' main places of solicitation and sex) are identified. In addition to previously documented brothel, lodge, street, dhaba (highway restaurant), and highway-based sex workers, under-researched or newly emerging sex worker categories are identified, including phone-based sex workers, parlour girls, and agricultural workers. Women working in brothels, lodges, dhabas, and on highways describe factors that put them at high HIV risk. Of these, dhaba and highway-based sex workers are poorly covered by existing interventions. The paper examines the HIV-related vulnerability factors specific to each sex work setting. The modes of operation and HIV-vulnerabilities of sex work settings identified in this paper have important implications for the local programme. PMID:23346389
The Female Sex Work Industry in a District of India in the Context of HIV Prevention.
Buzdugan, Raluca; Halli, Shiva S; Hiremath, Jyoti M; Jayanna, Krishnamurthy; Raghavendra, T; Moses, Stephen; Blanchard, James; Scambler, Graham; Cowan, Frances
2012-01-01
HIV prevalence in India remains high among female sex workers. This paper presents the main findings of a qualitative study of the modes of operation of female sex work in Belgaum district, Karnataka, India, incorporating fifty interviews with sex workers. Thirteen sex work settings (distinguished by sex workers' main places of solicitation and sex) are identified. In addition to previously documented brothel, lodge, street, dhaba (highway restaurant), and highway-based sex workers, under-researched or newly emerging sex worker categories are identified, including phone-based sex workers, parlour girls, and agricultural workers. Women working in brothels, lodges, dhabas, and on highways describe factors that put them at high HIV risk. Of these, dhaba and highway-based sex workers are poorly covered by existing interventions. The paper examines the HIV-related vulnerability factors specific to each sex work setting. The modes of operation and HIV-vulnerabilities of sex work settings identified in this paper have important implications for the local programme.
Shet, Arun S; Rao, Abha; Jebaraj, Paul; Mascarenhas, Maya; Zwarenstein, Merrick; Galanti, Maria Rosaria; Atkins, Salla
2017-09-18
Lay health workers (LHWs) are increasingly used to complement health services internationally. Their perceptions of the interventions they implement and their experiences in delivering community based interventions in India have been infrequently studied. We developed a novel LHW led intervention to improve anemia cure rates in rural community dwelling children attending village day care centers in South India. Since the intervention is delivered by the village day care center LHW, we sought to understand participating LHWs' acceptance of and perspectives regarding the intervention, particularly in relation to factors affecting daily implementation. We conducted a qualitative study alongside a cluster randomized controlled trial evaluating a complex community intervention for childhood anemia control in Karnataka, South India. Focus group discussions (FGDs) were conducted with trained LHWs assigned to deliver the educational intervention. These were complemented by non-participant observations of LHWs delivering the intervention. Transcripts of the FGDs were translated and analyzed using the framework analysis method. Several factors made the intervention acceptable to the LHWs and facilitated its implementation including pre-implementation training modules, intervention simplicity, and ability to incorporate the intervention into the routine work schedule. LHWs felt that the intervention impacted negatively on their preexisting workload. Fluctuating relationships with mothers weakened the LHWs position as providers of the intervention and hampered efficient implementation, despite the LHWs' highly valued position in the community. Modifiable barriers to the successful implementation of this intervention were seen at two levels. At a broader contextual level, hindering factors included the LHW being overburdened, inadequately reimbursed, and receiving insufficient employer support. At the health system level, lack of streamlining of LHW duties, inability of LHWs to diagnose anemia and temporary shortfalls in the availability of iron supplements constituted potentially modifiable barriers. This qualitative study identified some of the practical challenges as experienced by LHWs while delivering a community health intervention in India. Methodologically, it highlights the value of qualitative research in understanding implementation of complex community interventions. On the contextual level, the results indicate that efficient delivery of community interventions will require streamlining of LHW workloads and improved health system infrastructure support. This trial was registered with ISRCTN.com (identifier: ISRCTN68413407 ) on 23 September 2013.
Shaw, Souradet Y; Deering, Kathleen N; Reza-Paul, Sushena; Isac, Shajy; Ramesh, Banadakoppa M; Washington, Reynold; Moses, Stephen; Blanchard, James F
2011-12-29
Studies have demonstrated the significance of commercial sex work in the ongoing transmission of HIV and other sexually transmitted infections (STIs) in India. Clients of female sex workers (FSWs) are thought to be an important bridging population for HIV/STIs. However, there is a lack of information on basic characteristics of sex work clients. This study sought to describe the prevalence of HIV and other STIs, as well as examine the determinants of these pathogens among a sample of clients in south India. Data were from a cross-sectional biological and behavioural survey of FSW clients from six districts in Karnataka State, India. The prevalence of HIV, syphilis, herpes simplex virus type 2 (HSV-2), chlamydia (CT) and gonorrhoea (NG) among clients was examined. Multivariable logistic regression models were used to analyse the socio-demographic, sexual behaviour and sex-work related characteristics related to the prevalence of each pathogen. Sampling weights and appropriate survey methods were utilized in regression models to account for complex sampling design. The total sample size was 2,745. The average age of clients was 30.4 (SE:0.3). Across the total sample, the prevalence of HIV, HSV-2, syphilis and CT/NG was 5.6%, 28.4%, 3.6% and 2.2%, respectively. The prevalence of HIV/STIs varied substantially across districts, reaching statistical significance for HIV (p<.0001) and CT/NG (p=.005). In multivariable models, duration of paying for commercial sex was associated with increased risk for HIV and HSV-2 (AOR: 1.1; 95%CI: 1.0-1.1, p<.0001). Clients with brothels as a main FSW solicitation site were associated with increased risk of HIV (AOR: 2.4; 95%CI: 1.2-4.7, p=.001), while those frequenting lodges were at increased risk for CT/NG (AOR: 6.3; 95%CI: 1.9-20.6, p=.03). Examining co-infections, clients with HSV-2 infections were at substantially higher risk of being HIV-positive (AOR: 10.4; 95%CI: 6.1-17.7, p<.0001). This study fills in important gaps in knowledge regarding clients in southern India. The strong association between HIV and HSV-2 infections highlights the complications in designing effective prevention, intervention and management programs of this well-hidden population.
2011-01-01
Background Studies have demonstrated the significance of commercial sex work in the ongoing transmission of HIV and other sexually transmitted infections (STIs) in India. Clients of female sex workers (FSWs) are thought to be an important bridging population for HIV/STIs. However, there is a lack of information on basic characteristics of sex work clients. This study sought to describe the prevalence of HIV and other STIs, as well as examine the determinants of these pathogens among a sample of clients in south India. Methods Data were from a cross-sectional biological and behavioural survey of FSW clients from six districts in Karnataka State, India. The prevalence of HIV, syphilis, herpes simplex virus type 2 (HSV-2), chlamydia (CT) and gonorrhoea (NG) among clients was examined. Multivariable logistic regression models were used to analyse the socio-demographic, sexual behaviour and sex-work related characteristics related to the prevalence of each pathogen. Sampling weights and appropriate survey methods were utilized in regression models to account for complex sampling design. Results The total sample size was 2,745. The average age of clients was 30.4 (SE:0.3). Across the total sample, the prevalence of HIV, HSV-2, syphilis and CT/NG was 5.6%, 28.4%, 3.6% and 2.2%, respectively. The prevalence of HIV/STIs varied substantially across districts, reaching statistical significance for HIV (p<.0001) and CT/NG (p=.005). In multivariable models, duration of paying for commercial sex was associated with increased risk for HIV and HSV-2 (AOR: 1.1; 95%CI: 1.0-1.1, p<.0001). Clients with brothels as a main FSW solicitation site were associated with increased risk of HIV (AOR: 2.4; 95%CI: 1.2-4.7, p=.001), while those frequenting lodges were at increased risk for CT/NG (AOR: 6.3; 95%CI: 1.9-20.6, p=.03). Examining co-infections, clients with HSV-2 infections were at substantially higher risk of being HIV-positive (AOR: 10.4; 95%CI: 6.1-17.7, p<.0001). Conclusions This study fills in important gaps in knowledge regarding clients in southern India. The strong association between HIV and HSV-2 infections highlights the complications in designing effective prevention, intervention and management programs of this well-hidden population. PMID:22375691
Determination of elements in ayurvedic medicinal plants by AAS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Teerthe, Santoshkumar S.; Kerur, B. R., E-mail: kerurbrk@yahoo.com
India has a rich country for the uses of Ayurvedic medicinal plants for treatment and also the north- Karnataka boasts an unparallel diversity of medicinal plants. The present study attempts to estimate and compare the level of trace and heavy metals in some selected leaves and root samples of Ayurvedic medicinal plants such as Mg, Al, K, Cr, Mn, Fe, Cu, Zn, and Cd. The samples are collected from different places of North-Karnataka regions and sample solutions prepared as the ratio of 1:25:25+950ml=1000ppm.the trace and heavy elemental concentration was estimated using Atomic Absorption Spectrometric (AAS) Method. The average concentrations ofmore » Mg, Mn, Fe and Zn, are ranging from 2ppm to 5250.2ppm and potassium (K) has more concentration as compare to all other. The other elements likes Al, Cr, Cu, and Cd were also estimed and presented in the table. Therefore, these medicinal plants are rich in some essential minerals, especially K, Mg, Mn, Fe and Zn which are essential for human health.« less
Kiran, K R; Ravi, M V; Dhanya, B; Janagoudar, B S; Umesh, M R; Narayanarao, K
2016-09-01
In the present study, ambient air quality was monitored during July to November 2013 in the vicinity of Bellary Thermal Power Station (BTPS), Karnataka to assess the impact of pollutants emitted from power plant on the productivity of maize (Zea mays L.). Atmospheric pollutant load were measured in five different villages at varying distances and directions from thermal power plant, with the village farthest away from BTPS (Yelubenchi) as control. Maize yield was also estimated in these locations and correlated to the pollutant concentrations. It was found that, both particulate matter and SO2 which are indicators of emissions from coal-fueled power plants were highest in Thimmalapur village located in the predominant down wind direction. A significant reduction in maize yield was noticed (8197 to 6509 kg ha-1 for seed and 14041 to 9933 kg ha-1 for stover) across the gradient in distance and direction from BTPS which might be influenced by the pollutants emitted. The implications of these observations are further discussed in the paper.
Kini, Sanjay; Kamath, Veena G; Kulkarni, Muralidhar M; Kamath, Asha; Shivalli, Siddharudha
2016-01-01
According to Joint National Committee-7 (JNC-7) guidelines, a systolic blood pressure (SBP) of 120 to 139 mm Hg and/or diastolic blood pressure (DBP) of 80 to 89 mm Hg is considered as pre-hypertension. Existing evidence suggest that the cardiovascular morbidities are increasing among pre-hypertensive individuals compared to normal. To assess the magnitude and factors associated with pre-hypertension among young adults (20-30 years) in coastal villages of Udupi Taluk (an area of land with a city or town that serves as its administrative centre and usually a number of villages), Udupi District, Karnataka state, India. Community based cross sectional study. 6 (out of total 14) coastal villages of Udupi Taluk, Karnataka state, India. 1,152 young adults (age group: 20-30 years) selected by stratified random sampling in 6 coastal villages of Udupi Taluk, Karnataka state, India. A semi structured pre-tested questionnaire was used to elicit the details on socio-demographic variables, dietary habits, tobacco use, alcohol consumption, physical activity, family history of hypertension and stress levels. Anthropometric measurements and blood pressure were recorded according to standard protocols. Serum cholesterol was measured in a sub sample of the study population. Multivariate logistic regression was applied to identify the independent correlates of pre-hypertension among young adults (20-30 years). Prevalence, Odds ratio (OR) and adjusted (adj) OR for pre-hypertension among young adults (20-30 years). The prevalence of pre-hypertension in the study population was 45.2% (95%CI: 42.4-48). Multivariate logistic regression analysis revealed that age group of 25-30 years (adj OR: 4.25, 95% CI: 2.99-6.05), white collared (adj OR: 2.29, 95% CI: 1.08-4.85) and skilled occupation (adj OR: 3.24, 95% CI: 1.64-6.42), students (adj OR: 2.46, 95% CI: 1.22-4.95), using refined cooking oil (adj OR: 0.53, 95% CI: 0.29-0.95), extra salt in meals (adj OR: 2.46, 95% CI: 1.52-3.99), salty food items (adj OR: 6.99, 95% CI: 3.63-13.48), pre-obese (adj OR: 1.66, 95% CI: 1.03-2.67) and obese (adj OR: 9.16, 95% CI: 2.54, 36.4) were the significant correlates of pre-hypertension. In the study population, prevalence of pre-hypertension among young adults (20-30 years) was high (45.2%). Biological (age 25-30 years, pre-obesity and obesity) and behavioral (sedentary occupation, intake of extra salt in meals/salty food and not using refined cooking oil) factors were associated with pre-hypertension. Study emphasizes the need of community based screening of pre-hypertension under National Rural Health Mission. It also provides apt information for the evidence based designing of interventions for lifestyle modifications among high risk young adults in the study area.
Shivalli, Siddharudha; Gururaj, Nandihal
2015-01-01
Postnatal depression (PND) is one of the most common psychopathology and is considered as a serious public health issue because of its devastating effects on mother, family, and infant or the child. To elicit socio-demographic, obstetric and pregnancy outcome predictors of Postnatal Depression (PND) among rural postnatal women in Karnataka state, India. Hospital based analytical cross sectional study. A rural tertiary care hospital of Mandya District, Karnataka state, India. PND prevalence based estimated sample of 102 women who came for postnatal follow up from 4th to 10th week of lactation. Study participants were interviewed using validated kannada version of Edinburgh Postnatal Depression Scale (EPDS). Cut-off score of ≥ 13 was used as high risk of PND. The percentage of women at risk of PND was estimated, and differences according to socio-demographic, obstetric and pregnancy outcome were described. Logistic regression was applied to identify the independent predictors of PND risk. Prevalence, Odds ratio (OR) and adjusted (adj) OR of PND. Prevalence of PND was 31.4% (95% CI 22.7-41.4%). PND showed significant (P < 0.05) association with joint family, working women, non-farmer husbands, poverty, female baby and pregnancy complications or known medical illness. In binomial logistic regression poverty (adjOR: 11.95, 95% CI:1.36-105), birth of female baby (adjOR: 3.6, 95% CI:1.26-10.23) and pregnancy complications or known medical illness (adjOR: 17.4, 95% CI:2.5-121.2) remained as independent predictors of PND. Risk of PND among rural postnatal women was high (31.4%). Birth of female baby, poverty and complications in pregnancy or known medical illness could predict the high risk of PND. PND screening should be an integral part of postnatal care. Capacity building of grass root level workers and feasibility trials for screening PND by them are needed.
Deepak, Nitya Nand; Mirzabagi, Ellie; Koski, Alissa; Tripathi, Vandana
2013-01-01
Background and Objectives India has the highest annual number of maternal deaths of any country. As obstetric hemorrhage is the leading cause of maternal death in India, numerous efforts are under way to promote access to skilled attendance at birth and emergency obstetric care. Current initiatives also seek to increase access to active management of the third stage of labor for postpartum hemorrhage prevention, particularly through administration of an uterotonic after delivery. However, prior research suggests widespread inappropriate use of uterotonics at facilities and in communities–for example, without adequate monitoring or referral support for complications. This qualitative study aimed to document health providers’ and community members’ current knowledge, attitudes, and practices regarding uterotonic use during labor and delivery in India’s Karnataka state. Methods 140 in-depth interviews were conducted from June to August 2011 in Bagalkot and Hassan districts with physicians, nurses, recently delivered women, mothers-in-law, traditional birth attendants (dais), unlicensed village doctors, and chemists (pharmacists). Results Many respondents reported use of uterotonics, particularly oxytocin, for labor augmentation in both facility-based and home-based deliveries. The study also identified contextual factors that promote inappropriate uterotonic use, including high value placed on pain during labor; perceived pressure to provide or receive uterotonics early in labor and delivery, perhaps leading to administration of uterotonics despite awareness of risks; and lack of consistent and correct knowledge regarding safe storage, dosing, and administration of oxytocin. Conclusions These findings have significant implications for public health programs in a context of widespread and potentially increasing availability of uterotonics. Among other responses, efforts are needed to improve communication between community members and providers regarding uterotonic use during labor and delivery and to target training and other interventions to address identified gaps in knowledge and ensure that providers and pharmacists have up-to-date information regarding proper usage of uterotonic drugs. PMID:23638148
Persistence of azoxystrobin in/on grapes and soil in different grapes growing areas of India.
Gajbhiye, Vijay Tularam; Gupta, Suman; Mukherjee, Irani; Singh, Shashi Bala; Singh, Neera; Dureja, Prem; Kumar, Yogesh
2011-01-01
Persistence of azoxystrobin was studied in/on grapes when applied @ 150 g ai ha⁻¹ (recommended dose) and 300 g ai ha⁻¹ (double the recommended dose) in three grapes growing states of India, namely Karnataka, Maharashtra and Tamil Nadu, in the year 2006-2007. A total of five sprays were given at an interval of about 15 days. Grapes and soil samples were collected after 5th spray, extracted and analysed by gas chromatography using electron capture detector. Half life of azoxystrobin on grapes varied from 5.4 to 11.2 days. Residues of azoxystrobin were much below the prescribed MRL (0.5 mg kg⁻¹) after 21 days. The dissipation of azoxystrobin in soil followed first order rate kinetics with an average half life of 8.1 days at the recommended dose of application.
Conway, Declan; Dessai, Suraje; Stainforth, David A.
2018-01-01
Abstract Decision‐Making Under Uncertainty (DMUU) approaches have been less utilized in developing countries than developed countries for water resources contexts. High climate vulnerability and rapid socioeconomic change often characterize developing country contexts, making DMUU approaches relevant. We develop an iterative multi‐method DMUU approach, including scenario generation, coproduction with stakeholders and water resources modeling. We apply this approach to explore the robustness of adaptation options and pathways against future climate and socioeconomic uncertainties in the Cauvery River Basin in Karnataka, India. A water resources model is calibrated and validated satisfactorily using observed streamflow. Plausible future changes in Indian Summer Monsoon (ISM) precipitation and water demand are used to drive simulations of water resources from 2021 to 2055. Two stakeholder‐identified decision‐critical metrics are examined: a basin‐wide metric comprising legal instream flow requirements for the downstream state of Tamil Nadu, and a local metric comprising water supply reliability to Bangalore city. In model simulations, the ability to satisfy these performance metrics without adaptation is reduced under almost all scenarios. Implementing adaptation options can partially offset the negative impacts of change. Sequencing of options according to stakeholder priorities into Adaptation Pathways affects metric satisfaction. Early focus on agricultural demand management improves the robustness of pathways but trade‐offs emerge between intrabasin and basin‐wide water availability. We demonstrate that the fine balance between water availability and demand is vulnerable to future changes and uncertainty. Despite current and long‐term planning challenges, stakeholders in developing countries may engage meaningfully in coproduction approaches for adaptation decision‐making under deep uncertainty. PMID:29706676
Bhave, Ajay Gajanan; Conway, Declan; Dessai, Suraje; Stainforth, David A
2018-02-01
Decision-Making Under Uncertainty (DMUU) approaches have been less utilized in developing countries than developed countries for water resources contexts. High climate vulnerability and rapid socioeconomic change often characterize developing country contexts, making DMUU approaches relevant. We develop an iterative multi-method DMUU approach, including scenario generation, coproduction with stakeholders and water resources modeling. We apply this approach to explore the robustness of adaptation options and pathways against future climate and socioeconomic uncertainties in the Cauvery River Basin in Karnataka, India. A water resources model is calibrated and validated satisfactorily using observed streamflow. Plausible future changes in Indian Summer Monsoon (ISM) precipitation and water demand are used to drive simulations of water resources from 2021 to 2055. Two stakeholder-identified decision-critical metrics are examined: a basin-wide metric comprising legal instream flow requirements for the downstream state of Tamil Nadu, and a local metric comprising water supply reliability to Bangalore city. In model simulations, the ability to satisfy these performance metrics without adaptation is reduced under almost all scenarios. Implementing adaptation options can partially offset the negative impacts of change. Sequencing of options according to stakeholder priorities into Adaptation Pathways affects metric satisfaction. Early focus on agricultural demand management improves the robustness of pathways but trade-offs emerge between intrabasin and basin-wide water availability. We demonstrate that the fine balance between water availability and demand is vulnerable to future changes and uncertainty. Despite current and long-term planning challenges, stakeholders in developing countries may engage meaningfully in coproduction approaches for adaptation decision-making under deep uncertainty.
Bhattacharjee, Parinita; Campbell, Linda; Thalinja, Raghavendra; Nair, Sapna; Doddamane, Mahesh; Ramanaik, Satyanarayana; Isac, Shajy; Beattie, Tara S
2018-04-01
While traditional HIV prevention programs with female sex workers (FSWs) in Karnataka, India, have focused on reducing HIV transmission between FSWs and clients through increased condom use, these programs have not fully addressed the transmission risk between FSWs and their nonpaying intimate partners (IPs). Condom use is infrequent and violence is recurrent in these relationships: Furthermore, there is little evidence on the precise nature of FSW-IP relationships. Our study addresses this knowledge gap to inform HIV programs targeted at FSWs. A series of workshops, using participatory tools, was held to explore FSW-IP relationships; 31 FSWs and 37 IPs participated. Three aspects of FSW-IP relationships were examined: how FSWs and IPs understand and interpret their relationships, factors influencing condom use, and the role of violence and its consequences. FSWs wish to be perceived as their IPs' wives, while IPs expect their FSW partners to accept their dominance in the relationship. Nonuse of condoms signals fidelity and elevates the status of the relationship almost to that of marriage, which helps FSWs enter the category of "good" (married) women. Tolerating and accepting violence in these relationships is normative, as in other marital relationships; IPs justify violence as necessary to establish and maintain their power within the relationship. Both FSWs and IPs value their relationships despite the high degree of risk posed by low condom use and high levels of violence. Implications for program design include addressing current norms around masculinity and gender roles, and improving communication within relationships.
Detection of Genital HPV Infection Using Urine Samples: a Population Based Study in India.
Sabeena, Sasidharanpillai; Bhat, Parvati; Kamath, Veena; Mathew, Mary; Aswathyraj, Sushama; Devadiga, Santhosha; Prabhu, Suresha; Hindol, Maity; Chameetachal, Akhil; Krishnan, Anjana; Arunkumar, Govindakarnavar
2016-01-01
Cervical cancer is the second commonest cancer among Indian women and its association with human papilloma virus (HPV) is well established. This preventable cancer accounts for the maximum number of cancer related deaths among rural Indian women. Unlike in developed countries there are no organized cervical cancer screening programmes in India due to lack of resources and manpower. To detect genital HPV infection using urine samples among asymptomatic rural women in the age group of 18-65 years. The study area chosen was Perdoor village in Udupi Taluk, Karnataka State and all the women in the age group of 18-65 years formed the study cohort. A cross sectional study was conducted by house visits and 1,305 women were enrolled in the study. After taking written informed consent a data sheet was filled and early stream random urine samples were collected, transported to a laboratory at 4OC and aliquoted. Samples were tested using nested HPV PCR with PGMY09/11 and GP5+/6+ primers. Positive cases were genotyped by sequence analysis. Study participants included 1,134 sexually active and 171 unmarried women with a mean age at marriage of 22.1 (SD=3.9) years. Study area showed high female literacy rate of 86.6%. Five urine samples tested positive for HPV DNA (0.4%). We found very low genital HPV infection rate among women from monogamous community. This is the first major population based study carried out among asymptomatic rural women to detect genital HPV infectio from Karnataka using urine samples.
NASA Astrophysics Data System (ADS)
Bhave, Ajay Gajanan; Conway, Declan; Dessai, Suraje; Stainforth, David A.
2018-02-01
Decision-Making Under Uncertainty (DMUU) approaches have been less utilized in developing countries than developed countries for water resources contexts. High climate vulnerability and rapid socioeconomic change often characterize developing country contexts, making DMUU approaches relevant. We develop an iterative multi-method DMUU approach, including scenario generation, coproduction with stakeholders and water resources modeling. We apply this approach to explore the robustness of adaptation options and pathways against future climate and socioeconomic uncertainties in the Cauvery River Basin in Karnataka, India. A water resources model is calibrated and validated satisfactorily using observed streamflow. Plausible future changes in Indian Summer Monsoon (ISM) precipitation and water demand are used to drive simulations of water resources from 2021 to 2055. Two stakeholder-identified decision-critical metrics are examined: a basin-wide metric comprising legal instream flow requirements for the downstream state of Tamil Nadu, and a local metric comprising water supply reliability to Bangalore city. In model simulations, the ability to satisfy these performance metrics without adaptation is reduced under almost all scenarios. Implementing adaptation options can partially offset the negative impacts of change. Sequencing of options according to stakeholder priorities into Adaptation Pathways affects metric satisfaction. Early focus on agricultural demand management improves the robustness of pathways but trade-offs emerge between intrabasin and basin-wide water availability. We demonstrate that the fine balance between water availability and demand is vulnerable to future changes and uncertainty. Despite current and long-term planning challenges, stakeholders in developing countries may engage meaningfully in coproduction approaches for adaptation decision-making under deep uncertainty.
Mastiholi, Shivanand C; Somannavar, Manjunath S; Vernekar, Sunil S; Yogesh Kumar, S; Dhaded, Sangappa M; Herekar, Veena R; Lander, Rebecca L; Hambidge, Michael K; Krebs, Nancy F; Goudar, Shivaprasad S
2018-06-22
As per the World Health Organization, the nutritional status of women of reproductive age is important, as effects of undernutrition are propagated to future generations. More than one-third of Indian women in the reproductive age group are in a state of chronic nutritional deficiency during the preconception period leading to poor health and likely resulting in low birth weight babies. This study was aimed to assess the food insecurity and nutritional status of preconception women in a rural population of north Karnataka. A total of 770 preconception women were enrolled across a district in Karnataka from selected primary health centre areas by a cluster sampling method. Data on socioeconomic status, food insecurity and obstetric history were collected by trained research assistants, interviewing women at home. In half of the participants, a 1 day 24 -hour dietary recalls were conducted by dietary assistants to assess the dietary intakes. Anthropometric measurements and haemoglobin estimation were carried out at the health centres. In the present study, a majority of the participants (64.8%) belonged to the lower socio-economic classes and the prevalence of food insecurity was 27.4%. A majority of the participants had mild (15.5%) to moderate (78.6%) anaemia. About one-third of the participants (36.6%) were underweight. Significant associations were found between socio-economic status and anaemia (p = 0.0006) and between food insecurity and anaemia (p = 0.0001). The nutritional status of preconception women was poor and anemia was more prevalent in low-socioeconomic and food insecure population.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cochran, Jaquelin M; Palchak, Joseph D; Ehlen, Annaliese K
This chapter on Andhra Pradesh is one of six state chapters included in Appendix C of 'Greening the Grid: Pathways to Integrate 175 Gigawatts of Renewable Energy into India's Electric Grid, Vol. II - Regional Study' (the Regional Study). The objective of the state chapters is to provide modeling assumptions, results, and next steps to use and improve the model specific to each state. The model has inherent uncertainties, particularly in how the intrastate transmission network and RE generation projects will develop (e.g., locations, capacities). The model also does not include information on contracts or must-run status of particular plantsmore » for reliability purposes. By providing details on the higher spatial resolution model of 'Greening the Grid: Pathways to Integrate 175 Gigawatts of Renewable Energy into India's Electric Grid, Vol. II - Regional Study' (the Regional Study), which better represents the impact of congestion on least-cost scheduling and dispatch, provides a deeper understanding of the relationship among renewable energy (RE) location, transmission, and system flexibility with regard to RE integration, compared to 'Greening the Grid: Pathways to Integrate 175 Gigawatts of Renewable Energy into India's Electric Grid, Vol. I - National Study.'« less
Mapping of wasteland of india: A case study of Bangalore district of Karnataka
NASA Astrophysics Data System (ADS)
Behera, G.; Dutt, C. B. S.; Nageswara Rao, P. P.; Gupta, A. K.; Krishnamurthy, J.; Ganesharaj, K.; Padmavathy, A. S.; Yogarajan, N.
India is the second most populous country in the world. Its economy is agrarian in nature. Increasing demand for food, fodder, fuel and fibre has necessitated adoption of scientific measures for increase in land productivity and bringing more areas under cultivation/forests. However land degradation due to desertification, soil salinity, waterlogging, floods/drought, excessive soil erosion due to deforestation, unscientific agricultural practices etc. have resulted in the creation of vast stretches of wastelands and a decrease in per capita cultivable land besides ecological imbalance. Nearly 53 Mha are wasteland and 22 Mha of land have problems of either salinity, alkalinity, soil erosion, waterlogging, shifting cultivation or presently unused because of their undulating nature. Only 11% of India's geographic area is under effective tree cover. Forest degradation has increased by 14% over last 8-10 years. The land area prone to floods has doubled from 20 Mha to about 40 Mha in last 10 years. Awareness of this fact has resulted in the formation of the "National Wasteland Development Board" (NWDB) under the aegis of National Landuse and Wasteland Development Council (NLWC) with the Chairmanship of the Prime Minister of India.
NASA Astrophysics Data System (ADS)
Mishra, Praveen K.; Prasad, Sushma; Marwan, Norbert; Anoop, A.; Krishnan, R.; Gaye, Birgit; Basavaiah, N.; Stebich, Martina; Menzel, Philip; Riedel, Nils
2018-02-01
High resolution reconstructions of the India Summer Monsoon (ISM) are essential to identify regionally different patterns of climate change and refine predictive models. We find opposing trends of hydrological proxies between northern (Sahiya cave stalagmite) and central India (Lonar Lake) between 100 and 1300 CE with the strongest anti-correlation between 810 and 1300 CE. The apparently contradictory data raise the question if these are related to widely different regional precipitation patterns or reflect human influence in/around the Lonar Lake. By comparing multiproxy data with historical records, we demonstrate that only the organic proxies in the Lonar Lake show evidence of anthropogenic impact. However, evaporite data (mineralogy and δ18O) are indicative of precipitation/evaporation (P/E) into the Lonar Lake. Back-trajectories of air-mass circulation over northern and central India show that the relative contribution of the Bay of Bengal (BoB) branch of the ISM is crucial for determining the δ18O of carbonate proxies only in north India, whereas central India is affected significantly by the Arabian Sea (AS) branch of the ISM. We conclude that the δ18O of evaporative carbonates in the Lonar Lake reflects P/E and, in the interval under consideration, is not influenced by source water changes. The opposing trend between central and northern India can be explained by (i) persistent multidecadal droughts over central India between 810 and 1300 CE that provided an effective mechanism for strengthening sub-tropical westerly winds resulting in enhancement of wintertime (non-monsoonal) rainfall over northern parts of the Indian subcontinent, and/or (ii) increased moisture influx to northern India from the depleted BoB source waters.
Human dirofilariasis due to Dirofilaria repens in southern India.
Kotigadde, Subbannayya; Ramesh, Sathyavathi Alva; Medappa, Kariyappa Thadiangada
2012-01-01
Dirofilariasis is primarily confined to animals such as dogs, cats, foxes and raccoons. Human dirofilariasis is an accidental zoonotic infection acquired through mosquitoes. Human dirofilariasis due to Dirofilaria repens though endemic in Kerala, reports from Karnataka state are rare. We report a case of solitary subcutaneous dirofilariasis of the eyelid due to D. repens in a 47-year-old woman. She presented with periorbital edema. The swelling was soft, cystic with associated tenderness. A thin, white worm was noticed in the lesion and was removed by traction which was subsequently identified to be D. repens.
Human dirofilariasis due to Dirofilaria repens in southern India
Kotigadde, Subbannayya; Ramesh, Sathyavathi Alva; Medappa, Kariyappa Thadiangada
2012-01-01
Dirofilariasis is primarily confined to animals such as dogs, cats, foxes and raccoons. Human dirofilariasis is an accidental zoonotic infection acquired through mosquitoes. Human dirofilariasis due to Dirofilaria repens though endemic in Kerala, reports from Karnataka state are rare. We report a case of solitary subcutaneous dirofilariasis of the eyelid due to D. repens in a 47-year-old woman. She presented with periorbital edema. The swelling was soft, cystic with associated tenderness. A thin, white worm was noticed in the lesion and was removed by traction which was subsequently identified to be D. repens. PMID:23508234
Naseer, Ansaba; Shivalli, Siddharudha; Arunachalam, Cynthia
2017-01-01
Background Beedi also known as poor man’s cigarette is manufactured in almost all major states of India. Beedi workers are exposed to various health risks. There is an increased risk of systemic absorption of tobacco through skin and mucous membrane. The optic nerve is susceptible to damage from several toxic substances including tobacco. This group of disorders is known as toxic optic neuropathy (TON). The association of TON with occupational exposure to unburnt tobacco in beedi rollers has not been explored. Objectives Among the beedi rollers in Mangaluru and Bantwal talukas of Dakshina Kannada District, Karnataka, India: to assess the magnitude of potential TON utilizing colour vision and contrast sensitivity as screening tools and to identify the demographic, biological and occupational factors associated with potential TON. Methods A community-based cross-sectional study was conducted from April-Sept 2016 in Mangaluru and Bantwal talukas, of Dakshina Kannada district, Karnataka. Beedi rollers from twelve villages (six from each taluka) were included. In each of the selected villages, the investigators identified beedi collection centres and all the eligible beedi rollers were included in the study till the required number of beedi rollers for that village was achieved. Participants were screened at the study site for visual acuity, colour vision and contrast sensitivity and those with abnormal colour and contrast sensitivity in the presence of good visual acuity were considered to have potential TON. Results A total of 377 beedi rollers were approached; of which 365 consented to take part in the study (response rate: 96.81%). Women constituted the majority of the participants (n = 338, 92.6%). Based on the screening criteria, the prevalence of potential TON was 17.5% (n = 64, 95% CI: 13.5–21.9). On multiple logistic regression analysis, duration of beedi rolling (Adj OR: 1.061; 95% CI 1.015–1.109, p = 0.009), advancing age (Adj OR: 1.096; 95% CI 1.058–1.136, p<0.001) and presence of diabetes (Adj OR: 6.315; 95% CI 1.4572–27.376, p = 0.014) were independent correlates of potential TON. Conclusion In the present study, almost one out of six beedi rollers displayed clinical signs of potential TON. Increased duration of beedi rolling, advancing age and presence of diabetes were the independent correlates of potential TON. However, with this cross-sectional study it is not possible to conclude if these factors play a role individually or collectively or are a serendipitous association, for which large scale analytical studies are required. PMID:29149211
Persistence of Azoxystrobin in/on Grapes and Soil in Different Grapes Growing Areas of India
Gajbhiye, Vijay Tularam; Gupta, Suman; Mukherjee, Irani; Singh, Shashi Bala; Singh, Neera; Kumar, Yogesh
2010-01-01
Persistence of azoxystrobin was studied in/on grapes when applied @ 150 g ai ha−1 (recommended dose) and 300 g ai ha−1 (double the recommended dose) in three grapes growing states of India, namely Karnataka, Maharashtra and Tamil Nadu, in the year 2006–2007. A total of five sprays were given at an interval of about 15 days. Grapes and soil samples were collected after 5th spray, extracted and analysed by gas chromatography using electron capture detector. Half life of azoxystrobin on grapes varied from 5.4 to 11.2 days. Residues of azoxystrobin were much below the prescribed MRL (0.5 mg kg−1) after 21 days. The dissipation of azoxystrobin in soil followed first order rate kinetics with an average half life of 8.1 days at the recommended dose of application. PMID:21153804
Temporal changes in land cover types and the incidence of malaria in Mangalore, India.
Mohan, Venkata Raghava; Naumova, Elena N
2014-01-01
Malaria contributes to 881000 deaths worldwide annually and India is a major contributor in the region. This study aimed at detecting land cover changes and assesses their relationship with the burden of malaria in Mangalore taluk of southern India. Landsat TM images were obtained from the U.S. Geological Survey data repository. The statistics for the malaria incidences in the region were obtained from the National Vector Borne Diseases Control Program division of the State of Karnataka. The images were preprocessed, classified and change detection statistics were employed for major land cover types. An increase in the urban land cover by 20% with a reduction in the mountainous terrain by 34.7% and vegetation by 38.7% was noted between the years 2003 and 2005. The annual incidence of malaria increased five-fold from 203 to 1035/100000 population during the period. This study demonstrates the application of publicly available remote sensed data as a cost effective approach to study the agent, host and environment relationships in resource scarce settings which would provide valuable information planning and policy making at regional levels.
Vanham, D; Weingartner, R; Rauch, W
2011-01-01
India is facing major challenges in its water resources management (WRM) sector. Water shortages are attributed to issues such as an explosion in population, rapid urbanization and industrialization, environmental degradation and inefficient water use, all aggravated by changing climate and its impacts on demand, supply and water quality. This paper focuses on the contemporary and future situation in the Cauvery river basin in Southern India, shared by different states, predominantly Karnataka and Tamil Nadu. As water issues largely fall under the authority of the states, inter-state water disputes have a long tradition in the Cauvery river basin. Future changes in precipitation during the two monsoon seasons will only increase these tensions. Both states depend on the arrival of these monsoon rains to water their crops and to replenish the groundwater. The paper identifies the major challenges and general possible solutions for sustainable WRM within the river basin. It synthesises the relevant literature, describes practices that should be addressed in the scope of integrated WRM--including water availability increase and demand management--and stresses the need for further quantitative analyses.
Understanding the Impact of Extreme Temperature on Crop Production in Karnataka in India
NASA Astrophysics Data System (ADS)
Mahato, S.; Murari, K. K.; Jayaraman, T.
2017-12-01
The impact of extreme temperature on crop yield is seldom explored in work around climate change impact on agriculture. Further, these studies are restricted mainly to crops such as wheat and maize. Since different agro-climatic zones bear different crops and cropping patterns, it is important to explore the nature of the impact of changes in climate variables in agricultural systems under differential conditions. The study explores the effects of temperature rise on the major crops paddy, jowar, ragi and tur in the state of Karnataka of southern India. The choice of the unit of study to understand impact of climate variability on crop yields is largely restricted to availability of data for the unit. While, previous studies have dealt with this issue by replacing yield with NDVI at finer resolution, the use of an index in place of yield data has its limitations and may not reflect the true estimates. For this study, the unit considered is taluk, i.e. sub-district level. The crop yield for taluk is obtained between the year the 1995 to 2011 by aggregating point yield data from crop cutting experiments for each year across the taluks. The long term temperature data shows significantly increasing trend that ranges between 0.6 to 0.75 C across Karnataka. Further, the analysis suggests a warming trend in seasonal average temperature for Kharif and Rabi seasons across districts. The study also found that many districts exhibit the tendency of occurrence of extreme temperature days, which is of particular concern in terms of crop yield, since exposure of crops to extreme temperature has negative consequences for crop production and productivity. Using growing degree days GDD, extreme degree days EDD and total season rainfall as predictor variables, the fixed effect model shows that EDD is a more influential parameter as compared to GDD and rainfall. Also it has a statistically significant negative effect in most cases. Further, quantile regression was used to evaluate the robustness of the estimates of EDD in relation to crop yield. This showed the estimates to be robust across quantiles for most of the crops studied. Thus indicating a strong negative influence of exposure to extreme temperature on crop yield in the region.
Determinants of condom breakage among female sex workers in Karnataka, India
2011-01-01
Background Condoms are effective in preventing the transmission of HIV and other sexually transmitted infections, when properly used. However, recent data from surveys of female sex workers (FSWs) in Karnataka in south India, suggest that condom breakage rates may be quite high. It is important therefore to quantify condom breakage rates, and examine what factors might precipitate condom breakage, so that programmers can identify those at risk, and develop appropriate interventions. Methods We explored determinants of reported condom breakage in the previous month among 1,928 female sex workers in four districts of Karnataka using data from cross-sectional surveys undertaken from July 2008 to February 2009. Using stepwise multivariate logistic regression, we examined the possible determinants of condom breakage, controlling for several independent variables including the district and client load. Results Overall, 11.4% of FSWs reported at least one condom break in the previous month. FSWs were much more likely to report breakage if under 20 years of age (AOR 3.43, p = 0.005); if divorced/ separated/widowed (AOR 1.52, p = 0.012); if they were regular alcohol users (AOR 1.63, p = 0.005); if they mostly entertained clients in lodges/rented rooms (AOR 2.99, p = 0.029) or brothels (AOR 4.77, p = 0.003), compared to street based sex workers; if they had ever had anal sex (AOR 2.03, p = 0.006); if the sex worker herself (as opposed to the client) applied the condom at last use (AOR 1.90, p < 0.001); if they were inconsistent condom users (AOR 2.77, p < 0.001); and if they had never seen a condom demonstration (AOR 2.37, p < 0.001). Conclusions The reported incidence of condom breakage was high in this study, and this is a major concern for HIV/STI prevention programs, for which condom use is a key prevention tool. Younger and more marginalized female sex workers were most vulnerable to condom breakage. Special effort is therefore required to seek out such women and to provide information and skills on correct condom use. More research is also needed on what specific situational parameters might be important in predisposing women to condom breakage. PMID:22376237
Vinekar, Anand; Gilbert, Clare; Dogra, Mangat; Kurian, Mathew; Shainesh, Gangadharan; Shetty, Bhujang; Bauer, Noel
2014-01-01
Aim: To report the Karnataka Internet Assisted Diagnosis of Retinopathy of Prematurity (KIDROP) program for retinopathy of prematurity (ROP) screening in underserved rural areas using an indigenously developed tele-ROP model. Materials and Methods: KIDROP currently provides ROP screening and treatment services in three zones and 81 neonatal units in Karnataka, India. Technicians were trained to use a portable Retcam Shuttle (Clarity, USA) and validated against ROP experts performing indirect ophthalmoscopy. An indigenously developed 20-point score (STAT score) graded their ability (Level I to III) to image and decide follow-up based on a three-way algorithm. Images were also uploaded on a secure tele-ROP platform and accessed and reported by remote experts on their smart phones (iPhone, Apple). Results: 6339 imaging sessions of 1601 infants were analyzed. A level III technician agreed with 94.3% of all expert decisions. The sensitivity, specificity, positive predictive value and negative predictive value for treatment grade disease were 95.7, 93.2, 81.5 and 98.6 respectively. The kappa for technicians to decide discharge of babies was 0.94 (P < 0.001). Only 0.4% of infants needing treatment were missed. The kappa agreement of experts reporting on the iPhone vs Retcam for treatment requiring and mild ROP were 0.96 and 0.94 (P < 0.001) respectively. Conclusions: This is the first and largest real-world program to employ accredited non-physicians to grade and report ROP. The KIDROP tele-ROP model demonstrates that ROP services can be delivered to the outreach despite lack of specialists and may be useful in other middle-income countries with similar demographics. PMID:24492500
NASA Astrophysics Data System (ADS)
Sukhija, B. S.; Achutha Rao, A.
1983-01-01
Environmental tritium and radiocarbon studies were undertaken in the Vedavati river basin situated partly in Karnataka and partly in Andhra Pradesh, India, aimed at the determination of the general recharge condition of the water-bearing zones in the gneissic complex, granites and the Dharwar Group of metamorphic rocks, where groundwater occurs under semi-unconfined to semi-confined conditions and at places under the water-table condition. The groundwater movement is controlled by fractures, fissures, a weathered zone and surficial mantle. An attempt was also made to find out whether substantial recharge occurs along fractured lineaments; whether the water-bearing zones can be considered as interconnected or isolated, and whether the recharge and discharge areas identified by geohydrological considerations can be confirmed. Environmental tritium and radiocarbon contents, measured in ˜ 45 groundwater samples, show that a large number of samples are very young, containing water from post-thermonuclear-era rain, thus indicating an age less than 25 yr. In some other samples, despite radiocarbon ages found to be older, some component of recent precipitation is found to be present as indicated by bomb tritium. Groundwater dating in the area shows an excellent correlation between hydro-isochrons of minimum age with the recharge contour of maximum magnitude. This study has clearly resulted in the demarcation of the recharge areas. However, the discharge areas as such cannot be clearly delineated because of lack of a pattern indicating increase of ages in any particular direction. This, however, also reflects somewhat discontinuous groundwater bodies, which may also be expected from the general structure and hydrogeology of the region. Along a major lineament the groundwater is found to be very young thus confirming that substantial recharge occurs along lineaments.
Mishra, Sharmistha; Moses, Stephen; Hanumaiah, Prakash K; Washington, Reynold; Alary, Michel; Ramesh, B M; Isac, Shajy; Blanchard, James F
2009-03-01
To measure the determinants of syphilis among female sex workers (FSWs) in the state of Karnataka, South India. During 2004-2006, cross-sectional surveys were administered to 2312 FSWs across 5 districts in the state, in the context of a large-scale HIV preventive intervention program. Demographic and behavioral information, and serum (for syphilis, HSV-2 and HIV) and urine specimens (for Neisseria gonorrhoeae and Chlamydia trachomatis) were obtained. The prevalences of lifetime (TPHA positive) and active (RPR and TPHA positive) syphilis were 25.3% and 9.6%, respectively. There was considerable variation in the prevalence between districts, ranging from 10.9% to 37.4% lifetime, and 3.4% to 24.9% active infection. Factors associated with lifetime syphilis were older age, longer duration of sex work, illiteracy, client volume, practising sex work in >1 city, and sex work typology (public solicitation followed by brothel or lodge-based sex). The same typology, client volume, illiteracy, and having been widowed, divorced or deserted, were predictive of active infection. Of the 976 women who had symptoms of an STI, 78.8% had sought medical treatment, behavior that was protective for both outcomes. HIV infection was strongly associated with lifetime (OR 2.0; 95% CI: 1.6-2.6) and active syphilis (OR 2.1; 95% CI: 1.5-2.9). Despite reasonable treatment-seeking behavior, the high prevalence of syphilis has necessitated enhanced outreach efforts for FSWs and acceleration of the implementation of syphilis screening. Mobilizing resources to enhance syphilis control will not only reduce the burden of syphilis morbidity, but should impact in reducing HIV transmission.
Beattie, Tara S H; Bhattacharjee, Parinita; Suresh, M; Isac, Shajy; Ramesh, B M; Moses, Stephen
2012-10-01
Despite high HIV prevalence rates among most-at-risk groups, utilisation of HIV testing, treatment and care services was relatively low in Karnataka prior to 2008. The authors aimed to understand the barriers to and identify potential solutions for improving HIV service utilisation. Focus group discussions were carried out among homogeneous groups of female sex workers, men who have sex with men and transgenders, and programme peer educators in six districts across Karnataka in March and April 2008. 26 focus group discussions were conducted, involving 302 participants. Participants had good knowledge about HIV and HIV voluntary counselling and testing (VCT) services, but awareness of other HIV services was low. The fear of the psychological impact of a positive HIV test result and the perceived repercussions of being seen accessing HIV services were key personal and interpersonal barriers to HIV service utilisation. Previous experiences of discrimination at government healthcare services, coupled with discriminatory attitudes and behaviours by VCT staff, were key structural barriers to VCT service uptake among those who had not been HIV tested. Among those who had used government-managed prevention of parent to child transmission and antiretroviral treatment services, poor physical facilities, long waiting times, lack of available treatment, the need to give bribes to receive care and discriminatory attitudes of healthcare staff presented additional structural barriers. Embedding some HIV care services within existing programmes for vulnerable populations, as well as improving service quality at government facilities, are suggested to help overcome the multiple barriers to service utilisation. Increasing the uptake of HIV testing, treatment and care services is key to improving the quality and longevity of the lives of HIV-infected individuals.
Good governance and corruption in the health sector: lessons from the Karnataka experience.
Huss, R; Green, A; Sudarshan, H; Karpagam, Ss; Ramani, Kv; Tomson, G; Gerein, N
2011-11-01
Strengthening good governance and preventing corruption in health care are universal challenges. The Karnataka Lokayukta (KLA), a public complaints agency in Karnataka state (India), was created in 1986 but played a prominent role controlling systemic corruption only after a change of leadership in 2001 with a new Lokayukta (ombudsman) and Vigilance Director for Health (VDH). This case study of the KLA (2001-06) analysed the:Scope and level of poor governance in the health sector; KLA objectives and its strategy; Factors which affected public health sector governance and the operation of the KLA. We used a participatory and opportunistic evaluation design, examined documents about KLA activities, conducted three site visits, two key informant and 44 semi-structured interviews and used a force field model to analyse the governance findings. The Lokayukta and his VDH were both proactive and economically independent with an extended social network, technical expertise in both jurisdiction and health care, and were widely perceived to be acting for the common good. They mobilized media and the public about governance issues which were affected by factors at the individual, organizational and societal levels. Their investigations revealed systemic corruption within the public health sector at all levels as well as in public/private collaborations and the political and justice systems. However, wider contextual issues limited their effectiveness in intervening. The departure of the Lokayukta, upon completing his term, was due to a lack of continued political support for controlling corruption. Governance in the health sector is affected by positive and negative forces. A key positive factor was the combined social, cultural and symbolic capital of the two leaders which empowered them to challenge corrupt behaviour and promote good governance. Although change was possible, it was precarious and requires continuous political support to be sustained.
Stanton, Cynthia; Nand, Deepak Nitya; Koski, Alissa; Mirzabagi, Ellie; Brooke, Steve; Grady, Breanne; Mullany, Luke C
2014-11-13
Surveillance of drug quality for antibiotics, antiretrovirals, antimalarials and vaccines is better established than surveillance for maternal health drugs in low-income countries, particularly uterotonic drugs for the prevention and treatment of postpartum hemorrhage. The objectives of this study are to: assess private sector accessibility of four drugs used for uterotonic purposes (oxytocin, methylergometrine, misoprostol, valethamate bromide); and to assess potency of oxytocin and methylergometrine ampoules purchased by simulated clients. The study was conducted in Hassan and Bagalkot districts in Karnataka state and Agra and Gorakhpur districts in Uttar Pradesh state. A sample of 877 private pharmacies was selected (using a stratified, systematic sampling with random start), among which 847 were successfully visited. The target sample size for assessment of accessibility was 50 pharmacies per drug, per district. The target sample size for potency assessment was 100 purchases each of oxytocin and methylergometrine across all districts. Successful drug purchases varied by state. In Agra and Gorakhpur, 90%-100% of visits for each of the drugs resulted in a purchase. In Bagalkot and Hassan, only 29%-52% of visits for each drug resulted in a purchase. Regarding potency, the percent of active pharmaceutical ingredient was assessed using United States Pharmacopeia monograph #33 for both drugs; 193 and 188 ampoules of oxytocin and methylergometrine, respectively, were assessed. The percent of oxytocin ampoules outside manufacturer specification ranged from 33%-40% in Karnataka and from 22%-50% in Uttar Pradesh. In Bagalkot and Hassan, 96% and 100% of the methylergometrine ampoules were outside manufacturer specification, respectively. In Agra and Gorakhpur, 54% and 44% were outside manufacturer specification, respectively. Private sector accessibility of uterotonic drugs in study districts in Karnataka warrants attention. Most importantly, interventions to assure quality oxytocin and particularly methylergometrine are needed in study districts in both states.
Sriram, V; Gururaj, G; Razzak, J A; Naseer, R; Hyder, A A
2016-08-01
Strengthened emergency medical services (EMS) are urgently required in South Asia to reduce needless death and disability. Several EMS models have been introduced in India and Pakistan, and research on these models can facilitate improvements to EMS in the region. Our objective was to conduct a cross-case comparative analysis of three EMS organizations in India and Pakistan - GVK EMRI, Aman Foundation and Rescue 1122 - in order to draw out similarities and differences in their models. Case study methodology was used to systematically explore the organizational models of GVK EMRI (Karnataka, India), Aman Foundation (Karachi, Pakistan), and Rescue 1122 (Punjab, Pakistan). Qualitative methods - interviews, document review and non-participant observation - were utilized, and using a process of constant comparison, data were analysed across cases according to the WHO health system 'building blocks'. Emergent themes under each health system 'building block' of service delivery, health workforce, medical products and technology, health information systems, leadership and governance, and financing were described. Cross-cutting issues not applicable to any single building block were further identified. This cross-case comparison, the first of its kind in low- and middle-income countries, highlights key innovations and lessons, and areas of further research across EMS organizations in India, Pakistan and other resource-poor settings. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
Rekha Sarma, Roshmi; Munsi, Madhushree; Neelavara Ananthram, Aravind
2015-01-01
The Giant African Snail (Achatina fulica) is considered to be one the world’s 100 worst invasive alien species. The snail has an impact on native biodiversity, and on agricultural and horticultural crops. In India, it is known to feed on more than fifty species of native plants and agricultural crops and also outcompetes the native snails. It was introduced into India in 1847 and since then it has spread all across the country. In this paper, we use ecological niche modeling (ENM) to assess the distribution pattern of Giant African Snail (GAS) under different climate change scenarios. The niche modeling results indicate that under the current climate scenario, Eastern India, peninsular India and the Andaman and Nicobar Islands are at high risk of invasion. The three different future climate scenarios show that there is no significant change in the geographical distribution of invasion prone areas. However, certain currently invaded areas will be more prone to invasion in the future. These regions include parts of Bihar, Southern Karnataka, parts of Gujarat and Assam. The Andaman and Nicobar and Lakshadweep Islands are highly vulnerable to invasion under changed climate. The Central Indian region is at low risk due to high temperature and low rainfall. An understanding of the invasion pattern can help in better management of this invasive species and also in formulating policies for its control. PMID:26618637
Sarma, Roshmi Rekha; Munsi, Madhushree; Ananthram, Aravind Neelavara
2015-01-01
The Giant African Snail (Achatina fulica) is considered to be one the world's 100 worst invasive alien species. The snail has an impact on native biodiversity, and on agricultural and horticultural crops. In India, it is known to feed on more than fifty species of native plants and agricultural crops and also outcompetes the native snails. It was introduced into India in 1847 and since then it has spread all across the country. In this paper, we use ecological niche modeling (ENM) to assess the distribution pattern of Giant African Snail (GAS) under different climate change scenarios. The niche modeling results indicate that under the current climate scenario, Eastern India, peninsular India and the Andaman and Nicobar Islands are at high risk of invasion. The three different future climate scenarios show that there is no significant change in the geographical distribution of invasion prone areas. However, certain currently invaded areas will be more prone to invasion in the future. These regions include parts of Bihar, Southern Karnataka, parts of Gujarat and Assam. The Andaman and Nicobar and Lakshadweep Islands are highly vulnerable to invasion under changed climate. The Central Indian region is at low risk due to high temperature and low rainfall. An understanding of the invasion pattern can help in better management of this invasive species and also in formulating policies for its control.
Maheshwar, P.K.; Moharram, S. Ahmed; Janardhana, G.R.
2009-01-01
The study reports the occurrence of fumonisin producing Fusarium verticillioides in 90 samples of stored paddy (Oryza sativa L.) collected from different geographical regions of Karnataka, India. Fumonisin producing F. verticillioides was identified based on micromorphological characteristics and PCR using two sets of primers. One set of primers was F. verticillioides species specific, which selectively amplified the intergenic space region of rDNA. The other set of primers was specific to fumonisin producing F. verticillioides. Eight paddy samples were positive for F. verticillioides. Eleven isolates obtained from these samples were capable of producing fumonisin. PMID:24031332
Mathad, Monali D; Rajesh, S K; Pradhan, Balaram
2017-12-06
The present study aimed to explore the correlates and predictors of spiritual well-being among nursing students. One hundred and forty-five BSc nursing students were recruited from three nursing colleges in Bangalore, Karnataka, India. Data were collected using SHALOM, FMI, SCS-SF and SWLS questionnaires and analysed by the Pearson correlation test and multiple regression analysis. The results of our study revealed a significant correlation between variables, and a considerable amount of variance was explained by self-compassion, mindfulness and satisfaction with life on personal, communal, environmental and transcendental domains of spiritual well-being.
Isac, Shajy; Ramesh, B M; Rajaram, S; Washington, Reynold; Bradley, Janet E; Reza-Paul, Sushena; Beattie, Tara S; Blanchard, James F; Moses, Stephen
2015-01-01
Objectives This paper examined trends over time in condom use, and the prevalences of HIV and syphilis, among female sex workers (FSWs) in South India. Design Data from three rounds of cross-sectional surveys were analysed, with HIV and high-titre syphilis prevalence as outcome variables. Multivariable analysis was applied to examine changes in prevalence over time. Setting Five districts in Karnataka state, India. Participants 7015 FSWs were interviewed over three rounds of surveys (round 1=2277; round 2=2387 and round 3=2351). Women who reported selling sex in exchange for money or gifts in the past month, and aged between 18 and 49 years, were included. Interventions The surveys were conducted to monitor a targeted HIV prevention programme during 2004–2012. The main interventions included peer-led community outreach, services for the treatment and prevention of sexually transmitted infections, and empowering FSWs through community mobilisation. Results HIV prevalence declined significantly from rounds 1 to 3, from 19.6% to 10.8% (adjusted OR (AOR)=0.48, p<0.001); high-titre syphilis prevalence declined from 5.9% to 2.4% (AOR=0.50, p<0.001). Reductions were observed in most substrata of FSWs, although reductions among new sex workers, and those soliciting clients using mobile phones or from home, were not statistically significant. Condom use ‘always’ with occasional clients increased from 73% to 91% (AOR=1.9, p<0.001), with repeat clients from 52% to 86% (AOR=5.0, p<0.001) and with regular partners from 12% to 30% (AOR=4.2, p<0.001). Increased condom use was associated with exposure to the programme. However, condom use with regular partners remained low. Conclusions The prevalences of HIV infection and high-titre syphilis among FSWs have steadily declined with increased condom use. Further reductions in prevalence will require intensification of prevention efforts for new FSWs and those soliciting clients using mobile phones or from home, as well as increasing condom use in the context of regular partnerships. PMID:25818275
Shivalli, Siddharudha; Gururaj, Nandihal
2015-01-01
Introduction Postnatal depression (PND) is one of the most common psychopathology and is considered as a serious public health issue because of its devastating effects on mother, family, and infant or the child. Objective To elicit socio-demographic, obstetric and pregnancy outcome predictors of Postnatal Depression (PND) among rural postnatal women in Karnataka state, India. Design Hospital based analytical cross sectional study Setting A rural tertiary care hospital of Mandya District, Karnataka state, India. Sample PND prevalence based estimated sample of 102 women who came for postnatal follow up from 4th to 10th week of lactation. Method Study participants were interviewed using validated kannada version of Edinburgh Postnatal Depression Scale (EPDS). Cut-off score of ≥13 was used as high risk of PND. The percentage of women at risk of PND was estimated, and differences according to socio-demographic, obstetric and pregnancy outcome were described. Logistic regression was applied to identify the independent predictors of PND risk. Main Outcome Measures Prevalence, Odds ratio (OR) and adjusted (adj) OR of PND Results Prevalence of PND was 31.4% (95% CI 22.7–41.4%). PND showed significant (P<0.05) association with joint family, working women, non-farmer husbands, poverty, female baby and pregnancy complications or known medical illness. In binomial logistic regression poverty (adjOR: 11.95, 95% CI:1.36–105), birth of female baby (adjOR: 3.6, 95% CI:1.26–10.23) and pregnancy complications or known medical illness (adjOR: 17.4, 95% CI:2.5–121.2) remained as independent predictors of PND. Conclusion Risk of PND among rural postnatal women was high (31.4%). Birth of female baby, poverty and complications in pregnancy or known medical illness could predict the high risk of PND. PND screening should be an integral part of postnatal care. Capacity building of grass root level workers and feasibility trials for screening PND by them are needed. PMID:25848761
NASA Astrophysics Data System (ADS)
Jumani, S.
2016-12-01
The growth of small hydro-power projects (SHPs) is being widely encouraged as they are believed to be environmentally sustainable and socially equitable sources of energy. Easy policies, carbon credits and government sponsored monetary incentives have led to the mushrooming of SHPs along most tropical rivers, especially in developing countries. Our field study conducted between December, 2013 and September, 2014 assessed the social and ecological impacts of a cluster of SHPs in the biodiversity hotspot of the Western Ghats in India. Ecological impacts were studied with respect to freshwater fish assemblages, river water parameters, forest fragmentation and spread of invasive species. Social surveys were conducted to understand impacts on SHPs on socio-economic activities, resource access and human-animal conflict. Ecological impacts were found to be substantial. Freshwater fish species richness was significantly higher in un-dammed sites, and this variation in richness was explained by dam-related variables. Within dammed streams, spatial sections that were particularly damaging were identified. Fish species and guilds that were particularly susceptible to be adversely impacted were identified as indicator species. Four SHPs having a cumulative capacity of 45MW led to a direct loss of 14.5ha of forest land. Resultant loss in canopy cover and spread of invasive plant species was quantified. More than 10% of the river stretch was left de-watered due to the dams. Socially, SHPs were not as beneficial as they are believed to be. Respondents claimed that human-elephant conflict began only after SHP construction began. This relationship was examined with secondary data, and found to be true. In light of our findings, we suggest that the policy regarding SHPs be revised. Given that 6474 sites have been identified for SHP development in India, all without any individual or cumulative impact assessments or public consultations, studies to understand their impacts at the landscape level are underway. We have mapped all existing and planned SHPs within the Western Ghats of Karnataka. Forest fragmentation and river fragmentation indices are being calculated at various spatial scales to provide a holistic perspective of SHP development in an attempt to influence the development of better policies.
Ramanaik, Satyanarayana; Thompson, Laura H; du Plessis, Elsabé; Pelto, Pertti; Annigeri, Vinod; Doddamane, Mahesh; Bhattacharjee, Parinita; Shaw, Souradet Y; Deering, Kathleen; Khan, Shamshad; Halli, Shiva S; Lorway, Robert
2014-01-01
Global literature on female sex workers suggests that being in an intimate relationship is associated with barriers to practising safe sex behaviours. Condom use within intimate relationships is often seen as a sign of infidelity and fosters mistrust which could affect longevity, trust and intimacy within partnerships. Using qualitative data from Devadasi sex workers and their intimate male partners in Bagalkot District, Karnataka, India, we examined both partners' perspectives to understand the quality and dynamics of these relationships and the factors that influence condom use in intimate relationships. Our thematic analysis of individual interviews conducted in May 2011 with 20 couples suggests that many Devadasi sex workers and their intimate partners define their relationships as 'like marriage' which reduced their motivation to use condoms. Evidence from this study suggests that active participation in sex workers' collectives (sanghas) can increase condom use, education and family planning services, among other things, and could be helpful for both Devadasis and their intimate partners to better understand and accept safer sexual practices. Our work has direct implications for designing couple-based health interventions for traditional Devadasi sex workers and their intimate partners in India.
The dynamics of gender and class in access to health care: evidence from rural Karnataka, India.
Iyer, Aditi; Sen, Gita; George, Asha
2007-01-01
In the early 1990s, India embarked upon a course of health sector reform, the impact of which on an already unequal society is now becoming more apparent. This study sought to deepen understanding of equity effects by exploring gender and class dynamics vis-à-vis basic access to health care for self-reported long-term ailments. The authors drew on the results of a cross-sectional household survey in a poor agrarian region of south India to test whether gender bias in treatment-seeking is class-neutral and whether class bias is gender-neutral. They found evidence of "pure gender bias" in non-treatment operating against both non-poor and poor women, and evidence of "rationing bias" in discontinued treatment operating against poor women overall, but with some differences between the poor and poorest households. In poor households, men insulated themselves and passed the entire burden of rationing onto women; but among the poorest, men, like women, were forced to curtail treatment. There were economic class differences in continued, discontinued, and no treatment, but class was a gendered phenomenon operating through women, not men.
Shaw, Souradet Y; Lorway, Robert; Bhattacharjee, Parinita; Reza-Paul, Sushena; du Plessis, Elsabé; McKinnon, Lyle; Thompson, Laura H; Isac, Shajy; Ramesh, Banadakoppa M; Washington, Reynold; Moses, Stephen; Blanchard, James F
2016-08-01
Men and transgender women who have sex with men (MTWSM) continue to be an at-risk population for human immunodeficiency virus (HIV) infection in India. Identification of risk factors and determinants of HIV infection is urgently needed to inform prevention and intervention programming. Data were collected from cross-sectional biological and behavioral surveys from four districts in Karnataka, India. Multivariable logistic regression models were constructed to examine factors related to HIV infection. Sociodemographic, sexual history, sex work history, condom practices, and substance use covariates were included in regression models. A total of 456 participants were included; HIV prevalence was 12.4%, with the highest prevalence (26%) among MTWSM from Bellary District. In bivariate analyses, district (P = 0.002), lack of a current regular female partner (P = 0.022), and reported consumption of an alcoholic drink in the last month (P = 0.004) were associated with HIV infection. In multivariable models, only alcohol use remained statistically significant (adjusted odds ratios: 2.6, 95% confidence intervals: 1.2-5.8; P = 0.02). The prevalence of HIV continues to be high among MTWSM, with the highest prevalence found in Bellary district.
Evaluation of Workload and its Impact on Satisfaction Among Pharmacy Academicians in Southern India.
Ahmad, Akram; Khan, Muhammad Umair; Srikanth, Akshaya B; Patel, Isha; Nagappa, Anantha Naik; Jamshed, Shazia Qasim
2015-06-01
The purpose of this study was to determine the level of workload among pharmacy academicians working in public and private sector universities in India. The study also aimed to assess the satisfaction of academicians towards their workload. A cross-sectional study was conducted for a period of 2 months among pharmacy academicians in Karnataka state of Southern India. Convenience sampling was used to select a sample and was contacted via email and/or social networking sites. Questionnaire designed by thorough review literature was used as a tool to collect data on workload (teaching, research, extracurricular services) and satisfaction. Of 214 participants, 95 returned the filled questionnaire giving the response rate of 44.39%. Private sector academicians had more load of teaching (p=0.046) and they appeared to be less involved in research activities (p=0.046) as compared to public sector academicians. More than half of the respondents (57.9%) were satisfied with their workload with Assistant Professors were least satisfied as compared to Professors (p=0.01). Overall, private sector academicians are more burdened by teaching load and also are less satisfied of their workload. Revision of private universities policies may aid in addressing this issue.
Management of Biomedical Waste: An Exploratory Study.
Abhishek, K N; Suryavanshi, Harshal N; Sam, George; Chaithanya, K H; Punde, Prashant; Singh, S Swetha
2015-09-01
Dental operatories pose a threat due to the high chances of infection transmission both to the clinician and the patients. Hence, management of dental waste becomes utmost importance not only for the health benefit of the dentist himself, but also people who can come into contact with these wastes directly or indirectly. The present study was conducted to find out the management of biomedical waste in private dental practice among 3 districts of Karnataka. The study population included 186 private practitioners in 3 districts of Karnataka (Coorg, Mysore, Hassan), South India. A pre-tested self-administered questionnaire was distributed to assess the knowledge and practices regarding dental waste management. Descriptive statistics was used to summarize the results. Out of 186 study subjects, 71 (38%) were females and 115 (62%) were males. The maximum number of participants belonged to the age group of 28-33 years (29%). Undergraduate qualification was more (70%). 90 (48%) participants had an experience of 0-5 years. Chi-square analysis showed a highly significant association between participant who attended continuing dental education (CDE) program and their practice of dental waste management. Education with regards to waste management will help in enhancing practices regarding the same. In order to fill this vacuum CDE programs have to be conducted in pursuance to maintain health of the community.
Dermatological and respiratory problems in migrant construction workers of Udupi, Karnataka.
Banerjee, Mayuri; Kamath, Ramachandra; Tiwari, Rajnarayan R; Nair, Narayana Pillai Sreekumaran
2015-01-01
India being a developing country has tremendous demand of physical infrastructure and construction work as a result there is a raising demand of construction workers. Workers in construction industry are mainly migratory and employed on contract or subcontract basis. These workers face temporary relationship between employer and employee, uncertainty in working hours, contracting and subcontracting system, lack of basic continuous employment, lack basic amenities, and inadequacy in welfare schemes. To estimate the prevalence of respiratory and dermatological symptoms among migratory construction workers. This cross-sectional study was conducted in Manipal, Karnataka, among 340 male migratory construction workers. A standard modified questionnaire was used as a tool by the interviewer and the physical examination of the workers was done by a physician. The statistical analysis was done using Statistical Package for the Social Sciences (SPSS) version 15.0. Eighty percent of the workers belong to the age group of 18-30 years. The mean age of the workers was 26 ± 8.2 years. Most (43.8%) of the workers are from West Bengal followed by those from Bihar and Jharkhand. The rates of prevalence of respiratory and dermatological symptoms were 33.2% and 36.2%, respectively. The migrant construction workers suffer from a high proportion of respiratory and dermatological problems.
Variation in the prevalence of chronic bronchitis among smokers: a cross-sectional study.
Mahesh, P A; Jayaraj, B S; Chaya, S K; Lokesh, K S; McKay, A J; Prabhakar, A K; Pape, U J
2014-07-01
Given the wide variations in prevalence of chronic obstructive pulmonary disease observed between populations with similar levels of exposure to tobacco smoke, we aimed to investigate the possibility of variations in prevalence of chronic bronchitis (CB) between two geographically distinct smoking populations in rural Karnataka, India. The Burden of Obstructive Lung Disease (BOLD) questionnaire was administered to all men aged >30 years in a cross-sectional survey. The χ(2) and Fisher's exact tests were used to compare CB prevalence in the two populations. Logistic regression was used to analyse the impact of multiple variables on the occurrence of CB. Two samples of 2322 and 2182 subjects were included in the study. In non-smokers, CB prevalence did not differ between the populations. However, it was significantly different between smoking populations (44.79% vs. 2.13%, P < 0.0001). Logistic regression indicated that, in addition to smoking, region, age, occupational dust exposure and type of house were associated with higher likelihood of CB. An interaction between smoking and area of residence was found (P < 0.001) and appeared to explain the effect of region (without interaction). A significant difference in CB prevalence was observed between male populations from two areas of Karnataka state, including when stratified by smoking status. No significant difference was observed between non-smokers.
Washington, Reynold G; Nath, Anita; Isac, Shajy; Javalkar, Prakash; Ramesh, Banadakoppa M; Bhattacharjee, Parinita; Moses, Stephen
2014-07-01
To examine changes in behavioral outcomes among rural female sex workers (FSWs) involved in a community-based comprehensive HIV preventive intervention program in south India. A total of 14, 284 rural FSWs were reached by means of a community-based model for delivering outreach, medical, and referral services. Changes in behavior were assessed using 2 rounds of polling booth surveys conducted in 2008 and 2011. In all, 95% of the mapped FSWs were reached at least once, 80.3% received condoms as per need, and 71% received health services for sexually transmitted infections. There was a significant increase in condom use (from 60.4% to 72.4%, P = .001) and utilization of HIV counseling and testing services (from 63.9% to 92.4%; P = .000) between the 2 time periods. This model for a community-based rural outreach and HIV care was effective and could also be applied to many other health problems. © 2014 APJPH.
Self-reported symptoms of gynecological morbidity and their treatment in south India.
Bhatia, J C; Cleland, J
1995-01-01
This article presents an analysis of self-reported symptoms of gynecological problems among 3,600 recent mothers in Karnataka State, India. Approximately one-third of all women reported at least one current symptom; the most common were a feeling of weakness and tiredness (suggestive of anemia); menstrual disorders; white or colored vaginal discharge (suggestive of lower reproductive tract infection); and lower abdominal pain and discharge with fever (suggestive of acute pelvic inflammatory disease). Obstetric morbidity, associated with the last live birth, was strongly predictive of current gynecological symptoms. Women who delivered their last child in a private institution were significantly less likely to report symptoms than were those who delivered at home or in a government hospital. Nonusers or users of reversible contraceptive methods were also less likely to report symptoms of morbid conditions than were sterilized women. These associations persisted in analyses controlling for potentially confounding economic and demographic characteristics, and have far-reaching policy implications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roberts, J.M.; Rosier, P.T.W.; Murthy, K.V.
1992-12-31
Stomatal conductance, leaf water potential and leaf area index were measured in adjacent plantations of Eucalyptus camaldulensis and Eucalyptus tereticornis at Puradal, near Shimoga, Karnataka, southern India. The data were collected in a range of climatic conditions during a two year period immediately following plantation establishment. Physiological differences between the two species were small and confined largely to leaf area index. Stomatal conductance was highest in the post-monsoon period and declined to minimum values immediately prior to the onset of the monsoon, with the lowest conductances observed after the plantations had been established for more than one year. Stomatal conductance,more » leaf area index and above-canopy meteorological data were combined in a multi-layer transpiration model and used to calculate hourly values of transpiration from the two species. Rates of transpiration up to 6 mm d{sup {minus}1} were estimated for the post-monsoon period but fell to below 1 mm d{sup {minus}1} prior to the monsoon.« less
Potential for early warning of maalria in India using NOAA-AVHRR based vegetation health indices
NASA Astrophysics Data System (ADS)
Dhiman, R. C.; Kogan, Felix; Singh, Neeru; Singh, R. P.; Dash, A. P.
Malaria is still a major public health problem in India with about 1 82 million cases annually and 1000 deaths As per World Health Organization WHO estimates about 1 3 million Disability Adjusted Life Years DALYs are lost annually due to malaria in India Central peninsular region of India is prone to malaria outbreaks Meteorological parameters changes in ecological conditions development of resistance in mosquito vectors development of resistance in Plasmodium falciparum parasite and lack of surveillance are the likely reasons of outbreaks Based on satellite data and climatic factors efforts have been made to develop Early Warning System EWS in Africa but there is no headway in this regard in India In order to find out the potential of NOAA satellite AVHRR derived Vegetation Condition Index VCI Temperature Condition Index TCI and a cumulative indicator Vegetation Health Index VHI were attempted to find out their potential for development of EWS Studies were initiated by analysing epidemiological data of malaria vis-a-vis VCI TCI and VHI from Bikaner and Jaisalmer districts of Rajasthan and Tumkur and Raichur districts of Karnataka Correlation coefficients between VCI and monthly malaria cases for epidemic years were computed Positive correlation 0 67 has been found with one-month lag between VCI and malaria incidence in respect of Tumkur while a negative correlation with TCI -0 45 is observed In Bikaner VCI is found to be negatively related -0 71 with malaria cases in epidemic year of 1994 Weekly
Tripti, M; Lambs, L; Gurumurthy, G P; Moussa, I; Balakrishna, K; Chadaga, M D
2016-01-15
The small river basins in the narrow stretch of the Arabian Sea coast of southwest India experience high annual rainfall (800-8000 mm), with a higher proportion (85 %) during the summer monsoon period between June and September. This is due to a unique orographic barrier provided by the Western Ghats mountain belt (600-2600 m) for the summer monsoon brought by the southwesterly winds. This study is the first of a kind focusing on the water cycle with an intensive stable isotopes approach (samples of river water, groundwater, rainwater; seasonal and spatial sampling) in this part of the Western Ghats in Karnataka and also in the highest rainfall-receiving region (with places like Agumbe receiving 7000-8000 mm annual rainfall) in South India. In addition, the region lacks sustainable water budgeting due to high demographic pressure and a dry pre-monsoon season as the monsoon is mainly unimodal in this part of India, particularly close to the coast. The stable isotopic compositions of groundwater, river water and rainwater in two tropical river basins situated approximately 60 km apart, namely the Swarna near Udupi and the Nethravati near Mangalore, were studied from 2010 to 2013. The δ(18)O and δ(2)H values of the water samples were measured by isotope ratio mass spectrometry, and the d-excess values calculated to better understand the dominant source of the water and the influence of evaporation/recycling processes. The water in the smaller area basin (Swarna basin) does not show seasonal variability in the δ(18)O values for groundwater and river water, having a similar mean value of -3.1 ‰. The d-excess value remains higher in both wet and dry seasons suggesting strong water vapor recycling along the foothills of the Western Ghats. In contrast, the larger tropical basin (Nethravati basin) displays specific seasonal isotopic variability. The observation of higher d-excess values in winter with lower δ(18)O values suggests an influence of northeast winter monsoon water in the larger basin. The narrow coastal strip to the west of the Western Ghats displays unique water characteristics in both tropical river basins investigated. For the smaller and hilly Swarna basin, the dense vegetation (wet canopies) could largely re-evaporate the (intercepted) rain, leading to no marked seasonal or altitude effect on the water isotope values within the basin. The larger Nethravati basin, which stretches farther into the foothills of the Western Ghats, receives winter monsoon water, and thus exhibits a clear seasonal variability in rainfall moisture sources. The degree of water vapor recycling in these wet tropical basins dominates the isotopic composition in this narrow coastal stretch of South India. An insight into the soil water contribution to the river water and groundwater, even in the rainfall-dependent tropical basins of South India, is provided in this study. Copyright © 2015 John Wiley & Sons, Ltd.
Jathanna, Devcharan; Karanth, K. Ullas; Kumar, N. Samba; Karanth, Krithi K.; Goswami, Varun R.
2015-01-01
Understanding species distribution patterns has direct ramifications for the conservation of endangered species, such as the Asian elephant Elephas maximus. However, reliable assessment of elephant distribution is handicapped by factors such as the large spatial scales of field studies, survey expertise required, the paucity of analytical approaches that explicitly account for confounding observation processes such as imperfect and variable detectability, unequal sampling probability and spatial dependence among animal detections. We addressed these problems by carrying out ‘detection—non-detection’ surveys of elephant signs across a c. 38,000-km2 landscape in the Western Ghats of Karnataka, India. We analyzed the resulting sign encounter data using a recently developed modeling approach that explicitly addresses variable detectability across space and spatially dependent non-closure of occupancy, across sampling replicates. We estimated overall occupancy, a parameter useful to monitoring elephant populations, and examined key ecological and anthropogenic drivers of elephant presence. Our results showed elephants occupied 13,483 km2 (SE = 847 km2) corresponding to 64% of the available 21,167 km2 of elephant habitat in the study landscape, a useful baseline to monitor future changes. Replicate-level detection probability ranged between 0.56 and 0.88, and ignoring it would have underestimated elephant distribution by 2116 km2 or 16%. We found that anthropogenic factors predominated over natural habitat attributes in determining elephant occupancy, underscoring the conservation need to regulate them. Human disturbances affected elephant habitat occupancy as well as site-level detectability. Rainfall is not an important limiting factor in this relatively humid bioclimate. Finally, we discuss cost-effective monitoring of Asian elephant populations and the specific spatial scales at which different population parameters can be estimated. We emphasize the need to model the observation and sampling processes that often obscure the ecological process of interest, in this case relationship between elephants to their habitat. PMID:26207378
Malamardi, Sowmya N; Kamath, Ramachandra; Tiwari, Rajnarayan; Nair, Binu Valsalakumari Sreekumaran; Chandrasekaran, Varalakshmi; Phadnis, Sameer
2015-01-01
Occupational morbidities have been estimated to cause an economic loss up to 10-20% of the gross national product of a country. It is an important cause of occupational morbidity and decreased quality of life (QOL) for the workers. The aim of the present study is to assess the level of occupational stress and its association with the QOL among the public sector bank employees. The present study was conducted among employees of public sector banks in Mysore district, Karnataka, India. A cross-sectional study design was used for the study. Job stress was measured by using occupational stress index (OSI) scale questionnaire and health-related QOL was measured using the short form 12 (SF-12) questionnaire. The sample size estimated for the study was 526 and cluster random sampling technique was used. Chi-square test was used to find the association between the study variables and level of stress. Multiple linear regression model was used to find the determinants of health-related QOL among the study subjects. The total number of the study subjects was 546 out of which 57% were males and 43% were females. The proportion of study subjects reporting to be current smokers was 4.2% and almost all study subjects reported occasional alcohol consumption. The mean physical component summary (PCS) score and mental component summary (MCS) using the original United States standardization were 47.90 and 48.30, respectively. The individuals with mild stress scored higher in both PCS and MCS than the individuals who had moderate to severe stress levels. There was significant association of health related quality of life with the age of the respondent,presence of at least one morbidity and level of stress with health-related QOL. This study has shown an association of occupational stress with the QOL. There is a need for interventions aimed at mitigating the occupational stress among employees of the banking sector.
Measurement and modeling of CO2 exchange over forested landscapes in India: an overview
NASA Astrophysics Data System (ADS)
Kushwaha, S.; Dadhwal, V.
2009-04-01
The increasing atmospheric CO2 concentration and its potential impact on global climate change is the subject of worldwide studies, political debates and international discussions. The concern led to the establishment of the Kyoto Protocol to curtail emissions and mitigate the possible global warming. The studies so far suggest that terrestrial biological sinks might be the low cost options for carbon sequestration, which can be used to partially offset the industrial CO2 emissions globally. In past, the effectiveness of terrestrial sink and the quantitative estimates of their sink strengths have relied mainly on the measurements of changes in carbon stocks across the world. Recent developments in flux tower based measurement techniques such as Eddy Covariance for assessing the CO2, H2O and energy fluxes provide tools for quantifying the net ecosystem exchange (NEE) of CO2 on a continuous basis. These near real time measurements, when integrated with remote sensing, enable the up-scaling of the carbon fluxes to regional scale. More than 470 towers exist worldwide as of now. Indian subcontinent was not having any tower-based CO2 flux measurement system so far. The Indian Space Research Organization under its Geosphere Biosphere Programme is funding five eddy covariance towers for terrestrial CO2 flux measurements in different ecological regions of the country. The tower sites already planned are: (i) a mixed forest plantation (Dalbergia sissoo, Acacia catechu, Holoptelia integrifolia) at Haldwani in collaboration with DISAFRI, University of Tuscia, Italy and the Indian Council for Forestry Research and Education (ICFRE), Dehradun, (ii) a sal (Shorea robusta) forest in Doon valley Himalayan state of Uttarakhand in northern India, (ii) a teak (Tectona grandis) mixed forest at Betul in Madhya Pradesh in central India, (iv) an old teak plantation at Dandeli, and (v) a semi-evergreen forest at Nagarhole in Karnataka state in southern India. The three towers have been procured and the eddy covariance equipment installation on Haldwani tower will be completed this month. The equipment for ground based studies such as soil respiration system, soil moisture and temperature measurement system, PAR sensor, hemi view, light use efficiency measurement system etc. have been already procured. The spatial database containing a variety of information on soil types, rainfall, temperature, forest cover PAR, vegetation indices etc. has been prepared using remote sensing and other means. The temporal ground inventory of the vegetation and soil parameters is also under progress. Each site will involve a team leader, one research student and one master degree student. The Forest Departments of above mentioned states of India are actively collaborating in this research. Various universities and research institutions have also expressed interest to cooperate in the programme.
A Genome-Wide Search for Greek and Jewish Admixture in the Kashmiri Population
Tashi, Tsewang; Lorenzo, Felipe Ramos; Feusier, Julie Ellen; Mir, Hyder
2016-01-01
The Kashmiri population is an ethno-linguistic group that resides in the Kashmir Valley in northern India. A longstanding hypothesis is that this population derives ancestry from Jewish and/or Greek sources. There is historical and archaeological evidence of ancient Greek presence in India and Kashmir. Further, some historical accounts suggest ancient Hebrew ancestry as well. To date, it has not been determined whether signatures of Greek or Jewish admixture can be detected in the Kashmiri population. Using genome-wide genotyping and admixture detection methods, we determined there are no significant or substantial signs of Greek or Jewish admixture in modern-day Kashmiris. The ancestry of Kashmiri Tibetans was also determined, which showed signs of admixture with populations from northern India and west Eurasia. These results contribute to our understanding of the existing population structure in northern India and its surrounding geographical areas. PMID:27490348
Isac, Shajy; Ramesh, B M; Rajaram, S; Washington, Reynold; Bradley, Janet E; Reza-Paul, Sushena; Beattie, Tara S; Alary, Michel; Blanchard, James F; Moses, Stephen
2015-03-27
This paper examined trends over time in condom use, and the prevalences of HIV and syphilis, among female sex workers (FSWs) in South India. Data from three rounds of cross-sectional surveys were analysed, with HIV and high-titre syphilis prevalence as outcome variables. Multivariable analysis was applied to examine changes in prevalence over time. Five districts in Karnataka state, India. 7015 FSWs were interviewed over three rounds of surveys (round 1=2277; round 2=2387 and round 3=2351). Women who reported selling sex in exchange for money or gifts in the past month, and aged between 18 and 49 years, were included. The surveys were conducted to monitor a targeted HIV prevention programme during 2004-2012. The main interventions included peer-led community outreach, services for the treatment and prevention of sexually transmitted infections, and empowering FSWs through community mobilisation. HIV prevalence declined significantly from rounds 1 to 3, from 19.6% to 10.8% (adjusted OR (AOR)=0.48, p<0.001); high-titre syphilis prevalence declined from 5.9% to 2.4% (AOR=0.50, p<0.001). Reductions were observed in most substrata of FSWs, although reductions among new sex workers, and those soliciting clients using mobile phones or from home, were not statistically significant. Condom use 'always' with occasional clients increased from 73% to 91% (AOR=1.9, p<0.001), with repeat clients from 52% to 86% (AOR=5.0, p<0.001) and with regular partners from 12% to 30% (AOR=4.2, p<0.001). Increased condom use was associated with exposure to the programme. However, condom use with regular partners remained low. The prevalences of HIV infection and high-titre syphilis among FSWs have steadily declined with increased condom use. Further reductions in prevalence will require intensification of prevention efforts for new FSWs and those soliciting clients using mobile phones or from home, as well as increasing condom use in the context of regular partnerships. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Tomori, Cecilia; Srikrishnan, Aylur K; Mehta, Shruti H; Nimmagadda, Nymisha; Anand, Santhanam; Vasudevan, Canjeevaram K; Celentano, David D; Solomon, Sunil S
2017-11-10
In countries such as India, men who have same-sex partnerships may marry women due to cultural pressures regardless of their sexual desires and preferences. The wives of such men may be at risk for HIV but limited existing research addresses this issue. This qualitative study used in-depth interviews to investigate HIV-related risk among married men who have sex with men (n = 34) and women who were aware of their husband's same-sex behaviour (n = 13) from six research sites in five states and a Union Territory in India: Delhi (Delhi), Visakhapatnam (Andhra Pradesh), Hyderabad (Telangana), Bengaluru (Karnataka), Chennai and Madurai (Tamil Nadu). Thematic analysis revealed that wives of men who have sex with men were at risk for HIV from their husbands' sexual practices, which are often hidden to avoid the potential consequences of stigmatisation, as well as from gender-based inequities that make husbands the primary decision-makers about sex and condom use, even when wives are aware of their husband's same-sex behaviour. Innovative interventions are needed to address HIV-related risk in couples where wives remain unaware of their husband's same-sex behaviour, and for wives who are aware but remain within these marriages.
Evaluation of Workload and its Impact on Satisfaction Among Pharmacy Academicians in Southern India
Khan, Muhammad Umair; Srikanth, Akshaya B.; Patel, Isha; Nagappa, Anantha Naik; Jamshed, Shazia Qasim
2015-01-01
Objective The purpose of this study was to determine the level of workload among pharmacy academicians working in public and private sector universities in India. The study also aimed to assess the satisfaction of academicians towards their workload. Materials and Methods A cross-sectional study was conducted for a period of 2 months among pharmacy academicians in Karnataka state of Southern India. Convenience sampling was used to select a sample and was contacted via email and/or social networking sites. Questionnaire designed by thorough review literature was used as a tool to collect data on workload (teaching, research, extracurricular services) and satisfaction. Results Of 214 participants, 95 returned the filled questionnaire giving the response rate of 44.39%. Private sector academicians had more load of teaching (p=0.046) and they appeared to be less involved in research activities (p=0.046) as compared to public sector academicians. More than half of the respondents (57.9%) were satisfied with their workload with Assistant Professors were least satisfied as compared to Professors (p=0.01). Conclusion Overall, private sector academicians are more burdened by teaching load and also are less satisfied of their workload. Revision of private universities policies may aid in addressing this issue. PMID:26266133
2008-01-17
Delhi is the second largest metropolis in India, with a population of 16 million and is located in northern India along the banks of the Yamuna River. This image was acquired by NASA Terra satellite on September 22, 2003.
Raghavendhar, B Siva; Ray, Pratima; Ratagiri, Vinod H; Sharma, B S; Kabra, Sushil K; Lodha, Rakesh
2016-06-01
Chikungunya virus, a small (about 60-70 nm diameter), spherical, enveloped, positive, single stranded RNA virus is transmitted by Aedes mosquitoes. After a short period of incubation (3-5 days) symptoms like fever with joint pains and others start appearing. After a gap of 20 years, this virus re-emerged during 2006-2008 in India causing a major outbreak of CHIKV in India. This study was conducted subsequent to the major outbreak in order to evaluate the proportion of chikungunya virus infection in children with suggestive symptoms at three geographical locations of India. Lineage of circulating strains and changes in the E1 structural polypeptide were also determined. Blood samples were collected (in Sodium citrate vacutainer tubes) during 1st June 2009 to 31st May 2010 from children (age 0 ≤ 18 years) suspected to have chikungunya infection, that is, those who presented with sudden onset of fever and/or joint pain, myalgia, and headache from three regions of India, All India Institute of Medical Sciences (AIIMS) in New Delhi, Karnataka Institute of Medical Sciences (KIMS) in Hubli and Sawai Mansingh Medical College (SMS) in Jaipur. Detection of CHIKV antibodies in all acute-phase patient plasma samples was done by IgM ELISA and for samples within ≤5 days of fever, a one-step RT-PCR was carried out on a block thermo-cycler targeting 294 bp region of E1 gene that codes for the viral envelope protein. Comparison of nucleotide and amino acid sequences from few positive samples of two regions was done with African S-27 reference strain using BioEdit. A phylogenetic tree was constructed using MEGA 6 by using the Maximum Likelihood method based on the Kimura 2-parameter model. Out of the 723 acute phase samples tested from three geographical locations of India, Chikungunya virus infection was detected in 249/723 (34.44%) subjects by either IgM Elisa (180/723) or RT-PCR (69/412). RT-PCR was employed in samples collected from children with ≤5 days of fever. Maximum positive cases were from KIMS center, Hubli. Seasonally, positivity varied with number of enrolled cases at KIMS and SMS. Joint pain was significantly associated with CHIKV positivity (P = 0.0156). Presence/absence of certain clinical features varied with age (P < 0.05). Sequence analysis revealed four amino acid changes. Phylogenetic analysis with partial sequences of E1 gene from KIMS (n = 12) and SMS (n = 5) showed that the study isolates clustered with Indian Ocean Lineage strains (IOL) of East, Central and South African (ECSA) type. Evaluation of chikungunya virus infection in children from India during 2009-2010 showed high proportion of CHIKV infection in Southern region of India compared to Northern region. The circulating CHIKV strains were of Indian Ocean Lineage (IOL) group within the East, Central, and South African (ECSA) genotype. However few amino acid changes were observed in E1 polypeptide with reference to African strain S-27 (AF369024). Further studies are needed to know the implications of these changes in vector-pathogen compatibility and host-pathogen interactivity. As a whole, this study highlighted the proportion of CHIKV cases, lineage of causative strain and evolutionary pattern of circulating strain in terms of amino acid changes in the structural protein. © 2015 Wiley Periodicals, Inc.
Tamil Chola Bronzes and Swamimalai Legacy: Metal Sources and Archaeotechnology
NASA Astrophysics Data System (ADS)
Srinivasan, Sharada
2016-08-01
This review explores the great copper alloy image casting traditions of southern India from archaeometallurgical and ethnometallurgical perspectives. The usefulness of lead isotope ratio and compositional analysis in the finger-printing and art historical study of more than 130 early historic, Pallava, Chola, later Chola, and Vijayanagara sculptures (fifth-eighteenth centuries) is highlighted, including Nataraja, Buddha, Parvati, and Rama images made of copper, leaded bronze, brass, and gilt copper. Image casting traditions at Swamimalai in Tamil Nadu are compared with artistic treatises and with the technical examination of medieval bronzes, throwing light on continuities and changes in foundry practices. Western Indian sources could be pinpointed for a couple of medieval images from lead isotope analysis. Slag and archaeometallurgical investigations suggest the exploitation of some copper and lead-silver sources in the Andhra and Karnataka regions in the early historic Satavahana period and point to probable copper sources for the medieval images in Karnataka, Tamil Nadu, and Andhra Pradesh. The general lower iron content in southern Indian bronzes perhaps renders the proximal copper-magnetite reserves of Seruvila in Sri Lanka as a less likely source. Given the lack of lead deposits in Sri Lanka, however, the match of the lead isotope signatures of a well-known Ceylonese Buddhist Tara in British Museum with a Buddha image from Nagapattinam in Tamil Nadu may underscore ties between the island nation and the southern Indian Tamil regions.
Fog Occurrence and Associated Meteorological Factors Over Kempegowda International Airport, India
NASA Astrophysics Data System (ADS)
Kutty, Saumya G.; Agnihotri, G.; Dimri, A. P.; Gultepe, I.
2018-05-01
The increase in fog frequency over the past few decades is a major cause of concern for the aviation and transportation sectors. Accurate forecasting of the spatio-temporal extent of fog is crucial for minimizing socioeconomic losses. The present study attempts to characterize the fog frequency and associated meteorological factors over Kempegowda International Airport, Bengaluru (KIAB), in Karnataka, India. Maximum fog occurrence is observed during the month of December, followed by January. The time of onset of fog lies usually between 1800 and 0300 UTC. No fog is formed between 0400 and 1700 UTC indicating the role of radiation fog. The predominant wind direction during fog events is east or southeasterly. There is significant positive correlation between the fog frequency and both the northeast monsoon, October-November (0.72), as well as December-January-February (DJF) rainfall (0.80). Soil moisture conditions during the DJF period also play a key role in fog occurrence and its climatology, which is evident from the correlation coefficient of order 0.68. These suggest that further research is needed for understanding the extent of impact on aviation at KIAB.
Occupational exposure of cashew nut workers to Kyasanur Forest disease in Goa, India.
Patil, D Y; Yadav, P D; Shete, A M; Nuchina, J; Meti, R; Bhattad, D; Someshwar, S; Mourya, D T
2017-08-01
A series of suspected cases of Kyasanur Forest disease (KFD) in subjects returning to Belgaum in Karnataka State from Goa, India, is reported herein. KFD was confirmed in 13 out of 76 cases, either by real time RT-PCR or IgM ELISA. No case fatality was recorded. KFD virus positivity was also recorded among humans and monkeys from Sattari taluk in Goa during the same period. The envelope gene sequence of positive human samples from Belgaum showed highest identity of 99.98% to 99.99% with sequences of KFD virus isolated from human cases and monkeys from Goa. KFD activity has been reported from Goa among humans and monkeys since 2015. However, it has not been reported from Belgaum to date. These findings suggest that the cases (migrant laborers) contracted infection during cashew nut harvesting from KFD-affected Keri village, Sattari taluk, Goa and became ill after or during migration from the affected area to their native residence. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Pattenden, Jonathan
2010-01-01
This paper notes the prominence of self-help groups (SHGs) within current anti-poverty policy in India, and analyses the impacts of government- and NGO-backed SHGs in rural North Karnataka. It argues that self-help groups represent a partial neoliberalisation of civil society in that they address poverty through low-cost methods that do not challenge the existing distribution of power and resources between the dominant class and the labouring class poor. It finds that intra-group savings and loans and external loans/subsidies can provide marginal economic and political gains for members of the dominant class and those members of the labouring classes whose insecure employment patterns currently provide above poverty line consumption levels, but provide neither material nor political gains for the labouring class poor. Target-oriented SHG catalysts are inattentive to how the social relations of production reproduce poverty and tend to overlook class relations and socio-economic and political differentiation within and outside of groups, which are subject to interference by dominant class local politicians and landowners.
Impact of riparian land use on stream insects of Kudremukh National Park, Karnataka state, India.
Subramanian, K A; Sivaramakrishnan, K G; Gadgil, Madhav
2005-12-31
The impact of riparian land use on the stream insect communities was studied at Kudremukh National Park located within Western Ghats, a tropical biodiversity hotspot in India. The diversity and community composition of stream insects varied across streams with different riparian land use types. The rarefied family and generic richness was highest in streams with natural semi evergreen forests as riparian vegetation. However, when the streams had human habitations and areca nut plantations as riparian land use type, the rarefied richness was higher than that of streams with natural evergreen forests and grasslands. The streams with scrub lands and iron ore mining as the riparian land use had the lowest rarefied richness. Within a landscape, the streams with the natural riparian vegetation had similar community composition. However, streams with natural grasslands as the riparian vegetation, had low diversity and the community composition was similar to those of paddy fields. We discuss how stream insect assemblages differ due to varied riparian land use patterns, reflecting fundamental alterations in the functioning of stream ecosystems. This understanding is vital to conserve, manage and restore tropical riverine ecosystems.
Kerala reaps low fertility dividends.
1992-01-01
Unlike much of India, the state of Kerala has promoted the development of human resources, resulting in lower fertility rates. If current UN projections are correct, India will overtake China as the most populous nation in the world by 2025. Within India, however, great differences exist in fertility rates, reflecting the level of commitment from state governments. In India, state governments control much of the policy and spending on health, education, etc. While the state of Kerala has been among the most committed to human resource development in the developing world, India's 5 northern states (Rajasthan, Uttar Pradesh, Madhya Pradesh, Bihar, and Orissa) have been among the least committed. As a result, Kerala's fertility rate has fallen to 2.3 children/women--a rate lower than that of Thailand, China, the formers USSR, or Ireland. Kerala has a contraceptive prevalence rate 3 times the national average and the lowest infant mortality rate in all of India--only 26/1000 live births (infant mortality is 4-5 times higher in the 5 northern states). Only 27% of Kerala's population lives in poverty, compared to 34-49.5% in the northern states. Real incomes and industrialization have been growing faster in Kerala. And industrialization does not appear to have come at the expense of the environment. 2 factors are responsible for Kerala' accomplishments: 1) State government support of human development--the state has invested in health, education, and has conducted a land reform benefiting 3 million landless peasants. 2) The status of women--in Kerala, women are viewed as an asset, not a liability (as in the north). Kerala's female literacy is 66%, compared to 11-21% in the northern states. Kerala also enjoys the highest level of female labor force participation (35%) anywhere in India.
NASA Astrophysics Data System (ADS)
Bhattarai, N.; Jain, M.
2016-12-01
Expected changes in temperature and precipitation patterns in the rice-wheat belt of Northern India have implications for balancing crop water demand and available water resources. Because the impacts of water scarcity and reduced crop production are realized at a local scale, water-saving interventions are most effective when implemented locally. However, a paucity of fine-scale studies on the relationship between variations in climate and crop water demand has limited our ability to effectively implement such interventions. In an effort to better understand the responses of irrigated crops to changing climate in Northern India at finer-scales, we propose a remote sensing based semi-empirical approach. First, we employ a multi-model surface energy balance (SEB) approach to map seasonal evapotranspiration (ET)/water use (1995-2015) at 30 to 100 m resolution from space and investigate how seasonal and inter-annual variations in temperature and precipitation are associated with regional surface-energy budgets. Second, using remote estimates of ET and other biophysical variables, such as vegetation indices, land surface temperature, and albedo, we will explain the possible relationships between climate change and seasonal water demands of crops. Our estimates of high/moderate resolution (30 to 100 m) seasonal ET maps can make clear distinctions between impacts of climate variations on crop water demand at field, plot, and regional scales in Northern India. Finally, by improving our ability to identify targeted area for water-saving interventions, this study supports agricultural resiliency of Northern India in the face of climate change.
Sgaier, Sema K; Anthony, John; Bhattacharjee, Parinita; Baer, James; Malve, Vidyacharan; Bhalla, Aparajita; Hugar, Vijaykumar S
2014-01-01
ABSTRACT Scaling up HIV prevention programming among key populations (female sex workers and men who have sex with men) has been a central strategy of the Government of India. However, state governments have lacked the technical and managerial capacity to oversee and scale up interventions or to absorb donor-funded programs. In response, the national government contracted Technical Support Units (TSUs), teams with expertise from the private and nongovernmental sectors, to collaborate with and assist state governments. In 2008, a TSU was established in Karnataka, one of 6 Indian states with the highest HIV prevalence in the country and where monitoring showed that its prevention programs were reaching only 5% of key populations. The TSU provided support to the state in 5 key areas: assisting in strategic planning, rolling out a comprehensive monitoring and evaluation system, providing supportive supervision to intervention units, facilitating training, and assisting with information, education, and communication activities. This collaborative management model helped to increase capacity of the state, enabling it to take over funding and oversight of HIV prevention programs previously funded through donors. With the combined efforts of the TSU and the state government, the number of intervention units statewide increased from 40 to 126 between 2009 and 2013. Monthly contacts with female sex workers increased from 5% in 2008 to 88% in 2012, and with men who have sex with men, from 36% in 2009 to 81% in 2012. There were also increases in the proportion of both populations who visited HIV testing and counseling centers (from 3% to 47% among female sex workers and from 6% to 33% among men who have sex with men) and sexually transmitted infection clinics (from 4% to 75% among female sex workers and from 7% to 67% among men who have sex with men). Changes in sexual behaviors among key populations were also documented. For example, between 2008 and 2010, the proportion of surveyed female sex workers in 9 districts reporting that they used a condom at last intercourse rose from 60% to 68%; in 6 districts, the proportion of surveyed men who have sex with men reporting that they used a condom at last anal sex increased from 89% to 97%. The Karnataka experience suggests that TSUs can help governments enhance managerial and technical resources and leverage funds more effectively. With careful management of the working and reporting relationships between the TSU and the state government, this additional capacity can pave the way for the government to improve and scale up programs and to absorb previously donor-funded programs. PMID:25611478
Gower, David J; Giri, Varad; Torsekar, Varun R; Gaikwad, Kshamata
2013-01-29
Examination of type material and new collections from Goa, southern Maharashtra and northern Karnataka, leads to the conclusion that Gegeneophis nadkarnii Bhatta & Prashanth, 2004 is a subjective junior synonym of Gegeneophis danieli Giri, Wilkinson & Gower, 2003. The purported differences between these species are very minor and attributable to nor-mal individual variation, except for some features of the dentition that are peculiar to the exceptionally abnormal paratype of G. nadkarnii. This taxonomic revision extends the known geographic range of G. danieli and suggests it could be trans-ferred from Data Deficient to Least Concern status in the IUCN Red List.
NASA Technical Reports Server (NTRS)
Asoka, Akarsh; Gleeson, Tom; Wada, Yoshihide; Mishra, Vimal
2017-01-01
The depletion of groundwater resources threatens food and water security in India. However, the relative influence of groundwater pumping and climate variability on groundwater availability and storage remains unclear. Here we show from analyses of satellite and local well data spanning the past decade that long-term changes in monsoon precipitation are driving groundwater storage variability in most parts of India either directly by changing recharge or indirectly by changing abstraction. We find that groundwater storage has declined in northern India at the rate of 2 cm/yr and increased by 1 to 2 cm/yr in southern India between 2002 and 2013. We find that a large fraction of the total variability in groundwater storage in north-central and southern India can be explained by changes in precipitation. Groundwater storage variability in northwestern India can be explained predominantly by variability in abstraction for irrigation, which is in turn influenced by changes in precipitation. Declining precipitation in northern India is linked to Indian Ocean warming, suggesting a previously unrecognized teleconnection between ocean temperatures and groundwater storage.
Sustained progress, but no room for complacency: Results of 2015 HIV estimations in India
Pandey, Arvind; Dhingra, Neeraj; Kumar, Pradeep; Sahu, Damodar; Reddy, D.C.S.; Narayan, Padum; Raj, Yujwal; Sangal, Bhavna; Chandra, Nalini; Nair, Saritha; Singh, Jitenkumar; Chavan, Laxmikant; Srivastava, Deepika Joshi; Jha, Ugra Mohan; Verma, Vinita; Kant, Shashi; Bhattacharya, Madhulekha; Swain, Pushpanjali; Haldar, Partha; Singh, Lucky; Bakkali, Taoufik; Stover, John; Ammassari, Savina
2017-01-01
Background & objectives: Evidence-based planning has been the cornerstone of India's response to HIV/AIDS. Here we describe the process, method and tools used for generating the 2015 HIV estimates and provide a summary of the main results. Methods: Spectrum software supported by the UNAIDS was used to produce HIV estimates for India as a whole and its States/Union Territories. This tool takes into consideration the size and HIV prevalence of defined population groups and programme data to estimate HIV prevalence, incidence and mortality over time as well as treatment needs. Results: India's national adult prevalence of HIV was 0.26 per cent in 2015. Of the 2.1 million people living with HIV/AIDS, the largest numbers were in Andhra Pradesh, Maharashtra and Karnataka. New HIV infections were an estimated 86,000 in 2015, reflecting a decline by around 32 per cent from 2007. The declining trend in incidence was mirrored in most States, though an increasing trend was detected in Assam, Chandigarh, Chhattisgarh, Gujarat, Sikkim, Tripura and Uttar Pradesh. AIDS-related deaths were estimated to be 67,600 in 2015, reflecting a 54 per cent decline from 2007. There were variations in the rate and trend of decline across India for this indicator also. Interpretation & conclusions: While key indicators measured through Spectrum modelling confirm success of the National AIDS Control Programme, there is no room for complacency as rising incidence trends in some geographical areas and population pockets remain the cause of concern. Progress achieved so far in responding to HIV/AIDS needs to be sustained to end the HIV epidemic. PMID:29168464
Molecular Studies of Alphavirus Immunogenicity
1992-12-03
RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian
Akshaya, Kibballi Madhukeshwar; Shivalli, Siddharudha
2017-01-01
Birth preparedness and complication readiness (BPCR) is a strategy to promote timely use of skilled maternal and neonatal care during childbirth. According to World Health Organization, BPCR should be a key component of focused antenatal care. Dakshina Kannada, a coastal district of Karnataka state, is categorized as a high-performing district (institutional delivery rate >25%) under the National Rural Health Mission. However, a substantial proportion of women in the district experience complications during pregnancy (58.3%), childbirth (45.7%), and postnatal (17.4%) period. There is a paucity of data on BPCR practice and the factors associated with it in the district. Exploring this would be of great use in the evidence-based fine-tuning of ongoing maternal and child health interventions. To assess BPCR practice and the factors associated with it among the beneficiaries of two rural Primary Health Centers (PHCs) of Dakshina Kannada district, Karnataka, India. A facility-based cross-sectional study was conducted among 217 pregnant (>28 weeks of gestation) and recently delivered (in the last 6 months) women in two randomly selected PHCs from June -September 2013. Exit interviews were conducted using a pre-designed semi-structured interview schedule. Information regarding socio-demographic profile, obstetric variables, and knowledge of key danger signs was collected. BPCR included information on five key components: identified the place of delivery, saved money to pay for expenses, mode of transport identified, identified a birth companion, and arranged a blood donor if the need arises. In this study, a woman who recalled at least two key danger signs in each of the three phases, i.e., pregnancy, childbirth, and postpartum (total six) was considered as knowledgeable on key danger signs. Optimal BPCR practice was defined as following at least three out of five key components of BPCR. Proportion, Odds ratio, and adjusted Odds ratio (adj OR) for optimal BPCR practice. A total of 184 women completed the exit interview (mean age: 26.9±3.9 years). Optimal BPCR practice was observed in 79.3% (95% CI: 73.5-85.2%) of the women. Multivariate logistic regression revealed that age >26 years (adj OR = 2.97; 95%CI: 1.15-7.7), economic status of above poverty line (adj OR = 4.3; 95%CI: 1.12-16.5), awareness of minimum two key danger signs in each of the three phases, i.e., pregnancy, childbirth, and postpartum (adj OR = 3.98; 95%CI: 1.4-11.1), preference to private health sector for antenatal care/delivery (adj OR = 2.9; 95%CI: 1.1-8.01), and woman's discussion about the BPCR with her family members (adj OR = 3.4; 95%CI: 1.1-10.4) as the significant factors associated with optimal BPCR practice. In this study population, BPCR practice was better than other studies reported from India. Healthcare workers at the grassroots should be encouraged to involve women's family members while explaining BPCR and key danger signs with a special emphasis on young (<26 years) and economically poor women. Ensuring a reinforcing discussion between woman and her family members may further enhance the BPCR practice.
Akshaya, Kibballi Madhukeshwar
2017-01-01
Introduction Birth preparedness and complication readiness (BPCR) is a strategy to promote timely use of skilled maternal and neonatal care during childbirth. According to World Health Organization, BPCR should be a key component of focused antenatal care. Dakshina Kannada, a coastal district of Karnataka state, is categorized as a high-performing district (institutional delivery rate >25%) under the National Rural Health Mission. However, a substantial proportion of women in the district experience complications during pregnancy (58.3%), childbirth (45.7%), and postnatal (17.4%) period. There is a paucity of data on BPCR practice and the factors associated with it in the district. Exploring this would be of great use in the evidence-based fine-tuning of ongoing maternal and child health interventions. Objective To assess BPCR practice and the factors associated with it among the beneficiaries of two rural Primary Health Centers (PHCs) of Dakshina Kannada district, Karnataka, India. Methods A facility-based cross-sectional study was conducted among 217 pregnant (>28 weeks of gestation) and recently delivered (in the last 6 months) women in two randomly selected PHCs from June -September 2013. Exit interviews were conducted using a pre-designed semi-structured interview schedule. Information regarding socio-demographic profile, obstetric variables, and knowledge of key danger signs was collected. BPCR included information on five key components: identified the place of delivery, saved money to pay for expenses, mode of transport identified, identified a birth companion, and arranged a blood donor if the need arises. In this study, a woman who recalled at least two key danger signs in each of the three phases, i.e., pregnancy, childbirth, and postpartum (total six) was considered as knowledgeable on key danger signs. Optimal BPCR practice was defined as following at least three out of five key components of BPCR. Outcome measures Proportion, Odds ratio, and adjusted Odds ratio (adj OR) for optimal BPCR practice. Results A total of 184 women completed the exit interview (mean age: 26.9±3.9 years). Optimal BPCR practice was observed in 79.3% (95% CI: 73.5–85.2%) of the women. Multivariate logistic regression revealed that age >26 years (adj OR = 2.97; 95%CI: 1.15–7.7), economic status of above poverty line (adj OR = 4.3; 95%CI: 1.12–16.5), awareness of minimum two key danger signs in each of the three phases, i.e., pregnancy, childbirth, and postpartum (adj OR = 3.98; 95%CI: 1.4–11.1), preference to private health sector for antenatal care/delivery (adj OR = 2.9; 95%CI: 1.1–8.01), and woman’s discussion about the BPCR with her family members (adj OR = 3.4; 95%CI: 1.1–10.4) as the significant factors associated with optimal BPCR practice. Conclusion In this study population, BPCR practice was better than other studies reported from India. Healthcare workers at the grassroots should be encouraged to involve women’s family members while explaining BPCR and key danger signs with a special emphasis on young (<26 years) and economically poor women. Ensuring a reinforcing discussion between woman and her family members may further enhance the BPCR practice. PMID:28837683
Gupta, Ritu; Acharya, Arun Kumar
2016-01-01
Background and Objectives. Pregnancy can be a risk factor for dental diseases as oral tissues are liable to changes due to hormonal variations. The aim of the study was to assess the oral health status and treatment needs among pregnant women of Raichur district, Karnataka, India. Methods. Cross-sectional data was collected from 300 primigravidae from all the 5 taluks of Raichur district visiting the respective community health centre at taluk headquarters. A specially designed questionnaire was used to assess the demographic variables and oral hygiene practices. A clinical examination was done according to WHO (World Health Organization) criteria 1997 and recorded using WHO Oral Health Assessment Form. Results. The mean age of the pregnant women in the study was 21.8 (2.12) years. The prevalence of caries and periodontal diseases was 62.7% and 95%, respectively. The mean DT, MT, FT, and DMFT were 2.06 (2.5), 0.03 (0.17), 0.04 (0.27), and 2.13 (2.54), respectively. The mean OHI-S was 2.87 (1.27). Chi-square test showed that CPI scores increased with the trimester of pregnancy. Conclusion. The present study demonstrates poor oral hygiene and high prevalence of periodontal diseases, as well as a large proportion of unmet dental treatment needs among pregnant women of Raichur district, India.
Acharya, Arun Kumar
2016-01-01
Background and Objectives. Pregnancy can be a risk factor for dental diseases as oral tissues are liable to changes due to hormonal variations. The aim of the study was to assess the oral health status and treatment needs among pregnant women of Raichur district, Karnataka, India. Methods. Cross-sectional data was collected from 300 primigravidae from all the 5 taluks of Raichur district visiting the respective community health centre at taluk headquarters. A specially designed questionnaire was used to assess the demographic variables and oral hygiene practices. A clinical examination was done according to WHO (World Health Organization) criteria 1997 and recorded using WHO Oral Health Assessment Form. Results. The mean age of the pregnant women in the study was 21.8 (2.12) years. The prevalence of caries and periodontal diseases was 62.7% and 95%, respectively. The mean DT, MT, FT, and DMFT were 2.06 (2.5), 0.03 (0.17), 0.04 (0.27), and 2.13 (2.54), respectively. The mean OHI-S was 2.87 (1.27). Chi-square test showed that CPI scores increased with the trimester of pregnancy. Conclusion. The present study demonstrates poor oral hygiene and high prevalence of periodontal diseases, as well as a large proportion of unmet dental treatment needs among pregnant women of Raichur district, India. PMID:27293984
NASA Technical Reports Server (NTRS)
Laul, K. M.; Kim, K. M.
2010-01-01
In this paper, we present corroborative observational evidences from satellites, in-situ observations, and re-analysis data showing possible impacts of absorbing aerosols (black carbon and dust) on subseasonal and regional summer monsoon rainfall over India. We find that increased absorbing aerosols in the Indo-Gangetic Plain in recent decades may have lead to long-term warming of the upper troposphere over northern India and the Tibetan Plateau, enhanced rainfall in northern India and the Himalayas foothill regions in the early part (may-June) of the monsoon season, followed by diminished rainfall over central and southern India in the latter part (July-August) of the monsoon season. These signals which are consistent with current theories of atmospheric heating and solar dimming by aerosol and induced cloudiness in modulating the Indian monsoon, would have been masked by conventional method of using al-India rainfall averaged over the entire monsoon season.
Blanchard, James F; O'neil, John; Ramesh, B M; Bhattacharjee, Parinita; Orchard, Treena; Moses, Stephen
2005-02-01
The objective of the present study was to compare the sociodemographic characteristics and sex work patterns of women involved in the traditional Devadasi form of sex work with those of women involved in other types of sex work, in the Indian state of Karnataka. Data were gathered through in-person interviews. Sampling was stratified by district and by type of sex work. Of 1588 female sex workers (FSWs) interviewed, 414 (26%) reported that they entered sex work through the Devadasi tradition. Devadasi FSWs were more likely than other FSWs to work in rural areas (47.3% vs. 8.9%, respectively) and to be illiterate (92.8% vs. 76.9%, respectively). Devadasi FSWs had initiated sex work at a much younger age (mean, 15.7 vs. 21.8 years), were more likely to be home based (68.6% vs. 14.9%), had more clients in the past week (average, 9.0 vs. 6.4), and were less likely to migrate for work within the state (4.6% vs. 18.6%) but more likely to have worked outside the state (19.6% vs. 13.1%). Devadasi FSWs were less likely to report client-initiated violence during the past year (13.3% vs. 35.8%) or police harassment (11.6% vs. 44.3%). Differences in sociobehavioral characteristics and practice patterns between Devadasi and other FSWs necessitate different individual and structural interventions for the prevention of sexually transmitted infections, including human immunodeficiency virus infection.
Prasanna Kumar, S P; Hariprasad, P; Brijesh Singh, S; Gowtham, H G; Niranjana, S R
2014-01-01
The present study carried out with denaturing gradient gel electrophoresis of DNA extracted from rhizosphere soils of Rauwolfia spp. collected from Western Ghat (WG) regions of Karnataka indicated that Pseudomonas sp. was prevalently found followed by Methylobacterium sp., Bacillus sp. and uncultured bacteria. A total of 200 rhizobacteria were isolated from 58 rhizosphere soil samples comprising of 15 different bacterial genera. The Shannon Weaver diversity index (H') and Simpson's diversity index (D) were found to be 2.57 and 0.91 for cultivable bacteria, respectively. The total species richness of cultivable rhizobacteria was high in Coorg district comprising 15 bacterial genera while in Mysore district, four bacterial genera were recorded. Rarefaction curve analysis also indicated the presence of higher species richness in samples of Shimoga and Coorg. All the rhizobacteria were screened for their multiple plant growth promotion and disease suppression traits. The results revealed that 70% of the isolates colonized tomato roots, 42% produced indole acetic acid, 55% solubilized phosphorus, while 43, 22, 27, 19, 40, 15 and 44% produced siderophore, salicylic acid, hydrogen cyanide, chitinase, phytase, cellulase and protease, respectively. Rhizobacterial isolates showing antagonistic activity against Fusarium oxysporum and Aspergillus flavus were 53 and 33%, respectively. Plant growth promotion studies revealed that most of the isolates increased percent germination with significantly higher vigour index as compared to untreated control. Most predominant rhizobacteria found in the rhizospheres of Rauwolfia spp. of WG regions are potential PGPR which can serve as biofertilizers and biopesticides.
NASA Astrophysics Data System (ADS)
Rakesh, V.; Kantharao, B.
2017-03-01
Data assimilation is considered as one of the effective tools for improving forecast skill of mesoscale models. However, for optimum utilization and effective assimilation of observations, many factors need to be taken into account while designing data assimilation methodology. One of the critical components that determines the amount and propagation observation information into the analysis, is model background error statistics (BES). The objective of this study is to quantify how BES in data assimilation impacts on simulation of heavy rainfall events over a southern state in India, Karnataka. Simulations of 40 heavy rainfall events were carried out using Weather Research and Forecasting Model with and without data assimilation. The assimilation experiments were conducted using global and regional BES while the experiment with no assimilation was used as the baseline for assessing the impact of data assimilation. The simulated rainfall is verified against high-resolution rain-gage observations over Karnataka. Statistical evaluation using several accuracy and skill measures shows that data assimilation has improved the heavy rainfall simulation. Our results showed that the experiment using regional BES outperformed the one which used global BES. Critical thermo-dynamic variables conducive for heavy rainfall like convective available potential energy simulated using regional BES is more realistic compared to global BES. It is pointed out that these results have important practical implications in design of forecast platforms while decision-making during extreme weather events
Bradley, Janet; Moses, Stephen; Blanchard, James F; Rajaram, S; Ramesh, B M; Verma, Supriya; Alary, Michel
2010-02-01
A key indicator of success of HIV prevention programmes is the number of female sex worker (FSW) sex acts protected by condoms. This measure usually relies on FSW reports, which may be biased. We examined condom availability data in five Karnataka districts to estimate the proportion of FSW sex acts potentially protected by condoms. Financial, programme, population, condom and contraceptive data were obtained from governmental and non-governmental sources, surveys and HIV prevention programmes. Sexual behaviour data were obtained from general population and FSW surveys. We examined four scenarios in a sensitivity analysis, each one assuming different proportions of available condoms that might have been used by sex workers. Possible condom use rates for all FSW sex acts ranged from 3%-36% in 2004 to 56%-96% in 2008. The two most realistic scenarios that discounted the number of private sector condoms that might have been bought for sex acts other than with FSWs showed that 16-24% of FSW sex acts could have been protected by condoms in 2004 rising to 77-85% in 2008. These data suggest that condom availability in these Karnataka districts in 2004 was low in relation to the number of FSW sex acts, but rose substantially over the ensuing 4 years. Condom availability data can be useful for triangulation with other available data, such as self-reported condom use, to provide a range of possibilities regarding the number of FSW sex acts protected by condoms.
Amplification of ENSO Effects on Indian Summer Monsoon by Absorbing Aerosols
NASA Technical Reports Server (NTRS)
Kim, Maeng-Ki; Lau, William K. M.; Kim, Kyu-Myong; Sang, Jeong; Kim, Yeon-Hee; Lee, Woo-Seop
2015-01-01
In this study, we present observational evidence, based on satellite aerosol measurements and MERRA reanalysis data for the period 1979-2011, indicating that absorbing aerosols can have strong influence on seasonal-to-interannual variability of the Indian summer monsoon rainfall, including amplification of ENSO effects. We find a significant correlation between ENSO (El Nino Southern Oscillation) and aerosol loading in April-May, with La Nina (El Nino) conditions favoring increased (decreased) aerosol accumulation over northern India, with maximum aerosol optical depth (AOD) over the Arabian Sea and Northwestern India, indicative of strong concentration of dust aerosols transported from West Asia and Middle East deserts. Composite analyses based on a normalized aerosol index (NAI) show that high concentration of aerosol over northern India in April-May is associated with increased moisture transport, enhanced dynamically induced warming of the upper troposphere over the Tibetan Plateau, and enhanced rainfall over northern India and the Himalayan foothills during May-June, followed by a subsequent suppressed monsoon rainfall over all India,consistent with the Elevated Heat Pump (EHP) hypothesis (Lau et al. 2006). Further analyses from sub-sampling of ENSO years, with normal (less than 1 sigma), and abnormal (greater than 1 sigma)) NAI over northern India respectively show that the EHP may lead to an amplification of the Indian summer monsoon response to ENSO forcing, particularly with respect to the increased rainfall over the Himalayan foothills, and the warming of the upper troposphere over the Tibetan Plateau. Our results suggest that absorbing aerosol, particular desert dusts can strongly modulate ENSO influence, and possibly play important roles as a feedback agent in climate change in Asian monsoon regions.
1970-01-01
saland), NIGERIA, PORTUGUESE GUINEA , RHODESIA ( Southern Rhodesia), SENEGAL, SOUTH AFRICA, SUDAN, TANZANIA (Tanganyika), UGANDA, UPPER VOLTA, ZAMBIA...dae) from southern India. J. med. Ent. SCANLON, J. E. and S. ESAH. 1965. Distribution in altitude of mosquitoes in northern Thailand. Mosquito News... Northern Rhodesia) and from the Oriental Region: BURMA, CEYLON, INDIA(mainland and Nicobar Islands), INDONESIA, WEST MALAYSIA, PHILIPPINES
Type 1 diabetes in India: Overall insights.
Das, Ashok Kumar
2015-04-01
Type 1 diabetes mellitus (T1DM) is also on increase like type 2 diabetes, even though not in the same proportion, but still with a trend of 3-5% increase/year. India has three new cases of T1DM/100,000 children of 0-14 years. Three sets of prevalence data shows 17.93 cases/100,000 children in Karnataka, 3.2 cases/100,000 children in Chennai, and 10.2 cases/100,000 children in Karnal (Haryana). T1DM may be autoimmune or idiopathic in nature and is present in 9% cases of insulin deficiency. T1DM is primarily caused by genetic factors, environmental factors, and disorder of the immune regulatory mechanism. A combination of all these three factors causes autoimmune disease, which may ultimately result in the destruction of pancreatic beta cells leading to hyperglycemia, ketoacidosis and potentially death, if not treated with insulin. Prediabetes is the phase before the onset of T1DM, which provides a window of opportunity for early intervention. All available interventions including steroids, immunosuppressants, and cyclosporins can be possibly applied during the prediabetes phase. The treatment goals for T1DM are simple and include maintaining near normal blood glucose levels and avoiding long-term complications, which is a constant juggle between insulin and maintaining an appropriate lifestyle. The Indian Council of Medical Research funded Registry of People with diabetes in India with young age at onset (YDR) was started in the year 2006 with 10 collaborating centres across India. This registry is focusing on to provide an overview of diabetes in the young.
Ajay, Shweta; Kasthuri, Arvind; Kiran, Pretesh; Malhotra, Rahul
In India, owing to cultural norms and a lack of formal long-term care facilities, responsibility for care of the older person falls primarily on the family. Based on the stress process model, we assessed the association of type and number of impairments of older persons (∼primary stressors) with caregiver burden among their family caregivers in rural South India. All impaired older persons (aged ≥60, with impairment in activities of daily living (ADL) or cognition or vision or hearing) residing in 8 villages in Bangalore district, Karnataka, India, and their primary informal caregivers were interviewed. Caregiver burden was measured using the Zarit Burden Interview (ZBI; higher score indicating greater perceived burden). Linear regression models, adjusting for background characteristics of older persons and caregivers, assessed the association of type of impairment (physical [Yes/No], cognitive [Yes/No], vision [Yes/No] and hearing [Yes/No]) and number (1 or 2 or 3 or 4) of older person impairments with caregiver burden. A total of 140 caregivers, caring for 149 older persons, were interviewed. The mean (standard deviation) ZBI score was 21.2 (12.9). Of the various older person impairments, ZBI score was associated only with physical impairment (β=6.6; 95% CI: 2.1-11.1). Relative to caregivers of older person with one impairment, those caring for an older person with all 4 impairments had significantly higher ZBI score (β=13.9; CI: 2.5-25.4). Caregivers of older persons with multiple impairments, especially physical impairment, are vulnerable. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Sethuraman, Kavita; Lansdown, Richard; Sullivan, Keith
2006-06-01
Moderate malnutrition continues to affect 46% of children under five years of age and 47% of rural women in India. Women's lack of empowerment is believed to be an important factor in the persistent prevalence of malnutrition. In India, women's empowerment often varies by community, with tribes sometimes being the most progressive. To explore the relationship between women's empowerment, maternal nutritional status, and the nutritional status of their children aged 6 to 24 months in rural and tribal communities. This study in rural Karnataka, India, included tribal and rural subjects and used both qualitative and quantitative methods of data collection. Structured interviews with mothers were performed and anthropometric measurements were obtained for 820 mother-child pairs. The data were analyzed by multivariate and logistic regression. Some degree of malnutrition was seen in 83.5% of children and 72.4% of mothers in the sample. Biological variables explained most of the variance in nutritional status, followed by health-care seeking and women's empowerment variables; socioeconomic variables explained the least amount of variance. Women's empowerment variables were significantly associated with child nutrition and explained 5.6% of the variance in the sample. Maternal experience of psychological abuse and sexual coercion increased the risk of malnutrition in mothers and children. Domestic violence was experienced by 34% of mothers in the sample. In addition to the known investments needed to reduce malnutrition, improving women's nutrition, promoting gender equality, empowering women, and ending violence against women could further reduce the prevalence of malnutrition in this segment of the Indian population.
Characteristics of suicidal attempts among farmers in rural South India
Kumar, Ravi S.; Hashim, Uzma
2017-01-01
Background: Globally, farming as an industry is considered a high-risk occupation for suicides. Certain states in India like Karnataka have a suicide rate higher than the national average, and this is generally attributed to the farmers’ suicide. Aims: The aim is to study the characteristics of suicidal attempts among the farmer community in South India, with special emphasis on gender differences, modes used, and the immediate precipitant causes. Materials and Methods: Retrospective, case register-based, explorative-descriptive study of 426 consecutive medicolegal case files of patients whose stated occupation was farming and who were admitted as cases of deliberate self-harm or suicide attempt to a rural tertiary care hospital in rural South India. Results: Out of the 426 farmers who attempted suicide, majority were male (355, 83.3%), in the age group of 21–40 years (318, 75%), married (358, 84%), and belonging to lower socioeconomic status (268, 62.9%). About 54% of them had attempted suicide by consuming pesticides (230). Surprisingly, 183 (43%) and 86 (20.2%) reported the immediate precipitant as being relationship issues and marital conflict, respectively, and only 100 (23.5%) attributed it to financial reasons. Females were significantly associated with a past history of suicidal attempt while males tended to abuse alcohol before an attempt more frequently. Conclusions: Pesticide poisoning was the most common mode for attempting suicide among the farmers. Contrary to public perception and other studies, relationship, and marital issues, not financial reasons were found to be the most common immediate precipitant for the attempters in our study. PMID:29456318
2011-01-01
Background Unmet needs for mental health treatment in low income countries are pervasive. If mental health is to be effectively integrated into primary health care in low income countries like India then grass-roots workers need to acquire relevant knowledge and skills to be able to recognise, refer and support people experiencing mental disorders in their own communities. This study aims to provide a mental health training intervention to community health workers in Bangalore Rural District, Karnataka, India, and to evaluate the impact of this training on mental health literacy. Methods A pre-test post-test study design was undertaken with assessment of mental health literacy at three time points; baseline, completion of the training, and three month follow-up. Mental health literacy was assessed using the interviewer-administered Mental Health Literacy Survey. The training intervention was a four day course based on a facilitator's manual developed specifically for community health workers in India. Results 70 community health workers from Doddaballapur, Bangalore Rural District were recuited for the study. The training course improved participants' ability to recognize a mental disorder in a vignette, and reduced participants' faith in unhelpful and potentially harmful pharmacological interventions. There was evidence of a minor reduction in stigmatizing attitudes, and it was unclear if the training resulted in a change in participants' faith in recovery following treatment. Conclusion The findings from this study indicate that the training course demonstrated potential to be an effective way to improve some aspects of mental health literacy, and highlights strategies for strengthening the training course. PMID:21819562
NASA Astrophysics Data System (ADS)
Basavarajappa, T. H.
2012-07-01
Landfill site selection is a complex process involving geological, hydrological, environmental and technical parameters as well as government regulations. As such, it requires the processing of a good amount of geospatial data. Landfill site selection techniques have been analyzed for identifying their suitability. Application of Geographic Information System (GIS) is suitable to find best locations for such installations which use multiple criteria analysis. The use of Artificial intelligence methods, such as expert systems, can also be very helpful in solid waste planning and management. The waste disposal and its pollution around major cities in Karnataka are important problems affecting the environment. The Mysore is one of the major cities in Karnataka. The landfill site selection is the best way to control of pollution from any region. The main aim is to develop geographic information system to study the Landuse/ Landcover, natural drainage system, water bodies, and extents of villages around Mysore city, transportation, topography, geomorphology, lithology, structures, vegetation and forest information for landfill site selection. GIS combines spatial data (maps, aerial photographs, and satellite images) with quantitative, qualitative, and descriptive information database, which can support a wide range of spatial queries. For the Site Selection of an industrial waste and normal daily urban waste of a city town or a village, combining GIS with Analytical Hierarchy Process (AHP) will be more appropriate. This method is innovative because it establishes general indices to quantify overall environmental impact as well as individual indices for specific environmental components (i.e. surface water, groundwater, atmosphere, soil and human health). Since this method requires processing large quantities of spatial data. To automate the processes of establishing composite evaluation criteria, performing multiple criteria analysis and carrying out spatial clustering a suitable methodology was developed. The feasibility of site selection in the study area based on different criteria was used to obtain the layered data by integrating Remote Sensing and GIS. This methodology is suitable for all practical applications in other cities, also.
Munir, Ahmed R; Prem, Kumar D
2016-03-01
There is a growing awareness among teachers in the complementary and alternative medicine (CAM) disciplines that a formal training in educational methodology can improve their performance as teachers and student evaluators. The Training of Trainers programs conducted by Rajiv Gandhi University of Health Sciences, Karnataka, in the previous years have brought about a transformation among the teachers who attended those programs. Also the teachers were witness to a changing perception among students towards teachers who adapt innovative teaching/assessment strategies. This report illustrates an innovative training activity that was adapted to design a reference model that can be developed as an operational model for large-scale execution. Teachers who are under the affiliated CAM Institutions in Rajiv Gandhi University of Health Sciences, Karnataka, participated in a three-month 'Short Course in Educational Methodology'. This program was delivered on distance learning mode. The course was organised into four modules. Study material was provided for each of the module in the form of a study guide and related reference articles in electronic form. There were three contact programs - Induction and Introduction that also addressed overview of entire course and the subject matter of Module 1, and this was at the beginning of the course, first contact program to address the learner needs of Modules 2 and 3 and second contact program for the contents in Module 4. The participants were engaged during the entire course duration with interactive contact programs, self-study and application of concepts in their teaching/assessment practices, submission of assignments online, and microteaching presentation and peer review. The documentation and raw data generated during the course of training were used to generate an operational model for training of university teachers of health sciences faculty in general and teachers of CAM disciplines in particular. Establishing a model of training for university teachers who are engaged in health sciences education provides a strong platform to realise the roles of teacher, evolve as a conscientious and committed teacher and infuse their learners with passion and commitment to become competent in their professional performance.
Varghese, Beena; Krishnamurthy, Jayanna; Correia, Blaze; Panigrahi, Ruchika; Washington, Maryann; Ponnuswamy, Vinotha; Mony, Prem
2016-12-23
The majority of the maternal and perinatal deaths are preventable through improved emergency obstetric and newborn care at facilities. However, the quality of such care in India has significant gaps in terms of provider skills and in their preparedness to handle emergencies. We tested the feasibility, acceptability, and effectiveness of a "skills and drills" intervention, implemented between July 2013 and September 2014, to improve emergency obstetric and newborn care in the state of Karnataka, India. Emergency drills through role play, conducted every 2 months, combined with supportive supervision and a 2-day skills refresher session were delivered across 4 sub-district, secondary-level government facilities by an external team of obstetric and pediatric specialists and nurses. We evaluated the intervention through a quasi-experimental design with 4 intervention and 4 comparison facilities, using delivery case sheet reviews, pre- and post-knowledge tests among providers, objective structured clinical examinations (OSCEs), and qualitative in-depth interviews. Primary outcomes consisted of improved diagnosis and management of selected maternal and newborn complications (postpartum hemorrhage, pregnancy-induced hypertension, and birth asphyxia). Secondary outcomes included knowledge and skill levels of providers and acceptability and feasibility of the intervention. Knowledge scores among providers improved significantly in the intervention facilities; in obstetrics, average scores between the pre- and post-test increased from 49% to 57% (P=.006) and in newborn care, scores increased from 48% to 56% (P=.03). Knowledge scores in the comparison facilities were similar but did not improve significantly over time. Skill levels were significantly higher among providers in intervention facilities than comparison facilities (mean objective structured clinical examination scores for obstetric skills: 55% vs. 46%, respectively; for newborn skills: 58% vs. 48%, respectively; P<.001 for both obstetric and newborn), along with their confidence in managing complications. However, this did not result in significant differences in correct diagnosis and management of complications between intervention and comparison facilities. Shortage of trained nurses and doctors along with unavailability of a consistent supply chain was cited by most providers as major health systems barriers affecting provision of care. Improvements in knowledge, skills, and confidence levels of providers as a result of the skills and drills intervention was not sufficient to translate into improved diagnosis and management of maternal and newborn complications. System-level changes including adequate in-service training may also be necessary to improve maternal and newborn outcomes. © Varghese et al.
ERIC Educational Resources Information Center
Sahni, Urvashi
1999-01-01
Interviews children and adults living in rural areas in the state of Uttar Pradesh in northern India regarding education, revealing individuals' hopes and dreams against a backdrop of severe class, caste, and gender stratification. Examines the promise of schooling and literacy in India, the relationship of schooling and literacy to work, and of…
NASA Astrophysics Data System (ADS)
Rao, S. T.
2016-12-01
Alteration of natural flow regime is considered as one of the major threats to tropical stream fish assemblages as it alters the physio-chemical and micro-habitat features of the river. Flow alteration induced by Small hydro-power (SHP) plants disrupts the flow regime by flow diversion and regulation. The effects of flow alteration on tropical stream fish assemblages, especially in the Western Ghats of India is largely understudied. Such a knowledge is imperative to set limits on flow alteration as SHPs in the Western Ghats are being planned at an unprecedented rate with exemption from environment impact assessments and backing in the form of government subsidies and carbon credits. This study aimed to understand the response of fish assemblages to SHP induced flow alteration in a regulated and unregulated tributary of the Yettinahole River in the Western Ghats of Karnataka. The study intended to quantify the natural and altered flow regime using automated periodic depth measurements, its effect on micro-habitats and environmental variables and finally, understand how fish assemblages respond to such changes. The response of fish assemblage was measured in terms of catch-per-site, species-regime associations and ecological distance between the regimes. The study used a space for time substitution approach and found that the altered flow regime dampened the diurnal and seasonal patterns of natural flow regime. The altered flow regime influenced variations in water quality, micro-habitat heterogeneity and fish assemblage response, each characteristic of the type of flow alteration. The natural flow regime was found to have a higher catch-per-site and strong associations with endemic and niche-specific taxa. Compositional dissimilarities, in terms of ecological distance were observed between the altered and the natural flow regime. Dewatered or flow diverted regime contained species with lentic affinities while an overall low catch-per-site and weak species-regime association was found in the flow regulated regime. The study highlights the importance of natural flow regime in maintaining native biodiversity and suggests the need for cumulative impact assessments for setting limits on flow alteration.
Malamardi, Sowmya N.; Kamath, Ramachandra; Tiwari, Rajnarayan; Nair, Binu Valsalakumari Sreekumaran; Chandrasekaran, Varalakshmi; Phadnis, Sameer
2015-01-01
Background: Occupational morbidities have been estimated to cause an economic loss up to 10–20% of the gross national product of a country. It is an important cause of occupational morbidity and decreased quality of life (QOL) for the workers. Aim: The aim of the present study is to assess the level of occupational stress and its association with the QOL among the public sector bank employees. Materials and Methods: The present study was conducted among employees of public sector banks in Mysore district, Karnataka, India. A cross-sectional study design was used for the study. Job stress was measured by using occupational stress index (OSI) scale questionnaire and health-related QOL was measured using the short form 12 (SF-12) questionnaire. The sample size estimated for the study was 526 and cluster random sampling technique was used. Chi-square test was used to find the association between the study variables and level of stress. Multiple linear regression model was used to find the determinants of health-related QOL among the study subjects. Results: The total number of the study subjects was 546 out of which 57% were males and 43% were females. The proportion of study subjects reporting to be current smokers was 4.2% and almost all study subjects reported occasional alcohol consumption. The mean physical component summary (PCS) score and mental component summary (MCS) using the original United States standardization were 47.90 and 48.30, respectively. The individuals with mild stress scored higher in both PCS and MCS than the individuals who had moderate to severe stress levels. There was significant association of health related quality of life with the age of the respondent,presence of at least one morbidity and level of stress with health-related QOL. Conclusion: This study has shown an association of occupational stress with the QOL. There is a need for interventions aimed at mitigating the occupational stress among employees of the banking sector. PMID:26957810
Community perceptions of pre-eclampsia in rural Karnataka State, India: a qualitative study.
Vidler, Marianne; Charantimath, Umesh; Katageri, Geetanjali; Ramadurg, Umesh; Karadiguddi, Chandrashekhar; Sawchuck, Diane; Qureshi, Rahat; Dharamsi, Shafik; von Dadelszen, Peter; Derman, Richard; Goudar, Shivaprasad; Mallapur, Ashalata; Bellad, Mrutyunjaya
2016-06-08
Maternal deaths have been attributed in large part to delays in recognition of illness, timely transport to facility, and timely treatment once there. As community perceptions of pregnancy and their complications are critical to averting maternal morbidity and mortality, this study sought to contribute to the literature and explore community-based understandings of pre-eclampsia and eclampsia. The study was conducted in rural Karnataka State, India, in 2012-2013. Fourteen focus groups were held with the following community stakeholders: three with community leaders (n = 27), two with male decision-makers (n = 19), three with female decision-makers (n = 41), and six with reproductive age women (n = 132). Focus groups were facilitated by local researchers with clinical and research expertise. Discussions were audio-recorded, transcribed verbatim and translated to English for thematic analysis using NVivo 10. Terminology exists in the local language (Kannada) to describe convulsions and hypertension, but there were no terms that are specific to pregnancy. Community participants perceived stress, tension and poor diet to be precipitants of hypertension in pregnancy. Seizures in pregnancy were thought to be brought on by anaemia, poor medical adherence, lack of tetanus toxoid immunization, and exposure in pregnancy to fire or water. Sweating, fatigue, dizziness-unsteadiness, swelling, and irritability were perceived to be signs of hypertension, which was recognized to have the potential to lead to eclampsia or death. Home remedies, such as providing the smell of onion, placing an iron object in the hands, or squeezing the fingers and toes, were all used regularly to treat seizures prior to accessing facility-based care although transport is not delayed. It is evident that 'pre-eclampsia' and 'eclampsia' are not well-known; instead hypertension and seizures are perceived as conditions that may occur during or outside pregnancy. Improving community knowledge about, and modifying attitudes towards, hypertension in pregnancy and its complications (including eclampsia) has the potential to address community-based delays in disease recognition and delays in treatment that contribute to maternal and perinatal morbidity and mortality. Advocacy and educational initiatives should be designed to target knowledge gaps and potentially harmful practices, and respond to cultural understandings of disease. NCT01911494.
Eucalyptus water use greater than rainfall input - possible explanation from southern India
NASA Astrophysics Data System (ADS)
Calder, I. R.; Rosier, P. T. W.; Prasanna, K. T.; Parameswarappa, S.
Hydrological and silvicultural studies carried out in southern India on the effects of plantations of Eucalyptus and other fast growing exotic tree species have determined the impacts of these plantations on water resources, erosion, soil nutrient status and growth rates at sites of differing rainfall and soil depth in Karnataka. Whilst providing new information on these issues, the studies also raised two important questions: what was the explanation for the anomalous result that the water use of 3400 mm from Eucalyptus plantations at Hosakote over a three year period exceeded the rainfall of 2100 mm over the same period and why were growth rates of woodlots on most farmer's fields higher than those of plantations on land owned by the Karnataka Forest Department? The records of the soil moisture depletion patterns under these plantations from the day of planting provide the basis for the answers to both questions: i) whilst roots are penetrating into deeper soil layers, they are able to extract from a reservoir of water additional to that available from the rainfall each year, ii) farmer's land on which short rooted agricultural crops have been grown previously is likely to have a much higher soil water status than land previously under forest or scrub vegetation. These new studies have also established that the development of the drying front under the Eucalyptus camaldulensis plantations is very rapid, indicating average root extension rates in excess of 2.5 m per year, whilst those under Tectona grandis and Artocarpus heterophyllus advanced at approximately half the rate. These results have obvious implications for the long term sustainability of growth rates from these plantations and the recharge of groundwater. The authors believe that this study may be the first to report neutron probe soil moisture depletion observations, from the date of planting, beneath tree plantations in a dry climate. The extent to which the roots were able to penetrate raises the question of whether other studies, which have estimated water use from soil moisture observations in dry climates, may have seriously underestimated both the actual soil moisture depletion and the water use through having soil moisture measurements located to insufficient depth.
Laxmivandana, Rongala; Yergolkar, Prasanna; Gopalkrishna, Varanasi; Chitambar, Shobha D
2013-01-01
Non-polio enteroviruses (NPEVs) have been reported frequently in association with acute flaccid paralysis (AFP) cases during Polio Surveillance Programs (PSPs) worldwide. However, there is limited understanding on the attributes of their infections. This study reports characteristics of NPEVs isolated from AFP cases, investigated during PSPs held in 2009-2010, in Karnataka and Kerala states of south-western India having varied climatic conditions. NPEV cell culture isolates derived from stool specimens that were collected from 422 of 2186 AFP cases (<1-14 years age) and 17 of 41 asymptomatic contacts; and details of all AFP cases/contacts were obtained from National Polio Laboratory, Bangalore. The distribution of NPEV infections among AFP cases and circulation pattern of NPEV strains were determined by statistical analysis of the data. Genotyping of all NPEV isolates was carried out by partial VP1 gene sequencing and phylogenetic analysis. NPEV positive AFP cases were significantly higher in children aged <2 years; with residual paralysis; in summer months; and in regions with relatively hot climate. Genotyping of NPEVs identified predominance of human enteroviruses (HEV)-B species [81.9%-Echoviruses (E): 57.3%; coxsackieviruses (CV) B: 15%; numbered EVs: 8.9%; CVA9: 0.7%] and low levels of HEV-A [14.5%-CVA: 6%; numbered EVs: 8.5%] and HEV-C [3.6%-CVA: 2.6%; numbered EVs: 1%] species, encompassing 63 genotypes. EV76 (6.3%) and each of E3, CVB3 and E9 (4.97%) were found frequently during 2009 while E11 (6.7%), CVB1 (6.1%), E7 (5.1%) and E20 (5.1%) were detected commonly in 2010. A marked proportion of AFP cases from children aged <2 years; presenting with fever; and from north and south interior parts of Karnataka state was detected with E/numbered EVs than that found with CVA/CVB. This study highlights the extensive genetic diversity and diverse circulation patterns of NPEV strains in AFP cases from different populations and climatic conditions.
Gender inequality and entrepreneurship: the Indian silk industry.
Mayoux, L
1993-12-01
The production of raw silk yarns from cocoons (reeling) is a crucial middle stage in the silk industry. The author reviews the experience of attempts to encourage women's entrepreneurship in this industry in Karnataka, South India. Reeling is a potentially lucrative field with possibilities for upward mobility from small-scale to large-scale production if credit is readily available. The industry in India employs large numbers of skilled female workers from all communities and is one of few in which a sectoral gender policy is being implemented. While these factors may be thought to be conducive to the development of women entrepreneurs, none were in the areas studied at the time of research. No women were involved in marketing through the official marketing system and no women's co-operatives were operating. While women were listed among registered reelers, men controlled the businesses. Men simply used women to obtain supplementary bank loans or funds through other avenues otherwise open to only women. Policies for women in reeling have therefore proved to be overwhelmingly unsuccessful. The author considers gender inequality and gender policy at length in this context and concludes that the problem is systemic and structural in nature. Policy implications are considered.
New age data on the geological evolution of Southern India
NASA Technical Reports Server (NTRS)
Taylor, Paul N.; Chadwick, B.; Friend, C. R. L.; Ramakrishnan, M.; Moorbath, Stephen; Viswanatha, M. N.
1988-01-01
The Peninsular Gneisses of Southern India developed over a period of several hundred Ma in the middle-to-late Archaean. Gneisses in the Gorur-Hassan area of southern Karnataka are the oldest recognized constituents: Beckinsale et al. reported a preliminary Rb-Sr whole-rock isochron age of 33558 + or - 66 Ma, but further Rb-Sr and Pb/Pb whole-rock isochron determinations indicate a slightly younger, though more precise age of ca 3305 Ma (R. D. Beckinsale, Pers. Comm.). It is well established that the Peninsular Gneisses constitute basement on which the Dharwar schist belts were deposited. Well-documented exposures of unconformities, with basal quartz pebble conglomerates of the Dharwar Supergroup overlying Peninsular Gneisses, have been reported from the Chikmagalur and Chitradurga areas, and basement gneisses in these two areas have been dated by Rb-Sr and Pb/Pb whole-rock isochron methods at ca 3150 Ma and ca 3000 Ma respectively. Dharwar supracrustal rocks of the Chitradurga schist belt are intruded by the Chitradurga Granite, dated by a Pb/Pb whole-rock isochron at 2605 + or - 18 Ma. These results indicate that the Dharwar Supergroup in the Chitradurga belt was deposited between 3000 Ma and 2600 Ma.
Practice Perspectives of Left-Handed Clinical Dental Students in India
Puranik, Manjunath P; Uma, SR
2016-01-01
Introduction Handedness becomes important for students during their training period. Limited literature is available regarding the same. Aim The purpose of this study was to assess the dental practice perspectives and determine the hand preference and discomfort level among the Left-Handed (LH) clinical dental students. Materials and Methods A 30-item survey tool was used to conduct a cross-sectional survey among four successive LH cohorts (third and final year undergraduates, dental interns and postgraduates) in all the dental colleges of Bengaluru, Karnataka, India, during the year 2014. Results A total of 84 students completed the survey, response rate being 100%. About one-third (37%) reported that their institution was not properly equipped to accommodate LH students. Majority felt that LH dentists were at a higher risk of developing musculoskeletal complications. Mouth mirror handling showed equal distribution for handedness as compared to the other dental activities, whereas discomfort levels were negligible (“without any difficulty”). Dental practice perspective scores significantly correlated with the difficulty levels (r=-0.333, p<0.001). Conclusion Overall, the left-handers had a right dental practice perspective and their responses indicate a need to address their issues empathetically. PMID:27891465
The Synthesis of Biodiesel from Used Temple Oil
NASA Astrophysics Data System (ADS)
Saddu, Sharanabasappa; Kivade, S. B.; Ramana, P.
2018-05-01
Safe and sustainable resources of energy is required for the financial and industrial growth. A new approach in investigating, growth, production and the economy is necessary, for the future reorganization of a sustainable natural raw material. In India, because of many mythological and religious beliefs thousands of devotees pour oil in lamps in various temples and also over the idols in Hanuman and Shani temples. This poured oil cannot be utilized and was ultimately wasted. One of tender advertisements by department of Muzarai of Karnataka Government, the used oil potential at shree Renuka yallamma temple Soundatti, Belagavi district is 18,900 kg for the year 2016-2017. This is only one temple oil potential; the number of Hindu temples in India is a Puzzle. This used temple oil was used as alternative feedstock, to decrease the cost of bio fuel. Using ASTM standard methods, the properties of used temple oil biodiesel were analyzed. From the tests it is clear that the, properties of used temple oil biodiesel are similar to diesel fuel. The obtained yield of biodiesel was 94.51%. This study identified that the price of the feedstock was one of the most significant factors.
Impact of riparian land use on stream insects of Kudremukh National Park, Karnataka state, India
Subramanian, K.A.; Sivaramakrishnan, K.G.; Gadgil, Madhav
2005-01-01
The impact of riparian land use on the stream insect communities was studied at Kudremukh National Park located within Western Ghats, a tropical biodiversity hotspot in India. The diversity and community composition of stream insects varied across streams with different riparian land use types. The rarefied family and generic richness was highest in streams with natural semi evergreen forests as riparian vegetation. However, when the streams had human habitations and areca nut plantations as riparian land use type, the rarefied richness was higher than that of streams with natural evergreen forests and grasslands. The streams with scrub lands and iron ore mining as the riparian land use had the lowest rarefied richness. Within a landscape, the streams with the natural riparian vegetation had similar community composition. However, streams with natural grasslands as the riparian vegetation, had low diversity and the community composition was similar to those of paddy fields. We discuss how stream insect assemblages differ due to varied riparian land use patterns, reflecting fundamental alterations in the functioning of stream ecosystems. This understanding is vital to conserve, manage and restore tropical riverine ecosystems. PMID:17119631
Incidence of tempero-mandibular joint pain dysfunction syndrome in rural population.
Rao, M B; Rao, C B
1981-08-01
The incidence and clinical course of the tempero-mandibular joint dysfunction syndrome was studied among 1187 subjects over the age of 16, who attended the rural dental consultations held at various places in the State of Karnataka, India. The study revealed an incidence of 20.3%. Contracy to earlier reports, the incidence was higher in males than in females and more married females were affected than unmarried. Clicking appeared to be the predominant symptom in all age groups. The incidence of pain increased with age. Of all patients 43.75% were not aware of a clicking joint; 53.7% persons with clicking and 14% with pain were not disturbed by their symptoms. The findings of the study failed to establish any relationship between unilateral missing teeth and the occurrence of the pain dysfunction syndrome (PDS). The chewing habits (betel leaf, tobacco, betel nut) which are prevalent in India appeared to have no effect on the incidence of PDS. It is suggested that more epidemiological studies should be carried out in different parts of the world with varying social, political and economic systems to enable better understanding of the global incidence of PDS.
Roopesh Gopal, NV; Sudarshan, CY; Kumar, S Ganesh
2014-01-01
Background: There is paucity of information on the relationship of quality of life (QOL) in obsessive compulsive disorder (OCD) and dysthymic disorder (DD) with disability grade in India. Aim: To assess the relation of QOL with disability level in OCD and DD. Materials and Methods: This hospital based study was conducted in a medical institution in Davanagere, Karnataka, India. Data was collected by using Diagnostic and Statistical Manual IV Text Revision (DSM IV TR) criteria, WHO QOL BREF and IDEAS. Relationship between disability grade and QOL was assessed by independent sample t test. Results: Mild disabled OCD patients had a significantly better QOL in the Q1 domain i.e. perception on quality of life as compared to moderately disabled patients (P < 0.05), while in other domains of QOL, there was no statistically significant difference (P > 0.05). But, QOL score in physical domain showed significant difference across disability grades (56.00, SD = 6.89; 48.50, SD = 12.28) in DD, but not in other domains. Conclusion: Perception of QOL is better in those with mild disability in OCD, but in DD, physical domain of QOL score is more in mild disability compared to moderate disability. PMID:25191009
Roopesh Gopal, Nv; Sudarshan, Cy; Kumar, S Ganesh
2014-09-01
There is paucity of information on the relationship of quality of life (QOL) in obsessive compulsive disorder (OCD) and dysthymic disorder (DD) with disability grade in India. To assess the relation of QOL with disability level in OCD and DD. This hospital based study was conducted in a medical institution in Davanagere, Karnataka, India. Data was collected by using Diagnostic and Statistical Manual IV Text Revision (DSM IV TR) criteria, WHO QOL BREF and IDEAS. Relationship between disability grade and QOL was assessed by independent sample t test. Mild disabled OCD patients had a significantly better QOL in the Q1 domain i.e. perception on quality of life as compared to moderately disabled patients (P < 0.05), while in other domains of QOL, there was no statistically significant difference (P > 0.05). But, QOL score in physical domain showed significant difference across disability grades (56.00, SD = 6.89; 48.50, SD = 12.28) in DD, but not in other domains. Perception of QOL is better in those with mild disability in OCD, but in DD, physical domain of QOL score is more in mild disability compared to moderate disability.
Yegneswaran, Prakash Peralam; Sripathi, Handattu; Bairy, Indira; Lonikar, Vrushali; Rao, Rhagavendra; Prabhu, Smitha
2009-11-01
Sporotrichosis is commonly encountered due to traumatic implantation of thorns or decayed vegetation with the dimorphic fungi, Sporothrix schenckii. Zoonotic spread of Sporotrichosis is rare and we describe here the first case of feline transmission of lymphocutaneous sporotrichiosis encountered in India. An excision biopsy of nodulo-ulcerative lesion from the patients right elbow and forearm were collected for histopathology and portion of the specimen processed for mycological work up. Animal pathogenicity test performed in Swiss albino mice with intraperitoneal & foot pad inoculation. In addition an investigation of the ulcerative skin lesion from the domesticated cat was carried out. Histopathology examination of tissue sample from the patient and feline lesion revealed granulomatous reaction and a few slender elongated yeast cells consistent with Sporotrichosis. The diagnosis was confirmed by culturing Sporothrix schenkii and demonstration of thermal dimorphism. Pathogenicity testing in mice lead to orchitis in 12-15 days and the organism was re-isolated in pure culture. The patient was treated with oral saturated potassium iodide solution with complete resolution of the lesions. Close contact with infected domesticated feline can be a potential source of transmission for Sporotrichosis as evidenced in this report.
Huang, Wan-Ru; Wang, Sheng-Hsiang; Yen, Ming-Cheng; Lin, Neng-Huei; Promchote, Parichart
2016-09-16
During March and April, widespread burning occurs across farmlands in Indochina in preparation for planting at the monsoon onset. The resultant aerosols impact the air quality downwind. In this study, we investigate the climatic aspect of the interannual variation of springtime biomass burning in Indochina and its correlation with air quality at Mt. Lulin in Taiwan using long-term (2005-2015) satellite and global reanalysis data. Based on empirical orthogonal function (EOF) analysis, we find that the biomass burning activities vary with two geographical regions: northern Indochina (the primary EOF mode) and southern Indochina (the secondary EOF mode). We determine that the variation of biomass burning over northern Indochina is significantly related with the change in aerosol concentrations at Mt. Lulin. This occurs following the change in the so-called India-Burma Trough in the lower and middle troposphere. When the India-Burma Trough is intensified, a stronger northwesterly wind (to the west of the trough) transports the dryer air from higher latitude into northern Indochina, and this promotes local biomass burning activities. The increase in upward motion to the east of the intensified India-Burma Trough lifts the aerosols, which are transported toward Taiwan by the increased low-level westerly jet. Further diagnoses revealed the connection between the India-Burma Trough and the South Asian jet's wave train pattern as well as the previous winter's El Niño - Southern Oscillation phase. This information highlights the role of the India-Burma Trough in modulating northern Indochina biomass burning and possibly predicting aerosol transport to East Asia on the interannual time scale.
2011-01-01
Background Hippobosca longipennis (the 'dog louse fly') is a blood sucking ectoparasite found on wild carnivores such as cheetahs and lions and domesticated and feral dogs in Africa, the Middle East and Asia, including China. Known as an intermediate host for Acanthocheilonema dracunculoides and a transport host for Cheyletiella yasguri, it has also been suggested that H. longipennis may be a vector for other pathogens, including Acanthocheilonema sp.? nov., which was recently reported to infect up to 48% of dogs in northern India where this species of fly is known to commonly infest dogs. To test this hypothesis, hippoboscid flies feeding on dogs in Ladakh in northern India were collected and subjected to microscopic dissection. Results A total of 12 infective larvae were found in 10 out of 65 flies dissected; 9 from the head, 2 from the thorax and 1 from the abdomen. The larvae averaged 2, 900 (± 60) μm in length and 34 (± 5) μm in width and possessed morphological features characteristic of the family Onchocercidae. Genetic analysis and comparison of the 18S, ITS-2, 12S and cox-1 genes confirmed the identity of the larvae as the Acanthocheilonema sp.? nov. reported in dogs in Ladakh. Conclusion This study provides evidence for a potential intermediate host-parasite relationship between H. longipennis and the canine Acanthocheilonema sp.? nov. in northern India. PMID:21781294
ERIC Educational Resources Information Center
Allender, Tim
2003-01-01
Focuses on the dominant Anglican missionary schools in Punjab (India). States that the Anglican missions failed to fulfill their original design, but that Hindu schools were successful and played a role in India's movement for independence over British settlements in the northern region. (KDR)
A new species of Clidicus with asymmetrical parameres (Coleoptera, Staphylinidae, Scydmaeninae).
JaŁoszyŃski, PaweŁ
2018-03-20
Clidicus Laporte, 1832 currently comprises 27 species distributed in India (Karnataka, Tamil Nadu), Sri Lanka, Indonesia (Java, Kalimantan, Sumatra), Malaysia (Sabah, Sarawak), Laos, Vietnam, the Philippines (Mindanao), China (Hainan) and Australia (Queensland). Some species have conspicuously large adults reaching 8.5 mm, and they represent the largest known Scydmaeninae. Species of Clidicus were relatively poorly known until recently, when Orousset (2014) revised a large portion of this genus and described several new species. Other major studies include Besuchet (1971), who described Sri Lankan species, Jałoszyński et al. (2003) who recorded four new species from Vietnam and Laos, Jałoszyński (2009) with the first description of a Philippine species, and Zhou Li (2015), who discovered the first species in China. Another new species, representing the second Clidicus occurring in the Philippines, is described below.
Emergence of Arctic-like Rabies Lineage in India
Turner, Geoff; Paul, Joel P. V.; Madhusudana, Shampur N.; Wandeler, Alexander I.
2007-01-01
A collection of 37 rabies-infected samples, 10 human saliva and 27 animal brain, were recovered during 2001–2004 from the cities of Bangalore and Hyderabad in southern India and from Kasauli, a mountainous region in Himachal Pradesh, northern India. Phylogenetic analysis of partial N gene nucleotide sequences of these 37 specimens and 1 archival specimen identified 2 groups, divided according to their geographic (north or south) origins. Comparison of selected Indian viruses with representative rabies viruses recovered worldwide showed a close association of all Indian isolates with the circumpolar Arctic rabies lineage distributed throughout northern latitudes of North America and Europe and other viruses recovered from several Asian countries. PMID:17370523
Vignapandeyana (Fabaceae), a new species from northern Western Ghats, India.
Gaikwad, Sayajirao; Gore, Ramchandra; Randive, Sonali
2015-01-01
Vigna subg. Ceratotropis (Piper) Verdc. represents a homogenous and distinct group of species with highly specialized complex floral characters. It is most diverse in Asia. India, with 24 species, represents a secondary center of species diversity of the subgenus. A new species, Vignapandeyana RD Gore, SP Gaikwad & SD Randive, is described from hill slopes of the northern Western Ghats of India. It resembles Vignayadavii Gaikwad et al. and Vignadalzelliana (Kuntze) Verdc. but differs from the latter in its dimorphic shoots (some subterranean, with cleistogamous flowers) and densely hairy pods, from the former by its curved style, flattened style beak, foveolate seed coat and absence of standard protuberance and horn-like keel pocket in cleistogamous flowers.
Kumar, Sandeep; Acharya, Shashidhar; Vasthare, Ramprasad; Singh, Siddharth Kumar; Gupta, Anjali; Debnath, Nitai
2014-01-01
The consumption of soft-drinks has been associated with dental caries development. The aim was to evaluate dental caries experience amongst the workers working in soft-drink industries located in South India and compare it with other factory workers. To evaluate the validity of specific caries index (SCI), which is newer index for caries diagnosis. This was a cross-sectional study carried out among 420 workers (210 in soft-drinks factory and 210 in other factories), in the age group of 20-45 years of Udupi district, Karnataka, India. Index used for clinical examination was decayed, missing, filled surfaces (DMFS) index and SCI. The mean and standard deviation (SD) of decayed surface (5.8 ± 1.8), missing surface (4.3 ± 2) and filled surface (1.94 ± 1.95) and total DMFS score (12.11 ± 3.8) in soft-drinks factory workers were found to be significantly higher than the other factory workers. The total SCI score (mean and SD) was found to be significantly higher in soft-drinks factory workers (5.83 ± 1.80) compared with other factory workers (4.56 ± 1.45). There was a high correlation obtained between SCI score and DMFS score. The regression equation given by DMFS = 1.178 + 1.866 (SCI scores). The caries experience was higher in workers working in soft-drinks factory and this study also showed that specific caries index can be used as a valid index for assessing dental caries experience.
Marital status, family ties, and self-rated health among elders in South India.
Sudha, S; Suchindran, Chirayath; Mutran, Elizabeth J; Rajan, S Irudaya; Sarma, P Sankara
2006-01-01
This article examines the impact of familial social support ties (indicated by marital status, kin availability, sources of economic support, and frequency and quality of emotional interaction) on subjective health perception among a sample of elderly men and women aged 60 and older in South India. We used 1993 survey data from three states of South India: Kerala, Tamil Nadu, and Karnataka. We hypothesized that (a) widowhood would be associated with poorer self-rated health, (b) number of kin ties would be positively associated with self-rated health, (c) economic and emotional support from kin would improve outcomes, and (d) these associations would be stronger among women than among men. Results of logistic regression techniques supported the first hypothesis and partially supported the third. With regard to the second hypothesis, the presence of specific kin rather than the number of each type of family member was important. For the fourth hypothesis, results suggest that men and women in this sample have broadly similar associations between widowhood and self-rated health. For women however, controlling for socioeconomic status did not weaken the association between widowhood and self-rated health, suggesting the symbolic/cultural importance of this status. In general, these findings suggest that theories on the importance of marital status and kin ties for older adults' self-rated health, which were developed and tested in Western societies, need to be refined for Asian societies, where the nature of marriage and widowhood are different.
Kment, Petr; Carapezza, Attilio; Jindra, Zdeněk; Kondorosy, Előd
2017-01-25
The generic name Lanchnophorus Reuter, 1887, deemed for a long time to be unavailable as incorrect original spelling of Lachnophorus (in fact Lachnophorus Distant, 1903 is an unjustified emendation of the former), is restored as a valid name of the genus. Lachnesthus Bergroth, 1915, syn. nov. (new name for the preoccupied Lachnophorus Distant, 1903) is considered junior synonym of Lanchnophorus. The following nomenclatural changes are proposed: Lanchnophorus flavus (Scudder, 1971) comb. nov. = Lachnesthus chinai Scudder, nomen nudum; Lanchnophorus guttulatus Reuter, 1887, comb. restit. = Lachnophorus albidomaculatus Distant, 1913, syn. nov. = Lachnesthus rodriguezensis China, 1925, syn. nov.; Lanchnophorus leucospilus (Walker, 1872) comb. nov.; Lanchnophorus merula (Distant, 1903) comb. nov.; and Lanchnophorus singalensis (Dohrn, 1860) comb. nov. Three new species are described: Lanchnophorus gaoqingae Kment & Jindra sp. nov. from China (Yunnan), Lanchnophorus seminitens Kment & Carapezza sp. nov. from Socotra Island (Yemen), and Lanchnophorus webbi Kondorosy sp. nov. from India: Tamil Nadu. Bibliographies and known distribution of all the included species are reviewed. The following new country and state records are provided: L. flavus from Central African Republic, Ethiopia, Ghana, Mali, Malawi, Niger, Zambia and Zimbabwe; L. leucospilus from China (Yunnan) and Laos, L. merula from India (Kerala/Tamil Nadu) and Thailand; L. singalensis from Angola, Benin, Mozambique, Namibia, Senegal, Sierra Leone, Tanzania, Togo, Uganda, Zambia, Zimbabwe, China (Hainan), Iran (Sistan and Ba-luchestan), Oman, Pakistan, India (Himachal Pradesh, Karnataka, Kerala, Rajasthan), Malaysia, Philippines, and Thailand.
Priyamvada, Hema; Akila, M.; Singh, Raj Kamal; Ravikrishna, R.; Verma, R. S.; Philip, Ligy; Marathe, R. R.; Sahu, L. K.; Sudheer, K. P.; Gunthe, S. S.
2017-01-01
Macrofungi have long been investigated for various scientific purposes including their food and medicinal characteristics. Their role in aerobiology as a fraction of the primary biological aerosol particles (PBAPs), however, has been poorly studied. In this study, we present a source of macrofungi with two different but interdependent objectives: (i) to characterize the macrofungi from a tropical dry evergreen biome in southern India using advanced molecular techniques to enrich the database from this region, and (ii) to assess whether identified species of macrofungi are a potential source of atmospheric PBAPs. From the DNA analysis, we report the diversity of the terrestrial macrofungi from a tropical dry evergreen biome robustly supported by the statistical analyses for diversity conclusions. A total of 113 macrofungal species belonging to 54 genera and 23 families were recorded, with Basidiomycota and Ascomycota constituting 96% and 4% of the species, respectively. The highest species richness was found in the family Agaricaceae (25.3%) followed by Polyporaceae (15.3%) and Marasmiaceae (10.8%). The difference in the distribution of commonly observed macrofungal families over this location was compared with other locations in India (Karnataka, Kerala, Maharashtra, and West Bengal) using two statistical tests. The distributions of the terrestrial macrofungi were distinctly different in each ecosystem. We further attempted to demonstrate the potential role of terrestrial macrofungi as a source of PBAPs in ambient air. In our opinion, the findings from this ecosystem of India will enhance our understanding of the distribution, diversity, ecology, and biological prospects of terrestrial macrofungi as well as their potential to contribute to airborne fungal aerosols. PMID:28072853
Gururaj, Gopalakrishna; Kulkarni, Girish B; Rao, Girish N; Subbakrishna, D K; Stovner, Lars J; Steiner, Timothy J
2014-01-01
Headache disorders are common and burdensome throughout the world, placing high demand on health care services. Good information on their prevalence and distribution through sectors of the population are a prerequisite for planning interventions and organizing services, but unavailable for India. To find out the prevalence of headache disorders in Karnataka State and establish important sociodemographic associations. Using a door to door survey technique, amongst 2997 households, 2329 individuals were interviewed with a validated structured questionnaire by randomly sampling one adult member (aged 18-65 years) from eligible households in urban (n = 1226) and rural (n = 1103) areas of Bangalore, during the period April 2009 and January 2010. Chi-square, odds ratio (OR), and logistic regression. The 1-year prevalence of headache was 63.9% (62.0% when adjusted for age, gender and habitation) and 1-day prevalence (headache on the day prior to the survey) was 5.9%. Prevalence was higher in the age groups of 18-45 years, among females (OR = 2.3; 95% confidence interval: 1.9-2.7) and those in rural areas. Prevalence was higher in rural (71.2 [68.4-73.8]) than in urban areas (57.3 [54.5-60.1]) even after adjusting for gender. The proportion of days lost to headache from paid work was 1.1%, while overall productivity loss (from both paid and household work) was 2.8%. Headache disorders are a major health problem in India with significant burden. It requires systematic efforts to organize effective services to be able to reach a large number of people in urban and rural India. Education of physicians and other health-care workers, and the public should be a pillar of such efforts.
Mahesh, P A; Wong, Gary W K; Ogorodova, L; Potts, J; Leung, T F; Fedorova, O; Holla, Amrutha D; Fernandez-Rivas, M; Clare Mills, E N; Kummeling, I; Versteeg, S A; van Ree, R; Yazdanbakhsh, M; Burney, P
2016-07-01
Data are lacking regarding the prevalence of food sensitization and probable food allergy among general population in India. We report the prevalence of sensitization and probable food allergy to 24 common foods among adults from general population in Karnataka, South India. The study was conducted in two stages: a screening study and a case-control study. A total of 11 791 adults in age group 20-54 were randomly sampled from general population in South India and answered a screening questionnaire. A total of 588 subjects (236 cases and 352 controls) participated in the case-control study involving a detailed questionnaire and specific IgE estimation for 24 common foods. A high level of sensitization (26.5%) was observed for most of the foods in the general population, higher than that observed among adults in Europe, except for those foods that cross-react with birch pollen. Most of the sensitization was observed in subjects who had total IgE above the median IgE level. A high level of cross-reactivity was observed among different pollens and foods and among foods. The prevalence of probable food allergy (self-reports of adverse symptoms after the consumption of food and specific IgE to the same food) was 1.2%, which was mainly accounted for cow's milk (0.5%) and apple (0.5%). Very high levels of sensitization were observed for most foods, including those not commonly consumed in the general population. For the levels of sensitization, the prevalence of probable food allergy was low. This disassociation needs to be further explored in future studies. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Diabetes knowledge and self-efficacy among rural women in Gujarat, India.
Mehta, Naaman V; Trivedi, Mayur; Maldonado, Luis E; Saxena, Deepak; Humphries, Debbie L
2016-01-01
Type II diabetes has risen dramatically among rural women in India, specifically in the states of Gujarat, Karnataka, Tamil Nadu and Uttar Pradesh. Recent studies suggest that rural Indian women's low level of self-efficacy, or confidence in their ability to carry out tasks, such as managing diabetes, is a key reason for this increase. Therefore, this study utilizes the Health Belief Model to analyze whether increased awareness of diabetes leads to a positive increase in levels of self-efficacy among diabetic women in two rural villages of Gujarat. A cross-sectional study of 126 known cases of women with diabetes was carried out in the villages of Rajpur and Valam in the Mehsana District in the state of Gujarat, India, to assess the relationship between diabetes knowledge and self-efficacy. The instrument was adapted from the Michigan Diabetes Research and Training Center's Diabetes Empowerment Scale-Short Form and Knowledge, Attitudes and Practices Assessment of the Indian Institute of Public Health Gandhinagar. Participants' mean knowledge score was 10.77±2.86 out of a possible 24 points, for a mean percentage of 45%. The median self-efficacy score for the women was 7 with an interquartile range of 3. The age-adjusted multiple regression analysis demonstrated a significant positive correlation between knowledge and self-efficacy (p<0.001). The observations of this study suggest a positive correlation between diabetes knowledge and self-efficacy. Future diabetes educational interventions in India should place a greater emphasis on increasing knowledge among rural women. Specifically, these interventions should emphasize the major gaps in knowledge regarding causes of diabetes, complications and treatment procedures. Educational interventions that are catered more towards rural women will be critical for improving their self-efficacy.
Priyamvada, Hema; Akila, M; Singh, Raj Kamal; Ravikrishna, R; Verma, R S; Philip, Ligy; Marathe, R R; Sahu, L K; Sudheer, K P; Gunthe, S S
2017-01-01
Macrofungi have long been investigated for various scientific purposes including their food and medicinal characteristics. Their role in aerobiology as a fraction of the primary biological aerosol particles (PBAPs), however, has been poorly studied. In this study, we present a source of macrofungi with two different but interdependent objectives: (i) to characterize the macrofungi from a tropical dry evergreen biome in southern India using advanced molecular techniques to enrich the database from this region, and (ii) to assess whether identified species of macrofungi are a potential source of atmospheric PBAPs. From the DNA analysis, we report the diversity of the terrestrial macrofungi from a tropical dry evergreen biome robustly supported by the statistical analyses for diversity conclusions. A total of 113 macrofungal species belonging to 54 genera and 23 families were recorded, with Basidiomycota and Ascomycota constituting 96% and 4% of the species, respectively. The highest species richness was found in the family Agaricaceae (25.3%) followed by Polyporaceae (15.3%) and Marasmiaceae (10.8%). The difference in the distribution of commonly observed macrofungal families over this location was compared with other locations in India (Karnataka, Kerala, Maharashtra, and West Bengal) using two statistical tests. The distributions of the terrestrial macrofungi were distinctly different in each ecosystem. We further attempted to demonstrate the potential role of terrestrial macrofungi as a source of PBAPs in ambient air. In our opinion, the findings from this ecosystem of India will enhance our understanding of the distribution, diversity, ecology, and biological prospects of terrestrial macrofungi as well as their potential to contribute to airborne fungal aerosols.
Classrooms as Radical Spaces of Possibilities
ERIC Educational Resources Information Center
Sahni, Urvashi
2016-01-01
This article provides a brief snapshot of a girls school in Northern India called Prerna. Girls in India are unwanted, unequal and unsafe. Every year a million of them are killed in the womb. One third of the world's child brides (read "girl slaves") are in India. They live their lives in a grim, complex context where, gender, poverty…
Development Status of Higher Education in Northern India: A Review Study
ERIC Educational Resources Information Center
Verma, Chaman
2017-01-01
In development of any country depends upon higher educational status. India is fast growing country in the field of education and technology. Most of IT engineers are deputed in world's most IT companies. It has been possible because of strong development higher education system in India. This paper focuses on the comparative study of higher…
NASA Technical Reports Server (NTRS)
Lau, William K. M.; Kim, Kyu-Myong; Shi, Jainn-Jong; Matsui, T.; Chin, M.; Tan, Qian; Peters-Lidard, C.; Tao, W. K.
2016-01-01
The boreal summer of 2008 was unusual for the Indian monsoon, featuring exceptional heavy loading of dust aerosols over the Arabian Sea and northern-central India, near normal all- India rainfall, but excessive heavy rain, causing disastrous flooding in the Northern Indian Himalaya Foothills (NIHF) regions, accompanied by persistent drought conditions in central and southern India. Using NASA Unified-physics Weather Research Forecast (NUWRF) model with fully interactive aerosol physics and dynamics, we carried out three sets of 7-day ensemble model forecast experiments: 1) control with no aerosol, 2) aerosol radiative effect only and 3) aerosol radiative and aerosol-cloud-microphysics effects, to study the impacts of aerosol monsoon interactions on monsoon variability over the NIHF during the summer of 2008. Results show that aerosol-radiation interaction (ARI), i.e., dust aerosol transport, and dynamical feedback processes induced by aerosol-radiative heating, plays a key role in altering the large scale monsoon circulation system, reflected by an increased north-south tropospheric temperature gradient, a northward shift of heavy monsoon rainfall, advancing the monsoon onset by 1-5 days over the HF, consistent with the EHP hypothesis (Lau et al. 2006). Additionally, we found that dust aerosols, via the semi-direct effect, increase atmospheric stability, and cause the dissipation of a developing monsoon onset cyclone over northeastern India northern Bay of Bengal. Eventually, in a matter of several days, ARI transforms the developing monsoon cyclone into mesoscale convective cells along the HF slopes. Aerosol-Cloud-microphysics Interaction (ACI) further enhances the ARI effect in invigorating the deep convection cells and speeding up the transformation processes. Results indicate that even in short-term (up to weekly) numerical forecasting of monsoon circulation and rainfall, effects of aerosol-monsoon interaction can be substantial and cannot be ignored.
Kottayi, Soni; Bhat, Sham S; Hegde, K Sundeep; Peedikayil, Faizal C; Chandru, T P; Anil, Sukumaran
2016-09-01
Overweight and obesity are growing health-related problems worldwide, and it is currently the most prevalent nutritional disorder among children and adolescents. The objective of this study was to assess the association between overweight and dental caries among 12- to 15-year-old schoolchildren in Mangaluru district, Karnataka, India. Data were obtained from 2000 school-going children aged 12 to 15 years. The children were categorized as overweight and normal-weight group by assessing the body mass index (BMI). Body mass index was categorized using the classification system given by the International Obesity Task Force (IOTF) and obtained in units of kg/m 2 . The dental caries was assessed by detection and was performed according to decayed, missing, and filled teeth (DMFT) index. Of the 2000 children examined, the mean BMI recorded was 26.87 ± 2.26 for the overweight children and 20.82 ± 1.48 for the normal-weight children. Even though the DMFT (3.90 ± 2.95) in the overweight children was slightly higher than the control group (3.36 ± 2.73), it was not statistically significant. Within the confines of the present study, it can be concluded that there is no significant association between overweight and dental caries among the schoolchildren of Mangaluru district in Karnataka. Longitudinal studies are necessary to substantiate the possible relationships between dental caries and overweight in children. Knowledge of these relationships could lead to preventive health measures designed to reduce the prevalence of both obesity and dental caries.
Koppad, Anand K; Kaulgud, Ram S; Arun, B S
2017-09-01
It has been observed that metabolic syndrome is risk factor for Coronary Artery Disease (CAD) and exerts its effects through fat deposition and vascular aging. CAD has been acknowledged as a leading cause of death. In earlier studies, the metabolic risk has been estimated by Framingham risk score. Recent studies have shown that Neck Circumference (NC) has a good correlation with other traditional anthropometric measurements and can be used as marker of obesity. It also correlates with Framingham risk score, which is slightly more sophisticated measure of CAD risk. To assess the risk of CAD in a subject based on NC and to correlate the NC to Framingham risk score. The present cross-sectional study, done at Karnataka Institute of Medical Sciences, Hubli, Karnataka, India, includes 100 subjects. The study duration was of one year from 1 st January 2015 to 31 st December 2015. Anthropometric indices Body Mass Index (BMI) and NC were correlated with 10 year CAD risk as calculated by Framingham risk score. The correlation between BMI, NC, vascular age and Framingham risk score was calculated using Karl Pearson's correlation method. NC has a strong correlation with 10 year CAD risk (p≤0.001). NC was significantly greater in males as compared to females (p≤0.001). Males had greater risk of cardiovascular disease as reflected by higher 10 year Framingham risk score (p≤0.0035). NC gives simple and easy prediction of CAD risk and is more reliable than traditional risk markers like BMI. NC correlates positively with 10 year Framingham risk score.
[Legal abortion in an Indian state].
Baskara, N; Kanbargi, R
1978-01-01
The number of abortions in India increased steadily since 1972, the year in which it was legalized. This study examines the characteristics of abortion seekers in the state of Karnataka, which has a population of 29.3 million inhabitants. Data analyzed are about 8073 abortions done in the 35 hospitals authorized to perform the procedure; most of them are state hospitals, and some are private. In 1972 there were 721 abortions, compared to 5544 in 1974. 80% of these were performed in only 12 of the 35 hospitals. In average there were 13-14 abortions a month/hospital, and 8 abortions per doctor qualified to perform it. The majority of abortion seekers were between 30-34 in 1972, but between 25-29 in the following years; 92% were married; 46% had parity over 3, and 37% parity over 4. 84% were Hindu, 7% Muslim, and 9% Christian. Data suggested that the number of illiterate women seeking abortion is increasing. 84% of abortions were performed during the first trimester of pregnancy, mostly by curettage and vacuum aspiration. 13% were second trimester abortions done by saline solution or hysterotomy. The percentage of women accepting contraception after abortion was 33% in 1972 and only 36% in 1974. Tubal ligation seemed to be the preferred method, followed by insertion of IUD. There are still relatively few legal abortions performed in Karnataka; this is due partly to the fact that most hospitals are located in urban areas, and that it can be extremely difficult for a woman living in the countryside to reach it.
Vigna pandeyana (Fabaceae), a new species from northern Western Ghats, India
Gaikwad, Sayajirao; Randive, Sonali
2015-01-01
Abstract Background Vigna subg. Ceratotropis (Piper) Verdc. represents a homogenous and distinct group of species with highly specialized complex floral characters. It is most diverse in Asia. India, with 24 species, represents a secondary center of species diversity of the subgenus. New information A new species, Vigna pandeyana RD Gore, SP Gaikwad & SD Randive, is described from hill slopes of the northern Western Ghats of India. It resembles Vigna yadavii Gaikwad et al. and Vigna dalzelliana (Kuntze) Verdc. but differs from the latter in its dimorphic shoots (some subterranean, with cleistogamous flowers) and densely hairy pods, from the former by its curved style, flattened style beak, foveolate seed coat and absence of standard protuberance and horn-like keel pocket in cleistogamous flowers. PMID:25829861
NASA Technical Reports Server (NTRS)
Rao, Y. J. B.
1986-01-01
The two fold stratigraphic subdivision of the Archean-Proterozoic greenstone-gneiss association of Dharwar craton into an older Sargur group (older than 2.9 Ga.) and a younger Dharwar Supergroup serves as an a priori stratigraphic model. The concordant greenstone (schist)-gneiss (Peninsular gneiss) relationships, ambiguities in stratigraphic correlations of the schist belts assigned to Sargur group and difficulties in deciphering the older gneiss units can be best appreciated if the Sargur group be regarded as a trimodal association of: (1) ultrabasic-mafic metavolcanics (including komatiites), (2) clastic and nonclastic metasediments and paragneisses and (3) mainly tonalite/trondhemite gneisses and migmatites of diverse ages which could be as old as c. 3.4 ga. or even older. The extensive occurrence of this greenstone-gneiss complex is evident from recent mapping in many areas of central and southern Karnataka State.
Inservice Training of Primary Teachers Through Interactive Video Technology: An Indian Experience
NASA Astrophysics Data System (ADS)
Maheshwari, A. N.; Raina, V. K.
1998-01-01
India has yet to achieve elementary education for all children. Among the centrally sponsored initiatives to improve education are Operation Blackboard, to provide sufficient teachers and buildings, Minimum Levels of Learning, which set achievement targets, and the Special Orientation Programme for Primary School Teachers (SOPT). This article focuses on the last of these and describes the new technology used to train teachers so that the losses in transmission inherent in the cascade model are avoided. Interactive Video Technology involving the Indira Gandhi Open University and the Indian Space Research Organisation was used experimentally in seven-day training courses for primary school teachers in 20 centres in Karnataka State, providing one-way video transmissions and telephone feedback to experts from the centres. The responses from teachers and their trainers indicate considerable potential for the exploitation of new technology where large numbers of teachers require training.
NASA Astrophysics Data System (ADS)
Fazeli, M. Sharif; Sathyanarayan, S.; Satish, P. N.; Muthanna, Lata
1991-01-01
Physicochemical characteristics of wastewater from one of the paper mills near Nanjangud and the differential accumulation of heavy metals in parts of coconut trees growing in the area irrigated directly by the wastewaters of a paper mill were investigated. The total dissolved and suspended solids of wastewater were 1,136.9 mg/l and 2,185.4 mg/l, respectively. Biological oxygen demand (BOD) expands and COD is beyond the tolerance limit proposed by Indian standards. The concentrations of heavy metals like Cu, Pb, Zn, Ni, Co, and Cd in coconut water, root, and leaf are higher than the limits suggested by World Health Organization. Survival of coconut trees irrigated by polluted waters indicates tolerance to toxic heavy metals. Since coconut forms part of human food chain, accumulation of toxic heavy metals may lead to organic disorders.
Dermatoglyphics--a marker for malocclusion?
Tikare, S; Rajesh, G; Prasad, K W; Thippeswamy, V; Javali, S B
2010-08-01
Dermatoglyphics is the study of dermal ridge configurations on palmar and plantar surfaces of hands and feet. Dermal ridges and craniofacial structures are both formed during 6-7th week of intra-uterine life. It is believed that hereditary and environmental factors leading to malocclusion may also cause peculiarities in fingerprint patterns. To study and assess the relationship between fingerprints and malocclusion among a group of high school children aged 12-16 years in Dharwad, Karnataka, India. A total of 696 high school children aged 12-16 years were randomly selected. Their fingerprints were recorded using duplicating ink and malocclusion status was clinically assessed using Angle's classification. Chi-square analysis revealed statistical association between whorl patterns and classes 1 and 2 malocclusion (p < 0.05). However, no overall statistical association was observed between fingerprint patterns and malocclusion (p > 0.05). Dermatoglyphics might be an appropriate marker for malocclusion and further studies are required to elucidate an association between fingerprint patterns and malocclusion.
Outcomes of antiretroviral therapy in a northern Indian urban clinic.
Sharma, Surendra K; Dhooria, Sahajal; Prasad, K T; George, Ninoo; Ranjan, Sanjay; Gupta, Deepak; Sreenivas, Vishnubhatla; Kadhiravan, Tamilarasu; Miglani, Sunita; Sinha, Sanjeev; Wig, Naveet; Biswas, Ashutosh; Vajpayee, Madhu
2010-03-01
Antiretroviral therapy (ART) programmes have been successful in several countries. However, whether they would succeed as part of a national programme in a resource-constrained setting such as India is not clear. The outcomes and specific problems encountered in such a setting have not been adequately studied. We assessed the efficacy and functioning of India's national ART programme in a tertiary care centre in northern India. All ART-naive patients started on ART between May 2005 and October 2006 were included in the study and were followed until 31 April 2008. Periodic clinical and laboratory evaluations were carried out in accordance with national guidelines. Changes in CD4+ lymphocyte count, body weight and body mass index were assessed at follow-up, and the operational problems analysed. The setting was a tertiary care centre in northern India with a mixed population of patients, mostly of low socioeconomic status. The centre is reasonably well resourced but faces constraints in health-care delivery, such as lack of adequate human resources and a high patient load. The response to ART in the cohort studied was comparable to that reported from other countries. However, the programme had a high attrition rate, possibly due to patient-related factors and operational constraints. A high rate of attrition can affect the overall efficacy and functioning of an ART programme. Addressing the issues causing attrition might improve patient outcomes in India and in other resource-constrained countries.
Climate change and waterborne diarrhoea in northern India: impacts and adaptation strategies.
Moors, Eddy; Singh, Tanya; Siderius, Christian; Balakrishnan, Sneha; Mishra, Arabinda
2013-12-01
Although several studies show the vulnerability of human health to climate change, a clear comprehensive quantification of the increased health risks attributable to climate change is lacking. Even more complicated are assessments of adaptation measures for this sector. We discuss the impact of climate change on diarrhoea as a representative of a waterborne infectious disease affecting human health in the Ganges basin of northern India. A conceptual framework is presented for climate exposure response relationships based on studies from different countries, as empirical studies and appropriate epidemiological data sets for India are lacking. Four climate variables are included: temperature, increased/extreme precipitation, decreased precipitation/droughts and relative humidity. Applying the conceptual framework to the latest regional climate projections for northern India shows increases between present and future (2040s), varying spatially from no change to an increase of 21% in diarrhoea incidences, with 13.1% increase on average for the Ganges basin. We discuss three types of measures against diarrhoeal disease: reactive actions, preventive actions and national policy options. Preventive actions have the potential to counterbalance this expected increase. However, given the limited progress in reducing incidences over the past decade consorted actions and effective implementation and integration of existing policies are needed. © 2013.
Gopala; Rao, G P
2018-02-01
Phytoplasma suspected symptoms of phyllody, witches' broom, leaf yellowing, stunting and little leaf were observed in Chrysanthemum morifolium, Bougainvillea glabra, Jasminum sambac and Callistephus chinensis during survey of flower nurseries and experimental ornamental fields at Delhi, Maharashtra, Tamil Nadu and Karnataka from 2014 to 2016. Pleomorphic bodies typical to phytoplasma structures were observed in the phloem sieve elements of ultrathin sections of all the four symptomatic ornamental plants (stem tissue) in transmission electron microscope. Amplification of 1.8 and 1.2 kb phytoplasma DNA products was observed in all the four test plants in PCR assays using universal primer pairs P1/P7 followed by nested primer pair R16F2n/R16R2, respectively. Pairwise sequence comparison, phylogeny and virtual RFLP analysis of 16S rDNA sequences confirmed the association of two phytoplasma subgroups (16SrI-B and 16SrII-D) in four ornamental plant species. ' Ca. P. aurantifolia ' subgroup D (16SrII-D) was found associated with chrysanthemum phyllody and leaf yellowing at Delhi and Tamil Nadu, bougainvillea little leaf and yellowing at Delhi and Chinese aster phyllody at Bengaluru, Karnataka. However, jasmine little leaf and yellowing at Bengaluru, Karnataka and chrysanthemum stunting at Pune were found to be associated with ' Ca . P. asteris ' subgroup B-related strains (16SrI-B). The identification of 16SrII-D subgroup phytoplasma infecting bougainvillea and 16SrI-B subgroup infecting jasmine are the new reports to the world. Besides weed species, Cannabis sativa showing witches' broom in jasmine fields at Bengaluru and Parthenium hysterophorus showing witches' broom symptoms in chrysanthemum fields at Delhi were identified to be caused by phytoplasma strains classified under subgroups 16SrI-B and 16SrII-D, respectively, by PCR assays and 16Sr DNA sequence comparison analysis. Among the three major leafhopper species identified, only Hishimonas phycitis was identified positive for 16SrI-B and 16SrII-D subgroups of phytoplasmas from chrysanthemum fields at Delhi and jasmine fields at Bengaluru, respectively. The identity of similar phytoplasma strains infecting ornamental species in leafhopper and the weed species in the present study suggested that H. phycitis and weeds may act as potential natural sources for secondary spread of the identified phytoplasma strains.
An exploratory comparison of name generator content: Data from rural India.
Shakya, Holly B; Christakis, Nicholas A; Fowler, James H
2017-01-01
Since the 1970s sociologists have explored the best means for measuring social networks, although few name generator analyses have used sociocentric data or data from developing countries, partly because sociocentric studies in developing countries have been scant. Here, we analyze 12 different name generators used in a sociocentric network study conducted in 75 villages in rural Karnataka, India. Having unusual sociocentric data from a non-Western context allowed us to extend previous name generator research through the unique analyses of network structural measures, an extensive consideration of homophily, and investigation of status difference between egos and alters. We found that domestic interaction questions generated networks that were highly clustered and highly centralized. Similarity between respondents and their nominated contacts was strongest for gender, caste, and religion. We also found that domestic interaction name generators yielded the most homogeneous ties, while advice questions yielded the most heterogeneous. Participants were generally more likely to nominate those of higher social status, although certain questions, such as who participants talk to uncovered more egalitarian relationships, while other name generators elicited the names of social contacts distinctly higher or lower in status than the respondent. Some questions also seemed to uncover networks that were specific to the cultural context, suggesting that network researchers should balance local relevance with global generalizability when choosing name generators.
Potu, Bhagath Kumar; Kumar, Vinod; Salem, Abdel-Halim; Abu-Hijleh, Marwan
2014-01-01
The retromolar foramen (RMF) is a rare anatomical structure situated in the retromolar fossa behind the third molar tooth. When it is present, the foramen is connected with the mandibular canal and is believed to transmit neurovascular structures that provide accessory source to the mandibular molars and the buccal area. Reports from the literature show that the presence of RMF could pose a challenge in complete blockage of the inferior alveolar nerve during mandibular surgeries. We report the incidence of retromolar foramen from ninety-four dry mandibles of south-eastern part of Karnataka State, India. The foramen was observed in 11 mandibles out of 94 included in the study (11.7%). In three mandibles, the foramen was present bilaterally (3.2%) and in three it was on the left side (3.2%) and in five it was on the right side (5.3%). For the first time, we also measured the dimensions of the retromolar area and distance of the foramen from third molar tooth to understand its risks during the surgical extraction of the lower third molar tooth. A thorough review of the literature has also been done to compare the present findings with the studies reported from the various populations. PMID:25489487
Surgical site infections due to rapidly growing mycobacteria in puducherry, India.
Kannaiyan, Kavitha; Ragunathan, Latha; Sakthivel, Sulochana; Sasidar, A R; Muralidaran; Venkatachalam, G K
2015-03-01
Rapidly growing Mycobacteria are increasingly recognized, nowadays as an important pathogen that can cause wide range of clinical syndromes in humans. We herein describe unrelated cases of surgical site infection caused by Rapidly growing Mycobacteria (RGM), seen during a period of 12 months. Nineteen patients underwent operations by different surgical teams located in diverse sections of Tamil Nadu, Pondicherry, Karnataka, India. All patients presented with painful, draining subcutaneous nodules at the infection sites. Purulent material specimens were sent to the microbiology laboratory. Gram stain and Ziehl-Neelsen staining methods were used for direct examination. Culture media included blood agar, chocolate agar, MacConkey agar, Sabourauds agar and Lowenstein-Jensen medium for Mycobacteria. Isolated microorganisms were identified and further tested for antimicrobial susceptibility by standard microbiologic procedures. Mycobacterium fortuitum and M.chelonae were isolated from the purulent drainage obtained from wounds by routine microbiological techniques from all the specimens. All isolates analyzed for antimicrobial susceptibility pattern were sensitive to clarithromycin, linezolid and amikacin but were variable to ciprofloxacin, rifampicin and tobramycin. Our case series highlights that a high level of clinical suspicion should be maintained for patients presenting with protracted soft tissue lesions with a history of trauma or surgery as these infections not only cause physical but also emotional distress that affects both the patients and the surgeon.
Biggeri, Mario; Deepak, Sunil; Mauro, Vincenzo; Trani, Jean-Francois; Kumar, Jayanth; Ramasamy, Parthipan
2014-01-01
In this paper, we measure the effectiveness of Community-Based Rehabilitation (CBR) programmes in promoting the well-being of people with disabilities and removing the barriers to their participation in family and community decision-making processes. To evaluate the impact of the CBR programme, we use data from a large-scale control study in Karnataka, India. Propensity score matching is used to evaluate the impacts on disabled persons after 2, 4 and 7 years of entering the CBR. The theoretical framework for the analysis is based on the CBR guidelines, which are combined with the International Classification of Functionings (ICF), the United Nations Convention on the Rights of People with Disabilities (UN CRPD) and Amartya Sen's capability approach. CBR has a positive impact on the well-being of persons with disabilities participating in the programme and particularly on their participation within the family and the society at large. CBR programmes have a multidimensional and positive impact on individual and collective capabilities; on individual, agency and social empowerment. Implications for Rehabilitation Community-Based Rehabilitation (CBR) can make a lasting difference in the life of persons with disabilities. CBR improves participation and inclusion of persons with disabilities in the family and in the community.
Assessment of interns and postgraduate dental student's knowledge regarding equipment ergonomics.
Rajeswari, S Raja; Gowda, Triveni M; Kumar, Tarun Ab; Arya, Kanchan; Mehta, Dhoom Singh
2016-01-01
The substantial knowledge concerning ergonomics and its practical application is vital for forestalling musculoskeletal disorders. The role of equipment ergonomics (EE) in preventing these work-related ailments is significantly noteworthy. The aim of the study was to assess the prevailing perception of postgraduates (PGs) and interns regarding EE and preparing the Indian dental workforce for the challenges of India's growing economy and population. Authors conducted a cross-sectional survey between December 2013 and February 2014 amidst the interns and PG dental students of Davangere city, Karnataka, India. The data were collected using 21-item custom designed proforma, comprising of questions evaluating student's basic knowledge about EE. Statistical analysis was done using Chi-square test in each group (PGs and interns) and Mann-Whitney test was implemented for comparison between both groups. Of 358 subjects surveyed, 48% PGs and 52% interns affirmed that they came across EE only through this survey. In addition, 91.18% of PGs and 90.59% interns believed that the accentuation on EE is less in the current dental curriculum. Comprehensive understanding and practical application of EE among the participants was found to be lacking. The importance of microbreaks and chair side exercises should be emphasized and training should be initiated at an early stage before improper postural habits develop.
Early Precambrian crustal evolution of south India
NASA Technical Reports Server (NTRS)
Srinivasan, R.
1986-01-01
The Early Precambrian sequence in Karnataka, South India provides evidences for a distinct trend of evolution which differs from trends exhibited in many other Early Precambrian regions of the world. The supracrustal rock associations preserved in greenstone belts and as inclusions in gneisses and granulites suggest the evolution of the terrain from a stable to a mobile regime. The stable regime is represented by (1) layered ultramafic-mafic complexes, (2) orthoquartzite-basalt-rhyodacite-iron formation, and (30 ortho-quartzite-carbonate-Mn-Fe formation. The mobile regime, which can be shown on sedimentological grounds to have succeeded the stable regime, witnessed the accumulation of a greywacke-pillow basalt-dacite-rhyolite-iron formation association. Detrital sediments of the stable zone accumulated dominantly in fluvial environment and the associated volcanics are ubaerial. The volcanics of the stable regime are tholeiites derived from a zirconium and LREE-enriched sources. The greywackes of the mobile regime are turbidities, and the volcanic rocks possess continental margin (island-arc or back-arc) affinity; they show a LREE depleted to slightly LREE-enriched pattern. The evolution from a stable to a mobile regime is in contrast to the trend seen in most other regions of the world, where an early dominantly volcanic association of a mobile regime gives way upward in the sequence to sediments characteristic of a stable regime.
Mohanty, D; Colah, R B; Gorakshakar, A C; Patel, R Z; Master, D C; Mahanta, J; Sharma, S K; Chaudhari, U; Ghosh, M; Das, S; Britt, R P; Singh, S; Ross, C; Jagannathan, L; Kaul, R; Shukla, D K; Muthuswamy, V
2013-01-01
The population of India is extremely diverse comprising of more than 3,000 ethnic groups who still follow endogamy. Haemoglobinopathies are the commonest hereditary disorders in India and pose a major health problem. The data on the prevalence of β-thalassemias and other haemoglobinopathies in different caste/ethnic groups of India is scarce. Therefore the present multicentre study was undertaken in six cities of six states of India (Maharashtra, Gujarat, West Bengal, Assam, Karnataka and Punjab) to determine the prevalence of haemoglobinopathies in different caste/ethnic groups using uniform methodology. Fifty-six thousand seven hundred eighty individuals (college students and pregnant women) from different caste/ethnic groups were screened. RBC indices were measured on an automated haematology counter while the percentage of HbA(2), HbF and other abnormal Hb variants were estimated by HPLC on the Variant Hemoglobin Testing System. The overall prevalence of β-thalassemia trait was 2.78 % and varied from 1.48 to 3.64 % in different states, while the prevalence of β-thalassemia trait in 59 ethnic groups varied from 0 to 9.3 %. HbE trait was mainly seen in Dibrugarh in Assam (23.9 %) and Kolkata in West Bengal (3.92 %). In six ethnic groups from Assam, the prevalence of HbE trait varied from 41.1 to 66.7 %. Few subjects with δβ-thalassemia, HPFH, HbS trait, HbD trait, HbE homozygous and HbE β-thalassemia as well as HbS homozygous and HbS-β-thalassemia (<1 %) were also identified. This is the first large multicentre study covering cities from different regions of the country for screening for β-thalassemia carriers and other haemoglobinopathies where uniform protocols and methodology was followed and quality control ensured by the co-ordinating centre. This study also shows that establishment of centres for screening for β-thalassemia and other haemoglobinopathies is possible in medical colleges. Creating awareness, screening and counselling can be done at these centres. This experience will help to formulate a national thalassemia control programme in India.
Blanchard, Andrea K; Nair, Sapna G; Bruce, Sharon G; Ramanaik, Satyanarayana; Thalinja, Raghavendra; Murthy, Srikanta; Javalkar, Prakash; Pillai, Priya; Collumbien, Martine; Heise, Lori; Isac, Shajy; Bhattacharjee, Parinita
2018-05-11
Research has increasingly documented the important role that violence by clients and the police play in exacerbating HIV vulnerability for women in sex work. However few studies have examined violence in the intimate relationships of women in sex work, or drawn on community partnerships to explore the social dynamics involved. A community-based participatory research study was undertaken by community and academic partners leading intimate partner violence (IPV) and HIV prevention programs in Bagalkot district, Karnataka state, India. The purpose was to explore the experience and understandings of intimate partner violence and HIV/AIDS among women in sex work and their intimate partners in Bagalkot that would inform both theory and practice. A community-based, interpretive qualitative methodology was used. Data was collected between July and October 2014 through in-depth interviews with 38 participants, including 10 couples, 13 individual female sex workers, and 5 individual male intimate partners. Purposive sampling was done to maximize variation on socio-demographic characteristics. Thematic content analysis was conducted through coding and categorization for each interview question in NVivo 10.0, followed by collaborative analysis to answer the research questions. The results showed that an array of interrelated, multi-level factors underlay the widespread acceptance and perpetuation of violence and lack of condom use in participants' intimate relationships. These included individual expectations that justified violence and reflected societal gender norms, compounded by stigma, legal and economic constraints relating to sex work. The results demonstrate that structural vulnerability to IPV and HIV must be addressed not only on the individual and relationship levels to resolve relevant triggers of violence and lack of condom use, but also the societal-level to address gender norms and socio-economic constraints among women in sex work and their partners. The study contributes to a better understanding on the interplay of individual agency and structural forces at a time when researchers and program planners are increasingly pondering how best to address complex and intersecting social and health issues. Ongoing research should assess the generalizability of the results and the effectiveness of structural interventions aiming to reduce IPV and HIV vulnerability in other contexts.
Ghosh, Susanta K; Chakaravarthy, Preethi; Panch, Sandhya R; Krishnappa, Pushpalatha; Tiwari, Satyanarayan; Ojha, Vijay P; Manjushree, R; Dash, Aditya P
2011-07-28
In 2006, severe outbreaks of Aedes aegypti-transmitted chikungunya occurred in villages in Karnataka, South India. We evaluated the effectiveness of combined information, education and communication (IEC) campaigns using two potential poeciliid larvivorous fish guppy (Poecilia reticulata) and mosquitofish (Gambusia affinis), in indoor cement tanks for Aedes larval control. Trials were conducted in two villages (Domatmari and Srinivaspura) in Tumkur District from March to May 2006 for Poecilia and one village (Balmanda) in Kolar District from July to October 2006 for Gambusia. A survey on knowledge, attitude and practice (KAP) on chikungunya was initially conducted and IEC campaigns were performed before and after fish release in Domatmari (IEC alone, followed by IEC + Poecilia) and Balmanda (IEC + Gambusia). In Srinivaspura, IEC was not conducted. Larval surveys were conducted at the baseline followed by one-week and one-month post-intervention periods. The impact of fish on Aedes larvae and disease was assessed based on baseline and post-intervention observations. Only 18% of respondents knew of the role of mosquitoes in fever outbreaks, while almost all (n = 50 each) gained new knowledge from the IEC campaigns. In Domatmari, IEC alone was not effective (OR 0.54; p = 0.067). Indoor cement tanks were the most preferred Ae. aegypti breeding habitat (86.9%), and had a significant impact on Aedes breeding (Breteau Index) in all villages in the one-week period (p < 0.001). In the one-month period, the impact was most sustained in Domatmari (OR 1.58, p < 0.001) then Srinivaspura (OR 0.45, p = 0.063) and Balmanda (OR 0.51, p = 0.067). After fish introductions, chikungunya cases were reduced by 99.87% in Domatmari, 65.48% in Srinivaspura and 68.51% in Balmanda. Poecilia exhibited greater survival rates than Gambusia (86.04 vs.16.03%) in cement tanks. Neither IEC nor Poecilia alone was effective against Aedes (p > 0.05). We conclude that Poecilia + IEC is an effective intervention strategy. The operational cost was 0.50 (US$ 0.011, 1 US$= 47) per capita per application. Proper water storage practices, focused IEC with Poecilia introductions and vector sanitation involving the local administration and community, is suggested as the best strategy for Aedes control.
2011-01-01
Background Structural factors are known to affect individual risk and vulnerability to HIV. In the context of an HIV prevention programme for over 60,000 female sex workers (FSWs) in south India, we developed structural interventions involving policy makers, secondary stakeholders (police, government officials, lawyers, media) and primary stakeholders (FSWs themselves). The purpose of the interventions was to address context-specific factors (social inequity, violence and harassment, and stigma and discrimination) contributing to HIV vulnerability. We advocated with government authorities for HIV/AIDS as an economic, social and developmental issue, and solicited political leadership to embed HIV/AIDS issues throughout governmental programmes. We mobilised FSWs and appraised them of their legal rights, and worked with FSWs and people with HIV/AIDS to implement sensitization and awareness training for more than 175 government officials, 13,500 police and 950 journalists. Methods Standardised, routine programme monitoring indicators on service provision, service uptake, and community activities were collected monthly from 18 districts in Karnataka between 2007 and 2009. Daily tracking of news articles concerning HIV/AIDS and FSWs was undertaken manually in selected districts between 2005 and 2008. Results The HIV prevention programme is now operating at scale, with over 60,000 FSWs regularly contacted by peer educators, and over 17,000 FSWs accessing project services for sexually transmitted infections monthly. FSW membership in community-based organisations has increased from 8,000 to 37,000, and over 46,000 FSWs have now been referred for government-sponsored social entitlements. FSWs were supported to redress > 90% of the 4,600 reported incidents of violence and harassment reported between 2007-2009, and monitoring of news stories has shown a 50% increase in the number of positive media reports on HIV/AIDS and FSWs. Conclusions Stigma, discrimination, violence, harassment and social equity issues are critical concerns of FSWs. This report demonstrates that it is possible to address these broader structural factors as part of large-scale HIV prevention programming. Although assessing the impact of the various components of a structural intervention on reducing HIV vulnerability is difficult, addressing the broader structural factors contributing to FSW vulnerability is critical to enable these vulnerable women to become sufficiently empowered to adopt the safer sexual behaviours which are required to respond effectively to the HIV epidemic. PMID:21962115
Gurnani, Vandana; Beattie, Tara S; Bhattacharjee, Parinita; Mohan, H L; Maddur, Srinath; Washington, Reynold; Isac, Shajy; Ramesh, B M; Moses, Stephen; Blanchard, James F
2011-10-02
Structural factors are known to affect individual risk and vulnerability to HIV. In the context of an HIV prevention programme for over 60,000 female sex workers (FSWs) in south India, we developed structural interventions involving policy makers, secondary stakeholders (police, government officials, lawyers, media) and primary stakeholders (FSWs themselves). The purpose of the interventions was to address context-specific factors (social inequity, violence and harassment, and stigma and discrimination) contributing to HIV vulnerability. We advocated with government authorities for HIV/AIDS as an economic, social and developmental issue, and solicited political leadership to embed HIV/AIDS issues throughout governmental programmes. We mobilised FSWs and appraised them of their legal rights, and worked with FSWs and people with HIV/AIDS to implement sensitization and awareness training for more than 175 government officials, 13,500 police and 950 journalists. Standardised, routine programme monitoring indicators on service provision, service uptake, and community activities were collected monthly from 18 districts in Karnataka between 2007 and 2009. Daily tracking of news articles concerning HIV/AIDS and FSWs was undertaken manually in selected districts between 2005 and 2008. The HIV prevention programme is now operating at scale, with over 60,000 FSWs regularly contacted by peer educators, and over 17,000 FSWs accessing project services for sexually transmitted infections monthly. FSW membership in community-based organisations has increased from 8,000 to 37,000, and over 46,000 FSWs have now been referred for government-sponsored social entitlements. FSWs were supported to redress > 90% of the 4,600 reported incidents of violence and harassment reported between 2007-2009, and monitoring of news stories has shown a 50% increase in the number of positive media reports on HIV/AIDS and FSWs. Stigma, discrimination, violence, harassment and social equity issues are critical concerns of FSWs. This report demonstrates that it is possible to address these broader structural factors as part of large-scale HIV prevention programming. Although assessing the impact of the various components of a structural intervention on reducing HIV vulnerability is difficult, addressing the broader structural factors contributing to FSW vulnerability is critical to enable these vulnerable women to become sufficiently empowered to adopt the safer sexual behaviours which are required to respond effectively to the HIV epidemic.
Uragayala, S; Kamaraju, R; Tiwari, S N; Sreedharan, S; Ghosh, S K; Valecha, N
2018-06-01
There is an urgent need to test and incorporate new molecules with promising efficacy and novel mode of action to control insecticide-resistant mosquito vectors for disease control. We tested a new compound, clothianidin (SumiShield 50 WG), for its efficacy as an indoor residual spray (IRS) for the control of pyrethroid-resistant Anopheles culicifacies (Diptera: Culicidae) in comparison with pirimiphos methyl (Actellic CS) as a positive control. Ten villages were selected, five each for IRS with clothianidin (300 mg AI/m 2 ) and pirimiphos methyl (1000 mg AI/m 2 ) in Almatti Dam catchment area in Karnataka state, India. Entomological parameters were monitored in these sprayed villages using standard methods. Assessment of quality of spray was performed by analysing the insecticide content in the filter paper samples collected from sprayed houses. Perceptions of spray men and inhabitants were recorded post-spray on safety of these molecules. The mean applied to target ratio of content was 1.7 (n = 29) for clothianidin and 1.8 (n = 50) for pirimiphos methyl on filter paper samples analysed. Residual activity (≥80% mortality in exposed mosquitoes) after 24 h post-exposure of SumiShield WG was 5 months and increased to 6 months when the holding period was extended to 120 h and that of Actellic CS was 3 months at 24-h holding period and extended to 4 months at 120-h extended holding period. The mean densities of An. culicifacies in both arms fell drastically post-spray. In light trap collections, density of mosquitoes collected indoors was lower than outdoors in both arms indicating effectiveness of IRS. SumiShield WG was more efficacious in reducing the per-structure density than Actellic CS. The proportion of nulliparous mosquitoes was higher than that of parous mosquitoes during post-spray collections in both arms. The majority of adverse events reported were transitory and subsided without medication. Indoor residual spraying with SumiShield WG was found effective, operationally feasible and safe, and it is effective for up to 6 months. © 2018 John Wiley & Sons Ltd.
Kemmanu, Vasudha; Hegde, Kaushik; Giliyar, Subramanya K; Shetty, Bhujanga K; Kumaramanickavel, G; McCarty, Catherine A
2016-06-01
To determine the prevalence of childhood blindness and ocular morbidity in a rural pediatric population in South India. A population-based, cross-sectional survey of children was conducted in three phases in Pavagada and Madhugiri taluks (subdivisions) of Tumkur district in the state of Karnataka, India. In the first phase, trained fieldworkers screened 23,100 children. In the second phase, children with eye diseases were referred to the peripheral hospital to be examined by a general ophthalmologist. In the third phase, children with major eye diseases were examined by a pediatric ophthalmologist. The prevalence of ocular morbidity was 2.66% (95% confidence interval, CI, 2.46-2.87%). The most commonly observed ocular morbidity was Bitot spots (1%) followed by refractive error (0.6%). In total, 18 children were blind and the prevalence of childhood blindness (best-corrected visual acuity <3/60) was 0.08% (95% CI 0.04-0.11%); 8 (44.44%) had retinal blindness, 5 (27.76%) had lens-related blindness, 2 (11.11%) had bilateral microphthalmos, 1 (5.56%) was blind due to anterior staphyloma in the right eye and anophthalmos in the left eye, 1 (5.56%) had bilateral uveal coloboma and 1 (5.56%) had cortical visual impairment. Nearly half of the blindness in the population was due to unavoidable causes (retinal). In addition to providing eye care services, an appropriate service delivery model would include the provision of rehabilitative and low vision services and implementation of genetic studies to understand the causes and increase awareness of inherited eye diseases.
Orchard, Treena Rae
2007-06-01
The emotive issue of child prostitution is at the heart of international debates over 'trafficking' in women and girls, the "new slave trade", and how these phenomena are linked with globalization, sex tourism, and expanding transnational economies. However, young sex workers, particularly those in the 'third world', are often represented through tropes of victimization, poverty, and "backwards" cultural traditions, constructions that rarely capture the complexity of the girls' experiences and the role that prostitution plays in their lives. Based on ethnographic fieldwork with girls and young women who are part of the Devadasi (servant/slave of the God) system of sex work in India, this paper introduces an alternative example of child prostitution. Demonstrating the ways in which this practice is socially, economically, and culturally embedded in certain regions of rural south India underlies this new perspective. I argue that this embeddedness works to create, inform, and give meaning to these girls as they grow up in this particular context, not to isolate and produce totally different experiences of family, gender identity, and moral character as popular accounts of child prostitution contend. Data pertaining to socialization, 'positive' aspects of being a young sex worker in this context, political economy, HIV/AIDS, and changes in the Devadasi tradition are used to support my position. Taken together, this alternative example presents a more complex understanding of the micro- and macro-forces that impact child prostitution as well as the many factors that affect the girls' ideas of what they do and who they are as people, not just sex workers.
Das, Kusal K; Chadchan, Kailash S; Reddy, R Chandramouli; Biradar, M S; Kanthe, Pallavi S; Patil, Bheemshetty S; Ambekar, Jeevan G; Bagoji, Ishwar B; Das, Swastika
2017-11-08
Kenaf (Hibiscus cannabinus Linn, Pundi), Chick pea (Cicer arietinum Linn, Chana) and Prickly lettuce (Lactuca scariola Linn, Hattaraki) leaves are a few of indigenous plants which are routinely consumed by the people of north Karnataka in the diet. Studies on these plants showed some potential anti-diabetic efficacies. To examine the effect of leaves extracts of Hibiscus cannabinus Linn, Cicer arietinum Linn and Lactuca scariola Linn on cardiovascular integrity, glucose homeostasis and oxygen sensing cell signaling mechanisms in alloxan induced diabetic rats. In vitro and in vivo tests on glucose regulatory systems and molecular markers such as - NOS3, HIF- 1α and VEGF were conducted in alloxan induced diabetic rats supplemented with all the three plant extracts. Electrophysiological analysis (HRV, LF: HF ratio, baroreflex sensitivity, BRS) and histopathogy of myocardial tissues and elastic artery were evaluated in diabetic rats treated with L. scariola linn. Out of these three plant extracts, Lactuca scariola Linn supplementation showed significant beneficial effects on glucose homeostasis and oxygen sensing cell signaling pathways in alloxaninduced diabetic rats. Furthermore, effects of sub chronic supplementation of Lactuca scariola Linn aqueous extracts showed significant improvement in sympatho-vagal balance in diabetic rats by increase of Heart Rate Variability (HRV) and regaining of Baroreflex Sensitivity (BRS). These results were also corroborated with myocardial and elastic artery histopathology of Lactuca scariola Linn supplemented diabetic rats. These findings indicate an adaptive pathway for glucose homeostasis, oxygen sensing cell signaling mechanisms and cardio protective actions in alloxan - induced diabetic rats supplemented with Lactuca scariola Linn extracts. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Prasad, Banuru Muralidhara; Varatharajan, D
2011-01-01
Modern lifestyle changes led to increased dental care needs in India. Consequently, there has been a sharp rise in dentist numbers. Karnataka state alone produces 2,500 dentists annually, who are engaged in the non-government sector owing to inadequate public sector opportunities. This article aims to assess Karnataka private dental clinic quality and efficiency. Dentists were interviewed using a close-ended, structured interview schedule and their clinics were assessed using a checklist adopted from guidelines for providing machinery and equipment under the National Oral Health Care Programme (NOHCP). Dental "hotel" and clinical quality were scored based on this checklist. Clinical quality was "excellent" in 12 per cent of clinics and poor in 49 per cent. Clinics with better infrastructure charged higher price (p < 0.05). Multi-chair clinics charging fixed rates were high (81 per cent). According to 59.5 per cent of dentists, competition did not improve quality while 27 per cent felt that competition increased price, not quality. About 30.9 per cent of the poor quality clinics, 41 per cent average quality clinics and 26 per cent good quality clinics were technically efficient. The multi chair clinics offered better quality at higher prices and single chair clinics provided poorer quality at lower prices. In other words, they had a sub-optimal price-quality mix. Therefore, there is a need to regulate price and quality in all clinics to arrive at an optimal price-quality mix so that clients are not overburdened financially even while receiving good quality dental care. The article advocates that resources are used optimally as a way to achieve value for money and to achieve break-even points thereby providing quality care in a competitive market. Factors that influence dental practitioner behaviour are evaluated.
Ramesh, Ch.; Pattar, Manohar G.
2010-01-01
Methanolic extracts of 6 wild edible mushrooms isolated from the Western Ghats of Karnataka were used in this study. Among the isolates (Lycoperdon perlatum, Cantharellus cibarius, Clavaria vermiculris, Ramaria formosa, Marasmius oreades, Pleurotus pulmonarius), only 4 showed satisfactory results. Quantitative analysis of bioactive components revealed that total phenols are the major bioactive component found in extracts of isolates expressed as mg of GAE per gram of fruit body, which ranged from 3.20 ± 0.05 mg/mL to 6.25 ± 0.08 mg/mL. Average concentration of flavonoid ranged from 0.40 ± 0.052 mg/mL to 2.54 ± 0.08 mg/mL; followed by very small concentration of ascorbic acid (range, 0.06 ± 0.01 mg/mL to 0.16 ± 0.01 mg/mL) in all the isolates. All the isolates showed high phenol and flavonoid content, but ascorbic acid content was found in traces. Antioxidant efficiency by inhibitory concentration on 1,1-Diphenly-2-picrylhydrazyl (DPPH) was found significant when compared to standard antioxidant like Buthylated hydroxyanisol (BHA). The concentration (IC50) ranged from 0.94 ± 0.27 mg/mL to 7.57 ± 0.21 mg/mL. Determination of antimicrobial activity profile of all the isolates tested against a panel of standard pathogenic bacteria and fungi indicated that the concentrations of bioactive components directly influence the antimicrobial capability of the isolates. Agar diffusion assay showed considerable activity against all bacteria. Minimum inhibitory concentration values of the extracts of 4 isolates showed that they are also active even in least concentrations. These results are discussed in relation to therapeutic value of the studied mushrooms. PMID:21808550
NASA Astrophysics Data System (ADS)
Lau, William K. M.; Kim, Kyu-Myong; Shi, Jainn-Jong; Matsui, T.; Chin, M.; Tan, Qian; Peters-Lidard, C.; Tao, W. K.
2017-09-01
The boreal summer of 2008 was unusual for the Indian monsoon, featuring exceptional heavy loading of dust aerosols over the Arabian Sea and northern-central India, near normal all-India rainfall, but excessive heavy rain, causing disastrous flooding in the Northern Indian Himalaya Foothills (NIHF) regions, accompanied by persistent drought conditions in central and southern India. Using the NASA Unified-physics Weather Research Forecast (NUWRF) model with fully interactive aerosol physics and dynamics, we carried out three sets of 7-day ensemble model forecast experiments: (1) control with no aerosol, (2) aerosol radiative effect only and (3) aerosol radiative and aerosol-cloud-microphysics effects, to study the impacts of aerosol-monsoon interactions on monsoon variability over the NIHF during the summer of 2008. Results show that aerosol-radiation interaction (ARI), i.e., dust aerosol transport, and dynamical feedback processes induced by aerosol-radiative heating, plays a key role in altering the large-scale monsoon circulation system, reflected by an increased north-south tropospheric temperature gradient, a northward shift of heavy monsoon rainfall, advancing the monsoon onset by 1-5 days over the HF, consistent with the EHP hypothesis (Lau et al. in Clim Dyn 26(7-8):855-864, 2006). Additionally, we found that dust aerosols, via the semi-direct effect, increase atmospheric stability, and cause the dissipation of a developing monsoon onset cyclone over northeastern India/northern Bay of Bengal. Eventually, in a matter of several days, ARI transforms the developing monsoon cyclone into meso-scale convective cells along the HF slopes. Aerosol-Cloud-microphysics Interaction (ACI) further enhances the ARI effect in invigorating the deep convection cells and speeding up the transformation processes. Results indicate that even in short-term (up to weekly) numerical forecasting of monsoon circulation and rainfall, effects of aerosol-monsoon interaction can be substantial and cannot be ignored.
Kabir, Zubair
2003-07-01
The demographic and socio-economic determinants of post-neonatal deaths (n = 475) in a special project area of rural northern India (Ballabgarh) were ascertained from 1991 to 1999 using the electronic database system of the project area for data extraction, and were compared with the eligible living children of the same age using a matched population-based case-control study design. Similar determinants were also ascertained in neonatal deaths (n = 212) using the same study design. After controlling for the potential confounders using conditional logistic regression analyses, lower caste (a proxy measure for low socio-economic conditions in rural India) was found to be significantly associated with higher post-neonatal deaths (OR = 2.21). Higher maternal age (>30 years) and fathers' lower educational levels were significantly associated with higher neonatal deaths, in addition to higher post-neonatal deaths in the same area.
Demographic Trends, Policy Influences, and Economic Effects in China and India Through 2025
2011-04-01
see Bardhan (2003). 42 over four children per woman. These northern states are poor and have weak infrastructure, educational systems, and...www.hsph.harvard.edu/pgda/WorkingPapers/2010/PGDA_WP_53.pdf Bardhan , Pranab, “Crouching Tiger, Lumbering Elephant: A China-India Comparison,” in Kaushik
ERIC Educational Resources Information Center
Magrabi, Frances M., Ed.; Verma, Amita, Ed.
This publication contains case studies based on rural life in northern India. The titles include: (1) "Profiles of Two Indian Rural Settings"; (2) "Visitors View a Village"; (3) "Village Households"; (4) "Agriculture"; (5) "Women's Needs: Health and Nutrition"; (6) "Meal Pattern, Nutrient…
USDA-ARS?s Scientific Manuscript database
The goal of the current study was to characterize serological and virological parameters of the foot-and-mouth disease (FMD) carrier state at two farms in Nainital District, Uttarakhand State in northern India. Despite previous vaccination of cattle in these herds, clinical signs of FMD occurred in ...
Genetic affinities of the Siddis of South India: an emigrant population of East Africa.
Gauniyal, Mansi; Chahal, S M S; Kshatriya, Gautam K
2008-06-01
Historical records indicate that the Portuguese brought the African Siddis to Goa, India, as slaves about 500 years ago. Subsequently, the Siddis moved into the interior regions of the state of Karnataka, India, and have remained there ever since. Over time the Siddis have experienced considerable cultural changes because of their proximity to neighboring population groups. To understand the biological consequences of these changes, we studied the Siddis to determine the extent of genetic variation and the contributions from the African, European, and Indian ancestral populations. In the present study we typed the Siddis for 20 polymorphic serological, red cell, and Alu insertion-deletion loci. The overall pattern of phenotype (and genotype) distribution is in accordance with Hardy-Weinberg expectations. Considering the ethnohistorical records and the availability of secondary-source genetic data, we used two data sets in the analysis: one comprising eight serological and red cell enzyme markers with eight population groups and another comprising six Alu insertion-deletion markers with seven tribal groups of South India. The dendrograms generated from these two data sets on the basis of genetic distance analysis between the selected populations of African, European, and Indian descent reveals that the Siddis are closer to the Africans than they are to the South Indian populations. Genetic admixture analysis using a dihybrid model (19 loci) and a trihybrid model (10 loci and 8 loci) shows that the predominant influence comes from the Africans, a lesser contribution from the South Indians, and a slight contribution from the Portuguese. Thus the original composition of the African genes among the Siddis has been diluted to some extent by the contribution from southern Indian population groups. There is no nonrandom association of alleles among a set of 10 genetic marker systems considered in the present study. The demonstration of genetic homogeneity of the Siddis, despite their admixed origin, suggests the utility of this population for genetic and epidemiological studies.
Pasricha, Sant-Rayn; Vijaykumar, Varalaxmi; Prashanth, N S; Sudarshan, H; Biggs, Beverley-Ann; Black, Jim; Shet, Arun
2009-02-17
Anaemia is an important problem amongst young children living in rural India. However, there has not previously been a detailed study of the biological aetiology of this anaemia, exploring the relative contributions of iron, vitamin B12, folate and Vitamin A deficiency, inflammation, genetic haemoglobinopathy, hookworm and malaria. Nor have studies related these aetiologic biological factors to household food security, standard of living and child feeding practices. Barriers to conducting such work have included perceived reluctance of village communities to permit their children to undergo venipuncture, and logistical issues. We have successfully completed a community based, cross sectional field study exploring in detail the causes of anaemia amongst young children in a rural setting. A cross sectional, community based study. We engaged in extensive community consultation and tailored our study design to the outcomes of these discussions. We utilised local women as field workers, harnessing the capacity of local health workers to assist with the study. We adopted a programmatic approach with a census rather than random sampling strategy in the village, incorporating appropriate case management for children identified to have anaemia. We developed a questionnaire based on existing standard measurement tools for standard of living, food security and nutrition. Specimen processing was conducted at the Primary Health Centre laboratory prior to transport to an urban research laboratory. Adopting this study design, we have recruited 415 of 470 potentially eligible children who were living in the selected villages. We achieved support from the community and cooperation of local health workers. Our results will improve the understanding into anaemia amongst young children in rural India. However, many further studies are required to understand the health problems of the population of rural India, and our study design and technique provide a useful demonstration of a successful strategy.
Pregnancy wastage among HIV infected women in a high HIV prevalence district of India.
Halli, Shiva S; Khan, C G Hussain; Shah, Iqbal; Washington, Reynold; Isac, Shajy; Moses, Stephen; Blanchard, James F
2015-07-02
Bagalkot district in Karnataka state is one of the highest HIV prevalence districts in India. A large proportion of the girls also marry at early age in the district and negative pregnancy outcomes among the HIV positive women likely to have large pregnancy wastages. Therefore, this study examined the pregnancy wastages and the associated factors among HIV positive women in a high prevalent district in India. We used data from a cross-sectional survey conducted recently among randomly selected currently married HIV positive women, 15-29 years of age, in one of the high HIV prevalence districts in India. The study used the experience of reported pregnancy wastage as an outcome variable, and both bi-variate and multivariate logistic regression analyses were carried out to understand the factors associated with the pregnancy wastage among HIV infected women. Overall, 17% of the respondents reported pregnancy wastage, of which 81% were due to spontaneous abortions. Respondents who became pregnant since testing HIV positive reported significantly higher level of pregnancy wastage as compared to those were pregnant before they were tested for HIV. (AOR = 1.9; p = 0.00). While a positive association between duration of marriage and pregnancy wastage was noticed (AOR = 7.4; p = 0.01), there was a negative association between number of living children and pregnancy wastage (AOR = 0.24; p = 0.00). Living in a joint family was associated with increased reporting of pregnancy wastage as compared to those living in nuclear families (AOR = 1.7; p = 0.03). HIV prevention and care programs need to consider the reproductive health needs of HIV infected married women as a priority area since large proportion of these women reported negative pregnancy outcomes. There is also a need to explore ways to raise the age at marriage in order to stop women getting married before the legal age at marriage.
Urban-rural variations in air quality and health impacts in northern India
NASA Astrophysics Data System (ADS)
Karambelas, A. N.; Holloway, T.; Fiore, A. M.; Kinney, P.; DeFries, R. S.; Kiesewetter, G.; Heyes, C.
2017-12-01
Ambient air pollution in India is a severe problem, contributing to negative health impacts and early death. Ground-based monitors often used to quantify health impacts are often located in urban regions, however approximately 70% of India's population resides in rural areas. We use high-resolution concentrations from the regional Community Multi-scale Air Quality (CMAQ) model over densely-populated northern India to estimate air quality and health impacts due to anthropogenic emission sectors separately for urban and rural regions. Modeled concentrations inform relative risk calculations and exposure estimates as performed in the Global Burden of Disease. Anthropogenic emissions from the International Institute for Applied Systems Analysis (IIASA) Greenhouse Gas-Air Pollution Interactions and Synergies (GAINS) model following version 5a of the Evaluating the Climate and Air Quality Impacts of Short-Lived Pollutants project gridding structure are updated to reflect urban- and rural-specific activity information for transportation and residential combustion, and industrial and electrical generating unit location and magnitude information. We estimate 314,000 (95% Confidence Interval: 304,000—323,000) and 58,000 (CI: 39,000—70,000) adults (25 years or older) die prematurely each year from PM2.5 and O3 respectively in northern India, with the greatest impacts along the Indo-Gangetic Plain. Using urban and rural population distributions, we estimate that the majority of premature deaths resulting from PM2.5 and O3 are in rural (292,000) as opposed to urban (79,000) regions. These findings indicate the need for designing monitoring networks and ground-based health studies in rural areas of India to more accurately quantify the true health implications of ambient air pollution, in addition to supporting model evaluation. Using this urban-versus-rural emissions framework, we are assessing anthropogenic contributions to regional air quality and health impacts, and examining mitigation strategies to reduce anthropogenic emissions, improve air quality, and reduce PM2.5 and O3 attributable premature death in the near-term.
A brief and critical review on hydrofluorosis in diverse species of domestic animals in India.
Choubisa, Shanti Lal
2018-02-01
India is one of the fluoride-endemic countries where the maximum numbers of ground or drinking water sources are naturally fluoridated. In India, a total of 23, out of 36 states and union territories have drinking water contaminated with fluoride in varying concentration. In the present scenario, especially in rural India, besides the surface waters (perennial ponds, dams, rivers, etc.), bore wells and hand pumps are the principal drinking water sources for domestic animals such as cattle (Bos taurus), water buffaloes (Bubalus bubalis), sheep (Ovis aries), goats (Capra hircus), horses (Equus caballus), donkeys (Equus asinus) and dromedary camels (Camelus dromedarius). Out of 23 states, 17 states, namely Andhra Pradesh, Assam, Bihar, Chhattisgarh, Gujarat, Haryana, Jharkhand, Karnataka, Kerala, Madhya Pradesh, Maharashtra, Odisha (Orissa), Punjab, Rajasthan, Telangana, Uttar Pradesh and West Bengal, have fluoride beyond the maximum permissible limit of 1.0 or 1.5 ppm in drinking water. This situation is a great concern for the animal health because fluoride is a slow toxicant and causes chronic diverse serious health hazards or toxic effects. Despite the fact that domestic animals are the basic income sources in rural areas and possess a significant contributory role not only in the agriculture sector but also in the strengthening of economy as well as in sustainable development of the country, research work on chronic fluoride intoxication (hydrofluorosis) due to drinking of fluoridated water in domestic animals rearing in various fluoride-endemic states is not enough as compared to work done in humans. However, some interesting and excellent research works conducted on different aspects of hydrofluorosis in domesticated animals rearing in different states are briefly and critically reviewed in the present communication. Author believes that this review paper not only will be more useful for researchers to do some more advance research work on fluoride-induced toxicosis in different species of animals but will also be helpful in the making of health policy for domestic animals at state and national level for the mitigation of hydrofluorosis in India.
Kai, Lee Jun; Raju, Kalyani; Malligere Lingaiah, Harendra Kumar; Mariyappa, Narayanaswamy
2013-01-01
To assess the significance of social factors as risk factors for carcinoma cervix and to determine the significance of blood group to prevalence of carcinoma cervix in a semi-urban population of Kolar, Karnataka, India. One hundred cases of carcinoma cervix were included in the study, along with 200 females of the same ages considered as controls. Case details were collected from the hospital record section regarding social factors and blood groups and the data were analyzed by descriptive statistical methods. Blood group B showed the highest number of cases (55 cases) followed by blood group O (29 cases) in carcinoma cervix which was statistically significant (p<0.001). Age of marriage between 11 to 20 years showed highest number of carcinoma cervix cases (77 cases) and this also was statistically significant (p<0.001). Patients with rural background were 75 (p=0.112, odds ratio: 1.54), parity of more than or equal to two constituted 96 cases (p=0.006, odds ratio: 4.07) and Hindu patients were 95 in number (p=0.220, odds ratio: 1.89). Blood group B and age of marriage between 11 and 20 years were significantly associated with carcinoma cervix in our population. Region of residence, parity and religion presented with a altered risk for carcinoma cervix.
Hundekari, I A; Suryakar, A N; Rathi, D B
2013-03-01
Pesticide poisoning is an important cause of morbidity and mortality in India. To assess the oxidative damage, hemoglobin level and leukocyte count in acute organophosphorus pesticide poisoning. Plasma cholinesterase was assessed as a toxicity marker. Oxidative damage was assessed by estimating serum malondialdehyde (MDA) levels, plasma total antioxidant capacity (TAC), erythrocyte superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) levels. Progressive and significant decline (p< 0.001) in plasma cholinesterase in correlation with the severity of organophosphorus poisoning was observed. Serum MDA levels significantly increased (p< 0.001) in all grades of organophosphorus poisoning cases as compared to controls. Erythrocyte SOD, CAT and GPx were significantly increased (p< 0.05) in earlier grade and (p< 0.001) in later grades of organophosphorus poisoning cases as compared to controls. While plasma TAC (p<0.001) was significantly decreased in all grades of organophosphorus poisoning cases as compared to controls. Leucocytosis observed in these cases signifies the activation of defense mechanism which could be a positive response for survival. Organophosphorus compounds inhibit cholinesterase action leading to cholinergic hyperactivity. Increased MDA level may lead to peroxidative damages deteriorating the structural and functional integrity of neuronal membrane. Increased erythrocyte SOD, CAT and GPx activities suggest an adaptive measure to tackle the pesticide accumulation. Hence it is concluded that cholinesterase inhibition may initiate cellular dysfunction leading to acetylcholine induced oxidative damage.
An exploratory comparison of name generator content: Data from rural India
Shakya, Holly B.; Christakis, Nicholas A.; Fowler, James H.
2017-01-01
Since the 1970s sociologists have explored the best means for measuring social networks, although few name generator analyses have used sociocentric data or data from developing countries, partly because sociocentric studies in developing countries have been scant. Here, we analyze 12 different name generators used in a sociocentric network study conducted in 75 villages in rural Karnataka, India. Having unusual sociocentric data from a non-Western context allowed us to extend previous name generator research through the unique analyses of network structural measures, an extensive consideration of homophily, and investigation of status difference between egos and alters. We found that domestic interaction questions generated networks that were highly clustered and highly centralized. Similarity between respondents and their nominated contacts was strongest for gender, caste, and religion. We also found that domestic interaction name generators yielded the most homogeneous ties, while advice questions yielded the most heterogeneous. Participants were generally more likely to nominate those of higher social status, although certain questions, such as who participants talk to uncovered more egalitarian relationships, while other name generators elicited the names of social contacts distinctly higher or lower in status than the respondent. Some questions also seemed to uncover networks that were specific to the cultural context, suggesting that network researchers should balance local relevance with global generalizability when choosing name generators. PMID:28845086
Somaraj, Vinej; Shenoy, Rekha P; Panchmal, Ganesh Shenoy; Jodalli, Praveen S; Sonde, Laxminarayan; Karkal, Ravichandra
2017-01-01
This cross-sectional study aimed to assess the knowledge, attitude and anxiety pertaining to basic life support (BLS) and medical emergencies among interns in dental colleges of Mangalore city, Karnataka, India. The study subjects comprised of interns who volunteered from the four dental colleges. The knowledge and attitude of interns were assessed using a 30-item questionnaire prepared based on the Basic Life Support Manual from American Heart Association and the anxiety of interns pertaining to BLS and medical emergencies were assessed using a State-Trait Anxiety Inventory (STAI) Questionnaire. Chi-square test was performed on SPSS 21.0 (IBM Statistics, 2012) to determine statistically significant differences ( P <0.05) between assessed knowledge and anxiety. Out of 183 interns, 39.89% had below average knowledge. A total of 123 (67.21%) reported unavailability of professional training. The majority (180, 98.36%) felt the urgent need of training in basic life support procedures. Assessment of stress showed a total of 27.1% participants to be above high-stress level. Comparison of assessed knowledge and stress was found to be insignificant ( P =0.983). There was an evident lack of knowledge pertaining to the management of medical emergencies among the interns. As oral health care providers moving out to the society, a focus should be placed on the training of dental interns with respect to Basic Life Support procedures.
Wirth, Kathleen E.; Tchetgen Tchetgen, Eric J.; Silverman, Jay G.; Murray, Megan B.
2013-01-01
Studies have documented the substantial risk of human immunodeficiency virus (HIV) infection endured by sex-trafficked women, but it remains unclear how exposure to trafficking puts its victims at risk. We assessed whether the association between sex trafficking and HIV could be explained by self-reported forced prostitution or young age at entry into prostitution using cross-sectional data collected from 1,814 adult female sex workers in Karnataka, India, between August 2005 and August 2006. Marginal structural logistic regression was used to estimate adjusted odds ratios for HIV infection. Overall, 372 (21%) women met 1 or both criteria used to define sex trafficking: 278 (16%) began sex work before age 18 years, and 107 (5%) reported being forcibly prostituted. Thirteen (0.7%) met both criteria. Forcibly prostituted women were more likely to be HIV-infected than were women who joined the industry voluntarily, independent of age at entering prostitution (odds ratio = 2.30, 95% confidence interval: 1.08, 4.90). Conversely, after adjustment for forced prostitution and other confounders, no association between age at entry into prostitution and HIV was observed. The association between forced prostitution and HIV infection became stronger in the presence of sexual violence (odds ratio = 11.13, 95% confidence interval: 2.41, 51.40). These findings indicate that forced prostitution coupled with sexual violence probably explains the association between sex trafficking and HIV. PMID:23324332
Outcomes of antiretroviral therapy in a northern Indian urban clinic
Dhooria, Sahajal; Prasad, KT; George, Ninoo; Ranjan, Sanjay; Gupta, Deepak; Sreenivas, Vishnubhatla; Kadhiravan, Tamilarasu; Miglani, Sunita; Sinha, Sanjeev; Wig, Naveet; Biswas, Ashutosh; Vajpayee, Madhu
2010-01-01
Abstract Problem Antiretroviral therapy (ART) programmes have been successful in several countries. However, whether they would succeed as part of a national programme in a resource-constrained setting such as India is not clear. The outcomes and specific problems encountered in such a setting have not been adequately studied. Approach We assessed the efficacy and functioning of India’s national ART programme in a tertiary care centre in northern India. All ART-naive patients started on ART between May 2005 and October 2006 were included in the study and were followed until 31 April 2008. Periodic clinical and laboratory evaluations were carried out in accordance with national guidelines. Changes in CD4+ lymphocyte count, body weight and body mass index were assessed at follow-up, and the operational problems analysed. Local setting The setting was a tertiary care centre in northern India with a mixed population of patients, mostly of low socioeconomic status. The centre is reasonably well resourced but faces constraints in health-care delivery, such as lack of adequate human resources and a high patient load. Relevant changes The response to ART in the cohort studied was comparable to that reported from other countries. However, the programme had a high attrition rate, possibly due to patient-related factors and operational constraints. Lessons learnt A high rate of attrition can affect the overall efficacy and functioning of an ART programme. Addressing the issues causing attrition might improve patient outcomes in India and in other resource-constrained countries. PMID:20428391
Mahapatra, Bidhubhusan; Battala, Madhusudana; Porwal, Akash; Saggurti, Niranjan
2014-01-01
One of the indicators critical to the success of violence reduction programmes among female sex workers (FSWs) is the pattern of disclosure of violence. This study examines the rate of non-disclosure of violence among FSWs in India by perpetrators of violence and programme exposure. Data were drawn from a cross-sectional study conducted among FSWs in 2009 across four states of India: Andhra Pradesh, Karnataka, Maharashtra and Tamil Nadu. The analytical sample included 1341 FSWs who experienced physical violence in past six months. Multilevel logistic regression stratified by state was conducted to examine predictors of non-disclosure. About 54% of FSWs did not disclose their experience of violence to anyone with considerable variations in the pattern of disclosure across states. Another 36% of FSWs shared the experience with NGO worker/peer. Compared to violence perpetrated by paying partners/stranger, that by non-paying partner were twice more likely to report non-disclosure (53% vs. 68%, Adjusted Odds Ratio [AOR]: 1.8, 95% Confidence Interval [CI]: 1.3-2.4). Similarly, FSWs who were not registered with an NGO/sex worker collective were 40% more likely to report non-disclosure of violence against those registered (58% vs. 53%, AOR: 1.4, 95% CI: 1.1-1.9). Non-disclosure of physical violence is quite high among FSWs which can be a barrier to the success of violence reduction efforts. Immediate efforts are required to understand the reasons behind non-disclosure based on which interventions can be developed. Community collectivisation and designing gender-based interventions with the involvement of non-paying partners should be the way forward.
Verma, Anand; Shetty, Bharatesh K; Guddattu, Vasudeva; Chourasia, Mehul K; Pundir, Prachi
2017-04-04
Fluorosis, caused by ingestion of excessive amount of fluoride through food or water, is a major public health problem in India. This study was undertaken to quantify the dental fluorosis burden among school going adolescents and to find factors associated with dental fluorosis in Kolar taluka, Karnataka, India. A total of 1026 high school adolescents (12-17 years) were enrolled from different schools selected by stratified sampling method. Dental examination was done to record Dean's fluorosis index, and socio-demographic, food consumption and oral hygiene data were recorded using a pre-tested structured questionnaire. Fluoride content was measured using Orion apparatus, and Community Fluorosis Index (CFI) was calculated from drinking water samples from various drinking sources. Multivariable analysis with generalized estimating equation (GEE) regression model was used to explore the factors associated with dental fluorosis. Among 1026 enrolled students, 64.3% of adolescents were detected with dental fluorosis; more than 50% had either severe or moderate fluorosis according to the Dean's Fluorosis Index and Community Fluorosis Index (CFI). The majority of affected students were from government schools. The significantly associated factors with dental fluorosis were living in study area for more than 5 years and studying in government school. A strong positive correlation between the amount of fluoride content in drinking water sample collected and CFI was observed (rho = 0.570). Prevalence of dental fluorosis was considerably high, affecting nearly two-thirds of the students, and mainly in government schools and long-term residents of the area. Health education and community awareness for preventing fluorosis, apart from setting-up defluoridation plants or training for home based defluoridation techniques in study villages, should be considered.
Determinants of anemia among young children in rural India.
Pasricha, Sant-Rayn; Black, James; Muthayya, Sumithra; Shet, Anita; Bhat, Vijay; Nagaraj, Savitha; Prashanth, N S; Sudarshan, H; Biggs, Beverley-Ann; Shet, Arun S
2010-07-01
More than 75% of Indian toddlers are anemic. Data on factors associated with anemia in India are limited. The objective of this study was to determine biological, nutritional, and socioeconomic risk factors for anemia in this vulnerable age group. We conducted a cross-sectional study of children aged 12 to 23 months in 2 rural districts of Karnataka, India. Children were excluded if they were unwell or had received a blood transfusion. Hemoglobin, ferritin, folate, vitamin B(12), retinol-binding protein, and C-reactive protein (CRP) levels were determined. Children were also tested for hemoglobinopathy, malaria infection, and hookworm infestation. Anthropometric measurements, nutritional intake, family wealth, and food security were recorded. In addition, maternal hemoglobin level was measured. Anemia (hemoglobin level < 11.0 g/dL) was detected in 75.3% of the 401 children sampled. Anemia was associated with iron deficiency (low ferritin level), maternal anemia, and food insecurity. Children's ferritin levels were directly associated with their iron intake and CRP levels and with maternal hemoglobin level and inversely associated with continued breastfeeding and the child's energy intake. A multivariate model for the child's hemoglobin level revealed associations with log(ferritin level) (coefficient: 1.20; P < .001), folate level (0.05; P < .01), maternal hemoglobin level (0.16; P < .001), family wealth index (0.02; P < .05), child's age (0.05 per month; P < .005), hemoglobinopathy (-1.51; P < .001), CRP level (-0.18; P < .001), and male gender (-0.38; P < .05). Wealth index and food insecurity could be interchanged in this model. Hemoglobin level was primarily associated with iron status in these Indian toddlers; however, maternal hemoglobin level, family wealth, and food insecurity were also important factors. Strategies for minimizing childhood anemia must include optimized iron intake but should simultaneously address maternal anemia, poverty, and food insecurity.
Mahapatra, Bidhubhusan; Battala, Madhusudana; Porwal, Akash; Saggurti, Niranjan
2014-01-01
Objective One of the indicators critical to the success of violence reduction programmes among female sex workers (FSWs) is the pattern of disclosure of violence. This study examines the rate of non-disclosure of violence among FSWs in India by perpetrators of violence and programme exposure. Methods Data were drawn from a cross-sectional study conducted among FSWs in 2009 across four states of India: Andhra Pradesh, Karnataka, Maharashtra and Tamil Nadu. The analytical sample included 1341 FSWs who experienced physical violence in past six months. Multilevel logistic regression stratified by state was conducted to examine predictors of non-disclosure. Results About 54% of FSWs did not disclose their experience of violence to anyone with considerable variations in the pattern of disclosure across states. Another 36% of FSWs shared the experience with NGO worker/peer. Compared to violence perpetrated by paying partners/stranger, that by non-paying partner were twice more likely to report non-disclosure (53% vs. 68%, Adjusted Odds Ratio [AOR]: 1.8, 95% Confidence Interval [CI]: 1.3–2.4). Similarly, FSWs who were not registered with an NGO/sex worker collective were 40% more likely to report non-disclosure of violence against those registered (58% vs. 53%, AOR: 1.4, 95% CI: 1.1–1.9). Conclusions Non-disclosure of physical violence is quite high among FSWs which can be a barrier to the success of violence reduction efforts. Immediate efforts are required to understand the reasons behind non-disclosure based on which interventions can be developed. Community collectivisation and designing gender-based interventions with the involvement of non-paying partners should be the way forward. PMID:24846145
Revadekar, J V; Varikoden, Hamza; Murumkar, P K; Ahmed, S A
2018-02-01
The Western Ghats (WG) of India are basically north-south oriented mountains having narrow zonal width with a steep rising western face. The summer monsoon winds during June to September passing over the Arabian Sea are obstructed by the WG and thus orographically uplift to produce moderate-to-heavy precipitation over the region. However, it is seen that characteristic features of rainfall distribution during the season vary from north to south. Also its correlation with all-India summer monsoon rainfall increases from south to north. In the present study, an attempt is also made to examine long-term as well as short-term trends and variability in summer monsoon rainfall over different subdivisions of WG using monthly rainfall data for the period 1871-2014. Konkan & Goa and Coastal Karnataka show increase in rainfall from 1871 to 2014 in all individual summer monsoon months. Short-term trend analysis based on 31-year sliding window indicates that the trends are not monotonous, but has epochal behavior. In recent epoch, magnitudes of negative trends are consistently decreasing and have changed its sign to positive during 1985-2014. It has been observed that Indian Ocean Dipole (IOD) plays a dominant positive role in rainfall over entire WG in all summer monsoon months, whereas role of Nino regions are asymmetric over WG rainfall. Indian summer monsoon is known for its negative relationship with Nino SST. Negative correlations are also seen for WG rainfall with Nino regions but only during onset and withdrawal phase. During peak monsoon months July and August subdivisions of WG mostly show positive correlation with Nino SST. Copyright © 2017 Elsevier B.V. All rights reserved.
Factors affecting 30-month survival in lung cancer patients.
Mahesh, P A; Archana, S; Jayaraj, B S; Patil, Shekar; Chaya, S K; Shashidhar, H P; Sunitha, B S; Prabhakar, A K
2012-10-01
Age adjusted incidence rate of lung cancer in India ranges from 7.4 to 13.1 per 100,000 among males and 3.9 to 5.8 per 100,000 among females. The factors affecting survival in lung cancer patients in India are not fully understood. The current study was undertaken to evaluate the factors affecting survival in patients diagnosed with lung cancer attending a tertiary care cancer institute in Bangalore, Karnataka, India. Consecutive patients with primary lung cancer attending Bangalore Institute of Oncology, a tertiary care centre at Bangalore, between 2006 and 2009 were included. Demographic, clinical, radiological data were collected retrospectively from the medical records. A total of 170 consecutive subjects (128 males, 42 females) diagnosed to have lung cancer; 151 non-small cell lung cancer (NSCLC) and 19 small cell lung cancer (SCLC) were included. A higher proportion of never-smokers (54.1%) were observed, mostly presenting below the age of 60 yr. Most subjects were in stage IV and III at the time of diagnosis. More than 50 per cent of patients presented with late stage lung cancer even though the duration of symptoms is less than 2 months. The 30-month overall survival rates for smokers and never-smokers were 32 and 49 per cent, respectively. No significant differences were observed in 30 month survival based on age at presentation, gender and type of lung cancer. Cox proportional hazards model identified never-smokers and duration of symptoms less than 1 month as factors adversely affecting survival. Our results showed that lung cancer in Indians involved younger subjects and associated with poorer survival as compared to other ethnic population. Studies on large sample need to be done to evaluate risk factors in lung cancer patients.
Factors affecting 30-month survival in lung cancer patients
Mahesh, P.A.; Archana, S.; Jayaraj, B.S.; Patil, Shekar; Chaya, S.K.; Shashidhar, H.P.; Sunitha, B.S.; Prabhakar, A.K.
2012-01-01
Background & objectives: Age adjusted incidence rate of lung cancer in India ranges from 7.4 to 13.1 per 100,000 among males and 3.9 to 5.8 per 100,000 among females. The factors affecting survival in lung cancer patients in India are not fully understood. The current study was undertaken to evaluate the factors affecting survival in patients diagnosed with lung cancer attending a tertiary care cancer institute in Bangalore, Karnataka, India. Methods: Consecutive patients with primary lung cancer attending Bangalore Institute of Oncology, a tertiary care centre at Bangalore, between 2006 and 2009 were included. Demographic, clinical, radiological data were collected retrospectively from the medical records. Results: A total of 170 consecutive subjects (128 males, 42 females) diagnosed to have lung cancer; 151 non-small cell lung cancer (NSCLC) and 19 small cell lung cancer (SCLC) were included. A higher proportion of never-smokers (54.1%) were observed, mostly presenting below the age of 60 yr. Most subjects were in stage IV and III at the time of diagnosis. More than 50 per cent of patients presented with late stage lung cancer even though the duration of symptoms is less than 2 months. The 30-month overall survival rates for smokers and never-smokers were 32 and 49 per cent, respectively. No significant differences were observed in 30 month survival based on age at presentation, gender and type of lung cancer. Cox proportional hazards model identified never-smokers and duration of symptoms less than 1 month as factors adversely affecting survival. Interpretation & conclusions: Our results showed that lung cancer in Indians involved younger subjects and associated with poorer survival as compared to other ethnic population. Studies on large sample need to be done to evaluate risk factors in lung cancer patients. PMID:23168702
Kalal, B S; Puranik, P; Nagaraj, S; Rego, S; Shet, A
2016-01-01
Rickettsial infections are re-emerging. In India, they are now being reported from several areas where they were previously unknown. The objective of this study was to describe the epidemiology, clinical profile and outcome of serologically-confirmed scrub typhus and spotted fever among children in a tertiary care hospital in Bengaluru. Hospitalised children aged <18 years, with clinical features suggestive of rickettsial disease admitted between January 2010 and October 2012 were included prospectively. Diagnosis was based on scrub typhus and spotted fever-specific IgM and IgG by enzyme-linked immunosorbent assay (ELISA). Of 103 children with clinical features suggestive of rickettsial illness, ELISA test confirmed 53 cases for scrub typhus, 23 cases for spotted fever group and 14 with mixed infection. The average age was 7.3 (±3.9) years and 44 (71.0%) children were male. Majority of cases were from Karnataka (50%), Andhra Pradesh (32.3%) and Tamil Nadu (17.7%). Common clinical features included fever (100%, average duration 11 days), nausea and vomiting (44%), rash (36%); eschar was rare. Compared to the ELISA test, Weil-Felix test (OX-K titre of 1:80) had a sensitivity and specificity of 88.7% and 43.9%, respectively. Treatment with chloramphenicol or doxycycline was given to the majority of the children. Complications included meningoencephalitis (28%), shock (10%), retinal vasculitis (10%) and purpura fulminans (7%). These findings suggest that the burden of rickettsial infection among children in India is high, with a substantially high complication rate. Rickettsial-specific ELISA tests can help in early diagnosis and early institution of appropriate treatment that may prevent life-threatening complications.
Athreya, Vidya; Srivathsa, Arjun; Puri, Mahi; Karanth, Krithi K.; Kumar, N. Samba; Karanth, K. Ullas
2015-01-01
There is increasing evidence of large carnivore presence outside protected areas, globally. Although this spells conservation success through population recoveries, it makes carnivore persistence in human-use landscapes tenuous. The widespread distribution of leopards in certain regions of India typifies this problem. We obtained information on leopard-human interactions at a regional scale in Karnataka State, India, based on systematic surveys of local media reports. We applied an innovative occupancy modelling approach to map their distribution patterns and identify hotspots of livestock/human depredation. We also evaluated management responses like removals of ‘problem’ leopards through capture and translocations. Leopards occupied around 84,000 km2 or 47% of the State’s geographic area, outside designated national parks and wildlife sanctuaries. Their presence was facilitated by extent of vegetative cover- including irrigated croplands, rocky escarpments, and prey base in the form of feral and free-ranging dogs. Higher probabilities of livestock/human attacks by leopards were associated with similar ecological features as well as with capture/removals of leopards. Of the 56 cases of leopard removals reported, 91% did not involve human attacks, but followed livestock predation or only leopard sightings. The lack of knowledge on leopard ecology in human-use areas has resulted in unscientific interventions, which could aggravate the problem rather than mitigating it. Our results establish the presence of resident, breeding leopards in human-use areas. We therefore propose a shift in management focus, from current reactive practices like removal and translocation of leopards, to proactive measures that ensure safety of human lives and livelihoods. PMID:26556229
Mobile phones: the next step towards healthcare delivery in rural India?
DeSouza, Sherwin I; Rashmi, M R; Vasanthi, Agalya P; Joseph, Suchitha Maria; Rodrigues, Rashmi
2014-01-01
Given the ubiquity of mobile phones, their use to support healthcare in the Indian context is inevitable. It is however necessary to assess end-user perceptions regarding mobile health interventions especially in the rural Indian context prior to its use in healthcare. This would contextualize the use of mobile phone communication for health to 70% of the country's population that resides in rural India. To explore the acceptability of delivering healthcare interventions through mobile phones among users in a village in rural Bangalore. This was an exploratory study of 488 mobile phone users, residing in a village, near Bangalore city, Karnataka, South India. A pretested, translated, interviewer-administered questionnaire was used to obtain data on mobile phone usage patterns and acceptability of the mobile phone, as a tool for health-related communication. The data is described using basic statistical measures. The primary use of mobile phones was to make or receive phone calls (100%). Text messaging (SMS) was used by only 70 (14%) of the respondents. Most of the respondents, 484 (99%), were willing to receive health-related information on their mobile phones and did not consider receiving such information, an intrusion into their personal life. While receiving reminders for drug adherence was acceptable to most 479 (98%) of our respondents, 424 (89%) preferred voice calls alone to other forms of communication. Nearly all were willing to use their mobile phones to communicate with health personnel in emergencies and 367 (75%) were willing to consult a doctor via the phone in an acute illness. Factors such as sex, English literacy, employment status, and presence of chronic disease affected preferences regarding mode and content of communication. The mobile phone, as a tool for receiving health information and supporting healthcare through mHealth interventions was acceptable in the rural Indian context.
Skill Upgrading within Informal Training: Lessons from the Indian Auto Mechanic
ERIC Educational Resources Information Center
Barber, Jamie
2004-01-01
Informal training is known to be the dominant skill acquisition strategy for the majority of workers in India and many other economically developing countries and there is much benefit in understanding the strengths and weaknesses of this form of training. A participant observation case study was undertaken in northern India to investigate these…
The Dowry System in Northern India: Women's Attitudes and Social Change
ERIC Educational Resources Information Center
Srinivasan, Padma; Lee, Gary R.
2004-01-01
In spite of modernization and women's increasing role in the market economy, the practice of the dowry in India is becoming more widespread, and the value of dowries is increasing. There are many well-documented adverse consequences of the dowry system, particularly for women. This is a study of attitudes toward the dowry system among married…
Exploring the relationship between meteorology and surface PM2.5 in Northern India
NASA Astrophysics Data System (ADS)
Schnell, J.; Naik, V.; Horowitz, L. W.; Paulot, F.; Ginoux, P. A.
2017-12-01
Northern India is one of the most polluted and densely populated regions in world. Accurately modeling pollution in the region is difficult due to the extreme conditions with respect to emissions, meteorology, and topography, but it is paramount in order to understand how future changes in emissions and climate may alter the region's pollution regime. We evaluate a developmental version of the new-generation NOAA GFDL Atmospheric Model, version 4 (AM4) in its ability to simulate observed wintertime PM2.5 and its relationship to meteorology over the Northern India (23°N-31°N, 68°E-90°E). We perform two simulations of the GFDL-AM4 nudged to observed meteorology for the period (1980-2016) with two emission inventories developed for CMIP5 and CMIP6 and compare results with observations from India's Central Pollution Control Board (CPCB) for the period 1 October 2015 - 31 March 2016. Overall, our results indicate that the simulation with CMIP6 emissions has substantially reduced the low model bias in the region. The AM4, albeit biased low, generally simulates the magnitude and daily variability in observed total PM2.5. Ammonium nitrate and ammonium sulfate are the primary components of PM2.5 in the model, and although not directly observed, correlations of total observed PM2.5 and meteorology with the modeled individual PM2.5 components suggest the same for the observations. The model correctly reproduces the shape and magnitude of the seasonal cycle of PM2.5; but for the diurnal cycle, it misses the early evening rise and secondary maximum found in the observations. Observed PM2.5 abundances within the densely populated Indo-Gangetic Plain are by far the highest and are closely related to boundary layer meteorology, specifically relative humidity, wind speed, boundary layer height, and inversion strength. The GFDL-AM4 reproduces the observed pollution gradient over Northern India as well as the strength of the meteorology-PM2.5 relationship in most locations.
Sinha, Anju; Nath, Anita; Sethumadhavan, Rajeev; Isac, Shajy; Washington, Reynold
2016-05-26
Pediatric HIV is poised to become a major public health problem in India with the rising trend of HIV infection in pregnant women (Department of AIDS Control, Ministry of Health and Family Welfare, http://www.naco.gov.in). There is lack of information on the epidemiology of pediatric HIV infection in India. Existing surveillance systems tend to underestimate the Pediatric burden. The overall aim of the present study is to estimate the disease burden of pediatric HIV among children in Belgaum district in the state of Karnataka in Southern India. An innovative multipronged epidemiological approach to comb the district is proposed. The primary objectives of the study would be attained under three strategies. A prospective cohort design for objective (i) to determine the incidence rate of HIV by early case detection in infants and toddlers (0-18 months) born to HIV infected pregnant women; and cross sectional design for objectives (ii) to determine the prevalence of HIV infection in children (0-14 years) of HIV infected parents and (iii) to determine the prevalence of HIV in sick children (0-14 years) presenting with suspected signs and symptoms using age specific criteria for screening. Burden of pediatric HIV will be calculated as a product of cases detected in each strategy multiplied by a net inflation factor for each strategy. Study participants (i) (ii) (iii): HIV infected pregnant women and their live born children (ii) Any HIV-infected man/woman, of age 18-49 years, having a biological child of age 0-14 years (iii) Sick children of age 0-14 years presenting with suspected signs and symptoms and satisfying age-specific criteria for screening. Setting and conduct: Belgaum district which is a Category 'A' district (with more than 1 % antenatal prevalence in the district over the last 3 years before the study). Age-appropriate testing is used to detect HIV infection. There is a need to strengthen existing pediatric HIV estimation methods in India and other developing countries. We hope that the novel methodology emanating from this study would be applicable for estimating the burden of HIV in other settings and it would be adaptable for estimating the burden of other infectious/chronic diseases. Findings from this study will give future direction to the national program for prevention and control of HIV in India and other developing countries.
Seenivasan, Subbiah; Anderson, Todd Alan; Muraleedharan, Narayanannair
2016-07-01
Soils contaminated with heavy metals may pose a threat to environment and human health if metals enter the food chain over and above threshold levels. In general, there is a lack of information on the presence of heavy metals in tea [Camellia sinensis (L). O. Kuntze] plants and the soils in which they are grown. Therefore, an attempt was made to establish a database on the important heavy metals: cadmium (Cd), chromium (Cr), nickel (Ni), and lead (Pb). For an initial survey on heavy metals, soil samples were collected randomly from tea-growing areas of Tamil Nadu, Kerala, and Karnataka, India. Parallel studies were conducted in the greenhouse on uptake of Pb, Cd, and Ni from soils supplemented with these metals at different concentrations. Finally, metal distribution in the tea plants under field conditions was also documented to assess the accumulation potential and critical limit of uptake by plants.
Fish diversity and its conservation in major wetlands of Mysore.
Prasad, A G Devi; Venkataramana, G V; Thomas, Mathew
2009-09-01
The paper highlights the fish diversity in major wetlands of Mysore district, Karnataka, India and its conservation status. Forty-five species of fishes belonging to 15 families, 31 genera have been identified. Fish species belonging to genus Puntius were more common in many of these lakes. However it was observed that the fish diversity was decreasing since last two years unprecedently mainly due to manifold human activities. Fish diversity in the lakes is becoming rare and about seven species were identified as endangered. Out of the 45 identified fishes, six fish species were identified as threatened species. Tork hudree, also known as Deccan mahseer and seven other species were identified as vulnerable fish species. Though there were 40 species of fish endemic to this region, their number decreased with introduction of more exotic species. Conservation of endemic fishes, propagation of endangered and threatened fishes should be therefore, undertaken to preserve and protect fish diversity in the wetlands of Mysore district.
Raghavendra, N R; Reddy, R Purushottam; Nijagunappa, R
2011-01-01
The geochemical data is much widely used in establishing the overall chemical relation existing between the different rock types with their parentage. A major impetus for this shift comes not only from the need to understand and quantify better the spatial and temporal evolution, with emphasis on the younger greenstone belts (Kallur copper formations), but also from the recognition that such knowledge could form the basis for the sustainable development of our natural resources. In addition, the recurrence of natural hazards has reinforced the need to learn more about the mechanics and to develop predictive modeling with advanced technical tools. This paper is emphasizing on Granodiorites of Kallur area of Manvi Taluk, Raichur District to substantiate the classical approaches of exploration and data gathering through quantitative methods of data processing and interpretation. The trilinear diagram indicates that the granites are rich in Potash and Soda. This clearly indicates that Granites are fairly rich in K2O than Na2O.
NASA Astrophysics Data System (ADS)
Sudheerkumar, K. H.; Dhananjaya, N.; Reddy Yadav, L. S.
2016-04-01
Silver nanoparticles (Ag NPs) synthesized from silver nitrate solutions using the esterase-containing latex of the E. Tirucalli plant widely found in a large region in Karnataka, India. Plant-mediated synthesis of nanoparticles is a green chemistry approach that intercom-nects nanotechnology and plant biotechnology. The effect of extract concentration, contact time, and temperature on the reaction rate and the shape of the Ag nanoparticles was investigated. The nanoparticles have been characterized by powder X-ray diffraction, UV-visible spectroscopy, photoluminescence spectroscopy and morphology by scanning electron microscope, transmission electron microscopy, as a function of the ratio of silver ions to reducing agent molecules. Powder X-ray diffraction patterns show that the crystal structure obtained is face-centered cubic (fcc). The morphology of the silver nanoparticle was uniform with well-distributed elliptical particles with a range from 15 to 25nm. Ag NPs exhibit significant antibacterial activity against Bacillus cereus using the agar well diffusion method.
46 CFR 42.30-20 - Seasonal Tropical Areas.
Code of Federal Regulations, 2014 CFR
2014-10-01
... BY SEA Zones, Areas, and Seasonal Periods § 42.30-20 Seasonal Tropical Areas. The following are... continent; on the south and east by the northern boundary of the Tropical Zone. (1) Seasonal periods... coasts of Pakistan and India; on the south by the northern boundary of the Tropical Zone. (1) Seasonal...
46 CFR 42.30-20 - Seasonal Tropical Areas.
Code of Federal Regulations, 2013 CFR
2013-10-01
... BY SEA Zones, Areas, and Seasonal Periods § 42.30-20 Seasonal Tropical Areas. The following are... continent; on the south and east by the northern boundary of the Tropical Zone. (1) Seasonal periods... coasts of Pakistan and India; on the south by the northern boundary of the Tropical Zone. (1) Seasonal...
46 CFR 42.30-20 - Seasonal Tropical Areas.
Code of Federal Regulations, 2012 CFR
2012-10-01
... BY SEA Zones, Areas, and Seasonal Periods § 42.30-20 Seasonal Tropical Areas. The following are... continent; on the south and east by the northern boundary of the Tropical Zone. (1) Seasonal periods... coasts of Pakistan and India; on the south by the northern boundary of the Tropical Zone. (1) Seasonal...
Ghosh, Rohini; Sharma, Arun Kumar
2012-01-01
A micro-level investigation of 983 pregnant women (aged 15-49 years) regarding sex determination and associated factors was carried out in a periurban region of Northern India. Among the women surveyed, 183 chose to use sex determination. The highest percentage of sex determination was among 30-39-year-old women, and general caste and family size were two risk factors associated with sex determination. Correcting imbalances in sex ratios at birth is a complex issue without easy answers, especially in patriarchal societies. Apart from raising awareness among decisionmakers, property rights in favor of women and strict vigilance and record of registration of ultrasound machines are necessary.
The first darter (Aves: Anhingidae) fossils from India (late Pliocene).
Stidham, Thomas; Patnaik, Rajeev; Krishan, Kewal; Singh, Bahadur; Ghosh, Abhik; Singla, Ankita; Kotla, Simran S
2017-01-01
New fossils from the latest Pliocene portion of the Tatrot Formation exposed in the Siwalik Hills of northern India represent the first fossil record of a darter (Anhingidae) from India. The darter fossils possibly represent a new species, but the limited information on the fossil record of this group restricts their taxonomic allocation. The Pliocene darter has a deep pit on the distal face of metatarsal trochlea IV not reported in other anhingids, it has an open groove for the m. flexor perforatus et perforans digiti II tendon on the hypotarsus unlike New World anhingid taxa, and these darter specimens are the youngest of the handful of Neogene records of the group from Asia. These fossil specimens begin to fill in a significant geographic and temporal gap in the fossil record of this group that is largely known from other continents and other time periods. The presence of a darter and pelican (along with crabs, fish, turtles, and crocodilians) in the same fossil-bearing horizon strongly indicates the past presence of a substantial water body (large pond, lake, or river) in the interior of northern India in the foothills of the Himalayan Mountains.
NASA Astrophysics Data System (ADS)
Yu, Wusheng; Tian, Lide; Yao, Tandong; Xu, Baiqing; Wei, Feili; Ma, Yaoming; Zhu, Haifeng; Luo, Lun; Qu, Dongmei
2017-11-01
This project reports results of the first precipitation stable isotope (δ18 O and δD) time series produced for Qamdo in the northern Hengduan Mountains in the southeastern Tibetan Plateau. The data showed that the fluctuations of precipitation stable isotopes at Qamdo during the different seasons revealed various moisture sources. The westerlies and local recycling moisture dominated at the study area before the pre-monsoon and after the post-monsoon seasons, which resulted in similar trends of both precipitation stable isotopes and temperature. The marine moisture was transported to the northern Hengduan Mountains by the winter India-Burma Trough combined with convection. Consequently, stable isotopes in subsequent precipitation were occasionally observed to decrease suddenly. However, δ18 O and δD values of precipitation at Qamdo were lower during the monsoon period and the duration of those low values was longer because of the effects of the Indian Summer Monsoon and the strengthening convection. Our findings indicate that the effects of seasonal precipitation differences caused by various climate systems, including the winter India-Burma Trough and Indian Summer Monsoon, need to be considered when attempting to interpret tree-ring and ice core records for the Hengduan Mountains.
Deering, Kathleen N; Boily, Marie-Claude; Lowndes, Catherine M; Shoveller, Jean; Tyndall, Mark W; Vickerman, Peter; Bradley, Jan; Gurav, Kaveri; Pickles, Michael; Moses, Stephen; Ramesh, Banadakoppa M; Washington, Reynold; Rajaram, S; Alary, Michel
2011-12-29
The Avahan Initiative, a large-scale HIV preventive intervention targeted to high-risk populations including female sex workers (FSWs), was initiated in 2003 in six high-prevalence states in India, including Karnataka. This study assessed if intervention exposure was associated with condom use with FSWs' sexual partners, including a dose-response relationship. Data were from a cross-sectional study (2006-07) of 775 FSWs in three districts in Karnataka. Survey methods accounted for the complex cluster sampling design. Bivariate and multivariable logistic regression was used to separately model the relationships between each of five intervention exposure variables and five outcomes for consistent condom use (CCU= always versus frequently/sometimes/never) with different sex partners, including with: all clients; occasional clients; most recent repeat client; most recent non-paying partner; and the husband or cohabiting partner. Linear tests for trends were conducted for three continuous intervention exposure variables. FSWs reported highest CCU with all clients (81.7%); CCU was lowest with FSWs' husband or cohabiting partner (9.6%). In multivariable analysis, the odds of CCU with all clients and with occasional clients were 6.3-fold [95% confidence intervals, CIs: 2.8-14.5] and 2.3-fold [95% CIs: 1.4-4.1] higher among FSWs contacted by intervention staff and 4.9-fold [95% CIs: 2.6-9.3] and 2.3-fold [95% CIs: 1.3-4.1] higher among those who ever observed a condom demonstration by staff, respectively, compared to those who had not. A significant dose-response relationship existed between each of these CCU outcomes and increased duration since first contacted by staff (P=0.001; P=0.006) and numbers of condom demonstrations witnessed (P=0.004; P=0.026); a dose-response relationship was also observed between condom use with all clients and number of times contacted by staff (P=0.047). Intervention exposure was not associated with higher odds of CCU with the most recent repeat client, most recent non-paying partner or with the husband or cohabiting partner. Study findings suggest that exposure to a large-scale HIV intervention for FSWs was associated with increased CCU with commercial clients. Moreover, there were dose-response relationships between CCU with clients and increased duration since first contacted by staff, times contacted by staff and number of condom demonstrations. Additional program effort is required to increase condom use with non-commercial partners.
2011-01-01
Background The Avahan Initiative, a large-scale HIV preventive intervention targeted to high-risk populations including female sex workers (FSWs), was initiated in 2003 in six high-prevalence states in India, including Karnataka. This study assessed if intervention exposure was associated with condom use with FSWs’ sexual partners, including a dose-response relationship. Methods Data were from a cross-sectional study (2006-07) of 775 FSWs in three districts in Karnataka. Survey methods accounted for the complex cluster sampling design. Bivariate and multivariable logistic regression was used to separately model the relationships between each of five intervention exposure variables and five outcomes for consistent condom use (CCU= always versus frequently/sometimes/never) with different sex partners, including with: all clients; occasional clients; most recent repeat client; most recent non-paying partner; and the husband or cohabiting partner. Linear tests for trends were conducted for three continuous intervention exposure variables. Results FSWs reported highest CCU with all clients (81.7%); CCU was lowest with FSWs’ husband or cohabiting partner (9.6%). In multivariable analysis, the odds of CCU with all clients and with occasional clients were 6.3-fold [95% confidence intervals, CIs: 2.8-14.5] and 2.3-fold [95% CIs: 1.4-4.1] higher among FSWs contacted by intervention staff and 4.9-fold [95% CIs: 2.6-9.3] and 2.3-fold [95% CIs: 1.3-4.1] higher among those who ever observed a condom demonstration by staff, respectively, compared to those who had not. A significant dose-response relationship existed between each of these CCU outcomes and increased duration since first contacted by staff (P=0.001; P=0.006) and numbers of condom demonstrations witnessed (P=0.004; P=0.026); a dose-response relationship was also observed between condom use with all clients and number of times contacted by staff (P=0.047). Intervention exposure was not associated with higher odds of CCU with the most recent repeat client, most recent non-paying partner or with the husband or cohabiting partner. Conclusion Study findings suggest that exposure to a large-scale HIV intervention for FSWs was associated with increased CCU with commercial clients. Moreover, there were dose-response relationships between CCU with clients and increased duration since first contacted by staff, times contacted by staff and number of condom demonstrations. Additional program effort is required to increase condom use with non-commercial partners. PMID:22375863
Local and remote impacts of aerosol species on Indian summer monsoon rainfall in a GCM
NASA Astrophysics Data System (ADS)
Turner, A. G.; Guo, L.; Highwood, E.
2016-12-01
The HadGEM2 AGCM is used to determine the most important anthropogenic aerosols in the Indian monsoon using experiments in which observed trends in individual aerosol species are imposed. Sulphur dioxide (SD) emissions are shown to impact rainfall more strongly than black carbon (BC) aerosols, causing reduced rainfall especially over northern India. Significant perturbations due to BC are not noted until its emissions are scaled up in a sensitivity test, resulting in rainfall increases over northern India due to the Elevated Heat Pump mechanism, enhancing convection during the premonsoon and bringing forward the monsoon onset. Secondly, the impact of anthropogenic aerosols is compared to that of increasing greenhouse-gas concentrations and observed sea-surface temperature (SST) warming. The tropospheric temperature gradient driving the monsoon shows weakening when forced by either SD or imposed SST trends. However the observed SST trend is dominated by warming in the deep tropics; when the component of SST trend related to aerosol emissions is removed, further warming is found in the extratropical northern hemisphere that tends to offset monsoon weakening. This suggests caution is needed when using SST forcing as a proxy for greenhouse warming. Finally, aerosol emissions are decomposed into those from the Indian region and those elsewhere, in pairs of experiments with SD and BC. Both local and remote aerosol emissions are found to lead to rainfall changes over India; for SD, remote aerosols contribute around 75% of the rainfall decrease over India, while for BC the remote forcing is even more dominant.
Local and remote impacts of aerosol species on Indian summer monsoon rainfall in a GCM
NASA Astrophysics Data System (ADS)
Guo, Liang; Turner, Andrew; Highwood, Eleanor
2016-04-01
The HadGEM2 AGCM is used to determine the most important anthropogenic aerosols in the Indian monsoon using experiments in which observed trends in individual aerosol species are imposed. Sulphur dioxide (SD) emissions are shown to impact rainfall more strongly than black carbon (BC) aerosols, causing reduced rainfall especially over northern India. Significant perturbations due to BC are not noted until its emissions are scaled up in a sensitivity test, in which rainfall increases over northern India as a result of the Elevated Heat Pump mechanism, enhancing convection during the pre-monsoon and bringing forward the monsoon onset. Secondly, the impact of anthropogenic aerosols is compared to that of increasing greenhouse-gas concentrations and observed sea-surface temperature (SST) warming. The tropospheric temperature gradient driving the monsoon shows weakening when forced by either SD or imposed SST trends. However the observed SST trend is dominated by warming in the deep tropics; when the component of SST trend related to aerosol emissions is removed, further warming is found in the extratropical northern hemisphere that tends to offset monsoon weakening. This suggests caution is needed when using SST forcing as a proxy for greenhouse warming. Finally, aerosol emissions are decomposed into those from the Indian region and those elsewhere, in pairs of experiments with SD and BC. Both local and remote aerosol emissions are found to lead to rainfall changes over India; for SD, remote aerosols contribute around 75% of the rainfall decrease over India, while for BC the remote forcing is even more dominant.
Pai, Varadraj V; Hanumanthayya, Keloji; Tophakhane, Raghavendra S; Nandihal, Namrata W; Kikkeri, Narayan Shetty Naveen
2013-01-01
Tinea capitis is a superficial fungal infection of the hair follicle of scalp. Most of the dermatophytosis do not have such age propensity as tinea capitis which almost invariably involves the paediatric age group. The exact incidence of tinea capitis is not known. This study is done in order to isolate the species variation in an area, to know the changing patterns of occurrence of different species and their association with clinical pattern All clinically diagnosed cases of tinea capitis which presented to our out patient department over a period of one year were included in the study. 70 cases of Tinea capitis were studied. Tinea capitis is a disease of prepubertal children with common in age group of 5- 15 years. The incidence varies from 0.5% to 10%. Most common presenting feature was alopecia.
Clinical study of Tinea capitis in Northern Karnataka: A three-year experience at a single institute
Pai, Varadraj V.; Hanumanthayya, Keloji; Tophakhane, Raghavendra S.; Nandihal, Namrata W.; Kikkeri, Narayan Shetty Naveen
2013-01-01
Background: Tinea capitis is a superficial fungal infection of the hair follicle of scalp. Most of the dermatophytosis do not have such age propensity as tinea capitis which almost invariably involves the paediatric age group. The exact incidence of tinea capitis is not known. This study is done in order to isolate the species variation in an area, to know the changing patterns of occurrence of different species and their association with clinical pattern Materials and Methods: All clinically diagnosed cases of tinea capitis which presented to our out patient department over a period of one year were included in the study. Results: 70 cases of Tinea capitis were studied. Discussion: Tinea capitis is a disease of prepubertal children with common in age group of 5- 15 years. The incidence varies from 0.5% to 10%. Most common presenting feature was alopecia. PMID:23439970
Diabetes mellitus: Trends in northern India
Gutch, Manish; Razi, Syed Mohd; Kumar, Sukriti; Gupta, Keshav Kumar
2014-01-01
Diabetes mellitus is becoming a global health issue with more than 80% diabetics living in developing countries. India accounts for 62.4 million diabetics (2011). Indian Council of Medical Research India Diabetes Study (ICMR-INDIAB) study showed highest weighted prevalence rate in the north India among all studied regions. Diabetes in north India has many peculiarities in all aspects from risk factors to control programmers. North Indians are becoming more prone for diabetes and dyslipidemia because rapid westernization of living style and diet due rapid migration to metropolitan cities for employment. North Indian diabetes is plagued with gender bias against females, poor quality of health services, myths, and lack of disease awareness compounded with small number of prevention and awareness programmers that too are immature to counteract the growing pandemic. PMID:25285295
NASA Astrophysics Data System (ADS)
Madhu, B.; Ashok, N. C.; Balasubramanian, S.
2014-11-01
Multinomial logistic regression analysis was used to develop statistical model that can predict the probability of breast cancer in Southern Karnataka using the breast cancer occurrence data during 2007-2011. Independent socio-economic variables describing the breast cancer occurrence like age, education, occupation, parity, type of family, health insurance coverage, residential locality and socioeconomic status of each case was obtained. The models were developed as follows: i) Spatial visualization of the Urban- rural distribution of breast cancer cases that were obtained from the Bharat Hospital and Institute of Oncology. ii) Socio-economic risk factors describing the breast cancer occurrences were complied for each case. These data were then analysed using multinomial logistic regression analysis in a SPSS statistical software and relations between the occurrence of breast cancer across the socio-economic status and the influence of other socio-economic variables were evaluated and multinomial logistic regression models were constructed. iii) the model that best predicted the occurrence of breast cancer were identified. This multivariate logistic regression model has been entered into a geographic information system and maps showing the predicted probability of breast cancer occurrence in Southern Karnataka was created. This study demonstrates that Multinomial logistic regression is a valuable tool for developing models that predict the probability of breast cancer Occurrence in Southern Karnataka.
Representing Farmer Irrigation Decisions in Northern India: Model Development from the Bottom Up.
NASA Astrophysics Data System (ADS)
O'Keeffe, J.; Buytaert, W.; Brozovic, N.; Mijic, A.
2017-12-01
The plains of northern India are among the most intensely populated and irrigated regions of the world. Sustaining water demand has been made possible by exploiting the vast and hugely productive aquifers underlying the Indo-Gangetic basin. However, an increasing demand from a growing population and highly variable socio-economic and environmental variables mean present resources may not be sustainable, resulting in water security becoming one of India's biggest challenges. Unless solutions which take into consideration the regions evolving anthropogenic and environmental conditions are found, the sustainability of India's water resources looks bleak. Understanding water user decisions and their potential outcome is important for development of suitable water resource management options. Computational models are commonly used to assist water use decision making, typically representing natural processes well. The inclusion of human decision making however, one of the dominant drivers of change, has lagged behind. Improved representation of irrigation water user behaviour within models provides more accurate, relevant information for irrigation management. This research conceptualizes and proceduralizes observed farmer irrigation practices, highlighting feedbacks between the environment and livelihood. It is developed using a bottom up approach, informed through field experience and stakeholder interaction in Uttar Pradesh, northern India. Real world insights are incorporated through collected information creating a realistic representation of field conditions, providing a useful tool for policy analysis and water management. The modelling framework is applied to four districts. Results suggest predicted future climate will have little direct impact on water resources, crop yields or farmer income. In addition, increased abstraction may be sustainable in some areas under carefully managed conditions. By simulating dynamic decision making, feedbacks and interactions between water users, irrigation officials, agricultural practices, and external influences such as energy pricing and farming subsidies, this work highlights the importance of directly including water user behaviour in policy making and operational tools, which will help achieve water and livelihood security.
Reducing sexual risk behavior among high-risk couples in Northern India.
Jones, Deborah; Bagga, Rashmi; Nehra, Ritu; Deepika; Sethi, Sunil; Walia, Kamini; Kumar, Mahendra; Villar-Loubet, Olga; Lopez, Maria; Weiss, Stephen M
2013-09-01
With a population of 1.1 billion, India is considered to be a country in which effective prevention interventions could contain the development of a human immunodeficiency virus (HIV) epidemic. Heterosexual transmission accounts for 85 % of the extant HIV infections. This study sought to assess the feasibility of conducting a group, culturally tailored behavioral intervention and its impact on sexual barrier use, self-efficacy, knowledge, conflict resolution, and coping among high-risk heterosexual couples in Northern India. This pilot study was conducted at the Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh, India from February 2008 to January 2009. Thirty sexually active high-risk couples were drawn from a convenience sample of PGIMER patients attending infectious disease and family planning clinics. Couples participated in 1 month of three weekly gender-concordant behavioral intervention groups and were individually administered assessments preintervention and post-intervention. The intervention was tailored to the Northern Indian context and addressed sexual barrier use, human immunodeficiency virus (HIV)/sexually transmitted infection transmission, and cognitive behavioral skill building focusing on sexual negotiation and communication. The participants had a mean age of 32 years (men) and 29 years (women), and the majority had at least 10 years of education. At baseline, the majority reported inconsistent condom use (<100 % of the time; 64 % of women, 59 % of men). Post-intervention, nearly all participants reported consistent condom use (100 % of the time; 100 % of men, 97 % of women). Participants also reported decreased verbal aggression, increased self-efficacy, and increased HIV-related knowledge, and women increased their use of positive coping tactics. The results highlight the potential to successfully utilize a group intervention to discuss sensitive issues such as sexual risk behavior among both men and women. Strategies to improve condom use and communication without increasing intimate partner violence in high-risk couples may be an important adjunct to preventing the development of a generalized epidemic in India.
Stevens, Chris J; Murphy, Charlene; Roberts, Rebecca; Lucas, Leilani; Silva, Fabio; Fuller, Dorian Q
2016-10-01
The period from the late third millennium BC to the start of the first millennium AD witnesses the first steps towards food globalization in which a significant number of important crops and animals, independently domesticated within China, India, Africa and West Asia, traversed Central Asia greatly increasing Eurasian agricultural diversity. This paper utilizes an archaeobotanical database (AsCAD), to explore evidence for these crop translocations along southern and northern routes of interaction between east and west. To begin, crop translocations from the Near East across India and Central Asia are examined for wheat ( Triticum aestivum ) and barley ( Hordeum vulgare ) from the eighth to the second millennia BC when they reach China. The case of pulses and flax ( Linum usitatissimum ) that only complete this journey in Han times (206 BC-AD 220), often never fully adopted, is also addressed. The discussion then turns to the Chinese millets, Panicum miliaceum and Setaria italica , peaches ( Amygdalus persica ) and apricots ( Armeniaca vulgaris ), tracing their movement from the fifth millennium to the second millennium BC when the Panicum miliaceum reaches Europe and Setaria italica Northern India, with peaches and apricots present in Kashmir and Swat. Finally, the translocation of japonica rice from China to India that gave rise to indica rice is considered, possibly dating to the second millennium BC. The routes these crops travelled include those to the north via the Inner Asia Mountain Corridor, across Middle Asia, where there is good evidence for wheat, barley and the Chinese millets. The case for japonica rice, apricots and peaches is less clear, and the northern route is contrasted with that through northeast India, Tibet and west China. Not all these journeys were synchronous, and this paper highlights the selective long-distance transport of crops as an alternative to demic-diffusion of farmers with a defined crop package.
Stevens, Chris J; Murphy, Charlene; Roberts, Rebecca; Lucas, Leilani; Silva, Fabio; Fuller, Dorian Q
2016-01-01
The period from the late third millennium BC to the start of the first millennium AD witnesses the first steps towards food globalization in which a significant number of important crops and animals, independently domesticated within China, India, Africa and West Asia, traversed Central Asia greatly increasing Eurasian agricultural diversity. This paper utilizes an archaeobotanical database (AsCAD), to explore evidence for these crop translocations along southern and northern routes of interaction between east and west. To begin, crop translocations from the Near East across India and Central Asia are examined for wheat (Triticum aestivum) and barley (Hordeum vulgare) from the eighth to the second millennia BC when they reach China. The case of pulses and flax (Linum usitatissimum) that only complete this journey in Han times (206 BC–AD 220), often never fully adopted, is also addressed. The discussion then turns to the Chinese millets, Panicum miliaceum and Setaria italica, peaches (Amygdalus persica) and apricots (Armeniaca vulgaris), tracing their movement from the fifth millennium to the second millennium BC when the Panicum miliaceum reaches Europe and Setaria italica Northern India, with peaches and apricots present in Kashmir and Swat. Finally, the translocation of japonica rice from China to India that gave rise to indica rice is considered, possibly dating to the second millennium BC. The routes these crops travelled include those to the north via the Inner Asia Mountain Corridor, across Middle Asia, where there is good evidence for wheat, barley and the Chinese millets. The case for japonica rice, apricots and peaches is less clear, and the northern route is contrasted with that through northeast India, Tibet and west China. Not all these journeys were synchronous, and this paper highlights the selective long-distance transport of crops as an alternative to demic-diffusion of farmers with a defined crop package. PMID:27942165
Somannavar, Manjunath S; Appajigol, Jayaprakash S
2014-01-01
Obesity is a risk factor for cardiovascular disease (CVD), diabetes mellitus (DM), and hypertension (HTN). In an era of rapidly growing prevalence of obesity, it is important to explore the current knowledge, attitude, and practices of primary care physicians. Study participants were medical officers (MOs) of primary health centers in three districts of North Karnataka. The questionnaire was developed by a review of literature in the field and validated with five participants for scope, length, and clarity. Of the 102 participants, only 15% were aware about the burden of obesity in India. HTN, DM, and CVD were indicated as comorbidities by 73, 78, and 60 participants, respectively. Only 25 and 12 participants indicated appropriate body mass index (BMI) cut-off values for overweight and obesity diagnosis. Of the 102 participants, 54 were not aware of the guidelines for obesity management. Practices and attitudes of the participants were encouraging. Nearly all of them felt that the adults with BMI within the healthy range should be encouraged to maintain their weight and, three-fourth of them agreed that most overweight persons should be treated for weight loss and small weight loss can achieve major medical benefit. However, nearly half of the participants' responses were stereotypical as they felt only obese and overweight with comorbidities should be treated for weight loss. Two-thirds of them use BMI to diagnose overweight/obese and nearly all of them advice their patients to increase physical activity and restrict fat. Most of the participants were advising their patients to restrict sugar intake, increase fruits and vegetable consumption, reduce red meat, and avoid alcohol consumption. Present study exposed the lack of knowledge regarding obesity. However, practices and attitudes of the participants were promising. There is a need of in-service training to MOs to further improve their knowledge and practices towards management of obesity.
Government health insurance and spatial peer effects: New evidence from India.
Chatterjee, Chirantan; Joshi, Radhika; Sood, Neeraj; Boregowda, P
2018-01-01
What is the role of spatial peers in diffusion of information about health care? We use the implementation of a health insurance program in Karnataka, India that provided free tertiary care to poor households to explore this issue. We use administrative data on location of patient, condition for which the patient was hospitalized and date of hospitalization (10,507 observations) from this program starting November 2009 to June 2011 for 19 months to analyze spatial and temporal clustering of tertiary care. We find that the use of healthcare today is associated with an increase in healthcare use in the same local area (group of villages) in future time periods and this association persists even after we control for (1) local area fixed effects to account for time invariant factors related to disease prevalence and (2) local area specific time fixed effects to control for differential trends in health and insurance related outreach activities. In particular, we find that 1 new hospitalization today results in 0.35 additional future hospitalizations for the same condition in the same local area. We also document that these effects are stronger in densely populated areas and become pronounced as the insurance program becomes more mature suggesting that word of mouth diffusion of information might be an explanation for our findings. We conclude by discussing implications of our results for healthcare policy in developing economies. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kumar, Rishikesh; Guddattu, Vasudeva; Saravu, Kavitha
2016-12-01
Acquaintance is scanty on primaquine (PQ) efficacy and Plasmodium vivax recurrence in Udupi district, Karnataka, India. We assessed the efficacy of 14 days PQ regimen (0.25 mg/kg/day) to prevent P. vivax recurrence. Microscopically, aparasitemic adults (≥18 years) after acute vivax malaria on day 28 were re-enrolled into 15 months' long follow-up study. A peripheral blood smear examination was performed with participants at every 1-2 month interval. A nested PCR test was performed to confirm the mono-infection with P. vivax . Of 114 participants, 28 (24.6%) recurred subsequently. The median (IQR) duration of the first recurrence was 3.1 (2.2-5.8) months which ranged from 1.2 to 15.1 months, including initial 28 days. Participants with history of vivax malaria had significantly higher risk of recurrence, with hazard ratio (HR) (95% CI) of 2.62 (1.24-5.54) ( P =0.012). Severity of disease (11.4%, 13/114) was not associated ( P =1.00) with recurrence. Of 28 recurrence cases, the nPCR proved that P. vivax mono-infection recurrence rate was at least 72.7% (16/22) at first recurrence. In Udupi district, PQ dose of 0.25 mg/kg/day over 14 days seems inadequate to prevent recurrence in substantial proportion of vivax malaria. Patients with a history of vivax malaria are at high risk of recurrences.
Bhatia, Jagdish; Cleland, John
2004-11-01
The object of this study was to compare components of quality of care provided to female outpatients by practitioners working in the private and public sectors in Karnataka State, India. Consultations conducted by 18 private practitioners and 25 public-sector practitioners were observed for 5 days using a structured protocol. Private practitioners were selected from members of the Indian Medical Association in a predominantly rural sub-district of Kolar District. Government doctors were selected from a random sample of hospitals and health centres in three sub-districts of Mysore District. A total of 451 private-sector and 650 public-sector consultations were observed; in each sector about half involved a female practitioner. The mean length of consultation was 2.81 minutes in the public sector and 6.68 minutes in the private sector. Compared with public-sector practitioners, private practitioners were significantly more likely to undertake a physical examination and to explain their diagnosis and prognosis to the patient. Privacy was much better in the private sector. One-third of public-sector patients received an injection compared with two-thirds of private patients. The mean cost of drugs dispensed or prescribed were Rupees 37 and 74 in public and private sectors, respectively. Both in terms of thoroughness of diagnosis and doctor-patient communication, the quality of care appears to be much higher in the private than in the public sector. However, over-prescription of drugs by private practitioners may be occurring.
New records of chalcidid (Hymenoptera: Chalcididae) pupal parasitoids from India
Kanagarajan, Rasappan
2016-01-01
Abstract Background Chalcidids are one of the most important parasitoids of pupae of agriculturally important pests belonging to orders like Lepidoptera, Diptera, Coleoptera and Hymenoptera. Such an important group has not been studied consistently by any team of workers from any country apart from the notable contributions by Boucek, Steffan, Delvare and Narendran. (Boucek 1988, Steffan 1973, Delvare 1992 and Narendran 1989). On a personal note, Dr. John S Noyes of Natural History Museum London agrees with this view as expressed with the second author and hence we felt that we can initiate further work on this group within India. We currently hold hundreds of unidentified specimens of this family in our department collection confirming that we will have much work to do over a long period of time. New information New distribution records of Chalcididae from Andhra Pradesh (Brachymeria megaspila, B. minuta, Dirhinus anthracia and D. auratus), Bihar (B. podagrica, B. excarinata, B. hearseyi, D. anthracia, D. auratus, D. pilifer, Epitranus erythrogaster and Psilochalcis carinigena), Karnataka (B. apicicornis), Manipur (B. euploeae, D. auratus and E. erythrogaster), Mizoram (B. euploeae and D. anthracia), Nagaland (B. euploeae), Himachal Pradesh (B. alternipes), and Tamil Nadu (B. apicicornis, D. anthracia, D. deplanatus, D. pilifer, D. bakeri, E. observator, E. elongatulus, P. keralensis and P. soudanensis) and union territories Andaman & Nicobar Islands (B. podagrica, B. excarinata, E. erythrogaster and P. carinigena) and Pudhucherry (B. albicrus, D. anthracia, D. auratus, E. erythrogaster and P. kerelensis) are documented from the unidentified material mentioned above. PMID:26929709
Excess under-5 female mortality across India: a spatial analysis using 2011 census data.
Guilmoto, Christophe Z; Saikia, Nandita; Tamrakar, Vandana; Bora, Jayanta Kumar
2018-06-01
Excess female mortality causes half of the missing women (estimated deficit of women in countries with suspiciously low proportion of females in their population) today. Globally, most of these avoidable deaths of women occur during childhood in China and India. We aimed to estimate excess female under-5 mortality rate (U5MR) for India's 35 states and union territories and 640 districts. Using the summary birth history method (or Brass method), we derived district-level estimates of U5MR by sex from 2011 census data. We used data from 46 countries with no evidence of gender bias for mortality to estimate the effects and intensity of excess female mortality at district level. We used a detailed spatial and statistical analysis to highlight the correlates of excess mortality at district level. Excess female U5MR was 18·5 per 1000 livebirths (95% CI 13·1-22·6) in India 2000-2005, which corresponds to an estimated 239 000 excess deaths (169 000-293 000) per year. More than 90% of districts had excess female mortality, but the four largest states in northern India (Uttar Pradesh, Bihar, Rajasthan, and Madhya Pradesh) accounted for two-thirds of India's total number. Low economic development, gender inequity, and high fertility were the main predictors of excess female mortality. Spatial analysis confirmed the strong spatial clustering of postnatal discrimination against girls in India. The considerable effect of gender bias on mortality in India highlights the need for more proactive engagement with the issue of postnatal sex discrimination and a focus on the northern districts. Notably, these regions are not the same as those most affected by skewed sex ratio at birth. None. Copyright © 2018 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY-NC-ND 4.0 license. Published by Elsevier Ltd.. All rights reserved.
Climate change and threat of vector-borne diseases in India: are we prepared?
Dhiman, Ramesh C; Pahwa, Sharmila; Dhillon, G P S; Dash, Aditya P
2010-03-01
It is unequivocal that climate change is happening and is likely to expand the geographical distribution of several vector-borne diseases, including malaria and dengue etc. to higher altitudes and latitudes. India is endemic for six major vector-borne diseases (VBD) namely malaria, dengue, chikungunya, filariasis, Japanese encephalitis and visceral leishmaniasis. Over the years, there has been reduction in the incidence of almost all the diseases except chikungunya which has re-emerged since 2005. The upcoming issue of climate change has surfaced as a new threat and challenge for ongoing efforts to contain vector-borne diseases. There is greater awareness about the potential impacts of climate change on VBDs in India and research institutions and national authorities have initiated actions to assess the impacts. Studies undertaken in India on malaria in the context of climate change impact reveal that transmission windows in Punjab, Haryana, Jammu and Kashmir and north-eastern states are likely to extend temporally by 2-3 months and in Orissa, Andhra Pradesh and Tamil Nadu there may be reduction in transmission windows. Using PRECIS model (driven by HadRM2) at the resolution of 50 x 50 Km for daily temperature and relative humidity for year 2050, it was found that Orissa, West Bengal and southern parts of Assam will still remain malarious and transmission windows will open up in Himachal Pradesh and north-eastern states etc. Impact of climate change on dengue also reveals increase in transmission with 2 C rise in temperature in northern India. Re-emergence of kala-azar in northern parts of India and reappearance of chikungunya mainly in southern states of India has also been discussed. The possible need to address the threat and efforts made in India have also been highlighted. The paper concludes with a positive lead that with better preparedness threat of climate change on vector-borne diseases may be negated.
Patent Pooling for Promoting Access to Antiretroviral Drugs (ARVs) – A Strategic Option for India
Satyanarayana, Kanikaram; Srivastava, Sadhana
2010-01-01
The current HIV/AIDS scenario in India is quite grim with an estimated 2.4 million people living with HIV/AIDS (PLHA) in 2008, just behind South Africa and Nigeria. The anti-retroviral drugs (ARVs) remain the main stay of global HIV/AIDS treatment. Over 30 ARVs (single and FDCs) available under six categories viz., NRTIs (nucleoside reverse transcriptase inhibitors), NNRTIs (non-nucleoside reverse transcriptase inhibitors), Protease inhibitors, the new Fusion inhibitors, Entry inhibitors-CCR5 co-receptor antagonists and HIV integrase strand transfer inhibitors. The major originator companies for these ARVs are: Abbott, Boehringer Ingelheim (BI), Bristol-Myers Squibb (BMS), Gilead, GlaxoSmithKline (GSK), Merck, Pfizer, Roche, and Tibotec. Beginning with zidovidine in 1987, all the drugs are available in the developed countries. In India, about 30 ARVs are available as generics manufactured by Aurobindo, Hyderabad, Andhra Pradesh; Cipla Limited, Goa; Emcure Pharmaceuticals, Pune, Maharashtra; Hetero Drugs, Hyderabad, Andhra Pradesh; Macleods Pharmaceuticals, Daman; Matrix Laboratories, Nashik, Maharashtra; Ranbaxy, Sirmour, Himachal Pradesh; and Strides Arcolab, Bangalore, Karnataka. The National AIDS Control Organization (NACO) set up in 1992 by the Govt. of India provides free ARVs to HIV positive patients in India since 2004. The drugs available in India include both single drugs and FDCs covering both first line and second line ARVs. Even while there are claims of stabilization of the disease load, there is still huge gap of those who require ARVs as only about 150,000 PLHA receive the ARVs from the Govt. and other sources. Access to ARVs therefore is still a cause of serious concern ever since India became fully Trade Related Aspects of Intellectual Property Rights (TRIPS)-complaint in 2005. Therefore, the Indian pharmaceutical companies cannot make generics for those for drugs introduced post-2005 due to product patent regime. Other concerns include heat stable, other better formulations and second line ARVs for adults and more drugs and formulations for paediatric groups, that are still to be widely available in India and other developing countries. To examine whether strong intellectual property (IP) protection systems are to be considered important barriers for the limited or lack of access to ARVs, we studied the patent profile of the ARVs of the originator companies within and outside India. We could record 93 patents in the United States Patent & Trademark Office (USPTO). The originator companies have been also aggressively filing and enforcing patents in India. There have been a few efforts by companies like Gilead and GSK to grant licenses to generic manufacturers in developing countries, ostensibly to promote access to ARVs through lower (two-tier) pricing. These steps are considered as too little and too late. There is an urgent need to look for alternative strategies to promote access to ARVs both linked to and independent of IPRs. Patent pooling as a viable strategy mooted by the UNITAID should be seriously explored to promote access to ARVs. India is ideally suited for trying out the patent pool strategy as most of the global requirement of affordable ARV drugs for HIV/AIDS treatment is sourced from Indian generic companies. PMID:20148091
Patent Pooling for Promoting Access to Antiretroviral Drugs (ARVs) - A Strategic Option for India.
Satyanarayana, Kanikaram; Srivastava, Sadhana
2010-01-19
The current HIV/AIDS scenario in India is quite grim with an estimated 2.4 million people living with HIV/AIDS (PLHA) in 2008, just behind South Africa and Nigeria. The anti-retroviral drugs (ARVs) remain the main stay of global HIV/AIDS treatment. Over 30 ARVs (single and FDCs) available under six categories viz., NRTIs (nucleoside reverse transcriptase inhibitors), NNRTIs (non-nucleoside reverse transcriptase inhibitors), Protease inhibitors, the new Fusion inhibitors, Entry inhibitors-CCR5 co-receptor antagonists and HIV integrase strand transfer inhibitors. The major originator companies for these ARVs are: Abbott, Boehringer Ingelheim (BI), Bristol-Myers Squibb (BMS), Gilead, GlaxoSmithKline (GSK), Merck, Pfizer, Roche, and Tibotec. Beginning with zidovidine in 1987, all the drugs are available in the developed countries. In India, about 30 ARVs are available as generics manufactured by Aurobindo, Hyderabad, Andhra Pradesh; Cipla Limited, Goa; Emcure Pharmaceuticals, Pune, Maharashtra; Hetero Drugs, Hyderabad, Andhra Pradesh; Macleods Pharmaceuticals, Daman; Matrix Laboratories, Nashik, Maharashtra; Ranbaxy, Sirmour, Himachal Pradesh; and Strides Arcolab, Bangalore, Karnataka. The National AIDS Control Organization (NACO) set up in 1992 by the Govt. of India provides free ARVs to HIV positive patients in India since 2004. The drugs available in India include both single drugs and FDCs covering both first line and second line ARVs. Even while there are claims of stabilization of the disease load, there is still huge gap of those who require ARVs as only about 150,000 PLHA receive the ARVs from the Govt. and other sources. Access to ARVs therefore is still a cause of serious concern ever since India became fully Trade Related Aspects of Intellectual Property Rights (TRIPS)-complaint in 2005. Therefore, the Indian pharmaceutical companies cannot make generics for those for drugs introduced post-2005 due to product patent regime. Other concerns include heat stable, other better formulations and second line ARVs for adults and more drugs and formulations for paediatric groups, that are still to be widely available in India and other developing countries. To examine whether strong intellectual property (IP) protection systems are to be considered important barriers for the limited or lack of access to ARVs, we studied the patent profile of the ARVs of the originator companies within and outside India. We could record 93 patents in the United States Patent & Trademark Office (USPTO). The originator companies have been also aggressively filing and enforcing patents in India. There have been a few efforts by companies like Gilead and GSK to grant licenses to generic manufacturers in developing countries, ostensibly to promote access to ARVs through lower (two-tier) pricing. These steps are considered as too little and too late. There is an urgent need to look for alternative strategies to promote access to ARVs both linked to and independent of IPRs. Patent pooling as a viable strategy mooted by the UNITAID should be seriously explored to promote access to ARVs. India is ideally suited for trying out the patent pool strategy as most of the global requirement of affordable ARV drugs for HIV/AIDS treatment is sourced from Indian generic companies.
Springer, C; Heldt, N
2016-06-01
Owing to the lack in structural strength while composting certain kinds of organic wastes, 11 co-substrates were tested that are generally locally available in rural areas of northern Tamil Nadu, India. In addition to the classical composting parameters such as carbon/nitrogen ratio, moisture content, dry matter and organic dry matter, a compression test was conducted to evaluate the structural strength and the suitability as bulking agent for composting processes. Additionally, with respect to the climatic conditions in India, the water holding capacity was also evaluated. © The Author(s) 2016.
International Conference on Aerosols, Clouds and the Indian Monsoon
NASA Astrophysics Data System (ADS)
Singh, Ramesh P.; Tare, Vinod; Tripathi, S. N.
2005-06-01
In recent years, dense haze and fog problems in the northern parts of India have affected the 460 million people living in the Indo-Gangetic basin. Substantial Indian research activities related to aerosols, clouds, and monsoon are taking place in the central and southern parts of India. To attract attention to the problems, a three-day International Conference on Aerosols, Clouds and Indian Monsoon was recently held at the Indian Institute of Technology, Kanpur, in the central part of the Indo-Gangetic basin. About 120 delegates from India, Germany, Greece, Japan, Taiwan, and the United States attended the conference.
Urban versus rural health impacts attributable to PM2.5 and O3 in northern India
NASA Astrophysics Data System (ADS)
Karambelas, Alexandra; Holloway, Tracey; Kinney, Patrick L.; Fiore, Arlene M.; DeFries, Ruth; Kiesewetter, Gregor; Heyes, Chris
2018-06-01
Ambient air pollution in India contributes to negative health impacts and early death. Ground-based monitors often used to quantify health impacts are located in urban regions, yet approximately 70% of India’s population lives in rural communities. We simulate high-resolution concentrations of fine particulate matter (PM) and ozone from the regional Community Multi-scale Air Quality model over northern India, including updated estimates of anthropogenic emissions for transportation, residential combustion and location-based industrial and electrical generating emissions in a new anthropogenic emissions inventory. These simulations inform seasonal air quality and health impacts due to anthropogenic emissions, contrasting urban versus rural regions. For our northern India domain, we estimate 463 200 (95% confidence interval: 444 600–482 600) adults die prematurely each year from PM2.5 and that 37 800 (28 500–48 100) adults die prematurely each year from O3. This translates to 5.8 deaths per 10 000 attributable to air pollution out of an annual rate of 72 deaths per 10 000 (8.1% of deaths) using 2010 estimates. We estimate that the majority of premature deaths resulting from PM2.5 and O3 are in rural (383 600) as opposed to urban (117 200) regions, where we define urban as cities and towns with populations of at least 100 000 people. These findings indicate the need for rural monitoring and appropriate health studies to understand and mitigate the effects of ambient air pollution on this population in addition to supporting model evaluation.
Haldar, Partha; Sagar, Rajesh; Malhotra, Sumit; Kant, Shashi
2017-01-01
There is little information available on the type, pattern, trend, and demographic differentials of psychiatric cases attending a subdistrict level facility in India. Our objectives were to describe the sociodemographic profile of the patients availing the psychiatric outpatient department services and document the diagnosis. This study is based on a retrospective analysis of routinely recorded administrative data collected during psychiatry consultations that took place between January 2010 and June 2014, at the subdistrict level hospital, Ballabgarh, Faridabad district, Haryana, Northern India. The data were abstracted in Microsoft Excel, scrutinized for duplicates, and cleaned in terms of the International Classification of Diseases 10 th Revision coding. Descriptive analysis was done for dependent variables and continuous variables were compared using independent t -test. A total of 2806 people (new registrations) were provided psychiatric consultations between January 2010 and June 2014. The mean age of males was 33.7 years (95% confidence interval [CI], 32.9, 34.5) and of females was 35.6 years (95% CI, 34.9, 36.3). Neurotic, stress-related, and somatoform disorders (F40-F48) comprised the major category of diagnoses with 661 cases (24%), followed by unspecified mental disorders (F99) with 528 cases (19%), mood (affective) disorders (F30-F39) with 448 cases (16%), and episodic and paroxysmal disorders (G40-G47) with 334 cases (12%). We reported an increase in level and trend in the monthly attendance of patients who required psychiatric at a secondary care hospital in Northern India. We suggest that setting up of mental health units only at district hospital might not be a sufficient health system's approach as has been envisaged under the District Mental Health Program.
Nagori, Shakil Ahmed; Jose, Anson; Bhutia, Ongkila; Roychoudhury, Ajoy
2014-01-01
Temporomandibular joint (TMJ) ankylosis due to undiagnosed condylar fractures has a high incidence in India compared to western countries. We evaluated the demographics, injury pattern, hospital reporting and referral pattern of undiagnosed condylar fractures complicating TMJ ankylosis in northern India. We did a retrospective analysis by retrieving medical records of patients with post-traumatic TMJ ankylosis reporting to the Department of Oral and Maxillofacial Surgery, All India Institute of Medical Sciences between 1 July 2012 and 30 June 2013. Of 90 patients with post-traumatic TMJ ankylosis, 74 (82.2%) resided in rural areas. Sixty-three (70%) patients were from the states of Uttar Pradesh, Bihar and Jharkhand. Only 8.8% had higher education and 10% had an annual income of more than `2 lakh. In 69 (84.4%) patients, fall was the aetiological factor. Primary health centres (42%) and private clinics (20.5%) received the major share of patients immediately following injury. Few patients (19.3%) had some radiographic examination done and only 17% were referred by the primary healthcare provider. Of those referred only 3 were examined by a dental practitioner. Only 10% of all were diagnosed with condylar fractures. Patients with TMJ ankylosis presenting to us have poor literacy and income levels. A missed diagnosis of condylar fractures by rural healthcare providers contributes to its high incidence in India. Improving awareness of clinicians and improved rural healthcare infrastructure can help prevent this complication. Copyright 2014, NMJI.
Interannual variability of Indian monsoon rainfall
NASA Technical Reports Server (NTRS)
Paolino, D. A.; Shukla, J.
1984-01-01
The interannual variability of the Indian summer monsoon and its relationships with other atmospheric fluctuations were studied in hopes of gaining some insight into the predicability of the rainfall. Rainfall data for 31 meteorological subdivisions over India were provided by the India Meteorological Department (IMD). Fifty-three years of seasonal mean anomaly sea-level pressure (SLP) fields were used to determine if any relationships could be detected between fluctuations in Northern Hemisphere surface pressure and Indian monsoon rainfall. Three month running mean sea-level pressure anomalies at Darwin (close to one of the centers of the Southern Oscillation) were compiled for months preceding and following extreme years for rainfall averaged over all of India. Anomalies are small before the monsoon, but are quite large in months following the summer season. However, there is a large decrease in Darwin pressure for months preceding a heavy monsoon, while a deficient monsoon is preceded by a sharp increase in Darwin pressure. If a time series is constructed of the tendency of Darwin SLP between the Northern Hemisphere winter (DJF) and spring (MAM) and a correlation coefficient is computed between it and 81 years of rainfall average over all of India, one gets a C. C. of -.46, which is higher than any other previously computed predictor of the monsoon rainfall. This relationship can also be used to make a qualitative forecast for rainfall over the whole of India by considering the sign of the tendency in extreme monsoon years.
Instilling fear makes good business sense: unwarranted hysterectomies in Karnataka.
Xavier, Teena; Vasan, Akhila; S, Vijayakumar
2017-01-01
This paper uses data from two fact-finding exercises in two districts of Karnataka to trace how government and private doctors alike pushed women to undergo hysterectomies. The doctors provided grossly unscientific information to poor Dalit women to instil a fear of "cancer" in their minds to wilfully mislead them to undergo hysterectomies, following which many suffered complications and died. The paper examines a review, made by two separate panels of experts, of women's medical records from private hospitals to illustrate that a large proportion of the hysterectomies performed were medically unwarranted; that private doctors were using highly suspect diagnostic criteria, based on a single ultrasound scan, to perform the hysterectomies and had not sent even a single sample for histopathology; and that the medical records were incomplete, erroneous and, in several instances, manipulated. The paper describes how a combination of patriarchal bias, professional unscrupulousness and pro-private healthcare policies posed a serious threat to the survival and well-being of women in Karnataka.
Bradley, Janet; Jayanna, Krishnamurthy; Shaw, Souradet; Cunningham, Troy; Fischer, Elizabeth; Mony, Prem; Ramesh, B M; Moses, Stephen; Avery, Lisa; Crockett, Maryanne; Blanchard, James F
2017-01-07
Birthing in health facilities in India has increased over the last few years, yet maternal and neonatal mortality rates remain high. Clinical mentoring with case sheets or checklists for nurses is viewed as essential for on-going knowledge transfer, particularly where basic training is inadequate. This paper summarizes a study of the effect of such a programme on staff knowledge and skills in a randomized trial of 295 nurses working in 108 Primary Health Centres (PHCs) in Karnataka, India. Stratifying by district, half of the PHCs were randomly assigned to be intervention sites and provided with regular mentoring visits where case sheet/checklists were a central job and teaching aid, and half to be control sites, where no support was provided except provision of case sheets. Nurses' knowledge and skills around normal labour, labour complications and neonate issues were tested before the intervention began and again one year later. Univariate and multivariate analyses were conducted to examine the effect of mentoring and case sheets. Overall, on none of the 3 measures, did case sheet use without mentoring add anything to the basic nursing training when controlling for other factors. Only individuals who used both case-sheets and received mentoring scored significantly higher on the normal labour and neonate indices, scoring almost twice as high as those who only used case-sheets. This group was also associated with significantly higher scores on the complications of labour index, with their scores 2.3 times higher on average than the case sheet only control group. Individuals from facilities with 21 or more deliveries in a month tended to fare worse on all 3 indices. There were no differences in outcomes according to district or years of experience. This study demonstrates that provision of case sheets or checklists alone is insufficient to improve knowledge and practices. However, on-site mentoring in combination with case sheets can have a demonstrable effect on improving nurse knowledge and skills around essential obstetric and neonatal care in remote rural areas of India. We recommend scaling up of this mentoring model in order to improve staff knowledge and skills and reduce maternal and neonatal mortality in India. This study is registered at clinicaltrials.gov, Identifier No. NCT02004912 , November 27, 2013.
Hambidge, K Michael; Krebs, Nancy F; Garcés, Ana; Westcott, Jamie E; Figueroa, Lester; Goudar, Shivaprasad S; Dhaded, Sangappa; Pasha, Omrana; Aziz Ali, Sumera; Tshefu, Antoinette; Lokangaka, Adrien; Thorsten, Vanessa R; Das, Abhik; Stolka, Kristen; McClure, Elizabeth M; Lander, Rebecca L; Bose, Carl L; Derman, Richard J; Goldenberg, Robert L; Bauserman, Melissa
2017-07-24
Maternal stature and body mass indices (BMI) of non-pregnant women (NPW) of child bearing age are relevant to maternal and offspring health. The objective was to compare anthropometric indices of NPW in four rural communities in low- to low-middle income countries (LMIC). Anthropometry and maternal characteristics/household wealth questionnaires were obtained for NPW enrolled in the Women First Preconception Maternal Nutrition Trial. Body mass index (BMI, kg/m 2 ) was calculated. Z-scores were determined using WHO reference data. A total of 7268 NPW participated in Equateur, DRC (n = 1741); Chimaltenango, Guatemala (n = 1695); North Karnataka, India (n = 1823); and Thatta, Sindh, Pakistan (n = 2009). Mean age was 23 y and mean parity 1.5. Median (P25-P75) height (cm) ranged from 145.5 (142.2-148.9) in Guatemala to 156.0 (152.0-160.0) in DRC. Median weight (kg) ranged from 44.7 (39.9-50.3) in India to 52.7 (46.9-59.8) in Guatemala. Median BMI ranged from 19.4 (17.6-21.9) in India to 24.9 (22.3-28.0) in Guatemala. Percent stunted (<-2SD height for age z-score) ranged from 13.9% in DRC to 80.5% in Guatemala; % underweight (BMI <18.5) ranged from 1.2% in Guatemala to 37.1% in India; % overweight/obese (OW, BMI ≥25.0) ranged from 5.7% in DRC to 49.3% in Guatemala. For all sites, indicators for higher SES and higher age were associated with BMI. Lower SES women were underweight more frequently and higher SES women were OW more frequently at all sites. Younger women tended to be underweight, while older women tended to be OW. Anthropometric data for NPW varied widely among low-income rural populations in four countries located on three different continents. Global comparisons of anthropometric measurements across sites using standard reference data serve to highlight major differences among populations of low-income rural NPW and assist in evaluating the rationale for and the design of optimal intervention trials. ClinicalTrials.gov # NCT01883193 (18 June 2013, retrospectively registered).
Jingar, Aripta; Alaparthi, Gopala Krishna; Vaishali, K; Krishnan, Shyam; Zulfeequer; Unnikrishnan, B
2013-04-01
Evidence supports the use of pulmonary rehabilitation in the treatment of chronic obstructive pulmonary disease (COPD) patients both during acute exacerbation and at later stages. It is used in India; but, to date, there has been no study that has investigated the structure of pulmonary rehabilitation programs for COPD patients in India. The recent study aims to determine the current practice patterns of Indian Physiotherapists for COPD patients admitted in Intensive Care Units (ICUs) and wards in terms of assessment and treatment. A questionnaire-based survey was conducted across India. Questionnaires were distributed to around 800 physiotherapists via E-mail. Physiotherapists with a Master Degree and a specialization in cardiopulmonary science or a minimum of 1 year of experience in treating cardiopulmonary patients were included. The questionnaires addressed assessment measures and treatment techniques given to COPD patients. A total of 342 completed questionnaires were received, yielding a response rate of 43.8%, with a majority of responses from Karnataka, Maharashtra and Gujarat. The assessment and treatment techniques used were almost similar between ICUs and wards. More than 80% of the responders carried out the assessment of certain respiratory impairments in both ICUs and wards. An objective measure of dyspnea was taken by less than 40% of the responders, with little attention given to functional exercise capacity and health-related quality of life. Eighty-five percent of the responders used Dyspnea-relieving strategies and traditional airway clearance techniques in both ICUs and wards. Eighty-three percent of the responders were giving patients in the wards training for upper and lower extremity. Fifty percent were giving strength training in the wards. Whether patients are admitted in ICUs or Wards, the practice pattern adopted by Physiotherapists to treat them vary very little with respect to certain measures taken. Assessment predominantly focused on respiratory impairment measures, followed by dyspnea-quantifying measures, with little attention given to functional exercise capacity and health-related quality of life measures. Treatment techniques given were concentrated on dyspnea-relieving strategies, airway clearance techniques and upper and lower extremity exercises, with little attention given to strength training.
Using Third-Party Inspectors in Building Energy Codes Enforcement in India
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Sha; Evans, Meredydd; Kumar, Pradeep
India is experiencing fast income growth and urbanization, and this leads to unprecedented increases in demand for building energy services and resulting energy consumption. In response to rapid growth in building energy use, the Government of India issued the Energy Conservation Building Code (ECBC) in 2007, which is consistent with and based on the 2001 Energy Conservation Act. ECBC implementation has been voluntary since its enactment and a few states have started to make progress towards mandatory implementation. Rajasthan is the first state in India to adopt ECBC as a mandatory code. The State adopted ECBC with minor additions onmore » March 28, 2011 through a stakeholder process; it became mandatory in Rajasthan on September 28, 2011. Tamil Nadu, Gujarat, and Andhra Pradesh have started to draft an implementation roadmap and build capacity for its implementation. The Bureau of Energy Efficiency (BEE) plans to encourage more states to adopt ECBC in the near future, including Haryana, Uttar Pradesh, Karnataka, Maharashtra, West Bengal, and Delhi. Since its inception, India has applied the code on a voluntary basis, but the Government of India is developing a strategy to mandate compliance. Implementing ECBC requires coordination between the Ministry of Power and the Ministry of Urban Development at the national level as well as interdepartmental coordination at the state level. One challenge is that the Urban Local Bodies (ULBs), the enforcement entities of building by-laws, lack capacity to implement ECBC effectively. For example, ULBs in some states might find the building permitting procedures to be too complex; in other cases, lack of awareness and technical knowledge on ECBC slows down the amendment of local building by-laws as well as ECBC implementation. The intent of this white paper is to share with Indian decision-makers code enforcement approaches: through code officials, third-party inspectors, or a hybrid approach. Given the limited capacity and human resources available in the state and local governments, involving third-party inspectors could rapidly expand the capacity for plan reviews and broad implementation. However, the procedures of involving third-parties need to be carefully designed in order to guarantee a fair process. For example, there should be multiple checks and certification requirements for third-party inspectors, and the government should have the final approval when third-party inspectors are used in a project. This paper discusses different approaches of involving third-parties in ECBC enforcement; the Indian states may choose the approaches that work best in their given circumstances.« less
Dash, Paban Kumar; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Sahni, Ajay Kumar; Parida, Manmohan
2015-01-02
Dengue is now hyper-endemic in most parts of south and southeast Asia including India. The northern India particularly national capital New Delhi witnessed major Dengue outbreaks with Dengue virus type 1 (DENV-1) as the dominant serotype since last five years. This study was initiated to decipher the complete genome information of recently circulating DENV-1 (2009-2011) along with the prototype Indian DENV-1, isolated in 1956. Further extensive ML phylogenetic and Bayesian phylogeography analysis was carried out to investigate the evolution of this virus and understand its spatiotemporal diffusion across the globe. The complete genome analysis revealed deletion of a unique 21-nucleotide stretch in the 3' un-translated region of recent Indian DENV-1. The north Indian DENV-1 revealed up to 5.2% nucleotide sequence difference compared to recent isolates from southern India. Selection pressure analysis revealed positive selection in few amino acid sites of both structural and non-structural proteins. The molecular phylogeny classified the Indian DENV-1 into genotype III, which is also known as cosmopolitan genotype. The northern and southern Indian DENV-1 were grouped into distinct clades. The molecular clock analysis estimated a mean evolutionary rate of 7.08×10(-4) substitutions/site/year for cosmopolitan genotype. The phylogeography analysis revealed that the cosmopolitan genotype DENV-1 originated ∼1938 in India and subsequently spread globally. The diffusion of virus from India to Caribbean and South America was confirmed through SPREAD analysis. This study also confirmed the temporal displacement of different clades of DENV-1 in India over last five decades. Copyright © 2014 Elsevier B.V. All rights reserved.
Water: US Strategic Response to Conflicts Over a Finite Resource
2009-02-25
World War II ended and the African nations became independent, this Victorian Era arrangement soon encountered serious problems. Sudan and 6 Ethiopia...Carlisle Barracks, PA 17013-5050 USAWC CLASS OF 2009 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting burden for the collection...conditions in an already hostile region. Additionally, India has already drawn down many of its aquifers in northern India; the 17 economic and social
Earth view over India taken during STS-121
2006-07-04
STS121-331-019 (4-17 July 2006) --- (North is toward the lower right corner of the image). This vertical view over glaciers in the Karakoram Mountain range of Northern India was photographed from the Space Shuttle Discovery during the STS-121 mission. The glaciers are centered at 34.8 degrees north latitude and 77.8 degrees east longitude. The small peak in the center of the photo stands 25,170 feet high.
Reddy, G V; Guerrero, A
2001-01-01
Field trials were conducted in cabbage (Brassica oleracea var capitata), cauliflower (B oleracea var botrytis) and knol khol (B oleracea gongylodes) crops at two different locations in Karnataka State (India) to optimize the timing of insecticide applications to control the diamondback moth, Plutella xylostella, using sex pheromone traps. Our results indicate that applications of cartap hydrochloride as insecticide during a 12-24 h period after the pheromone traps had caught on average 8, 12 and 16 males per trap per night in cabbage, cauliflower and knol khol, respectively, were significantly more effective than regular insecticide sprays at 7, 9, 12 or 15 days after transplantation. This was demonstrated by estimation of the mean number of eggs and larvae per plant, the percentage of holes produced, as well as the marketable yield of the three crops at each location. A good correlation between the immature stages, infestation level, the estimated crop yield and the number of moths caught in pheromone traps was also found, indicating the usefulness of pheromone-based monitoring traps to predict population densities of the pest.
Karthikeyan, Veluswamy; Gnanamanickam, S S
2008-10-01
A total of 128 isolates of Setaria-infecting Magnaporthe grisea strains were obtained from different states of South India which includes sampling sites from Tamil Nadu, two from Karnataka, one from Andhra Pradesh and Kerala. Out of the selected 128 isolates 30 strains were tested with MAT1-1 and MAT1-2 fertile standard testers to determine their mating type. None of the 30 Setaria isolates produced perithecia with fertile testers. However, when monoconidial isolates were mated among themselves, isolates from the same field produced only barren perithecia and the tester isolates were able to mate readily with finger millet isolates. This is the first report of the mating-type studies on Setaria infecting Magnaporthe grisea with standard testers. This result indicates that the Setaria infecting population is infertile. In pathogenicity assay, it was found that 9 out of the 22 Setaria accessions were highly susceptible to Setaria strains of the blast fungus and seven cultivars/accessions were resistant to blast pathogen. Various virulence reactions were scored according to Standard Evaluation System.
On the Opening and Closure History of the Palaeo- and Neotethys
NASA Astrophysics Data System (ADS)
Torsvik, T. H.
2008-12-01
Gondwana was by far the largest tectonic entity in the Lower Palaeozoic, stretching from the South Pole to north of the Equator. South China was located close to Gondwana whilst e.g. North China, Tarim and Annamia were not attached to core Gondwana in the Lower Palaeozoic. Most of the area from the Taurides (Turkey) to at least East of India represented a passive margin for the whole of the Lower Palaeozoic, and Ordovician palaeomagnetic data from northern India now confidently place Tethyan Himalaya at the northern margin of cratonic India at this time. The Palaeotethys opened no earlier than the late Silurian when the Armorican Terrane Assemblage separated from Gondwana and by the early Carboniferous (c. 350 Ma), Palaeotethys had grown to more than 3000 km between NW Africa and southern France. This part of the Palaeotethys was subsequently closed at c. 320 Ma during the most important growth phase of Pangea when Laurussia, Gondwana and intervening terranes collided. Although some continental elements were still adjusting their positions along the Pangea perimeter. The Neotethys probably began opening at c. 265 Ma while Palaeotethyan oceanic crust was being subducted beneath Eurasia. North and South China and Annamia were not part of Pangea and located to tropical- subtropical latitudes in the eastern part of the Palaeotethys, separated by a wide Mongol-Okhotsk Ocean from the central and northern Asian parts of Pangea. Using a new reconstruction method we can now reconstruct the 258 Ma Emeishan large igneous province and hence South China in longitude. That positioning also determines the previously unknown width of the Palaeotethys Ocean between South China and Pangea at that time, which was as much as 7000 km. Palaeotethys had essentially vanished by the Late Triassic as a result of the collisions of many peri- Gondwana terranes (Cimmeria) with Eurasia. The Late Triassic also coincided with an important reorganization in the North Atlantic and a phase of crustal shortening in NW Siberia. The Early Jurassic witnessed the assembly of the Asian part of Pangea but simultaneously saw the break-up of Pangea in the Central Atlantic. At this time, India was still part of Pangea and the Neotethys was more than 9000 km wide across the Indian-Asian sector. India experienced a tormented post-Early Jurassic journey, first drifting away from East Africa, then East Antarctica/Australia, Madagascar and finally the Seychelles before its dramatic collision with Asia and destruction of the Neotethys in the process. The northern margin of India and the Tethyan Himalaya, however, must have remained very stable during most of the Phanerozoic as no significant rotation or deformation is recognised between Early Ordovician and Eocene times.
Varghese, George M; Janardhanan, Jeshina; Mahajan, Sanjay K; Tariang, David; Trowbridge, Paul; Prakash, John A J; David, Thambu; Sathendra, Sowmya; Abraham, O C
2015-01-01
Scrub typhus, an acute febrile illness that is widespread in the Asia-Pacific region, is caused by the bacterium Orientia tsutsugamushi, which displays high levels of antigenic variation. We conducted an investigation to identify the circulating genotypes of O. tsutsugamushi in 3 scrub typhus-endemic geographic regions of India: South India, Northern India, and Northeast India. Eschar samples collected during September 2010-August 2012 from patients with scrub typhus were subjected to 56-kDa type-specific PCR and sequencing to identify their genotypes. Kato-like strains predominated (61.5%), especially in the South and Northeast, followed by Karp-like strains (27.7%) and Gilliam and Ikeda strains (2.3% each). Neimeng-65 genotype strains were also observed in the Northeast. Clarifying the genotypic diversity of O. tsutsugamushi in India enhances knowledge of the regional diversity among circulating strains and provides potential resources for future region-specific diagnostic studies and vaccine development.
Reza-Paul, Sushena; Lazarus, Lisa; Doshi, Monika; Hafeez Ur Rahman, Syed; Ramaiah, Manjula; Maiya, Raviprakash; Ms, Venugopal; Venukumar, K T; Sundararaman, Sundar; Becker, Marissa; Moses, Stephen; Lorway, Robert
2016-01-01
HIV prevalence among female sex workers (FSWs) in India remains well above the national average. Pre-exposure prophylaxis (PrEP), a new HIV prevention technology, may help to reduce HIV incidence, but there is a dearth of research that can inform the potential scale-up of PrEP in India. In partnership with Ashodaya Samithi, a local sex worker collective, we conducted a feasibility study to assess acceptance of a planned PrEP demonstration project, willingness to use PrEP, and recommendations for project roll-out among FSWs in southern Karnataka. From January-April 2015, 6 focus group discussions, 47 in-depth interviews, and 427 interviewer-administered questionnaires were completed by female sex workers. All participants were 18 years of age or older and practiced sex work. Qualitative data were coded for key themes and emergent categories. Univariate descriptive analysis was employed to summarise the quantitative data. Qualitative. PrEP was described as an exciting new prevention technology that places control in the hands of FSWs and provides a "double safety" in combination with condom use. Participants expressed agreement that women who may experience more HIV risk in their occupational environments should be prioritized for enrollment into a demonstration project. Quantitative. 406 participants (95%) expressed interest in PrEP. Participants prioritized the inclusion of FSWs under the age of 25 (79%), those who do not use condoms when clients offer more money (58%), who do not consistently use condoms with regular partners (57%), who drink alcohol regularly (49%), and who do not use condoms consistently with clients (48%). This feasibility study indicated strong interest in PrEP and a desire to move forward with the demonstration project. Participants expressed their responses in terms of public health discourses surrounding risk, pointing to the importance of situating PrEP scale up within the trusted spaces of community-based organizations as a means of supporting PrEP uptake and adherence.
McGuinness, Sarah L; O'Toole, Joanne E; Boving, Thomas B; Forbes, Andrew B; Sinclair, Martha; Gautam, Sumit K; Leder, Karin
2017-01-01
Introduction Diarrhoea is a leading cause of death globally, mostly occurring as a result of insufficient or unsafe water supplies, inadequate sanitation and poor hygiene. Our study aims to investigate the impact of a community-level hygiene education program and a water quality intervention using riverbank filtration (RBF) technology on diarrhoeal prevalence. Methods and analysis We have designed a stepped wedge cluster randomised trial to estimate the health impacts of our intervention in 4 rural villages in Karnataka, India. At baseline, surveys will be conducted in all villages, and householders will receive hygiene education. New pipelines, water storage tanks and taps will then be installed at accessible locations in each village and untreated piped river water will be supplied. A subsequent survey will evaluate the impact of hygiene education combined with improved access to greater water volumes for hygiene and drinking purposes (improved water quantity). Villages will then be randomly ordered and RBF-treated water (improved water quality) will be sequentially introduced into the 4 villages in a stepwise manner, with administration of surveys at each time point. The primary outcome is a 7-day period prevalence of self-reported diarrhoea. Secondary outcomes include self-reported respiratory and skin infections, and reported changes in hygiene practices, household water usage and water supply preference. River, tank and tap water from each village, and stored water from a subset of households, will be sampled to assess microbial and chemical quality. Ethics and dissemination Ethics approval was obtained from the Monash University Human Research Ethics Committee in Australia and The Energy and Resources Institute Institutional Ethics Committee in India. The results of the trial will be presented at conferences, published in peer-reviewed journals and disseminated to relevant stakeholders. This study is funded by an Australian National Health and Medical Research Council (NHMRC) project grant. Trial registration number ACTRN12616001286437; pre-results. PMID:28314746
Mallikarjun, Sajjanshetty; Rao, Ashwini; Rajesh, Gururaghavendran; Shenoy, Ramya; Bh, Mithun Pai
2014-01-01
Smoking tobacco is considered as a leading cause of preventable death, mostly in developing countries like India. One of the primary goals of international tobacco control is to educate smokers about the risks associated with tobacco consumption. Tobacco warning labels (TWLs) on cigarette packages are one of the most common statutory means to communicate health risks of smoking to smokers, with the hope that once educated, they will be more likely to quit the habit. The present survey was conducted to assess the effectiveness of TWLs in communicating health risks of tobacco usage among 263 adult smokers working as bus drivers in Karnataka State Road Transport Corporation (KSRTC), Mangalore, India. Information was collected on demographic details, exposure and response to health warnings on tobacco products, intention to quit and nicotine dependency. The majority (79.5%) of the respondents revealed negative intentions towards quitting smoking. Nearly half of the participants had a 'low' nicotine dependency (47.5%) and 98.1% of the respondents had often noticed warning labels on tobacco packages. These health warnings made 71.5% of the respondents think about quitting smoking. Respondents who noticed advertisement or pictures about dangers of smoking had better knowledge, with respect to lung cancer and impotence as a consequence of tobacco. A higher exposure to warning labels was significantly associated with lower nicotine dependency levels of smokers among the present study population. A significantly higher number of respondents who noticed advertisement or pictures about the dangers of smoking thought about the risks of smoking and were more inclined to think about quitting smoking. As exposure increased, an increase in the knowledge and response of participants was also observed. Exposure to tobacco warning labels helps to educate smokers about health risks of tobacco smoking. It may be possible to promote oral health among bus drivers by developing strategies to educate them about these risk factors.
Mobile Phones: The Next Step towards Healthcare Delivery in Rural India?
DeSouza, Sherwin I.; Rashmi, M. R.; Vasanthi, Agalya P.; Joseph, Suchitha Maria; Rodrigues, Rashmi
2014-01-01
Background Given the ubiquity of mobile phones, their use to support healthcare in the Indian context is inevitable. It is however necessary to assess end-user perceptions regarding mobile health interventions especially in the rural Indian context prior to its use in healthcare. This would contextualize the use of mobile phone communication for health to 70% of the country's population that resides in rural India. Objectives To explore the acceptability of delivering healthcare interventions through mobile phones among users in a village in rural Bangalore. Methods This was an exploratory study of 488 mobile phone users, residing in a village, near Bangalore city, Karnataka, South India. A pretested, translated, interviewer-administered questionnaire was used to obtain data on mobile phone usage patterns and acceptability of the mobile phone, as a tool for health-related communication. The data is described using basic statistical measures. Results The primary use of mobile phones was to make or receive phone calls (100%). Text messaging (SMS) was used by only 70 (14%) of the respondents. Most of the respondents, 484 (99%), were willing to receive health-related information on their mobile phones and did not consider receiving such information, an intrusion into their personal life. While receiving reminders for drug adherence was acceptable to most 479 (98%) of our respondents, 424 (89%) preferred voice calls alone to other forms of communication. Nearly all were willing to use their mobile phones to communicate with health personnel in emergencies and 367 (75%) were willing to consult a doctor via the phone in an acute illness. Factors such as sex, English literacy, employment status, and presence of chronic disease affected preferences regarding mode and content of communication. Conclusion The mobile phone, as a tool for receiving health information and supporting healthcare through mHealth interventions was acceptable in the rural Indian context. PMID:25133610
Seismicity of the Earth 1900–2010 Himalaya and vicinity
Turner, Bethan; Jenkins, Jennifer; Turner, Rebecca; Parker, Amy; Sinclair, Alison; Davies, Sian; Hayes, Gavin P.; Villaseñor, Antonio; Dart, Rirchard L.; Tarr, Arthur C.; Furlong, Kevin P.; Benz, Harley M.
2013-01-01
Seismicity in the Himalaya region predominantly results from the collision of the India and Eurasia continental plates, which are converging at a relative rate of 40–50 mm/yr. Northward underthrusting of India beneath Eurasia generates numerous earthquakes and consequently makes this area one of the most seismically hazardous regions on Earth. The surface expression of the plate boundary is marked by the foothills of the north-south trending Sulaiman Range in the west, the Indo-Burmese Arc in the east, and the east-west trending Himalaya Front in the north of India. Along the western margin of the India plate, relative motions between India and Eurasia are accommodated by strike-slip, reverse, and oblique-slip faulting resulting in the complex Sulaiman Range fold and thrust belt, and the major translational Chaman Fault in Afghanistan. Beneath the Pamir‒Hindu Kush Mountains of northern Afghanistan, earthquakes occur to depths as great as 200 km as a result of remnant lithospheric subduction. Further north again, the Tian Shan is a seismically active intra-continental mountain belt defined by a series of east-west trending thrust faults thought to be related to the broad footprint of the India-Eurasia collision. Tectonics in northern India are dominated by motion along the Main Frontal Thrust and associated thrust faults of the India-Eurasia plate boundary, which have resulted in a series of large and devastating earthquakes in (and prior to) the 20th century. The Tibetan Plateau to the north of the main plate boundary is a broad region of uplift associated with the India-Eurasia collision, and is cut by a series of generally east-west trending strike-slip faults. These include the Kunlun, Haiyuan, and the Altyn Tagh faults, all of which are left-lateral structures, and the Kara-Koram right-lateral fault. Throughout the plateau, thrust faults accommodate the north-south compressional component of crustal shortening associated with the ongoing collision of India and Eurasia, while strike-slip and normal faults accommodate east-west extension. To the east, The Longmen Shan thrust belt marks the eastern margin of the Tibetan Plateau separating the complex tectonics of the plateau region from the relatively undeformed Sichuan Basin. Further south, the left-lateral Xiangshuihe-Xiaojiiang, right-lateral Red River and right-lateral Sagaing strike-slip fault systems accommodate deformation along the eastern margin of the India plate. Deep earthquakes have also occurred in the Indo-Burmese Arc region, thought to be an expression of eastward-directed subduction of the India plate, though whether subduction is ongoing is still debated.
Mattoo, Surendra K; Grover, Sandeep; Chakravarty, Kaustav; Trzepacz, Paula T; Meagher, David J; Gupta, Nitin
2012-01-01
Delirium is understudied in developing countries, where there tends to be a lower proportion of older persons and comorbid dementia. The authors assessed 100 consecutive cases of DSM-IV delirium (patients' mean age: 44.4 [standard deviation: 19.4] years; mean DRS-R98 score: 25.6 [3.6]) referred to an adult Consultation-Liaison Psychiatry service in Northern India. Disturbances of attention, orientation, visuospatial ability, and sleep disturbance were the most frequent symptoms, followed by language, thought-process abnormality, and motor agitation. A three-factor solution was identified, representing domains for cognition, higher-order thinking, and circadian rhythm/psychosis. These domains can guide studies addressing the relationship between symptom profile, therapeutic needs, and outcomes and are consistent with core domains previously identified in other countries.
NASA Astrophysics Data System (ADS)
Kiessling, Wolfgang; Kumar Pandey, Dhirendra; Schemm-Gregory, Mena; Mewis, Heike; Aberhan, Martin
2011-02-01
We present the first modern description of corals, brachiopods and bivalves from the Antalo Limestone in the Mekele Outlier of northern Ethiopia. This fauna is largely of Oxfordian age and lived in shallow subtidal environments and in small patch reefs. In combining our new data with fossil occurrence data from the Paleobiology Database, we conducted multidimensional scaling analyses to assess biogeographic patterns and the delineation of the Ethiopian Province for the Callovian to Kimmeridgian stages. Results suggest that an Ethiopian Province is indeed evident for our focal groups, but this is more confined than traditionally assumed. The so defined Ethiopian Province includes Tunisia, the Levant, Arabia and much of East Africa, but excludes Tanzania and India. The special status of India and Tanzania is perhaps due to latitudinal gradients in faunal composition.
Dahanukar, Neelesh; Krutha, Keerthi; Paingankar, Mandar S.; Padhye, Anand D.; Modak, Nikhil; Molur, Sanjay
2013-01-01
The Western Ghats of India harbors a rich diversity of amphibians with more than 77% species endemic to this region. At least 42% of the endemic species are threatened due to several anthropogenic stressors. However, information on amphibian diseases and their impacts on amphibian populations in this region are scarce. We report the occurrence of Batrachochytridium dendrobatidis (Bd), an epidermal aquatic fungal pathogen that causes chytridiomycosis in amphibians, from the Western Ghats. In the current study we detected the occurrence of a native Asian Bd strain from three endemic and threatened species of anurans, Bombay Night Frog Nyctibatrachus humayuni, Leith's Leaping Frog Indirana leithii and Bombay Bubble Nest Frog Raorchestes bombayensis, for the first time from the northern Western Ghats of India based on diagnostic nested PCR, quantitative PCR, DNA sequencing and histopathology. While, the Bd infected I. leithii and R. bombayensis did not show any external symptoms, N. humayuni showed lesions on the skin, browning of skin and sloughing. Sequencing of Bd 5.8S ribosomal RNA gene, and the ITS1 and ITS2 regions, revealed that the current Bd strain is related to a haplotype endemic to Asia. Our findings confirm the presence of Bd in northern Western Ghats and the affected amphibians may or may not show detectable clinical symptoms. We suggest that the significance of diseases as potential threat to amphibian populations of the Western Ghats needs to be highlighted from the conservation point of view. PMID:24147018
Chauhan, Parth R
2008-05-01
In the Himalayan foothills of northern India, evidence of widespread hominin occupation since at least the late Middle Pleistocene has been known since the early 20th century and indicates varied patterns of land-use and intraregional mobility. This lithic evidence primarily belongs to the Soanian industry, representing some of the highest concentrations of Paleolithic assemblages in the Old World based exclusively on pebble and cobble clasts. This body of evidence also signifies interregional dispersal from peninsular India or northern Pakistan, leading to environmental preferences that spread quickly through hominin populations in the region within a relatively short timespan. While rich in its technological repertoire, the Soanian industry is poorly- understood regarding site selection and raw material exploitation over time. Recent efforts demonstrate that Soanian sites on Siwalik frontal slopes between two major rivers vary considerably in their artifact quantities regardless of abundant raw material sources found across the landscape. Most of the assemblages suggest raw material transport distances of three kilometers or less from the localized sources. Geoarchaeological investigations at the richest known Soanian site, Toka, reveal dynamic evidence of pre- and postdepositional site formation including the exploitation of quartzite pebbles and cobbles by Pleistocene hominins from terrace and streambed contexts within a 1 km2 radius. Some field observations also disprove claims made by previous workers, of artifacts eroding out of late Pliocene exposures of the Upper Siwalik Tatrot Formation around Toka.
NASA Astrophysics Data System (ADS)
Ali, Jason R.; Aitchison, Jonathan C.
2005-10-01
"Greater India" is an 80-yr-old concept that has been used by geoscientists in plate tectonic models of the India-Asia collision system. Numerous authors working on the orogen and/or plate models of the broader region have added various sized chunks of continental lithosphere to the now northern edge of their reconstructed Indian plate. Prior to plate tectonic theory, Emile Argand (1924) [Argand, E., 1924. La tectonique de l' Asie. Proc. 13th Int. Geol. Cong. 7 (1924), 171-372.] and Arthur Holmes (1965) [Holmes, A., 1965. Principles of Physical Geology, Second Edition. The Ronald Press Company, New York, 1128.] thought that the Himalayan Mountains and Tibetan Plateau had been raised due to the northern edge of the Indian craton under-thrusting the entire region. Since the advent of plate tectonic theory, Greater India proposals have been based principally on three lines of logic. One group of workers has added various amounts of continental lithosphere to India as part of their Mesozoic Gondwana models. A second form of reconstruction is based on Himalayan crustal-shortening estimates. A third body of researchers has used India continent extensions as means of allowing initial contact between the block and the Eurasian backstop plate in southern Tibet to take place at various times between the Late Cretaceous and late Eocene in what we call "fill-the-gap" solutions. The Indian craton and the southern edge of Eurasia were almost invariably some distance from one another when the collision was supposed to have started; extensions to the sub-continent were used to circumvent the problem. Occasionally, Greater India extensions have been based on a combination of fill-the-gap and shortening estimate arguments. In this paper, we exhume and re-examine the key Greater India proposals. From our analysis, it is clear that many proponents have ignored key information regarding the sub-continent's pre break-up position within Gondwana and the bathymetry of the Indian Ocean west of Australia, in particular the Wallaby-Zenith Plateau Ridge and the Wallaby-Zenith Fracture Zone. We suggest that the Indian continent probably extended no more than 950 km in the central portion of the Main Boundary Thrust, up to the Wallaby-Zenith Fracture Zone. At the Western Syntaxis, the extension was about 600 km. These estimates are broadly compatible with some of the geophysically-derived models depicting subducted Indian lithosphere beneath Tibet, as well as estimates of Himalayan shortening. Models requiring sub-continent extensions > 9° ahead of the craton are probably wrong. We also suggest that northern India did not have a thinned rifted passive margin due to the earlier rifting of blocks away from it when it formed part of Gondwana. Instead, the boundary developed as a transform fault and probably had a very narrow ocean-continent transition zone (5-10 km wide), similar to the Romanche Fracture Zone offshore of Ghana, West Africa.
Long wavelength gravity anomalies over India: Crustal and lithospheric structures and its flexure
NASA Astrophysics Data System (ADS)
Tiwari, V. M.; Ravi Kumar, M.; Mishra, D. C.
2013-07-01
Long wavelength gravity anomalies over India were obtained from terrestrial gravity data through two independent methods: (i) wavelength filtering and (ii) removing crustal effects. The gravity fields due to the lithospheric mantle obtained from two methods were quite comparable. The long wavelength gravity anomalies were interpreted in terms of variations in the depth of the lithosphere-asthenosphere boundary (LAB) and the Moho with appropriate densities, that are constrained from seismic results at certain points. Modeling of the long wavelength gravity anomaly along a N-S profile (77°E) suggest that the thickness of the lithosphere for a density contrast of 0.05 g/cm3 with the asthenosphere is maximum of ˜190 km along the Himalayan front that reduces to ˜155 km under the southern part of the Ganga and the Vindhyan basins increasing to ˜175 km south of the Satpura Mobile belt, reducing to ˜155-140 km under the Eastern Dharwar craton (EDC) and from there consistently decreasing south wards to ˜120 km under the southernmost part of India, known as Southern Granulite Terrain (SGT). The crustal model clearly shows three distinct terrains of different bulk densities, and thicknesses, north of the SMB under the Ganga and the Vindhyan basins, and south of it the Eastern Dharwar Craton (EDC) and the Southern Granulite Terrain (SGT) of bulk densities 2.87, 2.90 and 2.96 g/cm3, respectively. It is confirmed from the exposed rock types as the SGT is composed of high bulk density lower crustal rocks and mafic/ultramafic intrusives while the EDC represent typical granite/gneisses rocks and the basement under the Vindhyan and Ganga basins towards the north are composed of Bundelkhand granite massif of the lower density. The crustal thickness along this profile varies from ˜37-38 km under the EDC, increasing to ˜40-45 km under the SGT and ˜40-42 km under the northern part of the Ganga basin with a bulge up to ˜36 km under its southern part. Reduced lithospheric and crustal thicknesses under the Vindhyan and the Ganga basins are attributed to the lithospheric flexure of the Indian plate due to Himalaya. Crustal bulge due to lithospheric flexure is well reflected in isostatic Moho based on flexural model of average effective elastic thickness of ˜40 km. Lithospheric flexure causes high heat flow that is aided by large crustal scale fault system of mobile belts and their extensions northwards in this section, which may be responsible for lower crustal bulk density in the northern part. A low density and high thermal regime in north India north of the SMB compared to south India, however does not conform to the high S-wave velocity in the northern part and thus it is attributed to changes in composition between the northern and the southern parts indicating a reworked lithosphere. Some of the long wavelength gravity anomalies along the east and the west coasts of India are attributed to the intrusives that caused the breakup of India from Antarctica, and Africa, Madagascar and Seychelles along the east and the west coasts of India, respectively.
Oral Health Literacy and Oral Health Status among Adults Attending Dental College Hospital in India.
Haridas, Reshmi; S, Supreetha; Ajagannanavar, Sunil Lingaraj; Tikare, Shreyas; Maliyil, Mathew J; Kalappa, Amrutha Ammanichanda
2014-01-01
Low health literacy is one among many reasons why preventable diseases remain so common and why people often do not adopt healthy practices. It is important to detect patients with inadequate oral health literacy (OHL) and to improve the level of communication between the provider and the patient. This study was aimed to determine the relationship between OHL with selected socio-demographic variables and oral health status among adults in Virajpet, Karnataka, India. A convenience sample of 187 subjects from the out-patient department of Coorg-Institute of Dental Sciences Hospital administered the Rapid Estimate of Adult Literacy in Dentistry (REALD-30). The demographic variables and the oral health status were recorded for every participant using World Health Organization oral health survey proforma (1997). Data were analyzed using t-tests, analysis of variance, correlations and Kruskal-Wallis test. The associations between REALD-30 scores and gender, age, and ethnicity were not statistically significant. Significant associations were found between REALD scores and the following oral-health related variables: Temperomandibular joint problems, prevalence of prosthetic need, CPI (Community Periodontal Index) and loss of attachment scores. REALD-30 scores were negatively correlated with DMFT (Decayed, Missing and Filled Teeth) scores and DAI (Dental Aesthetic Index) scores. OHL was not associated with sex, age, or ethnicity in this sample of the Virajpet population. OHL was associated with oral health status. Lower OHL was associated with poorer oral health status. OHL instruments can be considered to be included as screening tools to identifying individuals or groups with poor oral health outcomes.
Chowdappa, P; Kumar, B J Nirmal; Kumar, S P Mohan; Madhura, S; Bhargavi, B Reddi; Lakshmi, M Jyothi
2016-12-01
Severe outbreaks of Phytophthora fruit rot on brinjal, ridge gourd, and tomato have been observed since 2011 in Andhra Pradesh, Karnataka, Telangana, and Tamil Nadu states of India. Therefore, 76 Phytophthora nicotianae isolates, recovered from brinjal (17), ridge gourd (40), and tomato (19) from different localities in these states during the June to December cropping season of 2012 and 2013, were characterized based on phenotypic and genotypic analyses and aggressiveness on brinjal, tomato, and ridge gourd. All brinjal and ridge gourd isolates were A2, while tomato isolates were both A1 (13) and A2 (6). All isolates were metalaxyl sensitive. In addition, isolates were genotyped for three mitochondrial (ribosomal protein L5-small subunit ribosomal RNA [rpl5-rns], small subunit ribosomal RNA-cytochrome c oxidase subunit 2 [rns-cox2], and cox2+spacer) and three nuclear loci (hypothetical protein [hyp], scp-like extracellular protein [scp], and beta-tubulin [β-tub]). All regions were polymorphic but nuclear regions were more variable than mitochondrial regions. The network analysis of genotypes using the combined dataset of three nuclear regions revealed a host-specific association. However, the network generated using mitochondrial regions limited such host-specific groupings only to brinjal isolates. P. nicotianae isolates were highly aggressive and produced significantly (P ≤ 0.01) larger lesions on their respective host of origin than on other hosts. The results indicate significant genetic variation in the population of P. nicotianae, leading to identification of host-specific lineages responsible for severe outbreaks on brinjal, ridge gourd, and tomato.
Physicians' tobacco intervention counseling in a tertiary care hospital of South India.
Akshaya, K M; Majra, J P
2014-10-01
The tobacco epidemic is one of the biggest public health threats in the present world with a substantial contribution to mortality and morbidity. Patients' visits to their doctors for illnesses and health check-ups offer a great opportunity to screen them for tobacco use and also counsel them to quit tobacco use. This cross sectional study was carried out in out-patient departments of General Medicine and Pulmonary Medicine of a tertiary care medical college teaching hospital in Dakshina Kannada district of Karnataka state of India between April 2012 and July 2012 among the patients aged 18 years or above who were diagnosed as suffering from tobacco related diseases. Exit interview was conducted on the patients after obtaining a written informed consent using a pre designed semi-structured questionnaire. Data was entered, analyzed using SPSS v17 and Descriptive statistics, Fisher Exact test, Bivariate and multivariable logistic regression analyses were used. The present study reveals that 305 (87.1 %), 281 (80.3 %) and 257 (73.1 %) of the 350 participants were asked, assessed and advised respectively by the treating physicians to quit tobacco use where as only 18 (15.1 %) were assisted in their efforts to quit tobacco. Physician's counseling inventions were significantly associated with patient's age, sex, education, marital status and socio economic status of the patients as well as the treating physician's experience of more than 3 years. There is a need to incorporate tobacco history taking as a vital sign during medical history taking and this should be made as a routine in medical schools.
Chandel, Neha Palo; Bhat, Vidya V; Bhat, B S; Chandel, Sidharth S
2016-10-01
Advanced fertilization techniques like frozen embryo transfer (FET) and assisted reproductive technology have become popular and commonly used methods to treat patients suffering from infertility. Incidences of infertility are on a rise due to increased representation of females in the work place, delay in marriages, stress, and ignorance. We performed this prospective therapeutic study to compare FET and fresh embryo transfer in the treatment of infertility in terms of conception rate, patient acceptance, complications, and patient's compliance. A prospective screening therapeutic study on 108 patients, from September 2013 to September 2014 in Karnataka, India, randomized the patients into 2 groups (n = 54), Group-I treated with day-3 FET while Group-II was treated with fresh embryo transfer, after performing ICSI. In 108 patients, 45 % patients were within 35 years of age, 35 % were in the age group 35-39. Significantly, 22 (40.75 %) patients treated with FET conceived (P = 0.022), whereas 16 (29.63 %) patients treated with fresh embryo transfer conceived (P = 0.59). There is limited published literature from the subcontinent, comparing techniques like FET and embryo transfers in the treatment of infertility. Awareness and economic reforms must be formulated in India to facilitate individuals facing infertility problems to conceive. FET has better and significant conception rates compared to fresh embryo transfers. FET shares an advantage of providing good quality embryos for future and subsequent implantations in cases of failure. Patient counseling and motivation play a pivotal role in the success of therapeutic procedure.
Ahmed, Mansoor; Zama, Syed Y; Nagarajarao, Vadiraja; Khan, Mudassir A
2014-01-01
Iodine is an essential component of the hormones produced by the thyroid gland that are essential for mammalian life. Although goiter is the most visible sequelae of iodine deficiency, the major impact of hypothyroidism as a result of iodine deficiency is impaired neurodevelopment, particularly early in life. According to the World Health Organization, it is the single most preventable cause of mental retardation and brain damage. The simplest, most effective and inexpensive preventive method is the consumption of iodized salt. The objective of the following study is to estimate the prevalence of goiter in children in the rural areas of Mysore and Coorg districts in India and estimate iodine levels in salt samples. A cross-sectional study in the age group of 6-12 years, using population proportionate to size systematic sampling method. The total sample size was 10,082: out of which 5337 was from Mysore and the rest from Coorg district. Clinical examination of the thyroid gland was done and salt samples collected for the estimation of Iodine. The total prevalence of goiter was 19.01% in children of 6-12 years in Coorg district and 8.77% in Mysore district and it was more in females than in males. It was observed that iodine deficiency disorders is endemic in both districts, with a prevalence of 19.01% in children aged 6-12 years in Coorg district and 8.77% in Mysore district. Analysis of salt samples suggested that most of the samples were inadequately iodised (73.92% in Coorg and 45.92% in Mysore).
Sexual behavior and job stress in software professionals, Bengaluru - India
Babu, Giridhara R.; Mahapatra, Tanmay; Mahapatra, Sanchita; Detels, Roger
2013-01-01
Background: Sexually transmitted diseases are now gradually affecting the general population groups increasingly. Our earlier observations from qualitative research called for an effort to understand the sexual exposure, activity and behavior of the workers in these software professionals in Bengaluru, India. Aim: The current study is explored to understand the association of the sexual behaviors with Job. Materials and Methods: The study design employed was a cross-sectional study using a mixed sampling method. A total of 1071 subjects from software sector in Bengaluru, the capital city of Karnataka completed the self-administered questionnaire. The source population comprised all information technology/information technology enabled services (IT/ITES) professionals aged 20-59 years working in “technical functions” in 21 selected worksites (units) of the software industry. The exposure of interest was job stressors and the outcome measures were sexual behaviors in the form of having multiple sexual partners, paid sex in last 3 months and frequency of intercourse with irregular sexual partners and condom use with regular partners during last sexual act. Results: Among the study population, 74.3% reported not using a condom during their last vaginal intercourse with their regular partner. Regression estimates indicated that workers with high physical stressors had 6 times odds of having paid for sex in last 3 months and those with a moderate level of income related stress had 2.4 times likelihood of not using a condom during the last sexual intercourse with their regular partner. Conclusion: There is scope for starting prevention programs among young professionals in the IT/ITES sector to mitigate their possible risk behaviors. PMID:24421592
Holikatti, Prabhakar C; Kar, Nilamadhab
2015-01-01
It is common knowledge that patients seek treatment for psychiatric illnesses from various sources including the alternative medicine. Views and attitudes of clinicians often influence the provision of appropriate mental health care for these patients. In this context, it was intended to study the views of the practitioners of alternative medicine toward psychiatric disorders, patients and interventions. The study was conducted as a questionnaire-based survey among a sample of practitioners of alternative medicine specifically Ayurveda and Homeopathy, who were practicing in Solapur and adjoining areas of Maharashtra and Karnataka states in India. A semi-structured Attitudinal Inventory for Psychiatry questionnaire was used. Demographic and professional data were collected. Out of 62 practitioners approached, 50 responded (80.6%). There were no significant differences in the views of practitioners toward psychiatry and psychiatrists based on respondents' gender, place of residence, location of practice, type of alternative medicine, exposure to psychiatric patients, or if they knew someone with psychiatric illness. Attitudes were generally positive, but variable. Among negative observations were that approximately 60% of respondents felt that a patient can be disadvantaged by being given a psychiatric label and 58% believed that emotions are difficult to handle. A considerable proportion (40%) of the respondents felt doctors other than psychiatrists were unable to identify psychiatric disorders. This study's findings suggest that practitioners of alternative medicine have mixed views about mental illness, patients and treatment. Some of their negative views and perceived inability to identify psychiatric disorders may be addressed through further training, information sharing and collaborative work.
Atmospheric Science Data Center
2013-04-16
... an immense wintertime pool of pollution over the northern Indian state of Bihar. The discovery was made by researchers analyzing four ... Urbana-Champaign . MISR was built and is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Science Mission ...
Jade, Sridevi; Shrungeshwara, T S; Kumar, Kireet; Choudhury, Pallabee; Dumka, Rakesh K; Bhu, Harsh
2017-09-12
We estimate a new angular velocity for the India plate and contemporary deformation rates in the plate interior and along its seismically active margins from Global Positioning System (GPS) measurements from 1996 to 2015 at 70 continuous and 3 episodic stations. A new India-ITRF2008 angular velocity is estimated from 30 GPS sites, which include stations from western and eastern regions of the plate interior that were unrepresented or only sparsely sampled in previous studies. Our newly estimated India-ITRF2008 Euler pole is located significantly closer to the plate with ~3% higher angular velocity than all previous estimates and thus predicts more rapid variations in rates and directions along the plate boundaries. The 30 India plate GPS site velocities are well fit by the new angular velocity, with north and east RMS misfits of only 0.8 and 0.9 mm/yr, respectively. India fixed velocities suggest an approximate of 1-2 mm/yr intra-plate deformation that might be concentrated along regional dislocations, faults in Peninsular India, Kachchh and Indo-Gangetic plain. Relative to our newly-defined India plate frame of reference, the newly estimated velocities for 43 other GPS sites along the plate margins give insights into active deformation along India's seismically active northern and eastern boundaries.
Khan, M M; Sharma, S; Tripathi, B; Alvarez, F P
2017-01-01
To conduct a budget impact analysis (BIA) of introducing the immunization recommendations of India Expert Advisory Group (IEAG) for the years 2015-2017. The recommendations include introduction of one inactivated poliomyelitis vaccine (IPV) dose in the regular child immunization programme along with reductions in oral polio vaccine (OPV) doses in supplemental programmes. This is a national level analysis of budget impact of new polio immunization recommendations. Since the states of India vary widely in terms of size, vaccine coverage and supplemental vaccine needs, the study estimated the budget impact for each of the states of India separately to derive the national level budget impact. Based on the recommendations of IEAG, the BIA assumes that all children in India will get an IPV dose at 14 weeks of age in addition to the OPV and DPT (or Pentavalent-3) doses. Cost of introducing the IPV dose was estimated by considering vaccine price and vaccine delivery and administration costs. The cost savings associated with the reduction in number of doses of OPV in supplemental immunization were also estimated. The analysis used India-specific or international cost parameters to estimate the budget impact. Introduction of one IPV dose will increase the cost of vaccines in the regular immunization programme from $20 million to $47 million. Since IEAG recommends lower intensity of supplemental OPV vaccination, polio vaccine cost of supplemental programme is expected to decline from $72 million to $53 million. Cost of administering polio vaccines will also decline from $124 million to $105 million mainly due to the significantly lower intensity of supplemental polio vaccination. The net effect of adopting IEAG's recommendations on polio immunization turns out to be cost saving for India, reducing total polio immunization cost by $6 million. Additional savings could be achieved if India adopts the new policy regarding the handling of multi-dose vials after opening. Introduction of three doses of IPV with the existing polio immunization schedule will increase the budget requirement by $102 million but replacing OPV doses with IPV will increase the budget by about $59 million. Discontinuation of supplemental OPV immunization with replacement of OPV by IPV will reduce the Government of India's (GOI) polio immunization budget by $99 million. Although the overall cost of polio programme will decline with the adoption of IEAG's recommendations, state-level costs will vary widely. In states like Kerala, Karnataka, Uttar Pradesh and Andhra Pradesh, cost of polio immunization will increase while in Punjab and Jharkhand the costs will remain more or less constant. Significant cost reductions will happen in states with high intensity of supplemental polio immunizations (Bihar, Haryana and Delhi). The cost of procuring polio vaccines will more than double from $20 million to about $47 million requiring allocation of additional foreign exchanges. In some states (like Bihar), the decline in polio-related employment will be very high requiring reallocation of personnel from polio to other programmes. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.
Work status and health of women: a comparative study of northern and southern states of rural India.
Basu, Sharmishtha; Sidh, Shiv Narayan
2008-01-01
The paper examines the net effect of work status on women's health and whether the effect persists after controlling for the influence of socio-economic factors. Our hypothesis is that working women face a greater risk of morbidity and mortality, given that most would be expected to shoulder dual responsibilities: market and household. The paper also examines whether the risk varies across regions. In particular, we examine whether the work status-health relationship differs between the southern and northern regions of India, which are known to be distinct in female autonomy. While women in India face many serious health concerns, this analysis focuses on only two issues: nutritional status (as measured by body mass index and prevalence of anemia) and reproductive health (as assessed by the presence of reproductive health problems) of women from villages in the study area. Results show that though both work status and socio-economic factors influence health status, the latter are more important; most of the gross effect of work status is due to socio-economic conditions rather than work participation. This calls for policy intervention in providing better health facilities, female education and supplementary nutrition programs for poor women.
Spatial access to inpatient health care in northern rural India.
Ranga, Vikram; Panda, Pradeep
2014-05-01
Access to health care in rural areas is a major concern for local populations as well as for policy makers in developing countries. This paper examines spatial access to in-patient health care in northern rural India. In order to measure spatial access, impedance-based competition using the Three-Step floating Catchment Area (3SFCA) method, a modification of the simple gravity model, was used. 3SFCA was chosen for the study of the districts of Pratapgarh and Kanpur Dehat in the Uttar Pradesh state and Vaishali in the Bihar state, two of India's poorest states. This approach is based on discrete distance decay and also considers more parameters than other available methods, hence is believed to be a robust methodology. It was found that Vaishali district has the highest spatial access to in-patient health care followed by Pratapgarh and Kanpur Dehat. There is serious lack of health care, in Pratapgarh and Kanpur Dehat with 40% and 90% of the villages having shortage of in-patient care facilities in these respective districts. The most important factor affecting spatial access was found to be the distance to the nearest major urban agglomeration.
Cost analysis of a primary health centre in northern India.
Anand, K; Kapoor, S K; Pandav, C S
1993-01-01
Cost data are useful in health planning, budgeting and for assessing the efficiency of services. However, such data are not easily available from developing countries. We therefore estimated the cost incurred for the year 1991-92 on a primary health centre in northern India, which is affiliated to an academic institution. The total costs incurred included the capital costs for land, building, furniture, vehicles and equipment as well as the recurrent costs for salaries, drugs and vaccines, diesel and maintenance. Except for land, where the 'opportunity cost' was calculated, the current market rates were considered for all other factors. A discount rate of 10% was used in the study. A total of Rs 777,015 (US $24,282) was incurred on the primary health centre in the study year, 80% being recurrent costs. Salaries constituted 62% of the total costs. A sum of Rs 30 (US $0.94) per head per year on primary health care was being incurred. Salaries constitute the bulk of the cost incurred on health. Approximately Rs 28 (40%) of the Rs 69 spent per head per year on health services by the Government of India is incurred on providing primary health care services.
Implementing a sharps injury reduction program at a charity hospital in India.
Gramling, Joshua J; Nachreiner, Nancy
2013-08-01
Health care workers in India are at high risk of developing bloodborne infections from needlestick injuries. Indian hospitals often do not have the resources to invest in safety devices and protective equipment to decrease this risk. In collaboration with hospital staff, the primary author implemented a sharps injury prevention and biomedical waste program at an urban 60-bed charity hospital in northern India. The program aligned with hospital organizational objectives and was designed to be low-cost and sustainable. Occupational health nurses working in international settings or with international workers should be aware of employee and employer knowledge and commitment to occupational health and safety. Copyright 2013, SLACK Incorporated.
Climate Penalty on Air Quality and Human Health in China and India
NASA Astrophysics Data System (ADS)
Li, M.; Zhang, S.; Garcia-Menendez, F.; Monier, E.; Selin, N. E.
2017-12-01
Climate change, favoring more heat waves and episodes of stagnant air, may deteriorate air quality by increasing ozone and fine particulate matter (PM2.5) concentrations and high pollution episodes. This effect, termed as "climate penalty", has been quantified and explained by many earlier studies in the U.S. and Europe, but research efforts in Asian countries are limited. We evaluate the impact of climate change on air quality and human health in China and India using a modeling framework that links the Massachusetts Institute of Technology Integrated Global System Model to the Community Atmosphere Model (MIT IGSM-CAM). Future climate fields are projected under three climate scenarios including a no-policy reference scenario and two climate stabilization scenarios with 2100 total radiative forcing targets of 9.7, 4.5 and 3.7 W m-2, respectively. Each climate scenario is run for five representations of climate variability to account for the role of natural variability. Thirty-year chemical transport simulations are conducted in 1981-2010 and 2086-2115 under the three climate scenarios with fixed anthropogenic emissions at year 2000 levels. We find that 2000—2100 climate change under the no-policy reference scenario would increase ozone concentrations in eastern China and northern India by up to 5 ppb through enhancing biogenic emissions and ozone production efficiency. Ozone extreme episodes also become more frequent in these regions, while climate policies can offset most of the increase in ozone episodes. Climate change between 2000 and 2100 would slightly increase anthropogenic PM2.5 concentrations in northern China and Sichuan province, but significantly reduce anthropogenic PM2.5 concentrations in southern China and northern India, primarily due to different chemical responses of sulfate-nitrate-ammonium aerosols to climate change in these regions. Our study also suggests that the mitigation costs of climate policies can be partially offset by health benefits from reduced climate-induced air pollution in China.
Reconstructing the role of South China in Pangea and earlier supercontinents
NASA Astrophysics Data System (ADS)
Cawood, Peter; Zhao, Guochun; Yao, Jinlong; Wang, Wei; Xu, Yajun; Wang, Yuejun
2017-04-01
The history of the South China Craton and the constituent Yangtze and Cathaysia blocks is directly linked to Earth's Phanerozoic and Precambrian record of supercontinent assembly and dispersal. Exposed Archean rocks are limited to isolated fragments in the Yangtze Block and preserve a record of Meso- to Neo-Archean igneous activity, sedimentation and metamorphism associated with a period of global craton formation and stabilization that corresponds with assembly of the Kenor supercontinent/supercraton. However, there is insufficient data to link its history with other similar aged cratons. The tectonostratigraphic record in South China in the Paleoproterozoic, corresponding with assembly of Nuna, suggests that rock units in the Yangtze Block were spatially linked with northwestern Laurentia and possibly Siberia, whereas Cathaysia was joined to northern India. From the formation of Rodinia at the end of the Mesoproterozoic through to that of Pangea in the mid-Paleozoic, Cathaysia remained joined to northern India. Early Neoproterozoic supra-subduction zone magmatic arc-back arc assemblages ranging in age from 1000 Ma to 810 Ma occur within Cathaysia, along its northwestern margin, and along the southeastern margin of the Yangtze Block. These rocks provide a record of convergent plate interaction along the periphery of Rodinia, which continued along the western margin of the Yangtze Block until around 700 Ma and correlates with similar along strike subduction zone magmatism in northwest India, Seychelles and Madagascar. During final assembly of Gondwana in the early Paleozoic suturing of India-South China with the Western Australia-Mawson blocks along the Kuunga Orogen resulted in the accretion of the Sanya Block of Hainan Island with the rest of Cathaysia. The accretion of Laurussia to Gondwana in the mid-Paleozoic to form Pangea corresponds with the initiation of lithospheric extension along the northern margin of Gondwana and the separation of a number of continental blocks, including South China, which then drifted northward across the Paleo-Tethys to collide with the Asian segment of Pangea in the Permo-Triassic.
Bradley, Janet; Mony, Prem; Cunningham, Troy; Washington, Maryann; Bhat, Swarnarekha; Rao, Suman; Thomas, Annamma; S, Rajaram; Kar, Arin; N, Swaroop; B M, Ramesh; H L, Mohan; Fischer, Elizabeth; Crockett, Maryanne; Blanchard, James; Moses, Stephen; Avery, Lisa
2016-01-01
Background In India, although the proportion of institutional births is increasing, there are concerns regarding quality of care. We assessed the effectiveness of a nurse-led onsite mentoring program in improving quality of care of institutional births in 24/7 primary health centres (PHCs that are open 24 hours a day, 7 days a week) of two high priority districts in Karnataka state, South India. Primary outcomes were improved facility readiness and provider preparedness in managing institutional births and associated complications during child birth. Methods All functional 24/7 PHCs in the two districts were included in the study. We used a parallel, cluster randomized trial design in which 54 of 108 facilities received six onsite mentoring visits, along with an initial training update and specially designed case sheets for providers; the control arm received just the initial training update and the case sheets. Pre- and post-intervention surveys were administered in April-2012 and August-2013 using facility audits, provider interviews and case sheet audits. The provider interviews were administered to all staff nurses available at the PHCs and audits were done of all the filled case sheets during the month prior to data collection. In addition, a cost analysis of the intervention was undertaken. Results Between the surveys, we achieved coverage of 100% of facilities and 91.2% of staff nurse interviews. Since the case sheets were newly designed, case-sheet audit data were available only from the end line survey for about 80.2% of all women in the intervention facilities and 57.3% in the control facilities. A higher number of facilities in the intervention arm had all appropriate drugs, equipment and supplies to deal with gestational hypertension (19 vs.3, OR (odds ratio) 9.2, 95% C.I 2.5 to33.6), postpartum haemorrhage (29 vs. 12, OR 3.7, 95% C.I 1.6 to8.3); and obstructed labour (25 vs.9, OR 3.4, 95% CI 1.6 to8.3). The providers in the intervention arm had better knowledge of active management of the third stage of labour (82.4% vs.35.8%, AOR (adjusted odds ratio) 10, 95% C.I 5.5 to 18.2); management of maternal sepsis (73.5% vs. 10.9%, AOR 36.1, 95% C.I 13.6 to 95.9); neonatal resuscitation (48.5% vs.11.7%, AOR 10.7, 95% C.I 4.6 to 25.0) and low birth weight newborn care (58.1% vs. 40.9%, AOR 2.4, 95% C.I 1.2 to 4.7). The case sheet audits revealed that providers in the intervention arm showed greater compliance with the protocols during labour monitoring (77.3% vs. 32.1%, AOR 25.8, 95% C.I 9.6 to 69.4); delivery and immediate post-partum care for mothers (78.6% vs. 31.8%, AOR 22.1, 95% C.I 8.0 to 61.4) and for newborns (73.9% vs. 32.8%, AOR 24.1, 95% C.I 8.1 to 72.0). The cost analysis showed that the intervention cost an additional $5.60 overall per delivery. Conclusions The mentoring program successfully improved provider preparedness and facility readiness to deal with institutional births and associated complications. It is feasible to improve the quality of institutional births at a large operational scale, without substantial incremental costs. Trial Registration ClinicalTrials.gov NCT02004912 PMID:27658215
NASA Technical Reports Server (NTRS)
Kaskaoutis, Dimitris G.; Singh, Ramesh.P.; Gautam, Ritesh; Sharma, Manish; Kosmopoulos, P. G.; Tripathi, S. N.
2012-01-01
Natural and anthropogenic aerosols over northern India play an important role in influencing the regional radiation budget, causing climate implications to the overall hydrological cycle of South Asia. In the context of regional climate change and air quality, we discuss aerosol loading variability and trends at Kanpur AERONET station located in the central part of the Indo-Gangetic plains (IGP), during the last decade (2001-10). Ground-based radiometric measurements show an overall increase in column-integrated aerosol optical depth (AOD) on a yearly basis. This upward trend is mainly due to a sustained increase in the seasonal/monthly averaged AOD during the winter (Dec-Feb) and post-monsoon (Oct-Nov) seasons (dominated by anthropogenic emissions). In contrast, a neutral to weak declining trend is observed during late pre-monsoon (Mar-May) and monsoon (Jun-Sep) months, mainly influenced by inter-annual variations of dust outbreaks. A general decrease in coarse-mode aerosols associated with variable dust activity is observed, whereas the statistically significant increasing post-monsoon/winter AOD is reflected in a shift of the columnar size distribution towards relatively larger particles in the accumulation mode. Overall, the present study provides an insight into the pronounced seasonal behavior in aerosol loading trends and, in general, is in agreement with that associating the findings with those recently reported by satellite observations (MODIS and MISR) over northern India. Our results further suggest that anthropogenic emissions (due mainly to fossil-fuel and biomass combustion) over the IGP have continued to increase in the last decade.
NASA Astrophysics Data System (ADS)
Chowdari, Swarnapriya; Singh, Bijendra; Rao, B. Nageswara; Kumar, Niraj; Singh, A. P.; Chandrasekhar, D. V.
2017-08-01
Intracratonic South Rewa Gondwana Basin occupies the northern part of NW-SE trending Son-Mahanadi rift basin of India. The new gravity data acquired over the northern part of the basin depicts WNW-ESE and ENE-WSW anomaly trends in the southern and northern part of the study area respectively. 3D inversion of residual gravity anomalies has brought out undulations in the basement delineating two major depressions (i) near Tihki in the north and (ii) near Shahdol in the south, which divided into two sub-basins by an ENE-WSW trending basement ridge near Sidi. Maximum depth to the basement is about 5.5 km within the northern depression. The new magnetic data acquired over the basin has brought out ENE-WSW to E-W trending short wavelength magnetic anomalies which are attributed to volcanic dykes and intrusive having remanent magnetization corresponding to upper normal and reverse polarity (29N and 29R) of the Deccan basalt magnetostratigrahy. Analysis of remote sensing and geological data also reveals the predominance of ENE-WSW structural faults. Integration of remote sensing, geological and potential field data suggest reactivation of ENE-WSW trending basement faults during Deccan volcanism through emplacement of mafic dykes and sills. Therefore, it is suggested that South Rewa Gondwana basin has witnessed post rift tectonic event due to Deccan volcanism.
Fluoride contamination in drinking water in rural habitations of northern Rajasthan, India.
Suthar, Surindra; Garg, Vinod K; Jangir, Sushant; Kaur, Simarjeet; Goswami, Nidhi; Singh, Sushma
2008-10-01
This study was carried out to assess the fluoride concentration in groundwater in some villages of northern Rajasthan, India, where groundwater is the main source of drinking water. Water samples collected form deep aquifer based hand-pumps were analysed for fluoride content. Fluoride in presently studied sites was recorded in the ranges of 4.78 and 1.01 mg/l. The average fluoride concentration for this region was recorded 2.82 mg/l. As per the desirable and maximum permissible limit for fluoride in drinking water, determined by WHO or by Bureau of Indian Standards, the groundwater of about 95 of the studied sites is unfit for drinking purposes. Due to the higher fluoride level in drinking water several cases of dental and skeletal fluorosis have appeared at alarming rate in this region. The middle and eastern parts of the Hanumangarh, a northern most district of the state, can be classified as higher risk area for fluorosis; due to relatively high concentrations of fluoride (3-4 mg/l) in groundwater of this region. After evaluating the data of this study it is concluded that there is an instant need to take ameliorative steps in this region to prevent the population from fluorosis.
Meta-analysis of classical swine fever prevalence in pigs in India: A 5-year study
Patil, S. S.; Suresh, K. P.; Saha, S.; Prajapati, A.; Hemadri, D.; Roy, P.
2018-01-01
Aim: The aim of the study was to determine the overall prevalence of classical swine fever (CSF) in pigs in India, through a systematic review and meta-analysis of published data. Materials and Methods: Consortium for e-Resources in Agriculture, India, Google Scholar, PubMed, annual reports of All India Coordinated Research Project on Animal Disease Monitoring and Surveillance, and All India Animal Disease database of NIVEDI (NADRES) were used for searching and retrieval of CSF prevalence data (seroprevalence, virus antigen, and virus nucleic acid detection) in India using a search strategy combining keywords and related database-specific subject terms from January 2011 to December 2015 in English only. Results: A total of 22 data reports containing 6,158 samples size from 18 states of India were used for the quantitative synthesis, and overall 37% (95% confidence interval [CI]=0.24, 0.51) CSF prevalence in India was estimated. The data were classified into 4 different geographical zones of the country: 20% (95% CI=0.05, 0.55), 31% (95% CI=0.18, 0.47), 55% (95% CI=0.32, 0.76), and 34% (95% CI=0.14, 0.62). CSF prevalence was estimated in northern, eastern, western, and southern regions, respectively. Conclusion: This study indicates that overall prevalence of CSF in India is much lower than individual published reports. PMID:29657420
Shashibhushan, Kukkalli Kamalaksharappa; Pradeep, Muttugadur Chandrappa; Babaji, Prashant; Reddy, Vundela Rajashekar
2017-01-01
Introduction Oral health is an integral part of general health. Dental problems can be avoided if identified at an early stage. There is no data on oral health status of school going children in Karnataka state’s Shimoga city. Aim To evaluate oral health status of school going children among 5-15-year-old in Shimoga city. Materials and Methods A cross-sectional study was conducted among 1458 government and private school children aged 5-6, 9-10 and 14-15 years. Dental caries (DMFT and deft Index), oral hygiene status (OHI-S Index) and dental fluorosis (Dean’s Fluorosis Index) according to WHO diagnostic criteria (1997) were assessed. Data was evaluated using ANOVA and t-test by SPSS (IBM statistical software version 21.0.) at a level of 5% significance. Results The deft among 5-6-year-old children was 3.36±3.511, deft and DMFT among 9-10-year-old was 2.55±2.497 and 0.45±0.996 respectively and DMFT among 14-15-year-old was 1.34±1.832. The caries prevalence among 5-6-year-old was 68.8%, 9-10-year-old was 77.2% and 14-15-year-old was 48.9% and overall prevalence of dental caries was 65.3% which was statistically significant. Among 9-10-year-old oral hygiene was good in 85.4%, fair in 13.5% and poor in 1% of school children and among 14-15-year-old oral hygiene was good in 77.4%, fair in 22.2% and poor in 0.4%. Overall 81.7% of children had good oral hygiene. The prevalence of dental fluorosis was 14.5%. Conclusion The children from government school were found to be less caries free than the private school children, but the difference was not significant. Oral hygiene status is found to be good among both the private and government school children. So the dental awareness is required among children of government school. PMID:28893041
NASA Astrophysics Data System (ADS)
Orr, Elizabeth N.; Owen, Lewis A.; Murari, Madhav K.; Saha, Sourav; Caffee, Marc W.
2017-05-01
The glacial history of three tributary valleys (Namlung, Gopal Kangri and Stok Kangri) of the Stok valley, south of the Indus valley in the northern sector of the Zanskar Range, northern India is characterized using geomorphic mapping and cosmogenic 10Be surface exposure dating. The new glacial chronostratigraphy for the Stok valley is the first for the northern Zanskar Range and provides insights into the spatial variability of glaciation in the Himalayan-Tibetan orogen. This framework facilitates the understanding of the nature and the timing of landscape evolution and paleoenvironmental change in the Himalayan-Tibetan orogen. At least four glacial stages are evident within each of the tributary valleys of Gopal Kangri (MG1-MG4, youngest to oldest) and Stok Kangri (MS1-MS4) that feed into the Stok valley. With the exception of the MG4 glacial advance ( 124 ka) in Gopal Kangri, the Stok valley has preserved evidence of glaciations from 50 ka to the present. Equilibrium-line altitudes and glacier reconstructions for the Stok valley and its tributaries demonstrate that glaciations have become progressively less extensive through time. Former glacier extents of the Stok region are comparable in length with glacial advances during the last glacial cycle in eastern Zanskar and in the southern Ladakh Range to the south and north of the Indus valley, respectively. Landscape evolution in the study area has occurred across numerous glacial-interglacial cycles by a combination of glacial and fluvial processes and is similar to that of the Ladakh Range.
Sheoran, Nayantara
2015-01-01
Available without prescriptions in India since 2005, emergency contraceptive pills (ECPs) and their advertisements have provided women with increased contraceptive options and a vocabulary to talk about their reproductive lives. I draw on long-term fieldwork with women in urban India about ECPs, demonstrating a new form of 'stratified contraception' enabled by these pills and their advertisements. I posit that there are within India spaces that replicate the luxuries and privileges of the global North. These material conditions, I suggest, are replicated when it comes to contraception as there are hubs of women consumers of contraception and contraceptive advertising that participate in an 'imagined cosmopolitanism' within the global South in close proximity to 'contraceptive ghettos.' Moving beyond simplistic binaries, I outline three major stratifications along which women experience this medical technology and outline the implications for women and their contraceptive choices when notions of northern privilege exist in the 'South.'
NASA Technical Reports Server (NTRS)
2008-01-01
Delhi is the second largest metropolis in India, with a population of 16 million. Located in northern India along the banks of the Yamuna River, Delhi has the status of a federally-administered union territory. Within it is the district of New Delhi, India's capital. Delhi is one of the oldest continually inhabited cites in the world, with traces of human occupation dating to the second millennium BC. The image was acquired September 22, 2003, covers an area of 30.6 x 34.8 km, and is located near 28.6 degrees north latitude, 77.2 degrees east longitude. The image was acquired on August 4, 2005, covers an area of 55.8 x 55.8 km, and is located at 68.6 degrees north latitude, 134.7 degrees west longitude. The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.Earth observation taken by the Expedition 28 crew
2011-08-21
ISS028-E-029679 (21 Aug. 2011) --- A night time view of India-Pakistan borderlands is featured in this image photographed by an Expedition 28 crew member on the International Space Station. Clusters of yellow lights on the Indo-Gangetic Plain of northern India and northern Pakistan reveal numerous cities both large and small in this photograph. Of the hundreds of clusters, the largest are the metropolitan areas associated with the capital cities of Islamabad, Pakistan in the foreground and New Delhi, India at the top?for scale these metropolitan areas are approximately 700 kilometers apart. The lines of major highways connecting the larger cities also stand out. More subtle but still visible at night are the general outlines of the towering and partly cloud-covered Himalayan ranges immediately to the north (left). A striking feature of this photograph is the line of lights, with a distinctly more orange hue, snaking across the central part of the image. It appears to be more continuous and brighter than most highways in the view. This is the fenced and floodlit border zone between the countries of India and Pakistan. The fence is designed to discourage smuggling and arms trafficking between the two countries. A similar fenced zone separates India?s eastern border from Bangladesh (not visible). This image was taken with a 16-mm lens, which provides the wide field of view, as the space station was tracking towards the southeast across the subcontinent of India. The station crew took the image as part of a continuous series of frames, each frame taken with a one-second exposure time to maximize light collection ? unfortunately, this also causes blurring of some ground features. The distinct, bright zone above the horizon (visible at top) is produced by airglow, a phenomena caused by excitation of atoms and molecules high in the atmosphere (above 80 kilometers, or 50 miles altitude) by ultraviolet radiation from the sun. Part of the ISS Permanent Multipurpose Module, or PMM, and a solar panel array are visible at right.
Structural patterns in high grade terrain in parts of Tamil Nadu and Karnataka
NASA Technical Reports Server (NTRS)
Sugavanam, E. B.; Vidyadharan, K. T.
1988-01-01
Detailed geological mapping in parts of Tamil Nadu and Karnataka has brought out vast areas occupied by highly deformed charnockite and high grade gneisses. These areas, similar to high grade shield terrains in other parts of the world have the impress of extensive tectonic reworking multideformation and polymetamorphism and are closely associated with layered ultramafics, shelf type sediments and different igneous events. In North Arcot and Charmapuri districts of Tamil Nadu and Kollegal taluk in Mysore district in Karnataka, charnockite is intensely cofolded with a supracrustal succession of layered ultramafics, pyroxene granulite, pink granolites, magnetite quartzite and khondalites. These areas have undergone five phases of deformation, five generations of basic dyke activities, four phases of migmatisation and two periods of metallogeny. Geochronological data ranges from 2900 m.y. to 750 m.y. In working out the tectanostratigraphy of the above areas the basic dykes of different generations have served as major time markers. In addition, the persistent strike continuity of linear bands of pyroxene granulite, pink granolite and magnetite quartzite has been of great utility in using them as structural markers for bringing out the complex structural history in these areas.
Gudlavalleti, Murthy Venkata S; John, Neena; Allagh, Komal; Sagar, Jayanthi; Kamalakannan, Sureshkumar; Ramachandra, Srikrishna S
2014-11-01
Data shows that people with disability are more disadvantaged in accessing health, education and employment opportunities compared to people without a disability. There is a lack of credible documented evidence on health care access and barriers to access from India. The South India Disability Evidence (SIDE) Study was undertaken to understand the health needs of people with disabilities, and barriers to accessing health services. The study was conducted in one district each in two States (Andhra Pradesh and Karnataka) in 2012. Appropriate age and sex-matched people without a disability were recruited to compare with people with disability who were identified through a population-based survey and available government disability records by trained key informants. These people were then examined by a medical team to confirm the diagnosis. Investigators administered questionnaire schedules to people with and without a disability to harness information on employment and health service access, utilization and barriers. A total of 839 people with disabilities and 1153 age and sex matched people without a disability, aged 18 years or more were included. People with disability had significantly lower employment rates. On univariate analysis, people with disability (18.4%) needed to visit a hospital significantly more often in the preceding year compared to people without a disability (8.8%) (X2- 40.0562; P < =0.001). However adjusted odds ratios did not show a statistically significant difference. Significant differences were also observed with respect to past hospitalization. People with disabilities had 4.6 times higher risk of suffering from diabetes and 5.8 times higher risk of suffering from depression compared to people without a disability and the risk was significantly higher in males compared to females with disability. People with disability faced significantly more barriers to accessing health services compared to people without a disability. Barriers included ignorance regarding availability of services, costs of services and transportation. This study highlights the challenges that people with disability face in accessing health-care and employment opportunities. The study findings have public health implications and should be used for planning need-based appropriate strategies to improve health care access for people with disabilities.
Earth observations during STS-68
1998-04-14
STS068-L158-000C (30 September-11 October 1994) --- This south-looking view shows most of the west end of snow-dusted ranges on the Tibetan Plateau. A major fault line separates the plateau from the low-lying Takla Makan Desert (foreground). The darker areas along two rivers (foreground) make up one of the largest agricultural regions in the Takla Makan Desert. The hazy atmosphere over India (top) contrasts with the thinner, clear air over the plateau. The Vale of Kashmir in northern India is the prominent valley within the first wall of the Himalayan Mountains.
Nutrient environment of red tide- infested waters off south-west coast of India.
Joseph, Thresiamma; Shaiju, P; Laluraj, C M; Balachandran, K K; Nair, M; George, Rejomon; Nair, K K C; Sahayak, Satish; Prabhakaran, M P
2008-08-01
The bloom-infested waters along the southwest coast of India were assessed to bring about the probable cause related to the excessive algal production. Low nitrate and silicate concentrations were concomitant with slightly higher levels of phosphate. The silicate depletion in the bloom area is possibly an indication of community succession (diatom to dinoflagellate), since it was completely utilized by the preceding diatom blooms. The dinoflagellates in this region could have been advected from the northern regions where it was noticed during the previous months.
Preliminary pharmacognostic screening of Achyranthes coynei stem.
Upadhya, Vinayak; Ankad, Gireesh M; Pai, Sandeep R; Hegde, Shruti V; Hegde, Harsha V
2015-01-01
Achyranthes coynei is a rare, endemic perennial shrub reported from Karnataka and Maharashtra states of India. The plant is used to treat various disorders by folk healers and was proven to have antimicrobial and antioxidant properties. The present study was undertaken to evaluate microscopic and macroscopic characters of A. coynei stem, along with its physicochemical parameters. ProgRes(®) CapturePro and Microsoft Excel were used for statistical analysis. Perennial, shrubby nature and woody stem were the distinguishing morphological characters observed. Transverse section (TS) illustrated quadrangular outline of the stem and showed the presence of two types of trichomes on the thick-walled epidermis. TS also showed number of rosette calcium oxalates crystals; prismatic and microsphenoid crystals; conjoint, collateral open secondary vascular bundles; and two amphixylic medullary bundles in the pith. Ash and extractive values, micro and macro elements and nutritive factors were estimated in the present study. The presence of alkaloids, saponins and triterpenoids were observed in preliminary phytochemical screening. High-performance thin layer chromatographic analysis yielded different bands and also indicated the presence of oleanolic acid. The studied parameters for A. coynei stem will be useful for identification and authentication of the plant material.
"Heart Shots": a classroom activity to instigate active learning.
Abraham, Reem Rachel; Vashe, Asha; Torke, Sharmila
2015-09-01
The present study aimed to provide undergraduate medical students at Melaka Manipal Medical College (Manipal Campus), Manipal University, in Karnataka, India, an opportunity to apply their knowledge in cardiovascular concepts to real-life situations. A group activity named "Heart Shots" was implemented for a batch of first-year undergraduate students (n = 105) at the end of a block (teaching unit). Students were divided into 10 groups each having 10-11 students. They were requested to make a video/PowerPoint presentation about the application of cardiovascular principles to real-life situations. The presentation was required to be of only pictures/photos and no text material, with a maximum duration of 7 min. More than 95% of students considered that the activity helped them to apply their knowledge in cardiovascular concepts to real-life situations and understand the relevance of physiology in medicine and to revise the topic. More than 90% of students agreed that the activity helped them to apply their creativity in improving their knowledge and to establish a link between concepts rather than learning them as isolated facts. Based on the feedback, we conclude that the activity was student centered and that it facilitated learning. Copyright © 2015 The American Physiological Society.
Pal, Govind; Channanamchery, Radhika; Singh, R K; Kethineni, Udaya Bhaskar; Ram, H; Prasad, S Rajendra
2016-01-01
The present study was based on primary data collected from 100 farmers in Gulbarga district of Karnataka, India, during the agricultural year 2013-2014. Study shows that average land holding size of pigeonpea seed farmers was higher in comparison to grain farmers and district average. The study illustrates a ratio of 32 : 68 towards fixed and variable costs in pigeonpea certified seed production with a total cost of ₹ 39436 and the gross and net returns were ₹ 73300 and ₹ 33864 per hectare, respectively. The total cost of cultivation, gross return, and net return in pigeonpea seed production were higher by around 23, 32, and 44 percent than grain production, respectively. Hence, production of certified seed has resulted in a win-win situation for the farmers with higher yield and increased returns. The decision of the farmer on adoption of seed production technology was positively influenced by his education, age, land holding, irrigated land, number of crops grown, and extension contacts while family size was influencing negatively. Higher yield and profitability associated with seed production can be effectively popularized among farmers, resulting in increased certified seed production.
"From me to HIV": a case study of the community experience of donor transition of health programs.
Rodríguez, Daniela C; Tripathi, Vandana; Bohren, Meghan; Paul, Amy; Singh, Kriti; Chhabra, Vibha; Singh, Suneeta; Bennett, Sara
2015-08-19
Avahan, a large-scale HIV prevention program in India, transitioned over 130 intervention sites from donor funding and management to government ownership in three rounds. This paper examines the transition experience from the perspective of the communities targeted by these interventions. Fifteen qualitative longitudinal case studies were conducted across all three rounds of transition, including 83 in-depth interviews and 45 focus group discussions. Data collection took place between 2010 and 2013 in four states: Andhra Pradesh, Karnataka, Maharashtra and Tamil Nadu. We find that communication about transition was difficult at first but improved over time, while issues related to employment of peer educators were challenging throughout the transition. Clinical services were shifted to government providers resulting in mixed experiences depending on the population being targeted. Lastly, the loss of activities aimed at community ownership and mobilization negatively affected the beneficiaries' view of transition. While some programmatic changes resulted in improvements, additional opportunity costs for beneficiaries may pose barriers to accessing HIV prevention services. Communicating and engaging community stakeholders early on in future such transitions may mitigate negative feelings and lead to more constructive relationships and dialogue.
LATENT SPACE MODELS FOR MULTIVIEW NETWORK DATA
Salter-Townshend, Michael; McCormick, Tyler H.
2018-01-01
Social relationships consist of interactions along multiple dimensions. In social networks, this means that individuals form multiple types of relationships with the same person (e.g., an individual will not trust all of his/her acquaintances). Statistical models for these data require understanding two related types of dependence structure: (i) structure within each relationship type, or network view, and (ii) the association between views. In this paper, we propose a statistical framework that parsimoniously represents dependence between relationship types while also maintaining enough flexibility to allow individuals to serve different roles in different relationship types. Our approach builds on work on latent space models for networks [see, e.g., J. Amer. Statist. Assoc. 97 (2002) 1090–1098]. These models represent the propensity for two individuals to form edges as conditionally independent given the distance between the individuals in an unobserved social space. Our work departs from previous work in this area by representing dependence structure between network views through a multivariate Bernoulli likelihood, providing a representation of between-view association. This approach infers correlations between views not explained by the latent space model. Using our method, we explore 6 multiview network structures across 75 villages in rural southern Karnataka, India [Banerjee et al. (2013)]. PMID:29721127
LATENT SPACE MODELS FOR MULTIVIEW NETWORK DATA.
Salter-Townshend, Michael; McCormick, Tyler H
2017-09-01
Social relationships consist of interactions along multiple dimensions. In social networks, this means that individuals form multiple types of relationships with the same person (e.g., an individual will not trust all of his/her acquaintances). Statistical models for these data require understanding two related types of dependence structure: (i) structure within each relationship type, or network view, and (ii) the association between views. In this paper, we propose a statistical framework that parsimoniously represents dependence between relationship types while also maintaining enough flexibility to allow individuals to serve different roles in different relationship types. Our approach builds on work on latent space models for networks [see, e.g., J. Amer. Statist. Assoc. 97 (2002) 1090-1098]. These models represent the propensity for two individuals to form edges as conditionally independent given the distance between the individuals in an unobserved social space. Our work departs from previous work in this area by representing dependence structure between network views through a multivariate Bernoulli likelihood, providing a representation of between-view association. This approach infers correlations between views not explained by the latent space model. Using our method, we explore 6 multiview network structures across 75 villages in rural southern Karnataka, India [Banerjee et al. (2013)].
Intensified summer monsoon and the urbanization of Indus Civilization in northwest India.
Dixit, Yama; Hodell, David A; Giesche, Alena; Tandon, Sampat K; Gázquez, Fernando; Saini, Hari S; Skinner, Luke C; Mujtaba, Syed A I; Pawar, Vikas; Singh, Ravindra N; Petrie, Cameron A
2018-03-09
Today the desert margins of northwest India are dry and unable to support large populations, but were densely occupied by the populations of the Indus Civilization during the middle to late Holocene. The hydroclimatic conditions under which Indus urbanization took place, which was marked by a period of expanded settlement into the Thar Desert margins, remains poorly understood. We measured the isotopic values (δ 18 O and δD) of gypsum hydration water in paleolake Karsandi sediments in northern Rajasthan to infer past changes in lake hydrology, which is sensitive to changing amounts of precipitation and evaporation. Our record reveals that relatively wet conditions prevailed at the northern edge of Rajasthan from ~5.1 ± 0.2 ka BP, during the beginning of the agricultural-based Early Harappan phase of the Indus Civilization. Monsoon rainfall intensified further between 5.0 and 4.4 ka BP, during the period when Indus urban centres developed in the western Thar Desert margin and on the plains of Haryana to its north. Drier conditions set in sometime after 4.4 ka BP, and by ~3.9 ka BP an eastward shift of populations had occurred. Our findings provide evidence that climate change was associated with both the expansion and contraction of Indus urbanism along the desert margin in northwest India.
Nonomuraea indica sp. nov., novel actinomycetes isolated from lime-stone open pit mine, India.
Quadri, Syed Raziuddin; Tian, Xin-Peng; Zhang, Jing; Li, Jie; Nie, Guo-Xing; Tang, Shu-Kun; Al Ruwaili, Jamal; Agsar, Dayanand; Li, Wen-Jun; Dastager, Syed G
2015-08-01
A Gram-positive, aerobic, nonmotile actinomycete strain designated DRQ-2(T) was isolated from the soil sample collected from lime-stone open pit mine from the Gulbarga region, Karnataka province, India. Strain DRQ-2(T) was identified as a member of the genus Nonomuraea by a polyphasic approach. Strain DRQ-2(T) could be differentiated from other members of the genus Nonomuraea on the basis of physiology and 16S rRNA gene sequence analysis. The 16S rRNA gene sequence similarity of strain DRQ-2(T) showed highest sequence similarity to Nonomuraea muscovyensis DSM 45913(T) (99.1%), N. salmonea DSM 43678(T) (98.2%) and N. maheshkhaliensis JCM 13929(T) with 98.0%, respectively. Chemotaxonomic properties showing predominant menaquinones of MK-9 (H4), MK-9(H2) and MK-9(H6), major polar lipids comprised diphosphatidylglycerol, phosphatidylmono methyl ethanolamine (PME), phosphatidylethanolamine (PE), hydroxy-PME (OH-PME), hydroxy PE (OH-PEE), phosphatidylglycerol (PG), ninhydrin-positive phosphoglycolipid and unknown phospholipid, fatty acids with major amounts of i-C16:0, ai-C15:0 and ai-C17:0 supported allocation of the strain to the genus Nonomuraea. Results of DNA-DNA hybridization and physiological tests allowed genotypic and phenotypic differentiation of strain DRQ-2(T) from closely related species. The genomic DNA G+C content of the organism was 72.5 mol%. On the basis of phenotypic, chemotypic and molecular characteristics, strain DRQ-2(T) represents a novel species of the genus Nonomuraea, for which the name N. indica sp. nov. is proposed, with type strain DRQ-2(T) (=NCIM 5480(T)= CCTCC AA 209050(T)).
Popular perceptions of tobacco products and patterns of use among male college students in India.
Nichter, Mimi; Nichter, Mark; Van Sickle, David
2004-07-01
This paper examines popular perceptions of tobacco products and describes patterns of use among college youth in Karnataka, India. Data are drawn from 25 key informant interviews and six focus groups with male and female college students, interviews with shopkeepers, observational data on youth tobacco consumption, and a college-based survey. The survey was administered to 1587 males attending eleven colleges. Forty-five percent (n = 716) of college students surveyed had used tobacco products. Thirty-six percent (n = 573) had tried cigarettes, 10% (n = 157) had tried bidis, and 18% (n = 290) had tried gutkha. Tobacco consumption among smokers was low; for daily smokers, the mean number of cigarettes smoked was 6 per day. Students attending professional colleges, including engineering, medicine, and law were significantly more likely to have ever smoked and to be daily smokers when compared to students enrolled in other courses of study. In interviews, male students noted that smoking a cigarette enhanced one's manliness, relieved boredom, and eased tension. Although female students interviewed were non-smokers, several suggested that in the future, smoking might be an acceptable behavior among college-going females. When asked about their perceptions of smoking among youth in Western countries, the majority of students believed that three-quarters of male and female youth in the West smoked. This perception has been largely formed through media images, including satellite television and films. With regard to addiction, it was widely believed that filter-tipped cigarettes were one of the most addictive products because they are made of better quality tobacco, and are milder and smoother to smoke. Therefore, a person could easily smoke more of them, which would lead to addiction. Another widely held belief was that the more expensive the cigarette, the less harmful it was for one's health.
Venkataramana, M.; Rashmi, R.; Uppalapati, Siva R.; Chandranayaka, S.; Balakrishna, K.; Radhika, M.; Gupta, Vijai K.; Batra, H. V.
2015-01-01
In the present study, generation and characterization of a highly specific monoclonal antibody (mAb) against Ochratoxin A (OTA) was undertaken. The generated mAb was further used to develop a simple, fast, and sensitive sandwich dot-ELISA (s-dot ELISA) method for detection of OTA from contaminated food grain samples. The limit of detection (LOD) of the developed enzyme-linked immunosorbent assay (ELISA) method was determined as 5.0 ng/mL of OTA. Developed method was more specific toward OTA and no cross reactivity was observed with the other tested mycotoxins such as deoxynivalenol, fumonisin B1, or aflatoxin B1. To assess the utility and reliability of the developed method, several field samples of maize, wheat and rice (n = 195) collected from different geographical regions of southern Karnataka region of India were evaluated for the OTA occurrence. Seventy two out of 195 samples (19 maize, 38 wheat, and 15 rice) were found to be contaminated by OTA by s-dot ELISA. The assay results were further co-evaluated with conventional analytical high-performance liquid chromatography (HPLC) method. Results of the s-dot ELISA are in concordance with HPLC except for three samples that were negative for OTA presence by s-dot ELISA but found positive by HPLC. Although positive by HPLC, the amount of OTA in the three samples was found to be lesser than the accepted levels (>5 μg/kg) of OTA presence in cereals. Therefore, in conclusion, the developed s-dot ELISA is a better alternative for routine cereal based food and feed analysis in diagnostic labs to check the presence of OTA over existing conventional culture based, tedious analytical methods. PMID:26074899
Narahari, Saravu R; Bose, Kuthaje S; Aggithaya, Madhur G; Swamy, Gaddam Kumara; Ryan, Terence J; Unnikrishnan, Bhaskaran; Washington, Reynold G; Rao, Balu Palicheralu Sreenivasa; Rajagopala, Shrikrishna; Manjula, Kadengodlu; Vandana, Usha; Sreemol, Thaivalath Anandan; Rojith, Mathew; Salimani, Shanappa Y; Shefuvan, Mohammed
2013-09-01
Currently there is no global program to manage lymphoedema as a result of lymphatic filariasis (LF). The primary aim of this study was to determine the efficacy of a previously proposed integrative treatment protocol, using locally available resources to address the morbidity, in a community village setting. Two LF endemic districts of south India, Gulbarga in Karnataka (GK) and Alleppey in Kerala (AK), were selected for the study. All known patients were invited to an LF camp. Patients with grade two late or three lymphoedema were enrolled. All patients were given training in the integrative procedure which involved patient education and the domiciliary protocol. A total of 730 patients (851 limbs) completed the three and half month follow up. There was a statistically significant (1%) reduction up to mid thigh level volume measurement for both small (0.7-1.1 liters) and large (1.8-5.0 liters) limbs, p < 0.000. In AK inflammatory episodes at the three months interval reduced from 37.5% (127 patients) to 28.3% (96 patients) and in GK from 37.6% (147 patients) to 10.2% (40 patients), p < 0.000. All patients had reduced bacterial entry points. There was an overall improvement in quality of life in all domains of LF specific quality of life questionnaire p < 0.000. Self care and integrative treatment is possible in resource poor Indian village settings. Further work is needed to explore factors leading to better compliance by randomizing the interventions such as washing and emollient compression vs Ayurvedic and yoga interventions before integrative treatment is considered for national health programmes in developing countries.
NASA Astrophysics Data System (ADS)
Vouillamoz, J.-M.; Hoareau, J.; Grammare, M.; Caron, D.; Nandagiri, L.; Legchenko, A.
2012-11-01
Many human communities living in coastal areas in Africa and Asia rely on thin freshwater lenses for their domestic supply. Population growth together with change in rainfall patterns and sea level will probably impact these vulnerable groundwater resources. Spatial knowledge of the aquifer properties and creation of a groundwater model are required for achieving a sustainable management of the resource. This paper presents a ready-to-use methodology for estimating the key aquifer properties and the freshwater resource based on the joint use of two non-invasive geophysical tools together with common hydrological measurements. We applied the proposed methodology in an unconfined aquifer of a coastal sandy barrier in South-Western India. We jointly used magnetic resonance and transient electromagnetic soundings and we monitored rainfall, groundwater level and groundwater electrical conductivity. The combined interpretation of geophysical and hydrological results allowed estimating the aquifer properties and mapping the freshwater lens. Depending on the location and season, we estimate the freshwater reserve to range between 400 and 700 L m-2 of surface area (± 50%). We also estimate the recharge using time lapse geophysical measurements with hydrological monitoring. After a rainy event close to 100% of the rain is reaching the water table, but the net recharge at the end of the monsoon is less than 10% of the rain. Thus, we conclude that a change in rainfall patterns will probably not impact the groundwater resource since most of the rain water recharging the aquifer is flowing towards the sea and the river. However, a change in sea level will impact both the groundwater reserve and net recharge.
Assessment of the Status of National Oral Health Policy in India.
Kothia, Nandita Rani; Bommireddy, Vikram Simha; Devaki, Talluri; Vinnakota, Narayana Rao; Ravoori, Srinivas; Sanikommu, Suresh; Pachava, Srinivas
2015-07-26
National oral health policy was conscripted by the Indian Dental Association (IDA) in 1986 and was accepted as an integral part of National Health Policy (NHP) by the Central Council of Health and Family Welfare in one of its conferences in the year 1995. Objectives of this paper were to find out the efforts made or going on towards its execution, its current status and recent oral health-related affairs or programs, if any. Literature search was done using the institutional library, web-based search engines like 'Google' and 'PubMed' and also by cross referencing. It yielded 108 articles, of which 50 were excluded as they were not pertinent to the topic. Twenty-four were of global perspective rather than Indian and hence were not taken into account and finally 34 articles were considered for analyses. Documents related to central and state governments of India were also considered. All the articles considered for analysis were published within the past 10 years with gradual increase in number which depicts the researchers' increasing focus towards oral health policy. Criticisms, suggestions and recommendations regarding national oral health programs, dental manpower issues, geriatric dentistry, public health dentistry, dental insurance, oral health inequality, and public-private partnerships have taken major occupancies in the articles. Proposals like "model for infant and child oral health promotion" and "oral health policy phase 1 for Karnataka" were among the initiatives towards national oral health policy. The need for implementation of the drafted oral health policy with modification that suits the rapidly changing oral health system of this country is inevitable. © 2015 by Kerman University of Medical Sciences.
Assessment of the Status of National Oral Health Policy in India
Kothia, Nandita Rani; Bommireddy, Vikram Simha; Devaki, Talluri; Vinnakota, Narayana Rao; Ravoori, Srinivas; Sanikommu, Suresh; Pachava, Srinivas
2015-01-01
Background: National oral health policy was conscripted by the Indian Dental Association (IDA) in 1986 and was accepted as an integral part of National Health Policy (NHP) by the Central Council of Health and Family Welfare in one of its conferences in the year 1995. Objectives of this paper were to find out the efforts made or going on towards its execution, its current status and recent oral health-related affairs or programs, if any. Methods: Literature search was done using the institutional library, web-based search engines like ‘Google’ and ‘PubMed’ and also by cross referencing. It yielded 108 articles, of which 50 were excluded as they were not pertinent to the topic. Twenty-four were of global perspective rather than Indian and hence were not taken into account and finally 34 articles were considered for analyses. Documents related to central and state governments of India were also considered. Results: All the articles considered for analysis were published within the past 10 years with gradual increase in number which depicts the researchers’ increasing focus towards oral health policy. Criticisms, suggestions and recommendations regarding national oral health programs, dental manpower issues, geriatric dentistry, public health dentistry, dental insurance, oral health inequality, and public-private partnerships have taken major occupancies in the articles. Proposals like "model for infant and child oral health promotion" and "oral health policy phase 1 for Karnataka" were among the initiatives towards national oral health policy. Conclusion: The need for implementation of the drafted oral health policy with modification that suits the rapidly changing oral health system of this country is inevitable. PMID:26340486
Mahesh, P A; Jayaraj, B S; Prabhakar, A K; Chaya, S K; Vijaysimha, R
2013-01-01
Exposure to air pollution due to combustion of biomass fuels remains one of the significant risk factors for chronic respiratory diseases such as chronic bronchitis. There is a need to identify the minimum threshold level of biomass index that is significantly associated with chronic bronchitis. This study was undertaken to identify a threshold for biomass exposure index in a rural women population in Mysore district, south India. A cross-sectional survey was conducted in a representative population of Mysore and Nanjangud taluks. Eight villages each from Mysore and Nanjangud were randomly selected based on the list of villages from census 2001. A house-to-house survey was carried out by trained field workers using the Burden of Obstructive Diseases questionnaire, which evaluated the biomass smoke exposure and chronic bronchitis. All the women aged above 30 yr were included in the study. A total of 2011 women from Mysore and 1942 women from Nanjangud participated in the study. All women were non-smoking and used biomass fuels as the primary fuel for cooking. A threshold of biomass fuel exposure of 60 was identified on multivariate analysis in Mysore district after adjusting for age, passive smoking and working in a occupational exposure to dust, as the minimum required for a significant association with chronic bronchitis. One in every 20 women in Mysore district exposed to biomass fuel exposure index of 110 or more developed chronic bronchitis. The minimum threshold of biomass exposure index of 60 is necessary to have a significant risk of developing chronic bronchitis in women. The number needed to harm to develop chronic bronchitis reduces with increasing biomass exposure index and women residing in rural Nanjangud have a higher risk for developing chronic bronchitis as compared to women in Mysore.
Sahana, K S; Sujatha, R
2015-02-01
To study the clinical profile of dengue fever and its outcome in children with application of revised WHO classification and to identify risk factors for severe dengue. This study was a prospective observational study of children diagnosed with dengue from July 2012 through February 2013 at a tertiary care hospital in Bangalore, Karnataka (South India). Eighty one children including 55(67.9 %) boys and 26(32.1 %) girls were diagnosed with dengue. Mean age of presentation was 8 y. Vomiting (60.5 %), pain abdomen (32 %), headache (30.9 %), myalgia (23.5 %) and bleeding manifestations (16 %) were the common presenting complaints. Facial puffiness (63 %), hepatomegaly (51.9 %), ascites (48.1 %), pleural effusion (39.5 %) and petechiae (14.8 %) were noted during examination. Dengue NS1 antigen, IgM, IgG were positive in 66.7 %, 29.6 % and 18.5 % of cases respectively. Investigations showed hemoconcentration in 72.8 %, leucopenia (34.5 %), thrombocytopenia (82.7 %), abnormal liver function test (LFT) (33.3 %). USG abdomen was suggestive of dengue in 66.7 % and gall bladder edema was noted in 53.1 %. Two patients died out of the total 81 patients with mortality rate of 2.5 %. Number of cases classified as Dengue without warning signs (D), Dengue with warning signs (DW) and Severe Dengue (SD) were 48.1 %, 27.2 % and 24.7 % respectively. Children between 5 and 15 y were most affected by dengue fever. Pain abdomen and vomiting were most common presenting symptoms. Ascites, plerural effusion, hepatomegaly, gall bladder wall thickening and abnormal LFT were found significantly high in severe dengue cases.
Singh, Gayatri; Kumari, Babita; Sinam, Geetgovind; Kriti; Kumar, Navin; Mallick, Shekhar
2018-04-09
Fluorine is an essential element required in trace amounts but gets toxic for human beings at levels more than 1.5 mg F - L -1 primarily through drinking contaminated water. It is the 13th most abundant element and constitutes about 0.06-0.09% in the earth crust. It is electronegative in aqueous medium forming fluoride ion (F - ). Fluoride contamination in the environment occurs mostly due to anthropogenic and geogenic sources. Fluoride is widely distributed in all components of environment, air (0.1-0.6 μg L -1 ) soils (150-400 mg Kg -1 ) rocks (100-2000 mg Kg -1 ), plant (0.01-42 mg Kg -1 ) and water (1.0-38.5 mg L -1 ). Human beings and animals are being exposed to F - primarily from water (0.2-42.0 mg L -1 ) and plants (0.77-29.5 μg g -1 ). Fluorosis, a health hazard due to F - is a major problem in many countries across the world affecting about 200 million people globally. In India, > 62 million people in twenty states are facing problem due to F - . The most affected states are Rajasthan (7670 habitations), Telangana (1,174 habitations) and Karnataka (1122 habitations). To mitigate this problem, there is an urgent need to understand the current status and brief knowledge of F - geochemistry. The objective of this review is to highlight different sources of F - that contaminate different environmental matrices including plants, the extent of contamination level in India, uptake, translocation and toxicity mechanism in plants. The review also highlights currently available mitigation methods or technologies through physio-chemical and biological means. Copyright © 2018 Elsevier Ltd. All rights reserved.
Hydraulic and hydrogeochemical characteristics of a riverbank filtration site in rural India.
Boving, T B; Choudri, B S; Cady, P; Cording, A; Patil, K; Reddy, Veerabaswant
2014-07-01
A riverbank filtration (RBF) system was tested along the Kali River in rural part of the state of Karnataka in India. The polluted river and water from open wells served the local population as their principal irrigation water resource and some used it for drinking. Four RBF wells (up to 25 m deep) were installed. The mean hydraulic conductivity of the well field is 6.3 x 10(-3) cm/s and, based on Darcy's law, the water travel time from the river to the principal RBF well (MW3) is 45.2 days. A mixing model based on dissolved silica concentrations indicated that, depending on the distance from the river and closeness to irrigated rice fields, approximately 27 to 73% of the well water originated from groundwater. Stable isotopic data indicates that a fraction of the water was drawn in from the nearby rice fields that were irrigated with river water. Relative to preexisting drinking water sources (Kali River and an open well), RBF well water showed lower concentration of dissolved metals (60.1% zinc, 27.8% cadmium, 83.9% lead, 75.5% copper, 100% chromium). This study demonstrates that RBF technology can produce high-quality water from low-quality surface water sources in a rural, tropical setting typical for many emerging economies. Further, in parts of the world where flood irrigation is common, RBF well water may draw in infiltrated irrigation water, which possibly alters its geochemical composition. A combination of more than one mixing model, silica together with stable isotopes, was shown to be useful explaining the origin of the RBF water at this study site.
Mukhopadhyay, K K
1995-01-01
This article discusses the nature, magnitude, causes, and consequences of female child prostitution in India and offers measures for control and prevention of girl prostitution. Data are obtained from the 6-city study of prostitution and the author's own research. An estimated 85% of all prostitutes in Calcutta and Delhi entered the work at an early age. The numbers are rising. The promotion of tourism is linked with prostitution. Girl prostitutes are primarily located in low-middle income areas and business districts and are known by officials. Brothel keepers regularly recruit young girls. An estimated 33% of prostitutes are young girls. In Bangalore, Calcutta, Delhi, and Hyderabad, there are an estimated 10,000 girl prostitutes. UNICEF estimates about 300,000 child prostitutes. Girl prostitutes are grouped as common prostitutes, singers and dancers, call girls, religious prostitutes or devdasi, and caged brothel prostitutes. Religious prostitutes are mainly found in the South. Caged ones are found in Bombay. A little over 50% of prostitutes come from other countries, such as Nepal and Bangladesh. The girls tend to come from urban slums and poor rural areas. High prostitute supply regions include Andhra Pradesh, Karnataka, Maharashtra, Uttar Pradesh, Tamil Nadu, and West Bengel states. About 85% are Hindus, and about 66% are from scheduled castes and tribes. Bangalore and Bombay have a higher proportion of girl prostitutes. The causes of prostitution include ill treatment by parents, bad company, family prostitutes, social customs, inability to arrange marriage, lack of sex education, media, prior incest and rape, early marriage and desertion, lack of recreational facilities, ignorance, and acceptance of prostitution. Economic causes include poverty and economic distress. Psychological causes include desire for physical pleasure, greed, and dejection. Most enter involuntarily. A brief profile is given of the life of a prostitute.
Training outreach workers for AIDS prevention in rural India: is it sustainable?
Sivaram, S; Celentano, D D
2003-12-01
Through a process of community diagnosis and participation, a non-governmental organization in rural Karnataka state in India selected and trained peer outreach workers to implement and sustain AIDS prevention education activities. This activity was part of a larger AIDS education project that aimed at creating awareness and promoting risk-reducing behaviours in the community. This paper describes efforts of the project to identify and train peer educators during its implementation phase and discusses strategies used to facilitate sustainability. We evaluate the impact of these efforts by conducting an analysis in the project area 2 years after the end of the project. The findings reveal generalized interest among rural communities in HIV prevention issues. The project originally conducted an extensive survey to understand community organization and composition, which helped to identify potential partners and peer educators. Training peer educators was a multi-step process, and one with high attrition. While individual peer educators were an excellent resource during the life of the project, peer educators affiliated with village level institutions had the interest, access to resources and willingness to sustain project efforts. However, the sustainability of their efforts was associated with the quality of interactions with the project implementation team, the strength and leadership of their own institutions, the perceived benefits of implementing AIDS education activities after project life and the gender of the outreach worker. Non-sustainers did not have an organizational structure to backstop their work, were often poor and unemployed persons who later found gainful employment, and overwhelmingly, were female. We present a conceptual model based on these findings to help future projects plan for and achieve sustainability.
NASA Astrophysics Data System (ADS)
Xu, Chenxi; Sano, Masaki; Priyadarshan Dimri, Ashok; Ramesh, Rengaswamy; Nakatsuka, Takeshi; Shi, Feng; Guo, Zhengtang
2018-05-01
We have constructed a regional tree-ring cellulose oxygen isotope (δ18O) record for the northern Indian sub-continent based on two new records from northern India and central Nepal and three published records from northwestern India, western Nepal and Bhutan. The record spans the common interval from 1743 to 2008 CE. Correlation analysis reveals that the record is significantly and negatively correlated with the three regional climatic indices: all India rainfall (AIR; r = -0.5, p < 0.001, n = 138), Indian monsoon index (IMI; r = -0.45, p < 0.001, n = 51) and the intensity of monsoonal circulation (r = -0.42, p < 0.001, n = 51). The close relationship between tree-ring cellulose δ18O and the Indian summer monsoon (ISM) can be explained by oxygen isotope fractionation mechanisms. Our results indicate that the regional tree-ring cellulose δ18O record is suitable for reconstructing high-resolution changes in the ISM. The record exhibits significant interannual and long-term variations. Interannual changes are closely related to the El Niño-Southern Oscillation (ENSO), which indicates that the ISM was affected by ENSO in the past. However, the ISM-ENSO relationship was not consistent over time, and it may be partly modulated by Indian Ocean sea surface temperature (SST). Long-term changes in the regional tree-ring δ18O record indicate a possible trend of weakened ISM intensity since 1820. Decreasing ISM activity is also observed in various high-resolution ISM records from southwest China and Southeast Asia, and may be the result of reduced land-ocean thermal contrasts since 1820 CE.
Scarf-related injuries at a major trauma center in northern India.
Singh, Pritish; Kumar, Ashok; Shekhawat, Vishal
2017-04-01
Scarf is a long loose piece of cloth worn around the neck and shoulder. Despite cultural association of this apparel, it is part of numerous injury episodes of varying enormity. Entanglement of loose scarf in spoke wheels of bike, tricycle, belt driven machines like sugarcane juice machine, thresher, grinding machines, etc is observed both in social and industrial milieu. This study aims to investigate the scarf-related injuries at a major trauma center in northern India. From June 2013 to May 2015, a hospital-based prospective observational study was done in patients who presented to a level 1 trauma center in northern India with the mode of injury involving scarf around the neck. Demographic profile, mode of trauma, contributing factors, injury pattern, and the early management as well as early complications were recorded. There were 76 injuries directly related from scarf with the mean age of patients being 32.4 years. The most common primary factor involved was rotating wheel of motorbike/tricycle (46.1%), followed by belt driven machines (28.9%). The spectrum of injuries was diverse, including minor abrasions or lacerations (53.9%), large lacerations (15.8%), fractures and spine trauma (18.4%), mangled extremity and amputations (7.9%) and death (3.9%). More severe injury patterns were noted with belt driven machines. Scarf-related injuries constitute a sizable proportion of trauma, with varying degrees of severity. Devastating consequences in significant proportion of cases dictate the call for a prevention plan comprising both educational and legislative measures. Urgent preventive measures targeting scarf-related injuries will help reduce mortality and morbidity. Copyright © 2017 Daping Hospital and the Research Institute of Surgery of the Third Military Medical University. Production and hosting by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Teale, William; Collins, Alan S.; Foden, John; Payne, Justin L.; Plavsa, Diana; Chetty, T. R. K.; Santosh, M.; Fanning, Mark
2011-08-01
The northern Madurai Block, southern India, lies directly south of, and partly deformed by, the Palghat-Cauvery Shear Zone System (PCSS) - a potential suture of the Neoproterozoic Mozambique Ocean. The Kadavur gabbro-anorthosite complex lies south of the PCSS, in the northern Madurai Block, and crystallized at 829 ± 14 Ma (LA-ICPMS zircon data) in a supra-subduction zone setting. The complex contains zircon ɛHf(t) values of -12.5 to -8.6 that represent Palaeoproterozoic T(DM) model ages (2.3-2.5 Ga). These broadly agree with a whole rock neodymium T(DM) model age of 2287 Ma. Oxygen isotope δ 18O ratios range from 5.82‰ and 6.74‰. The parental magma for the gabbro-anorthosites are interpreted to be derived from a juvenile Neoproterozoic mantle contaminated by Mesoarchaean igneous infra-crustal sources. The gabbro-anorthosites intrude quartzites with dominantly Palaeoproterozoic detrital zircons that contain Neoarchaean and Mesoarchaean hafnium model ages. These quartzite zircons contain metamorphic rims that yield an age of 843 ± 23 Ma demonstrating the autochthonous nature of the gabbro-anorthosite complex. Later felsic magmatism is recorded by the 766 ± 8 Ma crystallisation age of the protolith of a felsic gneiss. Cryogenian magmatism in the Madurai Block is interpreted to form part of an extensive arc magmatic province within the southern East African Orogen that can be traced from central Madagascar, through southern India to the Wanni Complex of Sri Lanka. This province is interpreted to have formed above a south/west dipping subduction system as the Mozambique Ocean was subducted under the Neoproterozoic continent Azania.
NASA Astrophysics Data System (ADS)
Pal, I.; Lall, U.; Robertson, A. W.; Cane, M. A.; Bansal, R.
2013-06-01
Snowmelt-dominated streamflow of the Western Himalayan rivers is an important water resource during the dry pre-monsoon spring months to meet the irrigation and hydropower needs in northern India. Here we study the seasonal prediction of melt-dominated total inflow into the Bhakra Dam in northern India based on statistical relationships with meteorological variables during the preceding winter. Total inflow into the Bhakra Dam includes the Satluj River flow together with a flow diversion from its tributary, the Beas River. Both are tributaries of the Indus River that originate from the Western Himalayas, which is an under-studied region. Average measured winter snow volume at the upper-elevation stations and corresponding lower-elevation rainfall and temperature of the Satluj River basin were considered as empirical predictors. Akaike information criteria (AIC) and Bayesian information criteria (BIC) were used to select the best subset of inputs from all the possible combinations of predictors for a multiple linear regression framework. To test for potential issues arising due to multicollinearity of the predictor variables, cross-validated prediction skills of the best subset were also compared with the prediction skills of principal component regression (PCR) and partial least squares regression (PLSR) techniques, which yielded broadly similar results. As a whole, the forecasts of the melt season at the end of winter and as the melt season commences were shown to have potential skill for guiding the development of stochastic optimization models to manage the trade-off between irrigation and hydropower releases versus flood control during the annual fill cycle of the Bhakra Reservoir, a major energy and irrigation source in the region.
Climate Change and Waterborne Diarrhoea in Northern India: Impact and Adaptation Strategies
NASA Astrophysics Data System (ADS)
Moors, Eddy; Singh, Tanya; Siderius, Christian; Balakrishnan, Sneha; Mishra, Arabinda
2013-04-01
Although some studies showed the vulnerability of human health to climate change (e.g. 22.000 to 45.000 excess mortality cases during the heat waves in Europe, or the association of malaria outbreaks with El Niño) a clear quantification of the increased risks attributable to climate change is often lacking. Even more complicated are the assessments of the adaptation measures for this sector. Adaptation measures are in most cases very site specific. We discuss the impact of climate change on diarrhoea as a representative of waterborne disease affecting human health in the Ganges basin of Northern India. India is by far the leading country when it comes to child mortality under five years caused by diarrhoea and accounted for 386.600 deaths in 2007. Estimates on the increased risk of diarrhoea as a result of increased temperature in the 2030ies range between 8-11%. Uncertainties around these estimates mainly relate to the few studies that have characterized the exposure-response relationship and inter-model discrepancy of climate models. The influence of other climate parameters than temperature on diarrhoea in the future has not been assessed. As empirical studies and surveillance data for India are lacking we developed a conceptual framework for climate exposure-response relationships based on a literature review and applied it to future climate projections for the Ganges basin. Four climate variables are analysed: temperature, increased/extreme precipitation, decreased precipitation/droughts and relative humidity. In an analysis of reports on diarrhoea outbreaks we show the spatial and temporal distribution over the subcontinent. Most cases of diarrhoea occur during the hot summer (23%) and the wet and humid monsoon (57%) months. These reports often suggest sewage and pipe leakage as the leading cause of the local outbreaks. We demonstrate the applicability of the conceptual framework for the two districts in West Bengal, North and South 24 Parganas. All climate factors correlated positively with diarrhoea incidences. However, for relative humidity a positive correlation was not in line with the framework. Combining the impact of all four parameters gives an indication of the overall impact of climate change on diarrhoea in northern India. For the projected changes between current and future (2040ies), the expected impact ranges from no change to an increase of 21% in incidences, with 12% increase on average for the whole of northern India. The mid and mid-eastern region are expected to experience a high increase in incidences above average, influenced by the combined impacts of higher temperatures and decreases in humidity and precipitation. Actions to improve the health situation are often driven by daily realities and pressures of the current development context. However, improvements which are robust on the long term should incorporate future projections of population, economic growth, physical urban expansion, health sector development? and climate change. This can pose a challenge at first, but can also generate new incentives and innovations to tackle pressing problems. We discuss three types of measures: reactive actions, preventive actions and policy options and make recommendations on their applicability.
Bloom, S S; Tsui, A O; Plotkin, M; Bassett, S
2000-04-01
Women in India suffer from a high incidence of reproductive disease, disability and death. Very little work has been done on men, but a much higher incidence of sexual experience outside marriage and sexually transmitted diseases (STDs) among males than previously expected for this population is now being documented. In north India, women are dependent on their husbands and other family members for health-related decisions. Therefore, the behaviour, knowledge and attitudes of men are integral to the reproductive health status of couples there. This study explores knowledge about three distinct areas of reproductive health among 6549 married men in five districts of the northern state of Uttar Pradesh, India. Factors contributing to men's knowledge in the areas of fertility, maternal health and STDs were investigated. Results showed that very few men had basic knowledge in any of these areas. The likelihood of reporting knowledge was associated with a set of determinants that differed in their magnitude and effect across the areas of reproductive health explored. In particular, men's belief about the ability of an individual to prevent pregnancy demonstrated an independent association with men's knowledge. After controlling for factors such as age, parity and educational and economic status, men who believed it not possible to prevent a pregnancy were less likely to know when during the menstrual cycle women would become pregnant and certain facts about STDs, but they were more likely to be able to name two or more symptoms of serious maternal health conditions. Possible explanations for this trend are discussed.
NASA Astrophysics Data System (ADS)
Clyde, W. C.; Khan, I. H.; Gingerich, P. D.
2003-12-01
Initial continental collision between India and Asia is thought to have caused significant changes to global climate and biota, yet its timing and biogeographic consequences are uncertain. Structural and geophysical evidence indicates initial collision during the early Paleogene, but sedimentary evidence of this has been controversial owing to the intense deformation and metamorphism along the suture zone. Modern orders of mammals that appeared abruptly on northern continents coincident with the global warming event marking the Paleocene-Eocene boundary are hypothesized to have originated on the Indian subcontinent, but no relevant paleontologic information has been available to test this idea. Here we present sedimentologic, paleomagnetic, and paleontologic results that show the lower Eocene Ghazij Formation of western Pakistan records continental sedimentation and mammalian dispersal associated with initial India-Asia collision. Sedimentologically, the Ghazij exhibits a clear transition from shallow-marine facies in the lower part, to paralic deltaic facies in the middle part, and continental fluvial facies in the upper part. Paleomagnetic data indicate that Ghazij deposition occurred just before a pronounced decrease in the sea-floor spreading rate of the Indian Ocean. Large fossil mammal assemblages show strong endemism in the middle part of the formation but increasing cosmopolitanism and affiliation with northern continents higher in the formation. Our results support the hypothesis that initial continent-continent contact occurred near the Paleocene-Eocene boundary along the northwest edge of the Indo-Pakistan plate and that subsequent closure occurred diachronously along the rest of the suture. However, it appears that during initial collision, modern orders of mammals dispersed into India rather than out of it.
Maurya, A K; Singh, A K; Kumar, M; Umrao, J; Kant, S; Nag, V L; Kushwaha, R A S; Dhole, T N
2013-01-01
India has a high burden of drug-resistant tuberculosis (TB), although there is little data on multidrug-resistant tuberculosis (MDR-TB). Although MDR-TB has existed for long time in India, very few diagnostic laboratories are well-equipped to test drug sensitivity. The objectives of this study were to determine the prevalence of MDR-TB, first-line drug resistance patterns and its changing trends in northern India in the 4 years. This was a prospective study from July 2007 to December 2010. Microscopy, culture by Bactec460 and p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP) test was performed to isolate and identify Mycobacterium tuberculosis (M. tb) complex (MTBC). Drug sensitivity testing (DST) was performed by 1% proportional method (Bactec460) for four drugs: Rifampicin, isoniazid, ethambutol and streptomycin. Various clinical and demographical profiles were evaluated to analyse risk factors for development of drug resistance. We found the overall prevalence rate of MDR-TB to be 38.8%, increasing from 36.4% in 2007 to 40.8% in 2010. we found that the prevalence of MDR-TB in new and previously treated cases was 29.1% and 43.3% ( P < 0.05; CI 95%). The increasing trend of MDR-TB was more likely in pulmonary TB when compared with extra-pulmonary TB ( P < 0.05; CI 95%). we found a high prevalence (38.8%) of MDR-TB both in new cases (29.1%) and previously treated cases (43.3%).This study strongly highlights the need to make strategies for testing, surveillance, monitoring and management of such drug-resistant cases.
Blind Adolescents' Perceptions of Parental Attitudes.
ERIC Educational Resources Information Center
Agarwal, Rita; Piplani, Rashmi
1990-01-01
This study examined the perception of parental attitudes of 50 blind adolescents in northern India. Results indicated that blind girls perceived their parents as being more accepting and less rejecting than did blind boys, a result explained by culturally determined differences in social sex roles. (DB)
Study of Internal Dump Stability of Dudhichua Open Cast Project, Northern Coalfields Limited, India
NASA Astrophysics Data System (ADS)
Sengupta, S.; Roy, I.
2015-04-01
Dudhichua Open Cast Project is one of the prestigious projects of Northern Coalfields Limited, India; with total mineable coal reserves of approximately 400 million tonnes and corresponding 1,700 million m3 volume of waste rock i.e. overburden material. Accommodating this waste dump masses in the limited space of the de-coaled portion of the quarry is considered as one of the major challenges to the mine operators. It has been reported that this mine is facing frequent slope failures of waste rock dumps which is of great concern to the mine management in view of unsafe working condition. To tackle the above problem, a detailed investigation was carried out to propose a stable dump profile which will cater to the land economics and safety aspects of the mine. A detailed investigation along with recommendation of optimum design for dragline dump profile along with shovel-dumper-dump profile is presented in this paper.
Kinship Institutions and Sex Ratios in India
CHAKRABORTY, TANIKA; KIM, SUKKOO
2010-01-01
This article explores the relationship between kinship institutions and sex ratios in India at the turn of the twentieth century. Because kinship rules vary by caste, language, religion, and region, we construct sex ratios by these categories at the district level by using data from the 1901 Census of India for Punjab (North), Bengal (East), and Madras (South). We find that the male-to-female sex ratio varied positively with caste rank, fell as one moved from the North to the East and then to the South, was higher for Hindus than for Muslims, and was higher for northern Indo-Aryan speakers than for the southern Dravidian-speaking people. We argue that these systematic patterns in the data are consistent with variations in the institution of family, kinship, and inheritance. PMID:21308567
The problem of goitre prevention in India
Ramalingaswami, V.
1953-01-01
Endemic goitre continues to be prevalent in the entire northern submontane region of the Indian subcontinent. Although its etiology is complex, its prevention can be simply and effectively achieved by increasing the iodine intake of the population. The best way of ensuring a continual supply of iodine is by iodization of salt. Indian salt, however, is obtained mostly by solar evaporation of sea water or inland salt water, and is coarse and moist; it is consequently difficult to iodize uniformly. It is also likely that, under the conditions of storage and climate that prevail in India, the loss of iodine from salt iodized with iodide is considerable. The author recommends the iodization of all cooking salt used in the goitrous areas of India with 1 part of iodide to 100,000 parts of salt. PMID:13094515
Aerosol Optical Depth Over India
NASA Astrophysics Data System (ADS)
David, Liji Mary; Ravishankara, A. R.; Kodros, John K.; Venkataraman, Chandra; Sadavarte, Pankaj; Pierce, Jeffrey R.; Chaliyakunnel, Sreelekha; Millet, Dylan B.
2018-04-01
Tropospheric aerosol optical depth (AOD) over India was simulated by Goddard Earth Observing System (GEOS)-Chem, a global 3-D chemical-transport model, using SMOG (Speciated Multi-pOllutant Generator from Indian Institute of Technology Bombay) and GEOS-Chem (GC) (current inventories used in the GEOS-Chem model) inventories for 2012. The simulated AODs were 80% (SMOG) and 60% (GC) of those measured by the satellites (Moderate Resolution Imaging Spectroradiometer and Multi-angle Imaging SpectroRadiometer). There is no strong seasonal variation in AOD over India. The peak AOD values are observed/simulated during summer. The simulated AOD using SMOG inventory has particulate black and organic carbon AOD higher by a factor 5 and 3, respectively, compared to GC inventory. The model underpredicted coarse-mode AOD but agreed for fine-mode AOD with Aerosol Robotic Network data. It captured dust only over Western India, which is a desert, and not elsewhere, probably due to inaccurate dust transport and/or noninclusion of other dust sources. The calculated AOD, after dust correction, showed the general features in its observed spatial variation. Highest AOD values were observed over the Indo-Gangetic Plain followed by Central and Southern India with lowest values in Northern India. Transport of aerosols from Indo-Gangetic Plain and Central India into Eastern India, where emissions are low, is significant. The major contributors to total AOD over India are inorganic aerosol (41-64%), organic carbon (14-26%), and dust (7-32%). AOD over most regions of India is a factor of 5 or higher than over the United States.
Vassall, Anna; Chandrashekar, Sudhashree; Pickles, Michael; Beattie, Tara S; Shetty, Govindraj; Bhattacharjee, Parinita; Boily, Marie-Claude; Vickerman, Peter; Bradley, Janet; Alary, Michel; Moses, Stephen; Watts, Charlotte
2014-01-01
Most HIV prevention for female sex workers (FSWs) focuses on individual behaviour change involving peer educators, condom promotion and the provision of sexual health services. However, there is a growing recognition of the need to address broader societal, contextual and structural factors contributing to FSW risk behaviour. We assess the cost-effectiveness of adding community mobilisation (CM) and empowerment interventions (eg. community mobilisation, community involvement in programme management and services, violence reduction, and addressing legal policies and police practices), to core HIV prevention services delivered as part of Avahan in two districts (Bellary and Belgaum) of Karnataka state, Southern India. An ingredients approach was used to estimate economic costs in US$ 2011 from an HIV programme perspective of CM and empowerment interventions over a seven year period (2004-2011). Incremental impact, in terms of HIV infections averted, was estimated using a two-stage process. An 'exposure analysis' explored whether exposure to CM was associated with FSW's empowerment, risk behaviours and HIV/STI prevalence. Pathway analyses were then used to estimate the extent to which behaviour change may be attributable to CM and to inform a dynamic HIV transmission model. The incremental costs of CM and empowerment were US$ 307,711 in Belgaum and US$ 592,903 in Bellary over seven years (2004-2011). Over a 7-year period (2004-2011) the mean (standard deviation, sd.) number of HIV infections averted through CM and empowerment is estimated to be 1257 (308) in Belgaum and 2775 (1260) in Bellary. This translates in a mean (sd.) incremental cost per disability adjusted life year (DALY) averted of US$ 14.12 (3.68) in Belgaum and US$ 13.48 (6.80) for Bellary--well below the World Health Organisation recommended willingness to pay threshold for India. When savings from ART are taken into account, investments in CM and empowerment are cost saving. Our findings suggest that CM and empowerment is, at worst, highly cost-effective and, at best, a cost-saving investment from an HIV programme perspective. CM and empowerment interventions should therefore be considered as core components of HIV prevention programmes for FSWs.
Yellappa, Vijayashree; Lefèvre, Pierre; Battaglioli, Tullia; Narayanan, Devadasan; Van der Stuyft, Patrick
2016-07-19
In India, the Revised National TB control programme (RNTCP) offers free diagnosis and treatment for tuberculosis (TB), based on the Directly Observed Treatment Short course (DOTS) strategy. We conducted a qualitative study to explore the experience and consequences of having TB on patients enrolled in DOTS and their caretakers in Tumkur district, located in a southern state of India, Karnataka. We conducted 33 in-depth interviews on a purposive sample of TB patients from three groups: (1) patients who reached RNTCP directly on their own and took DOTS at RNTCP; (2) patients who were referred by private practitioners (PPs) to RNTCP and took DOTS at RNTCP; and (3) patients diagnosed by RNTCP and took DOTS from PPs. Data was analyzed using a thematic approach with the support of NVivo9. The study revealed that TB and DOTS have a large impact on patient's lives, which is often extended to the family and caretakers. The most vulnerable patients faced the most difficulty in accessing and completing DOTS. The family was the main source of support during patient's recovery. Patients residing in rural areas and, taking DOTS from the government facilities had to overcome many barriers to adhere to the DOTS therapy, such as long travelling distance to DOTS centers, inconvenient timings and unfavorable attitude of the RNTCP staff, when compared to patients who took DOTS from PPs. Advantages of taking DOTS from PPs cited by the patients were privacy, flexibility in timings, proximity and more immediate access to care. Patients and their family had to cope with stigmatization and fear and financial hardships that surfaced from TB and DOTS. Young patients living in urban areas were more worried about stigmatisation, than elderly patients living in rural areas. Patients who were referred by PPs experienced more financial problems compared to those who reached RNTCP services directly. Our study provided useful information about patient's needs and expectations while taking DOTS. The development of mechanisms within RNTCP towards patient centered care is needed to enable patients and caretakers cope with disease condition and adhere to DOTS.
McGuinness, Sarah L; O'Toole, Joanne E; Boving, Thomas B; Forbes, Andrew B; Sinclair, Martha; Gautam, Sumit K; Leder, Karin
2017-03-17
Diarrhoea is a leading cause of death globally, mostly occurring as a result of insufficient or unsafe water supplies, inadequate sanitation and poor hygiene. Our study aims to investigate the impact of a community-level hygiene education program and a water quality intervention using riverbank filtration (RBF) technology on diarrhoeal prevalence. We have designed a stepped wedge cluster randomised trial to estimate the health impacts of our intervention in 4 rural villages in Karnataka, India. At baseline, surveys will be conducted in all villages, and householders will receive hygiene education. New pipelines, water storage tanks and taps will then be installed at accessible locations in each village and untreated piped river water will be supplied. A subsequent survey will evaluate the impact of hygiene education combined with improved access to greater water volumes for hygiene and drinking purposes (improved water quantity). Villages will then be randomly ordered and RBF-treated water (improved water quality) will be sequentially introduced into the 4 villages in a stepwise manner, with administration of surveys at each time point. The primary outcome is a 7-day period prevalence of self-reported diarrhoea. Secondary outcomes include self-reported respiratory and skin infections, and reported changes in hygiene practices, household water usage and water supply preference. River, tank and tap water from each village, and stored water from a subset of households, will be sampled to assess microbial and chemical quality. Ethics approval was obtained from the Monash University Human Research Ethics Committee in Australia and The Energy and Resources Institute Institutional Ethics Committee in India. The results of the trial will be presented at conferences, published in peer-reviewed journals and disseminated to relevant stakeholders. This study is funded by an Australian National Health and Medical Research Council (NHMRC) project grant. ACTRN12616001286437; pre-results. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Emerging health risks associated with modern agriculture practices: a comprehensive study in India.
Sarkar, Atanu; Aronson, Kristan J; Patil, Shantagouda; Hugar, Lingappa B; vanLoon, Gary W
2012-05-01
In order to enhance food production, India has adopted modern agriculture practices and achieved noteworthy success. This achievement was essentially the result of a paradigm shift in agriculture that included high inputs of agrochemicals, water, and widespread practice of monoculture, as well as bureaucratic changes that promoted these changes. There are very few comprehensive analyses of potential adverse health outcomes that may be related to these changes. The objective of this study is to identify health risks associated with modern agricultural practices in the southern Indian state of Karnataka. This study aims to compare high-input and low-input agricultural practices and the consequences for health of people in these communities. The fieldwork was conducted from May to August, 2009 and included a survey carried out in six villages. Data were collected by in-depth personal interviews among 240 households and key informants, field observations, laboratory analyses, and data from secondary sources. The study identified four major visible impacts: occupational hazards, vector borne diseases, changing nutritional status, and inequity in development. In the high-input area, mechanization has resulted in more occurrences of serious accidents and injuries. Ecological changes due to rice cultivation in this area have further augmented mosquito breeding, and there has been a surge in the incidence of Japanese encephalitis and malaria. The traditional coarse cereals (complex carbohydrates, high protein) have been replaced by mill-polished rice (simple carbohydrate, low protein). The prevalence of overweight (BMI>25) has emerged as a new public health challenge, and this is most evident in large-landholding households, especially in the high-input agriculture areas. In all agro-ecological areas, it was observed that women faced a greater risk of both extremes of under-nutrition and being overweight. Output-driven and market-oriented modern agricultural practices have changed the ecology and disease pattern in this area in India, and our survey indicated significant health effects associated with these changes. There is a need for more extensive epidemiological studies in order to know the full impact on diseases and to understand the complex causal relationships. Copyright © 2012 Elsevier Inc. All rights reserved.
Reza-Paul, Sushena; Lazarus, Lisa; Doshi, Monika; Hafeez Ur Rahman, Syed; Ramaiah, Manjula; Maiya, Raviprakash; MS, Venugopal; Venukumar, K. T.; Sundararaman, Sundar; Becker, Marissa; Moses, Stephen; Lorway, Robert
2016-01-01
Background HIV prevalence among female sex workers (FSWs) in India remains well above the national average. Pre-exposure prophylaxis (PrEP), a new HIV prevention technology, may help to reduce HIV incidence, but there is a dearth of research that can inform the potential scale-up of PrEP in India. In partnership with Ashodaya Samithi, a local sex worker collective, we conducted a feasibility study to assess acceptance of a planned PrEP demonstration project, willingness to use PrEP, and recommendations for project roll-out among FSWs in southern Karnataka. Methods From January–April 2015, 6 focus group discussions, 47 in-depth interviews, and 427 interviewer-administered questionnaires were completed by female sex workers. All participants were 18 years of age or older and practiced sex work. Qualitative data were coded for key themes and emergent categories. Univariate descriptive analysis was employed to summarise the quantitative data. Results Qualitative. PrEP was described as an exciting new prevention technology that places control in the hands of FSWs and provides a “double safety” in combination with condom use. Participants expressed agreement that women who may experience more HIV risk in their occupational environments should be prioritized for enrollment into a demonstration project. Quantitative. 406 participants (95%) expressed interest in PrEP. Participants prioritized the inclusion of FSWs under the age of 25 (79%), those who do not use condoms when clients offer more money (58%), who do not consistently use condoms with regular partners (57%), who drink alcohol regularly (49%), and who do not use condoms consistently with clients (48%). Discussion This feasibility study indicated strong interest in PrEP and a desire to move forward with the demonstration project. Participants expressed their responses in terms of public health discourses surrounding risk, pointing to the importance of situating PrEP scale up within the trusted spaces of community-based organizations as a means of supporting PrEP uptake and adherence. PMID:27880833
Karande, Sunil
2015-08-21
Home delivery, low birth weight babies and maternal illiteracy among the poor in rural India are frequent. The rural poor prefer to seek healthcare from private providers, most of whom have no formal medical training and buy medicines from private pharmacies without a prescription owing to a weakly regulated environment. This report is of a 4-month-old baby from a remote village in northern India, who presented with exogenous Cushing syndrome. This baby was a full-term low birth weight home delivery. As the baby was not growing well, treatment was started at 1 month by a private doctor with betamethasone drops The mother on her own volition continued giving the betamethasone drops by buying the medicine over the counter from a private pharmacy. This case highlights the gaps in essential health services in rural India and the steps being taken to improve the situation. 2015 BMJ Publishing Group Ltd.
Karande, Sunil
2015-01-01
Home delivery, low birth weight babies and maternal illiteracy among the poor in rural India are frequent. The rural poor prefer to seek healthcare from private providers, most of whom have no formal medical training and buy medicines from private pharmacies without a prescription owing to a weakly regulated environment. This report is of a 4-month-old baby from a remote village in northern India, who presented with exogenous Cushing syndrome. This baby was a full-term low birth weight home delivery. As the baby was not growing well, treatment was started at 1 month by a private doctor with betamethasone drops The mother on her own volition continued giving the betamethasone drops by buying the medicine over the counter from a private pharmacy. This case highlights the gaps in essential health services in rural India and the steps being taken to improve the situation. PMID:26297767
C-Window Peaks on CE-HPLC are Extremely Rare in Northern India, and Only Infrequently Represent HbC.
Dass, Jasmita; Mittal, Suchi; Saraf, Amrita; Kotwal, Jyoti
2018-01-01
Hemoglobin C (HbC, HBB:c.19G > A) is a structural variant that has been reported rarely from India. This was a retrospective review of all high performance liquid chromatography (HPLCs) submitted over a 14 year period to a tertiary care center in North India with an aim of finding hemoglobins that elute in the C-window. Of the 32,364 HPLCs screened, 6 cases showed peaks in the C-window. Of these 6 cases, only two cases contained hemoglobin C. These was one case each of HbC/β thalassemia and compound heterozygosity for HbC and HbD. There were 4 cases which showed very similar red cell indices and chromatograms with multiple peaks eluting in D-window, C-window and an additional peak with a retention time of 4.74 min. These four cases were compound heterozygous for an α chain variant HbQ-India and a β-chain variant HbD.
Seismic hazard evaluation of the Oman India pipeline
DOE Office of Scientific and Technical Information (OSTI.GOV)
Campbell, K.W.; Thenhaus, P.C.; Mullee, J.E.
1996-12-31
The proposed Oman India pipeline will traverse approximately 1,135 km of the northern Arabian Sea floor and adjacent continental shelves at depths of over 3 km on its route from Ra`s al Jifan, Oman, to Rapar Gadhwali, India. The western part of the route crosses active faults that form the transform boundary between the Arabian and Indian tectonic plates. The eastern terminus of the route lies in the vicinity of the great (M {approximately} 8) 1829 Kutch, India earthquake. A probabilistic seismic hazard analysis was used to estimate the values of peak ground acceleration (PGA) with return periods of 200,more » 500 and 1,000 years at selected locations along the pipeline route and the submarine Indus Canyon -- a possible source of large turbidity flows. The results defined the ground-shaking hazard along the pipeline route and Indus Canyon for evaluation of risks to the pipeline from potential earthquake-induced geologic hazards such as liquefaction, slope instability, and turbidity flows. 44 refs.« less
Impacts of Energy Sector Emissions on PM2.5 Air Quality in Northern India
NASA Astrophysics Data System (ADS)
Karambelas, A. N.; Kiesewetter, G.; Heyes, C.; Holloway, T.
2015-12-01
India experiences high concentrations of fine particulate matter (PM2.5), and several Indian cities currently rank among the world's most polluted cities. With ongoing urbanization and a growing economy, emissions from different energy sectors remain major contributors to air pollution in India. Emission sectors impact ambient air quality differently due to spatial distribution (typical urban vs. typical rural sources) as well as source height characteristics (low-level vs. high stack sources). This study aims to assess the impacts of emissions from three distinct energy sectors—transportation, domestic, and electricity—on ambient PM2.5 in northern India using an advanced air quality analysis framework based on the U.S. EPA Community Multi-Scale Air Quality (CMAQ) model. Present air quality conditions are simulated using 2010 emissions from the Greenhouse Gas-Air Pollution Interaction and Synergies (GAINS) model. Modeled PM2.5 concentrations are compared with satellite observations of aerosol optical depth (AOD) from the Moderate Imaging Spectroradiometer (MODIS) for 2010. Energy sector emissions impacts on future (2030) PM2.5 are evaluated with three sensitivity simulations, assuming maximum feasible reduction technologies for either transportation, domestic, or electricity sectors. These simulations are compared with a business as usual 2030 simulation to assess relative sectoral impacts spatially and temporally. CMAQ is modeled at 12km by 12km and include biogenic emissions from the Community Land Model coupled with the Model of Emissions of Gases and Aerosols in Nature (CLM-MEGAN), biomass burning emissions from the Global Fires Emissions Database (GFED), and ERA-Interim meteorology generated with the Weather Research and Forecasting (WRF) model for 2010 to quantify the impact of modified anthropogenic emissions on ambient PM2.5 concentrations. Energy sector emissions analysis supports decision-making to improve future air quality and public health in India.
The global polio eradication initiative: lessons learned and prospects for success.
Aylward, Bruce; Tangermann, Rudolf
2011-12-30
Following the rapid progress towards interrupting indigenous wild poliovirus transmission in the Americas in the early 1980s, the Global Polio Eradication Initiative (GPEI) was launched with a resolution of the World Health Assembly (WHA) in 1988. The GPEI built on many lessons learned from smallpox eradication, including the large-scale deployment of technical assistance, implementing agendas of innovation and research and the use of professionally planned and guided advocacy. By the year 2000, the incidence of polio globally had decreased by 99% compared with the estimated >350,000 cases reported from 125 endemic countries in 1988. By 2002, three WHO Regions (the Americas, Western Pacific and European Regions) had been certified polio-free. By 2005, transmission of indigenous wild poliovirus (WPV) had been interrupted in all but 4 'endemic' countries: India, Nigeria, Pakistan and Afghanistan, where eradication efforts effectively stalled. WPV exported from northern Nigeria and northern India subsequently caused >50 outbreaks and paralysed >1500 children in previously polio-free countries across Asia and Africa. In each of the four remaining polio-endemic countries different challenges, or a combination of factors, prevented to build up sufficient levels of population immunity to stop transmission. Consequently, specific strategies were increasingly tailored to each setting. A new 2010-2012 GPEI Strategic Plan was developed which brought together several approaches to overcome the remaining hurdles to eradication, including the large-scale use of bivalent oral poliovaccine (bOPV) in supplementary immunization activities (SIAs). By the end of 2010, the impact of the new GPEI Strategic Plan 2010-2012 was apparent. Compared to 2009, the number of new polio cases in 2010 fell by 95% in both northern Nigeria and northern India, the world's largest remaining reservoirs of indigenous WPVs. By mid-2011, India had not reported a polio case for more than 5 months, and in Nigeria, endemic transmission appeared to be restricted to the north-east and north-west corners of the country. While polio cases due to WPV type 3 were still being detected in west and central Africa, the overall level of WPV3 transmission globally was at an all-time low. Uncontrolled WPV transmission appeared to be restricted to Chad and Pakistan, which increasingly represented the greatest risks to the GPEI. Although insufficient financing continued to be a major concern, political support for completing polio eradication in polio-infected countries was stronger than ever by mid-2011. While continued transmission in some areas, particularly in Pakistan and Chad, still had to be controlled as a matter of urgency, there were real opportunities to achieve new landmarks in polio eradication, especially in the key WPV reservoirs of India and Nigeria, setting the stage for polio to soon follow smallpox into the history books. Copyright © 2011 Elsevier Ltd. All rights reserved.
Instantaneous deformation and kinematics of the India-Australia Plate
NASA Astrophysics Data System (ADS)
Delescluse, Matthias; Chamot-Rooke, Nicolas
2007-02-01
Active intraplate deformation of the India-Australia Plate is now being captured by far-field global positioning system (GPS) measurements as well as measurements on a few islands located within the deforming zone itself. In this paper, we combine global and regional geodetic solutions with focal mechanisms of earthquakes to derive the present-day strain field of the India-Australia Plate. We first compile an updated catalogue of 131 Indian intraplate earthquakes (M > 5) spanning the period between the two Asian mega earthquakes of Assam 1897 and Sumatra 2004. Using Haines and Holt's numerical approach applied to a fully deformable India-Australia Plate, we show that the use of GPS data only or earthquakes data only has severe drawbacks, related, respectively, to the small number of stations and the incompleteness of the earthquakes catalogue. The combined solution avoids underestimation of the strain inherent to the Kostrov summation of seismic moments and provides details that cannot be reached by pure GPS modelling. We further explore the role of heterogeneity of the India-Australia Plate and find that the best model, in terms of geodetic vectors fit, relative distribution of strain, style and direction of principal strain from earthquakes, is obtained using the surface heat-flow as a proxy for rheological weakness of the oceanic lithosphere. The present-day deformation is distributed around the Afanasy Nikitin Chain in the Central Indian Basin (CIB)-where it is almost pure shortening-and within the Wharton Basin (WB) off Sumatra-where it is almost pure lateral strike-slip. The northern portion of NinetyEast ridge (NyR) appears as a major discontinuity for both strain and velocity. The new velocity field gives an India/Australia rotation pole located at 11.3°S, 72.8°E (-0.301°Myr-1) overlapping with previous solutions, with continental India moving eastward at rates ranging from 13 mm yr-1 (southern India) to 26 mm yr-1 (northern India) with respect to Australia. Taking into account the intraplate velocity field in the vicinity of the Sumatra trench, we obtain a convergence rate of 46 mm yr-1 towards N18°E at the epicentre of the 2004 Aceh megaearthquake. The predicted instantaneous shortening in the CIB and WB and extension near Chagos-Laccadive are in good agreement with the finite deformation measured from plate reconstructions and seismic profiles, suggesting a continuum of deformation since the onset of intraplate deformation around 7.5-8 Ma. Since no significant change in India convergence is detected at that time, we suggest that the intraplate deformation started with the trenchward acceleration of Australia detaching from India along a wide left-lateral oceanic shear band activating the NyR line of weakness as well as north-south fracture zones east of it. The predicted total amount of left lateral finite strain along these faults is in the range 110-140 km.
Multiple sclerosis in India: Iceberg or volcano.
Zahoor, Insha; Haq, Ehtishamul
2017-06-15
Multiple sclerosis (MS) 1 is a chronic neurodegenerative disease involving destruction of the myelin sheath around axons of the brain, spinal cord and optic nerve. There has been a tremendous transformation in its perspective across globe. In recent years, its prevalence has changed dramatically worldwide and India is no exception. Initially, MS was believed to be more common in the Caucasians of Northern Europe and United States; however, it has been found to be present in Indian subcontinent as well. There has been a considerable shift in MS prevalence in India and this has really changed the notion of considering India as a low risk zone for MS. In this review, a concise overview and latest update on changing scenario of MS in India is presented along with some major challenges regarding it persisting across globe even today. In India, remarkable upsurge is needed in carrying out large scale population-based epidemiological studies to get an idea about the true incidence and prevalence rates of MS viz a viz disease burden. Through this review, we have probably tried to identify the actual picture of MS prevalence in India and this could serve as harbinger for upcoming research and at the same time it would definitely aid in working out future strategies for MS management in the country. Copyright © 2017 Elsevier B.V. All rights reserved.
Modelling land cover change in the Ganga basin
NASA Astrophysics Data System (ADS)
Moulds, S.; Tsarouchi, G.; Mijic, A.; Buytaert, W.
2013-12-01
Over recent decades the green revolution in India has driven substantial environmental change. Modelling experiments have identified northern India as a 'hot spot' of land-atmosphere coupling strength during the boreal summer. However, there is a wide range of sensitivity of atmospheric variables to soil moisture between individual climate models. The lack of a comprehensive land cover change dataset to force climate models has been identified as a major contributor to model uncertainty. In this work a time series dataset of land cover change between 1970 and 2010 is constructed for northern India to improve the quantification of regional hydrometeorological feedbacks. The MODIS instrument on board the Aqua and Terra satellites provides near-continuous remotely sensed datasets from 2000 to the present day. However, the quality of satellite products before 2000 is poor. To complete the dataset MODIS images are extrapolated back in time using the Conversion of Land Use and its Effects at small regional extent (CLUE-s) modelling framework. Non-spatial estimates of land cover area from national agriculture and forest statistics, available on a state-wise, annual basis, are used as a direct model input. Land cover change is allocated spatially as a function of biophysical and socioeconomic drivers identified using logistic regression. This dataset will provide an essential input to a high resolution, physically based land surface model to generate the lower boundary condition to assess the impact of land cover change on regional climate.
Aetiology of Intellectual Disability in Paediatric Outpatients in Northern India
ERIC Educational Resources Information Center
Jauhari, Prashant; Boggula, Raju; Bhave, Anupama; Bhargava, Roli; Singh, Chandrakanta; Kohli, Neera; Yadav, Rajesh; Kumar, Rashmi
2011-01-01
Aim: To study the aetiology of intellectual disability in patients presenting to hospital and the diagnostic yield of a standardized examination. Method: Over a 1-year period, the first three children presenting to the paediatric outpatients department (OPD) on 2 selected weekdays with developmental delay, suspected intellectual disability, or…
Srivastava, Rashmi; Srivastava, Gaurav; Dilcher, David L.
2014-01-01
Premise of research A large number of fossil coryphoid palm wood and fruits have been reported from the Deccan Intertrappean beds of India. We document the oldest well-preserved and very rare costapalmate palm leaves and inflorescence like structures from the same horizon. Methodology A number of specimens were collected from Maastrichtian–Danian sediments of the Deccan Intertrappean beds, Ghughua, near Umaria, Dindori District, Madhya Pradesh, India. The specimens are compared with modern and fossil taxa of the family Arecaceae. Pivotal results Sabalites dindoriensis sp. nov. is described based on fossil leaf specimens including basal to apical parts. These are the oldest coryphoid fossil palm leaves from India as well as, at the time of deposition, from the Gondwana- derived continents. Conclusions The fossil record of coryphoid palm leaves presented here and reported from the Eurasian localities suggests that this is the oldest record of coryphoid palm leaves from India and also from the Gondwana- derived continents suggesting that the coryphoid palms were well established and wide spread on both northern and southern hemispheres by the Maastrichtian–Danian. The coryphoid palms probably dispersed into India from Europe via Africa during the latest Cretaceous long before the Indian Plate collided with the Eurasian Plate. PMID:25394208
Scaling up of HIV-TB collaborative activities: Achievements and challenges in India.
Deshmukh, Rajesh; Shah, Amar; Sachdeva, K S; Sreenivas, A N; Gupta, R S; Khaparde, S D
2016-01-01
India has been implementing HIV/TB collaborative activities since 2001 with rapid scale-up of infrastructure across the country during past decade in National AIDS Control Programme and Revised National TB Control Programme. India has shown over 50% reduction in new infections and around 35% reduction in AIDS-related deaths, thereby being one of the success stories globally. Substantial progress in the implementation of collaborative TB/HIV activities has occurred in India and it is marching towards target set out in the Global Plan to Stop TB and endorsed by the UN General Assembly to halve HIV associated TB deaths by 2015. While the successful approaches have led to impressive gains in HIV/TB control in India, there are emerging challenges including newer pockets with rising HIV trends in North India, increasing drug resistance, high mortality among co-infected patients, low HIV testing rates among TB patients in northern and eastern states in India, treatment delays and drop-outs, stigma and discrimination, etc. In spite of these difficulties, established HIV/TB coordination mechanisms at different levels, rapid scale-up of facilities with decentralisation of treatment services, regular joint supervision and monitoring, newer initiatives like use of rapid diagnostics for early diagnosis of TB among people living with HIV, TB notification, etc. have led to success in combating the threat of HIV/TB in India. This article highlights the steps taken by India, one of the largest HIV/TB programmes in world, in scaling up of the joint HIV-TB collaborative activities, the achievements so far and discusses the emerging challenges which could provide important lessons for other countries in scaling up their programmes. Copyright © 2016 Tuberculosis Association of India. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Haproff, P. J.; Yin, A.; Zuza, A. V.
2017-12-01
Investigations of continental collisions often focus on thrust belts oriented perpendicular to the plate-convergence direction and exclude belts that bound the flanks of a continental indenter despite being crucial to understanding the collisional process. Research of the Himalayan orogen, for example, has mostly centered on the east-trending thrust belt between the eastern and western syntaxes, resulting in inadequate examination of the north-trending Indo-Burma Ranges located along the eastern margin of India. To better understand the development of the entire Himalayan orogenic system, we conducted field mapping across the Northern Indo-Burma Range (NIBR), situated at the intersection of the eastern Himalaya and Indo-Burma Ranges. Our research shows that major lithologic units and thrust faults of the Himalaya extend to the NIBR, suggesting a shared geologic evolution. The structural framework of the NIBR consists of a southwest-directed thrust belt cored by a hinterland-dipping duplex, like the Himalaya. However, the Northern Indo-Burma orogen is distinct based on (1) the absence of the Tethyan Himalayan Sequence and southern Gangdese batholith, (2) the absence of the South Tibetan detachment, (3) crustal shortening greater than 80%, (4) an incredibly narrow orogen width of 7-33 km, (5) exposure of an ophiolitic mélange complex as a klippe, (6) and right-slip shear along the active range-bounding thrust fault. Furthermore, lithospheric deformation along the flank and northeast corner of India is characterized by right-slip transpression partitioned between the thrust belt and right-slip faults. Such a regime is interpreted to accommodate both contraction and clockwise rotation of Tibetan lithosphere around India, consistent with existing continuum deformation and rotation models.
Guha, P; Bhattacharjee, S; Chaudhuri, T K
2014-12-01
The Indian Subcontinent exhibits extensive diversity in its culture, religion, ethnicity and linguistic heritage, which symbolizes extensive genetic variations within the populations. The highly polymorphic Killer cell Immunoglobulin-like Receptor (KIR) family plays an important role in tracing genetic differentiation in human population. In this study, we aimed to analyse the KIR gene polymorphism in the Bengali population of northern West Bengal, India. To our knowledge, this is the first report on the KIR gene polymorphism in the Bengalis of West Bengal, India. Herein, we have studied the distribution of 14 KIR genes (KIR3DL1-3DL3, KIR2DL1-2DL5, KIR2DS1-2DS5 AND KIR3DS1) and two pseudogenes (KIR3DP1 and 2DP1) in the Bengalis. Apart from the framework genes (KIR2DL4, 3DL2, 3DL3 and 3DP1), which are present in all the individuals, the gene frequencies of other KIR genes varied between 0.34 and 0.88. Moreover, upon comparing the KIR polymorphism of the Bengalis with the available published data of other world populations, it has been found that the Indo-European-speaking Bengalis from the region share both Dravidian and Indo-Aryan gene pool with considerable influences of mongoloid and European descents. Furthermore, evidences from previously published data on human leucocyte antigen and Y-chromosome haplogroup diversity support the view. Our results will help to understand the genetic background of the Bengali population, in illustrating the population migration events in the eastern and north-eastern part of India, in explaining the extensive genetic admixture amongst the different linguistic groups of the region and also in KIR-related disease researches. © 2014 John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Chandra, Naveen; Hayashida, Sachiko; Saeki, Tazu; Patra, Prabir K.
2017-10-01
Methane (CH4) is one of the most important short-lived climate forcers for its critical roles in greenhouse warming and air pollution chemistry in the troposphere, and the water vapor budget in the stratosphere. It is estimated that up to about 8 % of global CH4 emissions occur from South Asia, covering less than 1 % of the global land. With the availability of satellite observations from space, variability in CH4 has been captured for most parts of the global land with major emissions, which were otherwise not covered by the surface observation network. The satellite observation of the columnar dry-air mole fractions of methane (XCH4) is an integrated measure of CH4 densities at all altitudes from the surface to the top of the atmosphere. Here, we present an analysis of XCH4 variability over different parts of India and the surrounding cleaner oceanic regions as measured by the Greenhouse gases Observation SATellite (GOSAT) and simulated by an atmospheric chemistry-transport model (ACTM). Distinct seasonal variations of XCH4 have been observed over the northern (north of 15° N) and southern (south of 15° N) parts of India, corresponding to the peak during the southwestern monsoon (July-September) and early autumn (October-December) seasons, respectively. Analysis of the transport, emission, and chemistry contributions to XCH4 using ACTM suggests that a distinct XCH4 seasonal cycle over northern and southern regions of India is governed by both the heterogeneous distributions of surface emissions and a contribution of the partial CH4 column in the upper troposphere. Over most of the northern Indian Gangetic Plain regions, up to 40 % of the peak-to-trough amplitude during the southwestern (SW) monsoon season is attributed to the lower troposphere ( ˜ 1000-600 hPa), and ˜ 40 % to uplifted high-CH4 air masses in the upper troposphere ( ˜ 600-200 hPa). In contrast, the XCH4 seasonal enhancement over semi-arid western India is attributed mainly ( ˜ 70 %) to the upper troposphere. The lower tropospheric region contributes up to 60 % in the XCH4 seasonal enhancement over the Southern Peninsula and oceanic region. These differences arise due to the complex atmospheric transport mechanisms caused by the seasonally varying monsoon. The CH4 enriched air mass is uplifted from a high-emission region of the Gangetic Plain by the SW monsoon circulation and deep cumulus convection and then confined by anticyclonic wind in the upper tropospheric heights ( ˜ 200 hPa). The anticyclonic confinement of surface emission over a wider South Asia region leads to a strong contribution of the upper troposphere in the formation of the XCH4 peak over northern India, including the semi-arid regions with extremely low CH4 emissions. Based on this analysis, we suggest that a link between surface emissions and higher levels of XCH4 is not always valid over Asian monsoon regions, although there is often a fair correlation between surface emissions and XCH4. The overall validity of ACTM simulation for capturing GOSAT observed seasonal and spatial XCH4 variability will allow us to perform inverse modeling of XCH4 emissions in the future using XCH4 data.
Seismic Structure of India from Regional Waveform Matching
NASA Astrophysics Data System (ADS)
Gaur, V.; Maggi, A.; Priestley, K.; Rai, S.
2003-12-01
We use a neighborhood adaptive grid search procedure and reflectivity synthetics to model regional distance range (500-2000~km) seismograms recorded in India and to determine the variation in the crust and uppermost mantle structure across the subcontinent. The portions of the regional waveform which are most influenced by the crust and uppermost mantle structure are the 10-100~s period Pnl and fundamental mode surface waves. We use the adaptive grid search algorithm to match both portions of the seismogram simultaneously. This procedure results in a family of 1-D path average crust and upper mantle velocity and attenuation models whose propagation characteristics closely match those of the real Earth. Our data set currently consist of ˜20 seismograms whose propagation paths are primarily confined to the Ganges Basin in north India and the East Dharwar Craton of south India. The East Dharwar Craton has a simple and uniform structure consisting of a 36+/-2 km thick two layer crust, and an uppermost mantle with a sub-Moho velocity of 4.5~km/s. The structure of northern India is more complicated, with pronounced low velocities in the upper crustal layer due to the large sediment thicknesses in the Ganges basin.
When status hurts: dimensions of women's status and domestic abuse in rural Northern India.
Mogford, Elizabeth
2011-07-01
This study is a multiple logistic regression analysis of the relationship between dimensions of women's status and domestic abuse in rural Uttar Pradesh, India, using the 1998-1999 National Family Health Survey (NFHS-2). Findings indicate that the effects of a woman's status on her likelihood of experiencing abuse depend on the social realm within which status operates. Specifically, more "public" dimensions of status are associated with a greater probability of abuse, while "domestic" dimensions are protective. The findings are interpreted in terms of transitioning gender norms in Uttar Pradesh and provide clarity to the literature on the complex relationship between status and abuse.
Bhat, Pradeep; Hegde, Ganesh R; Hegde, Gurumurthi; Mulgund, Gangadhar S
2014-01-01
Documentation of ethnomedicinal knowledge pertaining to the treatment of different types of skin diseases from the Central Western Ghats of India, a rich habitat of different ethnic communities. Frequent field surveys were carried out to invent the 'key informants' in the treatment of skin diseases in the study area. The information was collected through semi-structured open ended interviews with questionnaire in their local Kannada language. All medicinal plants recorded for the treatment of skin diseases were photographed in the field; voucher specimens were made subsequently and are deposited in the Herbarium, P.G. Department of Botany, Karnatak University, Dharwad. The information such as botanical name, status, family, vernacular name, habit and habitat, analysis like percentage of parts used, percentage of drug preparations, use value (UV), informants consensus factor (ICF), fidelity level (FL) and correlation between UV and use mention (Np) of the plants are provided. In all, 48 informants were interviewed. Amongst which 38 were the 'key informants' who gave the information exclusively about the treatment of skin diseases. Among 102 plant species collected, seven species are endemic to India and eleven species have their nativity outside India. Twelve species could be considered as new claims for skin diseases as their use has not been mentioned in Ayurveda or any other research articles surveyed. Of all the drug formulations, paste is the most preferred method (50%) followed by oil extraction (18.89%), juice (14.44%), ash (4.44%) etc. The highest UV is for Pongamia pinnata, Naregamia alata, Randia dumetorum and Girardinia diversifolia (1.50 each). The treatment for different types of skin diseases by the herbal healers are classified into 13 categories, out of which ringworm scored the highest ICF value. Similarly, the 100% FL value scored was in the order of 10 plants for boils, 4 plants for different types of sore, 2 plants for ringworm, intertrigo, eczema and pruritus respectively. As Caesalpinia mimosoides and Basella alba in the treatment of boils, Hygrophila schulli for inter trigo, Cissus discolor for ringworm, Mammea suriga for eczema scored high FL and high Np value, they can be considered as important species. The documentation and data analysis of the ethnomedicinal knowledge in the coastal regions of Uttara Kannada district of Central Western Ghats have provided the information about important plants in the treatment of different types of skin diseases. Further scientific analysis of such plants may provide novel compounds for the treatment of skin diseases. © 2013 The Authors. Published by Elsevier Ireland Ltd All rights reserved.
Health literacy among Indian adults seeking dental care.
D'Cruz, Audrey M; Shankar Aradhya, M R
2013-01-01
Poor literacy can impede one's ability not only to seek out needed health information but also to process, understand and use it to make appropriate health care decisions. The objective of the study was to assess the health literacy among adult patients seeking oral health care at in a private dental hospital in Bangalore, Karnataka, India. A cross sectional questionnaire survey was carried out on 500 subjects. The questionnaire designed by Chew and colleagues (2004) was modified and used as the survey instrument. To be eligible to participate in the study, the participants had to be aged above 18 years and able to read or write English/Kannada (local language). Analysis of variance (ANOVA) and Student's t-test (two tailed, independent) was used to find the significance of study parameters at 95% confidence interval. About 60.4% of the subjects had low health literacy level, 29.4% average and only 10.2% had high health literacy levels. Age and educational qualification had a suggestive significant difference with the mean health literacy scores while gender did not have any significant difference. Subjects who had completed post-graduation (57.8%) too had low health literacy levels. A large number of patients have low levels of health literacy that may interfere with their ability to process and understand basic health information.
Shailaja, U; Rao, Prasanna N; Debnath, Parikshit; Adhikari, Anjan
2014-01-01
Cerebral palsy (CP) is the leading cause of childhood disability affecting cognitive function and developments in approximately 1.5 to 3 cases per 1000 live births. Based on Ayurvedic therapeutic principles, CP patients were subjected to Abhyanga (massage) with Moorchita Tila Taila (processed sesame oil) and Svedana (fomentation) with Shastikashali Pinda Sveda (fomentation with bolus of drugs prepared with boiled rice). Study group received Mustadi Rajayapana Basti (enema with herbal decoction) and Baladi Yoga (a poly-herbo-mineral formulation), while the placebo group received Godhuma Vati (tablet prepared with wheat powder) and saline water as enema. Treatment with Mustadi Rajayapana Basti and Baladi Yoga improved the activities of daily life by 8.79%, gross motor functions by 19.76%, and fine motor functions 15.05%, and mental functions like memory retention got improved by 15.43%. The placebo group showed an improvement of 0.21% in daily life activities, 2.8% in gross motor, and 2.4% in fine motor functions. Mustadi Rajayapana Basti and Baladi Yoga proved to be more supportive in improving the motor activities and gross behavioral pattern. Further clinical trials are required to evaluate and validate the maximum effect of the combination therapy in a large sample with repetition of the courses for longer duration.
Shailaja, U; Rao, Prasanna N.; Debnath, Parikshit; Adhikari, Anjan
2014-01-01
Cerebral palsy (CP) is the leading cause of childhood disability affecting cognitive function and developments in approximately 1.5 to 3 cases per 1000 live births. Based on Ayurvedic therapeutic principles, CP patients were subjected to Abhyanga (massage) with Moorchita Tila Taila (processed sesame oil) and Svedana (fomentation) with Shastikashali Pinda Sveda (fomentation with bolus of drugs prepared with boiled rice). Study group received Mustadi Rajayapana Basti (enema with herbal decoction) and Baladi Yoga (a poly-herbo-mineral formulation), while the placebo group received Godhuma Vati (tablet prepared with wheat powder) and saline water as enema. Treatment with Mustadi Rajayapana Basti and Baladi Yoga improved the activities of daily life by 8.79%, gross motor functions by 19.76%, and fine motor functions 15.05%, and mental functions like memory retention got improved by 15.43%. The placebo group showed an improvement of 0.21% in daily life activities, 2.8% in gross motor, and 2.4% in fine motor functions. Mustadi Rajayapana Basti and Baladi Yoga proved to be more supportive in improving the motor activities and gross behavioral pattern. Further clinical trials are required to evaluate and validate the maximum effect of the combination therapy in a large sample with repetition of the courses for longer duration. PMID:24872933
Venkatesh; Krishna, V; Kumar, K Girish; Pradeepa, K; Kumar, S R Santosh; Kumar, R Shashi
2013-07-01
An efficient protocol was standardized for screening of panama wilt resistant Musa paradisiaca cv. Puttabale clones, an endemic cultivar of Karnataka, India. The synergistic effect of 6-benzyleaminopurine (2 to 6 mg/L) and thidiazuron (0.1 to 0.5 mg/L) on MS medium provoked multiple shoot induction from the excised meristem. An average of 30.10 +/- 5.95 shoots was produced per propagule at 4 mg/L 6-benzyleaminopurine and 0.3 mg/L thidiazuron concentrations. Elongation of shoots observed on 5 mg/L BAP augmented medium with a mean length of 8.38 +/- 0.30 shoots per propagule. For screening of disease resistant clones, multiple shoot buds were mutated with 0.4% ethyl-methane-sulfonate and cultured on MS medium supplemented with Fusarium oxysporum f. sp. cubense (FOC) culture filtrate (5-15%). Two month old co-cultivated secondary hardened plants were used for screening of disease resistance against FOC by the determination of biochemical markers such as total phenol, phenylalanine ammonia lyase, oxidative enzymes like peroxidase, polyphenol oxidase, catalase and PR-proteins like chitinase, beta-1-3 glucanase activities. The mutated clones of M. paradisiaca cv. Puttabale cultured on FOC culture filtrate showed significant increase in the levels of biochemical markers as an indicative of acquiring disease resistant characteristics to FOC wilt.
Bhat, Sathyanarayana; Udupa, Kumaraswamy
2013-08-01
Origin of ancient Indian toxicology can be dated back to vedic literature. Toxins of both animate and inanimate world were very well understood during the era. Rig and Atharva vedic texts describe such details. After classifying such toxins, Charaka Samhitha, the basic literature of Indian Medicine used gold and ghee as panaceas to counter act them. Ayurveda considers toxicology as one among the eight specialized branches of medical wisdom. Unfortunately, the available literature on this is very limited. Moreover, they have been discussed briefly in Charaka and Sushrutha Samhitha. Mangarasa I, a Jain scholar who lived on the foothills of the Western Ghats, in Southern India in 1350 A.D., felt this vacuum and composed an independent, elaborate Kannada text on toxicology. His less known text Khagendra Mani Darpana (KMD) is the first ever documented complete text on toxicology in the world. Medieval Indian wisdom on plant and animal diversities are very well reflected in this unique toxicological text. Centuries past to Linnean era, KMD gives vivid descriptions on zoological and botanical diversities of the time. This astonishing fact is an evidence of our ancestor's curiosities about the nature around them. A critical overview of the bio-diversity described in KMD text is discussed in this paper.
Selvamani, Manickam; Donoghue, Mandana; Basandi, Praveen Shivappa
2012-01-01
The purpose of this study was to determine the prevalence of odontogenic cysts and to identify their clinico-pathological features among patients by studying biopsy specimens obtained from the archives of the Department of Oral and Maxillofacial Pathology, College of Dental Sciences, Davangere, Karnataka, India, during the past 10 years. Data for the study were retrieved from the case records of patients fitting the histological classification of the World Health Organization (1992). Analyzed clinical variables included age, gender, anatomical location, and histological diagnosis. Of the 2275 biopsy reports analyzed, 194 cases (8.5%) were jaw cysts, including odontogenic (6.7%) and nonodontogenic cysts (0.25%). Odontogenic cysts included 69.3% radicular, 20.3% dentigerous, 5.2% keratinizing odontogenic, 3.3% residual, and 1.9% other cysts, such as lateral periodontal, botryoid odontogenic, and gingival cysts. The most frequent clinical manifestation was swelling, followed by a combination of pain and swelling. Age, gender, and location were related to the etiopathologic characteristics of the cyst type. A definitive diagnosis can be made on the basis of clinical, radiological, and histological findings, which makes a good interdepartmental relationship between the clinicians and pathologists essential. Knowledge of the biological and histological behavior of the odontogenic cysts is required for their early detection and treatment.
Violence against Educated Women by Intimate Partners in Urban Karnataka, India
Kundapur, Rashmi; Shetty, Shruthi M.; Kempaller, Vinayak J.; Kumar, Ashwini; Anurupa, M.
2017-01-01
Background: Initially viewed as a human rights issue, partner violence is increasingly seen as an important public health problem of international concern. Objectives: To assess the extent of physical, sexual, psychological, and controlling behavior of intimate partners against women in an educated society and find the association with age, age of marriage, married years, educational status of the women and that of partner. Materials and Methods: A prevalence of 15% was taken and final sample was 200, after considering loss of follow-up. Statistical Methods: Proportion, Z-test, Chi-square test. Results: The prevalence of violence against intimate partner in educated society was found to be 40.5% in a South Indian city. Physical assault was high in 30–50 years and increased with duration of marriage from 5.5% at 5 years to 33.3% in 10–20 years of married life. Sexual and psychological assault also increased in <5 years of married life to 35% and 47.6% in 10–20 years duration of marriage, which was statistically significant. Sexual and psychological assault showed a bimodal presentation. Less educated women and their partners were found to report more violence, which was statistically significant. Conclusion: Violence against women is not uncommon in the educated society. PMID:28852277
Impact of degree truncation on the spread of a contagious process on networks.
Harling, Guy; Onnela, Jukka-Pekka
2018-03-01
Understanding how person-to-person contagious processes spread through a population requires accurate information on connections between population members. However, such connectivity data, when collected via interview, is often incomplete due to partial recall, respondent fatigue or study design, e.g., fixed choice designs (FCD) truncate out-degree by limiting the number of contacts each respondent can report. Past research has shown how FCD truncation affects network properties, but its implications for predicted speed and size of spreading processes remain largely unexplored. To study the impact of degree truncation on predictions of spreading process outcomes, we generated collections of synthetic networks containing specific properties (degree distribution, degree-assortativity, clustering), and also used empirical social network data from 75 villages in Karnataka, India. We simulated FCD using various truncation thresholds and ran a susceptible-infectious-recovered (SIR) process on each network. We found that spreading processes propagated on truncated networks resulted in slower and smaller epidemics, with a sudden decrease in prediction accuracy at a level of truncation that varied by network type. Our results have implications beyond FCD to truncation due to any limited sampling from a larger network. We conclude that knowledge of network structure is important for understanding the accuracy of predictions of process spread on degree truncated networks.
Bhat, Sathyanarayana; Udupa, Kumaraswamy
2013-01-01
Origin of ancient Indian toxicology can be dated back to vedic literature. Toxins of both animate and inanimate world were very well understood during the era. Rig and Atharva vedic texts describe such details. After classifying such toxins, Charaka Samhitha, thebasic literature of Indian Medicine used gold and ghee as panaceas to counter act them. Ayurveda considers toxicology as one among the eight specialized branches of medical wisdom. Unfortunately, the available literature on this is very limited. Moreover, they have been discussed briefly in Charaka and Sushrutha Samhitha. Mangarasa I, a Jain scholar who lived on the foothills of the Western Ghats, in Southern India in 1350 A.D., felt this vacuum and composed an independent, elaborate Kannada text on toxicology. His less known text Khagendra Mani Darpana (KMD) is the first ever documented complete text on toxicology in the world. Medieval Indian wisdom on plant and animal diversities are very well reflected in this unique toxicological text. Centuries past to Linnean era, KMD gives vivid descriptions on zoological and botanical diversities of the time. This astonishing fact is an evidence of our ancestor's curiosities about the nature around them. A critical overview of the bio-diversity described in KMD text is discussed in this paper. PMID:23905027
Arakeri, Gururaj; Hunasgi, Santosh; Colbert, Serryth; Merkx, M A W; Brennan, Peter A
2014-07-01
Although oral submucous fibrosis (OSMF) is thought to be multifactorial in origin, the chewing of areca nut is thought to be the main cause. Alkaloids and tannins in areca nut are responsible for fibrosis, but recent evidence has suggested that copper ions are also an important mediator, and in a small pilot study we recently found that OSMF was significantly associated with a raised concentration of copper in drinking water. We have further investigated this association in a heterogeneous population in Hyderabad-Karnataka, India, a region with a high incidence of the condition. We evaluated 3 groups, each of 100 patients: those with OSMF who chewed gutkha, those who chewed gutkha but did not have OSMF, and healthy controls who did not chew gutkha. The difference between the groups in the mean concentration of copper in water measured by atomic absorption spectrometry was significant (p<0.001). There were also significant differences between the groups in mean concentrations of serum copper, salivary copper, and ceruloplasmin (p<0.001). Our results confirm that copper in drinking water contributes to the pathogenesis of OSMF, but ingestion of copper is unlikely to be the sole cause. Copyright © 2014 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Methodological Issues In Forestry Mitigation Projects: A CaseStudy Of Kolar District
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ravindranath, N.H.; Murthy, I.K.; Sudha, P.
2007-06-01
There is a need to assess climate change mitigationopportunities in forest sector in India in the context of methodologicalissues such as additionality, permanence, leakage, measurement andbaseline development in formulating forestry mitigation projects. A casestudy of forestry mitigation project in semi-arid community grazing landsand farmlands in Kolar district of Karnataka, was undertaken with regardto baseline and project scenariodevelopment, estimation of carbon stockchange in the project, leakage estimation and assessment ofcost-effectiveness of mitigation projects. Further, the transaction coststo develop project, and environmental and socio-economic impact ofmitigation project was assessed.The study shows the feasibility ofestablishing baselines and project C-stock changes. Since the areamore » haslow or insignificant biomass, leakage is not an issue. The overallmitigation potential in Kolar for a total area of 14,000 ha under variousmitigation options is 278,380 tC at a rate of 20 tC/ha for the period2005-2035, which is approximately 0.67 tC/ha/yr inclusive of harvestregimes under short rotation and long rotation mitigation options. Thetransaction cost for baseline establishment is less than a rupee/tC andfor project scenario development is about Rs. 1.5-3.75/tC. The projectenhances biodiversity and the socio-economic impact is alsosignificant.« less
Lakshminarayana, H D
1991-01-01
Data are obtained and analyzed from 4232 rural families of handloom weavers in Karnataka state, India. 60.20% families are small families with 6 or fewer family members, of whom 25% have 3 members. 96.78% of small families have only one occupation. 30.50% of large families and 12.42% of medium sized families have more than one occupation. About 74% of families have income under the poverty line (under Rs 3500/year). 83% of small families are under the poverty line. The dependency ratio of small families is 1:2. 33% of all dependents are found among small families which are below the poverty line. 82% of dependents in small families are in small families under the poverty line. Almost 50% of dependents belong to small families. Small families are found to have slightly lower levels of education, although average level of education is very similar regardless of family size. The findings are used as evidence that small families do not necessarily augment the economy and that economic, educational, and cultural thresholds may be necessary before small family size affects economic development and improves the general well-being of family members. The social system that the small family is operating in is considered an important factor affecting the quality of life of the family.
Seasonal and altitudinal changes in population density of 20 species of Drosophila in Chamundi hill.
Guruprasad, Basavarajpur R; Hegde, Shridhar N; Krishna, Mysore S
2010-01-01
A year long study was conducted to analyze the altitudinal and seasonal variation in a population of Drosophila (Diptera: Drosophilidae) on Chamundi hill of Mysore, Karnataka State, India. A total of 16,671 Drosophila flies belonging to 20 species of 4 subgenera were collected at altitudes of 680 m, 780 m, 880 m and 980 m. The subgenus Sophophora was predominant with 14 species and the subgenus Drosilopha was least represented with only a single species. Cluster analysis and constancy methods were used to analyze the species occurrence qualitatively. Altitudinal changes in the population density, and relative abundance of the different species at different seasons were also studied. The diversity of the Drosophila community was assessed by applying the Simpson and Berger-Parker indices. At 680 m the Simpson Index was low at 0.129 and the Berger- Parker index was high at 1.1 at 980 m. Linear regression showed that the Drosophila community was positively correlated with rainfall but not elevation, Furthermore the density of Drosophila changed significantly in different seasons (F = 11.20, df 2, 9; P<0.004). The distributional pattern of a species or related group of species was uneven in space and time. D. malerkotliana and D. nasuta were found at all altitudes and can be considered as dominant species.
Naveen, Kikkeri Narayanashetty; Tophakane, R S; Hanumanthayya, Keloji; Pv, Bhagawat; Pai, Varadraj V
2011-12-15
To study the various clinical presentations of herpes zoster and to find out the proportion of HIV positivity in these patients. A time bound study was conducted from November 2004 to October 2005. All clinically diagnosed cases of herpes zoster were tested for HIV infection with ELISA and confirmed by Tridot and Coomb AID. Total numbers of 90 zoster cases were recorded. Mean duration of pre herpetic neuralgia was 2.134 (standard deviation=1.424, F=8.951, P<0.001). The thoracic dermatome (46.66%) was most commonly involved, followed by the cranial nerves (18.88%), lumbar (14.44%), cervical (13.33%) and sacral (6.66%) nerves. A substantial proportion, 34 (37.77%) out of 90 cases, were found to be HIV positive. Of these, 64.7 percent of the HIV seropositive herpes zoster patients belonged to the age group of 21-40 years. Out of 39 who had a risk of exposure to STDs and whose ages were less than 50 years, 31 (79.48%) tested positive for HIV infection. The occurrence of zoster in the young age group in patients who report a history of risk factors for HIV, may need testing. Herpes zoster serves as a clinical indicator of HIV seropositivity and one of the earliest manifestations.
1992-04-16
the two major ranges is the narrow valley of the ...although lower, is also prominent and rises south of the Northern Plains to form the Aravalli Range in the west and the jungle- covered Chota Nagpur... The global components of the United States’ national security are defined by its national interests. These are delineated in the
Acoustic and Durational Properties of Indian English Vowels
ERIC Educational Resources Information Center
Maxwell, Olga; Fletcher, Janet
2009-01-01
This paper presents findings of an acoustic phonetic analysis of vowels produced by speakers of English as a second language from northern India. The monophthongal vowel productions of a group of male speakers of Hindi and male speakers of Punjabi were recorded, and acoustic phonetic analyses of vowel formant frequencies and vowel duration were…
Padalia, Rajendra C; Verma, Ram S; Sundaresan, Velusamy; Chanotiya, Chandan S
2010-08-01
The essential-oil compositions of leaves, flowers, and rhizomes of Alpinia galanga (L.) Willd., Alpinia calcarata Rosc., Alpinia speciosa K. Schum., and Alpinia allughas Rosc. were examined and compared by capillary GC and GC/MS. Monoterpenoids were the major oil constituents identified. 1,8-Cineole, alpha-terpineol, (E)-methyl cinnamate, camphor, terpinen-4-ol, and alpha- and beta-pinenes were the major constituents commonly distributed in leaf and flower essential oils. The presence of endo-fenchyl acetate, exo-fenchyl acetate, and endo-fenchol was the unique feature of rhizome essential oils of A. galanga, A. calcarata, and A. speciosa. On contrary, the rhizome oil of A. allughas was dominated by beta-pinene. Significant qualitative and quantitative variations were observed in essential-oil compositions of different parts of Alpinia species growing in subtemperate and subtropical regions of Northern India. Cluster analysis was performed to find similarities and differences in essential-oil compositions based on representative molecular skeletons. Monoterpenoids, viz., 1,8-cineole, terpinen-4-ol, camphor, pinenes, (E)-methyl cinnamate, and fenchyl derivatives, were used as chemotaxonomic markers.
Progress toward poliomyelitis eradication--India, January 2007-May 2009.
2009-07-10
India is the most populous of the four remaining countries (including Afghanistan, Nigeria, and Pakistan) where transmission of wild poliovirus (WPV) has never been interrupted. The last cases of WPV type 2 worldwide were reported in October 1999 in India. However, transmission of WPV type 1 (WPV1) and WPV type 3 (WPV3) persists in India in the northern states of Uttar Pradesh and Bihar. Transmission of indigenous WPV in all of India's other states was successfully interrupted in 2002, and all WPV cases reported since then in the country have resulted from WPV circulating in Uttar Pradesh and Bihar. This report updates previous reports and summarizes India's progress toward polio eradication since January 2007, as of May 29, 2009. In 2005, the government of India introduced the use of monovalent oral polio vaccine type 1 (mOPV1), which has higher efficacy against WPV1 than does trivalent oral polio vaccine (tOPV), in supplementary immunization activities. After a multistate WPV1 outbreak in 2006, preferential use of mOPV1 was accelerated and WPV1 cases decreased from 83 in 2007 to 18 during January-May 2009. A resurgence of WPV3 cases in Uttar Pradesh in 2007 led to an outbreak in Bihar. SIAs using monovalent type 3 OPV (mOPV3) were expanded in 2007, and the number of WPV3 cases declined from 794 in 2007 to 41 during January-May 2009. Simultaneously interrupting transmission in high-risk areas of western Uttar Pradesh and Bihar is the key to successful interruption of all WPV transmission in India.
Beattie, Tara S H; Bhattacharjee, Parinita; Ramesh, B M; Gurnani, Vandana; Anthony, John; Isac, Shajy; Mohan, H L; Ramakrishnan, Aparajita; Wheeler, Tisha; Bradley, Janet; Blanchard, James F; Moses, Stephen
2010-08-11
Violence against female sex workers (FSWs) can impede HIV prevention efforts and contravenes their human rights. We developed a multi-layered violence intervention targeting policy makers, secondary stakeholders (police, lawyers, media), and primary stakeholders (FSWs), as part of wider HIV prevention programming involving >60,000 FSWs in Karnataka state. This study examined if violence against FSWs is associated with reduced condom use and increased STI/HIV risk, and if addressing violence against FSWs within a large-scale HIV prevention program can reduce levels of violence against them. FSWs were randomly selected to participate in polling booth surveys (PBS 2006-2008; short behavioural questionnaires administered anonymously) and integrated behavioural-biological assessments (IBBAs 2005-2009; administered face-to-face). 3,852 FSWs participated in the IBBAs and 7,638 FSWs participated in the PBS. Overall, 11.0% of FSWs in the IBBAs and 26.4% of FSWs in the PBS reported being beaten or raped in the past year. FSWs who reported violence in the past year were significantly less likely to report condom use with clients (zero unprotected sex acts in previous month, 55.4% vs. 75.5%, adjusted odds ratio (AOR) 0.4, 95% confidence interval (CI) 0.3 to 0.5, p < 0.001); to have accessed the HIV intervention program (ever contacted by peer educator, 84.9% vs. 89.6%, AOR 0.7, 95% CI 0.4 to 1.0, p = 0.04); or to have ever visited the project sexual health clinic (59.0% vs. 68.1%, AOR 0.7, 95% CI 0.6 to 1.0, p = 0.02); and were significantly more likely to be infected with gonorrhea (5.0% vs. 2.6%, AOR 1.9, 95% CI 1.1 to 3.3, p = 0.02). By the follow-up surveys, significant reductions were seen in the proportions of FSWs reporting violence compared with baseline (IBBA 13.0% vs. 9.0%, AOR 0.7, 95% CI 0.5 to 0.9 p = 0.01; PBS 27.3% vs. 18.9%, crude OR 0.5, 95% CI 0.4 to 0.5, p < 0.001). This program demonstrates that a structural approach to addressing violence can be effectively delivered at scale. Addressing violence against FSWs is important for the success of HIV prevention programs, and for protecting their basic human rights.
The historic biogeography of India: isolation or contact?
Briggs, J C
1989-01-01
Geophysical maps depicting continental movement have consistently shown India, as it moved northward, to be located far out in the Tethys Sea. India split off from the African east coast about 148 m.y.a. From that time onward, according to almost all geophysical accounts, India was isolated from all of other continents until the early Miocene when it made contact with Eurasia. But the biological data, both fossil and Recent, indicate that this concept cannot be correct. If India had really existed as an isolated, oceanic continent for about 100 m.y., it should have developed a peculiar biota with many endemic genera and families in its terrestrial and shallow marine habitats. But there are virtually no remains of organisms indicating that India was isolated for any substantial time (millions of years). Instead, we find that almost all Indian taxa were possessed in common with other continents. As time went on, the northern relationships became stronger and the southern ones weaker. Most of the recent geophysical accounts show India not making contact with Eurasia until the early Miocene, but fossil materials show that this event must have taken place by the early Eocene. It has been postulated that, as India moved northward, it created a biogeographic barrier that separated marine fish populations and resulted in the east-west provinces that are now apparent in the Indian Ocean. At the same time, the barrier effect was supposed to have resulted in the formation of sister species that are now located far apart. Information currently available indicates that most living, tropical marine species are probably not over 3 m.y. old. Consequently, the northward movement of India, which took place primarily between 148 and 50 m.y.a., could have no bearing on the relationships of modern species.
NASA Astrophysics Data System (ADS)
Li, M.; Zhang, S.; Garcia-Menendez, F.; Monier, E.; Selin, N. E.
2016-12-01
Climate change, favoring more heat waves and episodes of stagnant air, may deteriorate air quality by increasing ozone and fine particulate matter (PM2.5) concentrations and high pollution episodes. This effect, termed as "climate penalty", has been quantified and explained by many earlier studies in the U.S. and Europe, but research efforts in Asian countries are limited. We evaluate the impact of climate change on air quality and human health in China and India using a modeling framework that links the Massachusetts Institute of Technology Integrated Global System Model to the Community Atmosphere Model (MIT IGSM-CAM). Future climate fields are projected under three climate scenarios including a no-policy reference scenario and two climate stabilization scenarios with 2100 total radiative forcing targets of 9.7, 4.5 and 3.7 W m-2, respectively. Each climate scenario is run for five representations of climate variability to account for the role of natural variability. Thirty-year chemical transport simulations are conducted in 1981-2010 and 2086-2115 under the three climate scenarios with fixed anthropogenic emissions at year 2000 levels. We find that 2000—2100 climate change under the no-policy reference scenario would increase ozone concentrations in eastern China and northern India by up to 5 ppb through enhancing biogenic emissions and ozone production efficiency. Ozone extreme episodes also become more frequent in these regions, while climate policies can offset most of the increase in ozone episodes. Climate change between 2000 and 2100 would slightly increase anthropogenic PM2.5 concentrations in northern China and Sichuan province, but significantly reduce anthropogenic PM2.5 concentrations in southern China and northern India, primarily due to different chemical responses of sulfate-nitrate-ammonium aerosols to climate change in these regions. Our study also suggests that the mitigation costs of climate policies can be partially offset by health benefits from reduced climate-induced air pollution in China.
Brar, A P S; Sood, N K; Kaur, P; Singla, L D; Sandhu, B S; Gupta, K; Narang, D; Singh, C K; Chandra, M
2017-10-01
Bovine calf scours reported to be caused by multiple aetiologies resulting in heavy mortality in unweaned calves and huge economic loss to the dairy farmers. Among these, cryptosporidiosis is an emerging waterborne zoonoses and one of the important causes of neonatal calf diarrhoea. Poor immune response coupled with primary cryptosporidial infections predispose neonatal calves to multiple secondary infections resulting in their deaths. In the present study, faecal samples from 100 diarrhoeic calves randomly picked up out of 17 outbreaks of bovine calf diarrhoea in periurban Ludhiana, Punjab in Northern India were subjected to conventional (microscopy, modified Zeihl-Neelsen (mZN) staining) and immunological and molecular techniques (faecal antigen capture ELISA and PCR) for detection of primary Cryptosporidium parvum infection as well as other frequently reported concurrent pathogens, viz. rotavirus and coronavirus, Salmonella spp., Escherichia coli, Clostridium perfringens and Eimeria spp. The faecal antigen capture ELISA and PCR revealed 35% prevalence of C. parvum in contrast to 25% by mZN staining with a relatively higher prevalence (66·7%) in younger (8-14-day-old) calves. The detection rate of the other enteropathogens associated with C. parvum was 45·71% for C. perfringens followed by Salmonella spp (40·0%), rotavirus (36·0%), coronavirus (16·0%), E. coli (12·0%) and Eimeria spp (4·0%) The sensitivity for detection of C. parvum by ELISA and mZN staining in comparison to PCR was 97·14% and 72·72%, respectively. An important finding of the study was that C. parvum alone was found in only 10% of the diarrhoeic faecal samples, whereas, majority of the samples (90%) showed mixed infections ranging from a combination of two to five agents. This is the first documentary proof of C. parvum and associated pathogens responsible for severe periurban outbreaks of bovine calf diarrhoea culminating in heavy mortality from Northern India.
Xu, Yue; Zhang, Gan; Li, Jun; Chakraborty, Paromita; Li, Hua; Liu, Xiang
2011-11-01
A range of organochlorinated compounds have been consumed in China, India and the countries of mainland southeast Asia (MSA). Considering their persistence in the environment and ability in long-range atmospheric transport (LRAT), the potential outflow of these compounds from this region is therefore of great concern in the context of the global distribution of toxic chemicals. As part of a monitoring campaign aimed at investigating the LRAT of organochlorine pesticides (OCPs) and polychlorinated biphenyls (PCBs) from southern China, MSA and northern India, atmospheric levels of OCPs and PCBs were measured once a week from October 2005 through December 2006 at Tengchong Mountain (TM), a remote site located in south-western China. The average concentrations of OCPs were found to be higher than those in other remote stations in the Arctic and the Tibetan plateau, except for α-hexachlorocyclohexane (α-HCH). A high level of β-HCH and low α-HCH/β-HCH ratio was attributed to an accidental release of β-HCH from unknown sources, besides obvious evidence of lindane (γ-HCH) and technical HCH usage. Temporal variations of chlordanes and endosulfan were related to the usage pattern of these compounds, as well as LRAT. In contrast, dichlorodiphenyltrichloroethane (DDT) exhibited a relatively minor seasonal variation. The OCP levels at the monitoring site were found to be related to the air parcel back trajectories on the basis of four distinct clusters. Elevated levels of HCHs and DDTs were observed when air parcels originated from northern India where considerable OCP usage was reported recently, while high levels of γ-HCH and TC (trans-chlordane) were mainly associated with air masses from southern China and northern MSA. The study highlighted the high background level of OCPs as well as their temporal patterns of trans-boundary LRAT in the MSA region.
Ancient Human Migrations to and through Jammu Kashmir- India were not of Males Exclusively.
Sharma, Indu; Sharma, Varun; Khan, Akbar; Kumar, Parvinder; Rai, Ekta; Bamezai, Rameshwar N K; Vilar, Miguel; Sharma, Swarkar
2018-01-16
Jammu and Kashmir (J&K), the Northern most State of India, has been under-represented or altogether absent in most of the phylogenetic studies carried out in literature, despite its strategic location in the Himalayan region. Nonetheless, this region may have acted as a corridor to various migrations to and from mainland India, Eurasia or northeast Asia. The belief goes that most of the migrations post-late-Pleistocene were mainly male dominated, primarily associated with population invasions, where female migration may thus have been limited. To evaluate female-centered migration patterns in the region, we sequenced 83 complete mitochondrial genomes of unrelated individuals belonging to different ethnic groups from the state. We observed a high diversity in the studied maternal lineages, identifying 19 new maternal sub-haplogroups (HGs). High maternal diversity and our phylogenetic analyses suggest that the migrations post-Pleistocene were not strictly paternal, as described in the literature. These preliminary observations highlight the need to carry out an extensive study of the endogamous populations of the region to unravel many facts and find links in the peopling of India.
Prediction of fog/visibility over India using NWP Model
NASA Astrophysics Data System (ADS)
Singh, Aditi; George, John P.; Iyengar, Gopal Raman
2018-03-01
Frequent occurrence of fog in different parts of northern India is common during the winter months of December and January. Low visibility conditions due to fog disrupt normal public life. Visibility conditions heavily affect both surface and air transport. A number of flights are either diverted or cancelled every year during the winter season due to low visibility conditions, experienced at different airports of north India. Thus, fog and visibility forecasts over plains of north India become very important during winter months. This study aims to understand the ability of a NWP model (NCMRWF, Unified Model, NCUM) with a diagnostic visibility scheme to forecast visibility over plains of north India. The present study verifies visibility forecasts obtained from NCUM against the INSAT-3D fog images and visibility observations from the METAR reports of different stations in the plains of north India. The study shows that the visibility forecast obtained from NCUM can provide reasonably good indication of the spatial extent of fog in advance of one day. The fog intensity is also predicted fairly well. The study also verifies the simple diagnostic model for fog which is driven by NWP model forecast of surface relative humidity and wind speed. The performance of NWP model forecast of visibility is found comparable to that from simple fog model driven by NWP forecast of relative humidity and wind speed.
Monitoring of ocean surface algal blooms in coastal and oceanic waters around India.
Tholkapiyan, Muniyandi; Shanmugam, Palanisamy; Suresh, T
2014-07-01
The National Aeronautics and Space Administration's (NASA) sensor MODIS-Aqua provides an important tool for reliable observations of the changing ocean surface algal bloom paradigms in coastal and oceanic waters around India. A time series of the MODIS-Aqua-derived OSABI (ocean surface algal bloom index) and its seasonal composite images report new information and comprehensive pictures of these blooms and their evolution stages in a wide variety of events occurred at different times of the years from 2003 to 2011, providing the first large area survey of such phenomena around India. For most of the years, the results show a strong seasonal pattern of surface algal blooms elucidated by certain physical and meteorological conditions. The extent of these blooms reaches a maximum in winter (November-February) and a minimum in summer (June-September), especially in the northern Arabian Sea. Their spatial distribution and retention period are also significantly increased in the recent years. The increased spatial distribution and intensity of these blooms in the northern Arabian Sea in winter are likely caused by enhanced cooling, increased convective mixing, favorable winds, and atmospheric deposition of the mineral aerosols (from surrounding deserts) of the post-southwest monsoon period. The southward Oman coastal current and southwestward winds become apparently responsible for their extension up to the central Arabian Sea. Strong upwelling along this coast further triggers their initiation and growth. Though there is a warming condition associated with increased sea surface height anomalies along the coasts of India and Sri Lanka in winter, surface algal bloom patches are still persistent along these coasts due to northeast monsoonal winds, enhanced precipitation, and subsequent nutrient enrichment in these areas. The occurrence of the surface algal blooms in the northern Bay of Bengal coincides with a region of the well-known Ganges-Brahmaputra Estuarine Frontal (GBEF) system, which increases supply of nutrients in addition to the land-derived inputs triggering surface algal blooms in this region. Low density (initiation stage) of such blooms observed in clear oceanic waters southeast and northeast of Sri Lanka may be caused by the vertical mixing processes (strong monsoonal winds) and the occurrence of Indian Ocean Dipole events. Findings based on the analyses of time series satellite data indicate that the new information on surface algal blooms will have important bearing on regional fisheries, ecosystem and environmental studies, and implications of climate change scenarios.
Developing the medicinal plants sector in northern India: challenges and opportunities
Kala, Chandra Prakash; Dhyani, Pitamber Prasad; Sajwan, Bikram Singh
2006-01-01
The medicinal properties of plant species have made an outstanding contribution in the origin and evolution of many traditional herbal therapies. These traditional knowledge systems have started to disappear with the passage of time due to scarcity of written documents and relatively low income in these traditions. Over the past few years, however, the medicinal plants have regained a wide recognition due to an escalating faith in herbal medicine in view of its lesser side effects compared to allopathic medicine in addition the necessity of meeting the requirements of medicine for an increasing human population. Through the realization of the continuous erosion of traditional knowledge of plants used for medicine in the past and the renewed interest at the present time, a need existed to review this valuable knowledge of medicinal plants with the purpose of developing medicinal plants sectors across the different states in India. Our major objectives therefore were to explore the potential in medicinal plants resources, to understand the challenges and opportunities with the medicinal plants sector, and also to suggest recommendations based upon the present state of knowledge for the establishment and smooth functioning of the medicinal plants sector along with improving the living standards of the underprivileged communities. The review reveals that northern India harbors a rich diversity of valuable medicinal plants, and attempts are being made at different levels for sustainable utilization of this resource in order to develop the medicinal plants sector.
Knowledge and Attitude Toward Corneal Donation Among High School Children in Northern India.
Gupta, Parul Chawla; Duggal, Mona; Jamir, Limalemla; Sharma, Drishti; Kankaria, Ankita; Sathyanath, Shreyaswi; Kaur, Rupinder; Rana, Kirtan; Ram, Jagat
2017-05-01
To assess the knowledge and attitude of school-going adolescents regarding corneal donation in government and private schools in an urban area of Northern India. A school-based cross-sectional study was conducted in an urban field practice area of Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India. A total of 365 participants of the seventh to 10th grade were enrolled from a government school and a private school. A pretested, semistructured, self-administered, bilingual (English and Hindi) questionnaire was used to assess the sociodemographic profile and knowledge and attitude related to corneal donation. Most (87%) (confidence interval, 83.1%-90.0%) participants had heard about corneal donation. Only 2% of students answered all the knowledge-related questions correctly. None knew about the national toll-free number for corneal donation. Three-fourth (72%) supported the idea of corneal donation. Of them, only 44% (confidence interval, 41.0-47.1) were willing to pledge to donate their own eyes. Fears and myths were the persistent barriers. The government and private schools differed in both knowledge and attitude, with the latter performing better. Knowledge among the selected high school children was poor. Although many supported the idea, only a few were willing to donate. We suggest that program components be evaluated from time to time. Future studies should explore the role of strengthening Information Education and Communication (IEC) activities among high school students for motivating community members to pledge to donate for corneal donation.
Utaaker, Kjersti Selstad; Myhr, Nina; Bajwa, Rajinder Singh; Joshi, Himanshu; Kumar, Anil; Robertson, Lucy J
2017-12-22
Various characteristics of goats mean they are highly suitable livestock for backyard rearing by people with limited resources. They are a popular livestock choice in India, where they are often kept to supplement an already scarce income. In these settings, hygiene and sanitation standards tend to be low, and weakens the interface between humans and animals, thus reducing the barrier between them and thereby increasing the likelihood that zoonotic and anthroponotic infections will occur. This study reports an investigation of the occurrence of Cryptosporidium spp. and Giardia duodenalis in goats being reared in different settings in urban and peri-urban areas in northern India, and addressed the zoonotic potential of these important protozoan parasites shed from goats living close to humans. The overall prevalence of G. duodenalis was 33.8 and 0.5% for Cryptosporidium spp.; the relatively low prevalence of cryptosporidiosis may reflect that most samples were derived from adult animals. The prevalence of G. duodenalis excretion was found to be similar to that reported in other studies. However, although other studies have reported a predominance of non-zoonotic Assemblage E in goats, in this study potentially zoonotic Assemblages predominated [Assemblage A (36%) and Assemblage B (32%)]. The results of this study indicate that in this area where goats and humans are living in close proximity, there may be sharing of intestinal parasites, which can be detrimental for both host species.
Future projections of active-break spells of Indian summer monsoon in a climate change perspective
NASA Astrophysics Data System (ADS)
Sudeepkumar, B. L.; Babu, C. A.; Varikoden, Hamza
2018-02-01
The effect of global climate change on Indian summer monsoon has been analysed with special emphasis on active-break cycle. The changes in intensity and duration of active and break monsoon conditions towards the end of the century are studied by using 850 hPa zonal circulations. The analysis is carried out using twenty year climatology of historical period (1986-2005) and future projections (2080-2099) simulated as part of Coupled Model Intercomparison Project phase 5 (CMIP5). Models are compared with NCEP/NCAR reanalysis data. The models that effectively capture the circulation pattern of monsoon (JJAS) are considered for assessing the future climate in RCP 4.5 scenario. They are CanESM2, CNRM-CM5, GFDL-ESM2M, MIROC5 and MPI-ESM-LR. During the southwest monsoon period, the ensemble mean of models projects a strengthening of the wind speed towards north (north of 15°N) and weakening to the southern region (especially south of 12°N) which facilitates wetting of northern Indian regions and drying of southern peninsular regions. In the case of active-break conditions, the active spells are found to be strengthening over northern India and weakening over the peninsular India, the break spells intensify over southern tip of peninsular India indicating intense breaks. Increased propensity of short intense active days and decreased propensity of long active days are also projected by the models. The number of break spells does not show any significant changes.
Clinical profile and outcome of children with scrub typhus from Chennai, South India.
Ganesh, Ramaswamy; Suresh, Natarajan; Pratyusha, L L; Janakiraman, Lalitha; Manickam, Mani; Andal, A
2018-06-01
Scrub typhus is an acute febrile illness caused by Orientia tsutsugamushi. We prospectively studied the clinico-laboratory profile and outcome of 358 children aged 1 day to 18 years diagnosed with scrub typhus from Chennai, South India. All children (100%) had fever. Eschar was seen in 67%. All children were treated with oral doxycycline and those with complications were treated with intravenous chloramphenicol/azithromycin. Rapid defervescence (within 48 h) after initiation of doxycline was seen in 306 (85%) and 52 (14.5%) developed complications. Multivariate logistic regression analysis revealed that children who had an elevated aspartate amino transferase (> 120 IU/L) and the presence of thrombocytopenia (platelet count less than 1 lac cells/mm 3 ) at admission had high risk of developing complications. The overall mortality rate in this series was 0.8%. Our 4-year study highlights the clinico-laboratory profile of Scrub typhus in children from Chennai, South India. Early recognition and prompt treatment reduces the complication and mortality. What is Known: • Scrub typhus is endemic to tsutsugamushi triangle, a geographical triangle extending from northern Japan in the east to Pakistan and Afghanistan in the west and northern Australia in the south. • There is paucity of data regarding its clinico-laboratory profile in neonates as well as its predictors of outcome. What is New: • Children who had an elevated AST and the presence of thrombocytopenia at admission had high risk of developing complications.
Impacts of snow darkening by absorbing aerosols on South Asian monsoon
NASA Astrophysics Data System (ADS)
Kim, K. M.; Lau, W. K. M.; Kim, M. K.; Sang, J.; Yasunari, T. J.; Koster, R. D.
2016-12-01
Seasonal heating over the Tibetan Plateau is a main driver of the onset of the South Asian Monsoon. Aerosols can play an important role in pre- and early monsoon seasonal heating process over the Tibetan Plateau by increasing atmospheric heating in the northern India, and by heating of the surface of the Tibetan Plateau and Himalayan slopes, via reduction of albedo of the snow surface through surface deposition - the so call snow-darkening effect (SDE). To examine the impact of SDE on weather and climate during late spring and early summer, two sets of NASA/GEOS-5 model simulations with and without SDE are conducted. Results show that SDE-induced surface heating accelerates snow melts and increases surface temperature over 4K in the entire Tibetan Plateau regions during boreal summer. Warmer Tibetan Plateau further accelerates seasonal warming in the upper troposphere and increases the north-south temperature gradient between the Tibetan Plateau and the equatorial Indian Ocean. This reversal of the north-south temperature gradient is a primary cause of the onset of the South Asian monsoon. SDE-induced increase of the meridional temperature gradient drives meridional circulation and enhanced upper tropospheric easterlies and lower tropospheric westerlies, and intensifies monsoon circulation and rainfall. This pattern enhances the EHP-like circulation anomalies induced by atmospheric heating of absorbing aerosols over the northern India. SDE-induced change in the India subcontinent differs that in Eurasia. SDE-induced land-atmospheric interactions in two regions will be also compared.
Epidemiology of Dyspepsia and Irritable Bowel Syndrome (IBS) in Medical Students of Northern India.
Basandra, Sumeena; Bajaj, Divyansh
2014-12-01
Dyspepsia and Irritable Bowel Syndrome (IBS) are perhaps one of the most common gastrointestinal diseases universally. The prevalence of dyspepsia ranges from 7-40% while the prevalence of IBS ranges between 3-22% in population based studies worldwide. This study was conducted to estimate the prevalence, socio-demographic and lifestyle associated risk factors of Dyspepsia and IBS among medical college students of urban Delhi, Northern India. It is a cross-sectional study and was carried out from January to March 2014 at Maulana Azad Medical College, New Delhi, India. A total of 210 students from a Medical College were asked to complete a semi-structured questionnaire based on identification and socio-demographic data, questions pertaining to lifestyle and Rome III criteria. Of the valid 200 subjects, 90(45%) were males and 110(55%) were females, with a mean age of 20.43± 1.05 y. Majority of the subjects (diagnosed with uninvestigated dyspepsia and IBS) were in the age group of 18-20 y with female gender having higher odds for both. The prevalence of dyspepsia was 18% while that of IBS was 16.5%.Consumption of fatty food, cigarettes and low physical activity were observed as most significant correlates. Rome III criteria enables symptom based diagnosis of dyspepsia and IBS.The prevalence of dyspepsia and IBS in college students from Delhi is observed to be higher. Association with lifestyle related factors highlights the importance of modifications in their prevention.