Science.gov

Sample records for nosocomial acinetobacter baumannii

  1. Nosocomial Acinetobacter baumannii Infections and Changing Antibiotic Resistance.

    PubMed

    Necati Hakyemez, Ismail; Kucukbayrak, Abdulkadir; Tas, Tekin; Burcu Yikilgan, Aslihan; Akkaya, Akcan; Yasayacak, Aliye; Akdeniz, Hayrettin

    2013-09-01

    In the intensive care setting, Acinetobacter baumannii causes ventilator-associated pneumonia and other nosocomial infections that are difficult to treat. Objective of this study was to investigate nosocomial A. baumannii infections and its changing antibiotic resistance. A total of 56 patients diagnosed with A.baumannii infections between January 2009 and December 2011 were included in the study. Diagnosis for nosocomial infections was established according to the CDC (Centers for Disease Control and Prevention) criteria. Identification of the agents isolated was carried out using conventional methods and VITEK 2 automated system, while antibiotic sensitivity testing was performed through VITEK 2 AST-N090 automated system. The most common infection was nosocomial pneumonia by 43%, among which 46% were ventilator-associated pneumonia. Considering all years, the most effective antibiotics on the isolated strains were found as colistin, tigecycline, imipenem and meropenem. However resistance to imipenem and meropenem was observed to increase over years. The issue of increased resistance to antibiotics poses difficulty in treatment of A. baumannii infections which in turn increases the rate of mortality and cost. In order to prevent development of resistance, antibiotics must be used in an appropriate way in accompanied with proper guidance.

  2. Nosocomial Infections Caused by Acinetobacter baumannii: Are We Losing the Battle?

    PubMed

    Protic, Dragana; Pejovic, Aleksa; Andjelkovic, Dragana; Djukanovic, Nina; Savic, Dragana; Piperac, Pavle; Markovic Denic, Ljiljana; Zdravkovic, Marija; Todorovic, Zoran

    2016-04-01

    The incidence of nosocomial infections caused by multi-drug- and extended-drug resistant strains of Acinetobacter is constantly increasing all over the world, with a high mortality rate. We analyzed the in-hospital data on the sensitivity of Acinetobacter baumannii isolates and correlated them with antibiotic treatment and clinical outcomes of nosocomial infections over a 17-mo period. Retrospective analysis was performed at the Clinical Center "Bezanijska kosa," Belgrade, Serbia. Microbiologic data (number and sensitivity of A. baumannii isolates) and clinical data (medical records of 41 randomly selected patients who developed nosocomial infection caused by A. baumannii) were matched. Acinetobacter baumannii, detected in 279 isolates and obtained from 19 patients (12% of all samples), was resistant to almost all antibiotics tested, including carbapenems, with the exception of colistin and tigecycline. It was obtained most often from the respiratory tract samples. Empiric treatment of the nosocomial infections (pneumonia in 75% of cases) involved cephalosporins, metronidazole, and carbapenems (80%, 66%, and 61% of patients, respectively), whereas tigecyclin and colistin were used primarily in targeted therapy (20% and 12% of patients, respectively). The mortality rate of patients treated empirically was significantly higher (p < 0.01), reaching 100% in the elderly. Nosocomial A. baumannii infections represent a significant clinical problem because of their high incidence, lack of susceptibility to the most commonly used antibiotics, and the often inappropriate treatment, which favors the development of multi-drug-resistant strains.

  3. [Ecological aspects and prophylaxis of Acinetobacter baumannii nosocomial infection].

    PubMed

    Boukadida, J

    2000-01-01

    Acinetobacter Baumannii is an aerobic strit gram negative bacteria cause of epidemic infection in intensive care units this bacteria is isolated from the patient and its environment. The detection of AB infection require the isolation of patients and decontamination of the material despite the virulence of the germ, these measures are necessary due to the rapid extension of epidemic in the absence of adequate means.

  4. Bacteremic nosocomial pneumonia caused by Acinetobacter baumannii and Acinetobacter nosocomialis: a single or two distinct clinical entities?

    PubMed

    Lee, Y-T; Kuo, S-C; Yang, S-P; Lin, Y-T; Chiang, D-H; Tseng, F-C; Chen, T-L; Fung, C-P

    2013-07-01

    The phenotypically indistinguishable Acinetobacter baumannii and Acinetobacter nosocomialis have become leading pathogens causing nosocomial pneumonia in critically ill patients. A. baumannii and A. nosocomialis nosocomial pneumonias were grouped as a single clinical entity previously. This study aimed to determine whether they are the same or a different clinical entity. A total of 121 patients with A. baumannii and 131 with A. nosocomialis bacteremic nosocomial pneumonia were included during an 8-year period. Despite the similar Charlson co-morbidity scores at admission, patients with A. baumannii pneumonia were more likely to have abnormal haematological findings, lobar pneumonia, significantly higher Acute Physiology and Chronic Health Evaluation II scores and higher frequency of shock at the onset of bacteraemia than those with A. nosocomialis pneumoni. A. baumannii isolates were resistant to more classes of antimicrobials, except colistin, and therefore the patients with A. baumannii pneumonia were more likely to receive inappropriate antimicrobial therapy. The 14-day mortality was significantly higher in patients with A. baumannii pneumonia (34.7% vs. 15.3%, p 0.001). A. baumannii was an independent risk factor for mortality (OR, 2.03; 95% CI, 1.05-3.90; p 0.035) in the overall cohort after adjustment for other risk factors for death, including inappropriate antimicrobial therapy. The results demonstrated the difference in clinical presentation, microbial characteristics and outcomes between A. baumannii and A. nosocomialis nosocomial pneumonia, and supported that they are two distinct clinical entities.

  5. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity

    PubMed Central

    Richards, A.M.; Kwaik, Y. Abu; Lamont, R.J.

    2015-01-01

    SUMMARY Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of ‘Iraqibacter’. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. PMID:25052812

  6. Code blue: Acinetobacter baumannii, a nosocomial pathogen with a role in the oral cavity.

    PubMed

    Richards, A M; Abu Kwaik, Y; Lamont, R J

    2015-02-01

    Actinetobacter baumannii is an important nosocomial pathogen that can cause a wide range of serious conditions including pneumonia, meningitis, necrotizing fasciitis and sepsis. It is also a major cause of wound infections in military personnel injured during the conflicts in Afghanistan and Iraq, leading to its popular nickname of 'Iraqibacter'. Contributing to its success in clinical settings is resistance to environmental stresses such as desiccation and disinfectants. Moreover, in recent years there has been a dramatic increase in the number of A. baumannii strains with resistance to multiple antibiotic classes. Acinetobacter baumannii is an inhabitant of oral biofilms, which can act as a reservoir for pneumonia and chronic obstructive pulmonary disease. Subgingival colonization by A. baumannii increases the risk of refractory periodontitis. Pathogenesis of the organism involves adherence, biofilm formation and iron acquisition. In addition, A. baumannii can induce apoptotic cell death in epithelial cells and kill hyphal forms of Candida albicans. Virulence factors that have been identified include pili, the outer membrane protein OmpA, phospholipases and extracellular polysaccharide. Acinetobacter baumannii can sense blue light through a blue-light sensing using flavin (BLUF) domain protein, BlsA. The resulting conformational change in BlsA leads to changes in gene expression, including virulence genes. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii in the nosocomial setting in Latin America.

    PubMed

    Labarca, Jaime A; Salles, Mauro José Costa; Seas, Carlos; Guzmán-Blanco, Manuel

    2016-01-01

    Increasing prevalence of carbapenem-resistant Pseudomonas aeruginosa and Acinetobacter baumannii strains in the nosocomial setting in Latin America represents an emerging challenge to public health, as the range of therapeutic agents active against these pathogens becomes increasingly constrained. We review published reports from 2002 to 2013, compiling data from throughout the region on prevalence, mechanisms of resistance and molecular epidemiology of carbapenem-resistant strains of P. aeruginosa and A. baumannii. We find rates of carbapenem resistance up to 66% for P. aeruginosa and as high as 90% for A. baumannii isolates across the different countries of Latin America, with the resistance rate of A. baumannii isolates greater than 50% in many countries. An outbreak of the SPM-1 carbapenemase is a chief cause of resistance in P. aeruginosa strains in Brazil. Elsewhere in Latin America, members of the VIM family are the most important carbapenemases among P. aeruginosa strains. Carbapenem resistance in A. baumannii in Latin America is predominantly due to the oxacillinases OXA-23, OXA-58 and (in Brazil) OXA-143. Susceptibility of P. aeruginosa and A. baumannii to colistin remains high, however, development of resistance has already been detected in some countries. Better epidemiological data are needed to design effective infection control interventions.

  8. The Immune Response against Acinetobacter baumannii, an Emerging Pathogen in Nosocomial Infections.

    PubMed

    García-Patiño, María Guadalupe; García-Contreras, Rodolfo; Licona-Limón, Paula

    2017-01-01

    Acinetobacter baumannii is the etiologic agent of a wide range of nosocomial infections, including pneumonia, bacteremia, and skin infections. Over the last 45 years, an alarming increase in the antibiotic resistance of this opportunistic microorganism has been reported, a situation that hinders effective treatments. In order to develop effective therapies against A. baumannii it is crucial to understand the basis of host-bacterium interactions, especially those concerning the immune response of the host. Different innate immune cells such as monocytes, macrophages, dendritic cells, and natural killer cells have been identified as important effectors in the defense against A. baumannii; among them, neutrophils represent a key immune cell indispensable for the control of the infection. Several immune strategies to combat A. baumannii have been identified such as recognition of the bacteria by immune cells through pattern recognition receptors, specifically toll-like receptors, which trigger bactericidal mechanisms including oxidative burst and cytokine and chemokine production to amplify the immune response against the pathogen. However, a complete picture of the protective immune strategies activated by this bacteria and its potential therapeutic use remains to be determined and explored.

  9. Small, Enigmatic Plasmids of the Nosocomial Pathogen, Acinetobacter baumannii: Good, Bad, Who Knows?

    PubMed Central

    Lean, Soo Sum; Yeo, Chew Chieng

    2017-01-01

    Acinetobacter baumannii is a Gram-negative nosocomial pathogen that has become a serious healthcare concern within a span of two decades due to its ability to rapidly acquire resistance to all classes of antimicrobial compounds. One of the key features of the A. baumannii genome is an open pan genome with a plethora of plasmids, transposons, integrons, and genomic islands, all of which play important roles in the evolution and success of this clinical pathogen, particularly in the acquisition of multidrug resistance determinants. An interesting genetic feature seen in majority of A. baumannii genomes analyzed is the presence of small plasmids that usually ranged from 2 to 10 kb in size, some of which harbor antibiotic resistance genes and homologs of plasmid mobilization genes. These plasmids are often overlooked when compared to their larger, conjugative counterparts that harbor multiple antibiotic resistance genes and transposable elements. In this mini-review, we will examine our current knowledge of these small A. baumannii plasmids and look into their genetic diversity and phylogenetic relationships. Some of these plasmids, such as the Rep-3 superfamily group and the pRAY-type, which has no recognizable replicase genes, are quite widespread among diverse A. baumannii clinical isolates worldwide, hinting at their usefulness to the lifestyle of this pathogen. Other small plasmids especially those from the Rep-1 superfamily are truly enigmatic, encoding only hypothetical proteins of unknown function, leading to the question of whether these small plasmids are “good” or “bad” to their host A. baumannii. PMID:28861061

  10. Investigation of a nosocomial outbreak of extended-spectrum beta-lactamase VEB-1-producing isolates of Acinetobacter baumannii in a hospital setting.

    PubMed

    Carbonne, A; Naas, T; Blanckaert, K; Couzigou, C; Cattoen, C; Chagnon, J-L; Nordmann, P; Astagneau, P

    2005-05-01

    A nosocomial outbreak of epidemiologically related VEB-1 extended-spectrum beta-lactamase-producing isolates of Acinetobacter baumannii occurred in 33 patients in an intensive care unit. A case-control study identified previous treatment with third-generation cephalosporins as the only risk factor for A. baumannii acquisition. Rationale for antibiotic use should be strengthened.

  11. Risk factors for nosocomial burn wound infection caused by multidrug resistant Acinetobacter baumannii.

    PubMed

    Tekin, Recep; Dal, Tuba; Bozkurt, Fatma; Deveci, Ozcan; Palanc, Ylmaz; Arslan, Eyüp; Selçuk, Caferi Tayyar; Hoşoğlu, Salih

    2014-01-01

    Acinetobacter baumannii infections in burn patients may lead to delays in wound healing, graft losses, and development of sepsis. Determining the risk factors for multidrug resistant A. baumannii (MDR-AB) infections is essential for infection control. In the present study, the authors aimed to evaluate risk factors for wound infections caused by A. baumannii in burn patients. The study was conducted at Dicle University Hospital Burn Center, from April 2011 to July 2012, to investigate the risk factors for MDR-AB infections. The data of both the case and control group patients and the result of wound cultures were recorded on a daily basis, on individual forms given for each patient, and analyzed. A total of 30 cases infected with MDR-AB, and 60 uninfected control patients, were included in the study. The mean age (±SD) was 7.7 ± 15.4 years in infected patients and 11.4 ± 16.5 years in uninfected patients. The mean total burn surface area was 13.5 ± 10.9% in uninfected patients and 34.7 ± 16.2% in infected patients. The mean total burn surface area, the abbreviated burn severity index, acute physiological and chronic health evaluation II score, day of admission to hospital, length of hospital stay, first excision day, prior usage of third-generation cephalosporins, and stay in intensive care unit of the infected patients were significantly higher (P < .001) than those of patients without infection. Univariate analysis found that high acute physiological and chronic health evaluation II score, first excision time of wound, invasive device usage, admission day to hospital, and prior usage of broad-spectrum antibiotics were risk factors for nosocomial infections. This study showed that multiple factors contribute to multidrug resistance in A. baumannii. A combination of an early diagnosis of wound infections, appropriate antimicrobial treatments, surgical debridement, and early wound closure may be effective in the management.

  12. Relatedness of wildlife and livestock avian isolates of the nosocomial pathogen Acinetobacter baumannii to lineages spread in hospitals worldwide.

    PubMed

    Wilharm, Gottfried; Skiebe, Evelyn; Higgins, Paul G; Poppel, Marie T; Blaschke, Ulrike; Leser, Sarah; Heider, Christine; Heindorf, Magdalena; Brauner, Paul; Jäckel, Udo; Böhland, Karin; Cuny, Christiane; Łopińska, Andżelina; Kaminski, Piotr; Kasprzak, Mariusz; Bochenski, Marcin; Ciebiera, Olaf; Tobółka, Marcin; Żołnierowicz, Katarzyna M; Siekiera, Joachim; Seifert, Harald; Gagné, Stéphanie; Salcedo, Suzana P; Kaatz, Michael; Layer, Franziska; Bender, Jennifer K; Fuchs, Stephan; Semmler, Torsten; Pfeifer, Yvonne; Jerzak, Leszek

    2017-09-19

    The natural habitats and potential reservoirs of the nosocomial pathogen Acinetobacter baumannii are poorly defined. Here, we put forth and tested the hypothesis of avian reservoirs of A. baumannii. We screened tracheal and rectal swab samples from livestock (chicken, geese) and wild birds (white stork nestlings) and isolated A. baumannii from 3% of sampled chicken (n=220), 8% of geese (n=40) and 25% of white stork nestlings (n=661). Virulence of selected avian A. baumannii isolates was comparable to that of clinical isolates in the Galleria mellonella infection model. Whole genome sequencing revealed the close relationship of an antibiotic-susceptible chicken isolate from Germany with a multidrug-resistant human clinical isolate from China and additional linkages between livestock isolates and human clinical isolates related to international clonal lineages. Moreover, we identified stork isolates related to human clinical isolates from the USA. Multilocus sequence typing disclosed further kinship between avian and human isolates. Avian isolates do not form a distinct clade within the phylogeny of A. baumannii, instead they diverge into different lineages. Further, we provide evidence that A. baumannii is constantly present in the habitats occupied by storks. Collectively, our study suggests A. baumannii could be a zoonotic organism that may disseminate into livestock. This article is protected by copyright. All rights reserved. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Whole-Genome Sequencing Elucidates Epidemiology of Nosocomial Clusters of Acinetobacter baumannii

    PubMed Central

    Willems, Stefanie; Kampmeier, Stefanie; Bletz, Stefan; Kossow, Annelene; Köck, Robin; Kipp, Frank

    2016-01-01

    We characterized two epidemiologically similar Acinetobacter baumannii clusters from two separate intensive care units (ICU) using core genome multilocus sequence typing. Clonal spread was confirmed in ICU-1 (12 of 14 isolates shared genotypes); in ICU-2, all genotypes (13 isolates) were diverse, thus excluding transmissions and enabling adequate infection control measures. PMID:27358465

  14. 1,2,4-Triazolidine-3-thiones Have Specific Activity against Acinetobacter baumannii among Common Nosocomial Pathogens.

    PubMed

    Corey, Brendan W; Thompson, Mitchell G; Hittle, Lauren E; Jacobs, Anna C; Asafo-Adjei, Edward A; Huggins, William M; Melander, Roberta J; Melander, Christian; Ernst, Robert K; Zurawski, Daniel V

    2017-01-13

    Acinetobacter baumannii are Gram-negative bacilli that pose a constant threat to susceptible patients because of increased resistance to multiple antibiotics and persistence in the hospital environment. After genome analysis, we discovered that A. baumannii harbors genes that share homology to an enzymatic pathway that elongates long-chain fatty acids (LCFA) in fungi. Previously, 1,2,4-triazolidine-3-thiones (T-3-Ts) were shown to inhibit hyphae production in fungi, and this same LCFA elongation pathway was implicated as the possible target. Therefore, we investigated if T-3-Ts also have activity against multidrug-resistant A. baumannii. Surprisingly, all of the clinical isolates of A. baumannii that were tested have susceptibility to ECC145 and ECC188 with MIC90 values of 8.0 μg/mL. In contrast, reference strains and clinical isolates of other common nosocomial bacteria that lack the LCFA pathway also lacked susceptibility. Time-kill experiments revealed that both ECC145 and ECC188 have a bacteriostatic effect against A. baumannii. Mass spectrometry analysis suggested that exposure to T-3-Ts resulted in less LCFA production. Supplementation of media with either 0.02% w/v oleic or linoleic acid abrogated the bacteriostatic effect of the compounds, which again implicated LCFA elongation as the target. Our results suggest these molecules could be a promising start to further exploit what appears to be an important aspect of A. baumannii membrane function and integrity.

  15. Clinical importance and cost of bacteremia caused by nosocomial multi drug resistant acinetobacter baumannii.

    PubMed

    Gulen, Tugba Arslan; Guner, Rahmet; Celikbilek, Nevreste; Keske, Siran; Tasyaran, Mehmet

    2015-09-01

    A. baumannii is an important nosocomial pathogen associated with high mortality, morbidity and medical cost. The aim of this study was to investigate risk factors for MDR A. baumannii bacteremia and also evaluate cost of hospitalization of these patients. Study was conducted in Ankara Atatürk Training and Research Hospital. Patients who were hospitalized in ICU and diagnosed for nosocomial blood stream infection (BSI) between January 2007 and December 2010 were checked retrospectively. Patients with nosocomial BSI caused by multidrug resistant A. baumannii were compared with the patients who had BSI caused by other Gram-negative microorganisms in terms of risk factors, mortality and medical costs. In multivariate analysis previous use of carbapenem, quinolone and metronidazole, and SAPS II score were found as independent risk factors. In case group; immunosupression, SAPS II score, and hospital stay until infection were independently associated with mortality in multivariate analysis. Our results suggest that the occurrence of MDR A.baumannii bacteremia was related with the usage of the wide spectrum antibiotics, and mortality rates were increased in patients that high SAPS II scores, long term hospitalization. Infection control procedures and limited antibiotic usage are very important for prevent nosocomial infections. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Investigation and control of a suspected nosocomial outbreak of pan-drug resistant Acinetobacter baumannii in an intensive care unit

    PubMed Central

    Ying, Qian; Qun, Li; Qinzhong, Liu; Mingliang, Chen; Hong, Chen; Ni, Zou

    2016-01-01

    Abstract Acinetobacter baumannii, a non-fermenting Gram-negative bacterium, is a common pathogen in intensive care units (ICU) that is easily spread through contact and can cause nosocomial outbreaks. This study investigated the risk factors associated with outbreaks of pan-drug resistant Acinetobacter baumannii (PDR-Ab) infection by studying a suspected nosocomial outbreak in a comprehensive ICU in a teaching hospital in China, and discusses the effectiveness of current prevention and control measures. Pathogen detection methods involving pulsed field gel electrophoresis (PFGE) were employed to survey patients infected or colonized with PDR-Ab. An epidemiological investigation was conducted to determine the risk factors for infection or colonization with PDR-Ab between 1 October 2014 and 16 January 2015. The rate of PDR-Ab infection in the ICU was higher during the period from 1 October 2014 to 16 January 2015 than it was between 1 October 2013 and 16 January 2014. Only two cases were confirmed to have the same genotype. Risk factors were explored and the rate of infection was found to be controlled by interventions targeting these risk factors. A decrease in the number of infections was observed after multiple prevention and control measures were implemented, preventing the outbreak of a nosocomial infection. PMID:28352851

  17. Biofilm Formation and Colistin Susceptibility of Acinetobacter baumannii Isolated from Korean Nosocomial Samples.

    PubMed

    Kim, Hyun Ah; Ryu, Seong Yeol; Seo, Incheol; Suh, Seong-Il; Suh, Min-Ho; Baek, Won-Ki

    2015-08-01

    Biofilm formation, a virulence factor of Acinetobacter baumannii, is associated with long-term survival in hospital environments and provides resistance to antibiotics. Standard tests for antibiotic susceptibility involve analyzing bacteria in the planktonic state. However, the biofilm formation ability can influence antibiotic susceptibility. Therefore, here, the biofilm formation ability of A. baumannii clinical isolates from Korea was investigated and the susceptibility of biofilm and planktonic bacteria to colistin was compared. Of the 100 clinical isolates examined, 77% exhibited enhanced biofilm formation capacity relative to a standard A. baumannii strain (ATCC 19606). Differences between the minimal inhibitory concentrations and minimal biofilm-inhibitory concentrations of colistin were significantly greater in the group of A. baumannii that exhibited enhanced biofilm formation than the group that exhibited less ability for biofilm formation. Thus, the ability to form a biofilm may affect antibiotic susceptibility and clinical failure, even when the dose administered is in the susceptible range.

  18. Is inhaled colistin beneficial in ventilator associated pneumonia or nosocomial pneumonia caused by Acinetobacter baumannii?

    PubMed

    Demirdal, Tuna; Sari, Ummu Sena; Nemli, Salih Atakan

    2016-02-24

    In the present study, our objective was to evaluate and compare the clinical and microbiological results in patients receiving systemic and systemic plus inhaled colistin therapy due to nosocomial pneumonia (NP) or ventilator associated pneumonia (VAP) caused by Acinetobacter baumannii. A retrospective matched case-control study was performed at the ICUs at Izmir Katip Celebi University Ataturk Training and Research Hospital from January 2013 to December 2014. Eighty patients who received only systemic colistin were matched 43 patients who received systemic colistin combined with inhaled therapy. In 97.6 % of the patients colistin was co-administered with at least one additional antibiotic. The most frequently co-administered antibiotics were carbapenems (79.7 %). The patient groups did not differ significantly in terms of the non-colistin antibiotics used for treatment (p > 0.05). Acute renal injury was observed in 53.8 % and 48.8 % of the patients who received parenteral colistin or parenteral plus inhaler colistin, respectively (p = 0.603). There were no significant differences between the groups in terms of clinical success (p = 0.974), clinical failure (p = 0.291), or recurrence (p = 0.094). Only, a significantly higher partial clinical improvement rate was observed in the systemic colistin group (p = 0.009). No significant differences between the two groups in terms of eradication (p = 0.712), persistence (p = 0.470), or recurrence (p = 0.356) rates was observed. One-month mortality rate was similar in systemic (47.5 %) and systemic plus inhaled (53.5 %) treatment groups (p = 0.526). Our results suggest that combination of inhaled colistin with intravenous colistin had no additional therapeutic benefit in terms of clinical or microbiological outcomes.

  19. Clonal Diversity of Nosocomial Epidemic Acinetobacter baumannii Strains Isolated in Spain▿

    PubMed Central

    Villalón, Pilar; Valdezate, Sylvia; Medina-Pascual, Maria J.; Rubio, Virginia; Vindel, Ana; Saez-Nieto, Juan A.

    2011-01-01

    Acinetobacter baumannii is one of the major pathogens involved in nosocomial outbreaks. The clonal diversity of 729 epidemic strains isolated from 19 Spanish hospitals (mainly from intensive care units) was analyzed over an 11-year period. Pulsed-field gel electrophoresis (PFGE) identified 58 PFGE types that were subjected to susceptibility testing, rpoB gene sequencing, and multilocus sequence typing (MLST). All PFGE types were multidrug resistant; colistin was the only agent to which all pathogens were susceptible. The 58 PFGE types were grouped into 16 clones based on their genetic similarity (cutoff of 80%). These clones were distributed into one major cluster (cluster D), three medium clusters (clusters A, B, and C), and three minor clusters (clusters E, F, and G). The rpoB gene sequencing and MLST results reflected a clonal distribution, in agreement with the PFGE results. The MLST sequence types (STs) (and their percent distributions) were as follows: ST-2 (47.5%), ST-3 (5.1%), ST-15 (1.7%), ST-32 (1.7%), ST-79 (13.6%), ST-80 (20.3%), and ST-81 (10.2%). ST-79, ST-80, and ST-81 and the alleles cpn60-26 and recA29 are described for the first time. International clones I, II, and III were represented by ST-81, ST-2, and ST-3, respectively. ST-79 and ST-80 could be novel emerging clones. This work confirms PFGE and MLST to be complementary tools in clonality studies. Here PFGE was able to demonstrate the monoclonal pattern of most outbreaks, the inter- and intrahospital transmission of bacteria, and their endemic persistence in some wards. MLST allowed the temporal evolution and spatial distribution of Spanish clones to be monitored and permitted international comparisons to be made. PMID:21177889

  20. Phenotypic and Molecular Characterization of Acinetobacter baumannii Clinical Isolates from Nosocomial Outbreaks in Los Angeles County, California▿

    PubMed Central

    Valentine, Sonya C.; Contreras, Deisy; Tan, Stephanie; Real, Lilian J.; Chu, Sheena; Xu, H. Howard

    2008-01-01

    Multidrug-resistant Acinetobacter baumannii strains have increasingly resulted in nosocomial outbreaks worldwide, leaving limited options for treatment. To date, little has been reported on the antimicrobial susceptibilities and genomic profiles of A. baumannii strains from hospital outbreaks in the Greater Los Angeles area. In this study, we examined the susceptibilities and genetic profiles of 20 nonduplicate isolates of A. baumannii from nosocomial outbreaks in Los Angeles County (LAC) and determined their mechanisms of fluoroquinolone resistance. Antibiotic susceptibility testing indicated that the majority of these LAC isolates were not susceptible to 14 of the 17 antibiotics tested, with the exception of doxycycline, minocycline, and tigecycline. In particular, all isolates were found to be resistant to ciprofloxacin. Genomic DNA analysis revealed eight epidemiologically distinct groups among these 20 A. baumannii isolates, consistent with antibiotic susceptibility profiles. Sequencing analysis confirmed that concurrent GyrA and ParC amino acid substitutions in the “hot spots” of their respective quinolone resistance-determining regions were primarily responsible for the high-level ciprofloxacin resistance of these isolates. Antibiotic susceptibility testing using two efflux pump inhibitors suggested that the presence of efflux pumps was only a secondary contributor to ciprofloxacin resistance for some of the isolates. In summary, the present study has revealed good correlation between the antibiotic susceptibility profiles and genetic fingerprints of 20 clinical isolates from nosocomial outbreaks in Los Angeles County and has determined their mechanisms of fluoroquinolone resistance, providing an important foundation for continued surveillance and epidemiological analyses of emerging A. baumannii isolates in Los Angeles County hospitals. PMID:18524965

  1. More Than Just Light: Clinical Relevance of Light Perception in the Nosocomial Pathogen Acinetobacter baumannii and Other Members of the Genus Acinetobacter.

    PubMed

    Ramírez, María Soledad; Müller, Gabriela Leticia; Pérez, Jorgelina Fernanda; Golic, Adrián Ezequiel; Mussi, María Alejandra

    2015-11-01

    A summary of the major findings concerning light modulation in Acinetobacter baumannii, which governs aspects related to the success of this microorganism as a nosocomial pathogen, is presented. Particularly, the evidence shows that light modulates the ability of the bacteria to persist in the environment, its virulence against eukaryotic hosts and even susceptibility to certain antibiotics. The light signal is sensed through different mechanisms, in some cases involving specialized photoreceptors of the BLUF-type, whereas in others, directly by a photosensitizer molecule. We also provide new data concerning the genomic context of BLUF-domain containing proteins within the genus Acinetobacter, as well as further insights into the mechanism of light-mediated reduction in susceptibility to antibiotics. The overall information points toward light being a crucial stimulus in the lifestyle of members of the genus Acinetobacter as well as in other clinically relevant species, such as members of the ESKAPE group, playing therefore an important role in the clinical settings.

  2. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen.

    PubMed

    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica

    2016-01-01

    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control.

  3. Antibiotic-Resistant Acinetobacter baumannii Increasing Success Remains a Challenge as a Nosocomial Pathogen

    PubMed Central

    Gonzalez-Villoria, Ana Maria; Valverde-Garduno, Veronica

    2016-01-01

    Antibiotic-resistant infectious bacteria currently imply a high risk and therefore constitute a strong challenge when treating patients in hospital settings. Characterization of these species and of particular strains is a priority for the establishment of diagnostic tests and preventive procedures. The relevance of Acinetobacter baumannii as a problematic microorganism in inpatient facilities, particularly intensive care units, has increased over time. This review aims to draw attention to (i) the historical emergence of carbapenem-resistant Acinetobacter baumannii, (ii) the current status of surveillance needs in Latin America, and (iii) recent data suggesting that A. baumannii continues to spread and evolve in hospital settings. First, we present synopsis of the series of events leading to the discovery and precise identification of this microorganism in hospital settings. Then key events in the acquisition of antibiotic-resistant genes by this microorganism are summarized, highlighting the race between new antibiotic generation and emergence of A. baumannii resistant strains. Here we review the historical development of this species as an infectious threat, the current state of its distribution, and antibiotic resistance characteristics, and we discuss future prospects for its control. PMID:26966582

  4. Nosocomial Outbreak of Carbapenem-Resistant Acinetobacter baumannii in Intensive Care Units and Successful Outbreak Control Program

    PubMed Central

    Choi, Won Suk; Kim, Su Hyun; Jeon, Eun Gyong; Son, Myeung Hee; Yoon, Young Kyung; Kim, Jung-Yeon; Kim, Mi Jeong; Sohn, Jang Wook; Kim, Min Ja

    2010-01-01

    Acinetobacter baumannii has been increasingly reported as a significant causative organism of various nosocomial infections. Here we describe an outbreak of carbapenem-resistant A. baumannii (CRAB) in the ICUs of a Korean university hospital, along with a successful outbreak control program. From October 2007 through July 2008, CRAB was isolated from 57 ICU patients. Nineteen patients were diagnosed as being truly infected with CRAB, four of whom were presumed to have died due to CRAB infection, producing a case-fatality rate of 21.1%. In surveillance of the environment and the healthcare workers (HCWs), CRAB was isolated from 24 (17.9%) of 135 environmental samples and seven (10.9%) of 65 HCWs. The pulsed field gel electrophoresis patterns showed that the isolates from patients, HCWs, and the environment were genetically related. Control of the outbreak was achieved by enforcing contact precautions, reducing environmental contamination through massive cleaning, and use of a closed-suctioning system. By August 2008 there were no new cases of CRAB in the ICUs. This study shows that the extensive spread of CRAB can happen through HCWs and the environmental contamination, and that proper strategies including strict contact precautions, massive environmental decontamination, and a closed-suctioning system can be effective for controlling CRAB outbreaks. PMID:20592889

  5. Comparative in vitro antimicrobial susceptibilities of nosocomial isolates of Acinetobacter baumannii and synergistic activities of nine antimicrobial combinations.

    PubMed Central

    Marques, M B; Brookings, E S; Moser, S A; Sonke, P B; Waites, K B

    1997-01-01

    The in vitro susceptibilities of 69 nosocomial Acinetobacter isolates were determined by the broth microdilution method. Fourteen (20%) isolates were resistant to at least two aminoglycosides and two extended-spectrum penicillins. Nine antimicrobial combinations were then tested for synergy against these 14 isolates by checkerboard titration: imipenem with ciprofloxacin, amikacin, and tobramycin and ampicillin-sulbactam, piperacillin-tazobactam, and ticarcillin-clavulanate with amikacin and tobramycin. Synergy was detected with one or more antimicrobial combinations against 9 of 14 (64%) isolates, partial synergy was detected with one or more combinations against all 14 isolates, and an additive effect alone was observed with two different combinations against two isolates. No antagonism was detected with any combination. Imipenem plus either amikacin or tobramycin resulted in a synergistic or partial synergistic response against all 14 isolates. Specific combinations showing synergy against A. baumannii isolates were imipenem with tobramycin (four isolates), imipenem with amikacin (three isolates), ampicillin-sulbactam with tobramycin (six isolates), ampicillin-sulbactam with amikacin (three isolates), and ticarcillin-clavulanate with tobramycin (one isolate). Genotyping by randomly amplified polymorphic DNA analysis showed that 9 of the 14 isolates were of one strain, 4 isolates were of a second strain, and the remaining isolate was of a different strain. Eight of 14 (57%) patients infected with resistant A. baumannii isolates died. Only 3 of 14 patients had received a therapeutic regimen which was tested for synergy. Clinical studies are needed to determine the significance of these findings. PMID:9145838

  6. Application of Bacteriophage-containing Aerosol against Nosocomial Transmission of Carbapenem-Resistant Acinetobacter baumannii in an Intensive Care Unit

    PubMed Central

    Ho, Yu-Huai; Tseng, Chun-Chieh; Wang, Lih-Shinn; Chen, Yi-Ting; Ho, Guan-Jin; Lin, Teng-Yi; Wang, Ling-Yi; Chen, Li-Kuang

    2016-01-01

    Background Carbapenem-resistant Acinetobacter baumannii (CRAB) is associated with nosocomial infections worldwide. Here, we used phage as a potential agent to evaluate the efficacy of daily cleaning practices combined with a bacteriophage-containing aerosol against CRAB. Methods A two-phase prospective intervention study was performed at a 945-bed public teaching hospital. From March to December 2013, we performed terminal cleaning using standard procedures plus an aerosol with active bacteriophage in the intensive care units to evaluate the impact on nosocomial incidence density, carbapenem-resistance rates and antimicrobial drug consumption amounts. Patients with culture proven CRAB infection were transferred to the isolation room when the phage aerosol cleaning had been completed. Results A total of 264 new acquisitions of CRAB were identified in the intensive care units (191 in the pre-intervention period and 73 in the intervention period). The rates of new acquisitions of CRAB in the intensive care units decreased from 8.57 per 1000 patient-days in the pre-intervention period to 5.11 per 1000 patient-days in the intervention period (p = 0.0029). The mean percentage of resistant isolates CRAB decreased from 87.76% to 46.07% in the intensive care units (p = 0.001). All of the antimicrobials showed a significant reduction in consumption except imipenem. Conclusions The bacteriophage was successful in decreasing the rates of infection caused by CRAB across intensive care units in a large teaching hospital. PMID:27992494

  7. Detection of the KPC Gene in Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii during a PCR-Based Nosocomial Surveillance Study in Puerto Rico▿

    PubMed Central

    Robledo, Iraida E.; Aquino, Edna E.; Vázquez, Guillermo J.

    2011-01-01

    A 6-month, PCR-based, island-wide hospital surveillance study of beta-lactam resistance in Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii was conducted in Puerto Rico. Of 10,507 isolates, 1,239 (12%) unique, multi-beta-lactam-resistant isolates from all geographical regions were identified. The KPC gene was detected in 61 E. coli, 333 K. pneumoniae, 99 P. aeruginosa, and 41 A. baumannii isolates, indicating the widespread dissemination of the KPC gene in clinically significant nosocomial isolates. PMID:21444702

  8. Resistance markers and genetic diversity in Acinetobacter baumannii strains recovered from nosocomial bloodstream infections.

    PubMed

    Martins, Hanoch S I; Bomfim, Maria Rosa Q; França, Rafaela O; Farias, Luiz M; Carvalho, Maria Auxiliadora R; Serufo, José Carlos; Santos, Simone G

    2014-01-28

    In this study, phenotypic and genotypic methods were used to detect metallo-β-lactamases, cephalosporinases and oxacillinases and to assess genetic diversity among 64 multiresistant Acinetobacter baumannii strains recovered from blood cultures in five different hospitals in Brazil from December 2008 to June 2009. High rates of resistance to imipenem (93.75%) and polymyxin B (39.06%) were observed using the disk diffusion (DD) method and by determining the minimum inhibitory concentration (MIC). Using the disk approximation method, thirty-nine strains (60.9%) were phenotypically positive for class D enzymes, and 51 strains (79.6%) were positive for cephalosporinase (AmpC). Using the E-test, 60 strains (93.75%) were positive for metallo-β-lactamases (MβLs). All strains were positive for at least one of the 10 studied genes; 59 (92.1%) contained blaVIM-1, 79.6% contained blaAmpC, 93.7% contained blaOXA23 and 84.3% contained blaOXA51. Enterobacteria Repetitive Intergenic Consensus (ERIC)-PCR analysis revealed a predominance of certain clones that differed from each other. However, the same band pattern was observed in samples from the different hospitals studied, demonstrating correlation between the genotypic and phenotypic results. Thus, ERIC-PCR is an appropriate method for rapidly clustering genetically related isolates. These results suggest that defined clonal clusters are circulating within the studied hospitals. These results also show that the prevalence of MDR A. baumannii may vary among clones disseminated in specific hospitals, and they emphasize the importance of adhering to appropriate infection control measures.

  9. Nosocomial infection by sequence type 357 multidrug-resistant Acinetobacter baumannii isolates in a neonatal intensive care unit in Daejeon, Korea.

    PubMed

    Sung, Ji Youn; Koo, Sun Hoe; Cho, Hye Hyun; Kwon, Kye Chul

    2013-07-01

    Acinetobacter baumannii is an important microorganism responsible for a number of nosocomial outbreaks, in particular, in intensive care units (ICUs). We investigated a nosocomial infection caused by multidrug-resistant (MDR) A. baumannii in a neonatal intensive care unit (NICU) in Korea. A. baumannii isolates were characterized using Etest (AB Biodisk, Sweden), two multiplex PCR assays, and multilocus sequence typing (MLST) scheme. PCR and PCR mapping experiments were performed for detecting and characterizing the determinants of antimicrobial resistance. Eight strains isolated from an NICU belonged to European (EU) clone II and revealed only one sequence type (ST), namely, ST357. All the isolates were susceptible to imipenem but were resistant to amikacin, gentamicin, ceftazidime, cefepime, and ciprofloxacin. To the best of our knowledge, this is the first report of a nosocomial infection in an NICU in Korea caused by ST357 MDR/carbapenem-susceptible A. baumannii strains. This result demonstrates that nosocomial outbreaks of MDR/carbapenem-susceptible strains as well as MDR/carbapenem-resistant isolates may occur in NICUs.

  10. Structure of shikimate kinase, an in vivo essential metabolic enzyme in the nosocomial pathogen Acinetobacter baumannii, in complex with shikimate.

    PubMed

    Sutton, Kristin A; Breen, Jennifer; MacDonald, Ulrike; Beanan, Janet M; Olson, Ruth; Russo, Thomas A; Schultz, L Wayne; Umland, Timothy C

    2015-08-01

    Acinetobacter baumannii is an opportunistic Gram-negative pathogen that is an important cause of healthcare-associated infections exhibiting high mortality rates. Clinical isolates of multidrug-resistant (MDR) and extremely drug-resistant (XDR) A. baumannii strains are increasingly being observed. Compounding this concern is the dearth of new antibacterial agents in late-stage development that are effective against MDR and XDR A. baumannii. As part of an effort to address these concerns, two genes (aroA and aroC) of the shikimate pathway have previously been determined to be essential for the growth and survival of A. baumannii during host infection (i.e. to be essential in vivo). This study expands upon these results by demonstrating that the A. baumannii aroK gene, encoding shikimate kinase (SK), is also essential in vivo in a rat soft-tissue infection model. The crystal structure of A. baumannii SK in complex with the substrate shikimate and a sulfate ion that mimics the binding interactions expected for the β-phosphate of ATP was then determined to 1.91 Å resolution and the enzyme kinetics were characterized. The flexible shikimate-binding domain and LID region are compared with the analogous regions in other SK crystal structures. The impact of structural differences and sequence divergence between SKs from pathogenic bacteria that may influence antibiotic-development efforts is discussed.

  11. [Eradication of a nosocomial outbreak of multidrug-resistant Acinetobacter baumannii infections after adjusting nursing workloads and reinforcing specific precautions].

    PubMed

    Bou, Ricardo; Gomar, Sonia; Hervás, Fany; Amorós, Aurora

    2013-11-01

    During 2009, an outbreak of multidrug-resistant Acinetobacter baumannii (MDR A. baumannii) infections was detected in a 27-bed intensive care unit, resulting in 25 cases being infected. A matched case-control study was conducted to identify risk factors for infection. The colonization pressure, or the proportion of other patients colonized by MDR A. baumannii, was estimated. TISS-28 and Omega scores of each patient were calculated to evaluate nursing work requirements. Conditional logistic regression analyses were carried out. Breakdowns in hand washing and glove use were observed. Infected patients (cases) were more likely than paired controls to have had longer exposure to invasive devices and antimicrobial treatment. The independent risk factors identified by the multivariate analysis were, mechanical ventilation [odds ratio (OR)=1.03; 95% confidence interval (CI), 1.01-1.05; P=.01], and exposure to an infected or colonized patient [OR=1.7; 95%CI, 1.1-2.6; P=.02). A combined infection control strategy was implemented, including strict compliance with isolation precautions, grouping of patients, reinforcing cleaning and disinfection of surfaces, and a decrease in work load. Subsequently, a sharp reduction in the incidence MDR A. baumannii infections was shown. Therapeutic activity scores were significantly higher for cases than for controls. The results suggest patient-to-patient transmission of MDR A. baumannii. Reinforcement of specific procedures and work load adjustment were essential to eradicate this outbreak. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  12. Pharmacodynamic comparisons of antimicrobials against nosocomial isolates of escherichia coli, klebsiella pneumoniae, acinetobacter baumannii and pseudomonas aeruginosa from the MYSTIC surveillance program: the OPTAMA Program, South America 2002.

    PubMed

    Kiffer, Carlos R V; Mendes, Caio; Kuti, Joseph L; Nicolau, David P

    2004-06-01

    The OPTAMA (Optimizing Pharmacodynamic Target Attainment using the MYSTIC [Meropenem Yearly Susceptibility Test Information Collection] Antibiogram) Program provides insight into the appropriate antibiotic options for empiric therapy for common nosocomial pathogens. In this report, South America is represented by Brazil, Colombia, Peru, and Venezuela. A 5000-subject Monte Carlo Simulation estimated pharmacodynamic target attainment for meropenem, imipenem, ceftazidime, cefepime, piperacillin/tazobactam, and ciprofloxacin against Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, and Pseudomonas aeruginosa. Pharmacokinetic parameter variability was derived from existing healthy volunteer data, and minimum inhibitory concentration (MIC) data came from the 2002 MYSTIC program. Piperacillin/tazobactam and ciprofloxacin displayed the lowest target attainment against all bacterial species (14% to 24% for A. baumannii, 26% to 37% for P. aeruginosa, and 48% to 66% for the Enterobacteriaceae). Overall, the carbapenems had the highest probabilities of attainment against the Enterobacteriaceae (98% to 100%) and A. baumannii (73% to 74%), whereas cefepime obtained the greatest target attainment against P. aeruginosa (65%). Because no single regimen had high target attainment against A. baumannii and P. aeruginosa, the use of combination therapy to treat these pathogens in South America may be justified. Because of the lack of agreement with percent susceptibility for certain antimicrobial regimens, the use of pharmacodynamic target attainment may be a more accurate predictor of microbiologic success.

  13. Evaluation of Ciprofloxacin (gyrA, parC Genes) and Tetracycline (tetB Gene) Resistance in Nosocomial Acinetobacter baumannii Infections

    PubMed Central

    Nowroozi, Jamileh; Akhavan Sepahi, Abbas; Tahmasebinejad Kamarposhti, Lida; Razavipour, Roya; Mazhar, Flor

    2014-01-01

    Background: Acinetobacter baumannii plays an important role in some types of nosocomial infections as an opportunist microorganism which increases levels of resistance to antibacterial drugs and disinfectants. Objectives: The aim of this study was to determine the resistance and sensitivity of A. baumannii to different antibiotics and evaluate the minimal inhibitory concentration (MIC) for Ciprofloxacin and Tetracycline; in addition to Surfanios, Citron and Aniosyme DD1 disinfectants, and also to detect the presence of gyrA, parC and tetB gene bands in the isolates. Materials and Methods: In this study, 65 A. baumannii isolates were collected from the hospitalized patients in NIOC hospital (National Iranian Oil Company hospital) of Tehran, Iran during 2010-2011. The pattern of sensitivity to antibiotics was determined using CSLI disk diffusion and MIC methods. Furthermore, resistance of isolates to the common disinfectants (Surfanios Citron and Aniosyme DD1) was determined in different hospital wards. Presence of gyrA, parC and tetB gene bands was also detected by PCR method. Results: Frequency of Acinetobacter resistance to Amikacin, Ciprofloxacin, co-Trimoxazole, Ceftazidime and Ceftriaxone was 100% in the isolates reviewed in this study. The frequency of resistance to Gentamicin and Tetracycline were 86.1% in the isolates. The MIC of Ciprofloxacin in all (100%) of isolates was 32-64 μg/mL which showed the resistance to Ciprofloxacin In 86.1% of cases the Gentamicin and Tetracycline MIC were ≥ 16 μg/mL and in 13.9% of isolates the Gentamicin and Tetracycline MIC were 4 μg/mL, these results showed the resistance and sensitivity to the Gentamicin and Tetracycline, respectively. Additionally, all (100%) of the A. baumannii isolates were resistant to disinfectant concentrations, which were used with the methods recommended by manufacturers (0.5%). In 100% of the isolates parC and gyrA genes bands were detected, and tetB gene was also detected in 86.1% of

  14. Mutations Decreasing Intrinsic β-Lactam Resistance Are Linked to Cell Division in the Nosocomial Pathogen Acinetobacter baumannii.

    PubMed

    Knight, Daniel; Dimitrova, Daniela D; Rudin, Susan D; Bonomo, Robert A; Rather, Philip N

    2016-06-01

    Transposon mutagenesis was used to identify novel determinants of intrinsic β-lactam resistance in Acinetobacter baumannii An EZ-Tn5 transposon insertion in a gene corresponding to the A1S_0225 sequence resulted in a 4-fold decrease in resistance to ampicillin, cefotaxime, imipenem, and ceftriaxone but did not alter resistance to other classes of antibiotics. Based on this phenotype, the gene was designated blhA (β-lactam hypersusceptibility). The blhA::EZ-Tn5 mutation conferred a similar phenotype in A. baumannii strain ATCC 17978. The wild-type blhA gene complemented the blhA::EZTn5 insertion and restored β-lactam resistance levels back to wild-type levels. The blhA mutation also increased β-lactam susceptibility in an adeB adeJ double mutant, indicating that the blhA mutation acted independently of these efflux systems to mediate susceptibility. In addition, mRNA levels for the blaOXA and blaADC β-lactamase genes were not altered by the blhA mutation. The blhA mutation resulted in a prominent cell division and morphological defect, with cells exhibiting a highly elongated phenotype, combined with large bulges in some cells. The blhA gene is unique to Acinetobacter and likely represents a novel gene involved in cell division. Three additional mutations, in zipA, zapA, and ftsK, each of which encode predicted cell division proteins, also conferred increased β-lactam susceptibility, indicating a common link between cell division and intrinsic β-lactam resistance in A. baumannii.

  15. Mutations Decreasing Intrinsic β-Lactam Resistance Are Linked to Cell Division in the Nosocomial Pathogen Acinetobacter baumannii

    PubMed Central

    Knight, Daniel; Dimitrova, Daniela D.; Rudin, Susan D.; Bonomo, Robert A.

    2016-01-01

    Transposon mutagenesis was used to identify novel determinants of intrinsic β-lactam resistance in Acinetobacter baumannii. An EZ-Tn5 transposon insertion in a gene corresponding to the A1S_0225 sequence resulted in a 4-fold decrease in resistance to ampicillin, cefotaxime, imipenem, and ceftriaxone but did not alter resistance to other classes of antibiotics. Based on this phenotype, the gene was designated blhA (β-lactam hypersusceptibility). The blhA::EZ-Tn5 mutation conferred a similar phenotype in A. baumannii strain ATCC 17978. The wild-type blhA gene complemented the blhA::EZTn5 insertion and restored β-lactam resistance levels back to wild-type levels. The blhA mutation also increased β-lactam susceptibility in an adeB adeJ double mutant, indicating that the blhA mutation acted independently of these efflux systems to mediate susceptibility. In addition, mRNA levels for the blaOXA and blaADC β-lactamase genes were not altered by the blhA mutation. The blhA mutation resulted in a prominent cell division and morphological defect, with cells exhibiting a highly elongated phenotype, combined with large bulges in some cells. The blhA gene is unique to Acinetobacter and likely represents a novel gene involved in cell division. Three additional mutations, in zipA, zapA, and ftsK, each of which encode predicted cell division proteins, also conferred increased β-lactam susceptibility, indicating a common link between cell division and intrinsic β-lactam resistance in A. baumannii. PMID:27067318

  16. A Nosocomial Outbreak of Extensively Drug Resistant (XDR) Acinetobacter baumannii Isolates Containing blaOXA-237 Encoded on a Plasmid.

    PubMed

    Hujer, Andrea M; Higgins, Paul G; Rudin, Susan D; Buser, Genevieve L; Marshall, Steven H; Xanthopoulou, Kyriaki; Seifert, Harald; Rojas, Laura J; Domitrovic, T Nicholas; Cassidy, P Maureen; Cunningham, Margaret C; Vega, Robert; Furuno, Jon P; Pfeiffer, Christopher D; Beldavs, Zintars G; Wright, Meredith S; Jacobs, Michael R; Adams, Mark D; Bonomo, Robert A

    2017-09-11

    Carbapenem antibiotics are among the mainstay for treating infections caused by Acinetobacter baumannii, especially in the Northwest United States where carbapenem resistant A. baumannii remain relatively rare. However, between June 2012 and October 2014, an outbreak of carbapenem-resistant A. baumannii occurred in 16 patients from 5 healthcare facilities in the state of Oregon. All isolates were defined as extensively-drug resistant (XDR). MLST revealed that the isolates belonged to sequence type 2 (international clone 2, IC2), and were greater than 95% similar by rep-PCR analysis. Multiplex PCR revealed the presence of a blaOXA carbapenemase gene, later identified as blaOXA-237 Whole genome sequencing of all isolates revealed a well-supported separate branch within a global A. baumannii phylogeny. Pacific Biosciences (PacBio) SMRT sequencing was also performed on one isolate to gain insight into the genetic location of the carbapenem resistance gene. We discovered that blaOXA-237, flanked on either side by ISAba1 elements in opposite orientations, was carried by a 15,198 bp plasmid designated pORAB01-3, and was present in all 16 isolates. The plasmid also contained genes encoding for: a TonB-dependent receptor, septicolysin, a type IV secretory system conjugative DNA transfer family protein, an integrase, a RepB family plasmid DNA replication initiator protein, an α/β hydrolase, and a BrnT/BrnA type II toxin-antitoxin system. This is the first reported outbreak associated with this specific carbapenemase. Particularly worrisome is that blaOXA-237 was plasmid encoded and found in the most prominent worldwide clonal group IC2, potentially giving pORAB01-3 great capacity for future widespread dissemination. Copyright © 2017 American Society for Microbiology.

  17. Virulence profiles and innate immune responses against highly lethal, multidrug-resistant nosocomial isolates of Acinetobacter baumannii from a tertiary care hospital in Mexico.

    PubMed

    Rosales-Reyes, Roberto; Gayosso-Vázquez, Catalina; Fernández-Vázquez, José Luis; Jarillo-Quijada, Ma Dolores; Rivera-Benítez, César; Santos-Preciado, José Ignacio; Alcántar-Curiel, María Dolores

    2017-01-01

    Virulence profiles and innate immune responses were studied in Acinetobacter baumannii from nosocomial infections collected over one year in a tertiary care hospital in Mexico. A. baumannii were identified by VITEK 2 System followed by susceptibility tests. Carbapenemase genes, active efflux mechanism to imipenem and meropenem and outer membrane proteins profile were analyzed to evaluate their role on the activity of carbapenem resistance. All isolates were genotyped by pulsed field gel electrophoresis. The ability to form biofilm was determined on a polystyrene surface. The resistance to complement was determined with a pooled human normal serum and TNFα release by infected macrophages was determined by ELISA. The 112 isolates from this study were associated with a 52% of mortality. All were resistance to β-lactams, fluoroquinolones, and trimethroprim-sulfamethoxal, 96 and 90% were resistant to meropenem and imipenem, respectively, but with high susceptibility to polymyxin B, colistin and tigecyclin. Isolates were classified in 11 different clones. Most isolates, 88% (99/112), were metallo-β-lactamases and carbapenemases producers, associated in 95% with the presence of blaOXA-72 gene. Only 4/99 and 1/99 of the carbapenem-resistant isolates were related to efflux mechanism to meropenem or imipenem resistance, respectively. The loss of expression of 22, 29, and/or 33-36-kDa proteins was detected in 8/11 of the clinical isolates with resistance to carbapenem. More than 96% (108/112) of the isolates were high producers of biofilms on biotic surfaces. Finally, all isolates showed variable resistance to normal human serum activity and were high inductors of TNFα release by macrophages. In summary, these results suggest that multidrug-resistant A. baumannii can persist in the hospital environment through its ability to form biofilms. The high mortality observed was due to their ability to survive normal human serum activity and capability to induce potent

  18. Characterization of a Nosocomial Outbreak Caused by a Multiresistant Acinetobacter baumannii Strain with a Carbapenem-Hydrolyzing Enzyme: High-Level Carbapenem Resistance in A. baumannii Is Not Due Solely to the Presence of β-Lactamases

    PubMed Central

    Bou, Germán; Cerveró, Gonzalo; Domínguez, M. Angeles; Quereda, Carmen; Martínez-Beltrán, Jesús

    2000-01-01

    From February to November 1997, 29 inpatients at Ramón y Cajal Hospital, Madrid, Spain, were determined to be either colonized or infected with imipenem- and meropenem-resistant Acinetobacter baumannii (IMRAB) strains (MICs, 128 to 256 μg/ml). A wide antibiotic multiresistance profile was observed with IMRAB strains. For typing IMRAB isolates, pulsed-field gel electrophoresis was used. For comparative purposes, 30 imipenem- and meropenem-susceptible A. baumannii (IMSAB) strains isolated before, during, and after the outbreak were included in this study. The molecular-typing results showed that the outbreak was caused by a single IMRAB strain (genotype A). By cloning experiments we identified a class D β-lactamase (OXA-24) encoded in the chromosomal DNA of this IMRAB strain which showed carbapenem hydrolysis. Moreover, the outer membrane profile of the IMRAB strain showed a reduction in the expression of two porins at 22 and 33 kDa when compared with genetically related IMSAB isolates. In addition no efflux mechanisms were identified in the IMRAB strains. In summary, we report here the molecular characterization of a nosocomial outbreak caused by one multiresistant A. baumannii epidemic strain that harbors a carbapenem-hydrolyzing enzyme. Although alterations in the penicillin-binding proteins cannot be ruled out, the reduction in the expression of two porins and the presence of this OXA-derived β-lactamase are involved in the carbapenem resistance of the epidemic nosocomial IMRAB strain. PMID:10970374

  19. Impact of antibiotic exposure on occurrence of nosocomial carbapenem-resistant Acinetobacter baumannii infection: a case control study.

    PubMed

    Chusri, Sarunyou; Silpapojakul, Kachornsakdi; McNeil, Edward; Singkhamanan, Kamonnut; Chongsuvivatwong, Virasakdi

    2015-02-01

    Carbapenem-resistant Acinetobacter baumannii (CRAB) infection is one of the most important healthcare associated diseases worldwide. Although antibiotic use is recognized as a risk factor for CRAB infection, the impact of antibiotic class and length of use on CRAB infection is still unclear. A case-control study was conducted in adult intensive care units and general wards of Songklanagarind Hospital, a tertiary-care hospital in southern Thailand, to investigate the effect of different antibiotic exposure and the duration of use on the risk of developing CRAB infection. Cases were defined as patients with carbapenem-susceptible A. baumannii (CSAB) or CRAB infection. Controls were randomly selected from patients and matched 1:1 with cases using ward and date of admission. Multinomial logistic regression was used to compute relative risk ratios (RRR) and 95% confidence intervals (CI) for CRAB infection. Of 197 cases with A. baumannii infection, there were 139 with CRAB infection and 58 with CSAB infection. Compared to the control group, use of fluoroquinolones, broad-spectrum cephalosporins and carbapenems for more than three days increased the risk of CRAB infection with RRR (95% CI) of 81.2 (38.1-862.7), 31.3 (9.9-98.7) and 112.1 (7.1-1770.6), respectively. The RRR (95% CI) for one to three day treatment of fluoroquinolones, broad-spectrum cephalosporins and carbapenems were 5.4 (0.8-38.7), 6.2 (0.1-353.2) and 63.3 (15.6-256.9), respectively. Long-term use of certain antibiotics and even short term use of carbapenems increased the risk of CRAB infection. In this setting, use of these antibiotics, especially carbapenems, should be limited to reduce CRAB infection.

  20. Comparison of a Repetitive Extragenic Palindromic Sequence-Based PCR Method and Clinical and Microbiological Methods for Determining Strain Sources in Cases of Nosocomial Acinetobacter baumannii Bacteremia

    PubMed Central

    Martín-Lozano, David; Cisneros, José Miguel; Becerril, Berta; Cuberos, Lucila; Prados, Trinidad; Ortíz-Leyba, Carlos; Cañas, Elías; Pachón, Jerónimo

    2002-01-01

    Using a repetitive extragenic palindromic PCR (REP-PCR), we genotypically characterized strains causing nosocomial Acinetobacter baumannii infections and analyzed the source of bacteremia in 67 patients from an institution in which infections by this bacterium were endemic. Six different genotypes were found, including 21, 27, 3, 9, 3, and 4 strains. The probable source of bacteremia, according to clinical and/or microbiological criteria, was known in 42 patients (63%): respiratory tract (n = 19), surgical sites (n = 12), intravascular catheters (n = 5), burns (n = 3), and urinary tract (n = 3). The definite source of bacteremia, according to REP-PCR, could be established in 30 (71%) out of the 42 patients with strains from blood and other sites; in these cases clinical and microbiological criteria for the source of bacteremia were thus confirmed. In the remaining 12 patients (29%) the probable source was refuted by the REP-PCR method. The definite sources of bacteremia according to genotype were as follows: respiratory tract in 13 patients (31%), surgical sites in 8 (19%), intravascular catheters in 4 (9%), burns in 3 (7%), and urinary tract in 2 (5%). A comparison of strains from blood cultures and other sites with regard to their REP-PCR and antimicrobial resistance profiles was also made. Taking the REP-PCR as the “gold standard,” the positive predictive value of antibiotype was 77% and the negative predictive value was 42%. In summary, the utility of the diagnosis of the source of nosocomial A. baumannii bacteremia using clinical and/or microbiological criteria, including antibiotyping, is limited, as demonstrated by REP-PCR. PMID:12454154

  1. Iron and Acinetobacter baumannii Biofilm Formation

    PubMed Central

    Gentile, Valentina; Frangipani, Emanuela; Bonchi, Carlo; Minandri, Fabrizia; Runci, Federica; Visca, Paolo

    2014-01-01

    Acinetobacter baumannii is an emerging nosocomial pathogen, responsible for infection outbreaks worldwide. The pathogenicity of this bacterium is mainly due to its multidrug-resistance and ability to form biofilm on abiotic surfaces, which facilitate long-term persistence in the hospital setting. Given the crucial role of iron in A. baumannii nutrition and pathogenicity, iron metabolism has been considered as a possible target for chelation-based antibacterial chemotherapy. In this study, we investigated the effect of iron restriction on A. baumannii growth and biofilm formation using different iron chelators and culture conditions. We report substantial inter-strain variability and growth medium-dependence for biofilm formation by A. baumannii isolates from veterinary and clinical sources. Neither planktonic nor biofilm growth of A. baumannii was affected by exogenous chelators. Biofilm formation was either stimulated by iron or not responsive to iron in the majority of isolates tested, indicating that iron starvation is not sensed as an overall biofilm-inducing stimulus by A. baumannii. The impressive iron withholding capacity of this bacterium should be taken into account for future development of chelation-based antimicrobial and anti-biofilm therapies. PMID:25438019

  2. Complete Genome Sequence of Lytic Bacteriophage LZ35 Infecting Acinetobacter baumannii Isolates

    PubMed Central

    Guo, Zhonghe; Huang, Honglan; Wu, Xiaolin; Hao, Yuchong

    2016-01-01

    Acinetobacter baumannii is a Gram-negative opportunistic pathogen that is frequently associated with nosocomial infections. Bacteriophages infecting A. baumannii can be used as effective agents to control these infections. Here, we announce the complete genome sequence of the lytic bacteriophage LZ35 infecting A. baumannii isolates. PMID:27856573

  3. Rapid identification of Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii with a multiplex PCR assay.

    PubMed

    Chen, Te-Li; Lee, Yi-Tzu; Kuo, Shu-Chen; Yang, Su-Pen; Fung, Chang-Phone; Lee, Shou-Dong

    2014-09-01

    Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii are clinically relevant members of the Acinetobacter calcoaceticus-A. baumannii (Acb) complex and important nosocomial pathogens. These three species are genetically closely related and phenotypically similar; however, they differ in their epidemiology, antibiotic resistance and pathogenicity. In this study, we investigated the use of a multiplex PCR-based assay designed to detect internal fragments of the 16S-23S rRNA intergenic region and the gyrB and recA genes. The assay was capable of differentiating A. baumannii, A. nosocomialis and A. pittii in a reliable manner. In 23 different reference strains and 89 clinical isolates of Acinetobacter species, the assay accurately identified clinically relevant Acb complex species except those 'between 1 and 3' or 'close to 13TU'. None of the non-Acb complex species was misidentified. In an analysis of 1034 positive blood cultures, the assay had a sensitivity of 92.4 % and specificity of 98.2 % for Acb complex identification. Our results show that a single multiplex PCR assay can reliably differentiate clinically relevant Acb complex species. Thus, this method may be used to better understand the clinical differences between infections caused by these species.

  4. Reservoirs of Non-baumannii Acinetobacter Species

    PubMed Central

    Al Atrouni, Ahmad; Joly-Guillou, Marie-Laure; Hamze, Monzer; Kempf, Marie

    2016-01-01

    Acinetobacter spp. are ubiquitous gram negative and non-fermenting coccobacilli that have the ability to occupy several ecological niches including environment, animals and human. Among the different species, Acinetobacter baumannii has evolved as global pathogen causing wide range of infection. Since the implementation of molecular techniques, the habitat and the role of non-baumannii Acinetobacter in human infection have been elucidated. In addition, several new species have been described. In the present review, we summarize the recent data about the natural reservoir of non-baumannii Acinetobacter including the novel species that have been described for the first time from environmental sources and reported during the last years. PMID:26870013

  5. Acinetobacter baumannii in human body louse.

    PubMed

    La Scola, Bernard; Raoult, Didier

    2004-09-01

    While we were isolating Bartonella quintana from body lice, 40 Acinetobacter baumannii strains were also isolated and genotyped. One clone was unique and the other was ampicillin susceptible. A. baumannii DNA was later detected in 21% of 622 lice collected worldwide. These findings show an A. baumannii epidemic in human body lice.

  6. Clinical implications of glycoproteomics for Acinetobacter baumannii.

    PubMed

    Kinsella, Rachel L; Scott, Nichollas E; Feldman, Mario F

    2015-02-01

    The opportunistic human pathogen Acinetobacter baumannii persists in the healthcare setting because of its ability to survive exposure to various antimicrobial and sterilization agents. A. baumannii's ability to cause multiple infection types complicates diagnosis and treatment. Rapid detection of A. baumannii infections would likely improve treatment outcomes. Recently published Acinetobacter glycoproteomic data show the prevalence of O-linked glycoproteins, suggesting the possibility for an O-glycan-based detection technology. O-glycan biosynthesis is required for protein glycosylation and capsular polysaccharide production in A. baumannii. Recent publications demonstrate key roles for protein glycosylation and capsular polysaccharide in the pathogenicity of A. baumannii. Targeted antimicrobial development against O-glycan biosynthesis may produce new effective treatment options for A. baumannii infections. Here, we discuss how the data gathered through Acinetobacter glycoproteomics can be used to develop technologies for rapid diagnosis and reveal potential antimicrobial targets. In addition, we consider the efficacy of glycoconjugate vaccine development against A. baumannii.

  7. Globally Expanding Carbapenemase Finally Appears in Spain: Nosocomial Outbreak of Acinetobacter baumannii Producing Plasmid-Encoded OXA-23 in Barcelona, Spain

    PubMed Central

    Mosqueda, Noraida; Espinal, Paula; Cosgaya, Clara; Viota, Sergio; Plasensia, Virginia; Álvarez-Lerma, Francisco; Montero, Milagro; Gómez, Julià; Horcajada, Juan Pablo; Roca, Ignasi

    2013-01-01

    Resistance of Acinetobacter baumannii clinical isolates to carbapenems is on the rise worldwide mainly in association with the production of OXA-23. Until recently, however, OXA-23 was absent in Spain. In this work, we report the molecular characterization of a hospital outbreak of OXA-23-producing A. baumannii in Barcelona caused by a multidrug-resistant (MDR) clone belonging to international clone IC-II/sequence type ST85 between October 2010 and May 2011. blaOXA-23 was carried in a plasmid of 90 kb and located within the composite transposon Tn2006. PMID:23877694

  8. Multidrug resistant Acinetobacter baumannii reaches a new frontier: prosthetic hip joint infection.

    PubMed

    Hischebeth, G T R; Wimmer, M D; Molitor, E; Seifert, H; Gravius, S; Bekeredjian-Ding, I

    2015-02-01

    Acinetobacter baumannii is an emerging nosocomial pathogen primarily in countries with a high prevalence of multidrug resistance. Here we report the detection of a bla OXA23 carbapenemase-producing A. baumannii strain in a German patient with prosthetic hip joint infection following several hip joint surgeries but no history of foreign travel.

  9. First Genome Sequence of a Mexican Multidrug-Resistant Acinetobacter baumannii Isolate

    PubMed Central

    Graña-Miraglia, Lucía; Lozano, Luis; Castro-Jaimes, Semiramis; Cevallos, Miguel A.; Volkow, Patricia

    2016-01-01

    Acinetobacter baumannii has emerged as an important nosocomial pathogen worldwide. Here, we present the draft genome of the first multidrug-resistant A. baumannii isolate, sampled from a tertiary hospital in Mexico City. This genome will provide a starting point for studying the genomic diversity of this species in Mexico. PMID:27013043

  10. In vitro activity of ceftobiprole against Acinetobacter baumannii clinical isolates.

    PubMed

    Marti, Sara; Sánchez-Céspedes, Javier; Espinal, Paula; Vila, Jordi

    2009-09-01

    Acinetobacter baumannii is a multiresistant opportunistic nosocomial pathogen responsible for outbreaks worldwide. The main infection caused by this microorganism is nosocomial pneumonia, in particular ventilator-associated pneumonia in patients in Intensive Care Units. Treatment of these nosocomial infections is becoming problematic because the level of resistance to antimicrobial agents is rising. Ceftobiprole is a new cephalosporin with activity against Gram-positive and Gram-negative pathogens. This study evaluated the in vitro activity of ceftobiprole against a collection of 58 A. baumannii clinical isolates and showed that the activity of ceftobiprole was superior to ceftazidime and cefepime when the bla(ADC)-like gene was not expressed or was expressed at a low level.

  11. Multidrug-Resistant Acinetobacter spp.: Increasingly Problematic Nosocomial Pathogens

    PubMed Central

    Lee, Kyungwon; Yong, Dongeun; Jeong, Seok Hoon

    2011-01-01

    Pathogenic bacteria have increasingly been resisting to antimicrobial therapy. Recently, resistance problem has been relatively much worsened in Gram-negative bacilli. Acinetobacter spp. are typical nosocomial pathogens causing infections and high mortality, almost exclusively in compromised hospital patients. Acinetobacter spp. are intrinsically less susceptible to antibiotics than Enterobacteriaceae, and have propensity to acquire resistance. A surveillance study in Korea in 2009 showed that resistance rates of Acinetobacter spp. were very high: to fluoroquinolone 67%, to amikacin 48%, to ceftazidime 66% and to imipenem 51%. Carbapenem resistance was mostly due to OXA type carbapenemase production in A. baumannii isolates, whereas it was due to metallo-β-lactamase production in non-baumannii Acinetobacter isolates. Colistin-resistant isolates were rare but started to be isolated in Korea. Currently, the infection caused by multidrug-resistant A. baumannii is among the most difficult ones to treat. Analysis at tertiary care hospital in 2010 showed that among the 1,085 isolates of Acinetobacter spp., 14.9% and 41.8% were resistant to seven, and to all eight antimicrobial agents tested, respectively. It is known to be difficult to prevent Acinetobacter spp. infection in hospitalized patients, because the organisms are ubiquitous in hospital environment. Efforts to control resistant bacteria in Korea by hospitals, relevant scientific societies and government agencies have only partially been successful. We need concerted multidisciplinary efforts to preserve the efficacy of currently available antimicrobial agents, by following the principles of antimicrobial stewardship. PMID:22028150

  12. Risk factors associated with multi-drug-resistant Acinetobacter baumannii nosocomial infections at a tertiary care hospital in Makkah, Saudi Arabia - a matched case–control study

    PubMed Central

    Al-Gethamy, Manal M; Faidah, Hani S; Adetunji, Hamed Ademola; Ashgar, Sami S; Mohanned, Tayeb K; Mohammed, Al-Haj; Khurram, Muhammad; Hassali, Mohamed A

    2017-01-01

    Objective To determine risk factors for multi-drug-resistant Acinetobacter baumannii (MDR-AB) nosocomial infections in intensive care units in a tertiary care hospital, Makkah, Saudi Arabia. Methods We performed a hospital-based, matched case–control study in patients who were admitted to Al Noor Specialist Hospital between 1 January 2012 and 31 August 2012. The study included cases of A. baumannii nosocomial infection and controls without infection. Controls were matched to cases by age and ward of admission. Results The most frequent site of infection was the respiratory tract (77.3%). Susceptibility to antimicrobial MDR-AB was 92.0% for ceftazidime and ciprofloxacin, while it was 83.3% for imipenem, 83.0% for trimethoprim, 79.0% for amikacin, and 72.7% for gentamicin. Multiple logistic regression of risk factors showed that immunosuppression (OR = 2.9; 95% CI 1.5–5.6; p = 0.002), clinical outcome (OR = 0.4; 95% CI 0.3–0.9; p = 0.01), invasive procedures (OR = 7.9; 95% CI 1.8–34.2; p = 0.002), a central venous catheter (OR = 2.9; 95% CI 1.5–5.6; p = 0.000), and an endotracheal tube (OR = 3.4; 95% CI 1.6–7.3; p = 0.001) were associated with MDR-AB. Conclusions Acinetobacter nosocomial infections are associated with admission to the ICU (Intensive care unit) and exposure to invasive procedures. PMID:28480813

  13. Blood stream infections caused by Acinetobacter baumannii group in Japan - Epidemiological and clinical investigation.

    PubMed

    Fujikura, Yuji; Yuki, Atsushi; Hamamoto, Takaaki; Kawana, Akihiko; Ohkusu, Kiyofumi; Matsumoto, Tetsuya

    2016-06-01

    Acinetobacter calcoaceticus-Acinetobacter baumannii complex, especially A. baumannii, Acinetobacter pittii and Acinetobacter nosocomialis, constitutes an important group of nosocomial pathogens; however, epidemiological or clinical characteristics and prognosis is limited in Japan. From 2009 to 2013, 47 blood stream infection cases resulting from A. baumannii group were reviewed at the National Defense Medical College, an 800-bed tertiary hospital. To determine the genospecies, further comparative nucleotide sequence analyses of the RNA polymerase b-subunit (rpoB) gene were performed. Sequence analysis of rpoB gene showed that 25 (49.0%), 17 (33.3%) and 5 (9.8%) cases were caused by A. baumannii, A. pittii and A. nosocomialis, respectively. The 30-day and in-hospital mortality rates of A. baumannii were 8.5% and 25.5%, respectively, and there were no significant differences between Acinetobacter species. Clinical characteristics were statistically insignificant. Multidrug-resistant Acinetobacter species were detected in 3 cases (5.9%) with same pulsed-field gel electrophoresis (PFGE) pattern and A. baumannii was less susceptible to amikacin and levofloxacin. In this study, the mortality and clinical characteristics were similar among A. baumannii group isolate cases despite some showing drug resistance. However, identification of Acinetobacter species helps to initiate appropriate antibiotic therapy in earlier treatment phase, because A. baumannii shows some drug resistance.

  14. Characterization of Acinetobacter baumannii biofilm associated components

    NASA Astrophysics Data System (ADS)

    Brossard, Kari A.

    Acinetobacter baumannii is a Gram-negative aerobic coccobaccillus that is a major cause of nosocomial infections worldwide. Infected individuals may develop pneumonia, urinary tract, wound, and other infections that are associated with the use of indwelling medical devices such as catheters and mechanical ventilation. Treatment is difficult because many A. baumannii isolates have developed multi-drug resistance and the bacterium can persist on abiotic surfaces. Persistence and resistance may be due to formation of biofilms, which leads to long-term colonization, evasion of the host immune system and resistance to treatment with antibiotics and disinfectants. While biofilms are complex multifaceted structures, two bacterial components that have been shown to be important in formation and stability are exopolysaccharides (EPS) and the biofilm-associated protein (Bap). An EPS, poly-beta-1,6-N-acetylglucosamine, PNAG, has been described for E. coli and S. epidermidis. PNAG acts as an intercellular adhesin. Production of this adhesin is dependent on the pga/icaABCD locus. We have identified a homologous locus in A. baumannii 307-0294 that is involved in production of an exopolysaccharide, recognized by an anti-PNAG antibody. We hypothesized that the A. baumannii pgaABCD locus plays a role in biofilm formation, and protection against host innate defenses and disinfectants suggesting that PNAG is a possible virulence factor for the organism. The first aim of this thesis will define the pgaABCD locus. We have previously identified Bap, a protein with similarity to those described for S. aureus and we have demonstrated that this protein is involved in maintaining the stability of biofilms on glass. We hypothesized that A. baumannii Bap plays a role in persistence and pathogenesis and is regulated by quorum sensing. In our second aim we will examine the role of Bap in attachment and biofilm formation on medically relevant surfaces and also determine if Bap is involved in

  15. Multiresistance and endemic status of acinetobacter baumannii associated with nosocomial infections in a tunisian hospital: a critical situation in the intensive care units

    PubMed Central

    Ben Othman, A.; Zribi, M.; Masmoudi, A.; Abdellatif, S.; Ben Lakhal, S.; Fendri, C.

    2011-01-01

    Acinetobacter baumannii is often implicated in hospital outbreaks in Tunisia. It’s a significant opportunistic pathogen associated with serious underlying diseases such as pneumoniae, meningitis and urinary tract infections. The aim of our study was to evaluate its degree of endemicity and its antibiotic resistance evolution essentially in the unit care where its isolation was predominant (57%). This study used 3 methods: antibiotyping, RAPD using 2 primers VIL 1, VIL5 and PFGE with ApaI restriction enzyme. The presence of integron1 and 2 was also studied. Antibiotyping showed that 92% of patients were resistant of all ß- lactams (except Imipenem) and that the resistance to Imipenem occurred in 47% of cases. RAPD profiles obtained with the 2 arbitrarily primers VIL1 and VIL5 gave respectively 5 and 4groups and PFGE fingerprinting patterns revealed 22 different pulsotypes. Integron 1 was present in 25% of unrelated strains and type 2 integron was not detected in any of the studied strains. Among 204 strains, multiple and heterogeneous groups were detected with the genomic studies. In addition, any correlation was obtained with the antibiotyping results. These findings demonstrate the endemic status of A. baumannii in our hospital and the persistence of a large number of multiresistant strains in the unit’s care. When outbreaks of A. baumannii occur, it’s essential to develop restricted hygiene procedures and a serious surveillance of critical units such as ICU for very ill patients. PMID:24031648

  16. Acinetobacter baumannii: Evolution of Antimicrobial Resistance—Treatment Options

    PubMed Central

    Doi, Yohei; Murray, Gerald L.; Peleg, Anton Y.

    2015-01-01

    The first decade of the 20th century witnessed a surge in the incidence of infections due to several highly antimicrobial-resistant bacteria in hospitals worldwide. Acinetobacter baumannii is one such organism that turned from an occasional respiratory pathogen into a major nosocomial pathogen. An increasing number of A. baumannii genome sequences have broadened our understanding of the genetic makeup of these bacteria and highlighted the extent of horizontal transfer of DNA. Animal models of disease combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Bacterial factors known to be important for disease include outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. A. baumannii has a propensity to accumulate resistance to various groups of antimicrobial agents. In particular, carbapenem resistance has become commonplace, accounting for the majority of A. baumannii strains in many hospitals today. Carbapenem-resistant strains are often resistant to all other routinely tested agents. Treatment of carbapenem-resistant A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin and tigecycline, but the efficacy and safety of these approaches are yet to be defined. Antimicrobial-resistant A. baumannii has high potential to spread among ill patients in intensive care units. Early recognition and timely implementation of appropriate infection control measures is crucial in preventing outbreaks. PMID:25643273

  17. Overproduction of Outer Membrane Protein A by Acinetobacter baumannii as a Risk Factor for Nosocomial Pneumonia, Bacteremia, and Mortality Rate Increase.

    PubMed

    Sánchez-Encinales, Viviana; Álvarez-Marín, Rocío; Pachón-Ibáñez, María Eugenia; Fernández-Cuenca, Felipe; Pascual, Alvaro; Garnacho-Montero, José; Martínez-Martínez, Luis; Vila, Jordi; Tomás, María Mar; Cisneros, José Miguel; Bou, Germán; Rodríguez-Baño, Jesús; Pachón, Jerónimo; Smani, Younes

    2017-03-15

    Outer membrane protein A (OmpA) is a porin involved in Acinetobacter baumannii pathogenesis. However, OmpA clinical implication in hospital-acquired infections remains unknown. We aimed to determine whether OmpA overproduction was a risk factor associated with pneumonia, bacteremia, and mortality. We analyzed demographic, microbiological, and clinical data from 100 patients included in a unicenter cohort and 246 included in a unicenter cohort and a multicenter cohort. Representative isolates were classified into 2 groups: (1) isolates from patients colonized by A. baumannii (16 from the unicenter and 20 from the multicenter cohort) and (2) isolates from bacteremic or nonbacteremic patients with pneumonia (PP) caused by A. baumannii (13 from the unicenter and 23 from the multicenter cohort) Expression of ompA was determined with quantitative reverse-transcription polymerase chain reaction. Isolates from PP overexpressed more ompA than those from colonized patients from the unicenter (ratio, 1.76 vs 0.36; P < .001) and the multicenter (1.36 vs 0.91; P = .03) cohorts. Among isolates from PP, those from bacteremic patients overexpressed nonsignificantly more ompA than those from nonbacteremic patients in the unicenter (ratio, 2.37 vs 1.43; P = .06) and the multicenter (2.03 vs 0.91; P = .14) cohorts. Multivariate analysis in both cohorts together showed ompA overexpression as independent risk factor for pneumonia (P < .001), bacteremia (P = .005), and death (P = .049). These data suggest that ompA overexpression is an associated factor for pneumonia, bacteremia, and death due to A. baumannii.

  18. [Current approaches to explain the virulence of Acinetobacter baumannii].

    PubMed

    Aşık, Gülşah

    2011-04-01

    Acinetobacter baumannii which is one of the most frequent nosocomial pathogens, has drawn attention in the last years owing to multi-drug resistant strains. A.baumannii may give rise to nosocomial epidemics especially in intensive care units and may lead to treatment failure due to its increasing antimicrobial resistance. These gram-negative non-fermentative coccobacilli may be encountered also in community associated infections. However, they are frequently isolated in pneumonia, urinary tract infection, bacteremia, meningitis and wound infections that develop in patients hospitalized for serious diseases. Although detailed data about the epidemiology and antimicrobial resistance patterns related to this bacteria exist, relatively limited data is present about the virulence factors and environmental physiology of A.baumannii. The role of some bacterial virulence factors in the pathogenesis of Acinetobacter infections have been enlightened by recent investigations. Among these virulence factors, production of extracellular enzymes with lipolytic and cytolytic activities, outer membrane protein (AbOmpA) with apoptotic effects on epithelial cells, adhesion molecules (fimbria and AbOmpA) that function during attachment to epithelial cells, K1 type capsular structure, type-1 pili and AbOmpA induced biofilm formation, siderophore (acinetobactin) or hemin mediated iron acquisition mechanisms, quorum sensing system that functions by the help of N-acyl homoserine lacton signal molecules and cellular components that enable Acinetobacter species to live under inappropriate environmental conditions like dryness, low temperature, restricted nutritional elements, can be counted. New information about the virulence factors will help better understanding of the adaptive response of A.baumannii in the host setting. This review is focused on the current information about the virulence factors of of A.baumannii.

  19. Identification of Ata, a Multifunctional Trimeric Autotransporter of Acinetobacter baumannii

    PubMed Central

    Bentancor, Leticia V.; Camacho-Peiro, Ana; Bozkurt-Guzel, Cagla; Pier, Gerald B.

    2012-01-01

    Acinetobacter baumannii has recently emerged as a highly troublesome nosocomial pathogen, especially in patients in intensive care units and in those undergoing mechanical ventilation. We have identified a surface protein adhesin of A. baumannii, designated the Acinetobacter trimeric autotransporter (Ata), that contains all of the typical features of trimeric autotransporters (TA), including a long signal peptide followed by an N-terminal, surface-exposed passenger domain and a C-terminal domain encoding 4 β-strands. To demonstrate that Ata encoded a TA, we created a fusion protein in which we replaced the entire passenger domain of Ata with the epitope tag V5, which can be tracked with specific monoclonal antibodies, and demonstrated that the C-terminal 101 amino acids of Ata were capable of exporting the heterologous V5 tag to the surface of A. baumannii in a trimeric form. We found that Ata played a role in biofilm formation and bound to various extracellular matrix/basal membrane (ECM/BM) components, including collagen types I, III, IV, and V and laminin. Moreover, Ata mediated the adhesion of whole A. baumannii cells to immobilized collagen type IV and played a role in the survival of A. baumannii in a lethal model of systemic infection in immunocompetent mice. Taken together, these results reveal that Ata is a TA of A. baumannii involved in virulence, including biofilm formation, binding to ECM/BM proteins, mediating the adhesion of A. baumannii cells to collagen type IV, and contributing to the survival of A. baumannii in a mouse model of lethal infection. PMID:22609912

  20. The complete genome and phenome of a community-acquired Acinetobacter baumannii.

    PubMed

    Farrugia, Daniel N; Elbourne, Liam D H; Hassan, Karl A; Eijkelkamp, Bart A; Tetu, Sasha G; Brown, Melissa H; Shah, Bhumika S; Peleg, Anton Y; Mabbutt, Bridget C; Paulsen, Ian T

    2013-01-01

    Many sequenced strains of Acinetobacter baumannii are established nosocomial pathogens capable of resistance to multiple antimicrobials. Community-acquired A. baumannii in contrast, comprise a minor proportion of all A. baumannii infections and are highly susceptible to antimicrobial treatment. However, these infections also present acute clinical manifestations associated with high reported rates of mortality. We report the complete 3.70 Mbp genome of A. baumannii D1279779, previously isolated from the bacteraemic infection of an Indigenous Australian; this strain represents the first community-acquired A. baumannii to be sequenced. Comparative analysis of currently published A. baumannii genomes identified twenty-four accessory gene clusters present in D1279779. These accessory elements were predicted to encode a range of functions including polysaccharide biosynthesis, type I DNA restriction-modification, and the metabolism of novel carbonaceous and nitrogenous compounds. Conversely, twenty genomic regions present in previously sequenced A. baumannii strains were absent in D1279779, including gene clusters involved in the catabolism of 4-hydroxybenzoate and glucarate, and the A. baumannii antibiotic resistance island, known to bestow resistance to multiple antimicrobials in nosocomial strains. Phenomic analysis utilising the Biolog Phenotype Microarray system indicated that A. baumannii D1279779 can utilise a broader range of carbon and nitrogen sources than international clone I and clone II nosocomial isolates. However, D1279779 was more sensitive to antimicrobial compounds, particularly beta-lactams, tetracyclines and sulphonamides. The combined genomic and phenomic analyses have provided insight into the features distinguishing A. baumannii isolated from community-acquired and nosocomial infections.

  1. Epidemiologic and Clinical Impact of Acinetobacter baumannii Colonization and Infection

    PubMed Central

    Villar, Macarena; Cano, María E.; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús

    2014-01-01

    Abstract Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence. PMID:25181313

  2. Copper Resistance of the Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Williams, Caitlin L.; Neu, Heather M.; Gilbreath, Jeremy J.; Michel, Sarah L. J.; Zurawski, Daniel V.

    2016-01-01

    ABSTRACT Acinetobacter baumannii is an important emerging pathogen that is capable of causing many types of severe infection, especially in immunocompromised hosts. Since A. baumannii can rapidly acquire antibiotic resistance genes, many infections are on the verge of being untreatable, and novel therapies are desperately needed. To investigate the potential utility of copper-based antibacterial strategies against Acinetobacter infections, we characterized copper resistance in a panel of recent clinical A. baumannii isolates. Exposure to increasing concentrations of copper in liquid culture and on solid surfaces resulted in dose-dependent and strain-dependent effects; levels of copper resistance varied broadly across isolates, possibly resulting from identified genotypic variation among strains. Examination of the growth-phase-dependent effect of copper on A. baumannii revealed that resistance to copper increased dramatically in stationary phase. Moreover, A. baumannii biofilms were more resistant to copper than planktonic cells but were still susceptible to copper toxicity. Exposure of bacteria to subinhibitory concentrations of copper allowed them to better adapt to and grow in high concentrations of copper; this copper tolerance response is likely achieved via increased expression of copper resistance mechanisms. Indeed, genomic analysis revealed numerous putative copper resistance proteins that share amino acid homology to known proteins in Escherichia coli and Pseudomonas aeruginosa. Transcriptional analysis revealed significant upregulation of these putative copper resistance genes following brief copper exposure. Future characterization of copper resistance mechanisms may aid in the search for novel antibiotics against Acinetobacter and other highly antibiotic-resistant pathogens. IMPORTANCE Acinetobacter baumannii causes many types of severe nosocomial infections; unfortunately, some isolates have acquired resistance to almost every available antibiotic

  3. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii

    PubMed Central

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick

    2016-01-01

    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol. PMID:27486453

  4. Stress Conditions Induced by Carvacrol and Cinnamaldehyde on Acinetobacter baumannii.

    PubMed

    Montagu, Angélique; Joly-Guillou, Marie-Laure; Rossines, Elisabeth; Cayon, Jérome; Kempf, Marie; Saulnier, Patrick

    2016-01-01

    Acinetobacter baumannii has emerged as a major cause of nosocomial infections. The ability of A. baumannii to display various resistance mechanisms against antibiotics has transformed it into a successful nosocomial pathogen. The limited number of antibiotics in development and the disengagement of the pharmaceutical industry have prompted the development of innovative strategies. One of these strategies is the use of essential oils, especially aromatic compounds that are potent antibacterial molecules. Among them, the combination of carvacrol and cinnamaldehyde has already demonstrated antibacterial efficacy against A. baumannii. The aim of this study was to determine the biological effects of these two compounds in A. baumannii, describing their effect on the rRNA and gene regulation under environmental stress conditions. Results demonstrated rRNA degradation by the carvacrol/cinnamaldehyde mixture, and this effect was due to carvacrol. Degradation was conserved after encapsulation of the mixture in lipid nanocapsules. Results showed an upregulation of the genes coding for heat shock proteins, such as groES, groEL, dnaK, clpB, and the catalase katE, after exposure to carvacrol/cinnamaldehyde mixture. The catalase was upregulated after carvacrol exposure wich is related to an oxidative stress. The combination of thiourea (hydroxyl radical scavenger) and carvacrol demonstrated a potent bactericidal effect. These results underline the development of defense strategies of the bacteria by synthesis of reactive oxygen species in response to environmental stress conditions, such as carvacrol.

  5. Complete Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Isolate Obtained from a Mexican Hospital (Sequence Type 422)

    PubMed Central

    Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Graña-Miraglia, Lucía; Lozano, Luis; Bocanegra-Ibarias, Paola; Volkow-Fernández, Patricia; Silva-Sanchez, Jesus; Castillo-Ramírez, Santiago

    2016-01-01

    Acinetobacter baumannii has emerged as a dangerous nosocomial pathogen, particularly for severely ill patients in intensive care units and patients with hematologic malignancies. Here, we present the complete genome sequence of a multidrug-resistant A. baumannii isolate, recovered from a Mexican hospital and classified as sequence type 422 according to the multilocus sequence typing Pasteur scheme. PMID:27340065

  6. Role of OmpA in the Multidrug Resistance Phenotype of Acinetobacter baumannii

    PubMed Central

    Fàbrega, Anna; Roca, Ignasi; Sánchez-Encinales, Viviana; Vila, Jordi; Pachón, Jerónimo

    2014-01-01

    Acinetobacter baumannii has emerged as a nosocomial pathogen with an increased prevalence of multidrug-resistant strains. The role of the outer membrane protein A (OmpA) in antimicrobial resistance remains poorly understood. In this report, disruption of the ompA gene led to decreased MICs of chloramphenicol, aztreonam, and nalidixic acid. We have characterized, for the first time, the contribution of OmpA in the antimicrobial resistance phenotype of A. baumannii. PMID:24379205

  7. Draft Genome Sequence of an International Clonal Lineage 1 Acinetobacter baumannii Strain from Argentina

    PubMed Central

    Vilacoba, Elisabet; Déraspe, Maxime; Traglia, German M.; Roy, Paul H.; Centrón, Daniela

    2014-01-01

    In the last few years Acinetobacter baumannii has emerged worldwide as an important nosocomial pathogen in medical institutions. Here, we present the draft genome sequence of the international clonal lineage 1 (ICL1) A. baumannii strain A144 that was isolated in a hospital in Buenos Aires City in the year 1997. The strain is susceptible to carbapenems and resistant to trimethoprim and gentamicin. PMID:25428965

  8. Acinetobacter baumannii neonatal mastitis: a case report.

    PubMed

    Mohr, Emma L; Berhane, Abeba; Zora, John Gregory; Suchdev, Parminder S

    2014-09-25

    Neonatal mastitis is a rare infection. When it does occur, infants younger than 2 months of age are typically affected and the majority of cases are caused by Staphylococcus aureus. We present the first reported case of neonatal mastitis caused by Acinetobacter baumannii, an unusual organism for this type of infection. A 15-day-old full-term Caucasian male neonate presented to our emergency room following fever at home and was admitted for routine neonatal sepsis evaluation. After admission, he developed purulent drainage from his right nipple, was diagnosed with mastitis, and was started on empiric therapy with clindamycin and cefotaxime with presumed coverage for S. aureus. Drainage culture identified pan-susceptible Acinetobacter baumannii/haemolyticus and antibiotic therapy was changed to ceftazidime. He was discharged after 5 days of ceftazidime with complete resolution of his symptoms. This case illustrates the importance of obtaining drainage cultures in mastitis cases because of the possibility of organisms besides S. aureus causing infection. Acinetobacter baumannii is considered part of the normal human flora and is associated with serious infections in intensive care units. This is the first case report describing Acinetobacter baumannii as an etiologic agent of neonatal mastitis and highlights the importance of including unusual organisms in the differential for infectious etiologies for general practitioners.

  9. Acinetobacter baumannii: biology and drug resistance - role of carbapenemases.

    PubMed

    Nowak, Pawel; Paluchowska, Paulina

    2016-01-01

    Acinetobacter baumannii is a Gram-negative, glucose-non-fermenting, oxidase-negative coccobacillus, most commonly associated with the hospital settings. The ability to survive in adverse environmental conditions as well as high level of natural and acquired antimicrobial resistance make A. baumannii one of the most important nosocomial pathogens. While carbapenems have long been considered as antimicrobials of last-resort, the rates of clinical A. baumannii strains resistant to these antibiotics are increasing worldwide. Carbapenem resistance among A. baumannii is conferred by coexisting mechanisms including: decrease in permeability of the outer membrane, efflux pumps, production of beta-lactamases, and modification of penicillin-binding proteins. The most prevalent mechanism of carbapenem resistance among A. baumannii is associated with carbapenem-hydro-lysing enzymes that belong to Ambler class D and B beta-lactamases. In addition, there have also been reports of resistance mediated by selected Ambler class A carbapenemases among A. baumannii strains. Resistance determinants in A. baumannii are located on chromosome and plasmids, while acquisition of new mechanisms can be mediated by insertion sequences, integrons, transposons, and plasmids. Clinical relevance of carbapen-em resistance among strains isolated from infected patients, carriers and hospital environment underlines the need for carbapenemase screening. Currently available methods vary in principle, accuracy and efficiency. The techniques that deserve particular attention belong to both easily accessible unsophisticated methods as well as advanced techniques based on mass spectrometry or molecular biology. While carbapenemases limit the therapeutic options in A. baumannii infections, studies concerning novel beta-lactamase inhibitors offer a new insight into effective therapy.

  10. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection.

    PubMed

    Noto, Michael J; Boyd, Kelli L; Burns, William J; Varga, Matthew G; Peek, Richard M; Skaar, Eric P

    2015-10-01

    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9(-/-) mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9(-/-) mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii.

  11. Toll-Like Receptor 9 Contributes to Defense against Acinetobacter baumannii Infection

    PubMed Central

    Noto, Michael J.; Boyd, Kelli L.; Burns, William J.; Varga, Matthew G.; Peek, Richard M.

    2015-01-01

    Acinetobacter baumannii is a common nosocomial pathogen capable of causing severe diseases associated with significant morbidity and mortality in impaired hosts. Pattern recognition receptors, such as the Toll-like receptors (TLRs), play a key role in pathogen detection and function to alert the immune system to infection. Here, we examine the role for TLR9 signaling in response to A. baumannii infection. In a murine model of A. baumannii pneumonia, TLR9−/− mice exhibit significantly increased bacterial burdens in the lungs, increased extrapulmonary bacterial dissemination, and more severe lung pathology compared with those in wild-type mice. Following systemic A. baumannii infection, TLR9−/− mice have significantly increased bacterial burdens in the lungs, as well as decreased proinflammatory cytokine and chemokine production. These results demonstrate that TLR9-mediated pathogen detection is important for host defense against the opportunistic pathogen Acinetobacter baumannii. PMID:26238713

  12. Inverse PCR for subtyping of Acinetobacter baumannii carrying ISAba1.

    PubMed

    Kim, Shukho; Park, Yun-Ju; Kim, Jungmin

    2016-05-01

    Acinetobacter baumannii has been prevalent in nosocomial infections, often causing outbreaks in intensive care units. ISAba1 is an insertion sequence that has been identified only in A. baumannii and its copy number varies among strains. It has been reported that ISAba1 provides a promoter for bla(OXA-51-like), bla(OXA-23-like), and bla(ampC), which are associated with the resistance of A. baumannii to carbapenems and cephalosporins. The main purpose of this study was to develop a novel inverse PCR method capable of typing A. baumannii strains. The method involves three major steps: cutting of genomic DNA with a restriction enzyme, ligation, and PCR. In the first step, bacterial genomic DNA was digested with DpnI. In the second step, the digested genomic DNAs were ligated to form intramolecular circular DNAs. In the last step, the ligated circular DNAs were amplified by PCR with primers specific for ISAba1 and the amplified PCR products were electrophoresed. Twenty-two clinical isolates of A. baumannii were used for the evaluation of the inverse PCR (iPCR) typing method. Dendrogram analysis revealed two major clusters, similar to pulsed-field gel electrophoresis (PFGE) results. Three ISAba1-associated genes--bla(ampC), bla(OXA-66-like), and csuD--were amplified and detected in the clinical isolates. This novel iPCR typing method is comparable to PFGE in its ability to discriminate A. baumannii strains, and is a promising molecular epidemiological tool for investigating A. baumannii carrying ISAba1.

  13. Genome organization of epidemic Acinetobacter baumannii strains

    PubMed Central

    2011-01-01

    Background Acinetobacter baumannii is an opportunistic pathogen responsible for hospital-acquired infections. A. baumannii epidemics described world-wide were caused by few genotypic clusters of strains. The occurrence of epidemics caused by multi-drug resistant strains assigned to novel genotypes have been reported over the last few years. Results In the present study, we compared whole genome sequences of three A. baumannii strains assigned to genotypes ST2, ST25 and ST78, representative of the most frequent genotypes responsible for epidemics in several Mediterranean hospitals, and four complete genome sequences of A. baumannii strains assigned to genotypes ST1, ST2 and ST77. Comparative genome analysis showed extensive synteny and identified 3068 coding regions which are conserved, at the same chromosomal position, in all A. baumannii genomes. Genome alignments also identified 63 DNA regions, ranging in size from 4 o 126 kb, all defined as genomic islands, which were present in some genomes, but were either missing or replaced by non-homologous DNA sequences in others. Some islands are involved in resistance to drugs and metals, others carry genes encoding surface proteins or enzymes involved in specific metabolic pathways, and others correspond to prophage-like elements. Accessory DNA regions encode 12 to 19% of the potential gene products of the analyzed strains. The analysis of a collection of epidemic A. baumannii strains showed that some islands were restricted to specific genotypes. Conclusion The definition of the genome components of A. baumannii provides a scaffold to rapidly evaluate the genomic organization of novel clinical A. baumannii isolates. Changes in island profiling will be useful in genomic epidemiology of A. baumannii population. PMID:21985032

  14. Quantitative proteomics to study carbapenem resistance in Acinetobacter baumannii

    PubMed Central

    Tiwari, Vishvanath; Tiwari, Monalisa

    2014-01-01

    Acinetobacter baumannii is an opportunistic pathogen causing pneumonia, respiratory infections and urinary tract infections. The prevalence of this lethal pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source. Moreover it resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. Resistance against carbapenem has emerged in Acinetobacter baumannii which can create significant health problems and is responsible for high morbidity and mortality. With the development of quantitative proteomics, a considerable progress has been made in the study of carbapenem resistance of Acinetobacter baumannii. Recent updates showed that quantitative proteomics has now emerged as an important tool to understand the carbapenem resistance mechanism in Acinetobacter baumannii. Present review also highlights the complementary nature of different quantitative proteomic methods used to study carbapenem resistance and suggests to combine multiple proteomic methods for understanding the response to antibiotics by Acinetobacter baumannii. PMID:25309531

  15. Genetic Mechanisms of Antimicrobial Resistance of Acinetobacter baumannii.

    PubMed

    Esterly, John S; Richardson, Chad L; Eltoukhy, Noha S; Qi, Chao; Scheetz, Marc H

    2011-02-01

    To summarize published data identifying known genetic mechanisms of antibiotic resistance in Acinetobacter baumannii and the correlating phenotypic expression of antibiotic resistance. MEDLINE databases (1966-July 15, 2010) were searched to identify original reports of genetic mechanisms of antibiotic resistance in A. baumannii. Numerous genetic mechanisms of resistance to multiple classes of antibiotics are known to exist in A. baumannii, a gram-negative bacterium increasingly implicated in nosocomial infections. Mechanisms may be constitutive or acquired via plasmids, integrons, and transposons. Methods of resistance include enzymatic modification of antibiotic molecules, modification of antibiotic target sites, expression of efflux pumps, and downregulation of cell membrane porin channel expression. Resistance to β-lactams appears to be primarily caused by β-lactamase production, including extended spectrum β-lactamases (b/aTEM, blaSHV, b/aTX-M,b/aKPC), metallo-β-lactamases (blaMP, blaVIM, bla, SIM), and most commonly, oxacillinases (blaOXA). Antibiotic target site alterations confer resistance to fluoroquinolones (gyrA, parC) and aminoglycosides (arm, rmt), and to a much lesser extent, β-lactams. Efflux pumps (tet, ade, abe) contribute to resistance against β-lactams, tetracyclines, fluoroquinolones, and aminoglycosides. Finally, porin channel deletion (carO, oprD) appears to contribute to β-lactam resistance and may contribute to rarely seen polymyxin resistance. Of note, efflux pumps and porin deletions as solitary mechanisms may not render clinical resistance to A. baumannii. A. baumannii possesses copious genetic resistance mechanisms. Knowledge of local genotypes and expressed phenotypes for A. baumannii may aid clinicians more than phenotypic susceptibilities reported in large epidemiologic studies. © 2011 SAGE Publications.

  16. Heteroresistance to Cephalosporins and Penicillins in Acinetobacter baumannii

    PubMed Central

    Hung, Kuei-Hsiang; Wang, Ming-Cheng; Huang, Ay-Huey; Yan, Jing-Jou

    2012-01-01

    Heteroresistance to antimicrobial agents may affect susceptibility test results and therapeutic success. In this study, we investigated heteroresistance to cephalosporins and penicillins in Acinetobacter baumannii, a major pathogen causing nosocomial infections. Two A. baumannii isolates exhibited heteroresistance to ampicillin-sulbactam, ticarcillin-clavulanic acid, cefepime, and cefpirome, showing a distinct colony morphology of circular rings within the inhibition halos. Pulsed-field gel electrophoresis (PFGE) and outer membrane protein (OMP) analysis demonstrated that subpopulations around the disks/Etest strips and the original strains all belonged to the same PFGE type and OMP profile. Population analysis profile (PAP) showed the presence of heteroresistant subpopulations with high cefepime resistance levels in two isolates (008 and 328). Interestingly, A. baumannii 008 contained two peaks: one was grown in the presence of up to 1 μg of cefepime/ml, the other apparently occurred when the concentration of cefepime was raised to 256 μg/ml. After serial passages without exposure to cefepime, the PAP curve maintained the same trend observed for the original strain of A. baumannii 008. However, the PAP curve showed a shift to relatively lower cefepime resistance (from 256 to 64 μg/ml) in A. baumannii 328 after 10 passages in antibiotic-free Mueller-Hinton agar plates. Convergence to a monotypic resistance phenotype did not occur. Growth rate analysis revealed that slower growth in resistant subpopulations may provide a strategy against antibiotic challenge. To our knowledge, this is the first report of heteroresistance to cephalosporins and penicillins in A. baumannii. PMID:22189112

  17. Early dissemination of OXA-72-producing Acinetobacter baumannii strain in Colombia: a case report.

    PubMed

    Saavedra, Sandra Yamile; Cayô, Rodrigo; Gales, Ana Cristina; Leal, Aura Lucia; Saavedra, Carlos Humberto

    2014-01-01

    Nosocomial infections caused by carbapenem-resistant Acinetobacter baumannii isolates have reached epidemic levels in past decades. Currently this microorganism is responsible for outbreaks of difficult eradication and with high mortality rates worldwide. We herein report a rare case of an OXA-72-producing A. baumannii isolate colonizing a 47-year-old male patient with peritonitis due to abdominal stab wound, four years earlier than the first report of this carbapenemase in Acinetobacter pittii in Colombia. Although OXA-72 presents a low prevalence compared with OXA-23, our study demonstrated that A. baumannii isolates carrying the blaOXA-72 gene were present in the hospital environment in Colombia and could act as a reservoir for further spread to other Acinetobacter species, like A. pittii, causing carbapenem-resistance. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  18. Extrahuman Epidemiology of Acinetobacter baumannii in Lebanon

    PubMed Central

    Rafei, Rayane; Hamze, Monzer; Pailhoriès, Hélène; Eveillard, Matthieu; Marsollier, Laurent; Joly-Guillou, Marie-Laure; Dabboussi, Fouad

    2015-01-01

    The presence of Acinetobacter baumannii outside hospitals is still a controversial issue. The objective of our study was to explore the extrahospital epidemiology of A. baumannii in Lebanon. From February 2012 to October 2013, a total of 73 water samples, 51 soil samples, 37 raw cow milk samples, 50 cow meat samples, 7 raw cheese samples, and 379 animal samples were analyzed by cultural methods for the presence of A. baumannii. Species identification was performed by rpoB gene sequencing. Antibiotic susceptibility was investigated, and the A. baumannii population was studied by two genotyping approaches: multilocus sequence typing (MLST) and blaOXA-51 sequence-based typing (SBT). A. baumannii was detected in 6.9% of water samples, 2.7% of milk samples, 8.0% of meat samples, 14.3% of cheese samples, and 7.7% of animal samples. All isolates showed a susceptible phenotype against most of the antibiotics tested and lacked carbapenemase-encoding genes, except one that harbored a blaOXA-143 gene. MLST analysis revealed the presence of 36 sequence types (STs), among which 24 were novel STs reported for the first time in this study. blaOXA-51 SBT showed the presence of 34 variants, among which 21 were novel and all were isolated from animal origins. Finally, 30 isolates had new partial rpoB sequences and were considered putative new Acinetobacter species. In conclusion, animals can be a potential reservoir for A. baumannii and the dissemination of new emerging carbapenemases. The roles of the novel animal clones identified in community-acquired infections should be investigated. PMID:25616788

  19. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride.

    PubMed

    Narayanan, Amoolya; Nair, Meera S; Karumathil, Deepti P; Baskaran, Sangeetha A; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni

    2016-01-01

    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections.

  20. Inactivation of Acinetobacter baumannii Biofilms on Polystyrene, Stainless Steel, and Urinary Catheters by Octenidine Dihydrochloride

    PubMed Central

    Narayanan, Amoolya; Nair, Meera S.; Karumathil, Deepti P.; Baskaran, Sangeetha A.; Venkitanarayanan, Kumar; Amalaradjou, Mary Anne Roshni

    2016-01-01

    Acinetobacter baumannii is a major nosocomial pathogen causing human infections with significant mortality rates. In most cases, infections are acquired through exposure to A. baumannii biofilms that persist on contaminated hospital equipment and surfaces. Thus, it is imperative to develop effective measures for controlling A. baumannii biofilms in nosocomial settings. This study investigated the efficacy of octenidine dihydrochloride (OH), a new generation disinfectant for reducing A. baumannii biofilms on polystyrene, stainless steel and catheters. OH at 0.3% (5 mM), 0.6% (10 mM), and 0.9% (15 mM) was effective in significantly inactivating A. baumannii biofilms on all tested surfaces (P < 0.05). Furthermore, OH was equally effective in inactivating biofilms of multidrug resistant and drug susceptible A. baumannii isolates. In addition, confocal imaging revealed the predominance of dead cells in the OH-treated samples in comparison to the control. Further, scanning electron microscopy of biofilms formed on catheters revealed that OH treatment significantly reduced A. baumannii biofilm populations in corroboration with our antibiofilm assay. These data underscore the efficacy of OH in inactivating A. baumannii biofilms, thereby suggesting its potential use as a disinfectant or a catheter lock solution to control A. baumannii infections. PMID:27375572

  1. Outbreak of multidrug-resistant Acinetobacter baumannii in an intensive care unit.

    PubMed

    Dettori, Marco; Piana, Andrea; Deriu, Maria Grazia; Lo Curto, Paola; Cossu, Andrea; Musumeci, Rosario; Cocuzza, Clementina; Astone, Vito; Contu, Maria Antonietta; Sotgiu, Giovanni

    2014-04-01

    Acinetobacter baumannii is a ubiquitous microrganism often able to colonize and survive in different environments. Currently it is one of the most common pathogens responsible for nosocomial infections, including outbreaks, especially in long-term care facilities. The aim of this study was to show the results of an environmental investigation and genotyping analysis of multidrug-resistant Acinetobacter baumannii associated with an outbreak in an intensive care unit of a tertiary hospital located in Northern Sardinia, Italy. Positive cultures of MDR Acinetobacter baumannii were reported during the month of June 2012, after the collection of biological samples from ten patients. Acinetobacter baumannii was isolated during the following environmental investigation from the headboard of two beds. All the strains were genotyped by performing multiplex PCR to identify the presence of genes encoding carbapenemases. The results showed specific bands of bla(OXA-51-like) gene and of the bla(OXA-23-like) gene. PFGE highlighted minimal differences in genomic fingerprints, while the cluster analysis grouped the isolated microorganisms into two closely related clusters, characterized by Dice's similarity coefficient equal to 95.1%. MLST showed that the strains belonged to ST31. The results of the study highlight the need, especially in high-risk areas, to adopt strict hygiene practices, particularly hand hygiene, and to ensure an appropriate turnover of personal protective equipment, which could be responsible for the spread of biological agents, such as MDR Acinetobacter baumannii.

  2. Acinetobacter baumannii Genes Required for Bacterial Survival during Bloodstream Infection

    PubMed Central

    Subashchandrabose, Sargurunathan; Smith, Sara; DeOrnellas, Valerie; Crepin, Sebastien; Kole, Monica; Zahdeh, Carina

    2015-01-01

    ABSTRACT Acinetobacter baumannii is emerging as a leading global multiple-antibiotic-resistant nosocomial pathogen. The identity of genes essential for pathogenesis in a mammalian host remains largely unknown. Using transposon-directed insertion-site sequencing (TraDIS), we identified A. baumannii genes involved in bacterial survival in a leukopenic mouse model of bloodstream infection. Mice were inoculated with a pooled transposon mutant library derived from 109,000 mutants, and TraDIS was used to map transposon insertion sites in the genomes of bacteria in the inoculum and of bacteria recovered from mouse spleens. Unique transposon insertion sites were mapped and used to calculate a fitness factor for every insertion site based on its relative abundance in the inoculum and postinfection libraries. Eighty-nine transposon insertion mutants that were underrepresented after experimental infection in mice compared to their presence in the inocula were delineated as candidates for further evaluation. Genetically defined mutants lacking feoB (ferrous iron import), ddc (d-ala-d-ala-carboxypeptidase), and pntB (pyridine nucleotide transhydrogenase subunit) exhibited a fitness defect during systemic infection resulting from bacteremia. In vitro, these mutants, as well as a fepA (ferric enterobactin receptor) mutant, are defective in survival in human serum and within macrophages and are hypersensitive to killing by antimicrobial peptides compared to the survival of the parental strain under these conditions. Our data demonstrate that FepA is involved in the uptake of exogenous enterobactin in A. baumannii. Genetic complementation rescues the phenotypes of mutants in assays that emulate conditions encountered during infection. In summary, we have determined novel A. baumannii fitness genes involved in the pathogenesis of mammalian infection. IMPORTANCE A. baumannii is a significant cause of bacterial bloodstream infection in humans. Since multiple antibiotic resistance

  3. The Complete Genome and Phenome of a Community-Acquired Acinetobacter baumannii

    PubMed Central

    Farrugia, Daniel N.; Elbourne, Liam D. H.; Hassan, Karl A.; Eijkelkamp, Bart A.; Tetu, Sasha G.; Brown, Melissa H.; Shah, Bhumika S.; Peleg, Anton Y.; Mabbutt, Bridget C.; Paulsen, Ian T.

    2013-01-01

    Many sequenced strains of Acinetobacter baumannii are established nosocomial pathogens capable of resistance to multiple antimicrobials. Community-acquired A. baumannii in contrast, comprise a minor proportion of all A. baumannii infections and are highly susceptible to antimicrobial treatment. However, these infections also present acute clinical manifestations associated with high reported rates of mortality. We report the complete 3.70 Mbp genome of A. baumannii D1279779, previously isolated from the bacteraemic infection of an Indigenous Australian; this strain represents the first community-acquired A. baumannii to be sequenced. Comparative analysis of currently published A. baumannii genomes identified twenty-four accessory gene clusters present in D1279779. These accessory elements were predicted to encode a range of functions including polysaccharide biosynthesis, type I DNA restriction-modification, and the metabolism of novel carbonaceous and nitrogenous compounds. Conversely, twenty genomic regions present in previously sequenced A. baumannii strains were absent in D1279779, including gene clusters involved in the catabolism of 4-hydroxybenzoate and glucarate, and the A. baumannii antibiotic resistance island, known to bestow resistance to multiple antimicrobials in nosocomial strains. Phenomic analysis utilising the Biolog Phenotype Microarray system indicated that A. baumannii D1279779 can utilise a broader range of carbon and nitrogen sources than international clone I and clone II nosocomial isolates. However, D1279779 was more sensitive to antimicrobial compounds, particularly beta-lactams, tetracyclines and sulphonamides. The combined genomic and phenomic analyses have provided insight into the features distinguishing A. baumannii isolated from community-acquired and nosocomial infections. PMID:23527001

  4. Genetic Regulation of Virulence and Antibiotic Resistance in Acinetobacter baumannii.

    PubMed

    Kröger, Carsten; Kary, Stefani C; Schauer, Kristina; Cameron, Andrew D S

    2016-12-28

    Multidrug resistant microorganisms are forecast to become the single biggest challenge to medical care in the 21st century. Over the last decades, members of the genus Acinetobacter have emerged as bacterial opportunistic pathogens, in particular as challenging nosocomial pathogens because of the rapid evolution of antimicrobial resistances. Although we lack fundamental biological insight into virulence mechanisms, an increasing number of researchers are working to identify virulence factors and to study antibiotic resistance. Here, we review current knowledge regarding the regulation of virulence genes and antibiotic resistance in Acinetobacter baumannii. A survey of the two-component systems AdeRS, BaeSR, GacSA and PmrAB explains how each contributes to antibiotic resistance and virulence gene expression, while BfmRS regulates cell envelope structures important for pathogen persistence. A. baumannii uses the transcription factors Fur and Zur to sense iron or zinc depletion and upregulate genes for metal scavenging as a critical survival tool in an animal host. Quorum sensing, nucleoid-associated proteins, and non-classical transcription factors such as AtfA and small regulatory RNAs are discussed in the context of virulence and antibiotic resistance.

  5. Genetic Regulation of Virulence and Antibiotic Resistance in Acinetobacter baumannii

    PubMed Central

    Kröger, Carsten; Kary, Stefani C.; Schauer, Kristina; Cameron, Andrew D. S.

    2016-01-01

    Multidrug resistant microorganisms are forecast to become the single biggest challenge to medical care in the 21st century. Over the last decades, members of the genus Acinetobacter have emerged as bacterial opportunistic pathogens, in particular as challenging nosocomial pathogens because of the rapid evolution of antimicrobial resistances. Although we lack fundamental biological insight into virulence mechanisms, an increasing number of researchers are working to identify virulence factors and to study antibiotic resistance. Here, we review current knowledge regarding the regulation of virulence genes and antibiotic resistance in Acinetobacter baumannii. A survey of the two-component systems AdeRS, BaeSR, GacSA and PmrAB explains how each contributes to antibiotic resistance and virulence gene expression, while BfmRS regulates cell envelope structures important for pathogen persistence. A. baumannii uses the transcription factors Fur and Zur to sense iron or zinc depletion and upregulate genes for metal scavenging as a critical survival tool in an animal host. Quorum sensing, nucleoid-associated proteins, and non-classical transcription factors such as AtfA and small regulatory RNAs are discussed in the context of virulence and antibiotic resistance. PMID:28036056

  6. Morphine, but not trauma, sensitizes to systemic Acinetobacter baumannii infection.

    PubMed

    Breslow, Jessica M; Monroy, M Alexandra; Daly, John M; Meissler, Joseph J; Gaughan, John; Adler, Martin W; Eisenstein, Toby K

    2011-12-01

    Acinetobacter baumannii is an important nosocomial pathogen in civilian intensive care units. Recently the incidence has increased in wounded military personnel. Morphine is documented in numerous animal studies to be immunosuppressive and to sensitize to infection. The hypotheses were tested that morphine, administered for analgesia in the battlefield, predisposes to Acinetobacter infection, and that the opioid may have an additive or synergistic effect with trauma. To test these hypotheses, an intraperitoneal infection model was established in mice using several Acinetobacter strains. Morphine administered for 48 h by implantation of a slow-release morphine pellet increased mortality compared to animals receiving a placebo pellet, an effect that was blocked by the mu-opioid receptor antagonist, naltrexone. Acinetobacter burdens in the blood, spleens, livers, and lungs of morphine-treated mice, were significantly higher than those in placebo-treated animals, confirming that mortality was due to potentiated growth of the bacteria. There were also elevated levels of pro-inflammatory cytokines in morphine-treated versus placebo-treated mice. Morphine caused a reduction in the total number of cells in the peritoneal cavity, a decrease in the percentage and total numbers of neutrophils, and a decrease in the total number of macrophages. Morphine treatment also suppressed levels of the neutrophil-inducing molecules, IL-17A and KC/CXCL1. However, IL-17A(-/-) mice given morphine were not sensitized to Acintobacter infection to a greater degree than similarly treated wild-type mice. Trauma alone did not sensitize to Acinetobacter infection, and there was no additive effect between morphine and trauma. These results support the hypothesis that morphine potentiates Acinetobacter infection.

  7. Biology of Acinetobacter baumannii: Pathogenesis, Antibiotic Resistance Mechanisms, and Prospective Treatment Options.

    PubMed

    Lee, Chang-Ro; Lee, Jung Hun; Park, Moonhee; Park, Kwang Seung; Bae, Il Kwon; Kim, Young Bae; Cha, Chang-Jun; Jeong, Byeong Chul; Lee, Sang Hee

    2017-01-01

    Acinetobacter baumannii is undoubtedly one of the most successful pathogens responsible for hospital-acquired nosocomial infections in the modern healthcare system. Due to the prevalence of infections and outbreaks caused by multi-drug resistant A. baumannii, few antibiotics are effective for treating infections caused by this pathogen. To overcome this problem, knowledge of the pathogenesis and antibiotic resistance mechanisms of A. baumannii is important. In this review, we summarize current studies on the virulence factors that contribute to A. baumannii pathogenesis, including porins, capsular polysaccharides, lipopolysaccharides, phospholipases, outer membrane vesicles, metal acquisition systems, and protein secretion systems. Mechanisms of antibiotic resistance of this organism, including acquirement of β-lactamases, up-regulation of multidrug efflux pumps, modification of aminoglycosides, permeability defects, and alteration of target sites, are also discussed. Lastly, novel prospective treatment options for infections caused by multi-drug resistant A. baumannii are summarized.

  8. Biology of Acinetobacter baumannii: Pathogenesis, Antibiotic Resistance Mechanisms, and Prospective Treatment Options

    PubMed Central

    Lee, Chang-Ro; Lee, Jung Hun; Park, Moonhee; Park, Kwang Seung; Bae, Il Kwon; Kim, Young Bae; Cha, Chang-Jun; Jeong, Byeong Chul; Lee, Sang Hee

    2017-01-01

    Acinetobacter baumannii is undoubtedly one of the most successful pathogens responsible for hospital-acquired nosocomial infections in the modern healthcare system. Due to the prevalence of infections and outbreaks caused by multi-drug resistant A. baumannii, few antibiotics are effective for treating infections caused by this pathogen. To overcome this problem, knowledge of the pathogenesis and antibiotic resistance mechanisms of A. baumannii is important. In this review, we summarize current studies on the virulence factors that contribute to A. baumannii pathogenesis, including porins, capsular polysaccharides, lipopolysaccharides, phospholipases, outer membrane vesicles, metal acquisition systems, and protein secretion systems. Mechanisms of antibiotic resistance of this organism, including acquirement of β-lactamases, up-regulation of multidrug efflux pumps, modification of aminoglycosides, permeability defects, and alteration of target sites, are also discussed. Lastly, novel prospective treatment options for infections caused by multi-drug resistant A. baumannii are summarized. PMID:28348979

  9. Stereochemical Insignificance Discovered in Acinetobacter baumannii Quorum Sensing

    PubMed Central

    Struss, Anjali Kumari; Watkins, Richard; Feske, Brent D.; Kaufmann, Gunnar F.; Janda, Kim D.

    2012-01-01

    Stereochemistry is a key aspect of molecular recognition for biological systems. As such, receptors and enzymes are often highly stereospecific, only recognizing one stereoisomer of a ligand. Recently, the quorum sensing signaling molecules used by the nosocomial opportunistic pathogen, Acinetobacter baumannii, were identified, and the primary signaling molecule isolated from this species was N-(3-hydroxydodecanoyl)-l-homoserine lactone. A plethora of bacterial species have been demonstrated to utilize 3-hydroxy-acylhomoserine lactone autoinducers, and in virtually all cases, the (R)-stereoisomer was identified as the natural ligand and exhibited greater autoinducer activity than the corresponding (S)-stereoisomer. Using chemical synthesis and biochemical assays, we have uncovered a case of stereochemical insignificance in A. baumannii and provide a unique example where stereochemistry appears nonessential for acylhomoserine lactone-mediated quorum sensing signaling. Based on previously reported phylogenetic studies, we suggest that A. baumannii has evolutionarily adopted this unique, yet promiscuous quorum sensing system to ensure its survival, particularly in the presence of other proteobacteria. PMID:22629354

  10. Evaluation of Parameters for High Efficiency Transformation of Acinetobacter baumannii

    PubMed Central

    Yildirim, Suleyman; Thompson, Mitchell G.; Jacobs, Anna C.; Zurawski, Daniel V.; Kirkup, Benjamin C.

    2016-01-01

    Acinetobacter baumannii is an emerging, nosocomial pathogen that is poorly characterized due to a paucity of genetic tools and methods. While whole genome sequence data from several epidemic and environmental strains have recently become available, the functional characterization of genes is significantly lagging. Efficient transformation is one of the first steps to develop molecular tools that can be used to address these shortcomings. Here we report parameters allowing high efficiency transformation of A. baumannii. Using a multi-factorial experimental design we found that growth phase, voltage, and resistance all significantly contribute to transformation efficiency. The highest efficiency (4.3 × 108 Transformants/μg DNA) was obtained at the stationary growth phase of the bacterium (OD 6.0) using 25 ng of plasmid DNA under 100 Ohms resistance and 1.7 kV/cm voltage. The optimized electroporation parameters reported here provide a useful tool for genetic manipulation of A. baumannii. PMID:26911658

  11. Acinetobacter baumannii: Emergence of a Successful Pathogen

    PubMed Central

    Peleg, Anton Y.; Seifert, Harald; Paterson, David L.

    2008-01-01

    Acinetobacter baumannii has emerged as a highly troublesome pathogen for many institutions globally. As a consequence of its immense ability to acquire or upregulate antibiotic drug resistance determinants, it has justifiably been propelled to the forefront of scientific attention. Apart from its predilection for the seriously ill within intensive care units, A. baumannii has more recently caused a range of infectious syndromes in military personnel injured in the Iraq and Afghanistan conflicts. This review details the significant advances that have been made in our understanding of this remarkable organism over the last 10 years, including current taxonomy and species identification, issues with susceptibility testing, mechanisms of antibiotic resistance, global epidemiology, clinical impact of infection, host-pathogen interactions, and infection control and therapeutic considerations. PMID:18625687

  12. Acinetobacter baumannii: an emerging opportunistic pathogen.

    PubMed

    Howard, Aoife; O'Donoghue, Michael; Feeney, Audrey; Sleator, Roy D

    2012-05-01

    Acinetobacter baumannii is an opportunistic bacterial pathogen primarily associated with hospital-acquired infections. The recent increase in incidence, largely associated with infected combat troops returning from conflict zones, coupled with a dramatic increase in the incidence of multidrug-resistant (MDR) strains, has significantly raised the profile of this emerging opportunistic pathogen. Herein, we provide an overview of the pathogen, discuss some of the major factors that have led to its clinical prominence and outline some of the novel therapeutic strategies currently in development.

  13. Genomic Evolution of Two Acinetobacter baumannii Clinical Strains from ST-2 Clones Isolated in 2000 and 2010 (ST-2_clon_2000 and ST-2_clon_2010).

    PubMed

    López, M; Rueda, A; Florido, J P; Blasco, L; Gato, E; Fernández-García, L; Martínez-Martínez, L; Fernández-Cuenca, F; Pachón, J; Cisneros, J M; Garnacho-Montero, J; Vila, J; Rodríguez-Baño, J; Pascual, A; Bou, G; Tomás, M

    2016-10-20

    Acinetobacter baumannii is a successful nosocomial pathogen due to its ability to persist in hospital environments by acquiring mobile elements such as transposons, plasmids, and phages. In this study, we compared two genomes of A. baumannii clinical strains isolated in 2000 (ST-2_clon_2000) and 2010 (ST-2_clon_2010) from GenBank project PRJNA308422.

  14. Genomic Evolution of Two Acinetobacter baumannii Clinical Strains from ST-2 Clones Isolated in 2000 and 2010 (ST-2_clon_2000 and ST-2_clon_2010)

    PubMed Central

    López, M.; Rueda, A.; Florido, J. P.; Blasco, L.; Gato, E.; Fernández-García, L.; Martínez-Martínez, L.; Fernández-Cuenca, F.; Pachón, J.; Cisneros, J. M.; Garnacho-Montero, J.; Vila, J.; Rodríguez-Baño, J.; Pascual, A.; Bou, G.

    2016-01-01

    Acinetobacter baumannii is a successful nosocomial pathogen due to its ability to persist in hospital environments by acquiring mobile elements such as transposons, plasmids, and phages. In this study, we compared two genomes of A. baumannii clinical strains isolated in 2000 (ST-2_clon_2000) and 2010 (ST-2_clon_2010) from GenBank project PRJNA308422. PMID:27795287

  15. Complete Genome Sequence of the Clinical Strain Acinetobacter baumannii R2090 Carrying the Chromosomally Encoded Metallo-β-Lactamase Gene blaNDM-1

    PubMed Central

    Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Nordmann, Patrice; Pühler, Alfred; Poirel, Laurent

    2015-01-01

    Acinetobacter baumannii is an emerging human pathogen causing nosocomial and community-acquired infections. Here, we present the complete genome sequence of the clinical A. baumannii strain R2090 carrying the metallo-β-lactamase gene blaNDM-1 in its chromosome within the transposon Tn125. PMID:26358593

  16. Analysis on distribution features and drug resistance of clinically isolated Acinetobacter baumannii.

    PubMed

    Ren, Guangming; Zhou, Min; Ding, Ning; Zhou, Ning; Li, Qingling

    2016-09-01

    The aim of the present study was to examine the clinical distribution and drug resistance of Acinetobacter baumannii infection, and provide evidence of clinical medication as well as the prophylaxis for the treatment of drug resistance bacteria. In total, 306 Acinetobacter baumanniis selected from routine culture were collected between January 2012 and December 2013, to analyze the distributions among clinical specimens and wards and their drug resistance state. Of the 306 Acinetobacter baumanniis, the main distribution of specimens was sputum, accounting for 77.78%. The distribution of administrative office was dominated by intensive care unit with a proportion of 40.0% in 2012, which rapidly increased to 60.9% in 2013, followed by neurosurgery, respiration medicine and orthopedics with proportions of 23, 12 and 9.0% in 2012 and 9.71, 8.74 and 3.88% in 2013, respectively. The Acinetobacter baumannii's drug resistance rate of Tazobactam and Piperacillin was increased from 68.0% in 2012 to 71.36% in 2013. At the same time, the drug resistance rate of imipenem was enhanced from 66.0% in 2012 to 72.81% in 2013. By 2013, the drug resistance rates of penbritin, ceftizoxime, cefotetan and macrodantin reached ≤100%. In conclusion, Acinetobacter baumannii mainly causes respiratory tract infection with severe drug resistance. The drug resistance of Acinetobacter baumannii was mainly manifested as multidrug resistance or even pan-drug resistance with an obvious increasing trend of tolerance. Thus, it is necessary to prevent and treat nosocomial infection, to minimize usage of antibiotics and to standardize medical operating, to reduce the increase in persistence.

  17. Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii

    PubMed Central

    Jara, Luis M.; Pérez-Varela, María; Corral, Jordi; Arch, Marta; Cortés, Pilar; Bou, Germán; Barbé, Jordi

    2015-01-01

    Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis. PMID:26503651

  18. Postcraniofacial trauma multidrug resistant Acinetobacter baumannii infection treated with intravenous colistin: a rare complication.

    PubMed

    Rastogi, Sanjay; Gupta, Anurag; Narne, Raja S; Reddy, Mahendra P; Bansal, Mansi; Kumar, Sanjeev

    2013-01-01

    Nosocomial meningitis is a rare complication of combined craniofacial and neurosurgical procedures. The increase in meningitis caused by multidrug-resistant (MDR) Acinetobacter baumannii has resulted in a significant reduction in available treatment options. We report a case of 52-year-old man who sustained a complex craniofacial trauma, who developed nosocomial MDR infection caused by A. baumannii in the wound. Patient was at significant risk of developing meningitis but, he was successfully treated with intravenous colistin. To conclude, patients with complex maxillofacial trauma are at high risk of MDR A. baumannii meningitis, especially in craniofacial intensive care units, and adequate infection control measures with proper institution of antibiotics, should be used to reduce the risk of this infection.

  19. Identification and Characterization of a Glycosyltransferase Involved in Acinetobacter baumannii Lipopolysaccharide Core Biosynthesis▿

    PubMed Central

    Luke, Nicole R.; Sauberan, Shauna L.; Russo, Thomas A.; Beanan, Janet M.; Olson, Ruth; Loehfelm, Thomas W.; Cox, Andrew D.; St. Michael, Frank; Vinogradov, Evgeny V.; Campagnari, Anthony A.

    2010-01-01

    Although Acinetobacter baumannii has emerged as a significant cause of nosocomial infections worldwide, there have been few investigations describing the factors important for A. baumannii persistence and pathogenesis. This paper describes the first reported identification of a glycosyltransferase, LpsB, involved in lipopolysaccharide (LPS) biosynthesis in A. baumannii. Mutational, structural, and complementation analyses indicated that LpsB is a core oligosaccharide glycosyl transferase. Using a genetic approach, lpsB was compared with the lpsB homologues of several A. baumannii strains. These analyses indicated that LpsB is highly conserved among A. baumannii isolates. Furthermore, we developed a monoclonal antibody, monoclonal antibody 13C11, which reacts to an LPS core epitope expressed by approximately one-third of the A. baumannii clinical isolates evaluated to date. Previous studies describing the heterogeneity of A. baumannii LPS were limited primarily to structural analyses; therefore, studies evaluating the correlation between these surface glycolipids and pathogenesis were warranted. Our data from an evaluation of LpsB mutant 307::TN17, which expresses a deeply truncated LPS glycoform consisting of only two 3-deoxy-d-manno-octulosonic acid residues and lipid A, suggest that A. baumannii LPS is important for resistance to normal human serum and confers a competitive advantage for survival in vivo. These results have important implications for the role of LPS in A. baumannii infections. PMID:20194587

  20. Colistin and tigecycline for management of external ventricular device-related ventriculitis due to multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Shrestha, Gentle Sunder; Tamang, Sushil; Paneru, Hem Raj; Shrestha, Pramesh Sunder; Keyal, Niraj; Acharya, Subhash Prasad; Marhatta, Moda Nath; Shilpakar, Sushil

    2016-01-01

    Acinetobacter baumannii is an important cause of nosocomial ventriculitis associated with external ventricular device (EVD). It is frequently multidrug resistant (MDR), carries a poor outcome, and is difficult to treat. We report a case of MDR Acinetobacter ventriculitis treated with intravenous and intraventricular colistin together with intravenous tigecycline. The patient developed nephrotoxicity and poor neurological outcome despite microbiological cure. Careful implementation of bundle of measures to minimize EVD-associated ventriculitis is valuable. PMID:27365967

  1. The Population Structure of Acinetobacter baumannii: Expanding Multiresistant Clones from an Ancestral Susceptible Genetic Pool

    PubMed Central

    Diancourt, Laure; Passet, Virginie; Nemec, Alexandr; Dijkshoorn, Lenie; Brisse, Sylvain

    2010-01-01

    Outbreaks of hospital infections caused by multidrug resistant Acinetobacter baumannii strains are of increasing concern worldwide. Although it has been reported that particular outbreak strains are geographically widespread, little is known about the diversity and phylogenetic relatedness of A. baumannii clonal groups. Sequencing of internal portions of seven housekeeping genes (total 2,976 nt) was performed in 154 A. baumannii strains covering the breadth of known diversity and including representatives of previously recognized international clones, and in 19 representatives of other Acinetobacter species. Restricted amounts of diversity and a star-like phylogeny reveal that A. baumannii is a genetically compact species that suffered a severe bottleneck in the recent past, possibly linked to a restricted ecological niche. A. baumannii is neatly demarcated from its closest relative (genomic species 13TU) and other Acinetobacter species. Multilocus sequence typing analysis demonstrated that the previously recognized international clones I to III correspond to three clonal complexes, each made of a central, predominant genotype and few single locus variants, a hallmark of recent clonal expansion. Whereas antimicrobial resistance was almost universal among isolates of these and a novel international clone (ST15), isolates of the other genotypes were mostly susceptible. This dichotomy indicates that antimicrobial resistance is a major selective advantage that drives the ongoing rapid clonal expansion of these highly problematic agents of nosocomial infections. PMID:20383326

  2. Evaluation of the Trimeric Autotransporter Ata as a Vaccine Candidate against Acinetobacter baumannii Infections

    PubMed Central

    Bentancor, Leticia V.; Routray, Abhisek; Bozkurt-Guzel, Cagla; Camacho-Peiro, Ana; Pier, Gerald B.

    2012-01-01

    Acinetobacter baumannii is a multidrug-resistant (MDR) nosocomial pathogen for which immunotherapeutic alternatives are needed. We previously identified a surface autotransporter of A. baumannii, Ata, that bound to various extracellular matrix/basal membrane proteins and was required for full virulence, biofilm formation, and the adhesion of A. baumannii to collagen type IV. We show here that Ata binding to collagen type IV was inhibited by antibodies to Ata. In addition, in the presence of complement and polymorphonuclear cells (PMNs), antibodies to Ata were highly opsonic against A. baumannii ATCC 17978 and showed low to moderate killing activity against four heterologous A. baumannii strains, whereas in the absence of PMNs, antibody to Ata efficiently promoted complement-dependent bactericidal killing of all of the tested A. baumannii isolates. Using a pneumonia model of infection in both immunocompetent and immunocompromised mice, we found that, compared to normal rabbit sera, antisera to Ata significantly reduced the levels of A. baumannii ATCC 17978 and two MDR strains in the lungs of infected mice. The ability of Ata to engender anti-adhesive, bactericidal, opsonophagocytic, and protective antibodies validates its potential use as an antigenic target against MDR A. baumannii infections. PMID:22825448

  3. Multidrug resistant Acinetobacter baumannii in veterinary medicine--emergence of an underestimated pathogen?

    PubMed

    Müller, Stefanie; Janssen, Traute; Wieler, Lothar H

    2014-01-01

    The proportion of multidrug resistant bacteria causing infections in animals has continuously been increasing. While the relevance of ESBL (extended spectrum beta-lactamase)-producing Enterobacteriaceae spp. and MRSA (methicillin resistant Staphylococcus aureus) is unquestionable, knowledge about multidrug resistant Acinetobacter baumannii in veterinary medicine is scarce. This is a worrisome situation, as A. baumannii are isolated from veterinary clinical specimens with rising frequency. The remarkable ability of A. baumannii to develop multidrug resistance and the high risk of transmission are known in human medicine for years. Despite this, data regarding A. baumannii isolates of animal origin are missing. Due to the changing role of companion animals with closer contact between animal and owner, veterinary intensive care medicine is steadily developing. It can be assumed that the number of "high risk" patients with an enhanced risk for hospital acquired infections will be rising simultaneously. Thus, development and spread of multidrug resistant pathogens is envisioned to rise. It is possible, that A. baumannii will evolve into a veterinary nosocomial pathogen similar to ESBL-producing Enterobacteriaceae and MRSA. The lack of attention paid to A. baumannii in veterinary medicine is even more worrying, as first reports indicate a transmission between humans and animals. Essential questions regarding the role of livestock, especially as a potential source of multidrug resistant isolates, remain unanswered. This review summarizes the current knowledge on A. baumannii in veterinary medicine for the first time. It underlines the utmost significance of further investigations of A. baumannii animal isolates, particularly concerning epidemiology and resistance mechanisms.

  4. Evaluation of the trimeric autotransporter Ata as a vaccine candidate against Acinetobacter baumannii infections.

    PubMed

    Bentancor, Leticia V; Routray, Abhisek; Bozkurt-Guzel, Cagla; Camacho-Peiro, Ana; Pier, Gerald B; Maira-Litrán, Tomás

    2012-10-01

    Acinetobacter baumannii is a multidrug-resistant (MDR) nosocomial pathogen for which immunotherapeutic alternatives are needed. We previously identified a surface autotransporter of A. baumannii, Ata, that bound to various extracellular matrix/basal membrane proteins and was required for full virulence, biofilm formation, and the adhesion of A. baumannii to collagen type IV. We show here that Ata binding to collagen type IV was inhibited by antibodies to Ata. In addition, in the presence of complement and polymorphonuclear cells (PMNs), antibodies to Ata were highly opsonic against A. baumannii ATCC 17978 and showed low to moderate killing activity against four heterologous A. baumannii strains, whereas in the absence of PMNs, antibody to Ata efficiently promoted complement-dependent bactericidal killing of all of the tested A. baumannii isolates. Using a pneumonia model of infection in both immunocompetent and immunocompromised mice, we found that, compared to normal rabbit sera, antisera to Ata significantly reduced the levels of A. baumannii ATCC 17978 and two MDR strains in the lungs of infected mice. The ability of Ata to engender anti-adhesive, bactericidal, opsonophagocytic, and protective antibodies validates its potential use as an antigenic target against MDR A. baumannii infections.

  5. CpaA a novel protease from Acinetobacter baumannii clinical isolates deregulates blood coagulation.

    PubMed

    Tilley, Derek; Law, Robert; Warren, Sarah; Samis, John A; Kumar, Ayush

    2014-07-01

    Acinetobacter baumannii is an important nosocomial pathogen that displays high antibiotic resistance. It causes a variety of infections including pneumonias and sepsis which may result in disseminated intravascular coagulation. In this work, we identify and characterize a novel secreted, zinc-dependent, metallo-endopeptidase CpaA (coagulation targeting metallo-endopeptidase of Acinetobacter baumannii) which deregulates human blood coagulation in vitro and thus is likely to contribute to A. baumannii virulence. Three quarters of the clinical isolates tested (n = 16) had the cpaA gene; however, it was absent from two type strains, A. baumannii ATCC 17978 and A. baumannii ATCC 19606. The CpaA protein was purified from one clinical isolate and was able to cleave purified factor (F) V and fibrinogen and reduce the coagulation activity of FV in human plasma. CpaA-treated plasma showed reduced clotting activity in contact pathway-activated partial thromboplastin time (aPTT) assays, but increased clotting activity in tissue factor pathway prothrombin time (PT) assays. A significant portion of clinically relevant A. baumannii isolates secrete a protease which targets and deregulates the coagulation system.

  6. [In vitro tigecycline and carbapenem susceptibilities of clinical Acinetobacter baumannii isolates].

    PubMed

    Nayman Alpat, Saygın; Aybey, Aşkın Derya; Akşit, Filiz; Ozgüneş, Ilhan; Kiremitçi, Abdurrahman; Usluer, Gaye

    2010-10-01

    Acinetobacter baumannii is a frequent cause of nosocomial infections in most hospitals. Management of infections caused by these strains is difficult, as the strains often display multiple drug resistance, including carbapenem. Tigecycline which is a glycylcycline derivative has antimicrobial activity against many gram-positive and gram-negative organisms. In this study, in vitro activity of tigecycline and carbapenems against clinical isolates of A.baumannii strains were investigated. A total of 100 A.baumannii isolates were collected from hospitalized patients with documented nosocomial infections [pneumonia (n = 39), surgical wound infection (n = 32), bacteremia (n = 16), catheter infection (n = 6), urinary tract infection (n = 5), peritonitis (n = 1), eye infection (n = 1)] between October 2006 and June 2007. Only one isolate per patient was included to the study. Minimum inhibitory concentrations (MIC) of tigecycline were determined by E-test (AB Biodisk, Sweden). Carbapenem resistance of A.baumannii strains were determined by disk diffusion method. All of the 100 A.baumannii isolates (100%) were found susceptible to tigecycline (MIC values ≤ 2 µg/ml; MIC ranges: 0.032-1.5 µg/ml). Imipenem susceptibility test was performed for 95 strains, and 36 (37.9%) were found sensitive, 18 (18.9%) were intermediate sensitive, and 41 (43.2%) were resistant. Meropenem susceptibility test was performed for 87 strains, and 22 (25.3%) were found sensitive, 9 (10.3%) were intermediate sensitive, and 56 (64.4%) were resistant. Since tigecycline is found quite effective on nosocomial A.baumannii isolates, it may be considered as a treatment alternative in infections caused by carbapenem-resistant Acinetobacter spp.

  7. Acinetobacter baumannii skin and soft-tissue infection associated with war trauma.

    PubMed

    Sebeny, Peter J; Riddle, Mark S; Petersen, Kyle

    2008-08-15

    Acinetobacter baumannii is usually associated with nosocomial pneumonia or bacteremia. Reports of A. baumannii skin and soft-tissue infection (SSTI) are uncommon. We performed a retrospective review of 57 inpatients admitted to a naval hospital ship and identified 8 patients with A. baumannii-associated SSTI. Demographic and clinical characteristics were compared between these patients and 49 patients with A. baumannii infections that were not SSTIs. We also reviewed 18 cases of A. baumannii-associated SSTI from the literature. Our 8 cases of A. baumannii-associated SSTI were associated with combat trauma wounds. The median age of the patients was 26 years. Although not statistically significant, A. baumannii-associated SSTIs were more likely to be associated with gunshot wounds (75% vs. 55%) or external fixators (63% vs. 29%), compared with A. baumannii infections that were not SSTIs. Use of a central venous catheter and total parenteral nutrition was also more common for patients with SSTI. Our cases of A. baumannii-associated SSTI presented as cellulitis with a "peau d'orange" appearance with overlying vesicles and, when untreated, progressed to necrotizing infection with bullae (hemorrhagic and nonhemorrhagic). In our case series, all isolates were multidrug resistant, and clinical success was achieved for 7 of 8 patients with debridement and carbapenem therapy. A. baumannii-associated SSTI is an emerging infection in patients who experience trauma. Clinicians should be aware of the potential role of A. baumannii as a multidrug-resistant pathogen causing hospital-acquired SSTI, particularly when associated with previous trauma or use of invasive devices. It should be suspected in patients who experience trauma and have edematous cellulitis with overlying vesicles. Early empirical coverage for drug-resistant species (e.g., with carbapenem therapy), combined with debridement, is usually curative.

  8. Isolation and Characterization of Antimicrobial Compounds in Plant Extracts against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Miyasaki, Yoko; Rabenstein, John D.; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M.; Kittell, Patricia Emmett; Morgan, Margie A.; Nichols, Wesley Stephen; Van Benschoten, M. M.; Hardy, William David; Liu, George Y.

    2013-01-01

    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii. PMID:23630600

  9. Acinetobacter baumannii-associated skin and soft tissue infections: recognizing a broadening spectrum of disease.

    PubMed

    Guerrero, Dubert M; Perez, Federico; Conger, Nicholas G; Solomkin, Joseph S; Adams, Mark D; Rather, Philip N; Bonomo, Robert A

    2010-02-01

    Acinetobacter baumannii is gaining importance as a cause of nosocomial infections, but its role in skin and soft tissue infection (SSTI) is not well defined. As a result of the outbreak of A. baumannii occurring in military personnel in Iraq and Afghanistan, reports of severe wound infections and SSTI caused by this pathogen are increasing in frequency. We describe four cases of monomicrobial and polymicrobial A. baumannii-associated necrotizing SSTI accompanied by A. baumannii bacteremia and offer a review of similar experiences published in the literature. Our comparative analysis reveals four unique features associated with necrotizing SSTI associated with A. baumannii: i) Occurs in hosts with underlying comorbidities (e.g., trauma, cirrhosis); ii) is often accompanied by bacteremia; iii) multiple drug resistance and the presence of co-pathogens frequently complicated treatment (64% of cases); iv) the cases reported here and in our review required surgical debridement (84% of cases) and led to substantial mortality (approximately 30%). As the prevalence of A. baumannii continues to increase in our health care system, SSTIs caused by this organism may become more common. Clinicians must be aware that the spectrum of disease caused by A. baumannii could include severe necrotizing SSTI and that vigilance for potential complications is necessary.

  10. Antimicrobial Resistance of Acinetobacter baumannii to Imipenem in Iran: A Systematic Review and Meta-Analysis.

    PubMed

    Pourhajibagher, Maryam; Hashemi, Farhad B; Pourakbari, Babak; Aziemzadeh, Masoud; Bahador, Abbas

    2016-01-01

    Imipenem-resistant multi-drug resistant (IR-MDR) Acinetobacter baumannii has been emerged as a morbidity successful nosocomial pathogen throughout the world.To address imipenem being yet the most effective antimicrobial agent against A. baumannii to control outbreaks and treat patients, a systematic review and meta-analysis was performed to evaluate the prevalence of IR-MDR A. baumannii. We systematically searched Web of Science, PubMed, MEDLINE, Science Direct, EMBASE, Scopus, Cochrane Library, Google Scholar, and Iranian databases to identify studies addressing the antibiotic resistance of A. baumannii to imipenem and the frequency of MDR strains in Iran. Out of 58 articles and after a secondary screening using inclusion and exclusion criteria and on the basis of title and abstract evaluation, 51 studies were selected for analysis. The meta-analysis revealed that 55% [95% confidence interval (CI), 53.0-56.5] of A. baumannii were resistant to imipenem and 74% (95% CI, 61.3-83.9) were MDR. The MDR A. baumannii population in Iran is rapidly changing toward a growing resistance to imipenem. Our findings highlight the critical need for a comprehensive monitoring and infection control policy as well as a national susceptibility review program that evaluates IR-MDR A. baumannii isolates from various parts of Iran.

  11. Acinetobacter baumannii Outer Membrane Vesicles Elicit a Potent Innate Immune Response via Membrane Proteins

    PubMed Central

    Jun, So Hyun; Lee, Jung Hwa; Kim, Bo Ra; Kim, Seung Il; Park, Tae In

    2013-01-01

    Acinetobacter baumannii is increasingly becoming a major nosocomial pathogen. This opportunistic pathogen secretes outer membrane vesicles (OMVs) that interact with host cells. The aim of this study was to investigate the ability of A. baumannii OMVs to elicit a pro-inflammatory response in vitro and the immunopathology in response to A. baumannii OMVs in vivo. OMVs derived from A. baumannii ATCC 19606T induced expression of pro-inflammatory cytokine genes, interleukin (IL)-1β and IL-6, and chemokine genes, IL-8, macrophage inflammatory protein-1α, and monocyte chemoattractant protein-1, in epithelial cells in a dose-dependent manner. Disintegration of OMV membrane with ethylenediaminetetraacetic acid resulted in low expression of pro-inflammatory cytokine genes, as compared with the response to intact OMVs. In addition, proteinase K-treated A. baumannii OMVs did not induce significant increase in expression of pro-inflammatory cytokine genes above the basal level, suggesting that the surface-exposed membrane proteins in intact OMVs are responsible for pro-inflammatory response. Early inflammatory processes, such as vacuolization and detachment of epithelial cells and neutrophilic infiltration, were clearly observed in lungs of mice injected with A. baumannii OMVs. Our data demonstrate that OMVs produced by A. baumannii elicit a potent innate immune response, which may contribute to immunopathology of the infected host. PMID:23977136

  12. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.

    PubMed

    Miyasaki, Yoko; Rabenstein, John D; Rhea, Joshua; Crouch, Marie-Laure; Mocek, Ulla M; Kittell, Patricia Emmett; Morgan, Margie A; Nichols, Wesley Stephen; Van Benschoten, M M; Hardy, William David; Liu, George Y

    2013-01-01

    The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii) is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii.

  13. Polymicrobial Chronic Infection Including Acinetobacter Baumannii in a Plated Segmental Defect in the Rat Femur

    DTIC Science & Technology

    2008-01-01

    Including Acinetobacter baumannii in a Plated Segmental Defect in the Rat Femur PRINCIPAL INVESTIGATOR: Dean T. Tsukayama, MD...FEB 2007 - 31 DEC 2007 4. TITLE AND SUBTITLE Polymicrobial Chronic Infection Including Acinetobacter baumannii 5a. CONTRACT NUMBER in a Plated...bone isolate of Acinetobacter baumannii exhibited very little osteolytic involvement when used alone in the model. Qualitative cultures indicated very

  14. Resources for Genetic and Genomic Analysis of Emerging Pathogen Acinetobacter baumannii

    PubMed Central

    Ramage, Elizabeth; Weiss, Eli J.; Radey, Matthew; Hayden, Hillary S.; Held, Kiara G.; Huse, Holly K.; Zurawski, Daniel V.; Brittnacher, Mitchell J.; Manoil, Colin

    2015-01-01

    ABSTRACT Acinetobacter baumannii is a Gram-negative bacterial pathogen notorious for causing serious nosocomial infections that resist antibiotic therapy. Research to identify factors responsible for the pathogen's success has been limited by the resources available for genome-scale experimental studies. This report describes the development of several such resources for A. baumannii strain AB5075, a recently characterized wound isolate that is multidrug resistant and displays robust virulence in animal models. We report the completion and annotation of the genome sequence, the construction of a comprehensive ordered transposon mutant library, the extension of high-coverage transposon mutant pool sequencing (Tn-seq) to the strain, and the identification of the genes essential for growth on nutrient-rich agar. These resources should facilitate large-scale genetic analysis of virulence, resistance, and other clinically relevant traits that make A. baumannii a formidable public health threat. IMPORTANCE Acinetobacter baumannii is one of six bacterial pathogens primarily responsible for antibiotic-resistant infections that have become the scourge of health care facilities worldwide. Eliminating such infections requires a deeper understanding of the factors that enable the pathogen to persist in hospital environments, establish infections, and resist antibiotics. We present a set of resources that should accelerate genome-scale genetic characterization of these traits for a reference isolate of A. baumannii that is highly virulent and representative of current outbreak strains. PMID:25845845

  15. Control of a Multi-Drug-Resistant Acinetobacter baumannii Outbreak after Orthopedics Department Relocation

    PubMed Central

    Gogou, Vasiliki; Meletis, Georgios; Tsitouras, Dimosthenis

    2013-01-01

    Acinetobacter baumannii clinical isolates have the ability to survive in the hospital niche for prolonged time periods and to develop resistance against multiple antimicrobial agents. Therefore, A. baumannii has emerged as an important cause of nosocomial outbreaks worldwide, especially in critical-care environments such as intensive care units. In the present communication, we report a multi-drug-resistant A. baumannii outbreak that occurred in an orthopedics department in Greece after the admission of a patient previously hospitalized in the intensive care unit of a Greek tertiary care hospital. Despite the implementation of infection control measures, 29 patients were infected, significantly raising their hospitalization periods and treatment costs. Interestingly, the outbreak was put under control after the department’s previously programmed relocation. PMID:27694769

  16. Ability of bacteriophage in resolving wound infection caused by multidrug-resistant Acinetobacter baumannii in uncontrolled diabetic rats.

    PubMed

    Shivaswamy, VinodKumar Chickmangalure; Kalasuramath, Suneeta Basavaraj; Sadanand, Chethan Kumar; Basavaraju, Abhishek Kilagere; Ginnavaram, Varsha; Bille, Sumanth; Ukken, Sanjay Saju; Pushparaj, Usha Nandini

    2015-04-01

    Acinetobacter baumannii, a substantial nosocomial pathogen, has developed resistance to almost all available antimicrobial drugs. Bacteriophage therapy is a possible alternative treatment for multidrug-resistant (MDR) bacterial infections. In this study, we have successfully isolated bacteriophage active against clinical strains of A. baumannii by enrichment from hospital sewage sludge using representatives of those strains. The bacteriophage isolated against A. baumannii formed plaques against beta-lactamases producing strains of A. baumannii. The utility of bacteriophage specific for A. baumannii to resolve wound infection in uncontrolled diabetic rats was evaluated. Five groups of uncontrolled diabetic rats were used. Group I was noninfected (Control), Group II was infected with MDR A. baumannii and challenged with bacteriophage, Group III was infected with MDR A. baumannii, Group IV was infected with MDR A. baumannii and challenged with antibiotic colistin, and Group V consisted of noninfected rats and sprayed with phage (Phage control). A significant decrease in infection, period of epithelization, and wound contraction was observed in the phage-challenged group when compared with antibiotic-treated uncontrolled diabetic rats and the control group. To conclude the study, new insights are provided into the biology of the broad host range of A. baumannii phage, demonstrating that A. baumannii phage has prospects for the treatment of infections caused by the MDR A. baumannii.

  17. Use of Comparative Genomics To Characterize the Diversity of Acinetobacter baumannii Surveillance Isolates in a Health Care Institution.

    PubMed

    Wallace, Lalena; Daugherty, Sean C; Nagaraj, Sushma; Johnson, J Kristie; Harris, Anthony D; Rasko, David A

    2016-10-01

    Despite the increasing prevalence of the nosocomial pathogen Acinetobacter baumannii, little is known about which genomic components contribute to clinical presentation of this important pathogen. Most whole-genome comparisons of A. baumannii have focused on specific genomic regions associated with phenotypes in a limited number of genomes. In this work, we describe the results of a whole-genome comparative analysis of 254 surveillance isolates of Acinetobacter species, 203 of which were A. baumannii, isolated from perianal swabs and sputum samples collected as part of an infection control active surveillance program at the University of Maryland Medical Center. The collection of surveillance isolates includes both carbapenem-susceptible and -resistant isolates. Based on the whole-genome phylogeny, the A. baumannii isolates collected belong to two major phylogenomic lineages. Results from multilocus sequence typing indicated that one of the major phylogenetic groups of A. baumannii was comprised solely of strains from the international clonal lineage 2. The genomic content of the A. baumannii isolates was examined using large-scale BLAST score ratio analysis to identify genes that are associated with carbapenem-susceptible and -resistant isolates, as well as genes potentially associated with the source of isolation. This analysis revealed a number of genes that were exclusive or at greater frequency in each of these classifications. This study is the most comprehensive genomic comparison of Acinetobacter isolates from a surveillance study to date and provides important information that will contribute to our understanding of the success of A. baumannii as a human pathogen.

  18. Survival of Acinetobacter baumannii on dry surfaces: comparison of outbreak and sporadic isolates.

    PubMed

    Jawad, A; Seifert, H; Snelling, A M; Heritage, J; Hawkey, P M

    1998-07-01

    Acinetobacter spp. are important nosocomial pathogens reported with increasing frequency in outbreaks of cross-infection during the past 2 decades. The majority of such outbreaks are caused by Acinetobacter baumannii. To investigate whether desiccation tolerance may be involved in the ability of certain strains of A. baumannii to cause hospital outbreaks, a blind study was carried out with 39 epidemiologically well-characterized clinical isolates of A. baumannii for which survival times were determined under simulated hospital conditions. The survival times on glass coverslips of 22 strains isolated from eight well-defined hospital outbreaks in a German metropolitan area were compared with the survival times of 17 sporadic strains not involved in outbreaks but rather isolated from inpatients in the same geographic area. All sporadic isolates have been shown by pulsed-field gel electrophoresis to represent different strain types. There was no statistically significant difference between the survival times of sporadic strains of A. baumannii and outbreak strains (27.2 versus 26.5 days, respectively; P < or = 0.44) by the Wilcoxon-Mann-Whitney test. All investigated A. baumannii strains, irrespective of their areas of endemicity or epidemic occurrence, have the ability to survive for a long time on dry surfaces. Antimicrobial susceptibility testing showed that A. baumannii outbreak strains were significantly more resistant to various broad-spectrum antimicrobial agents than sporadic strains. Both desiccation tolerance and multidrug resistance may contribute to their maintenance in the hospital setting and may explain in part their propensity to cause prolonged outbreaks of nosocomial infection.

  19. Characterisation and genome sequence of the lytic Acinetobacter baumannii bacteriophage vB_AbaS_Loki.

    PubMed

    Turner, Dann; Wand, Matthew E; Briers, Yves; Lavigne, Rob; Sutton, J Mark; Reynolds, Darren M

    2017-01-01

    Acinetobacter baumannii has emerged as an important nosocomial pathogen in healthcare and community settings. While over 100 of Acinetobacter phages have been described in the literature, relatively few have been sequenced. This work describes the characterisation and genome annotation of a new lytic Acinetobacter siphovirus, vB_AbaS_Loki, isolated from activated sewage sludge. Sequencing revealed that Loki encapsulates a 41,308 bp genome, encoding 51 predicted open reading frames. Loki is most closely related to Acinetobacter phage IME_AB3 and more distantly related to Burkholderia phage KL1, Paracoccus phage vB_PmaS_IMEP1 and Pseudomonas phages vB_Pae_Kakheti25, vB_PaeS_SCH_Ab26 and PA73. Loki is characterised by a narrow host range, among the 40 Acinetobacter isolates tested, productive infection was only observed for the propagating host, A. baumannii ATCC 17978. Plaque formation was found to be dependent upon the presence of Ca2+ ions and adsorption to host cells was abolished upon incubation with a mutant of ATCC 17978 encoding a premature stop codon in lpxA. The complete genome sequence of vB_AbaS_Loki was deposited in the European Nucleotide Archive (ENA) under the accession number LN890663.

  20. Characterisation and genome sequence of the lytic Acinetobacter baumannii bacteriophage vB_AbaS_Loki

    PubMed Central

    Wand, Matthew E.; Briers, Yves; Lavigne, Rob; Sutton, J. Mark; Reynolds, Darren M.

    2017-01-01

    Acinetobacter baumannii has emerged as an important nosocomial pathogen in healthcare and community settings. While over 100 of Acinetobacter phages have been described in the literature, relatively few have been sequenced. This work describes the characterisation and genome annotation of a new lytic Acinetobacter siphovirus, vB_AbaS_Loki, isolated from activated sewage sludge. Sequencing revealed that Loki encapsulates a 41,308 bp genome, encoding 51 predicted open reading frames. Loki is most closely related to Acinetobacter phage IME_AB3 and more distantly related to Burkholderia phage KL1, Paracoccus phage vB_PmaS_IMEP1 and Pseudomonas phages vB_Pae_Kakheti25, vB_PaeS_SCH_Ab26 and PA73. Loki is characterised by a narrow host range, among the 40 Acinetobacter isolates tested, productive infection was only observed for the propagating host, A. baumannii ATCC 17978. Plaque formation was found to be dependent upon the presence of Ca2+ ions and adsorption to host cells was abolished upon incubation with a mutant of ATCC 17978 encoding a premature stop codon in lpxA. The complete genome sequence of vB_AbaS_Loki was deposited in the European Nucleotide Archive (ENA) under the accession number LN890663. PMID:28207864

  1. Clinical isolates of Acinetobacter baumannii from a Portuguese hospital: PFGE characterization, antibiotic susceptibility and biofilm-forming ability.

    PubMed

    Duarte, Andreia; Ferreira, Susana; Almeida, Sofia; Domingues, Fernanda C

    2016-04-01

    Acinetobacter baumannii is an emerging pathogen associated with nosocomial infections that in addition has shown an increasing resistance to antibiotics. In this work the genetic diversity of A. baumannii isolates from a Portuguese hospital, their antibiotic resistance profiles and ability to form biofilms was studied. Seventy-nine clinical A. baumannii isolates were characterized by pulsed-field gel electrophoresis (PFGE) with 9 different PFGE profiles being obtained. Concerning the antimicrobial susceptibility, all A. baumannii isolates were resistant to 12 of the 17 tested antibiotics and classified as multidrug-resistant (MDR). In addition, 74.7% of the isolates showed biofilm formation ability, however no statistical significance with antibiotic resistance was observed. In contrast, urine samples isolates were more likely to form biofilms than strains isolated from other sources. Our findings highlight the high number of MDR A. baumannii isolates and the importance of the formation of biofilms as a potential virulence factor.

  2. [Emerging Acinetobacter baumannii infections and factors favouring their occurrence].

    PubMed

    Eveillard, M; Joly-Guillou, M-L

    2012-10-01

    During the last decade, Acinetobacter baumannii (AB) has been increasingly responsible for infections occurring in three particular contexts (in terms of patients and environment). Community AB pneumonia is severe infections, mainly described around the Indian Ocean, and which mainly concern patients with major co-morbidities. AB is also responsible for infections occurring among soldiers wounded in action during operations conducted in Iraq or Afghanistan. Lastly, this bacterium is responsible for infections occurring among casualties from natural disasters like earthquakes and tsunamis. Those infections are often due to multidrug-resistant strains, which can be implicated in nosocomial outbreaks when patients are hospitalized in a local casualty department or during their repatriation thereafter. The source of the contaminations which lead to AB infections following injuries (warfare or natural disasters) is still poorly known. Three hypotheses are usually considered: a contamination of wounds with environmental bacteria, a wound contamination from a previous cutaneous or oropharyngeal endogenous reservoir, or hospital acquisition. The implication of telluric or agricultural primary reservoirs in human AB infections is a common hypothesis which remains to be demonstrated by further specifically designed studies.

  3. Epidemiologic and clinical impact of Acinetobacter baumannii colonization and infection: a reappraisal.

    PubMed

    Villar, Macarena; Cano, María E; Gato, Eva; Garnacho-Montero, José; Miguel Cisneros, José; Ruíz de Alegría, Carlos; Fernández-Cuenca, Felipe; Martínez-Martínez, Luis; Vila, Jordi; Pascual, Alvaro; Tomás, María; Bou, Germán; Rodríguez-Baño, Jesús

    2014-07-01

    Acinetobacter baumannii is one of the most important antibiotic-resistant nosocomial bacteria. We investigated changes in the clinical and molecular epidemiology of A. baumannii over a 10-year period. We compared the data from 2 prospective multicenter cohort studies in Spain, one performed in 2000 (183 patients) and one in 2010 (246 patients), which included consecutive patients infected or colonized by A. baumannii. Molecular typing was performed by repetitive extragenic palindromic polymerase chain reaction (REP-PCR), pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). The incidence density of A. baumannii colonization or infection increased significantly from 0.14 in 2000 to 0.52 in 2010 in medical services (p < 0.001). The number of non-nosocomial health care-associated cases increased from 1.2% to 14.2%, respectively (p < 0.001). Previous exposure to carbapenems increased in 2010 (16.9% in 2000 vs 27.3% in 2010, p = 0.03). The drugs most frequently used for definitive treatment of patients with infections were carbapenems in 2000 (45%) and colistin in 2010 (50.3%). There was molecular-typing evidence of an increase in the frequency of A. baumannii acquisition in non-intensive care unit wards in 2010 (7.6% in 2000 vs 19.2% in 2010, p = 0.01). By MSLT, the ST2 clonal group predominated and increased in 2010. This epidemic clonal group was more frequently resistant to imipenem and was associated with an increased risk of sepsis, although not with severe sepsis or mortality. Some significant changes were noted in the epidemiology of A. baumannii, which is increasingly affecting patients admitted to conventional wards and is also the cause of non-nosocomial health care-associated infections. Epidemic clones seem to combine antimicrobial resistance and the ability to spread, while maintaining their clinical virulence.

  4. Translation Elongation Factor Tuf of Acinetobacter baumannii Is a Plasminogen-Binding Protein

    PubMed Central

    Koenigs, Arno; Zipfel, Peter F.; Kraiczy, Peter

    2015-01-01

    Acinetobacter baumannii is an important nosocomial pathogen, causing a variety of opportunistic infections of the skin, soft tissues and wounds, urinary tract infections, secondary meningitis, pneumonia and bacteremia. Over 63% of A. baumannii infections occurring in the United States are caused by multidrug resistant isolates, and pan-resistant isolates have begun to emerge that are resistant to all clinically relevant antibiotics. The complement system represents the first line of defense against invading pathogens. However, many A. baumannii isolates, especially those causing severe bacteremia are resistant to complement-mediated killing, though the underlying mechanisms remain poorly understood. Here we show for the first time that A. baumannii binds host-derived plasminogen and we identify the translation elongation factor Tuf as a moonlighting plasminogen-binding protein that is exposed on the outer surface of A. baumannii. Binding of plasminogen to Tuf is at least partly dependent on lysine residues and ionic interactions. Plasminogen, once bound to Tuf can be converted to active plasmin and proteolytically degrade fibrinogen as well as the key complement component C3b. Thus, Tuf acts as a multifunctional protein that may contribute to virulence of A. baumannii by aiding in dissemination and evasion of the complement system. PMID:26230848

  5. Unique Structural Modifications Are Present in the Lipopolysaccharide from Colistin-Resistant Strains of Acinetobacter baumannii

    PubMed Central

    Pelletier, Mark R.; Casella, Leila G.; Jones, Jace W.; Adams, Mark D.; Zurawski, Daniel V.; Hazlett, Karsten R. O.; Doi, Yohei

    2013-01-01

    Acinetobacter baumannii is a nosocomial opportunistic pathogen that can cause severe infections, including hospital-acquired pneumonia, wound infections, and sepsis. Multidrug-resistant (MDR) strains are prevalent, further complicating patient treatment. Due to the increase in MDR strains, the cationic antimicrobial peptide colistin has been used to treat A. baumannii infections. Colistin-resistant strains of A. baumannii with alterations to the lipid A component of lipopolysaccharide (LPS) have been reported; specifically, the lipid A structure was shown to be hepta-acylated with a phosphoethanolamine (pEtN) modification present on one of the terminal phosphate residues. Using a tandem mass spectrometry platform, we provide definitive evidence that the lipid A isolated from colistin-resistant A. baumannii MAC204 LPS contains a novel structure corresponding to a diphosphoryl hepta-acylated lipid A structure with both pEtN and galactosamine (GalN) modifications. To correlate our structural studies with clinically relevant samples, we characterized colistin-susceptible and -resistant isolates obtained from patients. These results demonstrated that the clinical colistin-resistant isolate had the same pEtN and GalN modifications as those seen in the laboratory-adapted A. baumannii strain MAC204. In summary, this work has shown complete structure characterization including the accurate assignment of acylation, phosphorylation, and glycosylation of lipid A from A. baumannii, which are important for resistance to colistin. PMID:23877686

  6. OmpW is a potential target for eliciting protective immunity against Acinetobacter baumannii infections.

    PubMed

    Huang, Weiwei; Wang, Shijie; Yao, Yufeng; Xia, Ye; Yang, Xu; Long, Qiong; Sun, Wenjia; Liu, Cunbao; Li, Yang; Ma, Yanbing

    2015-08-26

    Acinetobacter baumannii (A. baumannii) is an important conditioned pathogen that causes nosocomial and community-associated infections. In this study, we sought to investigate whether outer membrane protein W (OmpW) is a potential target for eliciting protective immunity against A. baumannii infections. Mice immunized with the fusion protein thioredoxin-OmpW generated strong OmpW-specific IgG responses. In a sepsis model, both active and passive immunizations against OmpW effectively protected mice from A. baumannii infections. This protection was demonstrated by a significantly improved survival rate, reduced bacterial burdens within organs, and the suppressed accumulation of inflammatory cytokines and chemokines in sera. Opsonophagocytic assays with murine macrophage RAW264.7 cells indicated that the bactericidal effects of the antisera derived from the immunized mice are mediated synergistically by specific antibodies and complement components. The antisera presented significant opsonophagocytic activities against homologous strains and clonally distinct clinical isolates in vitro. Protein data analysis showed that the sequence of OmpW, which has a molecule length of 183 amino acids, is more than 91% conserved in reported A. baumannii strains. In conclusion, we identified OmpW as a highly immunogenic and conserved protein as a valuable antigen candidate for the development of an effective vaccine or the preparation of antisera to control A. baumannii infections.

  7. Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates.

    PubMed

    Rasoulinejad, Samaneh; Gargari, Seyed Latif Mousavi

    2016-08-10

    Acinetobacter baumannii has turned into an important threat in nosocomial outbreak infections and multidrug resistance leading to high mortality rates in the 21st century. In recent years its mortality has increased by 15% which in part could be due to lack of a rapid and sensitive diagnostic test. In this work we introduced a new detection test for A. baumannii with two highly specific aptamer and nanobody molecules. High binding affinity DNA oligonucleotide aptamers toward A. baumannii were selected through 12 rounds of whole cell System Evolution of Ligands by EXponential enrichment process (SELEX). The SELEX procedures was monitored by flow cytometry. The dissociation constant and binding efficiency of the selected aptamer Aci49 was 7.547±1:353pM and 47.50%, respectively. A sandwich enzyme linked aptamer sorbent assay (ELASA) was designed with the biotinylated Aci49 aptamer and our previously developed nanobody against biofilm associated protein (Bap). The assay system was optimized with A. baumannii (ATCC 19606) and 47 clinical isolates of A. baumannii were tested. The threshold of detection in sandwich ELASA process was10(3) CFU/ml. The sensitivity of test toward the clinical isolates was 95.47%. Our results reveal that the sandwich ELASA is sensitive and specific enough for the rapid detection of A. baumannii from clinical isolates.

  8. Role of macrophages in early host resistance to respiratory Acinetobacter baumannii infection.

    PubMed

    Qiu, Hongyu; KuoLee, Rhonda; Harris, Greg; Van Rooijen, Nico; Patel, Girishchandra B; Chen, Wangxue

    2012-01-01

    Acinetobacter baumannii is an emerging bacterial pathogen that causes nosocomial pneumonia and other infections. Although it is recognized as an increasing threat to immunocompromised patients, the mechanism of host defense against A. baumannii infection remains poorly understood. In this study, we examined the potential role of macrophages in host defense against A. baumannii infection using in vitro macrophage culture and the mouse model of intranasal (i.n.) infection. Large numbers of A. baumannii were taken up by alveolar macrophages in vivo as early as 4 h after i.n. inoculation. By 24 h, the infection induced significant recruitment and activation (enhanced expression of CD80, CD86 and MHC-II) of macrophages into bronchoalveolar spaces. In vitro cell culture studies showed that A. baumannii were phagocytosed by J774A.1 (J774) macrophage-like cells within 10 minutes of co-incubation, and this uptake was microfilament- and microtubule-dependent. Moreover, the viability of phagocytosed bacteria dropped significantly between 24 and 48 h after co-incubation. Infection of J774 cells by A. baumannii resulted in the production of large amounts of proinflammatory cytokines and chemokines, and moderate amounts of nitric oxide (NO). Prior treatment of J774 cells with NO inhibitors significantly suppressed their bactericidal efficacy (P<0.05). Most importantly, in vivo depletion of alveolar macrophages significantly enhanced the susceptibility of mice to i.n. A. baumannii challenge (P<0.01). These results indicate that macrophages may play an important role in early host defense against A. baumannii infection through the efficient phagocytosis and killing of A. baumannii to limit initial pathogen replication and the secretion of proinflammatory cytokines and chemokines for the rapid recruitment of other innate immune cells such as neutrophils.

  9. CipA of Acinetobacter baumannii Is a Novel Plasminogen Binding and Complement Inhibitory Protein.

    PubMed

    Koenigs, Arno; Stahl, Julia; Averhoff, Beate; Göttig, Stephan; Wichelhaus, Thomas A; Wallich, Reinhard; Zipfel, Peter F; Kraiczy, Peter

    2016-05-01

    Acinetobacter baumannii is an emerging opportunistic pathogen, responsible for up to 10% of gram-negative, nosocomial infections. The global increase of multidrug-resistant and pan-resistant Acinetobacter isolates presents clinicians with formidable challenges. To establish a persistent infection,A. baumannii must overcome the detrimental effects of complement as the first line of defense against invading microorganisms. However, the immune evasion principles underlying serum resistance inA. baumannii remain elusive. Here, we identified a novel plasminogen-binding protein, termed CipA. Bound plasminogen, upon conversion to active plasmin, degraded fibrinogen and complement C3b and contributed to serum resistance. Furthermore, CipA directly inhibited the alternative pathway of complement in vitro, irrespective of its ability to bind plasminogen. A CipA-deficient mutant was efficiently killed by human serum and showed a defect in the penetration of endothelial monolayers, demonstrating that CipA is a novel multifunctional protein that contributes to the pathogenesis ofA. baumannii.

  10. Inactivation of Phospholipase D Diminishes Acinetobacter baumannii Pathogenesis▿ †

    PubMed Central

    Jacobs, Anna C.; Hood, Indriati; Boyd, Kelli L.; Olson, Patrick D.; Morrison, John M.; Carson, Steven; Sayood, Khalid; Iwen, Peter C.; Skaar, Eric P.; Dunman, Paul M.

    2010-01-01

    Acinetobacter baumannii is an emerging bacterial pathogen of considerable health care concern. Nonetheless, relatively little is known about the organism's virulence factors or their regulatory networks. Septicemia and ventilator-associated pneumonia are two of the more severe forms of A. baumannii disease. To identify virulence factors that may contribute to these disease processes, genetically diverse A. baumannii clinical isolates were evaluated for the ability to proliferate in human serum. A transposon mutant library was created in a strain background that propagated well in serum and screened for members with decreased serum growth. The results revealed that disruption of A. baumannii phospholipase D (PLD) caused a reduction in the organism's ability to thrive in serum, a deficiency in epithelial cell invasion, and diminished pathogenesis in a murine model of pneumonia. Collectively, these results suggest that PLD is an A. baumannii virulence factor. PMID:20194595

  11. Multidrug-Resistant Acinetobacter baumannii Harboring OXA-24 Carbapenemase, Spain

    PubMed Central

    Acosta, Joshi; Merino, María; Viedma, Esther; Poza, Margarita; Sanz, Francisca; Otero, Joaquín R.; Chaves, Fernando

    2011-01-01

    In February 2006, a patient colonized with a multidrug-resistant sequence type 56 Acinetobacter baumannii strain was admitted to a hospital in Madrid, Spain. This strain spread rapidly and caused a large outbreak in the hospital. Clinicians should be alert for this strain because its spread would have serious health consequences. PMID:21749771

  12. Photodynamic Therapy for Acinetobacter baumannii Burn Infections in Mice

    DTIC Science & Technology

    2009-06-29

    Acinetobacter baumannii Burn Infections in Mice Tianhong Dai,1,2 George P. Tegos,1,2 Zongshun Lu,1,3 Liyi Huang,1,2,4 Timur Zhiyentayev,1,5 Michael J...Agents Che- mother. 50:1402–1410. 28. Vallenet, D., P. Nordmann, V. Barbe, L. Poirel, S. Mangenot, E. Bataille , C. Dossat, S. Gas, A. Kreimeyer, P

  13. Molecular Epidemiology of Multi-Drug Resistant Acinetobacter baumannii Isolated in Shandong, China

    PubMed Central

    Jiang, Meijie; Liu, Lijuan; Ma, Yunhua; Zhang, Zhijun; Li, Ning; Zhang, Fusen; Zhao, Shuping

    2016-01-01

    Acinetobacter baumannii is an emerging nosocomial pathogen prevalent in hospitals worldwide. In order to understand the molecular epidemiology of multi-drug resistant (MDR) A. baumannii, we investigated the genotypes of A. baumannii isolated from 10 hospitals in Shandong, China, from August 2013 to December 2013, by pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Antimicrobial resistance genes were analyzed by PCR and DNA sequencing. By PFGE analysis, we discovered 11 PFGE types in these 10 hospitals. By MLST, we assigned these isolates to 12 sequence types (STs), 10 of which belong to the cloning complex CC92, including the prevalent ST369, ST208, ST195, and ST368. Two new STs, namely ST794 and ST809, were detected only in one hospital. All isolates of the MDR A. baumannii were resistant to carbapenem, except 2 isolates, which did not express the blaOXA-23 carbapenemase gene, indicating blaOXA-23 is the major player for carbapenem resistance. We also discovered armA is likely to be responsible for amikacin resistance, and may play a role in gentamicin and tobramycin resistance. aac(3)-I is another gene responsible for gentamicin and tobramycin resistance. In summary, we discovered that the majority of the isolates in Shandong, China, were the STs belonging to the CC92. Besides, two new STs were detected in one hospital. These new STs should be further investigated for prevention of outbreaks caused by A. baumannii. PMID:27818659

  14. Prevalence of OXA-type β-lactamases among Acinetobacter baumannii isolates from Northwest of Iran.

    PubMed

    Sohrabi, Nasrollah; Farajnia, Safar; Akhi, Mohammad Taghi; Nahaei, Mohammad Reza; Naghili, Behrooz; Peymani, Amir; Amiri, Zohreh; Rezaee, Mohammad Ahangarzadeh; Saeedi, Nazli

    2012-08-01

    Carbapenems have been considered as last line antibiotics for treatment of multidrug-resistant (MDR) Acinetobacter baumannii but carbapenem resistant A. baumannii has been increased during the last decade in many parts of the world. OXA-type β-lactamase enzymes are the most common cause of carbapenem resistance in A. baumannii and presence of ISAba1 in upstream of these genes may increase the expression of these OXA genes. The aim of this study was to determine, for the first time, the antibiotic resistance pattern and prevalence of OXA type β-lactamases among nosocomial A. baumannii isolates from northwest of Iran. A total of 100 A. baumannii isolates were recovered from hospitalized patients in a university hospital in northwest of Iran. Sixty-two percent of isolates were resistant to imipenem. All isolates carried bla(OXA-51)-like gene. Among imipenem resistant isolates, 88.7% carried bla(OXA-23)-like, 1.6% carried bla(OXA-40)-like, and 3.2% had bla(OXA-58)-like resistance genes. Ninety percent of isolates contained ISAba1 element and in 74.2% of imipenem resistant isolates, ISAba1 was located in upstream of bla(OXA-23)-like. The results of this study demonstrated high prevalence of OXA-type carbapenemase among MDR A. bumanii in the Northwest of Iran.

  15. Widespread dispersion of the resistance element tet(B)::ISCR2 in XDR Acinetobacter baumannii isolates.

    PubMed

    Vilacoba, E; Almuzara, M; Gulone, L; Traglia, G M; Montaña, S; Rodríguez, H; Pasteran, F; Pennini, M; Sucari, A; Gómez, N; Fernández, A; Centrón, D; Ramírez, M S

    2016-05-01

    Acinetobacter baumannii is a significant nosocomial pathogen often associated with extreme drug resistance (XDR). In Argentina, isolates of A. baumannii resistant to tetracyclines have accounted for more than 40% of drug-resistant isolates in some hospitals. We have previously reported the dispersion of the tet(B) resistance element associated with the ISCR2 transposase in epidemiologically unrelated A. baumannii isolates recovered from 1983 to 2011. This study extends this surveillance to 77 recent (2009-2013) XDR A. baumannii isolates with different levels of minocycline susceptibility. Isolates were examined by a pan-PCR assay, which showed six different amplification patterns, and specific PCRs were used for the confirmation of the the ΔISCR2-tet(B)-tet(R)-ISCR2 element. The tet(B) gene was present in 66 isolates and the ISCR2 element in 68 isolates; the tet(B) gene was associated with ISCR2 in all tet(B)-positive isolates. We conclude that this element is widespread in XDR A. baumannii isolates from Argentina and could be responsible for the emergence of tetracycline resistance in recent years.

  16. Novel Engineered Peptides of a Phage Lysin as Effective Antimicrobials against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Thandar, Mya; Lood, Rolf; Winer, Benjamin Y.; Deutsch, Douglas R.; Euler, Chad W.

    2016-01-01

    Acinetobacter baumannii is a Gram-negative bacterial pathogen responsible for a range of nosocomial infections. The recent rise and spread of multidrug-resistant A. baumannii clones has fueled a search for alternative therapies, including bacteriophage endolysins with potent antibacterial activities. A common feature of these lysins is the presence of a highly positively charged C-terminal domain with a likely role in promoting outer membrane penetration. In the present study, we show that the C-terminal amino acids 108 to 138 of phage lysin PlyF307, named P307, alone were sufficient to kill A. baumannii (>3 logs). Furthermore, P307 could be engineered for improved activity, the most active derivative being P307SQ-8C (>5-log kill). Both P307 and P307SQ-8C showed high in vitro activity against A. baumannii in biofilms. Moreover, P307SQ-8C exhibited MICs comparable to those of levofloxacin and ceftazidime and acted synergistically with polymyxin B. Although the peptides were shown to kill by disrupting the bacterial cytoplasmic membrane, they did not lyse human red blood cells or B cells; however, serum was found to be inhibitory to lytic activity. In a murine model of A. baumannii skin infection, P307SQ-8C reduced the bacterial burden by ∼2 logs in 2 h. This study demonstrates the prospect of using peptide derivatives from bacteriophage lysins to treat topical infections and remove biofilms caused by Gram-negative pathogens. PMID:26856847

  17. Rapid Killing of Acinetobacter baumannii by Polymyxins Is Mediated by a Hydroxyl Radical Death Pathway

    PubMed Central

    Sampson, Timothy R.; Liu, Xiang; Schroeder, Max R.; Kraft, Colleen S.; Burd, Eileen M.

    2012-01-01

    Acinetobacter baumannii is an opportunistic pathogen that is a cause of clinically significant nosocomial infections. Increasingly, clinical isolates of A. baumannii are extensively resistant to numerous antibiotics, and the use of polymyxin antibiotics against these infections is often the final treatment option. Historically, the polymyxins have been thought to kill bacteria through membrane lysis. Here, we present an alternative mechanism based on data demonstrating that polymyxins induce rapid cell death through hydroxyl radical production. Supporting this notion, we found that inhibition of radical production delays the ability of polymyxins to kill A. baumannii. Notably, we demonstrate that this mechanism of killing occurs in multidrug-resistant clinical isolates of A. baumannii and that this response is not induced in a polymyxin-resistant isolate. This study is the first to demonstrate that polymyxins induce rapid killing of A. baumannii and other Gram-negatives through hydroxyl radical production. This significantly augments our understanding of the mechanism of polymyxin action, which is critical knowledge toward the development of adjunctive therapies, particularly given the increasing necessity for treatment with these antibiotics in the clinical setting. PMID:22908157

  18. Rapid killing of Acinetobacter baumannii by polymyxins is mediated by a hydroxyl radical death pathway.

    PubMed

    Sampson, Timothy R; Liu, Xiang; Schroeder, Max R; Kraft, Colleen S; Burd, Eileen M; Weiss, David S

    2012-11-01

    Acinetobacter baumannii is an opportunistic pathogen that is a cause of clinically significant nosocomial infections. Increasingly, clinical isolates of A. baumannii are extensively resistant to numerous antibiotics, and the use of polymyxin antibiotics against these infections is often the final treatment option. Historically, the polymyxins have been thought to kill bacteria through membrane lysis. Here, we present an alternative mechanism based on data demonstrating that polymyxins induce rapid cell death through hydroxyl radical production. Supporting this notion, we found that inhibition of radical production delays the ability of polymyxins to kill A. baumannii. Notably, we demonstrate that this mechanism of killing occurs in multidrug-resistant clinical isolates of A. baumannii and that this response is not induced in a polymyxin-resistant isolate. This study is the first to demonstrate that polymyxins induce rapid killing of A. baumannii and other Gram-negatives through hydroxyl radical production. This significantly augments our understanding of the mechanism of polymyxin action, which is critical knowledge toward the development of adjunctive therapies, particularly given the increasing necessity for treatment with these antibiotics in the clinical setting.

  19. Genome-wide recombination drives diversification of epidemic strains of Acinetobacter baumannii.

    PubMed

    Snitkin, Evan S; Zelazny, Adrian M; Montero, Clemente I; Stock, Frida; Mijares, Lilia; Murray, Patrick R; Segre, Julie A

    2011-08-16

    Acinetobacter baumannii is an emerging human pathogen and a significant cause of nosocomial infections among hospital patients worldwide. The enormous increase in multidrug resistance among hospital isolates and the recent emergence of pan-drug-resistant strains underscores the urgency to understand how A. baumannii evolves in hospital environments. To this end, we undertook a genomic study of a polyclonal outbreak of multidrug-resistant A. baumannii at the research-based National Institutes of Health Clinical Center. Comparing the complete genome sequences of the three dominant outbreak strain types enabled us to conclude that, despite all belonging to the same epidemic lineage, the three strains diverged before their arrival at the National Institutes of Health. The simultaneous presence of three divergent strains from this lineage supports its increasing prevalence in international hospitals and suggests an ongoing adaptation to the hospital environment. Further genomic comparisons uncovered that much of the diversification that occurred since the divergence of the three outbreak strains was mediated by homologous recombination across 20% of their genomes. Inspection of recombinant regions revealed that several regions were associated with either the loss or swapping out of genes encoding proteins that are exposed to the cell surface or that synthesize cell-surface molecules. Extending our analysis to a larger set of international clinical isolates revealed a previously unappreciated ability of A. baumannii to vary surface molecules through horizontal gene transfer, with subsequent intraspecies dissemination by homologous recombination. These findings have immediate implications in surveillance, prevention, and treatment of A. baumannii infections.

  20. Deciphering the Multifactorial Nature of Acinetobacter baumannii Pathogenicity

    PubMed Central

    Antunes, Luísa C. S.; Imperi, Francesco; Carattoli, Alessandra; Visca, Paolo

    2011-01-01

    Background Acinetobacter baumannii is an emerging bacterial pathogen that causes a broad array of infections, particularly in hospitalized patients. Many studies have focused on the epidemiology and antibiotic resistance of A. baumannii, but little is currently known with respect to its virulence potential. Methodology/Principal Findings The aim of this work was to analyze a number of virulence-related traits of four A. baumannii strains of different origin and clinical impact for which complete genome sequences were available, in order to tentatively identify novel determinants of A. baumannii pathogenicity. Clinical strains showed comparable virulence in the Galleria mellonella model of infection, irrespective of their status as outbreak or sporadic strains, whereas a non-human isolate was avirulent. A combined approach of genomic and phenotypic analyses led to the identification of several virulence factors, including exoproducts with hemolytic, phospholipase, protease and iron-chelating activities, as well as a number of multifactorial phenotypes, such as biofilm formation, surface motility and stress resistance, which were differentially expressed and could play a role in A. baumannii pathogenicity. Conclusion/Significance This work provides evidence of the multifactorial nature of A. baumannii virulence. While A. baumannii clinical isolates could represent a selected population of strains adapted to infect the human host, subpopulations of highly genotypically and phenotypically diverse A. baumannii strains may exist outside the hospital environment, whose relevance and distribution deserve further investigation. PMID:21829642

  1. Antimicrobial susceptibility pattern in nosocomial infections caused by Acinetobacter species in Asir Region, Saudi Arabia.

    PubMed

    Abdalla, Nazar M; Osman, Amani A; Haimour, Waleed O; Sarhan, Mohammed A A; Mohammed, Mohammed N; Zyad, Eyhab M; Al-Ghtani, Abdalla M

    2013-03-15

    This study aimed at evaluating the sensitivity of antibiotics towards nosocomial infections caused by Acinetobacter species. The study took place during the period Dec. 2011- Dec. 2012 at Assir Central Hospital in collaboration with the department of microbiology, college of medicine, King Khalid University, Abha. A prospective study involving 150 patients presented with nosocomial infections due to Acinetobacter species detected by bacteriological tests; direct microscopy, culture in blood agar media, fermentation test in MacConkey media and MIC (minimum inhibitory concentration) for antibiotics sensitivity using Muller Hinton media and Chemical test using API 20. A 150 nosocomial infections in this study showed gram-negative coccobacilli, non motile, glucose-negative fermentor and oxidase negative. All isolates showed 100% sensitivity to: Imipramine, Meropenem, Colistin. From the rest of tested antibiotics the higher resistant ones were; Nitrofurantoin 87% and Cefoxitin 85%. The least resistant antibiotics; Imipenem 3% and Ticarcillin 7%. While variable resistance in the rest of tested antimicrobials. A 47 patients (31.3%) have used antibiotics prior to this study. The high rate of usage occurred in elder patients. The frequency of Acinetobacter calcoaceticus baumannii complex multi-drugs resistance ABCMDR is rising including almost all commonly used antibiotics. Only few antibiotics exert 100% sensitivity towards these bacteria.

  2. Biofilm Formation and Motility Depend on the Nature of the Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Vijayakumar, Saranya; Rajenderan, Sangeetha; Laishram, Shakti; Anandan, Shalini; Balaji, Veeraraghavan; Biswas, Indranil

    2016-01-01

    Acinetobacter baumannii is a nosocomial pathogen involved in various infections ranging from minor soft-tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia. The severity and the type of infections depend on the genetic and phenotypic variations of the strains. In this study, we compared the extent of biofilm formation and motility displayed by 60 multidrug-resistant A. baumannii clinical strains isolated from blood and sputum samples from patients from Southern India. Our results showed that isolates from the sputum samples formed significantly more robust biofilm compared to the blood isolates. On the other hand, we observed that the blood isolates were more motile than the sputum isolates. To the best of our knowledge, this is the first study that systematically evaluated the correlation between these two phenotypic traits and the nature of the isolates. PMID:27252939

  3. Characterization of blaOXA-143 variants in Acinetobacter baumannii and Acinetobacter pittii.

    PubMed

    Zander, Esther; Bonnin, Rémy A; Seifert, Harald; Higgins, Paul G

    2014-05-01

    The acquired carbapenem-hydrolyzing oxacillinase (OXA) OXA-143 has thus far been detected only in Acinetobacter baumannii isolates from Brazil. The aim of this study was to characterize three OXA-143 variants: OXA-231 and OXA-253 from carbapenem-resistant A. baumannii isolates and OXA-255 in a carbapenem-susceptible Acinetobacter pittii isolate originating from Brazil, Honduras, and the United States, respectively. The 5' rapid amplification of cDNA ends (RACE) technique identified the same transcription initiation site for all blaOXA-143-like genes and revealed differences in the putative promoter regions. However, all cloned OXA-143 variants conferred carbapenem resistance on A. baumannii ATCC 17978 and OXA-255 conferred carbapenem resistance on A. pittii SH024, which was correlated with blaOXA-255 gene expression. This is the first description of OXA-143-like outside A. baumannii. Detection of OXA-143-like in the United States and Honduras indicates its dissemination through the American continent.

  4. Acinetobacter baumannii Infection and IL-17 Mediated Immunity

    PubMed Central

    Yan, Zihe; Yang, Junjun; Hu, Renjing; Hu, Xichi; Chen, Kong

    2016-01-01

    Acinetobacter baumannii is a significant cause of severe hospital-acquired infections with a recent rise in multidrug-resistant infections involving traumatic wounds of military personnel. The interleukin-17 (IL-17) pathway is essential for neutrophil recruitment in response to a variety of pathogens, while the control of A. baumannii infection is known to be dependent on neutrophils. This suggests that IL-17 may play an important role in A. baumannii infection; however, this has yet to be studied. Here, we summarize the recent advances in understanding the host-pathogen interaction of A. baumannii and propose a potential role of the IL-17 pathway in generating a protective immune response. PMID:26977122

  5. Surface-associated motility, a common trait of clinical isolates of Acinetobacter baumannii, depends on 1,3-diaminopropane.

    PubMed

    Skiebe, Evelyn; de Berardinis, Véronique; Morczinek, Peter; Kerrinnes, Tobias; Faber, Franziska; Lepka, Daniela; Hammer, Bettina; Zimmermann, Ortrud; Ziesing, Stefan; Wichelhaus, Thomas A; Hunfeld, Klaus-Peter; Borgmann, Stefan; Gröbner, Sabine; Higgins, Paul G; Seifert, Harald; Busse, Hans-Jürgen; Witte, Wolfgang; Pfeifer, Yvonne; Wilharm, Gottfried

    2012-07-01

    While flagella-independent motility has long been described in representatives of the genus Acinetobacter, the mechanism of motility remains ambiguous. Acinetobacter baumannii, a nosocomial pathogen appearing increasingly multidrug-resistant, may profit from motility during infection or while persisting in the hospital environment. However, data on the frequency of motility skills among clinical A. baumannii isolates is scarce. We have screened a collection of 83 clinical A. baumannii isolates of different origin and found that, with the exception of one isolate, all were motile on wet surfaces albeit to varying degrees and exhibiting differing morphologies. Screening a collection of transposon mutants of strain ATCC 17978 for motility defects, we identified 2 akinetic mutants carrying transposon insertions in the dat and ddc gene, respectively. These neighbouring genes contribute to synthesis of 1,3-diaminopropane (DAP), a polyamine ubiquitously produced in Acinetobacter. Supplementing semi-solid media with DAP cured the motility defect of both mutants. HPLC analyses confirmed that DAP synthesis was abolished in ddc and dat mutants of different A. baumannii isolates and was re-established after genetic complementation. Both, the dat and ddc mutant of ATCC 17978 were attenuated in the Galleria mellonella caterpillar infection model. Taken together, surface-associated motility is a common trait of clinical A. baumannii isolates that requires DAP and may play a role in its virulence.

  6. OmpA Binding Mediates the Effect of Antimicrobial Peptide LL-37 on Acinetobacter baumannii

    PubMed Central

    Lin, Ming-Feng; Tsai, Pei-Wen; Chen, Jeng-Yi; Lin, Yun-You; Lan, Chung-Yu

    2015-01-01

    Multidrug-resistant Acinetobacter baumannii has recently emerged as an important pathogen in nosocomial infection; thus, effective antimicrobial regimens are urgently needed. Human antimicrobial peptides (AMPs) exhibit multiple functions and antimicrobial activities against bacteria and fungi and are proposed to be potential adjuvant therapeutic agents. This study examined the effect of the human cathelicidin-derived AMP LL-37 on A. baumannii and revealed the underlying mode of action. We found that LL-37 killed A. baumannii efficiently and reduced cell motility and adhesion. The bacteria-killing effect of LL-37 on A. baumannii was more efficient compared to other AMPs, including human ß–defensin 3 (hBD3) and histatin 5 (Hst5). Both flow cytometric analysis and immunofluorescence staining showed that LL-37 bound to A. baumannii cells. Moreover, far-western analysis demonstrated that LL-37 could bind to the A. baumannii OmpA (AbOmpA) protein. An ELISA assay indicated that biotin-labelled LL-37 (BA-LL37) bound to the AbOmpA74-84 peptide in a dose-dependent manner. Using BA-LL37 as a probe, the ~38 kDa OmpA signal was detected in the wild type but the ompA deletion strain did not show the protein, thereby validating the interaction. Finally, we found that the ompA deletion mutant was more sensitive to LL-37 and decreased cell adhesion by 32% compared to the wild type. However, ompA deletion mutant showed a greatly reduced adhesion defect after LL-37 treatment compared to the wild strain. Taken together, this study provides evidence that LL-37 affects A. baumannii through OmpA binding. PMID:26484669

  7. A rapid and simple method for constructing stable mutants of Acinetobacter baumannii

    PubMed Central

    2010-01-01

    Background Acinetobacter baumannii is a multidrug-resistant bacterium responsible for nosocomial infections in hospitals worldwide. Study of mutant phenotypes is fundamental for understanding gene function. The methodologies developed to inactivate A. baumannii genes are complicated and time-consuming; sometimes result in unstable mutants, and do not enable construction of double (or more) gene knockout mutant strains of A. baumannii. Results We describe here a rapid and simple method of obtaining A. baumannii mutants by gene replacement via double crossover recombination, by use of a PCR product that carries an antibiotic resistance cassette flanked by regions homologous to the target locus. To demonstrate the reproducibility of the approach, we produced mutants of three different chromosomal genes (omp33, oxyR, and soxR) by this method. In addition, we disrupted one of these genes (omp33) by integration of a plasmid into the chromosome by single crossover recombination, the most widely used method of obtaining A. baumannii mutants. Comparison of the different techniques revealed absolute stability when the gene was replaced by a double recombination event, whereas up to 40% of the population reverted to wild-type when the plasmid was disrupting the target gene after 10 passages in broth without selective pressure. Moreover, we demonstrate that the combination of both gene disruption and gene replacement techniques is an easy and useful procedure for obtaining double gene knockout mutants in A. baumannii. Conclusions This study provides a rapid and simple method of obtaining stable mutants of A. baumannii free of foreign plasmidic DNA, which does not require cloning steps, and enables construction of multiple gene knockout mutants. PMID:21062436

  8. Intravesical colistin irrigation to treat multidrug-resistant Acinetobacter baumannii urinary tract infection: a case report

    PubMed Central

    2012-01-01

    Introduction Acinetobacter baumannii is a Gram-negative bacteria and a significant nosocomial pathogen in hospitals. Multidrug-resistant A. baumannii have emerged as a cause of nosocomial infections in critically ill patients. This microorganism has the ability to produce biofilms on different surfaces, which could explain their ability to persist in clinical environments and their role in device-related infections. Case presentation We present the case of a 33-year-old Hispanic man with local invasive retroperitoneal leiomyosarcoma and right kidney exclusion along with femoral venous thrombosis, who was admitted for tumor resection. He had been receiving multiple nephrotoxic antibiotics for a long time (including tigecycline and colistimethate sodium) and had a persistent urinary infection related to multidrug-resistant A. baumannii (with susceptibility to colistimethate). Colistimethate was administered through a three-lumen urinary device for continuous urinary irrigation over seven days. Our patient did not refer to any adverse effects. A urine culture control taken at the end of the irrigation and another taken 10 days later were negative. Conclusion Colistimethate sodium and other antimicrobials infused by urinary irrigation can be a good option in patients in whom parenteral administration could be toxic. PMID:23273314

  9. Comparative Evaluation of Four Phenotypic Tests for Detection of Metallo-β-Lactamase and Carbapenemase Production in Acinetobacter baumannii

    PubMed Central

    Shivaprasad, Aparna; Shenoy, Poornima

    2014-01-01

    Introduction: Acinetobacter baumannii is an emerging multi-drug resistant opportunistic pathogen that causes a variety of nosocomial infections. In recent years, carbapenem resistance in A.baumannii has increased due to Ambler class B Metallo β-lactamases or class D OXA Carbapenemases. Objective: The present study was undertaken to detect and compare the various phenotypic methods for MBL production in nosocomial A.baumannii isolates. Materials and Methods: One hundred sixty eight A.baumannii isolates were subjected to disc diffusion assay. Imipenem resistant isolates were subjected to 4 different phenotypic tests. MBL screening was done by Imipenem-EDTA double disc synergy test, Imipenem-EDTA combined disc test, Modified Hodge test and MBL E-test. Results: Out of 168 A.baumannii isolates, 85 (50.59%) were imipenem resistant. Among these 85 isolates, 57 (67.05%) were MBL positive by DDST, 69 (81.18%) by CDT, 85 (100%) by MHT and all these 85 isolates were confirmed to be MBL positive by MBL E-test method. Conclusion: Combined disc test, Modified Hodge test & E-test are equally effective to detect MBL production. However, considering the cost constraints of E-test, simple MHT and CDT can be used. They are easy, economical and can be incorporated into routine testing in laboratories to monitor the emergence of MBLs in MDR A.baumannii. PMID:24995173

  10. Acinetobacter baumannii: An Emerging and Important Pathogen

    PubMed Central

    Alsan, Marcella; Klompas, Michael

    2016-01-01

    Objective To review the clinical significance, management, and control of Acinetobacter infections. Methods Literature review. Results Acinetobacter infections have become a major cause of hospital-acquired infections worldwide. Acinetobacter is noted for its ability to survive for long periods on hospital surfaces and equipment, its predilection to develop resistance to multiple antibiotics, its affinity to cause serious infections in critically ill patients, and many well described outbreaks attributable to contamination of a common source. The crude ICU mortality is approximately 40%. Rigorous antibiotic stewardship and infection control measures are critical to prevent the spread of multidrug-resistant Acinetobacter infections. There is also a pressing need for new therapeutic options. Conclusion Acinetobacter is an emerging pathogen of increasing significance. PMID:26966345

  11. Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-resistant A. baumannii in two comprehensive hospitals of Beijing, China.

    PubMed

    Li, Puyuan; Niu, Wenkai; Li, Huan; Lei, Hong; Liu, Wei; Zhao, Xiangna; Guo, Leijing; Zou, Dayang; Yuan, Xin; Liu, Huiying; Yuan, Jing; Bai, Changqing

    2015-01-01

    Acinetobacter baumannii is an important opportunistic pathogen associated with a variety of nosocomial infections. A rapid and sensitive molecular detection in clinical isolates is quite needed for the appropriate therapy and outbreak control of A. baumannii. Group 2 carbapenems have been considered the agents of choice for the treatment of multiple drug-resistant A. baumannii. But the prevalence of carbapenem-resistant A. baumannii (CRAB) has been steadily increasing in recent years. Here, we developed a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of A. baumannii in clinical samples by using high-specificity primers of the bla OXA-51 gene. Then we investigated the OXA-carbapenemases molecular epidemiology of A. baumannii isolates in two comprehensive hospitals in Beijing. The results showed that the LAMP assay could detect target DNA within 60 min at 65°C. The detection limit was 50 pg/μl, which was about 10-fold greater than that of PCR. Furthermore, this method could distinguish A. baumannii from the homologous A. nosocomialis and A. pittii. A total of 228 positive isolates were identified by this LAMP-based method for A. baumannii from 335 intensive care unit patients with clinically suspected multi-resistant infections in two hospitals in Beijing. The rates of CRAB are on the rise and are slowly becoming a routine phenotype for A. baumannii. Among the CRABs, 92.3% harbored both the bla OXA-23 and bla OXA-51 genes. Thirty-three pulsotypes were identified by pulsed-field gel electrophoresis, and the majority belonged to clone C. In conclusion, the LAMP method developed for detecting A. baumannii was faster and simpler than conventional PCR and has great potential for both point-of-care testing and basic research. We further demonstrated a high distribution of class D carbapenemase-encoding genes, mainly OXA-23, which presents an emerging threat in hospitals in China.

  12. Rapid detection of Acinetobacter baumannii and molecular epidemiology of carbapenem-resistant A. baumannii in two comprehensive hospitals of Beijing, China

    PubMed Central

    Li, Puyuan; Niu, Wenkai; Li, Huan; Lei, Hong; Liu, Wei; Zhao, Xiangna; Guo, Leijing; Zou, Dayang; Yuan, Xin; Liu, Huiying; Yuan, Jing; Bai, Changqing

    2015-01-01

    Acinetobacter baumannii is an important opportunistic pathogen associated with a variety of nosocomial infections. A rapid and sensitive molecular detection in clinical isolates is quite needed for the appropriate therapy and outbreak control of A. baumannii. Group 2 carbapenems have been considered the agents of choice for the treatment of multiple drug-resistant A. baumannii. But the prevalence of carbapenem-resistant A. baumannii (CRAB) has been steadily increasing in recent years. Here, we developed a loop-mediated isothermal amplification (LAMP) assay for the rapid detection of A. baumannii in clinical samples by using high-specificity primers of the blaOXA-51 gene. Then we investigated the OXA-carbapenemases molecular epidemiology of A. baumannii isolates in two comprehensive hospitals in Beijing. The results showed that the LAMP assay could detect target DNA within 60 min at 65°C. The detection limit was 50 pg/μl, which was about 10-fold greater than that of PCR. Furthermore, this method could distinguish A. baumannii from the homologous A. nosocomialis and A. pittii. A total of 228 positive isolates were identified by this LAMP-based method for A. baumannii from 335 intensive care unit patients with clinically suspected multi-resistant infections in two hospitals in Beijing. The rates of CRAB are on the rise and are slowly becoming a routine phenotype for A. baumannii. Among the CRABs, 92.3% harbored both the blaOXA-23 and blaOXA-51 genes. Thirty-three pulsotypes were identified by pulsed-field gel electrophoresis, and the majority belonged to clone C. In conclusion, the LAMP method developed for detecting A. baumannii was faster and simpler than conventional PCR and has great potential for both point-of-care testing and basic research. We further demonstrated a high distribution of class D carbapenemase-encoding genes, mainly OXA-23, which presents an emerging threat in hospitals in China. PMID:26441924

  13. Colistin-Resistant Acinetobacter baumannii: Beyond Carbapenem Resistance

    PubMed Central

    Qureshi, Zubair A.; Hittle, Lauren E.; O'Hara, Jessica A.; Rivera, Jesabel I.; Syed, Alveena; Shields, Ryan K.; Pasculle, Anthony W.; Ernst, Robert K.; Doi, Yohei

    2015-01-01

    Background. With an increase in the use of colistin methansulfonate (CMS) to treat carbapenem-resistant Acinetobacter baumannii infections, colistin resistance is emerging. Methods. Patients with infection or colonization due to colistin-resistant A. baumannii were identified at a hospital system in Pennsylvania. Clinical data were collected from electronic medical records. Susceptibility testing, pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST) were performed. To investigate the mechanism of colistin resistance, lipid A was subjected to matrix-assisted laser desorption/ionization mass spectrometry. Results. Twenty patients with colistin-resistant A. baumannii were identified. Ventilator-associated pneumonia was the most common type of infection. Nineteen patients had received intravenous and/or inhaled CMS for treatment of carbapenem-resistant, colistin-susceptible A. baumannii infection prior to identification of colistin-resistant isolates. The 30-day all-cause mortality rate was 30%. The treatment regimen for colistin-resistant A. baumannii infection associated with the lowest mortality rate was a combination of CMS, a carbapenem, and ampicillin-sulbactam. The colistin-susceptible and -resistant isolates from the same patients were highly related by PFGE, but isolates from different patients were not, suggesting evolution of resistance during CMS therapy. By MLST, all isolates belonged to the international clone II, the lineage that is epidemic worldwide. Phosphoethanolamine modification of lipid A was present in all colistin-resistant A. baumannii isolates. Conclusions. Colistin-resistant A. baumannii occurred almost exclusively among patients who had received CMS for treatment of carbapenem-resistant, colistin-susceptible A. baumannii infection. Lipid A modification by the addition of phosphoethanolamine accounted for colistin resistance. Susceptibility testing for colistin should be considered for A. baumannii identified

  14. Epithelial innate immune response to Acinetobacter baumannii challenge.

    PubMed

    Feng, Zhimin; Jia, Xun; Adams, Mark D; Ghosh, Santosh K; Bonomo, Robert A; Weinberg, Aaron

    2014-11-01

    Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic antimicrobial peptides (AMPs) that also function to bridge the innate and adaptive immune system. We tested the induction of hBD-2 and -3 by A. baumannii on primary oral and skin epithelial cells and found that A. baumannii induces hBD-3 transcripts to a greater extent than it induces hBD-2 transcripts on both types of cells. In addition, we found that A. baumannii is susceptible to hBD-2 and -3 killing at submicromolar concentrations. Moreover, hBD-3 induction by A. baumannii was found to be dependent on epidermal growth factor receptor (EGFR) signaling. Inhibition of mitogen-activated protein kinase resulted in reduced expression of both hBD-2 and -3. Lastly, a disintegrin and metalloprotease 17 (ADAM17; also known as TACE) was found to be critical for hBD-3 induction, while ADAM10 and dual oxidase 1 (Duox1) were not required for hBD-3 induction. Induction of AMPs is an important component of innate sensing of pathogens and may play an important role in triggering systemic immune responses to A. baumannii infection. Further studies on the interactions between epithelial cells and A. baumannii will help us understand early stages of infection and may shed light on why some individuals are more vulnerable to A. baumannii infection.

  15. Epithelial Innate Immune Response to Acinetobacter baumannii Challenge

    PubMed Central

    Feng, Zhimin; Jia, Xun; Adams, Mark D.; Ghosh, Santosh K.; Bonomo, Robert A.

    2014-01-01

    Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic antimicrobial peptides (AMPs) that also function to bridge the innate and adaptive immune system. We tested the induction of hBD-2 and -3 by A. baumannii on primary oral and skin epithelial cells and found that A. baumannii induces hBD-3 transcripts to a greater extent than it induces hBD-2 transcripts on both types of cells. In addition, we found that A. baumannii is susceptible to hBD-2 and -3 killing at submicromolar concentrations. Moreover, hBD-3 induction by A. baumannii was found to be dependent on epidermal growth factor receptor (EGFR) signaling. Inhibition of mitogen-activated protein kinase resulted in reduced expression of both hBD-2 and -3. Lastly, a disintegrin and metalloprotease 17 (ADAM17; also known as TACE) was found to be critical for hBD-3 induction, while ADAM10 and dual oxidase 1 (Duox1) were not required for hBD-3 induction. Induction of AMPs is an important component of innate sensing of pathogens and may play an important role in triggering systemic immune responses to A. baumannii infection. Further studies on the interactions between epithelial cells and A. baumannii will help us understand early stages of infection and may shed light on why some individuals are more vulnerable to A. baumannii infection. PMID:25114113

  16. Human neutrophils phagocytose and kill Acinetobacter baumannii and A. pittii.

    PubMed

    Lázaro-Díez, María; Chapartegui-González, Itziar; Redondo-Salvo, Santiago; Leigh, Chike; Merino, David; Segundo, David San; Navas, Jesús; Icardo, José Manuel; Acosta, Félix; Ocampo-Sosa, Alain; Martínez-Martínez, Luis; Ramos-Vivas, José

    2017-07-04

    Acinetobacter baumannii is a common cause of health care associated infections worldwide. A. pittii is an opportunistic pathogen also frequently isolated from Acinetobacter infections other than those from A. baumannii. Knowledge of Acinetobacter virulence factors and their role in pathogenesis is scarce. Also, there are no detailed published reports on the interactions between A. pittii and human phagocytic cells. Using confocal laser and scanning electron microscopy, immunofluorescence, and live-cell imaging, our study shows that immediately after bacteria-cell contact, neutrophils rapidly and continuously engulf and kill bacteria during at least 4 hours of infection in vitro. After 3 h of infection, neutrophils start to release neutrophil extracellular traps (NETs) against Acinetobacter. DNA in NETs colocalizes well with human histone H3 and with the specific neutrophil elastase. We have observed that human neutrophils use large filopodia as cellular tentacles to sense local environment but also to detect and retain bacteria during phagocytosis. Furthermore, co-cultivation of neutrophils with human differentiated macrophages before infections shows that human neutrophils, but not macrophages, are key immune cells to control Acinetobacter. Although macrophages were largely activated by both bacterial species, they lack the phagocytic activity demonstrated by neutrophils.

  17. Serum Albumin and Ca2+ Are Natural Competence Inducers in the Human Pathogen Acinetobacter baumannii

    PubMed Central

    Traglia, German Matias; Quinn, Brettni; Schramm, Sareda T. J.; Soler-Bistue, Alfonso

    2016-01-01

    The increasing frequency of bacteria showing antimicrobial resistance (AMR) raises the menace of entering into a postantibiotic era. Horizontal gene transfer (HGT) is one of the prime reasons for AMR acquisition. Acinetobacter baumannii is a nosocomial pathogen with outstanding abilities to survive in the hospital environment and to acquire resistance determinants. Its capacity to incorporate exogenous DNA is a major source of AMR genes; however, few studies have addressed this subject. The transformation machinery as well as the factors that induce natural competence in A. baumannii are unknown. In this study, we demonstrate that naturally competent strain A118 increases its natural transformation frequency upon the addition of Ca2+or albumin. We show that comEA and pilQ are involved in this process since their expression levels are increased upon the addition of these compounds. An unspecific protein, like casein, does not reproduce this effect, showing that albumin's effect is specific. Our work describes the first specific inducers of natural competence in A. baumannii. Overall, our results suggest that the main protein in blood enhances HGT in A. baumannii, contributing to the increase of AMR in this threatening human pathogen. PMID:27270286

  18. The Acinetobacter baumannii Oxymoron: Commensal Hospital Dweller Turned Pan-Drug-Resistant Menace

    PubMed Central

    Roca, Ignasi; Espinal, Paula; Vila-Farrés, Xavier; Vila, Jordi

    2012-01-01

    During the past few decades Acinetobacter baumannii has evolved from being a commensal dweller of health-care facilities to constitute one of the most annoying pathogens responsible for hospitalary outbreaks and it is currently considered one of the most important nosocomial pathogens. In a prevalence study of infections in intensive care units conducted among 75 countries of the five continents, this microorganism was found to be the fifth most common pathogen. Two main features contribute to the success of A. baumannii: (i) A. baumannii exhibits an outstanding ability to accumulate a great variety of resistance mechanisms acquired by different mechanisms, either mutations or acquisition of genetic elements such as plasmids, integrons, transposons, or resistant islands, making this microorganism multi- or pan-drug-resistant and (ii) The ability to survive in the environment during prolonged periods of time which, combined with its innate resistance to desiccation and disinfectants, makes A. baumannii almost impossible to eradicate from the clinical setting. In addition, its ability to produce biofilm greatly contributes to both persistence and resistance. In this review, the pathogenesis of the infections caused by this microorganism as well as the molecular bases of antibacterial resistance and clinical aspects such as treatment and potential future therapeutic strategies are discussed in depth. PMID:22536199

  19. Serum Albumin and Ca2+ Are Natural Competence Inducers in the Human Pathogen Acinetobacter baumannii.

    PubMed

    Traglia, German Matias; Quinn, Brettni; Schramm, Sareda T J; Soler-Bistue, Alfonso; Ramirez, Maria Soledad

    2016-08-01

    The increasing frequency of bacteria showing antimicrobial resistance (AMR) raises the menace of entering into a postantibiotic era. Horizontal gene transfer (HGT) is one of the prime reasons for AMR acquisition. Acinetobacter baumannii is a nosocomial pathogen with outstanding abilities to survive in the hospital environment and to acquire resistance determinants. Its capacity to incorporate exogenous DNA is a major source of AMR genes; however, few studies have addressed this subject. The transformation machinery as well as the factors that induce natural competence in A. baumannii are unknown. In this study, we demonstrate that naturally competent strain A118 increases its natural transformation frequency upon the addition of Ca(2+)or albumin. We show that comEA and pilQ are involved in this process since their expression levels are increased upon the addition of these compounds. An unspecific protein, like casein, does not reproduce this effect, showing that albumin's effect is specific. Our work describes the first specific inducers of natural competence in A. baumannii Overall, our results suggest that the main protein in blood enhances HGT in A. baumannii, contributing to the increase of AMR in this threatening human pathogen.

  20. Thai ethnomedicinal plants as resistant modifying agents for combating Acinetobacter baumannii infections

    PubMed Central

    2012-01-01

    Abstracts Background Acinetobacter baumannii is well-recognized as an important nosocomial pathogen, however, due to their intrinsic resistance to several antibiotics, treatment options are limited. Synergistic effects between antibiotics and medicinal plants, particularly their active components, have intensively been studied as alternative approaches. Methods Fifty-one ethanol extracts obtained from 44 different selected medicinal plant species were tested for resistance modifying agents (RMAs) of novobiocin against A. baumannii using growth inhibition assay. Results At 250 μg/ml, Holarrhena antidysenterica, Punica granatum, Quisqualis indica, Terminalia bellirica, Terminalia chebula, and Terminalia sp. that possessed low intrinsic antibacterial activity significantly enhanced the activity of novobiocin at 1 μg/ml (1/8xminimum inhibitory concentration) against this pathogen. Holarrhena antidysenterica at 7.8 μg/ml demonstrated remarkable resistant modifying ability against A. baumannii in combination with novobiocin. The phytochemical study revealed that constituents of this medicinal plant contain alkaloids, condensed tannins, and triterpenoids. Conclusion The use of Holarrhena antidysenterica in combination with novobiocin provides an effective alternative treatment for multidrug resistant A. baumannii infections. PMID:22536985

  1. The Effect of Colistin Resistance-Associated Mutations on the Fitness of Acinetobacter baumannii.

    PubMed

    Mu, Xinli; Wang, Nanfei; Li, Xi; Shi, Keren; Zhou, Zhihui; Yu, Yunsong; Hua, Xiaoting

    2016-01-01

    Acinetobacter baumannii had emerged as an important nosocomial and opportunistic pathogen worldwide. To assess the evolution of colistin resistance in A. baumannii and its effect on bacterial fitness, we exposed five independent colonies of A. baumannii ATCC 17978 to increasing concentrations of colistin in agar (4/5) and liquid media (1/5). Stable resistant isolates were analyzed using whole genome sequencing. All strains were colistin resistant after exposure to colistin. In addition to the previously reported lpxCAD and pmrAB mutations, we identified four novel putative colistin resistance genes: A1S_1983. hepA. A1S_3026, and rsfS. Lipopolysaccharide (LPS) loss mutants exhibited higher fitness costs than those of the pmrB mutant in nutrient-rich medium. The colistin-resistant mutants had a higher inhibition ratio in the serum growth experiment than that of the wild type strain in 100% serum. Minimum inhibitory concentration (MIC) results showed that the LPS-deficient but not the pmrB mutant had an altered antibiotic resistance profile. The compensatory mutations partially or completely rescued the LPS-deficient's fitness, suggesting that compensatory mutations play an important role in the emergence and spread of colistin resistance in A. baumannii.

  2. The Effect of Colistin Resistance-Associated Mutations on the Fitness of Acinetobacter baumannii

    PubMed Central

    Mu, Xinli; Wang, Nanfei; Li, Xi; Shi, Keren; Zhou, Zhihui; Yu, Yunsong; Hua, Xiaoting

    2016-01-01

    Acinetobacter baumannii had emerged as an important nosocomial and opportunistic pathogen worldwide. To assess the evolution of colistin resistance in A. baumannii and its effect on bacterial fitness, we exposed five independent colonies of A. baumannii ATCC 17978 to increasing concentrations of colistin in agar (4/5) and liquid media (1/5). Stable resistant isolates were analyzed using whole genome sequencing. All strains were colistin resistant after exposure to colistin. In addition to the previously reported lpxCAD and pmrAB mutations, we identified four novel putative colistin resistance genes: A1S_1983. hepA. A1S_3026, and rsfS. Lipopolysaccharide (LPS) loss mutants exhibited higher fitness costs than those of the pmrB mutant in nutrient-rich medium. The colistin-resistant mutants had a higher inhibition ratio in the serum growth experiment than that of the wild type strain in 100% serum. Minimum inhibitory concentration (MIC) results showed that the LPS-deficient but not the pmrB mutant had an altered antibiotic resistance profile. The compensatory mutations partially or completely rescued the LPS-deficient’s fitness, suggesting that compensatory mutations play an important role in the emergence and spread of colistin resistance in A. baumannii. PMID:27847502

  3. 2-DE analysis indicates that Acinetobacter baumannii displays a robust and versatile metabolism

    PubMed Central

    Soares, Nelson C; Cabral, Maria P; Parreira, José R; Gayoso, Carmen; Barba, Maria J; Bou, Germán

    2009-01-01

    Background Acinetobacter baumannii is a nosocomial pathogen that has been associated with outbreak infections in hospitals. Despite increasing awareness about this bacterium, its proteome remains poorly characterised, however recently the complete genome of A. baumannii reference strain ATCC 17978 has been sequenced. Here, we have used 2-DE and MALDI-TOF/TOF approach to characterise the proteome of this strain. Results The membrane and cytoplasmatic protein extracts were analysed separately, these analyses revealed the reproducible presence of 239 and 511 membrane and cytoplamatic protein spots, respectively. MALDI-TOF/TOF characterisation identified a total of 192 protein spots (37 membrane and 155 cytoplasmatic) and revealed that the identified membrane proteins were mainly transport-related proteins, whereas the cytoplasmatic proteins were of diverse nature, although mainly related to metabolic processes. Conclusion This work indicates that A. baumannii has a versatile and robust metabolism and also reveal a number of proteins that may play a key role in the mechanism of drug resistance and virulence. The data obtained complements earlier reports of A. baumannii proteome and provides new tools to increase our knowledge on the protein expression profile of this pathogen. PMID:19785748

  4. Differential Role of the T6SS in Acinetobacter baumannii Virulence

    PubMed Central

    Foucault-Grunenwald, Marie-Laure; Borges, Vitor; Charpentier, Xavier; Limansky, Adriana S.; Gomes, João Paulo; Viale, Alejandro M.; Salcedo, Suzana P.

    2015-01-01

    Gram-negative bacteria, such as Acinetobacter baumannii, are an increasing burden in hospitals worldwide with an alarming spread of multi-drug resistant (MDR) strains. Herein, we compared a type strain (ATCC17978), a non-clinical isolate (DSM30011) and MDR strains of A. baumannii implicated in hospital outbreaks (Ab242, Ab244 and Ab825), revealing distinct patterns of type VI secretion system (T6SS) functionality. The T6SS genomic locus is present and was actively transcribed in all of the above strains. However, only the A. baumannii DSM30011 strain was capable of killing Escherichia coli in a T6SS-dependent manner, unlike the clinical isolates, which failed to display an active T6SS in vitro. In addition, DSM30011 was able to outcompete ATCC17978 as well as Pseudomonas aeruginosa and Klebsiella pneumoniae, bacterial pathogens relevant in mixed nosocomial infections. Finally, we found that the T6SS of DSM30011 is required for host colonization of the model organism Galleria mellonella suggesting that this system could play an important role in A. baumannii virulence in a strain-specific manner. PMID:26401654

  5. Insights on the Horizontal Gene Transfer of Carbapenemase Determinants in the Opportunistic Pathogen Acinetobacter baumannii.

    PubMed

    Da Silva, Gabriela Jorge; Domingues, Sara

    2016-08-23

    Horizontal gene transfer (HGT) is a driving force to the evolution of bacteria. The fast emergence of antimicrobial resistance reflects the ability of genetic adaptation of pathogens. Acinetobacter baumannii has emerged in the last few decades as an important opportunistic nosocomial pathogen, in part due to its high capacity of acquiring resistance to diverse antibiotic families, including to the so-called last line drugs such as carbapenems. The rampant selective pressure and genetic exchange of resistance genes hinder the effective treatment of resistant infections. A. baumannii uses all the resistance mechanisms to survive against carbapenems but production of carbapenemases are the major mechanism, which may act in synergy with others. A. baumannii appears to use all the mechanisms of gene dissemination. Beyond conjugation, the mostly reported recent studies point to natural transformation, transduction and outer membrane vesicles-mediated transfer as mechanisms that may play a role in carbapenemase determinants spread. Understanding the genetic mobilization of carbapenemase genes is paramount in preventing their dissemination. Here we review the carbapenemases found in A. baumannii and present an overview of the current knowledge of contributions of the various HGT mechanisms to the molecular epidemiology of carbapenem resistance in this relevant opportunistic pathogen.

  6. Insights on the Horizontal Gene Transfer of Carbapenemase Determinants in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Da Silva, Gabriela Jorge; Domingues, Sara

    2016-01-01

    Horizontal gene transfer (HGT) is a driving force to the evolution of bacteria. The fast emergence of antimicrobial resistance reflects the ability of genetic adaptation of pathogens. Acinetobacter baumannii has emerged in the last few decades as an important opportunistic nosocomial pathogen, in part due to its high capacity of acquiring resistance to diverse antibiotic families, including to the so-called last line drugs such as carbapenems. The rampant selective pressure and genetic exchange of resistance genes hinder the effective treatment of resistant infections. A. baumannii uses all the resistance mechanisms to survive against carbapenems but production of carbapenemases are the major mechanism, which may act in synergy with others. A. baumannii appears to use all the mechanisms of gene dissemination. Beyond conjugation, the mostly reported recent studies point to natural transformation, transduction and outer membrane vesicles-mediated transfer as mechanisms that may play a role in carbapenemase determinants spread. Understanding the genetic mobilization of carbapenemase genes is paramount in preventing their dissemination. Here we review the carbapenemases found in A. baumannii and present an overview of the current knowledge of contributions of the various HGT mechanisms to the molecular epidemiology of carbapenem resistance in this relevant opportunistic pathogen. PMID:27681923

  7. [Evolution of antimicrobial susceptibility of Acinetobacter baumannii clinical isolates].

    PubMed

    López-Hernández, S; Alarcón, T; López-Brea, M

    2000-12-01

    Acinetobacter baumannii is a microorganism frequently implicated in colonization and infection in hospitalized patients. An increase of resistance has been observed in recent years making these infections difficult to treat. The in vitro activity of 24 antibiotics, 15 betalactam agents and nine nonbetalactams, was studied in 156 A. baumannii clinical isolates. The strains were collected from different clinical samples obtained from inpatients (92%) and 8% were from outpatients. Evolution of susceptibility from January 1995 to December 1997 was studied. MIC of the following antibiotics was determined by the agar dilution method: ampicillin, ticarcillin, piperacillin, ampicillin-sulbactam, amoxicillin- clavulanic acid, ticarcillin-clavulanic acid, piperacillin-tazobactam, cefotaxime, ceftazidime, cefepime, imipenem, meropenem, clavulanic acid, sulbactam, tazobactam, amikacin, gentamicin, tobramycin, ofloxacin, doxycycline, fosfomycin, rifampin, azithromycin and colistin. Low antimicrobial susceptibility was observed in most A. baumannii strains. Colistin, imipenem, meropenem and ampicillin-sulbactam showed the greatest susceptibility (100, 88.4, 88.4 and 84.6%, respectively). A. baumannii strains from inpatients showed a lower antimicrobial susceptibility than strains from outpatients, who showed a high percentage of susceptibility to most antibiotics. Rifampin and azithromycin showed certain in vitro activity against the most susceptible A. baumannii strains. A progressive decrease in susceptibility to most antibiotics was observed during the period studied. Carbapenem-resistant A. baumannii emerged in 1996 and increased in 1997.

  8. Methicillin-resistant Staphylococcus aureus and Acinetobacter baumannii on computer interface surfaces of hospital wards and association with clinical isolates

    PubMed Central

    2009-01-01

    Background Computer keyboards and mice are potential reservoirs of nosocomial pathogens, but routine disinfection for non-water-proof computer devices is a problem. With better hand hygiene compliance of health-care workers (HCWs), the impact of these potential sources of contamination on clinical infection needs to be clarified. Methods This study was conducted in a 1600-bed medical center of southern Taiwan with 47 wards and 282 computers. With education and monitoring program of hand hygiene for HCWs, the average compliance rate was 74% before our surveillance. We investigated the association of methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa and Acinetobacter baumannii, three leading hospital-acquired pathogens, from ward computer keyboards, mice and from clinical isolates in non-outbreak period by pulsed field gel electrophoresis and antibiogram. Results Our results revealed a 17.4% (49/282) contamination rate of these computer devices by S. aureus, Acinetobacter spp. or Pseudomonas spp. The contamination rates of MRSA and A. baumannii in the ward computers were 1.1% and 4.3%, respectively. No P. aeruginosa was isolated. All isolates from computers and clinical specimens at the same ward showed different pulsotypes. However, A. baumannii isolates on two ward computers had the same pulsotype. Conclusion With good hand hygiene compliance, we found relatively low contamination rates of MRSA, P. aeruginosa and A. baumannii on ward computer interface, and without further contribution to nosocomial infection. Our results suggested no necessity of routine culture surveillance in non-outbreak situation. PMID:19796381

  9. Methicillin-resistant Staphylococcus aureus and Acinetobacter baumannii on computer interface surfaces of hospital wards and association with clinical isolates.

    PubMed

    Lu, Po-Liang; Siu, L K; Chen, Tun-Chieh; Ma, Ling; Chiang, Wen-Gin; Chen, Yen-Hsu; Lin, Sheng-Fung; Chen, Tyen-Po

    2009-10-01

    Computer keyboards and mice are potential reservoirs of nosocomial pathogens, but routine disinfection for non-water-proof computer devices is a problem. With better hand hygiene compliance of health-care workers (HCWs), the impact of these potential sources of contamination on clinical infection needs to be clarified. This study was conducted in a 1600-bed medical center of southern Taiwan with 47 wards and 282 computers. With education and monitoring program of hand hygiene for HCWs, the average compliance rate was 74% before our surveillance. We investigated the association of methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa and Acinetobacter baumannii, three leading hospital-acquired pathogens, from ward computer keyboards, mice and from clinical isolates in non-outbreak period by pulsed field gel electrophoresis and antibiogram. Our results revealed a 17.4% (49/282) contamination rate of these computer devices by S. aureus, Acinetobacter spp. or Pseudomonas spp. The contamination rates of MRSA and A. baumannii in the ward computers were 1.1% and 4.3%, respectively. No P. aeruginosa was isolated. All isolates from computers and clinical specimens at the same ward showed different pulsotypes. However, A. baumannii isolates on two ward computers had the same pulsotype. With good hand hygiene compliance, we found relatively low contamination rates of MRSA, P. aeruginosa and A. baumannii on ward computer interface, and without further contribution to nosocomial infection. Our results suggested no necessity of routine culture surveillance in non-outbreak situation.

  10. RNA-mediated cis-regulation in Acinetobacter baumannii modulates stress-induced phenotypic variation.

    PubMed

    Ching, Carly; Gozzi, Kevin; Heinemann, Björn; Chai, Yunrong; Godoy, Veronica G

    2017-03-20

    In the nosocomial opportunistic pathogen Acinetobacter baumannii, RecA-dependent mutagenesis, which causes antibiotic resistance acquisition, is linked to the DNA damage response (DDR). Notably, unlike the Escherichia coli paradigm, recA and DDR gene expression in A. baumannii are bimodal. Namely, there is phenotypic variation upon DNA damage, which may provide a bet-hedging strategy for survival. Thus, understanding recA gene regulation is key to elucidate the yet unknown DDR regulation in A. baumannii Here, we identify a structured 5' Untranslated Region (5' UTR) in the recA transcript which serves as a cis-regulatory element. We show that a predicted stem-loop structure in this 5' UTR affects mRNA half-life and underlies bimodal gene expression and thus phenotypic variation in response to ciprofloxacin treatment. We furthermore show that the stem-loop structure of the recA 5' UTR influences intracellular RecA protein levels and, in vivo, impairing the formation of the stem-loop structure of the recA 5' UTR lowers cell survival to UV treatment and decreases rifampicin resistance acquisition from DNA damage-induced mutagenesis. We hypothesize that the 5' UTR allows for stable recA transcripts during stress, including antibiotic treatment, enabling cells to maintain suitable RecA levels for survival. This innovative strategy to regulate the DDR in A. baumannii may contribute to its success as a pathogen.ImportanceAcinetobacter baumannii is an opportunistic pathogen quickly gaining antibiotic resistances. Mutagenesis and antibiotic resistance acquisition are linked to the DNA damage response (DDR). However, how the DDR is regulated in A. baumannii remains unknown, since unlike most bacteria, A. baumannii does not follow the regulation of the Escherichia coli paradigm. Here, we have started to uncover the mechanisms regulating the novel A. baumannii DDR. We have found that a cis-acting 5' UTR regulates recA transcript stability, RecA protein levels, and DNA damage

  11. First report of OXA-72 producing Acinetobacter baumannii in Romania.

    PubMed

    Georgescu, M; Gheorghe, I; Dudu, A; Czobor, I; Costache, M; Cristea, V-C; Lazăr, V; Chifiriuc, M C

    2016-09-01

    This is the first report of an OXA-72-producing Acinetobacter baumannii strain in Romania, isolated from chronic leg ulcer samples. Identification of the strain was performed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Presence of carbapenem resistance genes was investigated by PCR and sequencing. Our data support the spread of the bla OXA-72 gene in Eastern Europe.

  12. Membrane proteomes of Pseudomonas aeruginosa and Acinetobacter baumannii.

    PubMed

    Dé, E; Cosette, P; Coquet, L; Siroy, A; Alexandre, S; Duncan, A; Naudin, B; Rihouey, C; Schaumann, A; Junter, G A; Jouenne, T

    2011-12-01

    Acinetobacter baumannii and Pseudomonas aeruginosa are known for their intrinsic resistance to antibiotics. Between mechanisms involved in this resistance, diminished expression of outer membrane proteins and up-regulation of efflux pumps play an important role. The characterization of membrane proteins is consequently necessary because of their importance in the antibiotic resistance but also in virulence. This review presents proteomic investigations aiming to describe the protein content of the membranes of these two bacterial species.

  13. Stress responses in the opportunistic pathogen Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E; Actis, Luis A

    2013-01-01

    Acinetobacter baumannii causes a wide range of severe infections among compromised and injured patients worldwide. The relevance of these infections are, in part, due to the ability of this pathogen to sense and react to environmental and host stress signals, allowing it to persist and disseminate in medical settings and the human host. This review summarizes current knowledge on the roles that environmental and cellular stressors play in the ability of A. baumannii to resist nutrient deprivation, oxidative and nitrosative injury, and even the presence of the commonly used antiseptic ethanol, which could serve as a nutrient- and virulence-enhancing signal rather than just being a convenient disinfectant. Emerging experimental evidence supports the role of some of these responses in the pathogenesis of the infections A. baumannii causes in humans and its capacity to resist antibiotics and host response effectors. PMID:23464372

  14. Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008-2014.

    PubMed

    Mahamat, Aba; Bertrand, Xavier; Moreau, Brigitte; Hommel, Didier; Couppie, Pierre; Simonnet, Christine; Kallel, Hatem; Demar, Magalie; Djossou, Felix; Nacher, Mathieu

    2016-07-01

    This study investigated the clinical epidemiology and resistance mechanisms of Acinetobacter baumannii and characterised the clonal diversity of carbapenem-resistant A. baumannii (CRAB) during an ICU-associated outbreak at Cayenne Hospital, French Guiana. All non-duplicate A. baumannii isolates from 2008 to 2014 were tested for antibiotic susceptibility by disk diffusion. Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on CRAB. Of the 441 A. baumannii isolates, most were from males (54.0%) and were detected mainly from the ICU (30.8%) and medicine wards (21.8%). In the ICU, strains were mainly isolated from the respiratory tract (44.1%) and bloodstream (14.0%), whereas in medicine wards they mainly were from wound/drainage (36.5%) and bloodstream (25.0%). A. baumannii showed the greatest susceptibility to piperacillin/tazobactam (92.7%), imipenem (92.5%), colistin (95.6%) and amikacin (97.2%), being lower in the ICU and medicine wards compared with other wards. An outbreak of OXA-23-producing CRAB occurred in the 13-bed ICU in 2010. CRAB strains were more co-resistant to other antimicrobials compared with non-CRAB. Molecular genetics analysis revealed five sequence types [ST78, ST107 and ST642 and two new STs (ST830 and ST831)]. Analysis of PFGE profiles indicated cross-transmissions of CRAB within the ICU, between the ICU and one medicine ward during transfer of patients, and within that medicine ward. This study provides the first clinical and molecular data of A. baumannii from French Guiana and the Amazon basin. The ICU was the highest risk unit of this nosocomial outbreak of OXA-23-producing CRAB, which could subsequently disseminate within the hospital.

  15. Association of biofilm production with colonization among clinical isolates of Acinetobacter baumannii

    PubMed Central

    Ryu, Seong Yeol; Baek, Won-Ki; Kim, Hyun Ah

    2017-01-01

    Background/Aims The pathogen Acinetobacter baumannii is increasingly causing healthcare-associated infections worldwide, particularly in intensive care units. Biofilm formation, a factor contributing to the virulence of A. baumannii, is associated with long-term persistence in hospital environments. The present study investigates the clinical impact of biofilm production on colonization and acquisition after patient admission. Methods Forty-nine A. baumannii isolates were obtained between August and November 2013 from Keimyung University Dongsan Medical Center, Daegu, Korea. All isolates were obtained from sputum samples of new patients infected or colonized by A. baumannii. The microtiter plate assay was used to determine biofilm formation. Results Twenty-four A. baumannii isolates (48%) demonstrated enhanced biofilm formation capacity than that of the standard A. baumannii strain (ATCC 19606). All isolates were resistant to carbapenem, 38 isolates (77%) were collected from patients in an intensive care unit, and 47 isolates (95%) were from patients who had been exposed to antibiotics in the previous month. The median duration of colonization was longer for biofilm-producing isolates than that of the biofilm non-biofilm producing isolates (18 days vs. 12 days, p < 0.05). Simultaneous colonization with other bacteria was more common for biofilm-producing isolates than that for the non-biofilm producing isolates. The most prevalent co-colonizing bacteria was Staphylococcus aureus. Conclusions Biofilm-producing isolates seem to colonize the respiratory tract for longer durations than the non-biofilm producing isolates. During colonization, biofilm producers promote co-colonization by other bacteria, particularly S. aureus. Additional research is required to determine possible links between biofilm formation and nosocomial infection. PMID:27653617

  16. Reduction in chlorhexidine efficacy against multi-drug-resistant Acinetobacter baumannii international clone II.

    PubMed

    Hayashi, M; Kawamura, K; Matsui, M; Suzuki, M; Suzuki, S; Shibayama, K; Arakawa, Y

    2017-03-01

    Nosocomial infections caused by Acinetobacter baumannii international clone II (IC II) can cause severe clinical outcomes. Differential evaluation of bactericidal efficacy of chlorhexidine gluconate (CHX) and benzethonium chloride (BZT) disinfectants against IC II and non-IC II isolates. Minimum inhibitory concentrations (MICs) of CHX and BZT were determined for 137 A. baumannii IC II, 99 non-IC II and 69 non-baumannii isolates, further classified according to MIC values into disinfectant-reduced susceptible (DRS) and disinfectant-susceptible (DS) groups. Time-kill curves and minimum bactericidal concentrations (MBCs) were evaluated for representative isolates in each group. CHX and BZT MIC90s for IC II isolates were 100 and 175mg/L, respectively, but those for non-IC II and non-baumannii isolates were <100mg/L. Nevertheless, time-kill curves indicated that CHX and BZT reduced live bacterial cell number by 5 log10 for IC II and non-IC II isolates within 30s when used at 1000mg/L, comparable to practical use concentrations. CHX MBC at 30s was 1000mg/L for IC II and non-IC II isolates, and was not influenced by addition of 3% bovine serum albumin (BSA); BZT MBC at 30s was 100mg/L without BSA and increased up to 500mg/L upon addition of BSA. No significant differences in BSA were found between DRS and DS isolates. CHX and BZT were effective against Acinetobacter spp. including IC II at a concentration of 1000mg/L and exposure for at least 30s, but their concentrations should be considered carefully to ensure sufficient effects in both clinical and healthcare settings. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  17. Molecular epidemiology and mechanisms of tigecycline resistance in clinical isolates of Acinetobacter baumannii from a Chinese university hospital.

    PubMed

    Deng, Mei; Zhu, Man-Hua; Li, Jun-Jie; Bi, Sheng; Sheng, Zi-Ke; Hu, Fei-Shu; Zhang, Jia-Jie; Chen, Wei; Xue, Xiao-Wei; Sheng, Ji-Fang; Li, Lan-Juan

    2014-01-01

    Because of its remarkable ability to acquire antibiotic resistance and to survive in nosocomial environments, Acinetobacter baumannii has become a significant nosocomial infectious agent worldwide. Tigecycline is one of the few therapeutic options for treating infections caused by A. baumannii isolates. However, tigecycline resistance has increasingly been reported. Our aim was to assess the prevalence and characteristics of efflux-based tigecycline resistance in clinical isolates of A. baumannii collected from a hospital in China. A total of 74 A. baumannii isolates, including 64 tigecycline-nonsusceptible A. baumannii (TNAB) and 10 tigecycline-susceptible A. baumannii (TSAB) isolates, were analyzed. The majority of them were determined to be positive for adeABC, adeRS, adeIJK, and abeM, while the adeE gene was found in only one TSAB isolate. Compared with the levels in TSAB isolates, the mean expression levels of adeB, adeJ, adeG, and abeM in TNAB isolates were observed to increase 29-, 3-, 0.7-, and 1-fold, respectively. The efflux pump inhibitors (EPIs) phenyl-arginine-β-naphthylamide (PAβN) and carbonyl cyanide 3-chlorophenylhydrazone (CCCP) could partially reverse the resistance pattern of tigecycline. Moreover, the tetX1 gene was detected in 12 (18.8%) TNAB isolates. To our knowledge, this is the first report of the tetX1 gene being detected in A. baumannii isolates. ST208 and ST191, which both clustered into clonal complex 92 (CC92), were the predominant sequence types (STs). This study showed that the active efflux pump AdeABC appeared to play important roles in the tigecycline resistance of A. baumannii. The dissemination of TNAB isolates in our hospital is attributable mainly to the spread of CC92.

  18. In Vitro Activity of Tigecycline and Colistin against clinical isolates of Acinetobacter baumannii in Hospitals in Tehran and Bandar-Abbas, Iran.

    PubMed

    Peerayeh, Shahin Najar; Karmostaji, Afsaneh; Sarasiabi, Soraya Sharifi; Javadpour, Sedigheh; Davoodian, Parivash; Moradi, Nahid

    2014-01-01

    The Acinetobacter species, particularly A. baumannii, has emerged as one of the main causes of nosocomial infections in recent years. The high prevalence of drug resistance in A. baumannii limits the therapeutic options for treating infections caused by these bacteria. The objective of this study was to determine the in vitro activity of Tigecycline and Colistin against clinical isolates of A. baumannii in Tehran and Bandar Abbas, Iran. This study was conducted from March 2009 to November 2010 at three hospitals in Tehran and Bandar Abbas, Iran, using 165 Acinetobacter species isolated from clinical specimens. All isolates were subjected to PCR to detect bla OXA-51-like genes that are unique to Acinetobacter baumannii. Isolates that gave a band for the bla OXA-51-like genes were identified as A. baumannii. Anti-microbial susceptibility tests were performed for Tigecycline, Colistin, and other antibiotics. Sensitivity rates to Colistin and Polymyxin-B were 100%. Resistance rates for Tigecycline were 4.2% in Tehran and 8.8% in Bandar-Abbas according to Jones criteria, whereas, according to U.S. FDA criteria, the resistance rates were 20.8% and 17.6%, respectively. New alternative drugs are needed for the treatment of drug resistant A. baumannii. Although Colistin appears to be a good choice, adverse reactions have limited its usage. Tigecycline is effective against A. baumannii isolates, and it shows promise for solving the problem.

  19. In Vitro Activity of Tigecycline and Colistin against clinical isolates of Acinetobacter baumannii in Hospitals in Tehran and Bandar-Abbas, Iran

    PubMed Central

    peerayeh, Shahin najar; Karmostaji, Afsaneh; sarasiabi, Soraya sharifi; Javadpour, Sedigheh; Davoodian, Parivash; Moradi, Nahid

    2014-01-01

    Background: The Acinetobacter species, particularly A. baumannii, has emerged as one of the main causes of nosocomial infections in recent years. The high prevalence of drug resistance in A. baumannii limits the therapeutic options for treating infections caused by these bacteria. The objective of this study was to determine the in vitro activity of Tigecycline and Colistin against clinical isolates of A. baumannii in Tehran and Bandar Abbas, Iran. Methods: This study was conducted from March 2009 to November 2010 at three hospitals in Tehran and Bandar Abbas, Iran, using 165 Acinetobacter species isolated from clinical specimens. All isolates were subjected to PCR to detect blaOXA-51-like genes that are unique to Acinetobacter baumannii. Isolates that gave a band for the blaOXA-51-like genes were identified as A. baumannii. Anti-microbial susceptibility tests were performed for Tigecycline, Colistin, and other antibiotics. Results: Sensitivity rates to Colistin and Polymyxin-B were 100%. Resistance rates for Tigecycline were 4.2% in Tehran and 8.8% in Bandar-Abbas according to Jones criteria, whereas, according to U.S. FDA criteria, the resistance rates were 20.8% and 17.6%, respectively. Conclusions: New alternative drugs are needed for the treatment of drug resistant A. baumannii. Although Colistin appears to be a good choice, adverse reactions have limited its usage. Tigecycline is effective against A. baumannii isolates, and it shows promise for solving the problem. PMID:25763168

  20. Identification of an Acinetobacter baumannii Zinc Acquisition System that Facilitates Resistance to Calprotectin-mediated Zinc Sequestration

    PubMed Central

    Hood, M. Indriati; Mortensen, Brittany L.; Moore, Jessica L.; Zhang, Yaofang; Kehl-Fie, Thomas E.; Sugitani, Norie; Chazin, Walter J.; Caprioli, Richard M.; Skaar, Eric P.

    2012-01-01

    Acinetobacter baumannii is an important nosocomial pathogen that accounts for up to 20 percent of infections in intensive care units worldwide. Furthermore, A. baumannii strains have emerged that are resistant to all available antimicrobials. These facts highlight the dire need for new therapeutic strategies to combat this growing public health threat. Given the critical role for transition metals at the pathogen-host interface, interrogating the role for these metals in A. baumannii physiology and pathogenesis could elucidate novel therapeutic strategies. Toward this end, the role for calprotectin- (CP)-mediated chelation of manganese (Mn) and zinc (Zn) in defense against A. baumannii was investigated. These experiments revealed that CP inhibits A. baumannii growth in vitro through chelation of Mn and Zn. Consistent with these in vitro data, Imaging Mass Spectrometry revealed that CP accompanies neutrophil recruitment to the lung and accumulates at foci of infection in a murine model of A. baumannii pneumonia. CP contributes to host survival and control of bacterial replication in the lung and limits dissemination to secondary sites. Using CP as a probe identified an A. baumannii Zn acquisition system that contributes to Zn uptake, enabling this organism to resist CP-mediated metal chelation, which enhances pathogenesis. Moreover, evidence is provided that Zn uptake across the outer membrane is an energy-dependent process in A. baumannii. Finally, it is shown that Zn limitation reverses carbapenem resistance in multidrug resistant A. baumannii underscoring the clinical relevance of these findings. Taken together, these data establish Zn acquisition systems as viable therapeutic targets to combat multidrug resistant A. baumannii infections. PMID:23236280

  1. Molecular Analysis of the Acinetobacter baumannii Biofilm-Associated Protein

    PubMed Central

    Goh, H. M. Sharon; Beatson, Scott A.; Totsika, Makrina; Moriel, Danilo G.; Phan, Minh-Duy; Szubert, Jan; Runnegar, Naomi; Sidjabat, Hanna E.; Paterson, David L.; Nimmo, Graeme R.; Lipman, Jeffrey

    2013-01-01

    Acinetobacter baumannii is a multidrug-resistant pathogen associated with hospital outbreaks of infection across the globe, particularly in the intensive care unit. The ability of A. baumannii to survive in the hospital environment for long periods is linked to antibiotic resistance and its capacity to form biofilms. Here we studied the prevalence, expression, and function of the A. baumannii biofilm-associated protein (Bap) in 24 carbapenem-resistant A. baumannii ST92 strains isolated from a single institution over a 10-year period. The bap gene was highly prevalent, with 22/24 strains being positive for bap by PCR. Partial sequencing of bap was performed on the index case strain MS1968 and revealed it to be a large and highly repetitive gene approximately 16 kb in size. Phylogenetic analysis employing a 1,948-amino-acid region corresponding to the C terminus of Bap showed that BapMS1968 clusters with Bap sequences from clonal complex 2 (CC2) strains ACICU, TCDC-AB0715, and 1656-2 and is distinct from Bap in CC1 strains. By using overlapping PCR, the bapMS1968 gene was cloned, and its expression in a recombinant Escherichia coli strain resulted in increased biofilm formation. A Bap-specific antibody was generated, and Western blot analysis showed that the majority of A. baumannii strains expressed an ∼200-kDa Bap protein. Further analysis of three Bap-positive A. baumannii strains demonstrated that Bap is expressed at the cell surface and is associated with biofilm formation. Finally, biofilm formation by these Bap-positive strains could be inhibited by affinity-purified Bap antibodies, demonstrating the direct contribution of Bap to biofilm growth by A. baumannii clinical isolates. PMID:23956398

  2. Draft Genome Sequences of Acinetobacter baumannii Isolates from Wounded Military Personnel.

    PubMed

    Arivett, Brock A; Ream, Dave C; Fiester, Steven E; Kidane, Destaalem; Actis, Luis A

    2016-08-25

    Acinetobacter baumannii is a Gram-negative bacterium capable of causing hospital-acquired infections that has been grouped with Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species as ESKAPE pathogens because of their extensive drug resistance phenotypes and increasing risk to human health. Twenty-four multidrug-resistant A. baumannii strains isolated from wounded military personnel were sequenced and annotated.

  3. Acinetobacter baumannii in Localised Cutaneous Mycobacteriosis in Falcons

    PubMed Central

    Muller, Margit Gabriele; George, Ancy Rajeev; Walochnik, Julia

    2010-01-01

    Between May 2007 and April 2009, 29 falcons with identically localized, yellowish discolored cutaneous lesions in the thigh and lateral body wall region were presented at Abu Dhabi Falcon Hospital. Out of 18 falcons integrated in this study, 16 tested positive to Mycobacterium. avium complex. The 2 negative falcons tested positive in the Mycobacterium genus PCR. Moreover, 1 falcon tested positive to M. avium. paratuberculosis in tissue samples by PCR. In all cases, blood and fecal samples tested negative. In the acid-fast stain, all samples showed the for mycobacteriosis typical rods. Moreover, in 13 samples Acinetobacter baumannii was detected by PCR and proven by DNA sequencing. Clinical features included highly elevated WBCs, heterophilia, lymphocytopenia, monocytosis, severe anemia and weight loss. A. baumannii, a gram-negative bacillus with the ability to integrate foreign DNA, has emerged as one of the major multidrug resistant bacteria. In veterinary medicine, it has so far been detected in dogs, cats, horses and wild birds. To the authors' knowledge, this is the first report of an A. baumannii infection in falcons and of a veterinary Mycobacterium-Acinetobacter coinfection. PMID:20871867

  4. Acinetobacter baumannii in Localised Cutaneous Mycobacteriosis in Falcons.

    PubMed

    Muller, Margit Gabriele; George, Ancy Rajeev; Walochnik, Julia

    2010-09-05

    Between May 2007 and April 2009, 29 falcons with identically localized, yellowish discolored cutaneous lesions in the thigh and lateral body wall region were presented at Abu Dhabi Falcon Hospital. Out of 18 falcons integrated in this study, 16 tested positive to Mycobacterium. avium complex. The 2 negative falcons tested positive in the Mycobacterium genus PCR. Moreover, 1 falcon tested positive to M. avium. paratuberculosis in tissue samples by PCR. In all cases, blood and fecal samples tested negative. In the acid-fast stain, all samples showed the for mycobacteriosis typical rods. Moreover, in 13 samples Acinetobacter baumannii was detected by PCR and proven by DNA sequencing. Clinical features included highly elevated WBCs, heterophilia, lymphocytopenia, monocytosis, severe anemia and weight loss. A. baumannii, a gram-negative bacillus with the ability to integrate foreign DNA, has emerged as one of the major multidrug resistant bacteria. In veterinary medicine, it has so far been detected in dogs, cats, horses and wild birds. To the authors' knowledge, this is the first report of an A. baumannii infection in falcons and of a veterinary Mycobacterium-Acinetobacter coinfection.

  5. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens

    PubMed Central

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa

    2015-01-01

    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem. PMID:26150810

  6. Antimicrobial active herbal compounds against Acinetobacter baumannii and other pathogens.

    PubMed

    Tiwari, Vishvanath; Roy, Ranita; Tiwari, Monalisa

    2015-01-01

    Bacterial pathogens cause a number of lethal diseases. Opportunistic bacterial pathogens grouped into ESKAPE pathogens that are linked to the high degree of morbidity, mortality and increased costs as described by Infectious Disease Society of America. Acinetobacter baumannii is one of the ESKAPE pathogens which cause respiratory infection, pneumonia and urinary tract infections. The prevalence of this pathogen increases gradually in the clinical setup where it can grow on artificial surfaces, utilize ethanol as a carbon source and resists desiccation. Carbapenems, a β-lactam, are the most commonly prescribed drugs against A. baumannii. The high level of acquired and intrinsic carbapenem resistance mechanisms acquired by these bacteria makes their eradication difficult. The pharmaceutical industry has no solution to this problem. Hence, it is an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In order to do this, here we have made an effort to review the active compounds of plants that have potent antibacterial activity against many bacteria including carbapenem resistant strain of A. baumannii. We have also briefly highlighted the separation and identification methods used for these active compounds. This review will help researchers involved in the screening of herbal active compounds that might act as a replacement for carbapenem.

  7. Immunization against Multidrug-Resistant Acinetobacter baumannii Effectively Protects Mice in both Pneumonia and Sepsis Models

    PubMed Central

    Huang, Weiwei; Yao, Yufeng; Long, Qiong; Yang, Xu; Sun, Wenjia; Liu, Cunbao; Jin, Xiaomei; li, Yang; Chu, Xiaojie; Chen, Bin; Ma, Yanbing

    2014-01-01

    Objective Acinetobacter baumannii is considered the prototypical example of a multi- or pan- drug-resistant bacterium. It has been increasingly implicated as a major cause of nosocomial and community-associated infections. This study proposed to evaluate the efficacy of immunological approaches to prevent and treat A. baumannii infections. Methods Mice were immunized with outer membrane vesicles (OMVs) prepared from a clinically isolated multidrug-resistant strain of A. baumannii. Pneumonia and sepsis models were used to evaluate the efficacy of active and passive immunization with OMVs. The probable effective mechanisms and the protective potential of clonally distinct clinical isolates were investigated in vitro using an opsonophagocytic assay. Results Intramuscular immunization with OMVs rapidly produced high levels of OMV-specific IgG antibodies, and subsequent intranasal challenge with A. baumannii elicited mucosal IgA and IgG responses. Both active and passive immunization protected the mice from challenges with homologue bacteria in a sepsis model. Bacterial burden in bronchoalveolar lavage fluids (BALF), lung, and spleen, inflammatory cell infiltration in BALF and lung, and inflammatory cytokine accumulation in BALF was significantly suppressed in the pneumonia model by both active and passive immunization strategies. The antisera from immunized mice presented with significant opsonophagocytic activities in a dose-dependent manner against not only homologous strains but also five of the other six clonally distinct clinical isolates. Conclusions Utilizing immunological characteristics of outer membrane proteins to elevate protective immunity and circumvent complex multidrug-resistance mechanisms might be a viable approach to effectively control A. baumannii infections. PMID:24956279

  8. Pharmacokinetics and Pharmacodynamics of Minocycline against Acinetobacter baumannii in a Neutropenic Murine Pneumonia Model.

    PubMed

    Zhou, Jian; Ledesma, Kimberly R; Chang, Kai-Tai; Abodakpi, Henrietta; Gao, Song; Tam, Vincent H

    2017-05-01

    Multidrug-resistant (MDR) Acinetobacter baumannii is increasingly more prevalent in nosocomial infections. Although in vitro susceptibility of A. baumannii to minocycline is promising, the in vivo efficacy of minocycline has not been well established. In this study, the in vivo activity of minocycline was evaluated in a neutropenic murine pneumonia model. Specifically, we investigated the relationship between minocycline exposure and bactericidal activity using five A. baumannii isolates with a broad range of susceptibility (MIC ranged from 0.25 mg/liter to 16 mg/liter). The pharmacokinetics of minocycline (single dose of 25 mg/kg of body weight, 50 mg/kg, 100 mg/kg, and a humanized regimen, given intraperitoneally) in serum and epithelial lining fluid (ELF) were characterized. Dose linearity was observed for doses up to 50 mg/kg and pulmonary penetration ratios (area under the concentration-time curve in ELF from 0 to 24 h [AUCELF,0-24]/area under the concentration time curve in serum from 0 to 24 h [AUCserum,0-24]) ranged from 2.5 to 2.8. Pharmacokinetic-pharmacodynamics (PK-PD) index values in ELF for various dose regimens against different A. baumannii isolates were calculated. The maximum efficacy at 24 h was approximately 1.5-log-unit reduction of pulmonary bacterial burdens from baseline. The AUC/MIC ratio was the PK-PD index most closely correlating to the bacterial burden (r(2) = 0.81). The required AUCELF,0-24/MIC for maintaining stasis and achieving 1-log-unit reduction were 140 and 410, respectively. These findings could guide the treatment of infections caused by A. baumannii using minocycline in the future. Additional studies to examine resistance development during therapy are warranted. Copyright © 2017 American Society for Microbiology.

  9. Intraspecies Transfer of the Chromosomal Acinetobacter baumannii blaNDM-1 Carbapenemase Gene

    PubMed Central

    Krahn, Thomas; Wibberg, Daniel; Maus, Irena; Winkler, Anika; Bontron, Séverine; Sczyrba, Alexander; Nordmann, Patrice; Pühler, Alfred; Poirel, Laurent

    2016-01-01

    The species Acinetobacter baumannii is one of the most important multidrug-resistant human pathogens. To determine its virulence and antibiotic resistance determinants, the genome of the nosocomial blaNDM-1-positive A. baumannii strain R2090 originating from Egypt was completely sequenced. Genome analysis revealed that strain R2090 is highly related to the community-acquired Australian A. baumannii strain D1279779. The two strains belong to sequence type 267 (ST267). Isolate R2090 harbored the chromosomally integrated transposon Tn125 carrying the carbapenemase gene blaNDM-1 that is not present in the D1279779 genome. To test the transferability of the metallo-β-lactamase (MBL) gene region, the clinical isolate R2090 was mated with the susceptible A. baumannii recipient CIP 70.10, and the carbapenem-resistant derivative R2091 was obtained. Genome sequencing of the R2091 derivative revealed that it had received an approximately 66-kb region comprising the transposon Tn125 embedding the blaNDM-1 gene. This region had integrated into the chromosome of the recipient strain CIP 70.10. From the four known mechanisms for horizontal gene transfer (conjugation, outer membrane vesicle-mediated transfer, transformation, and transduction), conjugation could be ruled out, since strain R2090 lacks any plasmid, and a type IV secretion system is not encoded in its chromosome. However, strain R2090 possesses three putative prophages, two of which were predicted to be complete and therefore functional. Accordingly, it was supposed that the transfer of the resistance gene region from the clinical isolate R2090 to the recipient occurred by general transduction facilitated by one of the prophages present in the R2090 genome. Hence, phage-mediated transduction has to be taken into account for the dissemination of antibiotic resistance genes within the species A. baumannii. PMID:26953198

  10. Synergistic Effects and Antibiofilm Properties of Chimeric Peptides against Multidrug-Resistant Acinetobacter baumannii Strains

    PubMed Central

    Gopal, Ramamourthy; Kim, Young Gwon; Lee, Jun Ho; Lee, Seog Ki; Chae, Jeong Don; Son, Byoung Kwan; Seo, Chang Ho

    2014-01-01

    The increasing prevalence of drug-resistant pathogens highlights the need to identify novel antibiotics. Here we investigated the efficacies of four new antimicrobial peptides (AMPs) for potential drug development. The antibacterial activities, synergistic effects, and antibiofilm properties of the four chimeric AMPs were tested against Acinetobacter baumannii, an emerging Gram-negative, nosocomial, drug-resistant pathogen. Nineteen A. baumannii strains resistant to ampicillin, cefotaxime, ciprofloxacin, tobramycin, and erythromycin were isolated at a hospital from patients with cholelithiasis. All four peptides exhibited significant antibacterial effects (MIC = 3.12 to 12.5 μM) against all 19 strains, whereas five commercial antibiotics showed little or no activity against the same pathogens. An exception was polymyxin, which was effective against all of the strains tested. Each of the peptides showed synergy against one or more strains when administered in combination with cefotaxime, ciprofloxacin, or erythromycin. The peptides also exhibited an ability to prevent biofilm formation, which was not seen with cefotaxime, ciprofloxacin, or erythromycin, though polymyxin also inhibited biofilm formation. Indeed, when administered in combination with ciprofloxacin, the AMP HPMA exerted a potent synergistic effect against A. baumannii biofilm formation. Collectively, our findings indicate that the AMPs tested have no cytotoxicity but possess potent antibacterial and antibiofilm activities and may act synergistically with commercial antibiotics. PMID:24366740

  11. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  12. [Lower respiratory tract infections related to Stenotrophomonas maltophilia and Acinetobacter baumannii].

    PubMed

    Baranzelli, A; Wallyn, F; Nseir, S

    2013-10-01

    Stenotrophomonas maltophilia and Acinetobacter baumannii are both non-fermenting ubiquitous Gram-negative bacilli. The incidence of lower respiratory tract infections related to these microorganisms is increasing, especially in intensive care units. Their capacity to acquire resistance against several antimicrobials is challenging for clinicians and microbiologists. Despite their low virulence, these pathogens are responsible for colonization and infection in patients with comorbidities, immunosuppression, and critically ill patients. S. maltophilia and A. baumannii are mainly identified in nosocomial infections: ventilator-associated pneumonia, bacteremia and surgical wound infection. Infections related to these microorganism are associated with high mortality and morbidity. Trimethoprime-sulfamethoxazole and carbapenem are the first line treatment for infections related to S. maltophilia and A. baumannii respectively. However, the increasing rate of resistance against these agents results in difficulties in treating patients with infections related to these pathogens. New antimicrobial agents and further randomized studies are needed to improve the treatment of these infections. Prevention of spared of these multidrug-resistant bacteria is mandatory, including hand-hygiene, environment cleaning, and limited usage of large spectrum antibiotics. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  13. Molecular Epidemiology and Characterization of Genotypes of Acinetobacter baumannii Isolates from Regions of South China.

    PubMed

    Ying, Jun; Lu, Junwan; Zong, Li; Li, Ailing; Pan, Ruowang; Cheng, Cong; Li, Kunpeng; Chen, Liqiang; Ying, Jianchao; Tou, Huifen; Zhu, Chuanxin; Xu, Teng; Yi, Huiguang; Li, Jinsong; Ni, Liyan; Xu, Zuyuan; Bao, Qiyu; Li, Peizhen

    2016-05-20

    The aim of this study was to analyze the molecular epidemiologic characteristics of Acinetobacter baumannii. A total of 398 isolates were collected in 7 regions of South China from January to June of 2012. Drug sensitivity was tested toward 15 commonly used antibiotics; thus, 146 multi-drug-resistant strains (resistant to more than 7 drugs) were identified, representing 36.7% of all isolates. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used for molecular subtyping. According to the PFGE results (with a cutoff of 70% similarity for the DNA electrophoretic bands), 146 strains were subdivided into 15 clusters, with cluster A being the largest (33.6%, distributed in all districts except Jiaxing). Cluster B was also widespread and included 14.4% of all strains. In addition, MLST results revealed 11 sequence types (ST), with ST208 being the most prevalent, followed by ST191 and ST729. Furthermore, 4 novel alleles and 6 novel STs were identified. Our results showed that multi-drug-resistant A. baumannii in South China shares the origin with other widespread strains in other countries. The nosocomial infections caused by A. baumannii have been severe in South China. Continuous monitoring and judicious antibiotic use are required.

  14. Early detection of metallo-β-lactamase NDM-1- and OXA-23 carbapenemase-producing Acinetobacter baumannii in Libyan hospitals.

    PubMed

    Mathlouthi, Najla; El Salabi, Allaaeddin Ali; Ben Jomàa-Jemili, Mariem; Bakour, Sofiane; Al-Bayssari, Charbel; Zorgani, Abdulaziz A; Kraiema, Abdulmajeed; Elahmer, Omar; Okdah, Liliane; Rolain, Jean-Marc; Chouchani, Chedly

    2016-07-01

    Acinetobacter baumannii is an opportunistic pathogen causing various nosocomial infections. The aim of this study was to characterise the molecular support of carbapenem-resistant A. baumannii clinical isolates recovered from two Libyan hospitals. Bacterial isolates were identified by matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF/MS). Antibiotic susceptibility testing was performed using disk diffusion and Etest methods, and carbapenem resistance determinants were studied by PCR amplification and sequencing. Multilocus sequence typing (MLST) was performed for typing of the isolates. All 36 imipenem-resistant isolates tested were identified as A. baumannii. The blaOXA-23 gene was detected in 29 strains (80.6%). The metallo-β-lactamase blaNDM-1 gene was detected in eight isolates (22.2%), showing dissemination of multidrug-resistant (MDR) A. baumannii in Tripoli Medical Center and Burn and Plastic Surgery Hospital in Libya, including one isolate that co-expressed the blaOXA-23 gene. MLST revealed several sequence types (STs). Imipenem-resistant A. baumannii ST2 was the predominant clone (16/36; 44.4%). This study shows that NDM-1 and OXA-23 contribute to antibiotic resistance in Libyan hospitals and represents the first incidence of the association of these two carbapenemases in an autochthonous MDR A. baumannii isolated from patients in Libya, indicating that there is a longstanding infection control problem in these hospitals.

  15. Structure and biosynthesis of fimsbactins A-F, siderophores from Acinetobacter baumannii and Acinetobacter baylyi.

    PubMed

    Proschak, Anna; Lubuta, Patrice; Grün, Peter; Löhr, Frank; Wilharm, Gottfried; De Berardinis, Veronique; Bode, Helge B

    2013-03-18

    Novel chatechol/hydroxamate siderophores (named "fimsbactins") were identified in Acinetobacter baumannii ATCC 17978 and Acinetobacter baylyi ADP1. The major compound, fimsbactin A, was isolated from low-iron cultures of A. baylyi ADP1, and its chemical structure was elucidated by mass spectrometry, and detailed (1)H, (13)C and (15)N NMR spectroscopy. From inverse feeding experiments following HPLC-MS analysis, the structures of five additional derivatives were elucidated. The gene cluster encoding the fimsbactin synthetase (fbs) was identified in both genomes, and mutants in fbs genes in A. baylyi were analyzed, thus allowing prediction of the fimsbactin biosynthesis pathway.

  16. Microbicides Alter the Expression and Function of RND-Type Efflux Pump AdeABC in Biofilm-Associated Cells of Acinetobacter baumannii Clinical Isolates

    PubMed Central

    Krishnamoorthy, Suvarna; Shah, Bhavikkumar P.; Lee, Hiu Ham

    2015-01-01

    Acinetobacter baumannii is a Gram-negative bacterium that causes nosocomial infections worldwide. This microbe's propensity to form biofilms allows it to persist and to survive on clinical abiotic surfaces for long periods. In fact, A. baumannii biofilm formation and its multidrug-resistant nature severely compromise our capacity to care for patients in hospital environments. In contrast, microbicides such as cetrimide (CT) and chlorhexidine (CHX) play important roles in the prevention and treatment of infections. We assessed the efficacy of CT and CHX, either alone or in combination, in eradicating A. baumannii biofilms formed by clinical isolates, by using stainless steel washers to mimic hard abiotic surfaces found in hospital settings. We demonstrated that increasing amounts of each microbicide, alone or in combination, were able to damage and to reduce the viability of A. baumannii biofilms efficaciously. Interestingly, the adeB gene of the resistance-nodulation-cell division (RND) family is predominantly associated with acquired resistance to antimicrobials in A. baumannii. We showed that CT and CHX adversely modified the expression and function of the RND-type efflux pump AdeABC in biofilm-associated A. baumannii cells. Furthermore, we established that these microbicides decreased the negative charges on A. baumannii cell membranes, causing dysregulation of the efflux pump and leading to cell death. Our findings suggest that CT and CHX, alone or in combination, can be used efficaciously for eradication of A. baumannii from hospital surfaces, in order to reduce infections caused by this nosocomial agent. PMID:26459900

  17. Microbicides Alter the Expression and Function of RND-Type Efflux Pump AdeABC in Biofilm-Associated Cells of Acinetobacter baumannii Clinical Isolates.

    PubMed

    Krishnamoorthy, Suvarna; Shah, Bhavikkumar P; Lee, Hiu Ham; Martinez, Luis R

    2015-10-12

    Acinetobacter baumannii is a Gram-negative bacterium that causes nosocomial infections worldwide. This microbe's propensity to form biofilms allows it to persist and to survive on clinical abiotic surfaces for long periods. In fact, A. baumannii biofilm formation and its multidrug-resistant nature severely compromise our capacity to care for patients in hospital environments. In contrast, microbicides such as cetrimide (CT) and chlorhexidine (CHX) play important roles in the prevention and treatment of infections. We assessed the efficacy of CT and CHX, either alone or in combination, in eradicating A. baumannii biofilms formed by clinical isolates, by using stainless steel washers to mimic hard abiotic surfaces found in hospital settings. We demonstrated that increasing amounts of each microbicide, alone or in combination, were able to damage and to reduce the viability of A. baumannii biofilms efficaciously. Interestingly, the adeB gene of the resistance-nodulation-cell division (RND) family is predominantly associated with acquired resistance to antimicrobials in A. baumannii. We showed that CT and CHX adversely modified the expression and function of the RND-type efflux pump AdeABC in biofilm-associated A. baumannii cells. Furthermore, we established that these microbicides decreased the negative charges on A. baumannii cell membranes, causing dysregulation of the efflux pump and leading to cell death. Our findings suggest that CT and CHX, alone or in combination, can be used efficaciously for eradication of A. baumannii from hospital surfaces, in order to reduce infections caused by this nosocomial agent.

  18. [Antibiotic resistance of Acinetobacter baumannii strains isolated from clinical specimens in the "Marius Nasta" Pneumology Institute, Bucharest].

    PubMed

    Moisoiu, Adriana; Ionită, Monica; Sârbu, Lăcrămioara; Stoica, Corina; Grigoriu, Liliana

    2014-01-01

    Acinetobacter baumannii (A. baumannii) is one of the leading causes of morbidity and mortality in patients who are in critical condition in hospitals and especially in intensive care units (ICU). Long time considered a bacterium with low virulence, A. baumannii has more recently become a cause for major concern in clinical practice due to its high level of antimicrobial resistance. The extend of infections with Acinetobacter baumannii in ICU is caused by multiple factors, such as mechanical ventilation, invasive procedures, the use of a large number of broad spectrum antibiotics and transmission through the hands of medical staff In this study we evaluated the resistance to antibiotics of 213 non-duplicated strains of A. baumannii isolated in the bacteriology laboratory of the "Marius Nasta" lnstitute of Pneumophtisiology (IPMN) from January 2012 to December 2013. These strains originated from patients in medical wards (56), ICU (143) and surgery (14). Strains identification was performed by classical methods on multitest media and with API kits (Bio Merieux). The antibiotic sensitivity was performed on Mueller-Hinton media in accordance with CLSI2013. Analysis of the resistance to antibiotics was the following: carbenicilin (87.3%), ceftriaxone (87.3%), cefoperazone with sulbactam (84.9%), ceftazidime (79.3%), carbapenems (imipenem and/or meropenem--75.1%), fluoroquinolones (ciprofloxacin and/orlevofloxacin--73.7%), cefepime (66.6%), piperacilin with tazobactam (62.4%), amikacin (50.2%), netilmicin (45%), gentamicin (42.7%) and tobramycin (35.6%). In our study, we only found two strains of Acinetobacter baumannii with resistance to colistin and 70 (32.8%) strains sensitive only to colistin, but resistant to all other antibiotics tested. A. baumannii is a pathogen with rapid spread and extended resistance to even newer antimicrobial agents. Due to its ability to survive in the hospital environment, A. baumannii has the immense potential to cause nosocomial

  19. Antimicrobial resistance in Acinetobacter baumannii: From bench to bedside

    PubMed Central

    Lin, Ming-Feng; Lan, Chung-Yu

    2014-01-01

    Acinetobacter baumannii (A. baumannii) is undoubtedly one of the most successful pathogens in the modern healthcare system. With invasive procedures, antibiotic use and immunocompromised hosts increasing in recent years, A. baumannii has become endemic in hospitals due to its versatile genetic machinery, which allows it to quickly evolve resistance factors, and to its remarkable ability to tolerate harsh environments. Infections and outbreaks caused by multidrug-resistant A. baumannii (MDRAB) are prevalent and have been reported worldwide over the past twenty or more years. To address this problem effectively, knowledge of species identification, typing methods, clinical manifestations, risk factors, and virulence factors is essential. The global epidemiology of MDRAB is monitored by persistent surveillance programs. Because few effective antibiotics are available, clinicians often face serious challenges when treating patients with MDRAB. Therefore, a deep understanding of the resistance mechanisms used by MDRAB can shed light on two possible strategies to combat the dissemination of antimicrobial resistance: stringent infection control and antibiotic treatments, of which colistin-based combination therapy is the mainstream strategy. However, due to the current unsatisfying therapeutic outcomes, there is a great need to develop and evaluate the efficacy of new antibiotics and to understand the role of other potential alternatives, such as antimicrobial peptides, in the treatment of MDRAB infections. PMID:25516853

  20. Exploiting Quorum Sensing Inhibition for the Control of Pseudomonas Aeruginosa and Acinetobacter Baumannii Biofilms.

    PubMed

    Castillo-Juarez, Israel; López-Jácome, Luis Esaú; Soberón-Chávez, Gloria; Tomás, María; Lee, Jintae; Castañeda-Tamez, Paulina; Hernández-Bárragan, Iván Ángelo; Cruz-Muñiz, Martha Yumiko; Maeda, Toshinari; Wood, Thomas K; García-Contreras, Rodolfo

    2017-01-05

    Pseudomonas aeruginosa and Acinetobacter baumannii are two of the main bacteria responsible for nosocomial infections; both organisms are resistant to several classes of antibiotics making their infections very difficult to treat. Moreover, they possess a remarkable ability to form biofilms, which further enhances their antimicrobial resistance. Both organisms coordinate their formation of biofilms and their expression of virulence factors through quorum sensing, a system that regulates gene expression at high cell densities and that plays a key role in the establishment of bacterial infections. Hence, interfering with these quorum-sensing systems has been proposed as an alternative to traditional antibiotics for the eradication of bacterial infections. In this review, we describe the quorum sensing systems of both organisms, the way they coordinate the formation of biofilms, the recent advances in biofilm disruption by quorum sensing interference, and the advantages and limitations of the implementation of these novel therapeutic options in the clinic.

  1. Pharmacokinetic/pharmacodynamic evaluation of sulbactam against Acinetobacter baumannii in in vitro and murine thigh and lung infection models.

    PubMed

    Yokoyama, Yuta; Matsumoto, Kazuaki; Ikawa, Kazuro; Watanabe, Erika; Shigemi, Akari; Umezaki, Yasuhiro; Nakamura, Koyo; Ueno, Keiichiro; Morikawa, Norifumi; Takeda, Yasuo

    2014-06-01

    Acinetobacter baumannii is a pathogen that has become globally associated with nosocomial infections. Sulbactam, a potent inhibitor of β-lactamases, was previously shown to be active against A. baumannii strains in vitro and effective against A. baumannii infections. However, a pharmacokinetic/pharmacodynamic (PK/PD) analysis of sulbactam against A. baumannii infections has not yet been performed. This is necessary because optimisation of dosing regimens should be based on PK/PD analysis. Therefore, in vitro and in vivo PK/PD analyses of sulbactam were performed using murine thigh and lung infection models of A. baumannii to evaluate the pharmacokinetics and pharmacodynamics of sulbactam. Sulbactam showed time-dependent bactericidal activity in vitro against A. baumannii. The PK/PD index that best correlated with its in vivo effects was the time that the free drug concentration remained above the minimum inhibitory concentration (fT>MIC) both in the thigh (R(2)=0.95) and lung (R(2)=0.96) infection models. Values of fT>MIC for a static effect and 1, 2 and 3log10 kill, respectively, were 21.0%, 32.9%, 43.6% and 57.3% in the thigh infection model and 20.4%, 24.5%, 29.3% and 37.3% in the lung infection model. Here we report the in vitro and in vivo time-dependent activities of sulbactam against A. baumannii infection and demonstrate that sulbactam was sufficiently bactericidal when an fT>MIC of >60% against A. baumannii thigh infection and >40% against A. baumannii lung infection was achieved.

  2. Characterization of newly isolated lytic bacteriophages active against Acinetobacter baumannii.

    PubMed

    Merabishvili, Maia; Vandenheuvel, Dieter; Kropinski, Andrew M; Mast, Jan; De Vos, Daniel; Verbeken, Gilbert; Noben, Jean-Paul; Lavigne, Rob; Vaneechoutte, Mario; Pirnay, Jean-Paul

    2014-01-01

    Based on genotyping and host range, two newly isolated lytic bacteriophages, myovirus vB_AbaM_Acibel004 and podovirus vB_AbaP_Acibel007, active against Acinetobacter baumannii clinical strains, were selected from a new phage library for further characterization. The complete genomes of the two phages were analyzed. Both phages are characterized by broad host range and essential features of potential therapeutic phages, such as short latent period (27 and 21 min, respectively), high burst size (125 and 145, respectively), stability of activity in liquid culture and low frequency of occurrence of phage-resistant mutant bacterial cells. Genomic analysis showed that while Acibel004 represents a novel bacteriophage with resemblance to some unclassified Pseudomonas aeruginosa phages, Acibel007 belongs to the well-characterized genus of the Phikmvlikevirus. The newly isolated phages can serve as potential candidates for phage cocktails to control A. baumannii infections.

  3. The structure of alanine racemase from Acinetobacter baumannii.

    PubMed

    Davis, Emily; Scaletti-Hutchinson, Emma; Opel-Reading, Helen; Nakatani, Yoshio; Krause, Kurt L

    2014-09-01

    Acinetobacter baumannii is an opportunistic Gram-negative bacterium which is a common cause of hospital-acquired infections. Numerous antibiotic-resistant strains exist, emphasizing the need for the development of new antimicrobials. Alanine racemase (Alr) is a pyridoxal 5'-phosphate dependent enzyme that is responsible for racemization between enantiomers of alanine. As D-alanine is an essential component of the bacterial cell wall, its inhibition is lethal to prokaryotes, making it an excellent antibiotic drug target. The crystal structure of A. baumannii alanine racemase (AlrAba) from the highly antibiotic-resistant NCTC13302 strain has been solved to 1.9 Å resolution. Comparison of AlrAba with alanine racemases from closely related bacteria demonstrates a conserved overall fold. The substrate entryway and active site of the enzymes were shown to be highly conserved. The structure of AlrAba will provide the template required for future structure-based drug-design studies.

  4. In vitro and in vivo biological activities of iron chelators and gallium nitrate against Acinetobacter baumannii.

    PubMed

    de Léséleuc, Louis; Harris, Greg; KuoLee, Rhonda; Chen, Wangxue

    2012-10-01

    We investigated the ability of compounds interfering with iron metabolism to inhibit the growth of Acinetobacter baumannii. Iron restriction with transferrin or 2,2-bipyridyl significantly inhibited A. baumannii growth in vitro. Gallium nitrate alone was moderately effective at reducing A. baumannii growth but became bacteriostatic in the presence of serum or transferrin. More importantly, gallium nitrate treatment reduced lung bacterial burdens in mice. The use of gallium-based therapies shows promise for the control of multidrug-resistant A. baumannii.

  5. Acinetobacter baumannii: association between environmental contamination of patient rooms and occupant status.

    PubMed

    Munoz-Price, L Silvia; Namias, Nicholas; Cleary, Timothy; Fajardo-Aquino, Yovanit; Depascale, Dennise; Arheart, Kristopher L; Rivera, Jesabel I; Doi, Yohei

    2013-05-01

    We aimed to determine the association between the presence of Acinetobacter baumannii in patient rooms and the carrier status of the occupants. Fifty-six (39%) of 143 rooms with A. baumannii-positive patients had results positive for A. baumannii. Only 49 (10%) of 485 rooms with A. baumannii-negative patients were positive (odds ratio, 5.72 [95% confidence interval, 3.66-8.96]; [Formula: see text]). Clinical and environmental isolates shared pulsed-field gel electrophoresis patterns.

  6. Acinetobacter baumannii RecA Protein in Repair of DNA Damage, Antimicrobial Resistance, General Stress Response, and Virulence ▿

    PubMed Central

    Aranda, Jesús; Bardina, Carlota; Beceiro, Alejandro; Rumbo, Soraya; Cabral, Maria P.; Barbé, Jordi; Bou, Germán

    2011-01-01

    RecA is the major enzyme involved in homologous recombination and plays a central role in SOS mutagenesis. In Acinetobacter spp., including Acinetobacter baumannii , a multidrug-resistant bacterium responsible for nosocomial infections worldwide, DNA repair responses differ in many ways from those of other bacterial species. In this work, the function of A. baumannii RecA was examined by constructing a recA mutant. Alteration of this single gene had a pleiotropic effect, showing the involvement of RecA in DNA damage repair and consequently in cellular protection against stresses induced by DNA damaging agents, several classes of antibiotics, and oxidative agents. In addition, the absence of RecA decreased survival in response to both heat shock and desiccation. Virulence assays in vitro (with macrophages) and in vivo (using a mouse model) similarly implicated RecA in the pathogenicity of A. baumannii . Thus, the data strongly suggest a protective role for RecA in the bacterium and indicate that inactivation of the protein can contribute to a combined therapeutic approach to controlling A. baumannii infections. PMID:21642465

  7. Computational gene network study on antibiotic resistance genes of Acinetobacter baumannii.

    PubMed

    Anitha, P; Anbarasu, Anand; Ramaiah, Sudha

    2014-05-01

    Multi Drug Resistance (MDR) in Acinetobacter baumannii is one of the major threats for emerging nosocomial infections in hospital environment. Multidrug-resistance in A. baumannii may be due to the implementation of multi-combination resistance mechanisms such as β-lactamase synthesis, Penicillin-Binding Proteins (PBPs) changes, alteration in porin proteins and in efflux pumps against various existing classes of antibiotics. Multiple antibiotic resistance genes are involved in MDR. These resistance genes are transferred through plasmids, which are responsible for the dissemination of antibiotic resistance among Acinetobacter spp. In addition, these resistance genes may also have a tendency to interact with each other or with their gene products. Therefore, it becomes necessary to understand the impact of these interactions in antibiotic resistance mechanism. Hence, our study focuses on protein and gene network analysis on various resistance genes, to elucidate the role of the interacting proteins and to study their functional contribution towards antibiotic resistance. From the search tool for the retrieval of interacting gene/protein (STRING), a total of 168 functional partners for 15 resistance genes were extracted based on the confidence scoring system. The network study was then followed up with functional clustering of associated partners using molecular complex detection (MCODE). Later, we selected eight efficient clusters based on score. Interestingly, the associated protein we identified from the network possessed greater functional similarity with known resistance genes. This network-based approach on resistance genes of A. baumannii could help in identifying new genes/proteins and provide clues on their association in antibiotic resistance. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. The genome sequence of Acinetobacter baumannii isolated from a septicemic patient in a local hospital in Malaysia

    PubMed Central

    Izwan, I.; Teh, L.K.; Salleh, M.Z.

    2015-01-01

    Acinetobacter baumannii is a Gram negative, strictly aerobic clinical pathogen causing mostly nosocomial infections globally. The DNA of an isolate from the blood of a local septicemic patient was sequenced using the Illumina GA IIx. The draft genome generated is 4,178,008 bp with a G + C content of 42%. From the annotation results, 47 resistance determinants including 16 multidrug resistance (MDR) genes were identified. The data may be accessed via the GenBank WGS master accession number APWV00000000. PMID:26697353

  9. Molecular epidemiology of Acinetobacter baumannii and Acinetobacter nosocomialis in Germany over a 5-year period (2005-2009).

    PubMed

    Schleicher, X; Higgins, P G; Wisplinghoff, H; Körber-Irrgang, B; Kresken, M; Seifert, H

    2013-08-01

    To investigate the species distribution within the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and the molecular epidemiology of A. baumannii and Acinetobacter nosocomialis, 376 Acinetobacter isolates were collected prospectively from hospitalized patients at 15 medical centres in Germany during three surveillance studies conducted over a 5-year period. Species identification was performed by molecular methods. Imipenem minimum inhibitory concentrations (MIC) were determined by broth microdilution. The prevalence of the most common carbapenemase-encoding genes was investigated by oxacillinase (OXA) -multiplex polymerase chain reaction (PCR). The molecular epidemiology was investigated by repetitive sequence-based PCR (rep-PCR; DiversiLab™). Acinetobacter pittii was the most prevalent Acinetobacter species (n = 193), followed by A. baumannii (n = 140), A. calcoaceticus (n = 10) and A. nosocomialis (n = 8). The majority of A. baumannii was represented by sporadic isolates (n = 70, 50%) that showed unique rep-PCR patterns, 25 isolates (18%) clustered with one or two other isolates, and only 45 isolates (32%) belonged to one of the previously described international clonal lineages. The most prevalent clonal lineage was international clone (IC) 2 (n = 34) and IC 1 (n = 6). According to CLSI, 25 A. baumannii isolates were non-susceptible to imipenem (MIC ≥ 8 mg/L), all of which produced an OXA-58-like or OXA-23-like carbapenemase. The rate of imipenem susceptibility among A. baumannii isolates decreased from 96% in 2005 to 76% in 2009. All other Acinetobacter isolates were susceptible to imipenem. The population structure of carbapenem-susceptible A. baumannii in Germany is highly diverse. Imipenem non-susceptibility was strongly associated with the clonal lineages IC 2 and IC 1. These data underscore the high clonality of carbapenem-resistant A. baumannii isolates.

  10. Imipenem: a potent inducer of multidrug resistance in Acinetobacter baumannii.

    PubMed

    Kuo, Han-Yueh; Chang, Kai-Chih; Kuo, Jai-Wei; Yueh, Hui-Wen; Liou, Ming-Li

    2012-01-01

    This study investigated the progression of multidrug resistance upon exposure to imipenem in Acinetobacter baumannii. Eighteen A. baumannii strains, including two reference strains (ATCC 19606 and ATCC 17978), four clinical strains (AB56, AB242, AB273 and AB279) and 12 antibiotic-selected mutant strains, were used in this study. Imipenem-selected mutants were generated from imipenem-susceptible strains (ATCC 19606, ATCC 17978 and AB242) by multistep selection resistance. Amikacin-, ciprofloxacin-, colistin-, meropenem- and ceftazidime-selected mutants were also generated from the two reference strains and were used for comparison. Antibiotic susceptibilities in the absence and presence of the efflux pump inhibitors carbonyl cyanide m-chlorophenylhydrazone (CCCP) and 1-(1-naphthylmethyl)-piperazine (NMP) were examined in the three imipenem-selected mutants and the three clinical multidrug-resistant (MDR) isolates. Expression profiles of the antimicrobial resistance genes in the imipenem-selected mutants and their parental strains were also determined. The results showed that imipenem was more likely, compared with the other antibiotics, to induce a MDR phenotype in the two reference strains. Differences in OXA-51-like carbapenemase, efflux pumps or/and AmpC β-lactamase expression were observed in the three imipenem-selected mutants. Moreover, a reduction in imipenem or amikacin resistance was observed when the imipenem-selected mutants and clinical isolates were exposed to NMP and CCCP. This study concluded that imipenem might be a potent inducer of multidrug resistance in A. baumannii strains. OXA-51-like carbapenemase combined with other resistance mechanisms may contribute to the development of multidrug resistance in A. baumannii. Monitoring the use of carbapenems is required to reduce the spread of MDR A. baumannii in hospitals.

  11. Multilocus Sequence Typing Analysis of Carbapenem-Resistant Acinetobacter baumannii in a Chinese Burns Institute

    PubMed Central

    Huang, Guangtao; Yin, Supeng; Gong, Yali; Zhao, Xia; Zou, Lingyun; Jiang, Bei; Dong, Zhiwei; Chen, Yu; Chen, Jing; Jin, Shouguang; Yuan, Zhiqiang; Peng, Yizhi

    2016-01-01

    Acinetobacter baumannii is a leading pathogen responsible for nosocomial infections. The emergence of carbapenem-resistant A. baumannii (CRAB) has left few effective antibiotics for clinicians to use. To investigate the temporal evolutionary relationships among CRAB strains, we collected 248 CRAB isolates from a Chinese burns institute over 3 years. The prevalence of the OXA-23 gene was detected by polymerase chain reaction. Multilocus sequence typing was used to type the CRAB strains and eBURST was used to analyze their evolutionary relationships. Wound surfaces (41%), sputa (24%), catheters (15%), and bloods (14%) were the four dominant isolation sources. Except for minocycline (33.5%) and sulbactam/cefoperazone (74.6%), these CRAB strains showed high resistance rates (>90%) to 16 tested antibiotics. The 248 isolates fall into 26 sequence types (STs), including nine known STs and 17 unknown STs. The majority (230/248) of these isolates belong to clonal complex 92 (CC92), including eight isolates belonging to seven unreported STs. A new CC containing 11 isolates grouped into four new STs was identified. The OXA-23 gene was detected at high prevalence among the CRAB isolates and the prevalence rate among the various STs differed. The majority of the isolates displayed a close evolutionary relationship, suggesting that serious nosocomial spreading and nosocomial infections of CRAB have occurred in the burn unit. In conclusion, the main CC for CRAB in this Chinese burn unit remained unchanged during the 3-year study period, and a new CC was identified. CC92 was the dominant complex, and more attention should be directed toward monitoring the new CC we have identified herein. PMID:27881972

  12. Multidrug-resistant Acinetobacter meningitis in children

    PubMed Central

    Shah, Ira; Kapdi, Muznah

    2016-01-01

    Acinetobacter species have emerged as one of the most troublesome pathogens for healthcare institutions globally. In more recent times, nosocomial infections involving the central nervous system, skin and soft tissue, and bone have emerged as highly problematic. Acinetobacter species infection is common in intensive care units; however, Acinetobacter baumannii meningitis is rarely reported. Here, we report two cases of Acinetobacter baumannii meningitis which was multidrug resistance and ultimately required the carbapenem group of drugs for the treatment.

  13. Antimicrobial Resistance Mechanisms and Genetic Diversity of Multidrug-Resistant Acinetobacter baumannii Isolated from a Teaching Hospital in Malaysia.

    PubMed

    Biglari, Shirin; Hanafiah, Alfizah; Mohd Puzi, Shaliawani; Ramli, Ramliza; Rahman, Mostafizur; Lopes, Bruno Silvester

    2017-07-01

    Multidrug-resistant (MDR) Acinetobacter baumannii has increasingly emerged as an important nosocomial pathogen. The aim of this study was to determine the resistance profiles and genetic diversity in A. baumannii clinical isolates in a tertiary medical center in Malaysia. The minimum inhibitory concentrations of carbapenems (imipenem and meropenem), cephalosporins (ceftazidime and cefepime), and ciprofloxacin were determined by E-test. PCR and sequencing were carried out for the detection of antibiotic resistance genes and mutations. Clonal relatedness among A. baumannii isolates was determined by REP-PCR. Sequence-based typing of OXA-51 and multilocus sequence typing were performed. One hundred twenty-five of 162 (77.2%) A. baumannii isolates had MDR phenotype. From the 162 A. baumannii isolates, 20 strain types were identified and majority of A. baumannii isolates (66%, n = 107) were classified as strain type 1 and were positive for ISAba1-blaOXA-23 and ISAba1-blaADC and had mutations in both gyrA and parC genes at positions, 83 and 80, resulting in serine-to-leucine conversion. REP-PCR analysis showed 129 REP types that generated 31 clones with a 90% similarity cutoff value. OXA-66 variant of the blaOXA-51-like genes was predominantly detected among our A. baumannii clinical isolates belonging to ST195 (found in six clones: 1, 8, 9, 19, 27, and 30) and ST208 (found in clone 21). The study helps us in understanding the genetic diversity of A. baumannii isolates in our setting and confirms that international clone II is the most widely distributed clone in Universiti Kebangsaan Malaysia Medical Centre, Malaysia.

  14. Association of class 1 and 2 integrons with multidrug-resistant Acinetobacter baumannii international clones and Acinetobacter nosocomialis isolates.

    PubMed

    Martins, Natacha; Picão, Renata Cristina; Adams-Sapper, Sheila; Riley, Lee W; Moreira, Beatriz Meurer

    2015-01-01

    The Acinetobacter baumannii clonal complex 113/79 (CC113/79) and class 2 integrons predominate in Latin America; a relationship between these characteristics was explored. The presence of integrases was determined in successive hospital Acinetobacter isolates (163 A. baumannii isolates and 72 Acinetobacter nosocomialis isolates). Most isolates had integrons, but class 1 and 2 integrons were present significantly more often in CC109/1 and CC113/79, respectively. The high prevalence of CC113/79 in Latin America may account for the predominance of class 2 integrons.

  15. Towards the complete proteinaceous regulome of Acinetobacter baumannii

    PubMed Central

    Pérez-Rueda, Ernesto; Antonio Ibarra, J

    2017-01-01

    The emergence of Acinetobacter baumannii strains, with broad multidrug-resistance phenotypes and novel virulence factors unique to hypervirulent strains, presents a major threat to human health worldwide. Although a number of studies have described virulence-affecting entities for this organism, very few have identified regulatory elements controlling their expression. Previously, our group has documented the global identification and curation of regulatory RNAs in A. baumannii. As such, in the present study, we detail an extension of this work, the performance of an extensive bioinformatic analysis to identify regulatory proteins in the recently annotated genome of the highly virulent AB5075 strain. In so doing, 243 transcription factors, 14 two-component systems (TCSs), 2 orphan response regulators, 1 hybrid TCS and 5 σ factors were found. A comparison of these elements between AB5075 and other clinical isolates, as well as a laboratory strain, led to the identification of several conserved regulatory elements, whilst at the same time uncovering regulators unique to hypervirulent strains. Lastly, by comparing regulatory elements compiled in this study to genes shown to be essential for AB5075 infection, we were able to highlight elements with a specific importance for pathogenic behaviour. Collectively, our work offers a unique insight into the regulatory network of A. baumannii strains, and provides insight into the evolution of hypervirulent lineages. PMID:28663824

  16. Towards the complete proteinaceous regulome of Acinetobacter baumannii.

    PubMed

    Casella, Leila G; Weiss, Andy; Pérez-Rueda, Ernesto; Antonio Ibarra, J; Shaw, Lindsey N

    2017-03-01

    The emergence of Acinetobacter baumannii strains, with broad multidrug-resistance phenotypes and novel virulence factors unique to hypervirulent strains, presents a major threat to human health worldwide. Although a number of studies have described virulence-affecting entities for this organism, very few have identified regulatory elements controlling their expression. Previously, our group has documented the global identification and curation of regulatory RNAs in A. baumannii. As such, in the present study, we detail an extension of this work, the performance of an extensive bioinformatic analysis to identify regulatory proteins in the recently annotated genome of the highly virulent AB5075 strain. In so doing, 243 transcription factors, 14 two-component systems (TCSs), 2 orphan response regulators, 1 hybrid TCS and 5 σ factors were found. A comparison of these elements between AB5075 and other clinical isolates, as well as a laboratory strain, led to the identification of several conserved regulatory elements, whilst at the same time uncovering regulators unique to hypervirulent strains. Lastly, by comparing regulatory elements compiled in this study to genes shown to be essential for AB5075 infection, we were able to highlight elements with a specific importance for pathogenic behaviour. Collectively, our work offers a unique insight into the regulatory network of A. baumannii strains, and provides insight into the evolution of hypervirulent lineages.

  17. Immunoprotective Efficacy of Acinetobacter baumannii Outer Membrane Protein, FilF, Predicted In silico as a Potential Vaccine Candidate

    PubMed Central

    Singh, Ravinder; Garg, Nisha; Shukla, Geeta; Capalash, Neena; Sharma, Prince

    2016-01-01

    Acinetobacter baumannii is emerging as a serious nosocomial pathogen with multidrug resistance that has made it difficult to cure and development of efficacious treatment against this pathogen is direly needed. This has led to investigate vaccine approach to prevent and treat A. baumannii infections. In this work, an outer membrane putative pilus assembly protein, FilF, was predicted as vaccine candidate by in silico analysis of A. baumannii proteome and was found to be conserved among the A. baumannii strains. It was cloned and expressed in E. coli BL21(DE3) and purified by Ni-NTA chromatography. Immunization with FilF generated high antibody titer (>64,000) and provided 50% protection against a standardized lethal dose (108 CFU) of A. baumannii in murine pneumonia model. FilF immunization reduced the bacterial load in lungs by 2 and 4 log cycles, 12 and 24 h post infection as compared to adjuvant control; reduced the levels of pro-inflammatory cytokines TNF-α, IL-6, IL-33, IFN-γ, and IL-1β significantly and histology of lung tissue supported the data by showing considerably reduced damage and infiltration of neutrophils in lungs. These results demonstrate the in vivo validation of immunoprotective efficacy of a protein predicted as a vaccine candidate by in silico proteomic analysis and open the possibilities for exploration of a large array of uncharacterized proteins. PMID:26904021

  18. OXA-23 and ISAba1-OXA-66 class D β-lactamases in Acinetobacter baumannii isolates from companion animals.

    PubMed

    Ewers, Christa; Klotz, Peter; Leidner, Ursula; Stamm, Ivonne; Prenger-Berninghoff, Ellen; Göttig, Stephan; Semmler, Torsten; Scheufen, Sandra

    2017-01-01

    Acinetobacter baumannii is recognised as a major pathogen of nosocomial infections that frequently show resistance to last-resort antimicrobials. To investigate whether A. baumannii from companion animals harbour carbapenem resistance mechanisms, 223 clinical isolates obtained from veterinary clinics between 2000 and 2013 in Germany were screened for carbapenem-non-susceptibility employing meropenem-containing Mueller-Hinton agar plates. Minimum inhibitory concentration (MIC) data were obtained using the VITEK(®)2 system. Assignment to international clones (ICs) was done by multiplex PCR or repetitive sequence-based PCR employing the DiversiLab system. Clonality was studied using pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Genes encoding carbapenemases and aminoglycoside-modifying enzymes were detected by PCR. In three samples from dogs, carbapenem-resistant A. baumannii carrying the blaOXA-23 gene on plasmids and located on transposon Tn2008 were identified. The isolates belonged to sequence type ST1(P) (clonal complex CC1/IC1/pulsotype II) and ST10(P) (CC10/IC8/pulsotype IV) according to the Pasteur MLST scheme, and to ST231(Ox) (CC109) and ST585(Ox) (CC447) following the Oxford scheme. Insertion sequence ISAba1 was identified upstream of blaOXA-66 in 58 A. baumannii isolates. MLST referred them to ST2(P) (CC2/IC2/pulsotypes I and III), ST208(Ox), ST350(Ox) and ST556(Ox) (all CC118), respectively. PFGE suggested nosocomial spread of these highly related strains, which frequently demonstrated a multidrug-resistant phenotype, in one veterinary clinic. These data show that A. baumannii from companion animals reveal resistance determinants and clonal lineages of strains globally emerging in humans. This suggests an interspecies transmission and warrants molecular surveillance of A. baumannii in veterinary clinics to mitigate its further spread.

  19. The probability of the Acinetobacter baumannii strain clonal spreading in donor-recipient systems, as confirmed by the molecular analysis of randomly amplified polymorphic DNA.

    PubMed

    Sikora, M; Netsvyetayeva, I; Golas, M; Swoboda-Kopec, E; de Walthoffen, S Walter; Sawicka-Grzelak, A; Pacholczyk, M; Chmura, A; Mlynarczyk, G

    2011-10-01

    Acinetobacter baumannii is an important pathogen widely distributed in the hospital environment and responsible for a variety of nosocomial infections. This micro-organism especially affects patients with impaired host defenses in the intensive care unit. It has been implicated in severe nosocomial infections including bloodstream infections, pneumonia, and meningitides. Those infections are often outbreaks caused by a single clone spreading. The aim of our study was an epidemiological analysis of Acinetobacter baumannii strains isolated from hospitalized liver/kidney transplant donors and recipients. The analyzed material for epidemiological test included 13 A. baumannii strains isolated in 2010 from eight liver/kidney donors and 5 organ recipients. The epidemiological analysis of the isolates was performed by the use of the random amplified polymorphic DNA (RAPD)-polymerase chain reaction method to determine their genetic relatedness. We isolated 9 A. baumannii strains from 8 organ donors. Among this group of isolates, four strains showed the same fingerprints that were classified as one RAPD type 1. The remaining donor isolates revealed differentiated patterns. All strains isolated from recipients formed distinct RAPD types, one of which was identical to the group of four donor strains (RAPD type 1). The clonal spreading of A. baumannii strains was not observed among recipients but we noted a single case of probable transmission of the pathogen from the donor to the recipient.

  20. Characterization of the chromosomal cephalosporinases produced by Acinetobacter lwoffii and Acinetobacter baumannii clinical isolates.

    PubMed Central

    Perilli, M; Felici, A; Oratore, A; Cornaglia, G; Bonfiglio, G; Rossolini, G M; Amicosante, G

    1996-01-01

    The beta-lactamases produced by Acinetobacter lwoffii ULA-501, Acinetobacter baumannii ULA-187, and A. baumannii AC-14 strains were purified and characterized, and their kinetic interactions with several beta-lactam molecules, including substrates and inhibitors, were studied in detail. The three enzymes appeared to be cephalosporinases with different acylation efficiencies (kcat/Km ratio values), and their hydrolytic activities were inhibited by benzylpenicillin, piperacillin, and cefotaxime, which did not behave as substrates. Carbenicillin was a substrate for the beta-lactamase from A. lwoffii ULA-501, whereas it acted as a transient inactivator of the enzymes produced by the two A. baumannii strains. Clavulanic acid was unable to inactivate the three beta-lactamases, whereas sulbactam behaved as an inactivator only at a high concentration (1 mM) which is difficult to achieve during antibiotic therapy. Analysis of the interaction with 6-beta-iodopenicillanic acid also allowed us to better discriminate the three beta-lactamases analyzed in the present study, which can be included in the group 1 functional class (5). PMID:8851599

  1. Regional differences and trends in antimicrobial susceptibility of Acinetobacter baumannii.

    PubMed

    Lob, Sibylle H; Hoban, Daryl J; Sahm, Daniel F; Badal, Robert E

    2016-04-01

    Acinetobacter baumannii, although representing a small percentage of Gram-negative bacilli isolates in intra-abdominal infections (IAIs) and urinary tract infections (UTIs), is frequently multidrug-resistant (MDR) and can pose difficult therapeutic challenges. From 2011 to 2014, 2337 A. baumannii were collected from IAIs and UTIs at 453 hospital sites in 48 countries as part of the SMART ongoing surveillance initiative. Current susceptibility and multidrug resistance, defined as resistance to at least three of the tested drug classes, were determined in a subset of 1011 isolates from 2013 to 2014. A. baumannii comprised 0.7-4.6% of all aerobic and facultative Gram-negative bacilli isolated in six global regions. MDR rates were lowest in North America (47%) and highest in Europe and the Middle East (>93%), with higher rates in ICUs than in non-ICU wards in almost all regions. Antimicrobial susceptibility profiles varied by region but resistance was high everywhere, with no drug inhibiting >70% of A. baumannii isolates in any region. Susceptibility to imipenem was highest in North America (64%) and lowest in Europe and the Middle East (≤11%). Amikacin overall was the most active of the studied agents, including against MDR isolates (of which 11-38% were susceptible). Trend analysis of only those countries that contributed isolates in each study year (2011-2014) demonstrated an increasing trend in MDR rates in the Middle East as well as decreasing susceptibility to several single antimicrobial agents in Africa, Europe and the Middle East. These patterns and trends can help direct antimicrobial therapy and infection control efforts.

  2. Towards the complete small RNome of Acinetobacter baumannii

    PubMed Central

    Weiss, Andy; Broach, William H.; Lee, Mackenzie C.

    2016-01-01

    In recent years, the Gram-negative bacterium Acinetobacter baumannii has garnered considerable attention for its unprecedented capacity to rapidly develop resistance to antibacterial therapeutics. This is coupled with the seemingly epidemic emergence of new hyper-virulent strains. Although strain-specific differences for A. baumannii isolates have been well described, these studies have primarily focused on proteinaceous factors. At present, only limited publications have investigated the presence and role of small regulatory RNA (sRNA) transcripts. Herein, we perform such an analysis, describing the RNA-seq-based identification of 78 A. baumannii sRNAs in the AB5075 background. Together with six previously identified elements, we include each of these in a new genome annotation file, which will serve as a tool to investigate regulatory events in this organism. Our work reveals that the sRNAs display high expression, accounting for >50 % of the 20 most strongly expressed genes. Through conservation analysis we identified six classes of similar sRNAs, with one found to be particularly abundant and homologous to regulatory, C4 antisense RNAs found in bacteriophages. These elements appear to be processed from larger transcripts in an analogous manner to the phage C4 molecule and are putatively controlled by two further sRNAs that are strongly antisense to them. Collectively, this study offers a detailed view of the sRNA content of A. baumannii, exposing sequence and structural conservation amongst these elements, and provides novel insight into the potential evolution, and role, of these understudied regulatory molecules. PMID:28348845

  3. Post Neurosurgical Meningitis due to Colistin Heteroresistant Acinetobacter baumannii

    PubMed Central

    Moosavian, Mojtaba; Shoja, Saeed; Nashibi, Roohangiz; Ebrahimi, Nasim; Tabatabaiefar, Mohammad Amin; Rostami, Soodabeh; Peymani, Amir

    2014-01-01

    Introduction: Recently Acinetobacter baumannii isolates have emerged as a problematic infectious agent that causes meningitis in neurosurgical patients. Colistin has been used successfully for the treatment of A. baumannii meningitis but colistin resistant isolates have been reported worldwide. Case Presentation: Two isolates of A. baumannii were cultured during a five-day period from cerebrospinal fluid (CSF) samples of a 20-year-old man with a gunshot trauma in the abdomen, which had exited from his back. Antimicrobial susceptibility tests of isolates were performed. Multiplex PCR was performed for detection of blaOXA-23-like, blaOXA-24-like and blaOXA-58-like genes. Metallo-β-lactamase genes such as: blaVIM, blaIMP, blaSPM and blaNDM were sought by singleplex PCR. In order to evaluate the genetic relationship, two isolates were examined by the repetitive extragenic palindromic-polymerase chain reaction (REP_PCR) method. Conclusions: E-test results showed that the isolates were sensitive to colistin and tigecycline with minimum inhibitory concentration of (MIC) 0.25 µg/mL and 1.5 µg/mL, respectively. Secondly the isolates were resistant to colistin with MIC > 256 µg/mL but remained sensitive to tigecycline with MIC 1.5 µg/mL. On the basis of the multiplex PCR, both of the isolates were positive for blaOXA-23-like. Other investigated genes such as blaOXA-24-like, blaOXA-58-like, blaVIM, blaIMP, blaSPM and blaNDM were negative. REP-PCR results showed that two isolates were derived from a single strain and both were the same. The results of our study revealed that the firs isolate of A. baumannii was colistin heteroresistant and was changed to completely resistant during therapy. Diagnosis and treatment of A. baumannii meningitis is very important and to avoid treatment failure we suggest that all A. baumannii isolates obtained from CSF should be evaluated properly for colistin heteroresistance. PMID:25632326

  4. [Successful treatment of a patient with multidrug resistant Acinetobacter baumannii meningitis with high dose ampicillin-sulbactam].

    PubMed

    Sayin Kutlu, Selda; Saçar, Suzan; Süzer, Tuncer; Cevahir, Nural; Okke, Demet; Dirgen Caylak, Selmin; Turgut, Hüseyin

    2008-04-01

    Acinetobacter baumannii is an important pathogen which causes severe nosocomial infections such as meningitis. Multidrug resistance is a growing problem throughout the world. In this report a case of multidrug resistant A.baumannii meningitis, treated with high dose of ampicillin-sulbactam (SAM) was presented. Rhinorrhea and confusion developed on the postoperative seventh day in a 67 years old male patient operated for macroadenoma of the hyphophysis gland. Since the cerebrospinal fluid (CSF) findings indicated a central nervous system infection, nosocomial meningitis was diagnosed and intravenous ceftazidime and vancomycin have started. Blood and CSF cultures of the patient revealed no growth and his general condition has improved. However, fever and confusion emerged again on the 21st day of therapy and the repeat CSF sample revealed increased pressure, purulent appearance, 510/mm3 leukocytes (90% PMNL), 58 mg/dl glucose (simultaneous blood glucose was 144 mg/dl) and 49 mg/dl protein. Direct microscopic examination of CSF revealed gram-negative coccobacilli and A.baumannii was identified in the culture. The isolate was resistant to piperacillin-tazobactam, third generation cephalosporins, aztreonam, ciprofloxacin, carbapenems and aminoglycosides, susceptible to sulbactam ampicillin and colistin. Ampicillin (12 gr) and sulbactam (6 gr) treatment was initiated and at the 72nd hour of the therapy the temperature and conciousness level of the patient returned to normal. Control CSF sample obtained on the 14th day of treatment revealed no leukocytes and no bacterial growth. The treatment was continued for 21 days and the patient recovered without any sequela. Since colistin which is one of the alternative antimicrobial treatment choices for resistant Acinetobacter infections, is not found in Turkey, sulbactam-ampicillin might be an effective and safe choice for the treatment of multi-resistant A. baumannii meningitis if the isolate was proven to be susceptible by

  5. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System.

    PubMed

    Ruiz, Federico M; Santillana, Elena; Spínola-Amilibia, Mercedes; Torreira, Eva; Culebras, Esther; Romero, Antonio

    2015-01-01

    The type VI secretion system (T6SS) is a bacterial macromolecular machine widely distributed in Gram-negative bacteria, which transports effector proteins into eukaryotic host cells or other bacteria. Membrane complexes and a central tubular structure, which resembles the tail of contractile bacteriophages, compose the T6SS. One of the proteins forming this tube is the hemolysin co-regulated protein (Hcp), which acts as virulence factor, as transporter of effectors and as a chaperone. In this study, we present the structure of Hcp from Acinetobacter baumannii, together with functional and oligomerization studies. The structure of this protein exhibits a tight β barrel formed by two β sheets and flanked at one side by a short α-helix. Six Hcp molecules associate to form a donut-shaped hexamer, as observed in both the crystal structure and solution. These results emphasize the importance of this oligomerization state in this family of proteins, despite the low similarity of sequence among them. The structure presented in this study is the first one for a protein forming part of a functional T6SS from A. baumannii. These results will help us to understand the mechanism and function of this secretion system in this opportunistic nosocomial pathogen.

  6. Demonstration of the interactions between aromatic compound-loaded lipid nanocapsules and Acinetobacter baumannii bacterial membrane.

    PubMed

    Montagu, A; Joly-Guillou, M-L; Guillet, C; Bejaud, J; Rossines, E; Saulnier, P

    2016-06-15

    Acinetobacter baumannii is an important nosocomial pathogen that is resistant to many commonly-used antibiotics. One strategy for treatment is the use of aromatic compounds (carvacrol, cinnamaldehyde) against A. baumannii. The aim of this study was to determine the interactions between bacteria and lipid nanocapsules (LNCs) over time based on the fluorescence of 3,3'-Dioctadecyloxacarbocyanine Perchlorate-LNCs (DiO-LNCs) and the properties of trypan blue to analyse the physicochemical mechanisms occurring at the level of the biological membrane. The results demonstrated the capacity of carvacrol-loaded LNCs to interact with and penetrate the bacterial membrane in comparison with cinnamaldehyde-loaded LNCs and unloaded LNCs. Modifications of carvacrol after substitution of hydroxyl functional groups by fatty acids demonstrated the crucial role of hydroxyl functions in antibacterial activity. Finally, after contact with the efflux pump inhibitor, carbonylcyanide-3-chlorophenyl hydrazine (CCCP), the results indicated the total synergistic antibacterial effect with Car-LNCs, showing that CCCP is associated with the action mechanism of carvacrol, especially at the level of the efflux pump mechanism.

  7. Crystal Structure of Hcp from Acinetobacter baumannii: A Component of the Type VI Secretion System

    PubMed Central

    Ruiz, Federico M.; Santillana, Elena; Spínola-Amilibia, Mercedes; Torreira, Eva; Culebras, Esther; Romero, Antonio

    2015-01-01

    The type VI secretion system (T6SS) is a bacterial macromolecular machine widely distributed in Gram-negative bacteria, which transports effector proteins into eukaryotic host cells or other bacteria. Membrane complexes and a central tubular structure, which resembles the tail of contractile bacteriophages, compose the T6SS. One of the proteins forming this tube is the hemolysin co-regulated protein (Hcp), which acts as virulence factor, as transporter of effectors and as a chaperone. In this study, we present the structure of Hcp from Acinetobacter baumannii, together with functional and oligomerization studies. The structure of this protein exhibits a tight β barrel formed by two β sheets and flanked at one side by a short α-helix. Six Hcp molecules associate to form a donut-shaped hexamer, as observed in both the crystal structure and solution. These results emphasize the importance of this oligomerization state in this family of proteins, despite the low similarity of sequence among them. The structure presented in this study is the first one for a protein forming part of a functional T6SS from A. baumannii. These results will help us to understand the mechanism and function of this secretion system in this opportunistic nosocomial pathogen. PMID:26079269

  8. Acinetobacter baumannii Biofilm Formation in Human Serum and Disruption by Gallium.

    PubMed

    Runci, Federica; Bonchi, Carlo; Frangipani, Emanuela; Visaggio, Daniela; Visca, Paolo

    2017-01-01

    Biofilm-associated infections caused by Acinetobacter baumannii are extremely recalcitrant to antibiotic treatment. We report that A. baumannii develops a mature biofilm when grown in complement-free human serum (HS). We demonstrate that 16 μM gallium nitrate (GaN) drastically reduces A. baumannii growth and biofilm formation in HS, whereas 64 μM GaN causes massive disruption of preformed A. baumannii biofilm. These findings pave the way to the repurposing of GaN as an antibiofilm agent for A. baumannii. Copyright © 2016 American Society for Microbiology.

  9. Osmotic Compounds Enhance Antibiotic Efficacy against Acinetobacter baumannii Biofilm Communities.

    PubMed

    Falghoush, Azeza; Beyenal, Haluk; Besser, Thomas E; Omsland, Anders; Call, Douglas R

    2017-10-01

    Biofilm-associated infections are a clinical challenge, in part because a hydrated matrix protects the bacterial community from antibiotics. Herein, we evaluated how different osmotic compounds (maltodextrin, sucrose, and polyethylene glycol [PEG]) enhance antibiotic efficacy against Acinetobacter baumannii biofilm communities. Established (24-h) test tube biofilms (strain ATCC 17978) were treated with osmotic compounds in the presence or absence of 10× the MIC of different antibiotics (50 μg/ml tobramycin, 20 μg/ml ciprofloxacin, 300 μg/ml chloramphenicol, 30 μg/ml nalidixic acid, or 100 μg/ml erythromycin). Combining antibiotics with hypertonic concentrations of the osmotic compounds for 24 h reduced the number of biofilm bacteria by 5 to 7 log (P < 0.05). Increasing concentrations of osmotic compounds improved the effect, but there was a trade-off with increasing solution viscosity, whereby low-molecular-mass compounds (sucrose, 400-Da PEG) worked better than higher-mass compounds (maltodextrin, 3,350-Da PEG). Ten other A. baumannii strains were similarly treated with 400-Da PEG and tobramycin, resulting in a mean 2.7-log reduction in recoverable bacteria compared with tobramycin treatment alone. Multivariate regression models with data from different osmotic compounds and nine antibiotics demonstrated that the benefit from combining hypertonic treatments with antibiotics is a function of antibiotic mass and lipophilicity (r(2) > 0.82; P < 0.002), and the relationship was generalizable for biofilms formed by A. baumannii and Escherichia coli K-12. Augmenting topical antibiotic therapies with a low-mass hypertonic treatment may enhance the efficacy of antibiotics against wound biofilms, particularly when using low-mass hydrophilic antibiotics.IMPORTANCE Biofilms form a barrier that protects bacteria from environmental insults, including exposure to antibiotics. We demonstrated that multiple osmotic compounds can enhance antibiotic efficacy against

  10. Platelet-activating Factor Receptor Initiates Contact of Acinetobacter baumannii Expressing Phosphorylcholine with Host Cells

    PubMed Central

    Smani, Younes; Docobo-Pérez, Fernando; López-Rojas, Rafael; Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo

    2012-01-01

    Adhesion is an initial and important step in Acinetobacter baumannii causing infections. However, the exact molecular mechanism of such a step between A. baumannii and the host cells remains unclear. Here, we demonstrated that the phosphorylcholine (ChoP)-containing outer membrane protein of A. baumannii binds to A549 cells through platelet-activating factor receptor (PAFR), resulting in activation of G protein and intracellular calcium. Upon A. baumannii expressing ChoP binding to PAFR, clathrin and β-arrestins, proteins involved in the direction of the vacuolar movement, are activated during invasion of A. baumannii. PAFR antagonism restricts the dissemination of A. baumannii in the pneumonia model. These results define a role for PAFR in A. baumannii interaction with host cells and suggest a mechanism for the entry of A. baumannii into the cytoplasm of host cells. PMID:22689572

  11. Controlling endemic multidrug-resistant Acinetobacter baumannii in Intensive Care Units using antimicrobial stewardship and infection control

    PubMed Central

    Cheon, Shinhye; Kim, Mi-Ja; Yun, Seon-Jin; Moon, Jae Young; Kim, Yeon-Sook

    2016-01-01

    Background/Aims: Nosocomial infections caused by multidrug-resistant (MDR) Acinetobacter baumannii have become public-health problem. However, few studies have evaluated the control of endemic MDR A. baumannii in Intensive Care Units (ICUs). Therefore, we investigated the effectiveness of antimicrobial stewardship and comprehensive intensified infection control measures for controlling endemic MDR A. baumannii in ICUs at a tertiary care center. Methods: Carbapenem use was strictly restricted through antimicrobial stewardship. Environmental cleaning and disinfection was performed at least 3 times per day in addition to basic infection control measures. Isolation using plastic curtains and contact precautions were applied to patients who were colonized or infected with MDR A. baumannii. The outcome was measured as the incidence density rate of hospital-onset MDR A. baumannii among patients in the ICUs. Results: The incidence density rate of hospital-onset MDR A. baumannii decreased from 22.82 cases per 1,000 patient-days to 2.68 cases per 1,000 patient-days after the interventions were implemented (odds ratio, 0.12; 95% confidence interval, 0.03 to 0.4; p < 0.001). The mean monthly use of carbapenems also decreased from 134.99 ± 82.26 defined daily doses per 1,000 patient-days to 94.85 ± 50.98 defined daily doses per 1,000 patient-days (p = 0.016). Conclusions: Concomitant implementation of strict antimicrobial stewardship and comprehensive infection control measures effectively controlled endemic MDR A. baumannii in our ICUs within 1 year. PMID:26874513

  12. Occupational Transmission of Acinetobacter baumannii from a United States Serviceman Wounded in Iraq to a Health Care Worker

    PubMed Central

    Whitman, Timothy J.; Qasba, Sonia S.; Timpone, Joseph G.; Babel, Britta S.; Kasper, Matthew R.; English, Judith F.; Sanders, John W.; Hujer, Kristine M.; Hujer, Andrea M.; Endimiani, Andrea; Eshoo, Mark W.; Bonomo, Robert A.

    2014-01-01

    Background Acinetobacter baumannii is increasingly recognized as being a significant pathogen associated with nosocomial outbreaks in both civilian and military treatment facilities. Current analyses of these outbreaks frequently describe patient-to-patient transmission. To date, occupational transmission of A. baumannii from a patient to a health care worker (HCW) has not been reported. We initiated an investigation of an HCW with a complicated case of A. baumannii pneumonia to determine whether a link existed between her illness and A. baumannii–infected patients in a military treatment facility who had been entrusted to her care. Methods Pulsed-field gel electrophoresis and polymerase chain reaction/electrospray ionization mass spectrometry, a form of multilocus sequencing typing, were done to determine clonality. To further characterize the isolates, we performed a genetic analysis of resistance determinants. Results and Conclusions A “look-back” analysis revealed that the multidrug resistant A. baumannii recovered from the HCW and from a patient in her care were indistinguishable by pulsed-field gel electrophoresis. In addition, polymerase chain reaction/electrospray ionization mass spectrometry indicated that the isolates were similar to strains of A. baumannii derived from European clone type II (Walter Reed Army Medical Center strain type 11). The exposure of the HCW to the index patient lasted for only 30 min and involved endotracheal suctioning without use of an HCW mask. An examination of 90 A. baumannii isolates collected during this investigation showed that 2 major and multiple minor clone types were present and that the isolates from the HCW and from the index patient were the most prevalent clone type. Occupational transmission likely occurred in the hospital; HCWs caring for patients infected with A. baumannii should be aware of this potential mode of infection spread. PMID:18611162

  13. [Distribution of blaOXA genes in Acinetobacter baumannii strains: a multicenter study].

    PubMed

    Ciftci, Ihsan Hakkı; Aşık, Gülşah; Karakeçe, Engin; Oksüz, Lütfiye; Yağcı, Server; Sesli Çetin, Emel; Ozdemir, Mehmet; Atasoy, Ali Rıza; Koçoğlu, Esra; Gül, Mustafa; Kurtoğlu, Muhammet Güzel; Köksal Çakırlar, Fatma; Seyrek, Adnan; Berktaş, Mustafa; Gültepe, Bilge; Ayyildiz, Ahmet

    2013-10-01

    Acinetobacter baumannii is the most important agent of nosocomial infections within the Acinetobacter genus. This gram-negative coccobacillus is intrinsically resistant to many antibiotics used in antimicrobial therapy, and capable of developing resistance including carbapenems. The objective of this study was to develop a multiplex real time polymerase chain reaction (qPCR) kit for OXA subgroups in A.baumannii, and to investigate the distribution of OXA subgroups in A.baumannii strains isolated from geographically different regions of Turkey. A total of 834 A.baumannii clinical isolates collected from different state and university medical centers in 13 provinces (Afyonkarahisar, Ankara, Bolu, Elazig, Erzurum, Isparta, Istanbul, Kahramanmaras, Konya, Sakarya, Van) between 2008-2011, were included in the study. The isolates were identified by conventional methods and automated systems [Vitek2 (bioMerieux, ABD) and Phoenix (BD Diagnostic, MD)]. The susceptibility profiles of the isolates were studied with automated systems and standard disc diffusion method. All samples were subjected to qPCR to detect blaOXA-51-like, blaOXA-23-like and blaOXA-58-like genes. A conventional PCR method was also used to detect blaOXA-24-like gene. The resistance rates observed during the study period were as follows: 96.8% for amoxicillin-clavulanate, 86.8% for ciprofloxacin, 74.7% for gentamicin, 71.7% for amikacin, 73.5% for cefaperozone-sulbactam, 72.1% for imipenem and 73% for meropenem. Six hundred and two (72.2 %) isolates were resistant to both imipenem and meropenem. Colistin was found to be the most effective antibiotic against A.baumannii isolates with 100% susceptibility rate. All isolates were positive for blaOXA-51-like, however blaOXA-24-like gene could not be demonstrated in any isolate. Total positivity rates of blaOXA-23-like and blaOXA-58-like genes were found as 53.7% and 12.5%, respectively, while these rates were 74.4% and 17.3% in carbapenem-resistant isolates

  14. Prevalence of antibiotic resistance among Acinetobacter baumannii isolates from Aleppo, Syria.

    PubMed

    Hamzeh, Abdul Rezzak; Al Najjar, Mona; Mahfoud, Maysa

    2012-10-01

    This study describes and analyzes Acinetobacter baumannii antibiotic susceptibly profile in Aleppo, Syria, thus providing vital information for guiding treatment of A baumannii infections. Two hundred sixty nonrepetitive A baumannii isolates were studied over 3.5 years. Resistance rates are at the higher end of globally reported levels. Newer cephalosporins and β-lactamase-resistant agents are becoming practically ineffective. Better activity is limited to carbapenems and colistin, which elicited the highest susceptibility levels.

  15. Community-acquired Acinetobacter baumannii: clinical characteristics, epidemiology and pathogenesis.

    PubMed

    Dexter, Carina; Murray, Gerald L; Paulsen, Ian T; Peleg, Anton Y

    2015-05-01

    Community-acquired Acinetobacter baumannii (CA-Ab) is a rare but serious cause of community-acquired pneumonia in tropical regions of the world. CA-Ab infections predominantly affect individuals with risk factors, which include excess alcohol consumption, diabetes mellitus, smoking and chronic lung disease. CA-Ab pneumonia presents as a surprisingly fulminant course and is characterized by a rapid onset of fever, severe respiratory symptoms and multi-organ dysfunction, with a mortality rate reported as high as 64%. It is unclear whether the distinct clinical syndrome caused by CA-Ab is because of host predisposing factors or unique bacterial characteristics, or a combination of both. Deepening our understanding of the drivers of overwhelming CA-Ab infection will provide important insights into preventative and therapeutic strategies.

  16. Crystal Structure of Carbapenemase OXA-58 from Acinetobacter baumannii

    PubMed Central

    Antunes, Nuno Tiago; Toth, Marta

    2014-01-01

    Class D β-lactamases capable of hydrolyzing last-resort carbapenem antibiotics represent a major challenge for treatment of bacterial infections. Wide dissemination of these enzymes in Acinetobacter baumannii elevated this pathogen to the category of most deadly and difficult to treat. We present here the structure of the OXA-58 β-lactamase, a major class D carbapenemase of A. baumannii, determined to 1.30-Å resolution. Unlike two other Acinetobacter carbapenemases, OXA23 and OXA-24, the OXA-58 enzyme lacks the characteristic hydrophobic bridge over the active site, despite conservation of the residues which participate in its formation. The active-site residues in OXA-58 are spatially conserved in comparison to those in other class D β-lactamases. Lys86, which activates water molecules during the acylation and deacylation steps, is fully carboxylated in the OXA-58 structure. In the absence of a substrate, a water molecule is observed in the active site of the enzyme and is positioned in the pocket that is usually occupied by the 6α-hydroxyethyl moiety of carbapenems. A water molecule in this location would efficiently deacylate good substrates, such as the penicillins, but in the case of carbapenems, it would be expelled by the 6α-hydroxyethyl moiety of the antibiotics and a water from the surrounding medium would find its way to the vicinity of the carboxylated Lys86 to perform deacylation. Subtle differences in the position of this water in the acyl-enzyme complexes of class D β-lactamases could ultimately be responsible for differences in the catalytic efficiencies of these enzymes against last-resort carbapenem antibiotics. PMID:24468777

  17. Functional features of TonB energy transduction systems of Acinetobacter baumannii.

    PubMed

    Zimbler, Daniel L; Arivett, Brock A; Beckett, Amber C; Menke, Sharon M; Actis, Luis A

    2013-09-01

    Acinetobacter baumannii is an opportunistic pathogen that causes severe nosocomial infections. Strain ATCC 19606(T) utilizes the siderophore acinetobactin to acquire iron under iron-limiting conditions encountered in the host. Accordingly, the genome of this strain has three tonB genes encoding proteins for energy transduction functions needed for the active transport of nutrients, including iron, through the outer membrane. Phylogenetic analysis indicates that these tonB genes, which are present in the genomes of all sequenced A. baumannii strains, were acquired from different sources. Two of these genes occur as components of tonB-exbB-exbD operons and one as a monocistronic copy; all are actively transcribed in ATCC 19606(T). The abilities of components of these TonB systems to complement the growth defect of Escherichia coli W3110 mutants KP1344 (tonB) and RA1051 (exbBD) under iron-chelated conditions further support the roles of these TonB systems in iron acquisition. Mutagenesis analysis of ATCC 19606(T) tonB1 (subscripted numbers represent different copies of genes or proteins) and tonB2 supports this hypothesis: their inactivation results in growth defects in iron-chelated media, without affecting acinetobactin biosynthesis or the production of the acinetobactin outer membrane receptor protein BauA. In vivo assays using Galleria mellonella show that each TonB protein is involved in, but not essential for, bacterial virulence in this infection model. Furthermore, we observed that TonB2 plays a role in the ability of bacteria to bind to fibronectin and to adhere to A549 cells by uncharacterized mechanisms. Taken together, these results indicate that A. baumannii ATCC 19606(T) produces three independent TonB proteins, which appear to provide the energy-transducing functions needed for iron acquisition and cellular processes that play a role in the virulence of this pathogen.

  18. Functional Features of TonB Energy Transduction Systems of Acinetobacter baumannii

    PubMed Central

    Zimbler, Daniel L.; Arivett, Brock A.; Beckett, Amber C.; Menke, Sharon M.

    2013-01-01

    Acinetobacter baumannii is an opportunistic pathogen that causes severe nosocomial infections. Strain ATCC 19606T utilizes the siderophore acinetobactin to acquire iron under iron-limiting conditions encountered in the host. Accordingly, the genome of this strain has three tonB genes encoding proteins for energy transduction functions needed for the active transport of nutrients, including iron, through the outer membrane. Phylogenetic analysis indicates that these tonB genes, which are present in the genomes of all sequenced A. baumannii strains, were acquired from different sources. Two of these genes occur as components of tonB-exbB-exbD operons and one as a monocistronic copy; all are actively transcribed in ATCC 19606T. The abilities of components of these TonB systems to complement the growth defect of Escherichia coli W3110 mutants KP1344 (tonB) and RA1051 (exbBD) under iron-chelated conditions further support the roles of these TonB systems in iron acquisition. Mutagenesis analysis of ATCC 19606T tonB1 (subscripted numbers represent different copies of genes or proteins) and tonB2 supports this hypothesis: their inactivation results in growth defects in iron-chelated media, without affecting acinetobactin biosynthesis or the production of the acinetobactin outer membrane receptor protein BauA. In vivo assays using Galleria mellonella show that each TonB protein is involved in, but not essential for, bacterial virulence in this infection model. Furthermore, we observed that TonB2 plays a role in the ability of bacteria to bind to fibronectin and to adhere to A549 cells by uncharacterized mechanisms. Taken together, these results indicate that A. baumannii ATCC 19606T produces three independent TonB proteins, which appear to provide the energy-transducing functions needed for iron acquisition and cellular processes that play a role in the virulence of this pathogen. PMID:23817614

  19. Transcriptome Remodeling of Acinetobacter baumannii during Infection and Treatment

    PubMed Central

    Wright, Meredith S.; Jacobs, Michael R.; Bonomo, Robert A.

    2017-01-01

    ABSTRACT Acinetobacter baumannii is an increasingly common multidrug-resistant pathogen in health care settings. Although the genetic basis of antibiotic resistance mechanisms has been extensively studied, much less is known about how genetic variation contributes to other aspects of successful infections. Genetic changes that occur during host infection and treatment have the potential to remodel gene expression patterns related to resistance and pathogenesis. Longitudinal sets of multidrug-resistant A. baumannii isolates from eight patients were analyzed by RNA sequencing (RNA-seq) to identify differentially expressed genes and link them to genetic changes contributing to transcriptional variation at both within-patient and population levels. The number of differentially expressed genes among isolates from the same patient ranged from 26 (patient 588) to 145 (patient 475). Multiple patients had isolates with differential gene expression patterns related to mutations in the pmrAB and adeRS two-component regulatory system genes, as well as significant differences in genes related to antibiotic resistance, iron acquisition, amino acid metabolism, and surface-associated proteins. Population level analysis revealed 39 genetic regions with clade-specific differentially expressed genes, for which 19, 8, and 3 of these could be explained by insertion sequence mobilization, recombination-driven sequence variation, and intergenic mutations, respectively. Multiple types of mutations that arise during infection can significantly remodel the expression of genes that are known to be important in pathogenesis. PMID:28270585

  20. Triclosan resistance in clinical isolates of Acinetobacter baumannii.

    PubMed

    Chen, Yagang; Pi, Borui; Zhou, Hua; Yu, Yunsong; Li, Lanjuan

    2009-08-01

    The susceptibility to triclosan of 732 clinical Acinetobacter baumannii isolates obtained from 25 hospitals in 16 cities in China from December 2004 to December 2005 was screened by using an agar dilution method. Triclosan MICs ranged between 0.015 and 16 mg l(-1), and the MIC(90) was 0.5 mg l(-1), lower than the actual in-use concentration of triclosan. Twenty triclosan-resistant isolates (MICs >or=1 mg l(-1)) were characterized by antibiotic susceptibility, clonal relatedness, fabI mutation, fabI expression, and efflux pump phenotype and expression to elucidate the resistance mechanism of A. baumannii to triclosan. The resistance rates of triclosan-resistant isolates to imipenem, levofloxacin, amikacin and tetracycline were higher than those of triclosan-sensitive isolates. Triclosan resistance was artificially classified as low level (MICs 1-2 mg l(-1)) or high level (MICs >or=4 mg l(-1)). High-level triclosan resistance could be explained by a Gly95Ser mutation of FabI, whilst wild-type fabI was observed to be overexpressed in low-level resistant isolates. Active efflux did not appear to be a major reason for acquired triclosan resistance, but acquisition of resistance appeared to be dependent on a background of intrinsic triclosan efflux.

  1. Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

    PubMed

    Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

    2014-10-01

    This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

  2. Antibiotic modulation of capsular exopolysaccharide and virulence in Acinetobacter baumannii.

    PubMed

    Geisinger, Edward; Isberg, Ralph R

    2015-02-01

    Acinetobacter baumannii is an opportunistic pathogen of increasing importance due to its propensity for intractable multidrug-resistant infections in hospitals. All clinical isolates examined contain a conserved gene cluster, the K locus, which determines the production of complex polysaccharides, including an exopolysaccharide capsule known to protect against killing by host serum and to increase virulence in animal models of infection. Whether the polysaccharides determined by the K locus contribute to intrinsic defenses against antibiotics is unknown. We demonstrate here that mutants deficient in the exopolysaccharide capsule have lowered intrinsic resistance to peptide antibiotics, while a mutation affecting sugar precursors involved in both capsule and lipopolysaccharide synthesis sensitizes the bacterium to multiple antibiotic classes. We observed that, when grown in the presence of certain antibiotics below their MIC, including the translation inhibitors chloramphenicol and erythromycin, A. baumannii increases production of the K locus exopolysaccharide. Hyperproduction of capsular exopolysaccharide is reversible and non-mutational, and occurs concomitantly with increased resistance to the inducing antibiotic that is independent of the presence of the K locus. Strikingly, antibiotic-enhanced capsular exopolysaccharide production confers increased resistance to killing by host complement and increases virulence in a mouse model of systemic infection. Finally, we show that augmented capsule production upon antibiotic exposure is facilitated by transcriptional increases in K locus gene expression that are dependent on a two-component regulatory system, bfmRS. These studies reveal that the synthesis of capsule, a major pathogenicity determinant, is regulated in response to antibiotic stress. Our data are consistent with a model in which gene expression changes triggered by ineffectual antibiotic treatment cause A. baumannii to transition between states of low

  3. Antibiotic Modulation of Capsular Exopolysaccharide and Virulence in Acinetobacter baumannii

    PubMed Central

    Geisinger, Edward; Isberg, Ralph R.

    2015-01-01

    Acinetobacter baumannii is an opportunistic pathogen of increasing importance due to its propensity for intractable multidrug-resistant infections in hospitals. All clinical isolates examined contain a conserved gene cluster, the K locus, which determines the production of complex polysaccharides, including an exopolysaccharide capsule known to protect against killing by host serum and to increase virulence in animal models of infection. Whether the polysaccharides determined by the K locus contribute to intrinsic defenses against antibiotics is unknown. We demonstrate here that mutants deficient in the exopolysaccharide capsule have lowered intrinsic resistance to peptide antibiotics, while a mutation affecting sugar precursors involved in both capsule and lipopolysaccharide synthesis sensitizes the bacterium to multiple antibiotic classes. We observed that, when grown in the presence of certain antibiotics below their MIC, including the translation inhibitors chloramphenicol and erythromycin, A. baumannii increases production of the K locus exopolysaccharide. Hyperproduction of capsular exopolysaccharide is reversible and non-mutational, and occurs concomitantly with increased resistance to the inducing antibiotic that is independent of the presence of the K locus. Strikingly, antibiotic-enhanced capsular exopolysaccharide production confers increased resistance to killing by host complement and increases virulence in a mouse model of systemic infection. Finally, we show that augmented capsule production upon antibiotic exposure is facilitated by transcriptional increases in K locus gene expression that are dependent on a two-component regulatory system, bfmRS. These studies reveal that the synthesis of capsule, a major pathogenicity determinant, is regulated in response to antibiotic stress. Our data are consistent with a model in which gene expression changes triggered by ineffectual antibiotic treatment cause A. baumannii to transition between states of low

  4. Genome Sequence of an Acinetobacter baumannii Strain Carrying Three Acquired Carbapenemase Genes

    PubMed Central

    Oinuma, Ken-Ichi; Suzuki, Masato; Sato, Kanako; Nakaie, Kiyotaka; Niki, Makoto; Takizawa, Etsuko; Niki, Mamiko; Shibayama, Keigo; Yamada, Koichi; Kakeya, Hiroshi

    2016-01-01

    The emergence of multiple-carbapenemase-producing Acinetobacter strains has been a serious concern during the past decade. Here, we report the draft genome sequence of an Acinetobacter baumannii strain isolated from a Japanese patient with three acquired carbapenemase genes: blaNDM-1, blaTMB-1, and blaOXA-58. PMID:27856588

  5. Structural basis for fragmenting the exopolysaccharide of Acinetobacter baumannii by bacteriophage ΦAB6 tailspike protein

    PubMed Central

    Lee, I-Ming; Tu, I-Fan; Yang, Feng-Ling; Ko, Tzu-Ping; Liao, Jiahn-Haur; Lin, Nien-Tsung; Wu, Chung-Yi; Ren, Chien-Tai; Wang, Andrew H.-J.; Chang, Ching-Ming; Huang, Kai-Fa; Wu, Shih-Hsiung

    2017-01-01

    With an increase in antibiotic-resistant strains, the nosocomial pathogen Acinetobacter baumannii has become a serious threat to global health. Glycoconjugate vaccines containing fragments of bacterial exopolysaccharide (EPS) are an emerging therapeutic to combat bacterial infection. Herein, we characterize the bacteriophage ΦAB6 tailspike protein (TSP), which specifically hydrolyzed the EPS of A. baumannii strain 54149 (Ab-54149). Ab-54149 EPS exhibited the same chemical structure as two antibiotic-resistant A. baumannii strains. The ΦAB6 TSP-digested products comprised oligosaccharides of two repeat units, typically with stoichiometric pseudaminic acid (Pse). The 1.48-1.89-Å resolution crystal structures of an N-terminally-truncated ΦAB6 TSP and its complexes with the semi-hydrolyzed products revealed a trimeric β-helix architecture that bears intersubunit carbohydrate-binding grooves, with some features unusual to the TSP family. The structures suggest that Pse in the substrate is an important recognition site for ΦAB6 TSP. A region in the carbohydrate-binding groove is identified as the determinant of product specificity. The structures also elucidated a retaining mechanism, for which the catalytic residues were verified by site-directed mutagenesis. Our findings provide a structural basis for engineering the enzyme to produce desired oligosaccharides, which is useful for the development of glycoconjugate vaccines against A. baumannii infection. PMID:28209973

  6. Characterization of surface antigen protein 1 (SurA1) from Acinetobacter baumannii and its role in virulence and fitness.

    PubMed

    Liu, Dong; Liu, Zeng-Shan; Hu, Pan; Cai, Ling; Fu, Bao-Quan; Li, Yan-Song; Lu, Shi-Ying; Liu, Nan-Nan; Ma, Xiao-Long; Chi, Dan; Chang, Jiang; Shui, Yi-Ming; Li, Zhao-Hui; Ahmad, Waqas; Zhou, Yu; Ren, Hong-Lin

    2016-04-15

    Acinetobacter baumannii is a Gram-negative bacillus that causes nosocomial infections, such as bacteremia, pneumonia, and meningitis and urinary tract and wound infections. In the present study, the surface antigen protein 1 (SurA1) gene of A. baumannii strain CCGGD201101 was identified, cloned and expressed, and then its roles in fitness and virulence were investigated. Virulence was observed in the human lung cancer cell lines A549 and HEp-2 at one week after treatment with recombinant SurA1. One isogenic SurA1 knock-out strain, GR0015, which was derived from the A. baumannii strain CCGGD201101 isolated from diseased chicks in a previous study, highlighted the effect of SurA1 on fitness and growth. Its growth rate in LB broth and killing activity in human sera were significantly decreased compared with strain CCGGD201101. In the Galleria mellonella insect model, the isogenic SurA1 knock-out strain exhibited a lower survival rate and decreased dissemination. These results suggest that SurA1 plays an important role in the fitness and virulence of A. baumannii.

  7. Structural basis for fragmenting the exopolysaccharide of Acinetobacter baumannii by bacteriophage ΦAB6 tailspike protein.

    PubMed

    Lee, I-Ming; Tu, I-Fan; Yang, Feng-Ling; Ko, Tzu-Ping; Liao, Jiahn-Haur; Lin, Nien-Tsung; Wu, Chung-Yi; Ren, Chien-Tai; Wang, Andrew H-J; Chang, Ching-Ming; Huang, Kai-Fa; Wu, Shih-Hsiung

    2017-02-17

    With an increase in antibiotic-resistant strains, the nosocomial pathogen Acinetobacter baumannii has become a serious threat to global health. Glycoconjugate vaccines containing fragments of bacterial exopolysaccharide (EPS) are an emerging therapeutic to combat bacterial infection. Herein, we characterize the bacteriophage ΦAB6 tailspike protein (TSP), which specifically hydrolyzed the EPS of A. baumannii strain 54149 (Ab-54149). Ab-54149 EPS exhibited the same chemical structure as two antibiotic-resistant A. baumannii strains. The ΦAB6 TSP-digested products comprised oligosaccharides of two repeat units, typically with stoichiometric pseudaminic acid (Pse). The 1.48-1.89-Å resolution crystal structures of an N-terminally-truncated ΦAB6 TSP and its complexes with the semi-hydrolyzed products revealed a trimeric β-helix architecture that bears intersubunit carbohydrate-binding grooves, with some features unusual to the TSP family. The structures suggest that Pse in the substrate is an important recognition site for ΦAB6 TSP. A region in the carbohydrate-binding groove is identified as the determinant of product specificity. The structures also elucidated a retaining mechanism, for which the catalytic residues were verified by site-directed mutagenesis. Our findings provide a structural basis for engineering the enzyme to produce desired oligosaccharides, which is useful for the development of glycoconjugate vaccines against A. baumannii infection.

  8. A Method for generating marker-less gene deletions in multidrug-resistant Acinetobacter baumannii

    PubMed Central

    2013-01-01

    Background Acinetobacter baumannii is an important nosocomial pathogen that has become increasingly resistant to multiple antibiotics. Genetic manipulation of MDR A. baumannii is useful especially for defining the contribution of each active efflux mechanism in multidrug resistance. Existing methods rely on the use of an antibiotic selection marker and are not suited for multiple gene deletions. Results A tellurite-resistant (sacB+, xylE+) suicide vector, pMo130-TelR, was created for deleting the adeFGH and adeIJK operons in two clinical MDR A. baumannii, DB and R2 from Singapore. Using a two-step selection, plasmid insertion recombinants (first-crossover) were selected for tellurite resistance and the deletion mutants (second-crossover) were then selected for loss of sacB. The DNA deletions were verified by PCR while loss of gene expression in the ΔadeFGH, ΔadeIJK and ΔadeFGHΔadeIJK deletion mutants was confirmed using qRT-PCR. The contribution of AdeFGH and AdeIJK pumps to MDR was defined by comparing antimicrobial susceptibilities of the isogenic mutants and the parental strains. The deletion of adeIJK produced no more than eight-fold increase in susceptibility to nalidixic acid, tetracycline, minocycline, tigecycline, clindamycin, trimethoprim and chloramphenicol, while the deletion of adeL-adeFGH operon alone had no impact on antimicrobial susceptibility. Dye accumulation assays using H33342 revealed increased dye retention in all deletion mutants, except for the R2ΔadeFGH mutant, where a decrease was observed. Increased accumulation of ethidium bromide was observed in the parental strains and all pump deletion mutants in the presence of efflux inhibitors. The efflux pump deletion mutants in this study revealed that only the AdeIJK, but not the AdeFGH RND pump, contributes to antimicrobial resistance and dye accumulation in MDR A. baumannii DB and R2. Conclusions The marker-less gene deletion method using pMo130-TelR is applicable for creating single and

  9. Acinetobacter baumannii Isolated from Lebanese Patients: Phenotypes and Genotypes of Resistance, Clonality, and Determinants of Pathogenicity

    PubMed Central

    Dahdouh, Elias; Hajjar, Micheline; Suarez, Monica; Daoud, Ziad

    2016-01-01

    Introduction: Acinetobacter baumannii is a nosocomial pathogen that usually affects critically ill patients. High mortality rates have been associated with MDR A. baumannii infections. Carbapenem resistance among these isolates is increasing worldwide and is associated with certain International Clones (ICs) and oxacillinases (OXAs). Moreover, this organism possesses a wide range of virulence factors, whose expression is not yet fully understood. In this study, clinical A. baumannii isolates are characterized in terms of antibiotic resistance, mechanisms of carbapenem resistance, clonality, and virulence. Materials and Methods: A. baumannii clinical isolates (n = 90) where obtained from a tertiary care center in Beirut, Lebanon. API 20NE strips in addition to the amplification of blaOXA−51−like were used for identification. Antibiotic susceptibility testing by disk diffusion was then performed in addition to PCRs for the detection of the most commonly disseminated carbapenemases. Clonality was determined by tri-locus PCR typing and doubling times were determined for isolates with varying susceptibility profiles. Biofilm formation, hemolysis, siderophore production, proteolytic activity, and surface motility was then determined for all the isolates. Statistical analysis was then performed for the determination of associations. Results and Discussion: 81 (90%) of the isolates were resistant to carbapenems. These high rates are similar to other multi-center studies in the country suggesting the need of intervention on a national level. 74 (91.3%) of the carbapenem resistant isolates harbored blaOXA−23−like including two that also harbored blaOXA−24−like. 88.9% of the A. baumannii isolates pertained to ICII and three other international clones were detected, showing the wide dissemination of clones into geographically distinct locations. Virulence profiles were highly diverse and no specific pattern was observed. Nevertheless, an association between

  10. Genomic sequencing of a strain of Acinetobacter baumannii and potential mechanisms to antibiotics resistance.

    PubMed

    Zhao, Lei; Li, Hongru; Zhu, Ziwen; Wakefield, Mark R; Fang, Yujiang; Ye, Ying

    2017-02-09

    Acinetobacter baumannii has been becoming a great challenge to clinicians due to their resistance to almost all available antibiotics. In this study, we sequenced the genome from a multiple antibiotics resistant Acinetobacter baumannii stain which was named A. baumannii-1isolated from China by SMRT sequencing technology to explore its potential mechanisms to antibiotic resistance. We found that several mechanisms might contribute to the antibiotic resistance of Acinetobacter baumannii. Specifically, we found that SNP in genes associated with nucleotide excision repair and ABC transporter might contribute to its resistance to multiple antibiotics; we also found that specific genes associated with bacterial DNA integration and recombination, DNA-mediated transposition and response to antibiotics might contribute to its resistance to multiple antibiotics; Furthermore, specific genes associated with penicillin and cephalosporin biosynthetic pathway and specific genes associated with CHDL and MBL β-lactamase genes might contribute to its resistance to multiple antibiotics. Thus, the detailed mechanisms by which Acinetobacter baumannii show extensive resistance to multiple antibiotics are very complicated. Such a study might be helpful to develop new strategies to control Acinetobacter baumannii infection.

  11. The role of bla(OXA-like carbapenemase) and their insertion sequences (ISS) in the induction of resistance against carbapenem antibiotics among Acinetobacter baumannii isolates in Tehran hospitals.

    PubMed

    Asadollahi, Khairollah; Alizadeh, Eshrat; Akbari, Mehdi; Taherikalani, Morovat; Niakan, Mohammad; Maleki, Abbas; Asadollahi, Parisa; Soroush, Setareh; Feizabadi, Mohammad-Mahdi; Emaneini, Mohammad

    2011-01-01

    This study aimed to evaluate the occurrence and dissemination of bla(OXA-like) carbapenemase genes and their insertion sequences among Acinetobacter baumannii isolates, taken from different hospitals in Tehran city and also their roles in the induction of resistance to carbapenem drugs. A total number of 100 non duplicate Acinetobacter baumannii with different origins, were isolated from patients with proved nosocomial infections at eight university hospital in Tehran city. Antimicrobial susceptibility of these strains was done by E-test against 7 antimicrobial agents according to CLSI guideline. PCR of bla(OXA-51-like), bla(OXA-23-like), bla(OXA-24-like), bla(OXA-58-like), IS(ABA-1), IS(1133) was carried out by specialized primers and then these strains were typed by REP-fingerprinting. Colistin, imipenem and meropenem were the most sensitive antibiotics against Acinetobacter baumannii isolates with 96%, 51% and 51% sensitivity respectively. All the isolates had a bla(OXA-51-like) intrinsic to these species. The rates of bla(OXA-23), 23 and 58-like were 38%, 32% and 1% respectively. Coexistence of bla(OXA-51/23/24-like) was observed among 16% of these isolates. All bla(OXA-23-like) carbapenemase genes had only one IS(ABA1). REP fingerprinting showed 5 genotypes among carbapenem resistant isolates, 16 of them being genotype A. This study emphasized on the major role of bla(OXA-like) carbapenemase, particularly bla(OXA-23-like) carbapenemase and their IS(ABA1), in the dissemination of carbapenem resistant Acinetobacter baumannii. This study confirmed a presumptive role of IS element neighboring the carbapenemase gene in the elevation of resistance to carbapenem drug among Acinetobacter baumannii isolates for the first time in Iran.

  12. Epidemiological characterization of Acinetobacter baumannii bloodstream isolates from a Chinese Burn Institute: A three-year study.

    PubMed

    Huang, Guangtao; Yin, Supeng; Xiang, Lijuan; Gong, Yali; Sun, Kedai; Luo, Xiaoqiang; Zhang, Cheng; Yang, Zichen; Deng, Liuyang; Jiang, Bei; Jin, Shouguang; Chen, Jing; Peng, Yizhi

    2016-11-01

    Acinetobacter baumannii infection is a serious threat to burn patients. Bacteremia due to A. baumannii is becoming the most common cause of mortality following burn. However, the epidemiology of A. baumannii causing burn-related bloodstream infections has rarely been reported. We retrospectively collected 81 A. baumannii isolates from the bloodstream of burn patients over a three-year period. Antibiotic susceptibility tests, the prevalence of antibiotic-resistant genes and sequence typing (ST) were conducted to characterize these strains. Most of the isolates showed an extensive drug-resistant phenotype. The resistance frequencies to imipenem and meropenem were 94% and 91%, respectively. The blaOXA-23-like gene, AmpC, IS-AmpC, PER and SIM are the five most prevalent resistant genes, and their prevalence rates are 93% (75/81), 86% (70/81), 73% (59/81), 73% (59/81) and 52% (42/81), respectively. The 81 isolates were grouped into 10 known and 18 unknown ST types, with ST368 (38%) being the most prevalent. Except for ST457 and four new types (STn2, STn6, STn11 and STn14), the remaining 23 ST types belonged to one clonal complex 92, which is most common among clinical isolate in China. The above results indicated that ST368 isolates possessing both the blaOXA-23-like gene and ampC gene were the main culprits of the increasing nosocomial A. baumannii infection in this study. More attention should be paid to monitoring the molecular epidemiology of A. baumannii isolates from burn patients to prevent further distribution. Such information may help clinicians with therapeutic decisions and infection control in the Burns Institute.

  13. Evolution of Carbapenem-Resistant Acinetobacter baumannii Revealed through Whole-Genome Sequencing and Comparative Genomic Analysis

    PubMed Central

    Li, Henan; Liu, Fei; Zhang, Yawei; Wang, Xiaojuan; Zhao, Chunjiang; Chen, Hongbin; Zhang, Feifei; Zhu, Baoli

    2014-01-01

    Acinetobacter baumannii is a globally important nosocomial pathogen characterized by an evolving multidrug resistance. A total of 35 representative clinical A. baumannii strains isolated from 13 hospitals in nine cities in China from 1999 to 2011, including 32 carbapenem-resistant and 3 carbapenem-susceptible A. baumannii strains, were selected for whole-genome sequencing and comparative genomic analysis. Phylogenetic analysis revealed that the earliest strain, strain 1999BJAB11, and two strains isolated in Zhejiang Province in 2004 were the founder strains of carbapenem-resistant A. baumannii. Ten types of AbaR resistance islands were identified, and a previously unreported AbaR island, which comprised a two-component response regulator, resistance-related proteins, and RND efflux system proteins, was identified in two strains isolated in Zhejiang in 2004. Multiple transposons or insertion sequences (ISs) existed in each strain, and these gradually tended to diversify with evolution. Some of these IS elements or transposons were the first to be reported, and most of them were mainly found in strains from two provinces. Genome feature analysis illustrated diversified resistance genes, surface polysaccharides, and a restriction-modification system, even in strains that were phylogenetically and epidemiologically very closely related. IS-mediated deletions were identified in the type VI secretion system region, the csuE region, and core lipooligosaccharide (LOS) loci. Recombination occurred in the heme utilization region, and intrinsic resistance genes (blaADC and blaOXA-51-like variants) and three novel blaOXA-51-like variants (blaOXA-424, blaOXA-425, and blaOXA-426) were identified. Our results could improve the understanding of the evolutionary processes that contribute to the emergence of carbapenem-resistant A. baumannii strains and help elucidate the molecular evolutionary mechanism in A. baumannii. PMID:25487793

  14. Molecular epidemiology and antimicrobial resistance phenotypes of Acinetobacter baumannii isolated from patients in three hospitals in southern Vietnam.

    PubMed

    Tuan Anh, Nguyen; Nga, Tran Vu Thieu; Tuan, Huynh Minh; Tuan, Nguyen Si; Y, Dao Minh; Vinh Chau, Nguyen Van; Baker, Stephen; Duong, Ho Huynh Thuy

    2017-01-01

    Multidrug resistance in the nosocomial pathogen Acinetobacter baumannii limits therapeutic options and impacts on clinical care. Resistance against carbapenems, a group of last-resort antimicrobials for treating multidrug-resistant (MDR) A. baumannii infections, is associated with the expression (and over-expression) of carbapenemases encoded by the blaOXA genes. The aim of this study was to determine the prevalence of antimicrobial-resistant A. baumannii associated with infection in three hospitals in southern Vietnam and to characterize the genetic determinants associated with resistance against carbapenems. We recovered a total of 160 A. baumannii isolates from clinical samples collected in three hospitals in southern Vietnam from 2012 to 2014. Antimicrobial resistance was common; 119/160 (74 %) of isolates were both MDR and extensively drug resistant (XDR). High-level imipenem resistance (>32 µg ml-1) was determined for 109/117 (91.6 %) of the XDR imipenem-nonsusceptible organisms, of which the majority (86.7 %) harboured the blaOXA-51 and blaOXA-23 genes associated with an ISAba1 element. Multiple-locus variable number tandem repeat analysis segregated the 160 A. baumannii into 107 different multiple-locus variable number tandem repeat analysis types, which described five major clusters. The biggest cluster was a clonal complex composed mainly of imipenem-resistant organisms that were isolated from all three of the study hospitals. Our study indicates a very high prevalence of MDR/XDR A. baumannii causing clinically significant infections in hospitals in southern Vietnam. These organisms commonly harboured the blaOXA-23 gene with ISAba1 and were carbapenem resistant; this resistance phenotype may explain their continued selection and ongoing transmission within the Vietnamese healthcare system.

  15. Galleria mellonella as a model system to study Acinetobacter baumannii pathogenesis and therapeutics.

    PubMed

    Peleg, Anton Y; Jara, Sebastian; Monga, Divya; Eliopoulos, George M; Moellering, Robert C; Mylonakis, Eleftherios

    2009-06-01

    Nonmammalian model systems of infection such as Galleria mellonella (caterpillars of the greater wax moth) have significant logistical and ethical advantages over mammalian models. In this study, we utilize G. mellonella caterpillars to study host-pathogen interactions with the gram-negative organism Acinetobacter baumannii and determine the utility of this infection model to study antibacterial efficacy. After infecting G. mellonella caterpillars with a reference A. baumannii strain, we observed that the rate of G. mellonella killing was dependent on the infection inoculum and the incubation temperature postinfection, with greater killing at 37 degrees C than at 30 degrees C (P = 0.01). A. baumannii strains caused greater killing than the less-pathogenic species Acinetobacter baylyi and Acinetobacter lwoffii (P < 0.001). Community-acquired A. baumannii caused greater killing than a reference hospital-acquired strain (P < 0.01). Reduced levels of production of the quorum-sensing molecule 3-hydroxy-C(12)-homoserine lactone caused no change in A. baumannii virulence against G. mellonella. Treatment of a lethal A. baumannii infection with antibiotics that had in vitro activity against the infecting A. baumannii strain significantly prolonged the survival of G. mellonella caterpillars compared with treatment with antibiotics to which the bacteria were resistant. G. mellonella is a relatively simple, nonmammalian model system that can be used to facilitate the in vivo study of host-pathogen interactions in A. baumannii and the efficacy of antibacterial agents.

  16. Worldwide dissemination of acquired carbapenem-hydrolysing class D β-lactamases in Acinetobacter spp. other than Acinetobacter baumannii.

    PubMed

    Zander, Esther; Fernández-González, Ana; Schleicher, Xenia; Dammhayn, Cathrin; Kamolvit, Witchuda; Seifert, Harald; Higgins, Paul G

    2014-04-01

    The aim of this study was to identify acquired OXA-type carbapenemases in Acinetobacter spp. other than Acinetobacter baumannii. From a total of 453 carbapenem-susceptible and -resistant Acinetobacter isolates collected worldwide, 23 were positive for blaOXA genes by multiplex PCR. These isolates were identified as Acinetobacter pittii (n=18), Acinetobacter nosocomialis (n=2), Acinetobacter junii (n=1) and Acinetobacter genomic species 14TU/13BJ (n=2). The blaOXA genes and associated insertion sequence (IS) elements were sequenced by primer walking. In 11 of these isolates, sequencing of the PCR products revealed that they were false-positive for blaOXA. The remaining 12 isolates, originating from Europe, Asia, South America, North America and South Africa, harboured OXA-23 (n=4), OXA-58 (n=5), OXA-40-like (n=1) and OXA-143-like (n=1); one A. pittii isolate harboured both OXA-23 and OXA-58. IS elements were associated with blaOXA in 10 isolates. OXA multiplex PCR showed a high degree of false-positive results (47.8%), indicating that detection of blaOXA in non-baumanniiAcinetobacter spp. should be confirmed using additional methods.

  17. Efficacy of the small molecule inhibitor of Lipid II BAS00127538 against Acinetobacter baumannii

    PubMed Central

    de Leeuw, Erik PH

    2014-01-01

    Objective To test the activity of a small molecule compound that targets Lipid II against Acinetobacter baumannii. Methods Susceptibility to small molecule Lipid II inhibitor BAS00127538 was assessed using carbapenem- and colistin-resistant clinical isolates of A. baumannii. In addition, synergy between colisitin and this compound was assessed. Results Small molecule Lipid II inhibitor BAS00127538 potently acts against A. baumannii and acts synergistically with colistin. Conclusion For the first time, a compound that targets Lipid II is described that acts against multi-drug resistant isolates of A. baumannii. The synergy with colistin warrants further lead development of BAS00127538. PMID:25143710

  18. In Vitro and In Vivo Biological Activities of Iron Chelators and Gallium Nitrate against Acinetobacter baumannii

    PubMed Central

    Harris, Greg; KuoLee, Rhonda; Chen, Wangxue

    2012-01-01

    We investigated the ability of compounds interfering with iron metabolism to inhibit the growth of Acinetobacter baumannii. Iron restriction with transferrin or 2,2-bipyridyl significantly inhibited A. baumannii growth in vitro. Gallium nitrate alone was moderately effective at reducing A. baumannii growth but became bacteriostatic in the presence of serum or transferrin. More importantly, gallium nitrate treatment reduced lung bacterial burdens in mice. The use of gallium-based therapies shows promise for the control of multidrug-resistant A. baumannii. PMID:22825117

  19. Longitudinal Characterization of Acinetobacter baumannii-calcoaceticus Complex, Klebsiella pneumoniae, and Methicillin-Resistant Staphylococcus aureus Colonizing and Infecting Combat Casualties

    DTIC Science & Technology

    2012-01-01

    Brief report Longitudinal characterization of Acinetobacter baumannii-calcoaceticus complex, Klebsiella pneumoniae , and methicillin-resistant...resistant Acinetobacter baumannii-calcoaceticus complex Klebsiella pneumoniae Methicillin-resistant Staphylococcus aureus MRSA Drug-resistant...Acinetobacter baumannii-calcoaceticus complex, Klebsiella pneumoniae , and methicillin- resistant Staphylococcus aureus colonize and infect combat casualties

  20. Community-Acquired Bacteremic Acinetobacter Pneumonia in Tropical Australia Is Caused by Diverse Strains of Acinetobacter baumannii, with Carriage in the Throat in At-Risk Groups

    PubMed Central

    Anstey, Nicholas M.; Currie, Bart J.; Hassell, Marilyn; Palmer, Didier; Dwyer, Brian; Seifert, Harald

    2002-01-01

    Acinetobacter isolates from eight subjects with community-acquired Acinetobacter pneumonia (CAAP), a major cause of fatal community-acquired pneumonia in tropical Australia, were phenotypically and genotypically confirmed by pulsed-field gel electrophoresis analysis to be broadly diverse Acinetobacter baumannii strains. Wet-season throat carriage of A. baumannii was found in 10% of community residents with excess levels of alcohol consumption, the major at-risk group for CAAP. PMID:11825997

  1. Acinetobacter seifertii sp. nov., a member of the Acinetobacter calcoaceticus-Acinetobacter baumannii complex isolated from human clinical specimens.

    PubMed

    Nemec, Alexandr; Krizova, Lenka; Maixnerova, Martina; Sedo, Ondrej; Brisse, Sylvain; Higgins, Paul G

    2015-03-01

    This study aimed to define the taxonomic status of a phenetically distinct group of 16 strains that corresponds to Acinetobacter genomic species 'close to 13TU', a provisional genomic species of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex recognized by Gerner-Smidt and Tjernberg in 1993. These strains have been isolated in different countries since the early 1990s and were mostly recovered from human clinical specimens. They were compared with 45 reference strains representing the known taxa of the ACB complex using taxonomic methods relevant to the genus Acinetobacter. Based on sequence analysis of the concatenated partial sequences (2976 bp) of seven housekeeping genes, the 16 strains formed a tight and well-supported cluster (intracluster sequence identity of ≥98.4 %) that was clearly separated from the other members of the ACB complex (≤94.7 %). The species status of the group was supported by average nucleotide identity values of ≤91.7 % between the whole genome sequence of representative strain NIPH 973(T) (NCBI accession no. APOO00000000) and those of the other species. In addition, whole-cell matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF) MS analyses indicated the distinctness of the group at the protein level. Metabolic and physiological tests revealed several typical features of the group, although they did not allow its reliable differentiation from the other members of the ACB complex. We conclude that the 16 strains represent a distinct novel species, for which we propose the name Acinetobacter seifertii sp. nov. The type strain is NIPH 973(T) ( = CIP 110471(T) = CCUG 34785(T) = CCM 8535(T)).

  2. Assessment of Minocycline and Polymyxin B Combination against Acinetobacter baumannii

    PubMed Central

    Bowers, Dana R.; Cao, Henry; Zhou, Jian; Ledesma, Kimberly R.; Sun, Dongxu; Lomovskaya, Olga

    2015-01-01

    Antimicrobial resistance among Acinetobacter baumannii is increasing worldwide, often necessitating combination therapy. The clinical utility of using minocycline with polymyxin B is not well established. In this study, we investigated the activity of minocycline and polymyxin B against 1 laboratory isolate and 3 clinical isolates of A. baumannii. Minocycline susceptibility testing was performed with and without an efflux pump inhibitor, phenylalanine-arginine β-naphthylamide (PAβN). The intracellular minocycline concentration was determined with and without polymyxin B (0.5 μg/ml). Time-kill studies were performed over 24 h using approximately 106 CFU/ml of each strain with clinically relevant minocycline concentrations (2 μg/ml and 8 μg/ml), with and without polymyxin B (0.5 μg/ml). The in vivo efficacy of the combination was assessed in a neutropenic murine pneumonia model. Infected animals were administered minocycline (50 mg/kg), polymyxin B (10 mg/kg), or both to achieve clinically equivalent exposures in humans. A reduction in the minocycline MIC (≥4×) was observed in the presence of PAβN. The intracellular concentration and in vitro bactericidal effect of minocycline were both enhanced by polymyxin B. With 2 minocycline-susceptible strains, the bacterial burden in lung tissue at 24 h was considerably reduced by the combination compared to monotherapy with minocycline or polymyxin B. In addition, the combination prolonged survival of animals infected with a minocycline-susceptible strain. Polymyxin B increased the intracellular concentration of minocycline in bacterial cells and enhanced the bactericidal activity of minocycline, presumably due to efflux pump disruption. The clinical utility of this combination should be further investigated. PMID:25712362

  3. In Vitro Efficacy of Doripenem against Pseudomonas aeruginosa and Acinetobacter baumannii by E-Test.

    PubMed

    Gilani, Mehreen; Munir, Tehmina; Latif, Mahwish; Rehman, Sabahat; Ansari, Maliha; Hafeez, Amira; Najeeb, Sara; Saad, Nadia; Gilani, Mehwish

    2015-10-01

    To assess the in vitro efficacy of doripenem against Pseudomonas aeruginosa and Acinetobacter baumannii using Epsilometer strips. Cross-sectional study. Department of Microbiology, Army Medical College, Rawalpindi and National University of Sciences and Technology, Islamabad, from May 2014 to September 2014. A total of 60 isolates of Acinetobacter baumannii and Pseudomonas aeruginosa collected from various clinical samples received from Military Hospital were included in the study. The specimens were inoculated onto blood, MacConkey and chocolate agars. The isolates were identified using Gram staining, motility, catalase test, oxidase test and API 20NE (Biomeriux, France). Organisms identified as Acinetobacter baumannii and Pseudomonas aeruginosa were included in the study. Bacterial suspensions equivalent to 0.5 McFarland turbidity standard of the isolates were prepared and applied on Mueller Hinton agar. Epsilometer strip was placed in the center of the plate and incubated for 18-24 hours. Minimum Inhibitory Concentration (MIC) was taken to be the point where the epsilon intersected the E-strip. MIC of all the isolates was noted. For Pseudomonas aeruginosa isolates, MIC(50) was 12 µg/mL and MIC(90) was 32 µg/mL. For Acinetobacter baumannii MIC(50) and MIC(90) was 32 µg/mL. Doripenem is no more effective against Pseudomonas aeruginosa and Acinetobacter baumannii in our setting.

  4. Potential of a lytic bacteriophage to disrupt Acinetobacter baumannii biofilms in vitro.

    PubMed

    Liu, Yannan; Mi, Zhiqiang; Niu, Wenkai; An, Xiaoping; Yuan, Xin; Liu, Huiying; Wang, Yong; Feng, Yuzhong; Huang, Yong; Zhang, Xianglilan; Zhang, Zhiyi; Fan, Hang; Peng, Fan; Li, Puyuan; Tong, Yigang; Bai, Changqing

    2016-10-01

    The ability of Acinetobacter baumannii to form biofilms and develop antibiotic resistance makes it difficult to control infections caused by this bacterium. In this study, we explored the potential of a lytic bacteriophage to disrupt A. baumannii biofilms. The potential of the lytic bacteriophage to disrupt A. baumannii biofilms was assessed by performing electron microscopy, live/dead bacterial staining, crystal violet staining and by determining adenosine triphosphate release. The bacteriophage inhibited the formation of and disrupted preformed A. baumannii biofilms. Results of disinfection assay showed that the lytic bacteriophage lysed A. baumannii cells suspended in blood or grown on metal surfaces. These results suggest the potential of the lytic bacteriophage to disrupt A. baumannii biofilms.

  5. Subinhibitory Concentrations of Trimethoprim and Sulfamethoxazole Prevent Biofilm Formation by Acinetobacter baumannii through Inhibition of Csu Pilus Expression.

    PubMed

    Moon, Ki Hwan; Weber, Brent S; Feldman, Mario F

    2017-09-01

    Acinetobacter baumannii is emerging as a multidrug-resistant nosocomial pathogen of increasing threat to human health worldwide. Pili are important bacterial virulence factors, playing a role in attachment to host cells and biofilm formation. The Csu pilus, which is assembled via the chaperone-usher secretion system, has been studied in A. baumannii ATCC 19606. Here we show that, in opposition to previous reports, the common laboratory strain ATCC 17978 produces Csu pili. We found that, although ATCC 17978 was resistant to sulfamethoxazole (Smx) and trimethoprim (Tmp), subinhibitory concentrations of these antibiotics abolished the expression of Csu and consequently produced a dramatic reduction in biofilm formation by ATCC 17978. Smx and Tmp acted synergistically to inhibit the enzymatic systems involved in the bacterial synthesis of tetrahydrofolate (THF), which is required for the synthesis of nucleotides. The effects of these antibiotics were partially relieved by exogenous THF addition, indicating that Smx and Tmp turn off Csu assembly by inducing folate stress. We propose that, for Acinetobacter, nanomolar concentrations of Smx and Tmp represent a "danger signal." In response to this signal, Csu expression is repressed, allowing biofilm dispersal and escape from potentially inhibitory concentrations of antibiotics. The roles of antibiotics as signaling molecules are being increasingly acknowledged, with clear implications for both the treatment of bacterial diseases and the understanding of complex microbial interactions in the environment. Copyright © 2017 American Society for Microbiology.

  6. Diverse responses to UV light exposure in Acinetobacter include the capacity for DNA damage-induced mutagenesis in the opportunistic pathogens Acinetobacter baumannii and Acinetobacter ursingii.

    PubMed

    Hare, Janelle M; Bradley, James A; Lin, Ching-li; Elam, Tyler J

    2012-03-01

    Error-prone and error-free DNA damage repair responses that are induced in most bacteria after exposure to various chemicals, antibiotics or radiation sources were surveyed across the genus Acinetobacter. The error-prone SOS mutagenesis response occurs when DNA damage induces a cell's umuDC- or dinP-encoded error-prone polymerases. The model strain Acinetobacter baylyi ADP1 possesses an unusual, regulatory umuD allele (umuDAb) with an extended 5' region and only incomplete fragments of umuC. Diverse Acinetobacter species were investigated for the presence of umuDC and their ability to conduct UV-induced mutagenesis. Unlike ADP1, most Acinetobacter strains possessed multiple umuDC loci containing either umuDAb or a umuD allele resembling that of Escherichia coli. The nearly omnipresent umuDAb allele was the ancestral umuD in Acinetobacter, with horizontal gene transfer accounting for over half of the umuDC operons. Despite multiple umuD(Ab)C operons in many strains, only three species conducted UV-induced mutagenesis: Acinetobacter baumannii, Acinetobacter ursingii and Acinetobacter beijerinckii. The type of umuDC locus or mutagenesis phenotype a strain possessed was not correlated with its error-free response of survival after UV exposure, but similar diversity was apparent. The survival of 30 Acinetobacter strains after UV treatment ranged over five orders of magnitude, with the Acinetobacter calcoaceticus-A. baumannii (Acb) complex and haemolytic strains having lower survival than non-Acb or non-haemolytic strains. These observations demonstrate that a genus can possess a range of DNA damage response mechanisms, and suggest that DNA damage-induced mutation could be an important part of the evolution of the emerging pathogens A. baumannii and A. ursingii.

  7. Diverse responses to UV light exposure in Acinetobacter include the capacity for DNA damage-induced mutagenesis in the opportunistic pathogens Acinetobacter baumannii and Acinetobacter ursingii

    PubMed Central

    Bradley, James A.; Lin, Ching-li; Elam, Tyler J.

    2012-01-01

    Error-prone and error-free DNA damage repair responses that are induced in most bacteria after exposure to various chemicals, antibiotics or radiation sources were surveyed across the genus Acinetobacter. The error-prone SOS mutagenesis response occurs when DNA damage induces a cell’s umuDC- or dinP-encoded error-prone polymerases. The model strain Acinetobacter baylyi ADP1 possesses an unusual, regulatory umuD allele (umuDAb) with an extended 5′ region and only incomplete fragments of umuC. Diverse Acinetobacter species were investigated for the presence of umuDC and their ability to conduct UV-induced mutagenesis. Unlike ADP1, most Acinetobacter strains possessed multiple umuDC loci containing either umuDAb or a umuD allele resembling that of Escherichia coli. The nearly omnipresent umuDAb allele was the ancestral umuD in Acinetobacter, with horizontal gene transfer accounting for over half of the umuDC operons. Despite multiple umuD(Ab)C operons in many strains, only three species conducted UV-induced mutagenesis: Acinetobacter baumannii, Acinetobacter ursingii and Acinetobacter beijerinckii. The type of umuDC locus or mutagenesis phenotype a strain possessed was not correlated with its error-free response of survival after UV exposure, but similar diversity was apparent. The survival of 30 Acinetobacter strains after UV treatment ranged over five orders of magnitude, with the Acinetobacter calcoaceticus–A. baumannii (Acb) complex and haemolytic strains having lower survival than non-Acb or non-haemolytic strains. These observations demonstrate that a genus can possess a range of DNA damage response mechanisms, and suggest that DNA damage-induced mutation could be an important part of the evolution of the emerging pathogens A. baumannii and A. ursingii. PMID:22117008

  8. 5-Episinuleptolide Decreases the Expression of the Extracellular Matrix in Early Biofilm Formation of Multi-Drug Resistant Acinetobacter baumannii

    PubMed Central

    Tseng, Sung-Pin; Hung, Wei-Chun; Huang, Chiung-Yao; Lin, Yin-Shiou; Chan, Min-Yu; Lu, Po-Liang; Lin, Lin; Sheu, Jyh-Horng

    2016-01-01

    Nosocomial infections and increasing multi-drug resistance caused by Acinetobacter baumannii have been recognized as emerging problems worldwide. Moreover, A. baumannii is able to colonize various abiotic materials and medical devices, making it difficult to eradicate and leading to ventilator-associated pneumonia, and bacteremia. Development of novel molecules that inhibit bacterial biofilm formation may be an alternative prophylactic option for the treatment of biofilm-associated A. baumannii infections. Marine environments, which are unlike their terrestrial counterparts, harbor an abundant biodiversity of marine organisms that produce novel bioactive natural products with pharmaceutical potential. In this study, we identified 5-episinuleptolide, which was isolated from Sinularia leptoclados, as an inhibitor of biofilm formation in ATCC 19606 and three multi-drug resistant A. baumannii strains. In addition, the anti-biofilm activities of 5-episinuleptolide were observed for Gram-negative bacteria but not for Gram-positive bacteria, indicating that the inhibition mechanism of 5-episinuleptolide is effective against only Gram-negative bacteria. The mechanism of biofilm inhibition was demonstrated to correlate to decreased gene expression from the pgaABCD locus, which encodes the extracellular polysaccharide poly-β-(1,6)-N-acetylglucosamine (PNAG). Scanning electron microscopy (SEM) indicated that extracellular matrix of the biofilm was dramatically decreased by treatment with 5-episinuleptolide. Our study showed potentially synergistic activity of combination therapy with 5-episinuleptolide and levofloxacin against biofilm formation and biofilm cells. These data indicate that inhibition of biofilm formation via 5-episinuleptolide may represent another prophylactic option for solving the persistent problem of biofilm-associated A. baumannii infections. PMID:27483290

  9. Amide side chain amphiphilic polymers disrupt surface established bacterial bio-films and protect mice from chronic Acinetobacter baumannii infection.

    PubMed

    Uppu, Divakara S S M; Samaddar, Sandip; Ghosh, Chandradhish; Paramanandham, Krishnamoorthy; Shome, Bibek R; Haldar, Jayanta

    2016-01-01

    Bacterial biofilms represent the root-cause of chronic or persistent infections in humans. Gram-negative bacterial infections due to nosocomial and opportunistic pathogens such as Acinetobacter baumannii are more difficult to treat because of their inherent and rapidly acquiring resistance to antibiotics. Due to biofilm formation, A. baumannii has been noted for its apparent ability to survive on artificial surfaces for an extended period of time, therefore allowing it to persist in the hospital environment. Here we report, maleic anhydride based novel cationic polymers appended with amide side chains that disrupt surface established multi-drug resistant A. baumannii biofilms. More importantly, these polymers significantly (p < 0.0001) decrease the bacterial burden in mice with chronic A. baumannii burn wound infection. The polymers also show potent antibacterial efficacy against methicillin resistant Staphylococcus aureus (MRSA), vancomycin resistant Enterococci (VRE) and multi-drug resistant clinical isolates of A. baumannii with minimal toxicity to mammalian cells. We observe that optimal hydrophobicity dependent on the side chain chemical structure of these polymers dictate the selective toxicity to bacteria. Polymers interact with the bacterial cell membranes by causing membrane depolarization, permeabilization and energy depletion. Bacteria develop rapid resistance to erythromycin and colistin whereas no detectable development of resistance occurs against these polymers even after several passages. These results suggest the potential use of these polymeric biomaterials in disinfecting biomedical device surfaces after the infection has become established and also for the topical treatment of chronic bacterial infections.

  10. Characterization of NDM-1- and OXA-23-producing Acinetobacter baumannii isolates from inanimate surfaces in a hospital environment in Algeria.

    PubMed

    Zenati, K; Touati, A; Bakour, S; Sahli, F; Rolain, J M

    2016-01-01

    Investigation of several outbreaks of multidrug-resistant Acinetobacter baumannii infection has demonstrated that contamination of the inanimate hospital environment could be implicated in the spread of these multidrug-resistant strains. To investigate the occurrence of carbapenem-resistant A. baumannii on inanimate surfaces and possible dissemination in the hospital environment in Algeria as a potential source of infection in humans. A. baumannii strains were isolated from the hospital environment and identified by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). Antimicrobial susceptibility was determined using disc diffusion and E-test methods. Carbapenemase activity was detected using microbiological tests, including modified Hodge test, modified Carba NP test, and EDTA test. Carbapenem resistance determinants were studied by polymerase chain reaction (PCR) and sequencing. Clonal relatedness was determined using multi-locus sequence typing (MLST). A total of 67 A. baumannii isolates were obtained from 868 environmental samples and identified by MALDI-TOF MS. Among them, 61 isolates were resistant to imipenem with minimum inhibitory concentration >32 μg/mL and positive by the modified Hodge test and modified Carba NP test. In addition, the activity of carbapenemase was inhibited by EDTA in 32 strains. PCR and sequencing showed the presence of blaOXA-23 gene in 29 strains, and the blaNDM-1 gene in 32 isolates. MLST demonstrated the presence of five types of ST (ST19, ST2, ST85, ST98, and ST115). Our study demonstrated the dissemination of carbapenemase-producing A. baumannii strains recovered from inanimate surfaces in a hospital environment, surrounding patients, healthcare workers and visitors, in Algeria as a potential source for nosocomial infection. Copyright © 2015 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  11. Critical role of bacterial isochorismatase in the autophagic process induced by Acinetobacter baumannii in mammalian cells

    PubMed Central

    Wang, Yang; Zhang, Kaiyu; Shi, Xiaochen; Wang, Chao; Wang, Feng; Fan, Junwen; Shen, Fengge; Xu, Jiancheng; Bao, Wanguo; Liu, Mingyuan; Yu, Lu

    2016-01-01

    A recent study reported that Acinetobacter baumannii could induce autophagy, but the recognition and clearance mechanism of intracytosolic A. baumannii in the autophagic process and the molecular mechanism of autophagy induced by the pathogen remains unknown. In this study, we first demonstrated that invading A. baumannii induced a complete, ubiquitin-mediated autophagic response that is dependent upon septins SEPT2 and SEPT9 in mammalian cells. We also demonstrated that autophagy induced by A. baumannii was Beclin-1 dependent via the AMPK/ERK/mammalian target of rapamycin pathway. Of interest, we found that the isochorismatase mutant strain had significantly decreased siderophore-mediated ferric iron acquisition ability and had a reduced the ability to induce autophagy. We verified that isochorismatase was required for the recognition of intracytosolic A. baumannii mediated by septin cages, ubiquitinated proteins, and ubiquitin-binding adaptor proteins p62 and NDP52 in autophagic response. We also confirmed that isochorismatase was required for the clearance of invading A. baumannii by autophagy in vitro and in the mouse model of infection. Together, these findings provide insight into the distinctive recognition and clearance of intracytosolic A. baumannii by autophagy in host cells, and that isochorismatase plays a critical role in the A. baumannii–induced autophagic process.—Wang, Y., Zhang, K., Shi, X., Wang, C., Wang, F., Fan, J., Shen, F., Xu, J., Bao, W., Liu, M., Yu, L. Critical role of bacterial isochorismatase in the autophagic process induced by Acinetobacter baumannii in mammalian cells. PMID:27432399

  12. Identification of novel vaccine candidates against Acinetobacter baumannii using reverse vaccinology

    PubMed Central

    Chiang, Ming-Hsien; Sung, Wang-Chou; Lien, Shu-Pei; Chen, Ying-Zih; Lo, Annie Fei-yun; Huang, Jui-Hsin; Kuo, Shu-Chen; Chong, Pele

    2015-01-01

    Acinetobacter baumannii (Ab) is a global emerging bacterium causing nosocomial infections such as pneumonia, meningitis, bacteremia and soft tissue infections especially in intensive care units. Since Ab is resistant to almost all conventional antibiotics, it is now one of the 6 top-priorities of the dangerous microorganisms listed by the Infectious Disease Society of America. The development of vaccine is one of the most promising and cost-effective strategies to prevent infections. In this study, we identified potential protective vaccine candidates using reverse vaccinology. We have analyzed 14 on-line available Ab genome sequences and found 2752 homologous core genes. Using information obtained from immuno-proteomic experiments, published proteomic information and the bioinformatics PSORTb v3.0 software to predict the location of extracellular and/or outer membrane proteins, 77 genes were identified and selected for further studies. After excluding those antigens have been used as vaccine candidates reported by the in silico search-engines of PubMed and Google Scholar, 13 proteins could potentially be vaccine candidates. We have selected and cloned the genes of 3 antigens that were further expressed and purified. These antigens were found to be highly immunogenic and conferred partial protection (60%) in a pneumonia animal model. The strategy described in the present study incorporates the advantages of reverse vaccinology, bioinformatics and immuno-proteomic platform technologies and is easy to perform to identify novel immunogens for multi-component vaccines development. PMID:25751377

  13. In vivo protein interaction network analysis reveals porin-localized antibiotic inactivation in Acinetobacter baumannii strain AB5075.

    PubMed

    Wu, Xia; Chavez, Juan D; Schweppe, Devin K; Zheng, Chunxiang; Weisbrod, Chad R; Eng, Jimmy K; Murali, Ananya; Lee, Samuel A; Ramage, Elizabeth; Gallagher, Larry A; Kulasekara, Hemantha D; Edrozo, Mauna E; Kamischke, Cassandra N; Brittnacher, Mitchell J; Miller, Samuel I; Singh, Pradeep K; Manoil, Colin; Bruce, James E

    2016-11-11

    The nosocomial pathogen Acinetobacter baumannii is a frequent cause of hospital-acquired infections worldwide and is a challenge for treatment due to its evolved resistance to antibiotics, including carbapenems. Here, to gain insight on A. baumannii antibiotic resistance mechanisms, we analyse the protein interaction network of a multidrug-resistant A. baumannii clinical strain (AB5075). Using in vivo chemical cross-linking and mass spectrometry, we identify 2,068 non-redundant cross-linked peptide pairs containing 245 intra- and 398 inter-molecular interactions. Outer membrane proteins OmpA and YiaD, and carbapenemase Oxa-23 are hubs of the identified interaction network. Eighteen novel interactors of Oxa-23 are identified. Interactions of Oxa-23 with outer membrane porins OmpA and CarO are verified with co-immunoprecipitation analysis. Furthermore, transposon mutagenesis of oxa-23 or interactors of Oxa-23 demonstrates changes in meropenem or imipenem sensitivity in strain AB5075. These results provide a view of porin-localized antibiotic inactivation and increase understanding of bacterial antibiotic resistance mechanisms.

  14. Potential Synergy Activity of the Novel Ceragenin, CSA-13, against Carbapenem-Resistant Acinetobacter baumannii Strains Isolated from Bacteremia Patients

    PubMed Central

    Bozkurt-Guzel, Cagla; Savage, Paul B.; Akcali, Alper; Ozbek-Celik, Berna

    2014-01-01

    Carbapenem-resistant Acinetobacter baumannii is an important cause of nosocomial infections, particularly in patients in the intensive care units. As chronic infections are difficult to treat, attempts have been made to discover new antimicrobials. Ceragenins, designed to mimic the activities of antimicrobial peptides, are a new class of antimicrobial agents. In this study, the in vitro activities of CSA-13 either alone or in combination with colistin (sulphate), tobramycin, and ciprofloxacin were investigated using 60 carbapenem-resistant A. baumannii strains isolated from bacteremia patients blood specimens. MICs and MBCs were determined by microbroth dilution technique. Combinations were assessed by using checkerboard technique. The MIC50 values (mg/L) of CSA-13, colistin, tobramycin, and ciprofloxacin were 2, 1, 1.25, and 80, respectively. The MIC90 (mg/L) of CSA-13 and colistin were 8 and 4. The MBCs were equal to or twice greater than those of the MICs. Synergistic interactions were mostly seen with CSA-13-colistin (55%), whereas the least synergistic interactions were observed in the CSA-13-tobramycin (35%) combination. No antagonism was observed. CSA-13 appears to be a good candidate for further investigations in the treatment of A. baumannii infections. However, future studies should be performed to correlate the safety, efficacy, and pharmacokinetic parameters of this molecule. PMID:24804236

  15. In vivo protein interaction network analysis reveals porin-localized antibiotic inactivation in Acinetobacter baumannii strain AB5075

    PubMed Central

    Wu, Xia; Chavez, Juan D.; Schweppe, Devin K.; Zheng, Chunxiang; Weisbrod, Chad R.; Eng, Jimmy K.; Murali, Ananya; Lee, Samuel A.; Ramage, Elizabeth; Gallagher, Larry A.; Kulasekara, Hemantha D.; Edrozo, Mauna E.; Kamischke, Cassandra N.; Brittnacher, Mitchell J.; Miller, Samuel I.; Singh, Pradeep K.; Manoil, Colin; Bruce, James E.

    2016-01-01

    The nosocomial pathogen Acinetobacter baumannii is a frequent cause of hospital-acquired infections worldwide and is a challenge for treatment due to its evolved resistance to antibiotics, including carbapenems. Here, to gain insight on A. baumannii antibiotic resistance mechanisms, we analyse the protein interaction network of a multidrug-resistant A. baumannii clinical strain (AB5075). Using in vivo chemical cross-linking and mass spectrometry, we identify 2,068 non-redundant cross-linked peptide pairs containing 245 intra- and 398 inter-molecular interactions. Outer membrane proteins OmpA and YiaD, and carbapenemase Oxa-23 are hubs of the identified interaction network. Eighteen novel interactors of Oxa-23 are identified. Interactions of Oxa-23 with outer membrane porins OmpA and CarO are verified with co-immunoprecipitation analysis. Furthermore, transposon mutagenesis of oxa-23 or interactors of Oxa-23 demonstrates changes in meropenem or imipenem sensitivity in strain AB5075. These results provide a view of porin-localized antibiotic inactivation and increase understanding of bacterial antibiotic resistance mechanisms. PMID:27834373

  16. Identification of a general O-linked protein glycosylation system in Acinetobacter baumannii and its role in virulence and biofilm formation.

    PubMed

    Iwashkiw, Jeremy A; Seper, Andrea; Weber, Brent S; Scott, Nichollas E; Vinogradov, Evgeny; Stratilo, Chad; Reiz, Bela; Cordwell, Stuart J; Whittal, Randy; Schild, Stefan; Feldman, Mario F

    2012-01-01

    Acinetobacter baumannii is an emerging cause of nosocomial infections. The isolation of strains resistant to multiple antibiotics is increasing at alarming rates. Although A. baumannii is considered as one of the more threatening "superbugs" for our healthcare system, little is known about the factors contributing to its pathogenesis. In this work we show that A. baumannii ATCC 17978 possesses an O-glycosylation system responsible for the glycosylation of multiple proteins. 2D-DIGE and mass spectrometry methods identified seven A. baumannii glycoproteins, of yet unknown function. The glycan structure was determined using a combination of MS and NMR techniques and consists of a branched pentasaccharide containing N-acetylgalactosamine, glucose, galactose, N-acetylglucosamine, and a derivative of glucuronic acid. A glycosylation deficient strain was generated by homologous recombination. This strain did not show any growth defects, but exhibited a severely diminished capacity to generate biofilms. Disruption of the glycosylation machinery also resulted in reduced virulence in two infection models, the amoebae Dictyostelium discoideum and the larvae of the insect Galleria mellonella, and reduced in vivo fitness in a mouse model of peritoneal sepsis. Despite A. baumannii genome plasticity, the O-glycosylation machinery appears to be present in all clinical isolates tested as well as in all of the genomes sequenced. This suggests the existence of a strong evolutionary pressure to retain this system. These results together indicate that O-glycosylation in A. baumannii is required for full virulence and therefore represents a novel target for the development of new antibiotics.

  17. First report of NDM-1-producing Acinetobacter baumannii sequence type 25 in Brazil.

    PubMed

    Pillonetto, Marcelo; Arend, Lavinia; Vespero, Eliana Carolina; Pelisson, Marsileni; Chagas, Thiago Pavoni Gomes; Carvalho-Assef, Ana Paula D'Alincourt; Asensi, Marise Dutra

    2014-12-01

    New Delhi metallo-β-lactamase 1 (NDM-1) was first identified in Brazil in Enterobacter hormaechei and Providencia rettgeri in 2013. Here, we describe the first case of NDM-1-producing Acinetobacter baumannii sequence type 25 isolated from the urinary tract of a 71-year-old man who died of multiple complications, including A. baumannii infection. The NDM-1 gene was detected by quantitative PCR, and its sequence confirmed its presence in an ∼ 100-kb plasmid.

  18. Draft Genome Sequence of the Biofilm-Hyperproducing Acinetobacter baumannii Clinical Strain MAR002

    PubMed Central

    Álvarez-Fraga, Laura; López, María; Merino, María; Rumbo-Feal, Soraya; Tomás, María

    2015-01-01

    We report the draft genome sequence of Acinetobacter baumannii strain MAR002, a biofilm-hyperproducing clinical strain isolated during the study CP/09/0033 (GEIH/REIPI-Ab2010, Spain). The genome of A. baumannii MAR002 has an approximate length of 3,717,929 bp and 3,300 protein-coding sequences, with a C+G content of 39.09%. PMID:26205868

  19. Draft Genome Sequence of an Extensively Drug-Resistant Acinetobacter baumannii Indigo-Pigmented Strain

    PubMed Central

    Traglia, German; Vilacoba, Elisabet; Almuzara, Marisa; Diana, Leticia; Iriarte, Andres; Centrón, Daniela

    2014-01-01

    Last year in 2013, we reported an outbreak due to indigo-pigmented Acinetobacter baumannii strains in a hospital from Buenos Aires, Argentina. Here, we present the draft genome sequence of one of the strains (A. baumannii A33405) involved in the outbreak. This isolate was categorized as extensively drug-resistant (XDR) and harbors different genetic elements associated with horizontal genetic transfer and multiple antibiotic resistances. PMID:25395633

  20. Iron acquisition functions expressed by the human pathogen Acinetobacter baumannii.

    PubMed

    Zimbler, Daniel L; Penwell, William F; Gaddy, Jennifer A; Menke, Sharon M; Tomaras, Andrew P; Connerly, Pamela L; Actis, Luis A

    2009-02-01

    Acinetobacter baumannii is a gram-negative bacterium that causes serious infections in compromised patients. More recently, it has emerged as the causative agent of severe infections in military personnel wounded in Iraq and Afghanistan. This pathogen grows under a wide range of conditions including iron-limiting conditions imposed by natural and synthetic iron chelators. Initial studies using the type strain 19606 showed that the iron proficiency of this pathogen depends on the expression of the acinetobactin-mediated iron acquisition system. More recently, we have observed that hemin but not human hemoglobin serves as an iron source when 19606 isogenic derivatives affected in acinetobactin transport and biosynthesis were cultured under iron-limiting conditions. This finding is in agreement with the observation that the genome of the strain 17978 has a gene cluster coding for putative hemin-acquisition functions, which include genes coding for putative hemin utilization functions and a TonBExbBD energy transducing system. This system restored enterobactin biosynthesis in an E. coli ExbBD deficient strain but not when introduced into a TonB mutant. PCR and Southern blot analyses showed that this hemin-utilization gene cluster is also present in the 19606 strain. Analysis of the 17978 genome also showed that this strain harbors genes required for acinetobactin synthesis and transport as well as a gene cluster that could code for additional iron acquisition functions. This hypothesis is in agreement with the fact that the inactivation of the basD acinetobactin biosynthetic gene did not affect the growth of A. baumannii 17978 cells under iron-chelated conditions. Interestingly, this second iron uptake gene cluster is flanked by perfect inverted repeats and includes transposase genes that are expressed transcriptionally. Also interesting is the observation that this additional cluster could not be detected in the type strain 19606, an observation that suggests some

  1. Acinetobacter baumannii and A. pittii clinical isolates lack adherence and cytotoxicity to lung epithelial cells in vitro.

    PubMed

    Lázaro-Díez, María; Navascués-Lejarza, Teresa; Remuzgo-Martínez, Sara; Navas, Jesús; Icardo, José Manuel; Acosta, Felix; Martínez-Martínez, Luis; Ramos-Vivas, José

    2016-09-01

    The molecular and genetic basis of Acinetobacter baumannii and Acinetobacter pittii virulence remains poorly understood, and there is still lack of knowledge in host cell response to these bacteria. In this study, we have used eleven clinical Acinetobacter strains (A. baumannii n = 5; A. pittii n = 6) to unravel bacterial adherence, invasion and cytotoxicity to human lung epithelial cells. Our results showed that adherence to epithelial cells by Acinetobacter strains is scarce and cellular invasion was not truly detected. In addition, all Acinetobacter strains failed to induce any cytotoxic effect on A549 cells.

  2. Epidemiology and resistance features of Acinetobacter baumannii isolates from the ward environment and patients in the burn ICU of a Chinese hospital.

    PubMed

    Gong, Yali; Shen, Xiaodong; Huang, Guangtao; Zhang, Cheng; Luo, Xiaoqiang; Yin, Supeng; Wang, Jing; Hu, Fuquan; Peng, Yizhi; Li, Ming

    2016-08-01

    Acinetobacter baumannii is an important opportunistic pathogen that causes severe nosocomial infections, especially in intensive care units (ICUs). Over the past decades, an everincreasing number of hospital outbreaks caused by A. baumannii have been reported worldwide. However, little attention has been directed toward the relationship between A. baumannii isolates from the ward environment and patients in the burn ICU. In this study, 88 A. baumannii isolates (26 from the ward environment and 62 from patients) were collected from the burn ICU of the Southwest Hospital in Chongqing, China, from July through December 2013. Antimicrobial susceptibility testing results showed that drug resistance was more severe in isolates from patients than from the ward environment, with all of the patient isolates being fully resistant to 10 out of 19 antimicrobials tested. Isolations from both the ward environment and patients possessed the β-lactamase genes bla OXA-51, bla OXA-23, bla AmpC, bla VIM, and bla PER. Using pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST), these isolates could be clustered into 4 major PFGE types and 4 main sequence types (ST368, ST369, ST195, and ST191) among which, ST368 was the dominant genotype. Epidemiologic and molecular typing data also revealed that a small-scale outbreak of A. baumannii infection was underway in the burn ICU of our hospital during the sampling period. These results suggest that dissemination of β-lactamase genes in the burn ICU might be closely associated with the high-level resistance of A. baumannii, and the ICU environment places these patients at a high risk for nosocomial infection. Cross-contamination should be an important concern in clinical activities to reduce hospitalacquired infections caused by A. baumannii.

  3. Characterization and identification of newly isolated Acinetobacter baumannii strain serdang 1 for phenol removal

    NASA Astrophysics Data System (ADS)

    Yadzir, Z. H. M.; Shukor, M. Y.; Nazir, M. S.; Abdullah, M. A.

    2012-09-01

    A new indigenous bacterial strain from Malaysian soil contaminated with petroleum waste had been successfully isolated, characterized and identified for phenol removal. The gram negative bacteria showed 98% identity with Acinetobacter baumannii based on Biolog{trade mark, serif} Identification System and the determination of a partial 16S ribosomal RNA (rRNA) sequence. The isolate clustered with species belonging to Acinetobacter clade in a 16S rDNA-based neighbour-joining phylogenetic tree.

  4. Candida albicans Airway Colonization Facilitates Subsequent Acinetobacter baumannii Pneumonia in a Rat Model.

    PubMed

    Tan, Xiaojiang; Chen, Ruilan; Zhu, Song; Wang, Huijun; Yan, Dongxing; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios

    2016-06-01

    The objective of the study was to determine the effects of Candida albicans respiratory tract colonization on Acinetobacter baumannii pneumonia in a rat model. Rats were colonized with C. albicans by instillation of 3 × 10(6) CFU into their airways, while sterile saline was instilled in the control group. The colonized rats were further divided into two groups: treated with amphotericin B or not. The rats were subsequently infected with A. baumannii (10(8) CFU by tracheobronchial instillation). A. baumannii lung CFU counts, cytokine lung levels, and rates of A. baumannii pneumonia were compared between groups. In vitro expression of A. baumannii virulence genes was measured by reverse transcription (RT)-PCR after 24-hour incubation with C. albicans or with Mueller-Hinton (MH) broth alone. Rats with Candida colonization developed A. baumannii pneumonia more frequently and had higher A. baumannii CFU burdens and heavier lungs than controls. After A. baumannii infection, lung interleukin 17 (IL-17) concentrations were lower and gamma interferon (IFN-γ) concentrations were higher in Candida-colonized rats than in controls. Candida-colonized rats treated with amphotericin B had a decreased rate of A. baumannii pneumonia and lower IFN-γ levels but higher IL-17 levels than untreated rats. Expression of basC, barB, bauA, ptk, plc2, and pld2 was induced while expression of ompA and abaI was suppressed in A. baumannii cultured in the presence of C. albicans C. albicans colonization facilitated the development of A. baumannii pneumonia in a rat model. Among Candida-colonized rats, antifungal treatment lowered the incidence of A. baumannii pneumonia. These findings could be due to modification of the host immune response and/or expression of A. baumannii virulence genes by Candida spp. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Species identification within Acinetobacter calcoaceticus-baumannii complex using MALDI-TOF MS.

    PubMed

    Toh, Benjamin E W; Paterson, David L; Kamolvit, Witchuda; Zowawi, Hosam; Kvaskoff, David; Sidjabat, Hanna; Wailan, Alexander; Peleg, Anton Y; Huber, Charlotte A

    2015-11-01

    Acinetobacter baumannii, one of the more clinically relevant species in the Acinetobacter genus is well known to be multi-drug resistant and associated with bacteremia, urinary tract infection, pneumonia, wound infection and meningitis. However, it cannot be differentiated from closely related species such as Acinetobacter calcoaceticus, Acinetobacter pittii and Acinetobacter nosocomialis by most phenotypic tests and can only be differentiated by specific, time consuming genotypic tests with very limited use in clinical microbiological laboratories. As a result, these species are grouped into the A. calcoaceticus-A. baumannii (Acb) complex. Herein we investigated the mass spectra of 73 Acinetobacter spp., representing ten different species, using an AB SCIEX 5800 MALDI-TOF MS to differentiate members of the Acinetobacter genus, including the species of the Acb complex. RpoB gene sequencing, 16S rRNA sequencing, and gyrB multiplex PCR were also evaluated as orthogonal methods to identify the organisms used in this study. We found that whilst 16S rRNA and rpoB gene sequencing could not differentiate A. pittii or A. calcoaceticus, they can be differentiated using gyrB multiplex PCR and MALDI-TOF MS. All ten Acinetobacter species investigated could be differentiated by their MALDI-TOF mass spectra. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Clinical and Epidemiological Significance of Carbapenem Resistance in Acinetobacter baumannii Infections

    PubMed Central

    Tal-Jasper, Ruthy; Katz, David E.; Amrami, Nadav; Ravid, Dor; Avivi, Dori; Zaidenstein, Ronit; Lazarovitch, Tsilia; Dadon, Mor; Kaye, Keith S.

    2016-01-01

    Carbapenems are considered the treatment of choice for Acinetobacter baumannii infections. Many facilities implement preventive measures toward only carbapenem-resistant A. baumannii (CRAB). However, the independent role of the carbapenem resistance determinant on patient outcomes remains controversial. In a 6-year analysis of adults with A. baumannii bloodstream infection (BSI), the outcomes of 149 CRAB isolates were compared to those of 91 patients with carbapenem-susceptible A. baumannii. In bivariable analyses, CRAB BSIs were significantly associated with worse outcomes and with a delay in the initiation of appropriate antimicrobial therapy (DAAT). However, in multivariable analyses, carbapenem resistance status was no longer associated with poor outcomes, while DAAT remained an independent predictor. The epidemiological significance of A. baumannii should not be determined by its resistance to carbapenems. PMID:26883694

  7. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii.

    PubMed

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong

    2016-01-01

    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs-antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics.

  8. Evaluation of High-Resolution Melting Curve Analysis of Ligation-Mediated Real-Time PCR, a Rapid Method for Epidemiological Typing of ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter Species) Pathogens

    PubMed Central

    Ryberg, Anna; Billström, Hanna; Hällgren, Anita; Nilsson, Lennart E.; Marklund, Britt-Inger; Olsson-Liljequist, Barbro; Schön, Thomas

    2014-01-01

    A single-tube method, ligation-mediated real-time PCR high-resolution melt analysis (LMqPCR HRMA), was modified for the rapid typing of Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp. (ESKAPE) pathogens. A 97% agreement (60/62 isolates) was achieved in comparison to pulsed-field gel electrophoresis (PFGE) results, which indicates that LMqPCR HRMA is a rapid and accurate screening tool for monitoring nosocomial outbreaks. PMID:25232168

  9. Effect of Ethanol on Differential Protein Production and Expression of Potential Virulence Functions in the Opportunistic Pathogen Acinetobacter baumannii

    PubMed Central

    Nwugo, Chika C.; Arivett, Brock A.; Zimbler, Daniel L.; Gaddy, Jennifer A.; Richards, Ashley M.; Actis, Luis A.

    2012-01-01

    Acinetobacter baumannii persists in the medical environment and causes severe human nosocomial infections. Previous studies showed that low-level ethanol exposure increases the virulence of A. baumannii ATCC 17978. To better understand the mechanisms involved in this response, 2-D gel electrophoresis combined with mass spectrometry was used to investigate differential protein production in bacteria cultured in the presence or absence of ethanol. This approach showed that the presence of ethanol significantly induces and represses the production of 22 and 12 proteins, respectively. Although over 25% of the ethanol-induced proteins were stress-response related, the overall bacterial viability was uncompromised when cultured under these conditions. Production of proteins involved in lipid and carbohydrate anabolism was increased in the presence of ethanol, a response that correlates with increased carbohydrate biofilm content, enhanced biofilm formation on abiotic surfaces and decrease bacterial motility on semi-solid surfaces. The presence of ethanol also induced the acidification of bacterial cultures and the production of indole-3-acetic acid (IAA), a ubiquitous plant hormone that signals bacterial stress-tolerance and promotes plant-bacteria interactions. These responses could be responsible for the significantly enhanced virulence of A. baumannii ATCC 17978 cells cultured in the presence of ethanol when tested with the Galleria mellonella experimental infection model. Taken together, these observations provide new insights into the effect of ethanol in bacterial virulence. This alcohol predisposes the human host to infections by A. baumannii and could favor the survival and adaptation of this pathogen to medical settings and adverse host environments. PMID:23284824

  10. Effect of ethanol on differential protein production and expression of potential virulence functions in the opportunistic pathogen Acinetobacter baumannii.

    PubMed

    Nwugo, Chika C; Arivett, Brock A; Zimbler, Daniel L; Gaddy, Jennifer A; Richards, Ashley M; Actis, Luis A

    2012-01-01

    Acinetobacter baumannii persists in the medical environment and causes severe human nosocomial infections. Previous studies showed that low-level ethanol exposure increases the virulence of A. baumannii ATCC 17978. To better understand the mechanisms involved in this response, 2-D gel electrophoresis combined with mass spectrometry was used to investigate differential protein production in bacteria cultured in the presence or absence of ethanol. This approach showed that the presence of ethanol significantly induces and represses the production of 22 and 12 proteins, respectively. Although over 25% of the ethanol-induced proteins were stress-response related, the overall bacterial viability was uncompromised when cultured under these conditions. Production of proteins involved in lipid and carbohydrate anabolism was increased in the presence of ethanol, a response that correlates with increased carbohydrate biofilm content, enhanced biofilm formation on abiotic surfaces and decrease bacterial motility on semi-solid surfaces. The presence of ethanol also induced the acidification of bacterial cultures and the production of indole-3-acetic acid (IAA), a ubiquitous plant hormone that signals bacterial stress-tolerance and promotes plant-bacteria interactions. These responses could be responsible for the significantly enhanced virulence of A. baumannii ATCC 17978 cells cultured in the presence of ethanol when tested with the Galleria mellonella experimental infection model. Taken together, these observations provide new insights into the effect of ethanol in bacterial virulence. This alcohol predisposes the human host to infections by A. baumannii and could favor the survival and adaptation of this pathogen to medical settings and adverse host environments.

  11. The Impact of Antibiotic Consumption on Development of Acinetobacter Baumannii Resistance

    PubMed Central

    Granov, Djana; Ljubovic, Amela Dedeic; Zec, Svjetlana Loga; Granov, Nermir; Hukic, Mirsada

    2016-01-01

    Aim: The aim of this study was to examine the impact of antibiotic consumption on development of antimicrobial resistance in Acinetobacter baumannii. Material and Methods: The study was conducted in University Clinical Center of Sarajevo. In our retrospective study Acinetobacter baumannii isolated in period from July 1st 2009 to December 31st 2012. Isolates were detected from different clinical samples including urine, wound swab, blood, bronchial aspirate and other samples which were collected from patients situated on various hospital wards. Clinical isolates belonged to one per patient in a given period of time. Results: Antimicrobial resistance was interpreted according to CLSI breakpoints. Consumption of antibiotics was analyzed according to recommendations of the ESAC-Net and current Acinetobacter baumannii classification. Pearson’s correlation showed a positive correlation between gentamicin consumption and emerging of resistance (p = 0.023). Conclusion: Increase in the antimicrobial use was followed with an increase in resistance of Acinetobacter baumannii isolates. Monitoring of antibiotic resistance and consumption is of a great importance in order to reduce the emergence and spread of antimicrobial resistant organisms in the health care settings. PMID:28144198

  12. Meta-analysis of colistin for the treatment of Acinetobacter baumannii infection.

    PubMed

    Chen, Zhijin; Chen, Yu; Fang, Yaogao; Wang, Xiaotian; Chen, Yanqing; Qi, Qingsong; Huang, Fang; Xiao, Xungang

    2015-11-24

    Multidrug resistant among Acinetobacter baumannii infection is associated with a high mortality rate and limits the therapeutic options. The aim of this study was to assess the safety and efficacy of colistin monotherapy vs. other single antibiotic therapy AND colistin-based combination therapy (with other antibiotics) vs. colistin alone for the treatment of Acinetobacter baumannii infection. Online electronic database were searched for studies evaluating colistin with or without other antibiotics in treatment of patients with drug-resistant Acinetobacter baumannii infection. Totally, twelve studies met the inclusion criteria. For colistin-based combination therapy, six articles including 668 patients were included. Our results showed that the overall clinical response did not differ significantly between colistin-based combination therapy and monotherapy (OR = 1.37, 95% CI = 0.86-2.19, P = 0.18). This insignificance was also detected in ICU mortality, length of stay and nephrotoxicity (P > 0.05). However, the colistin-based combination therapy was shown increasing the microbiological response (OR = 2.14, 95% CI = 1.48-3.07, P < 0.0001). For colistin monotherapy, six studies involving 491 patients were analyzed. The results were in concordance with the findings of the colistin-based combination therapy group. Our results suggest that colistin may be a promising therapy as safe and efficacious as standard antibiotics for the treatment of drug-resistant Acinetobacter baumannii infection.

  13. Meta-analysis of colistin for the treatment of Acinetobacter baumannii infection

    PubMed Central

    Chen, Zhijin; Chen, Yu; Fang, Yaogao; Wang, Xiaotian; Chen, Yanqing; Qi, Qingsong; Huang, Fang; Xiao, Xungang

    2015-01-01

    Multidrug resistant among Acinetobacter baumannii infection is associated with a high mortality rate and limits the therapeutic options. The aim of this study was to assess the safety and efficacy of colistin monotherapy vs. other single antibiotic therapy AND colistin-based combination therapy (with other antibiotics) vs. colistin alone for the treatment of Acinetobacter baumannii infection. Online electronic database were searched for studies evaluating colistin with or without other antibiotics in treatment of patients with drug-resistant Acinetobacter baumannii infection. Totally, twelve studies met the inclusion criteria. For colistin-based combination therapy, six articles including 668 patients were included. Our results showed that the overall clinical response did not differ significantly between colistin-based combination therapy and monotherapy (OR = 1.37, 95% CI = 0.86–2.19, P = 0.18). This insignificance was also detected in ICU mortality, length of stay and nephrotoxicity (P > 0.05). However, the colistin-based combination therapy was shown increasing the microbiological response (OR = 2.14, 95% CI = 1.48–3.07, P < 0.0001). For colistin monotherapy, six studies involving 491 patients were analyzed. The results were in concordance with the findings of the colistin-based combination therapy group. Our results suggest that colistin may be a promising therapy as safe and efficacious as standard antibiotics for the treatment of drug-resistant Acinetobacter baumannii infection. PMID:26597507

  14. Colistin methanesulfonate against multidrug-resistant Acinetobacter baumannii in an in vitro pharmacodynamic model.

    PubMed

    Kroeger, Lisa A; Hovde, Laurie B; Mitropoulos, Isaac F; Schafer, Jeremy; Rotschafer, John C

    2007-09-01

    Using an in vitro pharmacodynamic model, a multidrug-resistant strain of Acinetobacter baumannii was exposed to colistin methanesulfonate alone and in combination with ceftazidime. Pre- and postexposure colistin sulfate MICs were determined. A single daily dose of colistin methanesulfonate combined with continuous-infusion ceftazidime prevented regrowth and postexposure MIC increases.

  15. Draft Genome Sequences of Clinical Isolates of Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Erickson, Keesha E.; Madinger, Nancy E.

    2017-01-01

    ABSTRACT We report here the draft genome sequences of two clinically isolated Acinetobacter baumannii strains. These samples were obtained from patients at the University of Colorado Hospital in 2007 and 2013 and encode an estimated 20 and 13 resistance genes, respectively. PMID:28153899

  16. Draft Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Strain from Chile

    PubMed Central

    Lopes, Bruno S.; García, Patricia; Domínguez Yévenes, Mariana; Lima, Celia; Bello-Toledo, Helia; González-Rocha, Gerardo; Amyes, Sebastian G. B.

    2015-01-01

    Acinetobacter baumannii strain Ab5 was isolated in the year 2007 in Chile, being one of the first multidrug-resistant (MDR) cases reported in the country. Here, we present the very first draft genome sequence of an MDR Chilean strain, which shows the presence of diverse resistance and acquired virulence genes. PMID:26139713

  17. Draft Genome Sequence of a Multidrug-Resistant Acinetobacter baumannii Strain from Chile.

    PubMed

    Opazo, Andrés; Lopes, Bruno S; García, Patricia; Domínguez Yévenes, Mariana; Lima, Celia; Bello-Toledo, Helia; González-Rocha, Gerardo; Amyes, Sebastian G B

    2015-07-02

    Acinetobacter baumannii strain Ab5 was isolated in the year 2007 in Chile, being one of the first multidrug-resistant (MDR) cases reported in the country. Here, we present the very first draft genome sequence of an MDR Chilean strain, which shows the presence of diverse resistance and acquired virulence genes. Copyright © 2015 Opazo et al.

  18. In-silico modeling of a novel OXA-51 from β-lactam-resistant Acinetobacter baumannii and its interaction with various antibiotics.

    PubMed

    Tiwari, Vishvanath; Nagpal, Isha; Subbarao, Naidu; Moganty, Rajeswari R

    2012-07-01

    Acinetobacter baumannii, one of the major Gram negative bacteria, causes nosocomial infections such as pneumonia, urinary tract infection, meningitis, etc. β-lactam-based antibiotics like penicillin are used conventionally to treat infections of A. baumannii; however, they are becoming progressively less effective as the bacterium produces diverse types of β-lactamases to inactivate the antibiotics. We have recently identified a novel β-lactamase, OXA-51 from clinical strains of A. baumannii from our hospital. In the present study, we generated the structure of OXA-51 using MODELLER9v7 and studied the interaction of OXA-51 with a number of β-lactams (penicillin, oxacillin, ceftazidime, aztreonam and imipenem) using two independent programs: GLIDE and GOLD. Based on the results of different binding parameters and number of hydrogen bonds, interaction of OXA-51 was found to be maximum with ceftazidime and lowest with imipenem. Further, molecular dynamics simulation results also support this fact. The lowest binding affinity of imipenem to OXA-51 indicates clearly that it is not efficiently cleaved by OXA-51, thus explaining its high potency against resistant A. baumannii. This finding is supported by experimental results from minimum inhibitory concentration analysis and transmission electron microscopy. It can be concluded that carbapenems (imipenem) are presently effective β-lactam antibiotics against resistant strains of A. baumannii harbouring OXA-51. The results presented here could be useful in designing more effective derivatives of carbapenem.

  19. Multidrug-resistant Acinetobacter baumannii strains carrying the bla(OxA-23) and the bla(GES-11) genes in a neonatology center in Tunisia.

    PubMed

    Charfi-Kessis, Karama; Mansour, Wejdene; Ben Haj Khalifa, Anis; Mastouri, Maha; Nordmann, Patrice; Aouni, Mahjoub; Poirel, Laurent

    2014-09-01

    Multidrug-resistant and difficult-to-treat Acinetobacter baumannii may be responsible for nosocomial infections. The production of carbapenem-hydrolyzing class D β-lactamases (CHDLs) and extended-spectrum β-lactamase (ESBLs) of the GES type possessing a carbapenemase activity has been increasingly reported worldwide in A. baumannii. The aim of this study was to analyze the resistance mechanisms of two carbapenem resistant A. baumannii clinical isolates recovered in a neonatology center in the center-east of Tunisia. Two carbapenem resistant A. baumannii isolates were recovered. The first isolate co-harbored the blaGES-11 ESBL gene and the blaOxA-23 CHDL gene. Analyses of the genetic location indicated that the blaGES-11 gene was plasmid located (Gr6). However, the blaOxA-23 gene was located on the chromosome. The second strain had only the blaOxA-23 CHDL gene, which was plasmid located. This study showed the first description of the GES-type β-lactamase in A. baumannii in Tunisia.

  20. An Investigation of Antibacterial Resistance Patterns Among Acinetobacter baumannii and Pseudomonas aeruginosa Isolates Collected from Intensive Care Units of a University-Affiliated Hospital in Ahvaz, Iran

    PubMed Central

    Izadpour, Farrokh; Ranjbari, Nastaran; Aramesh, Mohammad-Reza; Moosavian, Mojtaba; ShahAli, Shiva; Larki, Farzaneh; Tabesh, Hamed; Morvaridi, Afrooz

    2016-01-01

    Background In recent decades, multidrug-resistant non-fermenting Gram-negative pathogens, particularly Acinetobacter baumannii and Pseudomonas aeruginosa, have been recognized as a major cause of healthcare-associated and nosocomial infections and outbreaks. Objectives The aim of this study was to determine the prevalence and pattern of antibiotic resistance in A. baumannii and P. aeruginosa isolates collected from intensive care units (ICUs). Methods One hundred fifty-five clinical isolates, including 80 (51.6%) isolates of A. baumannii and 75 (48.4%) isolates of P. aeruginosa, from hospitalized patients in the ICUs of a teaching hospital in Ahvaz, Iran, were collected from January 1 to December 30, 2013. The organisms were identified with conventional bacteriological methods, and antimicrobial susceptibility testing was performed on all isolates in accordance with clinical laboratory and standards institute (CLSI) guidelines. Results The maximum resistance rates among A. baumannii isolates were observed for ciprofloxacin and trimethoprim-sulfamethoxazole (96.9% and 95.2%, respectively). For P. aeruginosa isolates, the maximum resistance rates were reported for ceftriaxone and trimethoprim-sulfamethoxazole (97.2% and 92.4%, respectively). Conclusions The majority of A. baumannii and P. aeruginosa isolates were found to be resistant to commonly recommended antibiotics. Therefore, surveillance of antibiotic consumption and proper antibiotic administration guidelines are essential for preventing major outbreaks in the future. PMID:27800136

  1. Role of Fibronectin in the Adhesion of Acinetobacter baumannii to Host Cells

    PubMed Central

    Smani, Younes; McConnell, Michael J.; Pachón, Jerónimo

    2012-01-01

    Adhesion to host cells is an initial and important step in Acinetobacter baumannii pathogenesis. However, there is relatively little information on the mechanisms by which A. baumannii binds to and interacts with host cells. Adherence to extracellular matrix proteins, such as fibronectin, affords pathogens with a mechanism to invade epithelial cells. Here, we found that A. baumannii adheres more avidly to immobilized fibronectin than to control protein. Free fibronectin used as a competitor resulted in dose-dependent decreased binding of A. baumannii to fibronectin. Three outer membrane preparations (OMPs) were identified as fibronectin binding proteins (FBPs): OMPA, TonB-dependent copper receptor, and 34 kDa OMP. Moreover, we demonstrated that fibronectin inhibition and neutralization by specific antibody prevented significantly the adhesion of A. baumannii to human lung epithelial cells (A549 cells). Similarly, A. baumannii OMPA neutralization by specific antibody decreased significantly the adhesion of A. baumannii to A549 cells. These data indicate that FBPs are key adhesins that mediate binding of A. baumannii to human lung epithelial cells through interaction with fibronectin on the surface of these host cells. PMID:22514602

  2. [Antimicrobial susceptibility and molecular characterization of multidrug-resistant Acinetobacter baumannii isolated in an university hospital].

    PubMed

    Direkel, Şahin; Çopur Çiçek, Ayşegül; Karagöz, Alper; Aydoğan Ejder, Nebahat; Oktay, Efdal; Delialioğlu, Nuran; Özgümüş, Osman Birol; Durmaz, Rıza

    2016-10-01

    Acinetobacter baumannii, an aerobic, non-motile, gram-negative bacterium is an important nosocomial pathogen which shows resistance to the most antibiotics. Carbapenems are the most commonly used antibiotics for the treatment of infections caused by this pathogen. However the emergence of resistance against carbapenems in an increasing rate generates serious problems for antimicrobial therapy. The aims of this study were to detect the antibiotic susceptibility, and the presence of blaOXA resistance genes of clinical A.baumannii isolates and to determine the clonal relationship between these isolates. A total of 79 A.baumannii strains isolated from various clinical specimens (37 respiratory tract samples, 11 wound, 10 blood, 8 catheters, 6 tissue, 5 urine, 2 abscess) of the patients admitted to Mersin University Medical School Hospital between May 2012-January 2013, were included in the study. The isolates were identified by conventional methods and Vitek®2 Compact automated system. Antibiotic susceptibilities of the isolates were determined by Kirby-Bauer disk diffusion method and evaluated according to CLSI criteria. The presence of blaOXA-51, blaOXA-23, blaOXA-24, blaOXA-48 and blaOXA-58 genes were detected by an in-house polymerase chain reaction (PCR), and the clonal relationship between the isolates were identified by pulsed-field gel electroforesis (PFGE) using the ApaI restriction enzyme. In our study, all of the isolates were susceptible to colistin, while the resistance rates against piperacillin-tazobactam, ciprofloxacin, imipenem, meropenem, cefoperazone/sulbactam, trimethoprim-sulfamethoxazole, ceftazidime, levofloxacin, gentamicin, tetracycline, ampicillin-sulbactam, amikacin, netilmicin and tigecycline were 97.5%, 96.2%, 94.9%, 94.9%, 93.6%, 91.1%, 88.6%, 86%, 83.6%, 77.2%, 69.6%, 55.7%, 27.8% and 3.8%, respectively. All the isolates were identified as A.baumannii with the OXA-specific PCR and OXA16S rDNA sequence analysis. All of the isolates (100

  3. [Evaluation of the efficacy of colistin/sulbactam combination on carbapenem-resistant Acinetobacter baumannii strains].

    PubMed

    Çetinkol, Yeliz; Telli, Murat; Altunçekiç Yıldırım, Arzu; Çalgın, Mustafa Kerem

    2016-07-01

    Acinetobacter baumannii strains, are opportunistic pathogens that cause severe nosocomial infections that are difficult to treat due to development of resistance to multiple antibiotics. As the antibiotic choices to be used in treatment are limited, combinations of a variety of antibiotics are used. The aims of this study were to identify the minimal inhibitory concentration (MIC) values of colistin and sulbactam against A.baumannii isolates and to determine the in vitro activity of colistin-sulbactam combination. A total of 50 A.baumannii strains isolated from different clinical specimens (32 tracheal aspirates, 10 blood, 6 urine and 2 wound samples) were included in the study. The identification of bacteria was performed by traditional methods and Vitek-2 (BioMerieux, France) automated system. Antibiotic susceptibilities were detected by Mueller-Hinton agar disk diffusion method and Vitek-2 automated system and the results were interpreted according to the CLSI standards. MIC values of colistin and sulbactam against A.baumannii strains and in vitro interactions of colistin-sulbactam combinations were determined with the E-test (BioMerieux, France). Fractional inhibitory concentration (FIC) index was used for the detection of efficacy of drug combinations. The presence of oxacillinase and metallo-beta-lactamase (MBL) genes that lead carbapenem resistance was investigated by polymerase chain reaction (PCR), and pulsed-field gel electrophoresis (PFGE) was performed for the determination of clonal relationship. In our study, all strains (100%) were detected as susceptible to colistin, 48 (96%) to trimethoprim/sulphamethoxazole and 18 to (36%) tigecyclin; however all of them were resistant to the other studied antibiotics, including sulbactam and carbapenem. When the colistin-sulbactam combination was assessed according to FIC index, all strains were found to have antagonistic effect. All of the carbapenem-resistant strains were positive for OXA-51 and OXA-23, and 3

  4. Improvement of MALDI-TOF MS profiling for the differentiation of species within the Acinetobacter calcoaceticus-Acinetobacter baumannii complex.

    PubMed

    Šedo, Ondrej; Nemec, Alexandr; Křížová, Lenka; Kačalová, Magdaléna; Zdráhal, Zbyněk

    2013-12-01

    MALDI-TOF MS is currently becoming the method of choice for rapid identification of bacterial species in routine diagnostics. Yet, this method suffers from the inability to differentiate reliably between some closely related bacterial species including those of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex, namely A. baumannii and Acinetobacter nosocomialis. In the present study, we evaluated a protocol which was different from that used in the Bruker Daltonics identification system (MALDI BioTyper) to improve species identification using a taxonomically precisely defined set of 105 strains representing the four validly named species of the ACB complex. The novel protocol is based on the change in matrix composition from alpha-cyano-4-hydroxycinnamic acid (saturated solution in water:acetonitrile:trifluoroacetic acid, 47.5:50:2.5, v/v) to ferulic acid (12.5mgml(-1) solution in water:acetonitrile:formic acid 50:33:17, v/v), while the other steps of sample processing remain unchanged. Compared to the standard protocol, the novel one extended the range of detected compounds towards higher molecular weight, produced signals with better mass resolution, and allowed the detection of species-specific signals. As a result, differentiation of A. nosocomialis and A. baumannii strains by cluster analysis was improved and 13 A. nosocomialis strains, assigned erroneously or ambiguously by using the standard protocol, were correctly identified.

  5. Candida spp. airway colonization: A potential risk factor for Acinetobacter baumannii ventilator-associated pneumonia.

    PubMed

    Tan, Xiaojiang; Zhu, Song; Yan, Dongxing; Chen, Weiping; Chen, Ruilan; Zou, Jian; Yan, Jingdong; Zhang, Xiangdong; Farmakiotis, Dimitrios; Mylonakis, Eleftherios

    2016-08-01

    This retrospective study was conducted to identify potential risk factors for Acinetobacter baumannii (A. baumannii) ventilator-associated pneumonia (VAP) and evaluate the association between Candida spp. airway colonization and A. baumannii VAP. Intensive care unit (ICU) patients who were on mechanical ventilation (MV) for ≥48 hours were divided into the following groups: patients with and without Candida spp. airway colonization; colonized patients receiving antifungal treatment or not; patients with A. baumannii VAP and those without VAP. Logistic regression analysis and propensity score matching were used to identify factors independently associated with A. baumannii VAP. Among 618 eligible patients, 264 (43%) had Candida spp. airway colonization and 114 (18%) developed A. baumannii VAP. Along with MV for ≥7 days (adjusted odds ratio [aOR] 8.9, 95% confidence intervals [95% CI] 4.9-15.8) and presence of a central venous catheter (aOR 3.2, 95% CI 1.1-9), Candida spp. airway colonization (aOR 2.6, 95% CI 1.6-4.3) was identified as an independent risk factor for A. baumannii VAP. Patients with Candida spp. airway colonization were more likely to develop A. baumannii VAP than non-colonized patients (23% vs 15%, P=.01 and 34% vs. 15%, P<.001 in propensity score-matched subgroups). Administration of antifungal agents was not associated with A. baumannii VAP (29% vs. 21%, P=.153) but with higher in-hospital mortality (53% vs. 39%, P=.037). Candida spp. airway colonization (43%) and A. baumannii VAP (18%) were common in ICU patients who were on mechanical ventilation for at least 48 hours. Candida spp. airway colonization was an independent risk factor for subsequent A. baumannii VAP. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. [Characterization and determination of antibiotic resistance profiles of a single clone Acinetobacter baumannii strains isolated from blood cultures].

    PubMed

    Karagöz, Alper; Baran, Irmak; Aksu, Neriman; Acar, Sümeyra; Durmaz, Rıza

    2014-10-01

    Acinetobacter baumannii which is a significant cause of nosocomial infections, increases the rate of morbidity and mortality in health care settings especially in intensive care units (ICUs). The aim of this study was to determine the antibiotic resistance profiles of A.baumannii strains isolated from blood cultures of inpatients from different ICUs, wards and hospital environment and evaluate their clonal relationships and epidemiologic features. A total of 54 A.baumannii strains (47 from the blood cultures and 7 from the hospital environment), identified between 01 January 2012-28 December 2012 at the Clinical Microbiology Laboratory of Ankara Numune Training and Research Hospital, Turkey, were included in the study. Identification of A.baumannii isolates and their antimicrobial [sulbactam-ampicillin (SAM), piperacillin (PIP), piperacillin-tazobactam (TZP), ceftazidime (CFZ), cefoperazone-sulbactam (SCF), cefepime (CEF), imipenem (IMP), meropenem (MER), amikacin (AMK), gentamicin (GEN), netilmicin (NT), ciprofloxacin (CIP), levofloxacin (LVF), tetracycline (TET), tigecycline (TG), colistin (COL), trimethoprim-sulfamethoxazole (SXT)] susceptibility testing were performed by Vitek 2 (bioMérieux, France) system. The clonal relationship between the A.baumannii isolates was analysed by pulsed-field gel electrophoresis (PFGE). In our study colistin, tigecycline and netilmicin were found to be the most effective agents against A.baumannii isolates. All of the clinical isolates (n= 47) were found susceptible to COL, however all were resistant to SAM, PIP, TZP, CEF, IPM, CFZ, MER and CIP. While 1.85%, 14.8%, 14.8%, 16.6%, 59.2% and 22.2% of the isolates were susceptible to SCF, AMK, NT, GEN, TG and SXT, respectively; 1.85%, 1.85%, 9.2%, 16.6%, 38.8% and 27.7% of the isolates were intermediate to SCF, TET, AMK, NT, LVF and TG, respectively. Similarly, all of the environmental A.baumannii isolates (n= 7) were resistant to SAM, PIP, TZP, CFZ, CEF, IPM, MER and CIP, and all

  7. [Investigation of OXA type beta-lactamases and PFGE patterns in Acinetobacter baumannii strains resistant to carbapenems].

    PubMed

    Keyik, Serafettin; Arslan, Uğur; Türk Dağı, Hatice; Seyhan, Tuba; Fındık, Duygu

    2014-10-01

    Acinetobacter baumannii is an important opportunistic and multidrug-resistant pathogen leading to nosocomial infections. Over the last 10 years, a significant and threatening increase in resistance to carbapenems, mainly due to the dissemination of class D beta-lactamases, has been reported in A.baumannii worldwide. The most common types of beta-lactamases causing carbapenem resistance in A.baumannii are the OXA-23, OXA-24, OXA-40, OXA-58 and OXA-143 type serine beta-lactamases. The aim of this study was to investigate the presence of OXA type beta-lactamases in carbapenem-resistant A.baumannii strains and the clonal relationship between the strains. A total of 105 non-duplicate carbapenem-resistant A.baumannii strains isolated from various clinical samples (68 blood, 18 bronchoalveolar lavage, 13 drainage, 3 urine, 2 cerebrospinal fluid and 1 catheter samples) in the Microbiology Laboratories of Selcuk University, Meram (2009-2012) and Selcuklu (2007-2008) Medical School Hospitals, were included in the study. The isolates were identified by conventional methods and Phoenix 100 BD (BD Diagnostic, USA) and Vitek II (bioMerieux, France) automated systems. Carbapenem susceptibility test was performed by Kirby-Bauer disk diffusion method according to the CLSI standards. bla(OXA 23-like), bla(OXA 24-like), bla(OXA 58-like) and bla(OXA 51-like) genes were amplified by multiplex PCR assay and clonal relatedness was investigated by pulsed-field gel electrophoresis (PFGE) using ApaI enzyme. The bla(OXA 51-like) gene was determined in all carbapenem-resistant A.baumannii isolates, while the bla(OXA 23-like) and bla(OXA 58-like) genes were detected in 46.6% and 53.3% of isolates, respectively. However bla(OXA 24-like) gene was not demonstrated in any isolates. bla(OXA 23-like) gene was determined in both Meram and Selcuklu Medical School hospitals, but bla(OXA 58-like) gene was detected only in Meram Medical School hospital. PFGE analysis of the isolates revealed 32 different

  8. Outcomes of critically ill cancer patients with Acinetobacter baumannii infection

    PubMed Central

    Ñamendys-Silva, Silvio A; Correa-García, Paulina; García-Guillén, Francisco J; González-Herrera, María O; Pérez-Alonso, Américo; Texcocano-Becerra, Julia; Herrera-Gómez, Angel; Cornejo-Juárez, Patricia; Meneses-García, Abelardo

    2015-01-01

    AIM: To describe the intensive care unit (ICU) outcomes of critically ill cancer patients with Acinetobacter baumannii (AB) infection. METHODS: This was an observational study that included 23 consecutive cancer patients who acquired AB infections during their stay at ICU of the National Cancer Institute of Mexico (INCan), located in Mexico City. Data collection took place between January 2011, and December 2012. Patients who had AB infections before ICU admission, and infections that occurred during the first 2 d of ICU stay were excluded. Data were obtained by reviewing the electronic health record of each patient. This investigation was approved by the Scientific and Ethics Committees at INCan. Because of its observational nature, informed consent of the patients was not required. RESULTS: Throughout the study period, a total of 494 critically ill patients with cancer were admitted to the ICU of the INCan, 23 (4.6%) of whom developed AB infections. Sixteen (60.9%) of these patients had hematologic malignancies. Most frequent reasons for ICU admission were severe sepsis or septic shock (56.2%) and postoperative care (21.7%). The respiratory tract was the most frequent site of AB infection (91.3%). The most common organ dysfunction observed in our group of patients were the respiratory (100%), cardiovascular (100%), hepatic (73.9%) and renal dysfunction (65.2%). The ICU mortality of patients with 3 or less organ system dysfunctions was 11.7% (2/17) compared with 66.6% (4/6) for the group of patients with 4 or more organ system dysfunctions (P = 0.021). Multivariate analysis identified blood lactate levels (BLL) as the only variable independently associated with in-ICU death (OR = 2.59, 95%CI: 1.04-6.43, P = 0.040). ICU and hospital mortality rates were 26.1% and 43.5%, respectively. CONCLUSION: The mortality rate in critically ill patients with both HM, and AB infections who are admitted to the ICU is high. The variable most associated with increased mortality was

  9. Innate immune responses to systemic Acinetobacter baumannii infection in mice: neutrophils, but not interleukin-17, mediate host resistance.

    PubMed

    Breslow, Jessica M; Meissler, Joseph J; Hartzell, Rebecca R; Spence, Phillip B; Truant, Allan; Gaughan, John; Eisenstein, Toby K

    2011-08-01

    Acinetobacter baumannii is a nosocomial pathogen with a high prevalence of multiple-drug-resistant strains, causing pneumonia and sepsis. The current studies further develop a systemic mouse model of this infection and characterize selected innate immune responses to the organism. Five clinical isolates, with various degrees of antibiotic resistance, were assessed for virulence in two mouse strains, and between male and female mice, using intraperitoneal infection. A nearly 1,000-fold difference in virulence was found between bacterial strains, but no significant differences between sexes or mouse strains were observed. It was found that microbes disseminated rapidly from the peritoneal cavity to the lung and spleen, where they replicated. A persistent septic state was observed. The infection progressed rapidly, with mortality between 36 and 48 h. Depletion of neutrophils with antibody to Ly-6G decreased mean time to death and increased mortality. Interleukin-17 (IL-17) promotes the response of neutrophils by inducing production of the chemokine keratinocyte-derived chemoattractant (KC/CXCL1), the mouse homolog of human IL-8. Acinetobacter infection resulted in biphasic increases in both IL-17 and KC/CXCL1. Depletion of neither IL-17 nor KC/CXCL1, using specific antibodies, resulted in a difference in bacterial burdens in organs of infected mice at 10 h postinfection. Comparison of bacterial burdens between IL-17a(-/-) and wild-type mice confirmed that the absence of this cytokine did not sensitize mice to Acinetobacter infection. These studies definitely demonstrate the importance of neutrophils in resistance to systemic Acinetobacter infection. However, neither IL-17 nor KC/CXCL1 alone is required for effective host defense to systemic infection with this organism.

  10. Evaluation of CHROMagar Acinetobacter for Detection of Enteric Carriage of Multidrug-Resistant Acinetobacter baumannii in Samples from Critically Ill Patients▿

    PubMed Central

    Gordon, N. C.; Wareham, D. W.

    2009-01-01

    CHROMagar Acinetobacter was used to screen stool and perineal swabs for enteric carriage of multidrug-resistant Acinetobacter baumannii in samples from critically ill patients. Results were compared with a molecular assay resulting in sensitivity and specificity of culture compared to PCR of 91.7% and 89.6%, respectively. PMID:19439546

  11. First detection of OXA-24 carbapenemase-producing Acinetobacter baumannii isolates in Bulgaria.

    PubMed

    Todorova, Bozhana; Velinov, Tzvetan; Ivanov, Ivan; Dobreva, Elina; Kantardjiev, Todor

    2014-04-01

    This report describes the first identification of OXA-24 carbapenemase-producing Acinetobacter baumannii isolates from Bulgaria. According to national surveillance data A. baumannii along with Pseudomonas aeruginosa are the most troublesome microorganisms in hospital environment with high rates of acquired carbapenem resistance. In the present study real-time multiplex PCR was performed to identify the most common carbapenemase genes in 15 non-duplicate carbapenem-resistant A. baumannii isolates collected in 2012. The results showed lack of KPC, GES, VIM, IMP-type enzymes. Four A. baumannii isolates tested positive by PCR for the acquired OXA-24 together with the intrinsic OXA-51 carbapenemase. OXA-24 and OXA-23 were determined as co-existent in one isolate. Two isolates were identified with OXA-23 in addition to the OXA-51 carbapenemase.

  12. Phosphoproteomics as an emerging weapon to develop new antibiotics against carbapenem resistant strain of Acinetobacter baumannii.

    PubMed

    Tiwari, Vishvanath; Tiwari, Monalisa

    2015-01-01

    Acinetobacter baumannii causes pneumonia, bloodstream infections, urinary tract infections, respiratory infections and meningitis. A. baumannii has developed resistance against most of the antibiotics including carbapenem. Therefore, to battle carbapenem resistance, there is a need to develop antimicrobial drugs with new modes of action. Phosphoproteomics will help identify the differentially phosphorylated protein and its crucial phosphosites which facilitate the elucidation of molecular mechanism of signaling and regulation of carbapenem resistant strain of A. baumannii as compared to carbapenem sensitive strain. This understanding might be useful for the development of new antibiotics against kinases involved in the phosphorylation of identified phosphosites in carbapenem resistant strain of A. baumannii. The proposed antibiotics selectively inhibit carbapenem resistant strain which further avoids its excessive use against carbapenem sensitive strain and thereafter reduces emergence of resistance.

  13. Screening and deciphering antibiotic resistance in Acinetobacter baumannii: a state of the art.

    PubMed

    Bonnin, Rémy A; Nordmann, Patrice; Poirel, Laurent

    2013-06-01

    Acinetobacter baumannii, recognized as a serious threat in healthcare facilities, has the ability to develop resistance to antibiotics quite easily. This resistance is related to either gene acquisition (horizontal gene transfer) or mutations in the genome, leading to gene disruption, over- or down-expression of genes. The clinically relevant antibiotic resistances in A. baumannii include resistance to aminoglycosides, broad-spectrum cephalosporins, carbapenems, tigecycline and colistin, which are the last resort antibiotics. The intrinsic and acquired resistance mechanisms of A. baumannii are presented here, with special focus on β-lactam resistance. The most up-to-date techniques for identification, including phenotypical and molecular tests, and screening of those emerging resistance traits are also highlighted. The implementation of early detection and identification of multidrug-resistant A. baumannii is crucial to control their spread.

  14. Distribution of AdeABC efflux system genes in genotypically diverse strains of clinical Acinetobacter baumannii.

    PubMed

    Wieczorek, Piotr; Sacha, Paweł; Czaban, Sławomir; Hauschild, Tomasz; Ojdana, Dominika; Kowalczuk, Oksana; Milewski, Robert; Poniatowski, Bogusław; Nikliński, Jacek; Tryniszewska, Elżbieta

    2013-10-01

    Acinetobacter baumannii has emerged as a highly problematic hospital-associated pathogen. Different mechanisms contribute to the formation of multidrug resistance in A. baumannii, including the AdeABC efflux system. Distribution of the structural and regulatory genes encoding the AdeABC efflux system among genetically diverse clinical A. baumannii strains was achieved by using PCR and pulsed-field gel electrophoresis techniques. The distribution of adeABRS genes is extremely high among our A. baumannii strains, except the adeC gene. We have observed a large proportion of strains presenting multidrug-resistance phenotype for several years. The efflux pump could be an important mechanism in these strains in resistance to antibiotics.

  15. Complete Genome Sequence of a blaOXA-58-Producing Acinetobacter baumannii Strain Isolated from a Mexican Hospital

    PubMed Central

    Pérez-Oseguera, Ángeles; Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Silva-Sanchez, Jesus; Garza-González, Elvira; Castillo-Ramírez, Santiago

    2017-01-01

    ABSTRACT In this study, we present the complete genome sequence of a blaOXA-58-producing Acinetobacter baumannii strain, sampled from a Mexican hospital and not related to the international clones. PMID:28883144

  16. Complete Genome Sequence of a blaOXA-58-Producing Acinetobacter baumannii Strain Isolated from a Mexican Hospital.

    PubMed

    Pérez-Oseguera, Ángeles; Castro-Jaimes, Semiramis; Salgado-Camargo, Abraham David; Silva-Sanchez, Jesus; Garza-González, Elvira; Castillo-Ramírez, Santiago; Cevallos, Miguel Ángel

    2017-09-07

    In this study, we present the complete genome sequence of a blaOXA-58-producing Acinetobacter baumannii strain, sampled from a Mexican hospital and not related to the international clones. Copyright © 2017 Pérez-Oseguera et al.

  17. Risk factors for carbapenem-resistant Acinetobacter baumannii infections at a tertiary care hospital in New Caledonia, South Pacific.

    PubMed

    Le Hello, Simon; Falcot, Virginie; Lacassin, Flore; Mikulski, Marc; Baumann, Francine

    2010-12-01

    In New Caledonia, South Pacific, Acinetobacter baumannii is a nosocomial pathogen. OXA-23 carbapenem-resistant A. baumannii (CRAB) has been ranked third among all multidrug-resistant (MDR) bacteria at the main hospital of Nouméa in New Caledonia (24.8%, 50/202 isolates). In the present study, risk factors and outcomes for 50 patients with CRAB infection were compared with those of 152 patients infected with other MDR bacteria. Independent risk factors for infection with CRAB were respiratory ward admission (odds ratio 2.8, 95% confidence interval 1.1-7.1) and previous treatment with quinolones, β-lactams and anti-MRSA antibiotics. The 30-day mortality was higher for CRAB infections compared with other MDR infections (14% vs 3.3%, p = 0.006). These findings highlight the importance of knowing specific local characteristics relating to the ecology and patterns of resistance of MDR bacteria so as to avoid the emergence of unexpected pan-resistant bacteria.

  18. Prevalence and Genetic Characterization of Carbapenem- and Polymyxin-Resistant Acinetobacter baumannii Isolated from a Tertiary Hospital in Terengganu, Malaysia.

    PubMed

    Lean, Soo-Sum; Suhaili, Zarizal; Ismail, Salwani; Rahman, Nor Iza A; Othman, Norlela; Abdullah, Fatimah Haslina; Jusoh, Zakaria; Yeo, Chew Chieng; Thong, Kwai-Lin

    2014-01-01

    Nosocomial infection caused by Acinetobacter baumannii is of great concern due to its increasing resistance to most antimicrobials. In this study, 54 nonrepeat isolates of A. baumannii from the main tertiary hospital in Terengganu, Malaysia, were analyzed for their antibiograms and genotypes. Out of the 54 isolates, 39 (72.2%) were multidrug resistant (MDR) and resistant to carbapenems whereas 14 (25.9%) were categorized as extensive drug resistant (XDR) with additional resistance to polymyxin B, the drug of "last resort." Pulsed-field gel electrophoresis analyses showed that the polymyxin-resistant isolates were genetically diverse while the carbapenem-resistant isolates were clonally related. The 14 XDR isolates were further investigated for mutations in genes known to mediate polymyxin resistance, namely, pmrCAB, and the lipopolysaccharide biosynthesis genes, lpxA, lpxC, lpxD, and lpsB. All 14 isolates had a P102H mutation in pmrA with no mutation detected in pmrC and pmrB. No mutation was detected in lpxA but each polymyxin-resistant isolate had 2-4 amino acid substitutions in lpxD and 1-2 substitutions in lpxC. Eight resistant isolates also displayed a unique H181Y mutation in lpsB. The extent of polymyxin resistance is of concern and the novel mutations discovered here warrant further investigations.

  19. Prevalence and Genetic Characterization of Carbapenem- and Polymyxin-Resistant Acinetobacter baumannii Isolated from a Tertiary Hospital in Terengganu, Malaysia

    PubMed Central

    Lean, Soo-Sum; Suhaili, Zarizal; Ismail, Salwani; Rahman, Nor Iza A.; Othman, Norlela; Abdullah, Fatimah Haslina; Thong, Kwai-Lin

    2014-01-01

    Nosocomial infection caused by Acinetobacter baumannii is of great concern due to its increasing resistance to most antimicrobials. In this study, 54 nonrepeat isolates of A. baumannii from the main tertiary hospital in Terengganu, Malaysia, were analyzed for their antibiograms and genotypes. Out of the 54 isolates, 39 (72.2%) were multidrug resistant (MDR) and resistant to carbapenems whereas 14 (25.9%) were categorized as extensive drug resistant (XDR) with additional resistance to polymyxin B, the drug of “last resort.” Pulsed-field gel electrophoresis analyses showed that the polymyxin-resistant isolates were genetically diverse while the carbapenem-resistant isolates were clonally related. The 14 XDR isolates were further investigated for mutations in genes known to mediate polymyxin resistance, namely, pmrCAB, and the lipopolysaccharide biosynthesis genes, lpxA, lpxC, lpxD, and lpsB. All 14 isolates had a P102H mutation in pmrA with no mutation detected in pmrC and pmrB. No mutation was detected in lpxA but each polymyxin-resistant isolate had 2–4 amino acid substitutions in lpxD and 1-2 substitutions in lpxC. Eight resistant isolates also displayed a unique H181Y mutation in lpsB. The extent of polymyxin resistance is of concern and the novel mutations discovered here warrant further investigations. PMID:25006521

  20. Identification of OXA-23 carbapenemases: novel variant OXA-239 in Acinetobacter baumannii ST758 clinical isolates in Mexico

    PubMed Central

    Tamayo-Legorreta, E M; Garza-Ramos, U; Barrios-Camacho, H; Sanchez-Perez, A; Galicia-Paredes, A; Meza-Chavez, A; Silva-Sanchez, J

    2014-01-01

    A collection of 15 carbapenem-resistance Acinetobacter baumannii clinical isolates was analysed on two tertiary hospitals in Mexico. The OXA-51 was identified in all isolates, followed by OXA-239 and OXA-58; OXA-239 is described as a new OXA-23-like allele. These carbapenemases were identified on four clonal groups, distributed between two neighbouring hospitals. Acinetobacter baumannii is poorly studied in Mexico; this situation urges the implementation of strategies to prevent its dissemination. PMID:25566396

  1. Acinetobacter baumannii Response to Host-Mediated Zinc Limitation Requires the Transcriptional Regulator Zur

    PubMed Central

    Mortensen, Brittany L.; Rathi, Subodh; Chazin, Walter J.

    2014-01-01

    Acinetobacter baumannii is a leading cause of ventilator-associated pneumonia in intensive care units, and the increasing rates of antibiotic resistance make treating these infections challenging. Consequently, there is an urgent need to develop new antimicrobials to treat A. baumannii infections. One potential therapeutic option is to target bacterial systems involved in maintaining appropriate metal homeostasis, processes that are critical for the growth of pathogens within the host. The A. baumannii inner membrane zinc transporter ZnuABC is required for growth under low-zinc conditions and for A. baumannii pathogenesis. The expression of znuABC is regulated by the transcriptional repressor Zur. To investigate the role of Zur during the A. baumannii response to zinc limitation, a zur deletion mutant was generated, and transcriptional changes were analyzed using RNA sequencing. A number of Zur-regulated genes were identified that exhibit increased expression both when zur is absent and under low-zinc conditions, and Zur binds to predicted Zur box sequences of several genes affected by zinc levels or the zur mutation. Furthermore, the zur mutant is impaired for growth in the presence of both high and low zinc levels compared to wild-type A. baumannii. Finally, the zur mutant exhibits a defect in dissemination in a mouse model of A. baumannii pneumonia, establishing zinc sensing as a critical process during A. baumannii infection. These results define Zur-regulated genes within A. baumannii and demonstrate a requirement for Zur in the A. baumannii response to the various zinc levels experienced within the vertebrate host. PMID:24816603

  2. Acinetobacter baumannii Infection Inhibits Airway Eosinophilia and Lung Pathology in a Mouse Model of Allergic Asthma

    PubMed Central

    Qiu, Hongyu; KuoLee, Rhonda; Harris, Greg; Zhou, Hongyan; Miller, Harvey; Patel, Girishchandra B.; Chen, Wangxue

    2011-01-01

    Allergic asthma is a dysregulation of the immune system which leads to the development of Th2 responses to innocuous antigens (allergens). Some infections and microbial components can re-direct the immune response toward the Th1 response, or induce regulatory T cells to suppress the Th2 response, thereby inhibiting the development of allergic asthma. Since Acinetobacter baumannii infection can modulate lung cellular and cytokine responses, we studied the effect of A. baumannii in modulating airway eosinophilia in a mouse model of allergic asthma. Ovalbumin (OVA)-sensitized mice were treated with live A. baumannii or phosphate buffered saline (PBS), then intranasally challenged with OVA. Compared to PBS, A. baumannii treatment significantly reduced pulmonary Th2 cytokine and chemokine responses to OVA challenge. More importantly, the airway inflammation in A. baumannii-treated mice was strongly suppressed, as seen by the significant reduction of the proportion and the total number of eosinophils in the bronchoalveolar lavage fluid. In addition, A. baumannii-treated mice diminished lung mucus overproduction and pathology. However, A. baumannii treatment did not significantly alter systemic immune responses to OVA. Serum OVA-specific IgE, IgG1 and IgG2a levels were comparable between A. baumannii- and PBS-treated mice, and tracheobronchial lymph node cells from both treatment groups produced similar levels of Th1 and Th2 cytokines in response to in vitro OVA stimulation. Moreover, it appears that TLR-4 and IFN-γ were not directly involved in the A. baumannii-induced suppression of airway eosinophilia. Our results suggest that A. baumannii inhibits allergic airway inflammation by direct suppression of local pulmonary Th2 cytokine responses to the allergen. PMID:21789200

  3. Therapeutic Efficacy of Lysophosphatidylcholine in Severe Infections Caused by Acinetobacter baumannii

    PubMed Central

    Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo

    2015-01-01

    Due to the significant increase in antimicrobial resistance of Acinetobacter baumannii, immune system stimulation to block infection progression may be a therapeutic adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC), a major component of phospholipids in eukaryotic cells, is involved in immune cell recruitment and modulation. The aim of this study was to show if LPC could be useful for treating infections caused by A. baumannii. A. baumannii ATCC 17978 was used in this study. Levels of serum LPC and levels of the inflammatory cytokines tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), IL-1β, and IL-10 were determined by spectrophotometric assay and enzyme-linked immunosorbent assay (ELISA), respectively, using a murine peritoneal sepsis model in which mice were inoculated with 5.3 log CFU/ml of A. baumannii. The therapeutic efficacy of LPC against A. baumannii in murine peritoneal sepsis and pneumonia models was assessed for 48 h after bacterial infection. At early time points in the murine model of peritoneal sepsis caused by A. baumannii, LPC was depleted and was associated with an increase of inflammatory cytokine release. Preemptive therapy with LPC in murine peritoneal sepsis and pneumonia models markedly enhanced spleen and lung bacterial clearance and reduced the numbers of positive blood cultures and the mouse mortality rates. Moreover, treatment with LPC reduced proinflammatory cytokine production. These data demonstrate that LPC is efficacious as a preemptive treatment in experimental models of peritoneal sepsis and pneumonia caused by A. baumannii. PMID:25896698

  4. Joint Transcriptional Control of Virulence and Resistance to Antibiotic and Environmental Stress in Acinetobacter baumannii

    PubMed Central

    Gallagher, Larry A.; Jacobson, Rachael K.; Usacheva, Elena A.; Peterson, Lance R.; Zurawski, Daniel V.; Shuman, Howard A.

    2015-01-01

    ABSTRACT The increasing emergence of antibiotic-resistant bacterial pathogens represents a serious risk to human health and the entire health care system. Many currently circulating strains of Acinetobacter baumannii exhibit resistance to multiple antibiotics. A key limitation in combating A. baumannii is that our understanding of the molecular mechanisms underlying the pathogenesis of A. baumannii is lacking. To identify potential virulence determinants of a contemporary multidrug-resistant isolate of A. baumannii, we used transposon insertion sequencing (TnSeq) of strain AB5075. A collection of 250,000 A. baumannii transposon mutants was analyzed for growth within Galleria mellonella larvae, an insect-based infection model. The screen identified 300 genes that were specifically required for survival and/or growth of A. baumannii inside G. mellonella larvae. These genes encompass both known, established virulence factors and several novel genes. Among these were more than 30 transcription factors required for growth in G. mellonella. A subset of the transcription factors was also found to be required for resistance to antibiotics and environmental stress. This work thus establishes a novel connection between virulence and resistance to both antibiotics and environmental stress in A. baumannii. PMID:26556274

  5. Molecular detection of aminoglycoside-modifying enzyme genes in Acinetobacter baumannii clinical isolates.

    PubMed

    Heidary, Mohsen; Salimi Chirani, Alireza; Khoshnood, Saeed; Eslami, Gita; Atyabi, Seyyed Mohammad; Nazem, Habibollah; Fazilati, Mohammad; Hashemi, Ali; Soleimani, Saleh

    2016-12-16

    Acinetobacter baumannii is a major opportunistic pathogen in healthcare settings worldwide. In Iran, there are only few reports on the prevalence of aminoglycoside resistance genes among A. baumannii isolates. The aim of this study was to investigate the existence of aminoglycoside-modifying enzyme (AME) genes from A. baumannii strains collected at a university teaching hospital in Iran. One hundred A. baumannii strains were collected between 2014 and 2015 from hospitalized patients at Loghman Hakim Hospital, Tehran, Iran. Antimicrobial susceptibility was determined by disk diffusion method according to the Clinical and Laboratory Standards Institute recommendations. The DNA was extracted using a kit obtained from Bioneer Co. (Korea) and was used as a template for polymerase chain reaction. The most active antimicrobial agent against these strains was colistin. The rate of extended-spectrum cephalosporin resistance was 97%. The aadA1, aadB, aac(6')-Ib, and aac(3)-IIa genes were found in 85%, 77%, 72%, and 68% of A. baumannii isolates, respectively. This study showed a high prevalence rate of AME genes in A. baumannii. This prevalence rate has explained that further aminoglycoside resistance genes may have role in the resistance of clinical isolates of A. baumannii. Therefore, control and treatment of serious infections caused by this opportunistic pathogen should be given more consideration.

  6. Therapeutic efficacy of lysophosphatidylcholine in severe infections caused by Acinetobacter baumannii.

    PubMed

    Smani, Younes; Domínguez-Herrera, Juan; Ibáñez-Martínez, José; Pachón, Jerónimo

    2015-07-01

    Due to the significant increase in antimicrobial resistance of Acinetobacter baumannii, immune system stimulation to block infection progression may be a therapeutic adjuvant to antimicrobial treatment. Lysophosphatidylcholine (LPC), a major component of phospholipids in eukaryotic cells, is involved in immune cell recruitment and modulation. The aim of this study was to show if LPC could be useful for treating infections caused by A. baumannii. A. baumannii ATCC 17978 was used in this study. Levels of serum LPC and levels of the inflammatory cytokines tumor necrosis factor alpha (TNF-α), interleukin-6 (IL-6), IL-1β, and IL-10 were determined by spectrophotometric assay and enzyme-linked immunosorbent assay (ELISA), respectively, using a murine peritoneal sepsis model in which mice were inoculated with 5.3 log CFU/ml of A. baumannii. The therapeutic efficacy of LPC against A. baumannii in murine peritoneal sepsis and pneumonia models was assessed for 48 h after bacterial infection. At early time points in the murine model of peritoneal sepsis caused by A. baumannii, LPC was depleted and was associated with an increase of inflammatory cytokine release. Preemptive therapy with LPC in murine peritoneal sepsis and pneumonia models markedly enhanced spleen and lung bacterial clearance and reduced the numbers of positive blood cultures and the mouse mortality rates. Moreover, treatment with LPC reduced proinflammatory cytokine production. These data demonstrate that LPC is efficacious as a preemptive treatment in experimental models of peritoneal sepsis and pneumonia caused by A. baumannii.

  7. The sensor kinase BfmS mediates virulence in Acinetobacter baumannii.

    PubMed

    Liou, Ming-Li; Soo, Po-Chi; Ling, Siao-Ru; Kuo, Han-Yueh; Tang, Chuan Yi; Chang, Kai-Chih

    2014-08-01

    BfmR, the response regulator component of the two-component system BfmRS, has important roles in biofilm formation and cellular morphology of Acinetobacter baumannii. Until now, the contribution of the sensor kinase BfmS to the virulence of this bacterium remains unknown. In this study, a bfmS knockout and complementation studies were performed to clarify the role of BfmS in A. baumannii virulence. We constructed a bfmS knockout mutant in the A. baumannii 17978 type strain by transposon inactivation. To clarify the role of bfmS in A. baumannii virulence, the biofilm formation, adherence ability to eukaryotic cells, serum resistance, and antibiotic susceptibility tests were performed in A. baumannii 17978 and its derivative knockout and complementation strains. The bfmS knockout displayed a reduction in biofilm formation, loss of adherence to eukaryotic cells, and greater sensitivity to serum killing compared with the parent strain. Proteomic analysis of culture supernatants revealed that the release of outer membrane proteins (Omps), including CarO and outer membrane protein A (OmpA), was associated with the inactivation of BfmS in A. baumannii. This study is the first to demonstrate that the pathway regulated by the sensor kinase BfmS is associated with biofilm formation, adherence to biotic surfaces, serum resistance, and antibiotic susceptibility, which may be associated with the release of Omps in A. baumannii. Copyright © 2013. Published by Elsevier B.V.

  8. Synergistic effects of ethnomedicinal plants of Apocynaceae family and antibiotics against clinical isolates of Acinetobacter baumannii.

    PubMed

    Chusri, Sasitorn; Siriyong, Thanyaluck; Na-Phatthalung, Pinanong; Voravuthikunchai, Supayang Piyawan

    2014-06-01

    To investigate the efficacy of 17 ethnomedicinal plants belonging to Apocynaceae family used in combination with 16 conventional antibiotics against non-multidrug resistant-, multidrug resistant (MDR)-, and extensive drug resistant (XDR) Acinetobacter baumannii (A. baumannii). Antibacterial activity and resistance modifying ability of 272 combinations were determined by growth inhibition assays and further confirmed by time-kill assay. Among the combinations of the antibiotics with Apocynaceae ethanol extracts on this pathogen, 15 (5%) had synergistic effects, 23 (8%) had partial synergistic effects and 234 (86%) had no effects. Synergistic activity was observed mostly when the Apocynaceae extracts were combined with rifampicin or cefazolin. Interestingly, 10 out of 17 combinations between the extracts and rifampicin displayed synergistic or partial synergistic behaviors. Holarrhena antidysenterica extract was additionally tested to restore rifampicin activity against clinical isolates of MDR and XDR A. baumannii. With respect to total or partial synergy, 70% was XDR A. baumannii isolates and 66% was MDR A. baumannii isolates. Holarrhena antidysenterica extract clearly demonstrated the ability to restore rifampicin activity against both A. baumannii ATCC19606 and clinically isolated A. baumannii. Additional studies examining its active principles as well as mechanisms of actions such as the effects on efflux pumps and outer membrane permeability alterations are recommended. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  9. Molecular Identification of Resistance Determinants, Integrons and Genetic Relatedness of Extensively Drug Resistant Acinetobacter baumannii Isolated From Hospitals in Tehran, Iran

    PubMed Central

    Najar Peerayeh, Shahin; Karmostaji, Afsaneh

    2015-01-01

    Background: Acinetobacter baumannii has emerged as an important nosocomial pathogen. Hospital outbreaks of extensively drug resistant (XDR) A. baumannii are a great concern. Objectives: Aims of this study were to characterize the resistance determinants and genetic relatedness of (XDR) A. baumannii isolates in hospitals in Tehran, Iran. Materials and Methods: During a three-year study, clinical isolates of A. baumannii were collected from two hospitals in Tehran, Iran. Susceptibility testing to antibiotics was performed by disk diffusion method and XDR A. baumannii isolates were identified. Genes’ encoding for carbapenemase production and integrons were identified by PCR. MICs of imipenem and meropenem were determined by agar dilution. Multiple locus variable-number tandem repeat analysis (MLVA) typing was used to determine genetic relationships of XDR isolates. Results: Using PCR for amplification of blaOXA-51, 93.9% (123.131) of isolates were identified as A. baumannii and 24.4% (30.123) were XDR. These isolates were resistant to gentamicin, ciprofloxacin, amikacin, cotrimoxazole, cefepime, cefotaxime, aztreonam and ceftazidime. Thirty percent of the isolates were resistant to tigecycline. All isolates were susceptible to colistin and polymyxin-B, while 93.3% (28.30) possessed blaOXA-23-like and 6.7% (2.30) possessed blaOXA-24-like. All isolates possessed insertion sequence (ISAba1) in the upstream region of the OXA-23-like gene. Almost 96.7% (29.30) of the isolates were positive for class I integron and 43.3% (13.30) for class II. These isolates were also positive for class I. Class III integron was not detected. MLVA typing of XDR isolates showed seven clonally complexes and 16 singletons. Conclusions: The population structure of the A. baumannii isolates in our hospitals was genetically diverse. A significant association between XDR pattern and presence of class 1 integron (P < 0.001) was found indicating that many antibiotic resistance determinants are

  10. Classical β-Lactamase Inhibitors Potentiate the Activity of Daptomycin against Methicillin-Resistant Staphylococcus aureus and Colistin against Acinetobacter baumannii

    PubMed Central

    Rose, Warren; Berti, Andrew; Olson, Joshua; Munguia, Jason; Nonejuie, Poochit; Sakoulas, Eleanna; Rybak, Michael J.; Pogliano, Joseph; Nizet, Victor

    2016-01-01

    ABSTRACT We asked whether beta-lactamase inhibitors (BLIs) increased the activity of daptomycin (DAP) against methicillin-resistant Staphylococcus aureus (MRSA), the peptide antibiotic colistin (COL) against the emerging Gram-negative nosocomial pathogen Acinetobacter baumannii, and the human host defense peptide cathelicidin LL37 against either pathogen. DAP and LL37 kill curves were performed with or without BLIs against MRSA, vancomycin-intermediate S. aureus (VISA), and heterogeneous VISA (hVISA). COL and LL37 kill curves were performed against A. baumannii. Boron-dipyrromethene (BODIPY)-labeled DAP binding to MRSA grown with the BLI tazobactam (TAZ) was assessed microscopically. The combination of COL plus TAZ was studied in a murine model of A. baumannii pneumonia. TAZ alone lacked in vitro activity against MRSA or A. baumannii. The addition of TAZ to DAP resulted in a 2- to 5-log10 reduction in recoverable MRSA CFU at 24 h compared to the recoverable CFU with DAP alone. TAZ plus COL showed synergy by kill curves for 4 of 5 strains of A. baumannii tested. Growth with 20 mg/liter TAZ resulted in 2- to 2.5-fold increases in the intensity of BODIPY-DAP binding to MRSA and hVISA strains. TAZ significantly increased the killing of MRSA and A. baumannii by LL37 in vitro. TAZ increased the activity of COL in a murine model of A. baumannii pneumonia. Classical BLIs demonstrate synergy with peptide antibiotics. Since BLIs have scant antimicrobial activity on their own and are thus not expected to increase selective pressure toward antibiotic resistance, their use in combination with peptide antibiotics warrants further study. PMID:27872080

  11. Growth in glucose-based medium and exposure to subinhibitory concentrations of imipenem induce biofilm formation in a multidrug-resistant clinical isolate of Acinetobacter baumannii.

    PubMed

    Nucleo, Elisabetta; Steffanoni, Laura; Fugazza, Giulia; Migliavacca, Roberta; Giacobone, Ernesto; Navarra, Antonella; Pagani, Laura; Landini, Paolo

    2009-12-22

    Acinetobacter baumannii is emerging as an important nosocomial pathogen. Multidrug resistance, as well as ability to withstand environmental stresses, makes eradication of A. baumannii difficult, particularly from hospital settings. Over a six-year period, 73 isolates of A. baumannii were collected from infected patients in two hospitals in Italy. While 69 out of the 73 isolates displayed identical multidrug antibiotic resistance pattern, they were susceptible to carbapenems. Genetic profiles of these 69 isolates, determined by Pulsed Field Gel Electrophoresis (PFGE), indicated that they were genetically related and could be clustered in a specific clone, called SMAL. We tested the ability of the SMAL clone to form biofilm, an important determinant for bacterial colonization of the human host and for persistence in the hospital environment. Biofilm formation by A. baumannii SMAL, measured as surface adhesion to polystyrene, is strongly affected by growth conditions, being impaired in rich growth media such as LB, while being favoured in glucose-based medium. Surface adhesion in glucose-based media is inhibited by treatment with cellulase, suggesting that it depends on production of cellulose or of a chemically related extracellular polysaccharide. Exposure of A. baumannii SMAL to subinhibitory concentrations of imipenem resulted in biofilm stimulation and increased production of iron uptake proteins. Growth in iron-supplemented medium also stimulated surface adhesion, thus suggesting that increased intracellular iron concentrations might act as an environmental signal for biofilm formation in A. baumannii SMAL. Our results indicate that exposure to subinhibitory concentrations of imipenem can stimulate biofilm formation and induce iron uptake in a pathogenic strain of A. baumannii, with potential implications on antibiotic susceptibility and ability to persist in the human host.

  12. Growth in glucose-based medium and exposure to subinhibitory concentrations of imipenem induce biofilm formation in a multidrug-resistant clinical isolate of Acinetobacter baumannii

    PubMed Central

    2009-01-01

    Background Acinetobacter baumannii is emerging as an important nosocomial pathogen. Multidrug resistance, as well as ability to withstand environmental stresses, makes eradication of A. baumannii difficult, particularly from hospital settings. Results Over a six-year period, 73 isolates of A. baumannii were collected from infected patients in two hospitals in Italy. While 69 out of the 73 isolates displayed identical multidrug antibiotic resistance pattern, they were susceptible to carbapenems. Genetic profiles of these 69 isolates, determined by Pulsed Field Gel Electrophoresis (PFGE), indicated that they were genetically related and could be clustered in a specific clone, called SMAL. We tested the ability of the SMAL clone to form biofilm, an important determinant for bacterial colonization of the human host and for persistence in the hospital environment. Biofilm formation by A. baumannii SMAL, measured as surface adhesion to polystyrene, is strongly affected by growth conditions, being impaired in rich growth media such as LB, while being favoured in glucose-based medium. Surface adhesion in glucose-based media is inhibited by treatment with cellulase, suggesting that it depends on production of cellulose or of a chemically related extracellular polysaccharide. Exposure of A. baumannii SMAL to subinhibitory concentrations of imipenem resulted in biofilm stimulation and increased production of iron uptake proteins. Growth in iron-supplemented medium also stimulated surface adhesion, thus suggesting that increased intracellular iron concentrations might act as an environmental signal for biofilm formation in A. baumannii SMAL. Conclusions Our results indicate that exposure to subinhibitory concentrations of imipenem can stimulate biofilm formation and induce iron uptake in a pathogenic strain of A. baumannii, with potential implications on antibiotic susceptibility and ability to persist in the human host. PMID:20028528

  13. Response to Bile Salts in Clinical Strains of Acinetobacter baumannii Lacking the AdeABC Efflux Pump: Virulence Associated with Quorum Sensing

    PubMed Central

    López, Maria; Blasco, Lucia; Gato, Eva; Perez, Astrid; Fernández-Garcia, Laura; Martínez-Martinez, Luis; Fernández-Cuenca, Felipe; Rodríguez-Baño, Jesús; Pascual, Alvaro; Bou, German; Tomás, Maria

    2017-01-01

    Introduction: Acinetobacter baumannii is an opportunistic nosocomial pathogen associated with multiple infections. This pathogen usually colonizes (first stage of microbial infection) host tissues that are in contact with the external environment. As one of the sites of entry in human hosts is the gastrointestinal tract, the pathogen must be capable of tolerating bile salts. However, studies analyzing the molecular characteristics involved in the response to bile salts in clinical strains of A. baumannii are scarce. Material and Methods: Microbiological and transcriptional studies (arrays and RT-PCR) in the response to bile salts were carried out in isogenic (A. baumanni ΔadeB ATCC 17978 and A. baumannii ΔadeL ATCC 17978) and clinical strains from clone ST79/PFGE-HUI-1 which is characterized by lacking the AdeABC efflux pump and by overexpression the AdeFGH efflux pump. Results and Discussion: In presence of bile salts, in addition to the glutamate/aspartate transporter were found overexpressed in A. baumannii ΔadeB ATCC 17978, the virulence factors (surface motility, biofilm, and Type VI Secretion System) which are associated with activation of the Quorum Sensing system. Overexpression of these factors was confirmed in clinical strains of clone ST79/PFGE-HUI-1. Conclusions: This the first study about the adaptive response to bile salts investigating the molecular and microbiological characteristics in response to bile salts of an isogenic model of A. baumannii ATCC 17978 and clinical isolates of A. baumannii (clinical strains of ST79/PFGE-HUI-1) lacking the main RND efflux pump (AdeABC). Clinical isolates of A. baumannii lacking the AdeABC efflux pump (clone ST79/PFGE-HUI-1) displayed a new clinical profile (increased invasiveness) possibly associated with the response to stress conditions (such as the presence of bile salts). PMID:28536672

  14. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia

    PubMed Central

    Durn, Goran; Goic-Barisic, Ivana; Kovacic, Ana

    2014-01-01

    Over the past decade, bacteria of the genus Acinetobacter have emerged as a leading cause of hospital-acquired infections. Outbreaks of Acinetobacter infections are considered to be caused exclusively by contamination and transmission in hospital environments. The natural habitats of clinically important multiresistant Acinetobacter spp. remain to be defined. In this paper, we report an incidental finding of a viable multidrug-resistant strain of Acinetobacter baumannii, related to clinical isolates, in acid paleosol from Croatia. The environmental isolate of A. baumannii showed 87% similarity to a clinical isolate originating from a hospital in this geographic area and was resistant to gentamicin, trimethoprim-sulfamethoxazole, ciprofloxacin, and levofloxacin. In paleosol, the isolate was able to survive a low pH (3.37), desiccation, and a high temperature (50°C). The probable source of A. baumannii in paleosol is illegally disposed waste of external origin situated in the abandoned quarry near the sampling site. The bacteria could have been leached from waste by storm water and thus infiltrated the paleosol. PMID:24584245

  15. Emergence of extensively drug-resistant OXA-72-producing Acinetobacter baumannii in Recife, Brazil: risk of clonal dissemination?

    PubMed

    de Sá Cavalcanti, Felipe Lira; Almeida, Anna Carolina Soares; Vilela, Marinalda Anselmo; de Morais Junior, Marcos Antonio; de Morais, Marcia Maria Camargo; Leal-Balbino, Tereza Cristina

    2013-11-01

    Two new examples of OXA-72-producing Acinetobacter baumannii isolate resistant to a broad spectrum of antimicrobials, but not polymyxin B, have been identified in Recife, Brazil. Molecular typing indicated a close genetic link with the OXA-72-producing A. baumannii previously isolated in São Paulo, suggesting the possibility of clonal dissemination within the country.

  16. Comparative Activities of Ciprofloxacin, Clinafloxacin, Gatifloxacin, Gemifloxacin, Levofloxacin, Moxifloxacin, and Trovafloxacin against Epidemiologically Defined Acinetobacter baumannii Strains

    PubMed Central

    Heinemann, Barbara; Wisplinghoff, Hilmar; Edmond, Michael; Seifert, Harald

    2000-01-01

    In vitro activities of seven fluoroquinolones against 140 clinical Acinetobacter baumannii isolates representing 138 different strain types were determined. The rank order of activity was clinafloxacin > gatifloxacin > levofloxacin > trovafloxacin > gemifloxacin = moxifloxacin > ciprofloxacin. The 31 outbreak-related A. baumannii strains were significantly more resistant than were 109 sporadic strains. PMID:10898706

  17. Rapid discrimination of Acinetobacter baumannii international clone II lineage by pyrosequencing SNP analyses of bla(OXA-51-like) genes.

    PubMed

    Matsui, Mari; Suzuki, Satowa; Suzuki, Masato; Arakawa, Yoshichika; Shibayama, Keigo

    2013-08-01

    We found that Acinetobacter baumannii international clone II generally possesses unique GTA sequence at nucleotide positions 106-108 in the bla(OXA-51-like) genes. We exploited this to develop an easy and rapid method for discrimination of international clone II from other A. baumannii by employing pyrosequencing analyses of single nucleotide polymorphisms.

  18. Contribution of resistance-nodulation-cell division efflux systems to antibiotic resistance and biofilm formation in Acinetobacter baumannii.

    PubMed

    Yoon, Eun-Jeong; Chabane, Yassine Nait; Goussard, Sylvie; Snesrud, Erik; Courvalin, Patrice; Dé, Emmanuelle; Grillot-Courvalin, Catherine

    2015-03-24

    Acinetobacter baumannii is a nosocomial pathogen of increasing importance due to its multiple resistance to antibiotics and ability to survive in the hospital environment linked to its capacity to form biofilms. To fully characterize the contribution of AdeABC, AdeFGH, and AdeIJK resistance-nodulation-cell division (RND)-type efflux systems to acquired and intrinsic resistance, we constructed, from an entirely sequenced susceptible A. baumannii strain, a set of isogenic mutants overexpressing each system following introduction of a point mutation in their cognate regulator or a deletion for the pump by allelic replacement. Pairwise comparison of every derivative with the parental strain indicated that AdeABC and AdeFGH are tightly regulated and contribute to acquisition of antibiotic resistance when overproduced. AdeABC had a broad substrate range, including β-lactams, fluoroquinolones, tetracyclines-tigecycline, macrolides-lincosamides, and chloramphenicol, and conferred clinical resistance to aminoglycosides. Importantly, when combined with enzymatic resistance to carbapenems and aminoglycosides, this pump contributed in a synergistic fashion to the level of resistance of the host. In contrast, AdeIJK was expressed constitutively and was responsible for intrinsic resistance to the same major drug classes as AdeABC as well as antifolates and fusidic acid. Surprisingly, overproduction of AdeABC and AdeIJK altered bacterial membrane composition, resulting in decreased biofilm formation but not motility. Natural transformation and plasmid transfer were diminished in recipients overproducing AdeABC. It thus appears that alteration in the expression of efflux systems leads to multiple changes in the relationship between the host and its environment, in addition to antibiotic resistance. Increased expression of chromosomal genes for RND-type efflux systems plays a major role in bacterial multidrug resistance. Acinetobacter baumannii has recently emerged as an important

  19. [Shall we report the carbapenem resistance in Pseudomonas aeruginosa and Acinetobacter baumannii strains detected by BD Phoenix system?].

    PubMed

    Oğünç, Dilara; Ongüt, Gözde; Ozen, Nevgün Sepin; Baysan, Betil Ozhak; Günseren, Filiz; Dağlar, Duygu; Demirbakan, Hadiye; Gültekin, Meral

    2010-04-01

    Imipenem and meropenem are broad spectrum antimicrobial agents that are especially useful in the treatment of nosocomially acquired Pseudomonas aeruginosa and Acinetobacter spp. infections. Previous reports have noted that susceptibility tests could show false resistance to imipenem. For this reason, Centers for Disease Control and Prevention has recommended that all carbapenem resistant or intermediate resistant isolates should be tested with an additional method to verify the results. This study was aimed to evaluate the imipenem and meropenem susceptibilities by disk diffusion, E-test and broth microdilution in P. aeruginosa and Acinetobacter baumannii strains found to be resistant or intermediate to imipenem-meropenem by BD Phoenix automated susceptibility testing system. Between January 2006-January 2007, 85 non-duplicate isolates of A. baumannii and 51 non-duplicate isolates of P. aeruginosa which were determined as resistant or intermediate resistant to imipenem and/or meropenem by BD Phoenix automated identification and susceptibility system (Becton Dickinson, Sparks, MD, USA) were collected in Akdeniz University Hospital Central Laboratory. All strains were tested by E-test (AB Biodisk, Sweden), disk diffusion and reference broth microdilution (BMD) method following CLSI recommendations. All 51 isolates of P. aeruginosa determined as imipenem and/or meropenem resistant or intermediate resistant by BD Phoenix, were found to be imipenem and/or meropenem resistant or intermediate resistant by the reference BMD method. Minor error rates were same for all testing systems (1.9%) except for the meropenem results of BD Phoenix system (5.9%). No major errors were produced by any system. For A. baumannii, only one very major error was detected for meropenem by BD Phoenix system. Number of minor errors determined for meropenem by all testing systems compared to the reference test, ranged from 2 (2.4%) to 3 (3.5%). It was concluded that carbapenem susceptibility test

  20. Prevalence of digestive tract colonization of carbapenem-resistant Acinetobacter baumannii in hospitals in Saudi Arabia.

    PubMed

    Aljindan, Reem; Bukharie, Huda; Alomar, Amer; Abdalhamid, Baha

    2015-04-01

    Carbapenem-resistant Acinetobacter baumannii is a major health problem worldwide, especially in intensive care units (ICUs). This study aimed to detect the prevalence of A. baumannii colonization of the gastrointestinal tract of patients admitted to the ICU in two hospitals in Saudi Arabia. In addition, it aimed to characterize the molecular mechanisms of carbapenem resistance in these isolates. From January to June 2014, 565 rectal swab specimens were screened for Acinetobacer strains and carbapenem resistance using CHROMagar Acinetobacter and CHROMagar KPC agar plates, respectively. Organism identification and susceptibility were detected using the Vitek 2 system. A total of 47 Acinetobacter spp. were detected, and 35 were resistant to carbapenem, making the prevalence of Acinetobacter spp. 8.3% (47/565) and carbapenem resistance (6.2%, 35/565). The 47 strains showed remarkable clonal diversity as revealed by PFGE. Using PCR, OXA-51, a chromosomal marker for A. baumannii, was detected in 46 strains. OXA-23 β-lactamase was detected in all 35 carbapenem-resistant A. baumannii. No IMP, VIM, SPM, SIM, GIM, KPC or NDM β-lactamases were detected in these isolates. Thus, OXA-23 was the main mechanism of carbapenem resistance in these isolates. To the best of our knowledge, this is the first study to detect the prevalence of Acinetobacter colonization in the digestive tract of ICU patients in Saudi Arabia. This study revealed the importance of having well-established protocols for early identification of these multidrug-resistant organisms, optimizing infection-control strategies and having active surveillance studies to reduce morbidity, mortality and cost.

  1. In vitro and in vivo activities of E-101 solution against Acinetobacter baumannii isolates from U.S. military personnel.

    PubMed

    Denys, G A; Davis, J C; O'Hanley, P D; Stephens, J T

    2011-07-01

    We evaluated the in vitro and in vivo activity of a novel topical myeloperoxidase-mediated antimicrobial, E-101 solution, against 5 multidrug-resistant Acinetobacter baumannii isolates recovered from wounded American soldiers. Time-kill studies demonstrated rapid bactericidal activity against all A. baumannii strains tested in the presence of 3% blood. The in vitro bactericidal activity of E-101 solution against A. baumannii strains was confirmed in a full-thickness excision rat model. Additional in vivo studies appear warranted.

  2. Characterization, sequencing and comparative genomic analysis of vB_AbaM-IME-AB2, a novel lytic bacteriophage that infects multidrug-resistant Acinetobacter baumannii clinical isolates.

    PubMed

    Peng, Fan; Mi, Zhiqiang; Huang, Yong; Yuan, Xin; Niu, Wenkai; Wang, Yahui; Hua, Yuhui; Fan, Huahao; Bai, Changqing; Tong, Yigang

    2014-07-05

    With the use of broad-spectrum antibiotics, immunosuppressive drugs, and glucocorticoids, multidrug-resistant Acinetobacter baumannii (MDR-AB) has become a major nosocomial pathogen species. The recent renaissance of bacteriophage therapy may provide new treatment strategies for combatting drug-resistant bacterial infections. In this study, we isolated a lytic bacteriophage vB_AbaM-IME-AB2 has a short latent period and a small burst size, which clear its host's suspension quickly, was selected for characterization and a complete genomic comparative study. The isolated bacteriophage vB_AbaM-IME-AB2 has an icosahedral head and displays morphology resembling Myoviridae family. Gel separation assays showed that the phage particle contains at least nine protein bands with molecular weights ranging 15-100 kDa. vB_AbaM-IME-AB2 could adsorb its host cells in 9 min with an adsorption rate more than 99% and showed a short latent period (20 min) and a small burst size (62 pfu/cell). It could form clear plaques in the double-layer assay and clear its host's suspension in just 4 hours. Whole genome of vB_AbaM-IME-AB2 was sequenced and annotated and the results showed that its genome is a double-stranded DNA molecule consisting of 43,665 nucleotides. The genome has a G + C content of 37.5% and 82 putative coding sequences (CDSs). We compared the characteristics and complete genome sequence of all known Acinetobacter baumannii bacteriophages. There are only three that have been sequenced Acinetobacter baumannii phages AB1, AP22, and phiAC-1, which have a relatively high similarity and own a coverage of 65%, 50%, 8% respectively when compared with our phage vB_AbaM-IME-AB2. A nucleotide alignment of the four Acinetobacter baumannii phages showed that some CDSs are similar, with no significant rearrangements observed. Yet some sections of these strains of phage are nonhomologous. vB_AbaM-IME-AB2 was a novel and unique A. baumannii bacteriophage. These findings suggest a common

  3. High Frequency of OXA-253-Producing Acinetobacter baumannii in Different Hospitals in Recife, Brazil.

    PubMed

    de Sá Cavalcanti, Felipe Lira; Mendes-Marques, Carina Lucena; Vasconcelos, Crhisllane Rafaele Dos Santos; de Lima Campos, Túlio; Rezende, Antonio Mauro; Xavier, Danilo Elias; Leal, Nilma Cintra; de-Melo-Neto, Osvaldo Pompilio; de Morais, Marcia Maria Camargo; Leal-Balbino, Tereza Cristina

    2017-01-01

    Here, we report the isolation of 31 Acinetobacter baumannii strains producing OXA-253 in a single large Brazilian city. These strains belonged to five different sequence types (STs), including 4 STs not previously associated with blaOXA-253 In all strains, the blaOXA-253 gene was located in a plasmid within a genetic environment similar to what was found previously in Brazil and Italy. The reported data emphasize the successful transmission of the blaOXA-253 gene through a large area and the tendency for this resistance determinant to remain in the A. baumannii population.

  4. The effect of terminal cleaning on environmental contamination rates of multidrug-resistant Acinetobacter baumannii.

    PubMed

    Strassle, Paula; Thom, Kerri A; Johnson, J Kristie; Johnsonm, J Kristie; Leekha, Surbhi; Lissauer, Matthew; Zhu, Jingkun; Harris, Anthony D

    2012-12-01

    We evaluated the prevalence of multidrug-resistant Acinetobacter baumannii environmental contamination before and after discharge cleaning in rooms of infected/colonized patients. 46.9% of rooms and 15.3% of sites were found contaminated precleaning, and 25% of rooms and 5.5% of sites were found contaminated postcleaning. Cleaning significantly decreased environmental contamination of A baumannii; however, persistent contamination represents a significant risk factor for transmission. Further studies on this and more effective cleaning methods are needed.

  5. High Frequency of OXA-253-Producing Acinetobacter baumannii in Different Hospitals in Recife, Brazil

    PubMed Central

    de Sá Cavalcanti, Felipe Lira; Mendes-Marques, Carina Lucena; Vasconcelos, Crhisllane Rafaele dos Santos; de Lima Campos, Túlio; Rezende, Antonio Mauro; Xavier, Danilo Elias; Leal, Nilma Cintra; de-Melo-Neto, Osvaldo Pompilio; de Morais, Marcia Maria Camargo

    2016-01-01

    ABSTRACT Here, we report the isolation of 31 Acinetobacter baumannii strains producing OXA-253 in a single large Brazilian city. These strains belonged to five different sequence types (STs), including 4 STs not previously associated with blaOXA-253. In all strains, the blaOXA-253 gene was located in a plasmid within a genetic environment similar to what was found previously in Brazil and Italy. The reported data emphasize the successful transmission of the blaOXA-253 gene through a large area and the tendency for this resistance determinant to remain in the A. baumannii population. PMID:27855080

  6. Inhibition of LpxC Increases Antibiotic Susceptibility in Acinetobacter baumannii

    PubMed Central

    García-Quintanilla, Meritxell; Caro-Vega, José M.; Pulido, Marina R.; Moreno-Martínez, Patricia; Pachón, Jerónimo

    2016-01-01

    LpxC inhibitors have generally shown poor in vitro activity against Acinetobacter baumannii. We show that the LpxC inhibitor PF-5081090 inhibits lipid A biosynthesis, as determined by silver staining and measurements of endotoxin levels, and significantly increases cell permeability. The presence of PF-5081090 at 32 mg/liter increased susceptibility to rifampin, vancomycin, azithromycin, imipenem, and amikacin but had no effect on susceptibility to ciprofloxacin and tigecycline. Potentiating existing antibiotics with LpxC inhibitors may represent an alternative treatment strategy for multidrug-resistant A. baumannii. PMID:27270288

  7. Control of hospital endemicity of multiple-drug-resistant Acinetobacter baumannii ST457 with directly observed hand hygiene.

    PubMed

    Cheng, V C C; Chen, J H K; Poon, R W S; Lee, W M; So, S Y C; Wong, S C Y; Chau, P H; Yip, C C Y; Wong, S S Y; Chan, J F W; Hung, I F N; Ho, P L; Yuen, K Y

    2015-04-01

    An increasing endemicity of multiple-drug-resistant Acinetobacter baumannii (MRAB) ST457 was noted in Hong Kong. The epidemiology, risk factors, and infection control measures to prevent nosocomial transmission of this epidemic clone were analyzed. A total of 5,058 patients cultured positive with A. baumannii between 1 January 2004 and 30 June 2014 were included, of which 297 (5.9 %) had bacteremia. The first case of MRAB bacteremia emerged in 2009, with an incidence that increased from 0.27 (one case) in 2009 to 1.86 (14 cases) per 100,000 patient-days in 2013 (p < 0.001). With the implementation of strict contact precautions and directly observed hand hygiene in conscious patients immediately before receiving meals and medications in July 2013, the incidence of MRAB bacteremia reduced from its peak to 0.77 (one case) per 100,000 patient-days in the first 6 months of 2014 (p < 0.001). Patients from long-term care facilities for the elderly [odds ratio (OR) 18.6, confidence interval (CI) 2.1-162.4, p = 0.008] and history of carbapenem (OR 7.0, CI 1.7-28.0, p = 0.006) and beta-lactam/beta-lactamase use (OR 5.6, CI 1.1-28.7, p = 0.038) 90 days prior to admission were independent risk factors for MRAB bacteremia by logistic regression when compared with carbapenem-susceptible A. baumannii bacteremia.

  8. Fluorescence-Based Flow Sorting in Parallel with Transposon Insertion Site Sequencing Identifies Multidrug Efflux Systems in Acinetobacter baumannii

    PubMed Central

    Cain, Amy K.; Huang, TaoTao; Liu, Qi; Elbourne, Liam D. H.; Boinett, Christine J.; Brzoska, Anthony J.; Li, Liping; Ostrowski, Martin; Nhu, Nguyen Thi Khanh; Nhu, Tran Do Hoang; Baker, Stephen; Paulsen, Ian T.

    2016-01-01

    ABSTRACT Multidrug efflux pumps provide clinically significant levels of drug resistance in a number of Gram-negative hospital-acquired pathogens. These pathogens frequently carry dozens of genes encoding putative multidrug efflux pumps. However, it can be difficult to determine how many of these pumps actually mediate antimicrobial efflux, and it can be even more challenging to identify the regulatory proteins that control expression of these pumps. In this study, we developed an innovative high-throughput screening method, combining transposon insertion sequencing and cell sorting methods (TraDISort), to identify the genes encoding major multidrug efflux pumps, regulators, and other factors that may affect the permeation of antimicrobials, using the nosocomial pathogen Acinetobacter baumannii. A dense library of more than 100,000 unique transposon insertion mutants was treated with ethidium bromide, a common substrate of multidrug efflux pumps that is differentially fluorescent inside and outside the bacterial cytoplasm. Populations of cells displaying aberrant accumulations of ethidium were physically enriched using fluorescence-activated cell sorting, and the genomic locations of transposon insertions within these strains were determined using transposon-directed insertion sequencing. The relative abundance of mutants in the input pool compared to the selected mutant pools indicated that the AdeABC, AdeIJK, and AmvA efflux pumps are the major ethidium efflux systems in A. baumannii. Furthermore, the method identified a new transcriptional regulator that controls expression of amvA. In addition to the identification of efflux pumps and their regulators, TraDISort identified genes that are likely to control cell division, cell morphology, or aggregation in A. baumannii. PMID:27601573

  9. Clinical and antimicrobial profile of Acinetobacter spp.: An emerging nosocomial superbug.

    PubMed

    Tripathi, Purti C; Gajbhiye, Sunita R; Agrawal, Gopal Nandlal

    2014-01-01

    Recently, Acinetobacter has emerged as significant hospital pathogen, notoriously known to acquire antibiotic resistance to most of the commonly prescribed antimicrobials. Many risk factors are associated with Acinetobacter infections, especially in patients in intensive care unit (ICU). This study aims to isolate Acinetobacter from various clinical specimens and to determine its antimicrobial sensitivity pattern. Identification, speciation and antimicrobial sensitivity testing were performed using the standard microbiological techniques. Slime production was also tested by microtiter plate and tube method. From the processed clinical specimens, 107 Acinetobacter strains (1.02%) were isolated of which 76 (0.74%) isolates were from general wards and 31 (11.96%) were from ICU. Significantly higher percentage of Acinetobacter strains was found in ICU compared with general wards (P < 0.05). Most common Acinetobacter infection was abscess. Infections were more common in males and were associated with major risk factors such as post-surgical, diabetes mellitus, catheterization, extended hospital stay and prolonged antibiotic usage. Acinetobacter baumanii was the most common species isolated to cause abscess, wound infection, etc. 62.61% and 28.97% isolates produced slime by microtiter plate and tube method. Imipenem was most sensitive drug followed by amikacin. Ceftazidime, cefotaxime, piperacillin were most resistant. 43.00% isolates were IPM resistant. A. baumanii was more resistant to commonly used antimicrobials. Acinetobacter nosocomial infections resistant to most antimicrobials have emerged, especially in ICU. Early identification and continued surveillance of prevalent organism will help prevent the spread of Acinetobacter in hospital environment.

  10. Complexity of Complement Resistance Factors Expressed by Acinetobacter baumannii Needed for Survival in Human Serum.

    PubMed

    Sanchez-Larrayoz, Amaro F; Elhosseiny, Noha M; Chevrette, Marc G; Fu, Yang; Giunta, Peter; Spallanzani, Raúl G; Ravi, Keerthikka; Pier, Gerald B; Lory, Stephen; Maira-Litrán, Tomás

    2017-08-30

    Acinetobacter baumannii is a bacterial pathogen with increasing impact in healthcare settings, due in part to this organism's resistance to many antimicrobial agents, with pneumonia and bacteremia as the most common manifestations of disease. A significant proportion of clinically relevant A. baumannii strains are resistant to killing by normal human serum (NHS), an observation supported in this study by showing that 12 out of 15 genetically diverse strains of A. baumannii are resistant to NHS killing. To expand our understanding of the genetic basis of A. baumannii serum resistance, a transposon (Tn) sequencing (Tn-seq) approach was used to identify genes contributing to this trait. An ordered Tn library in strain AB5075 with insertions in every nonessential gene was subjected to selection in NHS. We identified 50 genes essential for the survival of A. baumannii in NHS, including already known serum resistance factors, and many novel genes not previously associated with serum resistance. This latter group included the maintenance of lipid asymmetry genetic pathway as a key determinant in protecting A. baumannii from the bactericidal activity of NHS via the alternative complement pathway. Follow-up studies validated the role of eight additional genes identified by Tn-seq in A. baumannii resistance to killing by NHS but not by normal mouse serum, highlighting the human species specificity of A. baumannii serum resistance. The identification of a large number of genes essential for serum resistance in A. baumannii indicates the degree of complexity needed for this phenotype, which might reflect a general pattern that pathogens rely on to cause serious infections. Copyright © 2017 by The American Association of Immunologists, Inc.

  11. Acinetobacter baumannii Coordinates Urea Metabolism with Metal Import To Resist Host-Mediated Metal Limitation.

    PubMed

    Juttukonda, Lillian J; Chazin, Walter J; Skaar, Eric P

    2016-09-27

    During infection, bacterial pathogens must adapt to a nutrient metal-limited environment that is imposed by the host. The innate immune protein calprotectin inhibits bacterial growth in vitro by chelating the divalent metal ions zinc (Zn(2+), Zn) and manganese (Mn(2+), Mn), but pathogenic bacteria are able to cause disease in the presence of this antimicrobial protein in vivo. One such pathogen is Acinetobacter baumannii, a Gram-negative bacterium that causes pneumonia and bloodstream infections that can be complicated by resistance to multiple antibiotics. A. baumannii inhibition by calprotectin is dependent on calprotectin Mn binding, but the mechanisms employed by A. baumannii to overcome Mn limitation have not been identified. This work demonstrates that A. baumannii coordinates transcription of an NRAMP family Mn transporter and a urea carboxylase to resist the antimicrobial activities of calprotectin. This NRAMP family transporter facilitates Mn accumulation and growth of A. baumannii in the presence of calprotectin. A. baumannii is found to utilize urea as a sole nitrogen source, and urea utilization requires the urea carboxylase encoded in an operon with the NRAMP family transporter. Moreover, urea carboxylase activity is essential for calprotectin resistance in A. baumannii Finally, evidence is provided that this system combats calprotectin in vivo, as deletion of the transporter impairs A. baumannii fitness in a mouse model of pneumonia, and this fitness defect is modulated by the presence of calprotectin. These findings reveal that A. baumannii has evolved mechanisms to subvert host-mediated metal sequestration and they uncover a connection between metal starvation and metabolic stress.

  12. Acinetobacter baumannii Coordinates Urea Metabolism with Metal Import To Resist Host-Mediated Metal Limitation

    PubMed Central

    Juttukonda, Lillian J.; Chazin, Walter J.

    2016-01-01

    ABSTRACT During infection, bacterial pathogens must adapt to a nutrient metal-limited environment that is imposed by the host. The innate immune protein calprotectin inhibits bacterial growth in vitro by chelating the divalent metal ions zinc (Zn2+, Zn) and manganese (Mn2+, Mn), but pathogenic bacteria are able to cause disease in the presence of this antimicrobial protein in vivo. One such pathogen is Acinetobacter baumannii, a Gram-negative bacterium that causes pneumonia and bloodstream infections that can be complicated by resistance to multiple antibiotics. A. baumannii inhibition by calprotectin is dependent on calprotectin Mn binding, but the mechanisms employed by A. baumannii to overcome Mn limitation have not been identified. This work demonstrates that A. baumannii coordinates transcription of an NRAMP family Mn transporter and a urea carboxylase to resist the antimicrobial activities of calprotectin. This NRAMP family transporter facilitates Mn accumulation and growth of A. baumannii in the presence of calprotectin. A. baumannii is found to utilize urea as a sole nitrogen source, and urea utilization requires the urea carboxylase encoded in an operon with the NRAMP family transporter. Moreover, urea carboxylase activity is essential for calprotectin resistance in A. baumannii. Finally, evidence is provided that this system combats calprotectin in vivo, as deletion of the transporter impairs A. baumannii fitness in a mouse model of pneumonia, and this fitness defect is modulated by the presence of calprotectin. These findings reveal that A. baumannii has evolved mechanisms to subvert host-mediated metal sequestration and they uncover a connection between metal starvation and metabolic stress. PMID:27677795

  13. Draft Genome Sequences of Multidrug-Resistant Acinetobacter sp. Strains from Colombian Hospitals

    PubMed Central

    Falquet, Laurent; Reguero, María T.; Mantilla, José R.; Valenzuela, Emilia M.; González, Elsa; Cepeda, Alexandra; Escalante, Andrea

    2013-01-01

    The draft genome sequences of the strains Acinetobacter baumannii 107m, Acinetobacter nosocomialis 28F, and Acinetobacter pittii 42F, isolated from Colombian hospitals, are reported here. These isolates are causative of nosocomial infections and are classified as multidrug resistant, as they showed resistance to four different antibiotic groups. PMID:24285656

  14. Bactericidal activity of herbal volatile oil extracts against multidrug-resistant Acinetobacter baumannii

    PubMed Central

    Intorasoot, Amornrat; Chornchoem, Piyaorn; Sookkhee, Siriwoot; Intorasoot, Sorasak

    2017-01-01

    Aim: The aim of the study is to investigate the antibacterial activity of 10 volatile oils extracted from medicinal plants, including galangal (Alpinia galanga Linn.), ginger (Zingiber officinale), plai (Zingiber cassumunar Roxb.), lime (Citrus aurantifolia), kaffir lime (Citrus hystrix DC.), sweet basil (Ocimum basilicum Linn.), tree basil (Ocimum gratissimum), lemongrass (Cymbopogon citratus DC.), clove (Syzygium aromaticum), and cinnamon (Cinnamomum verum) against four standard strains of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, and 30 clinical isolates of multidrug-resistant A. baumannii (MDR-A. baumannii). Materials and Methods: Agar diffusion, minimum inhibitory concentration, and minimum bactericidal concentration (MBC) were employed for the determination of bactericidal activity of water distilled medicinal plants. Tea tree oil (Melaleuca alternifolia) was used as positive control in this study. Results: The results indicated the volatile oil extracted from cinnamon exhibited potent antibacterial activity against the most common human pathogens, S. aureus, E. coli, P. aeruginosa, and A. baumannii. Most of volatile oil extracts were less effective against non-fermentative bacteria, P. aeruginosa. In addition, volatile oil extracted from cinnamon, clove, and tree basil possessed potent bactericidal activity against MDR-A. baumannii with MBC90 of 0.5, 1, and 2 mg/mL, respectively. Conclusions: The volatile oil extracts would be useful as alternative natural product for the treatment of the most common human pathogens and MDR-A. baumannii infections. PMID:28512603

  15. Bactericidal activity of herbal volatile oil extracts against multidrug-resistant Acinetobacter baumannii.

    PubMed

    Intorasoot, Amornrat; Chornchoem, Piyaorn; Sookkhee, Siriwoot; Intorasoot, Sorasak

    2017-01-01

    The aim of the study is to investigate the antibacterial activity of 10 volatile oils extracted from medicinal plants, including galangal (Alpinia galanga Linn.), ginger (Zingiber officinale), plai (Zingiber cassumunar Roxb.), lime (Citrus aurantifolia), kaffir lime (Citrus hystrix DC.), sweet basil (Ocimum basilicum Linn.), tree basil (Ocimum gratissimum), lemongrass (Cymbopogon citratus DC.), clove (Syzygium aromaticum), and cinnamon (Cinnamomum verum) against four standard strains of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, and 30 clinical isolates of multidrug-resistant A. baumannii (MDR-A. baumannii). Agar diffusion, minimum inhibitory concentration, and minimum bactericidal concentration (MBC) were employed for the determination of bactericidal activity of water distilled medicinal plants. Tea tree oil (Melaleuca alternifolia) was used as positive control in this study. The results indicated the volatile oil extracted from cinnamon exhibited potent antibacterial activity against the most common human pathogens, S. aureus, E. coli, P. aeruginosa, and A. baumannii. Most of volatile oil extracts were less effective against non-fermentative bacteria, P. aeruginosa. In addition, volatile oil extracted from cinnamon, clove, and tree basil possessed potent bactericidal activity against MDR-A. baumannii with MBC90 of 0.5, 1, and 2 mg/mL, respectively. The volatile oil extracts would be useful as alternative natural product for the treatment of the most common human pathogens and MDR-A. baumannii infections.

  16. Impact of Acinetobacter baumannii superoxide dismutase on motility, virulence, oxidative stress resistance and susceptibility to antibiotics.

    PubMed

    Heindorf, Magdalena; Kadari, Mahendar; Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried

    2014-01-01

    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii.

  17. Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics

    PubMed Central

    Heider, Christine; Skiebe, Evelyn; Wilharm, Gottfried

    2014-01-01

    Acinetobacter baumannii is a Gram-negative bacterium appearing as an opportunistic pathogen in hospital settings. Superoxide dismutase (SOD) contributes to virulence in several pathogenic bacteria by detoxifying reactive oxygen species released in the course of host defense reactions. However, the biological role of SODs in A. baumannii has not yet been elucidated. Here, we inactivated in A. baumannii ATCC 17978 gene A1S_2343, encoding a putative SOD of the Fe-Mn type by transposon insertion, resulting in mutant ATCC 17978 sod2343::Km. The mutation was also introduced in two naturally competent A. baumannii isolates by transformation with chromosomal DNA derived from mutant ATCC 17978 sod2343::Km. We demonstrate that inactivation of sod2343 leads to significant motility defects in all three A. baumannii strains. The mutant strains were more susceptible to oxidative stress compared to their parental strains. Susceptibility to colistin and tetracycline was increased in all mutant strains while susceptibility of the mutants to gentamicin, levofloxacin and imipenem was strain-dependent. In the Galleria mellonella infection model the mutant strains were significantly attenuated. In conclusion, sod2343 plays an important role in motility, resistance to oxidative stress, susceptibility to antibiotics and virulence in A. baumannii. PMID:25000585

  18. The contribution of nutrient metal acquisition and metabolism to Acinetobacter baumannii survival within the host

    PubMed Central

    Mortensen, Brittany L.; Skaar, Eric P.

    2013-01-01

    Acinetobacter baumannii is a significant contributor to intensive care unit (ICU) mortality causing numerous types of infection in this susceptible ICU population, most notably ventilator-associated pneumonia. The substantial disease burden attributed to A. baumannii and the rapid acquisition of antibiotic resistance make this bacterium a serious health care threat. A. baumannii is equipped to tolerate the hostile host environment through modification of its metabolism and nutritional needs. Among these adaptations is the evolution of mechanisms to acquire nutrient metals that are sequestered by the host as a defense against infection. Although all bacteria require nutrient metals, there is diversity in the particular metal needs among species and within varying tissue types and bacterial lifecycles. A. baumannii is well-equipped with the metal homeostatic systems required for the colonization of a diverse array of tissues. Specifically, iron and zinc homeostasis is important for A. baumannii interactions with biotic surfaces and for growth within vertebrates. This review discusses what is currently known regarding the interaction of A. baumannii with vertebrate cells with a particular emphasis on the contributions of metal homeostasis systems. Overall, published research supports the utility of exploiting these systems as targets for the development of much-needed antimicrobials against this emerging infectious threat. PMID:24377089

  19. [Prevalence of Acinetobacter baumannii carriage in patients of 53 French intensive care units on a given day].

    PubMed

    Chatellier, D; Burucoa, C; Pinsard, M; Frat, J-P; Robert, R

    2007-02-01

    This study was made to evaluate multiresistant Acinetobacter baumannii colonization in French intensive care units. We conducted a prevalence study on the carriage of A. baumannii for a one-day period in various French ICUs. On December 10, 2003, one nasal and/or rectal swab sampling was performed in 506 patients of 53 ICUs. Sixteen patients (3.16%) from 7 centers (13%) were colonized by A. baumannii. None of the known risk factors for colonization by multiresistant A. baumannii were identified in these patients. Overall, A. baumannii colonization is limited except during epidemic situations. Our study reflects the carriage of A. baumannii in ICUs on a given day. This study showed that there was no multiresistant A. baumannii epidemic clone, potentially responsible for outbreaks, present in the tested French ICUs.

  20. Factors associated with recovery of Acinetobacter baumannii in a combat support hospital.

    PubMed

    Griffith, Matthew E; Gonzalez, Russell S; Holcomb, John B; Hospenthal, Duane R; Wortmann, Glenn W; Murray, Clinton K

    2008-07-01

    A retrospective review of hospital records for Acinetobacter baumannii infection at a US Army combat support hospital revealed a monthly infection rate ranging from 20.5 to 0 cases per 1,000 patients admitted. The rate correlated with the mean census of host-nation patients in the intensive care unit, the mean census of host-nation patients on the wards, and length of stay in the intensive care unit.

  1. Multidrug resistant Acinetobacter baumannii: a descriptive study in a city hospital

    PubMed Central

    2010-01-01

    Background Multidrug resistant Acinetobacter baumannii, (MRAB) is an important cause of hospital acquired infection. The purpose of this study is to determine the risk factors for MRAB in a city hospital patient population. Methods This study is a retrospective review of a city hospital epidemiology data base and includes 247 isolates of Acinetobacter baumannii (AB) from 164 patients. Multidrug resistant Acinetobacter baumannii was defined as resistance to more than three classes of antibiotics. Using the non-MRAB isolates as the control group, the risk factors for the acquisition of MRAB were determined. Results Of the 247 AB isolates 72% (177) were multidrug resistant. Fifty-eight percent (143/247) of isolates were highly resistant (resistant to imipenem, amikacin, and ampicillin-sulbactam). Of the 37 patients who died with Acinetobacter colonization/infection, 32 (86%) patients had the organism recovered from the respiratory tract. The factors which were found to be significantly associated (p ≤ 0.05) with multidrug resistance include the recovery of AB from multiple sites, mechanical ventilation, previous antibiotic exposure, and the presence of neurologic impairment. Multidrug resistant Acinetobacter was associated with significant mortality when compared with sensitive strains (p ≤ 0.01). When surgical patients (N = 75) were considered separately, mechanical ventilation and multiple isolates remained the factors significantly associated with the development of multidrug resistant Acinetobacter. Among surgical patients 46/75 (61%) grew a multidrug resistant strain of AB and 37/75 (40%) were resistant to all commonly used antibiotics including aminoglycosides, cephalosporins, carbepenems, extended spectrum penicillins, and quinolones. Thirty-five percent of the surgical patients had AB cultured from multiple sites and 57% of the Acinetobacter isolates were associated with a co-infecting organism, usually a Staphylococcus or Pseudomonas. As in medical

  2. Synergistic activity of coriander oil and conventional antibiotics against Acinetobacter baumannii.

    PubMed

    Duarte, A; Ferreira, S; Silva, F; Domingues, F C

    2012-02-15

    In this study we investigated the existence of synergistic antibacterial effect between coriander (Coriandrum sativum L.) essential oil and six different antibacterial drugs (cefoperazone, chloramphenicol, ciprofloxacin, gentamicin, tetracycline and piperacillin). The antibacterial activity of coriander oil was assessed using microdilution susceptibility testing and synergistic interaction by checkerboard assays. The association of coriander essential oil with chloramphenicol, ciprofloxacin, gentamicin and tetracycline against Acinetobacter baumannii showed in vitro effectiveness, which is an indicator of a possible synergistic interaction against two reference strains of A. baumannii (LMG 1025 and LMG 1041) (FIC index from 0.047 to 0.375). However, when tested the involvement between coriander essential oil and piperacillin or cefoperazone, the isobolograms and FIC index showed an additive interaction. The in vitro interaction could improve the antimicrobial effectiveness of ciprofloxacin, gentamicin and tetracycline and may contribute to resensitize A. baumannii to the action of chloramphenicol. Copyright © 2011 Elsevier GmbH. All rights reserved.

  3. VEB-1 Extended-Spectrum β-lactamase–producing Acinetobacter baumannii, France1

    PubMed Central

    Coignard, Bruno; Carbonne, Anne; Blanckaert, Karine; Bajolet, Odile; Bernet, Claude; Verdeil, Xavier; Astagneau, Pascal; Desenclos, Jean-Claude; Nordmann, Patrice

    2006-01-01

    VEB-1 extended-spectrum β-lactamase–producing Acinetobacter baumannii was responsible for an outbreak in hospitals in France. A national alert was triggered in September 2003 when 4 hospitals reported clusters of A. baumannii infection with similar susceptibility profiles. Case definitions and laboratory guidelines were disseminated, and prospective surveillance was implemented; strains were sent to a single laboratory for characterization and typing. From April 2003 through June 2004, 53 hospitals reported 290 cases of A. baumannii infection or colonization; 275 isolates were blaVEB-1-positive and clonally related. Cases were first reported in 5 districts of northern France, then in 10 other districts in 4 regions. Within a region, interhospital spread was associated with patient transfer. In northern France, investigation and control measures led to a reduction of reported cases after January 2004. The national alert enabled early control of new clusters, demonstrating the usefulness of early warning about antimicrobial drug resistance. PMID:16965700

  4. Genes Involved in the Biosynthesis and Transport of Acinetobactin in Acinetobacter baumannii

    PubMed Central

    Hasan, Tarik; Choi, Chul Hee

    2015-01-01

    Pathogenic bacteria survive in iron-limited host environments by using several iron acquisition mechanisms. Acinetobacter baumannii, causing serious infections in compromised patients, produces an iron-chelating molecule, called acinetobactin, which is composed of equimolar quantities of 2,3-dihydroxybenzoic acid (DHBA), L-threonine, and N-hydroxyhistamine, to compete with host cells for iron. Genes that are involved in the production and transport of acinetobactin are clustered within the genome of A. baumannii. A recent study showed that entA, located outside of the acinetobactin gene cluster, plays important roles in the biosynthesis of the acinetobactin precursor DHBA and in bacterial pathogenesis. Therefore, understanding the genes that are associated with the biosynthesis and transport of acinetobactin in the bacterial genome is required. This review is intended to provide a general overview of the genes in the genome of A. baumannii that are required for acinetobactin biosynthesis and transport. PMID:25873846

  5. Attenuation of quorum sensing-mediated virulence of Acinetobacter baumannii by Glycyrrhiza glabra flavonoids.

    PubMed

    Bhargava, Nidhi; Singh, Sukhvinder P; Sharma, Anupam; Sharma, Prince; Capalash, Neena

    2015-01-01

    To develop an alternative quorum quenching therapy against multidrug-resistant Acinetobacter baumannii. Activity-guided partially purified fraction (F1) from Glycyrrhiza glabra significantly (p < 0.05) reduced quorum sensing regulated virulence factors of A. baumannii viz. motility, biofilm formation and production of antioxidant enzymes. Mechanistically, F1 downregulated the expression of autoinducer synthase gene, abaI, and consequently reduced (92%) the production of 3-OH-C12-HSL as determined by ESI-MS. Q-TOF and Q-TRAP analyses suggested the presence of flavonoids viz. licoricone, glycyrin and glyzarin as the active ingredients. This is the first report on quorum quenching activity of G. glabra linked to its flavonoids that downregulated the expression of abaI and attenuated quorum sensing regulated virulence of A. baumannii.

  6. Intranasal treatment with bacteriophage rescues mice from Acinetobacter baumannii-mediated pneumonia.

    PubMed

    Wang, Yong; Mi, Zhiqiang; Niu, Wenkai; An, Xiaoping; Yuan, Xin; Liu, Huiying; Li, Puyuan; Liu, Yannan; Feng, Yuzhong; Huang, Yong; Zhang, Xianglilan; Zhang, Zhiyi; Fan, Hang; Peng, Fan; Tong, Yigang; Bai, Changqing

    2016-05-01

    With the emergence of drug-resistant bacteria, finding alternative agents to treat antibiotic-resistant bacterial infections is imperative. A mouse pneumonia model was developed by combining cyclophosphamide pretreatment and Acinetobacter baumannii challenge, and a lytic bacteriophage was evaluated for its therapeutic efficacy in this model by examining the survival rate, bacterial load in the lung and lung pathology. Intranasal instillation with bacteriophage rescued 100% of mice following lethal challenge with A. baumannii. Phage treatment reduced bacterial load in the lung. Microcomputed tomography indicated a reduction in lung inflammation in mice given phage. This research demonstrates that intranasal application of bacteriophage is viable, and could provide complete protection from pneumonia caused by A. baumannii.

  7. Molecular Mechanisms of Sulbactam Antibacterial Activity and Resistance Determinants in Acinetobacter baumannii

    PubMed Central

    Penwell, William F.; Shapiro, Adam B.; Giacobbe, Robert A.; Gu, Rong-Fang; Gao, Ning; Thresher, Jason; McLaughlin, Robert E.; Huband, Michael D.; DeJonge, Boudewijn L. M.; Ehmann, David E.

    2015-01-01

    Sulbactam is a class A β-lactamase inhibitor with intrinsic whole-cell activity against certain bacterial species, including Acinetobacter baumannii. The clinical use of sulbactam for A. baumannii infections is of interest due to increasing multidrug resistance in this pathogen. However, the molecular drivers of its antibacterial activity and resistance determinants have yet to be precisely defined. Here we show that the antibacterial activities of sulbactam vary widely across contemporary A. baumannii clinical isolates and are mediated through inhibition of the penicillin-binding proteins (PBPs) PBP1 and PBP3, with very low frequency of resistance; the rare pbp3 mutants with high levels of resistance to sulbactam are attenuated in fitness. These results support further investigation of the potential clinical utility of sulbactam. PMID:25561334

  8. Molecular mechanisms of sulbactam antibacterial activity and resistance determinants in Acinetobacter baumannii.

    PubMed

    Penwell, William F; Shapiro, Adam B; Giacobbe, Robert A; Gu, Rong-Fang; Gao, Ning; Thresher, Jason; McLaughlin, Robert E; Huband, Michael D; DeJonge, Boudewijn L M; Ehmann, David E; Miller, Alita A

    2015-03-01

    Sulbactam is a class A β-lactamase inhibitor with intrinsic whole-cell activity against certain bacterial species, including Acinetobacter baumannii. The clinical use of sulbactam for A. baumannii infections is of interest due to increasing multidrug resistance in this pathogen. However, the molecular drivers of its antibacterial activity and resistance determinants have yet to be precisely defined. Here we show that the antibacterial activities of sulbactam vary widely across contemporary A. baumannii clinical isolates and are mediated through inhibition of the penicillin-binding proteins (PBPs) PBP1 and PBP3, with very low frequency of resistance; the rare pbp3 mutants with high levels of resistance to sulbactam are attenuated in fitness. These results support further investigation of the potential clinical utility of sulbactam.

  9. Outbreak of Extensively Drug-Resistant Acinetobacter baumannii Indigo-Pigmented Strains

    PubMed Central

    Vilacoba, Elisabet; Almuzara, Marisa; Gulone, Lucia; Rodriguez, Rocio; Pallone, Elida; Bakai, Romina; Centrón, Daniela

    2013-01-01

    Acinetobacter baumannii pigmented strains are not common in clinical settings. Here, we report an outbreak caused by indigo-pigmented A. baumannii strains isolated in an acute care hospital in Argentina from March to September 2012. Pan-PCR assays exposed a unique pattern belonging to the recently described regional CC113B/CC79P clonal complex that confirms the relevant relationships among the indigo-pigmented A. baumannii strains. All of them were extensively drug resistant and harbored different genetic elements associated with horizontal genetic transfer, such as the transposon Tn2006, class 2 integrons, AbaR-type islands, IS125, IS26, strA, strB, florR, and the small recombinase ISCR2 associated with the sul2 gene preceded by ISAba1. PMID:23985923

  10. A milk pump as a source for spreading Acinetobacter baumannii in a neonatal intensive care unit.

    PubMed

    Engür, Defne; Çakmak, Bilin Çetinkaya; Türkmen, Münevver Kaynak; Telli, Murat; Eyigör, Mete; Güzünler, Melike

    2014-12-01

    Acinetobacter baumannii is a Gram-negative coccobacillus that has emerged as a troublesome pathogen causing institutional outbreaks. Environmental contamination is a distinctive characteristic of this microorganism, which brings a further difficulty in infection control. During A. baumannii outbreaks in intensive care units, a common contaminated object can be found as a reservoir. Finding out this source by epidemiological investigations is of particular importance in order to develop effective interventions. We describe an outbreak of A. baumannii and the results of epidemiological investigations in a neonatal intensive care unit. The outbreak strain was isolated from the outer surface of a breastmilk pump. We have successfully controlled the outbreak by careful reviewing of our milk collection process.

  11. Lytic Myophage Abp53 Encodes Several Proteins Similar to Those Encoded by Host Acinetobacter baumannii and Phage phiKO2 ▿ †

    PubMed Central

    Lee, Chia-Ni; Tseng, Tsai-Tien; Lin, Juey-Wen; Fu, Yung-Chieh; Weng, Shu-Fen; Tseng, Yi-Hsiung

    2011-01-01

    Acinetobacter baumannii is an important Gram-negative opportunistic pathogen causing nosocomial infections. The emergence of multiple-drug-resistant A. baumannii isolates has increased in recent years. Directed toward phage therapy, a lytic phage of A. baumannii, designated Abp53, was isolated from a sputum sample in this study. Abp53 has an isometric head and a contractile tail with tail fibers (belonging to Myoviridae), a latent period of about 10 min, and a burst size of approximately 150 PFU per infected cell. Abp53 could completely lyse 27% of the A. baumannii isolates tested, which were all multiple drug resistant, but not other bacteria. Mg2+ enhanced the adsorption and productivity of, and host lysis by, Abp53. Twenty Abp53 virion proteins were visualized in SDS-polyacrylamide gel electrophoresis, with a 47-kDa protein being the predicted major capsid protein. Abp53 has a double-stranded DNA genome of 95 kb. Sequence analyses of a 10-kb region revealed 8 open reading frames. Five of the encoded proteins, including 3 tail components and 2 hypothetical proteins, were similar to proteins encoded by A. baumannii strain ACICU. ORF1176 (one of the tail components, 1,176 amino acids [aa]), which is also similar to tail protein gp21 of Klebsiella phage phiKO2, contained repeated domains similar to those within the ACICU_02717 protein of A. baumannii ACICU and gp21. These findings suggest a common ancestry and horizontal gene transfer during evolution. As phages can expand the host range by domain duplication in tail fiber proteins, repeated domains in ORF1176 might have a similar significance in Abp53. PMID:21821767

  12. Potential of bacteriophage ΦAB2 as an environmental biocontrol agent for the control of multidrug-resistant Acinetobacter baumannii

    PubMed Central

    2013-01-01

    Background Multidrug-resistant Acinetobacter baumannii (MDRAB) is associated with nosocomial infections worldwide. To date, the use of a phage to prevent infections caused by MDRAB has not been demonstrated. Results The MDRAB-specific phage ϕAB2 was stable at 4°C and pH 7 in 0.5% chloroform solution, and showed a slight decrease in plaque-forming units (PFU)/ml of 0.3–0.9 log after 330 days of storage. The addition of ϕAB2 at a concentration of at least 105 PFU/ml to an A. baumannii M3237 suspension killed >99.9% of A. baumannii M3237 after 5 min, regardless of A. baumannii M3237 concentration (104, 105, or 106 colony-forming units (CFU)/ml). The addition of ϕAB2 at a concentration of 108 PFU/slide (>107 PFU/cm2) to glass slides containing A. baumannii M3237 at 104, 105, or 106 CFU/slide, significantly reduced bacterial numbers by 93%, 97%, and 99%, respectively. Thus, this concentration is recommended for decontamination of glass surfaces. Moreover, infusion of ϕAB2 into 10% glycerol exhibited strong anti-MDRAB activity (99.9% reduction), even after 90 days of storage. Treatment of a 10% paraffin oil-based lotion with ϕAB2 significantly reduced (99%) A. baumannii M3237 after 1 day of storage. However, ϕAB2 had no activity in the lotion after 1 month of storage. Conclusions Phages may be useful for reducing MDRAB contamination in liquid suspensions or on hard surfaces. Phages may also be inoculated into a solution to produce an antiseptic hand wash. However, the phage concentration and incubation time (the duration of phage contact with bacteria) should be carefully considered to reduce the risk of MDRAB contamination. PMID:23834712

  13. Identification of Variable-Number Tandem-Repeat (VNTR) Sequences in Acinetobacter baumannii and Interlaboratory Validation of an Optimized Multiple-Locus VNTR Analysis Typing Scheme▿†

    PubMed Central

    Pourcel, Christine; Minandri, Fabrizia; Hauck, Yolande; D'Arezzo, Silvia; Imperi, Francesco; Vergnaud, Gilles; Visca, Paolo

    2011-01-01

    Acinetobacter baumannii is an important opportunistic pathogen responsible for nosocomial outbreaks, mostly occurring in intensive care units. Due to the multiplicity of infection sources, reliable molecular fingerprinting techniques are needed to establish epidemiological correlations among A. baumannii isolates. Multiple-locus variable-number tandem-repeat analysis (MLVA) has proven to be a fast, reliable, and cost-effective typing method for several bacterial species. In this study, an MLVA assay compatible with simple PCR- and agarose gel-based electrophoresis steps as well as with high-throughput automated methods was developed for A. baumannii typing. Preliminarily, 10 potential polymorphic variable-number tandem repeats (VNTRs) were identified upon bioinformatic screening of six annotated genome sequences of A. baumannii. A collection of 7 reference strains plus 18 well-characterized isolates, including unique types and representatives of the three international A. baumannii lineages, was then evaluated in a two-center study aimed at validating the MLVA assay and comparing it with other genotyping assays, namely, macrorestriction analysis with pulsed-field gel electrophoresis (PFGE) and PCR-based sequence group (SG) profiling. The results showed that MLVA can discriminate between isolates with identical PFGE types and SG profiles. A panel of eight VNTR markers was selected, all showing the ability to be amplified and good amounts of polymorphism in the majority of strains. Independently generated MLVA profiles, composed of an ordered string of allele numbers corresponding to the number of repeats at each VNTR locus, were concordant between centers. Typeability, reproducibility, stability, discriminatory power, and epidemiological concordance were excellent. A database containing information and MLVA profiles for several A. baumannii strains is available from http://mlva.u-psud.fr/. PMID:21147956

  14. Identification of a General O-linked Protein Glycosylation System in Acinetobacter baumannii and Its Role in Virulence and Biofilm Formation

    PubMed Central

    Iwashkiw, Jeremy A.; Seper, Andrea; Weber, Brent S.; Scott, Nichollas E.; Vinogradov, Evgeny; Stratilo, Chad; Reiz, Bela; Cordwell, Stuart J.; Whittal, Randy; Schild, Stefan; Feldman, Mario F.

    2012-01-01

    Acinetobacter baumannii is an emerging cause of nosocomial infections. The isolation of strains resistant to multiple antibiotics is increasing at alarming rates. Although A. baumannii is considered as one of the more threatening “superbugs” for our healthcare system, little is known about the factors contributing to its pathogenesis. In this work we show that A. baumannii ATCC 17978 possesses an O-glycosylation system responsible for the glycosylation of multiple proteins. 2D-DIGE and mass spectrometry methods identified seven A. baumannii glycoproteins, of yet unknown function. The glycan structure was determined using a combination of MS and NMR techniques and consists of a branched pentasaccharide containing N-acetylgalactosamine, glucose, galactose, N-acetylglucosamine, and a derivative of glucuronic acid. A glycosylation deficient strain was generated by homologous recombination. This strain did not show any growth defects, but exhibited a severely diminished capacity to generate biofilms. Disruption of the glycosylation machinery also resulted in reduced virulence in two infection models, the amoebae Dictyostelium discoideum and the larvae of the insect Galleria mellonella, and reduced in vivo fitness in a mouse model of peritoneal sepsis. Despite A. baumannii genome plasticity, the O-glycosylation machinery appears to be present in all clinical isolates tested as well as in all of the genomes sequenced. This suggests the existence of a strong evolutionary pressure to retain this system. These results together indicate that O-glycosylation in A. baumannii is required for full virulence and therefore represents a novel target for the development of new antibiotics. PMID:22685409

  15. Development of a real-time PCR assay for the rapid detection of Acinetobacter baumannii from whole blood samples.

    PubMed

    De Gregorio, Eliana; Roscetto, Emanuela; Iula, Vita Dora; Martinucci, Marianna; Zarrilli, Raffaele; Di Nocera, Pier Paolo; Catania, Maria Rosaria

    2015-04-01

    Acinetobacter baumannii is a multidrug-resistant pathogen associated with severe infections in hospitalized patients, including pneumonia, urinary and bloodstream infections. Rapid detection of A. baumannii infection is crucial for timely treatment of septicemic patients. The aim of the present study was to develop a specific marker for a quantitative polymerase chain reaction (PCR) assay for the detection of A. baumannii. The target gene chosen is the biofilm-associated protein (bap) gene, encoding a cell surface protein involved in biofilm formation. The assay is specific for A. baumannii, allowing its discrimination from different species of Acinetobacter and other clinically relevant bacterial pathogens. The assay is able to detect one genomic copy of A. baumannii, corresponding to 4 fg of purified DNA, and 20 colony-forming units/ml using DNA extracted from spiked whole blood samples.

  16. In vitro and in vivo antimicrobial activities of gallium nitrate against multidrug-resistant Acinetobacter baumannii.

    PubMed

    Antunes, Luísa C S; Imperi, Francesco; Minandri, Fabrizia; Visca, Paolo

    2012-11-01

    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO(3))(3), the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO(3))(3) delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO(3))(3) activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO(3))(3) also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO(3))(3) inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO(3))(3) also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii.

  17. In Vitro and In Vivo Antimicrobial Activities of Gallium Nitrate against Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Antunes, Luísa C. S.; Imperi, Francesco; Minandri, Fabrizia

    2012-01-01

    Multidrug-resistant Acinetobacter baumannii poses a tremendous challenge to traditional antibiotic therapy. Due to the crucial role of iron in bacterial physiology and pathogenicity, we investigated iron metabolism as a possible target for anti-A. baumannii chemotherapy using gallium as an iron mimetic. Due to chemical similarity, gallium competes with iron for binding to several redox enzymes, thereby interfering with a number of essential biological reactions. We found that Ga(NO3)3, the active component of an FDA-approved drug (Ganite), inhibits the growth of a collection of 58 A. baumannii strains in both chemically defined medium and human serum, at concentrations ranging from 2 to 80 μM and from 4 to 64 μM, respectively. Ga(NO3)3 delayed the entry of A. baumannii into the exponential phase and drastically reduced bacterial growth rates. Ga(NO3)3 activity was strongly dependent on iron availability in the culture medium, though the mechanism of growth inhibition was independent of dysregulation of gene expression controlled by the ferric uptake regulator Fur. Ga(NO3)3 also protected Galleria mellonella larvae from lethal A. baumannii infection, with survival rates of ≥75%. At therapeutic concentrations for humans (28 μM plasma levels), Ga(NO3)3 inhibited the growth in human serum of 76% of the multidrug-resistant A. baumannii isolates tested by ≥90%, raising expectations on the therapeutic potential of gallium for the treatment of A. baumannii bloodstream infections. Ga(NO3)3 also showed strong synergism with colistin, suggesting that a colistin-gallium combination holds promise as a last-resort therapy for infections caused by pan-resistant A. baumannii. PMID:22964249

  18. Screening of Herbal-Based Bioactive Extract Against Carbapenem-Resistant Strain of Acinetobacter baumannii.

    PubMed

    Tiwari, Monalisa; Roy, Ranita; Tiwari, Vishvanath

    2016-07-01

    Acinetobacter baumannii is grouped in the ESKAPE pathogens by Infectious Disease Society of America, which is linked to high degree of morbidity, mortality, and increased costs. The high level of acquired and intrinsic resistance mechanisms of these bacteria makes it an urgent requirement to find a suitable alternative to carbapenem, a commonly prescribed drug for Acinetobacter infection. In this study, methanolic extracts of six medicinal plants were subjected to phytochemical screening and their antimicrobial activity was tested against two strains of A. baumannii (ATCC 19606, carbapenem-sensitive strain, and RS 307, carbapenem-resistant strain). Synergistic effect of the plant extracts and antibiotics was also tested. Bael or Aegle marmelos contains tannin, phenol, terpenoids, glycoside, alkaloids, coumarine, steroid, and quinones. Flowers of madar or Calotropis procera possess tannin, phenol, terpenoids, glycoside, quinone, anthraquinone, anthocyanin, coumarin, and steroid. An inhibitory growth curve was seen for both the bacterial strains when treated with A. marmelos, Curcuma longa, and leaves and flowers of C. procera. Antibiotics alone showed a small zone of inhibition, but when used with herbal extracts they exhibited larger zone of inhibition. Synergistic effect of A. marmelos and imipenem was the best against both the strains of A. baumannii. From this study, it can be concluded that extracts from A. marmelos and leaves and flowers of C. procera exhibited the most effective antibacterial activity. These herbal extracts may be used to screen the bioactive compound against the carbapenem-resistant strain of A. baumannii.

  19. Structural and bioinformatic characterization of an Acinetobacter baumannii type II carrier protein

    SciTech Connect

    Allen, C. Leigh; Gulick, Andrew M.

    2014-06-01

    The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented. Microorganisms produce a variety of natural products via secondary metabolic biosynthetic pathways. Two of these types of synthetic systems, the nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), use large modular enzymes containing multiple catalytic domains in a single protein. These multidomain enzymes use an integrated carrier protein domain to transport the growing, covalently bound natural product to the neighboring catalytic domains for each step in the synthesis. Interestingly, some PKS and NRPS clusters contain free-standing domains that interact intermolecularly with other proteins. Being expressed outside the architecture of a multi-domain protein, these so-called type II proteins present challenges to understand the precise role they play. Additional structures of individual and multi-domain components of the NRPS enzymes will therefore provide a better understanding of the features that govern the domain interactions in these interesting enzyme systems. The high-resolution crystal structure of a free-standing carrier protein from Acinetobacter baumannii that belongs to a larger NRPS-containing operon, encoded by the ABBFA-003406–ABBFA-003399 genes of A. baumannii strain AB307-0294, that has been implicated in A. baumannii motility, quorum sensing and biofilm formation, is presented here. Comparison with the closest structural homologs of other carrier proteins identifies the requirements for a conserved glycine residue and additional important sequence and structural requirements within the regions that interact with partner proteins.

  20. Phase-Variable Control of Multiple Phenotypes in Acinetobacter baumannii Strain AB5075

    PubMed Central

    Tipton, Kyle A.; Dimitrova, Daniela

    2015-01-01

    ABSTRACT Acinetobacter baumannii strain AB5075 produces colonies with two opacity phenotypes, designated opaque and translucent. These phenotypes were unstable and opaque and translucent colony variants were observed to interconvert at high frequency, suggesting that a phase-variable mechanism was responsible. The frequency of phase variation both within colonies and in broth cultures increased in a cell density-dependent manner and was mediated by the accumulation of an extracellular factor. This factor was distinct from the known A. baumannii signaling molecule 3-OH C12-homoserine lactone. Opaque and translucent colony variants exhibited a number of phenotypic differences, including cell morphology, surface motility, biofilm formation, antibiotic resistance, and virulence in a Galleria mellonella model. Additional clinical isolates exhibited a similar phase-variable control of colony opacity, suggesting that this may be a common feature of A. baumannii. IMPORTANCE A novel phase-variable mechanism has been identified in Acinetobacter baumannii that results in an interconversion between opaque and translucent colony phenotypes. This phase variation also coordinately regulates motility, cell shape, biofilm formation, antibiotic resistance, and virulence. The frequency of phase variation is increased at high cell density via a diffusible extracellular signal. To our knowledge, this report presents the first example of phase variation in A. baumannii and also the first example of quorum sensing-mediated control of phase variation in a bacterium. The findings are important, as this phase-variable mechanism can be identified only via changes in colony opacity using oblique light; therefore, many researchers studying A. baumannii may unknowingly be working with different colony variants. PMID:26013481

  1. Novel use of antimicrobial hand sanitizer in treatment of nosocomial acinetobacter infection.

    PubMed

    Donahue, Meghan; Watson, Luke R; Torress-Cook, Alfonso; Watson, Paul A

    2009-01-01

    Colonization of wounds with multidrug-resistant organisms is a difficult orthopedic problem. Acinetobacter infections are especially difficult because they are resistant to all currently available antibiotics. We present the use of a novel skin sanitizer, Stay Byotrol Clean (Byotrol Inc, Spartanburg, South Carolina), to treat a multidrug-resistant wound infection. A 31-year-old T10 paraplegic man presented with chronic bilateral stage IV decubitus trochanteric ulcers. Cultures grew methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus. The ulcers were initially treated with irrigation and debridement and vancomycin, levaquin, and cefepime. After 4 months of aggressive treatment, the cultures continued to be positive for Escherichia coli and Acinetobacter baumannii. The patient was started on amikacin and tigecycline. Despite 1 additional month of aggressive wound care, debridements, and intravenous antibiotics, the cultures continued to grow A baumannii and Pseudomonas aerug. The A baumannii was resistant to all available antibiotics tested. The ulcers were then treated with daily application of Stay Byotrol Clean hand and skin sanitizer. Four days later, cultures were negative for any bacterial growth, with no A baumannii. After 1 week, the ulcers showed new granulation tissue with no visible necrotic tissue. After 3 months of treatment, the ulcers had healed. Stay Byotrol Clean is nonirritating and contains no iodine or alcohol. It is currently being used for decolonization of patients on admission to the hospital, however, there is great potential for its use in wound treatment, preoperative surgical sterilization, and orthopedic devices.

  2. Effect of carbonyl cyanide 3-chlorophenylhydrazone (CCCP) on killing Acinetobacter baumannii by colistin.

    PubMed

    Park, Young Kyoung; Ko, Kwan Soo

    2015-01-01

    We investigated the effect of cyanide 3-chlorophenylhydrazone (CCCP) and other efflux pump inhibitors (EPIs) on the colistin susceptibility in Acinetobacter baumannii. While minimum inhibitory concentrations (MICs) of colistin in all colistin-resistant strains decreased significantly with 25 μM of CCCP and 2,4-dinitrophenol (DNP), phenyl-arginine-β-naphthylamide (PAβN), and reserpine did not decrease the colistin MICs. However, CCCP and DNP as well as PAβN and reserpine did not have a significant effect on the MICs of the other agents. Efflux pump gene expressions in colistin-resistant strains were not increased compared with those in colistin-susceptible strains. When only 5X MIC of colistin (5 mg/L) was provided to a colistin-susceptible A. baumannii strain, the bacterial cell number was reduced by 9 h after exposure to colistin, but regrowth was observed. When CCCP was added to colistin, bacterial cells were completely killed after 24 to 48 h of incubation, which was not due to the toxicity of CCCP itself. Colistin resistance in A. baumannii may not be due to efflux pumps. Our present study suggests that bacterial cells with reduced metabolic activity by CCCP are more susceptible to colistin in A. baumannii. It may show the possibility that combined therapy with colistin and other antimicrobial agents could effective against A. baumannii infections.

  3. Investigations on the genomic diversity of OXA from isolated Acinetobacter baumannii.

    PubMed

    Ma, Z; Zhou, L Q; Wang, H; Luo, L P

    2015-11-23

    We distinguished the four OXA-type carbapenemase subgroup alleles present in 120 strains of Acinetobacter baumannii by using polymerase chain reaction (PCR) and investigated the distributions of the OXA subgroups in clinically isolated samples. Amplification of the OXA genes blaOXA-23, blaOXA-24, blaOXA-51, and blaOXA-58 was performed by multiplex PCR. Antibiotics susceptibility test was conducted for determine the sensitivity of the A. baumannii to clinical common used antibiotics by Kirby-Bauer method. Results revealed that 46 (51.69%) of the samples were positive for only the blaOXA51 gene and 41 (46.07%) were positive for both the blaOXA51 and blaOXA58 genes in the 89 isolates of A. baumannii. Among these, 45 were carbapenem-resistant and 44 carbapenem-sensitive. Strains containing either blaOXA51 or blaOXA58 showed resistance or sensitivity to carbapenems, respectively. A. baumannii isolated from intensive care units showed significantly higher resistance rate to Cefepime, Piperacillin-tazobactam, Amikacin, Ceftazidime, Cefotaxime, Sulfamethoxazole-trimethoprim, and Gentamicin than those isolated from other departments (P < 0.05). In conclusion, we found that the presence of blaOXA-51 and blaOXA-58 appears to convey a mechanism of resistance or sensitivity to carbapenems, respectively, in A. baumannii clinical isolates.

  4. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar.

    PubMed

    Rolain, J-M; Loucif, L; Al-Maslamani, M; Elmagboul, E; Al-Ansari, N; Taj-Aldeen, S; Shaukat, A; Ahmedullah, H; Hamed, M

    2016-05-01

    The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR) Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC), Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (bla OXA-23, bla OXA-24, bla OXA-58, bla NDM) was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and bla OXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for bla OXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar.

  5. Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach.

    PubMed

    Hua, Xiaoting; Liu, Lilin; Fang, Youhong; Shi, Qiucheng; Li, Xi; Chen, Qiong; Shi, Keren; Jiang, Yan; Zhou, Hua; Yu, Yunsong

    2017-01-01

    Acinetobacter baumannii has emerged as an important opportunistic pathogen due to its ability to acquire resistance to most currently available antibiotics. Colistin is often considered as the last line of therapy for infections caused by multidrug-resistant A. baumannii (MDRAB). However, colistin-resistant A. baumannii strain has recently been reported. To explore how multiple drug-resistant A. baumannii responded to colistin resistance, we compared the genomic, transcriptional and proteomic profile of A. baumannii MDR-ZJ06 to the induced colistin-resistant strain ZJ06-200P5-1. Genomic analysis showed that lpxC was inactivated by ISAba1 insertion, leading to LPS loss. Transcriptional analysis demonstrated that the colistin-resistant strain regulated its metabolism. Proteomic analysis suggested increased expression of the RND efflux pump system and down-regulation of FabZ and β-lactamase. These alterations were believed to be response to LPS loss. In summary, the lpxC mutation not only established colistin resistance but also altered global gene expression.

  6. Contribution of EmrAB efflux pumps to colistin resistance in Acinetobacter baumannii.

    PubMed

    Lin, Ming-Feng; Lin, Yun-You; Lan, Chung-Yu

    2017-02-01

    Efflux pumps play an important role in antimicrobial resistance for Acinetobacter baumannii. However, the function of the Emr pump system and the relationship between Emr and drug resistance has not been characterized in A. baumannii. In this study, four possible groups of emr-like genes were found by searching a genome database. Among them, A1S_1772 (emrB) and A1S_1773 (emrA) were demonstrated to be co-transcribed as a single operon. Moreover, during osmotic stress, A1S_1772 showed the largest change in gene expression compared to the other emrB-like genes, and deletion of A1S_1772 (AB ΔemrB) significantly slowed cell growth in 20% sucrose. Using a phenotypic microarray analysis, the AB ΔemrB mutant was more susceptible to colistin and nafcillin, paromomycin, spiramycin, and D,L-serine hydroxmate than the wild type. The spot assay, time kill assay and minimal inhibition concentration determination also indicated that the wild type could tolerate colistin better than the AB ΔemrB mutant. Finally, the increased expression levels of all emrB-like genes, including A1S_0775, A1S_0909, A1S_1772, and A1S_1799, in colistin resistance-induced A. baumannii further supported the possible involvement of the emrB genes in A. baumannii colistin resistance. Together, the Emr pump systems in A. baumannii contribute to adaptation to osmotic stress and resistance to colistin.

  7. Antibiotic Resistance Determinant-Focused Acinetobacter baumannii Vaccine Designed Using Reverse Vaccinology

    PubMed Central

    Ni, Zhaohui; Chen, Yan; Ong, Edison; He, Yongqun

    2017-01-01

    As one of the most influential and troublesome human pathogens, Acinetobacter baumannii (A. baumannii) has emerged with many multidrug-resistant strains. After collecting 33 complete A. baumannii genomes and 84 representative antibiotic resistance determinants, we used the Vaxign reverse vaccinology approach to predict classical type vaccine candidates against A. baumannii infections and new type vaccine candidates against antibiotic resistance. Our genome analysis identified 35 outer membrane or extracellular adhesins that are conserved among all 33 genomes, have no human protein homology, and have less than 2 transmembrane helices. These 35 antigens include 11 TonB dependent receptors, 8 porins, 7 efflux pump proteins, and 2 fimbrial proteins (FilF and CAM87009.1). CAM86003.1 was predicted to be an adhesin outer membrane protein absent from 3 antibiotic-sensitive strains and conserved in 21 antibiotic-resistant strains. Feasible anti-resistance vaccine candidates also include one extracellular protein (QnrA), 3 RND type outer membrane efflux pump proteins, and 3 CTX-M type β-lactamases. Among 39 β-lactamases, A. baumannii CTX-M-2, -5, and -43 enzymes are predicted as adhesins and better vaccine candidates than other β-lactamases to induce preventive immunity and enhance antibiotic treatments. This report represents the first reverse vaccinology study to systematically predict vaccine antigen candidates against antibiotic resistance for a microbial pathogen. PMID:28230771

  8. The induction and identification of novel Colistin resistance mutations in Acinetobacter baumannii and their implications

    PubMed Central

    Thi Khanh Nhu, Nguyen; Riordan, David W.; Do Hoang Nhu, Tran; Thanh, Duy Pham; Thwaites, Guy; Huong Lan, Nguyen Phu; Wren, Brendan W.; Baker, Stephen; Stabler, Richard A

    2016-01-01

    Acinetobacter baumannii is a significant cause of opportunistic hospital acquired infection and has been identified as an important emerging infection due to its high levels of antimicrobial resistance. Multidrug resistant A. baumannii has risen rapidly in Vietnam, where colistin is becoming the drug of last resort for many infections. In this study we generated spontaneous colistin resistant progeny (up to >256 μg/μl) from four colistin susceptible Vietnamese isolates and one susceptible reference strain (MIC <1.5 μg/μl). Whole genome sequencing was used to identify single nucleotide mutations that could be attributed to the reduced colistin susceptibility. We identified six lpxACD and three pmrB mutations, the majority of which were novel. In addition, we identified further mutations in six A. baumannii genes (vacJ, pldA, ttg2C, pheS and conserved hypothetical protein) that we hypothesise have a role in reduced colistin susceptibility. This study has identified additional mutations that may be associated with colistin resistance through novel resistance mechanisms. Our work further demonstrates how rapidly A. baumannii can generate resistance to a last resort antimicrobial and highlights the need for improved surveillance to identified A. baumannii with an extensive drug resistance profile. PMID:27329501

  9. Antibiotic Resistance Determinant-Focused Acinetobacter baumannii Vaccine Designed Using Reverse Vaccinology.

    PubMed

    Ni, Zhaohui; Chen, Yan; Ong, Edison; He, Yongqun

    2017-02-21

    As one of the most influential and troublesome human pathogens, Acinetobacter baumannii (A. baumannii) has emerged with many multidrug-resistant strains. After collecting 33 complete A. baumannii genomes and 84 representative antibiotic resistance determinants, we used the Vaxign reverse vaccinology approach to predict classical type vaccine candidates against A. baumannii infections and new type vaccine candidates against antibiotic resistance. Our genome analysis identified 35 outer membrane or extracellular adhesins that are conserved among all 33 genomes, have no human protein homology, and have less than 2 transmembrane helices. These 35 antigens include 11 TonB dependent receptors, 8 porins, 7 efflux pump proteins, and 2 fimbrial proteins (FilF and CAM87009.1). CAM86003.1 was predicted to be an adhesin outer membrane protein absent from 3 antibiotic-sensitive strains and conserved in 21 antibiotic-resistant strains. Feasible anti-resistance vaccine candidates also include one extracellular protein (QnrA), 3 RND type outer membrane efflux pump proteins, and 3 CTX-M type β-lactamases. Among 39 β-lactamases, A. baumannii CTX-M-2, -5, and -43 enzymes are predicted as adhesins and better vaccine candidates than other β-lactamases to induce preventive immunity and enhance antibiotic treatments. This report represents the first reverse vaccinology study to systematically predict vaccine antigen candidates against antibiotic resistance for a microbial pathogen.

  10. Management of an Acinetobacter baumannii outbreak in an intensive care unit.

    PubMed

    Tanguy, M; Kouatchet, A; Tanguy, B; Pichard, É; Fanello, S; Joly-Guillou, M-L

    2017-10-01

    Acinetobacter baumannii is a ubiquitous pathogen resistant to desiccation and responsible for healthcare-associated infections (HAI), especially in intensive care units (ICU) where it is responsible for 5-10% of HAIs. An A. baumannii outbreak occurred in the ICU of the University Hospital of Angers, France. To describe the A. baumannii outbreak and to evaluate the control measures taken. The secondary objective was to evaluate the impact of the electronic alert system on the incidence of multidrug resistance to antibiotics. We performed a descriptive study of A. baumannii carriers during the outbreak. Case contacts and carriers were described using the epidemic curve and a case synopsis table. From August 2011 to September 2013, 49 patients presenting with an extended-spectrum beta-lactamase-producing A. baumannii infection were identified: thirty-four were colonized and 15 were infected. No death was due to the outbreak. Measures taken were: geographical and technical isolation of patients, dedicated team implementation, contact precaution implementation including hand hygiene measures, appropriate use of gloves, and reinforcement of bio-cleaning procedures. Some patients were re-admitted to hospital while still being carriers; this could explain epidemic peaks. The immersion mission of the hygiene nurse contributed to answering healthcare workers' queries and led to a better cooperation between the ICU and the hygiene team. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  11. Characterization of the Acinetobacter baumannii growth phase-dependent and serum responsive transcriptomes.

    PubMed

    Jacobs, Anna C; Sayood, Khalid; Olmsted, Stephen B; Blanchard, Catlyn E; Hinrichs, Steven; Russell, David; Dunman, Paul M

    2012-04-01

    Acinetobacter baumannii has emerged as a bacterial pathogen of considerable healthcare concern. Yet, little is known about the organism's basic biological processes and the regulatory networks that modulate expression of its virulence factors and antibiotic resistance. Using Affymetrix GeneChips , we comprehensively defined and compared the transcriptomes of two A. baumannii strains, ATCC 17978 and 98-37-09, during exponential and stationary phase growth in Luria-Bertani (LB) medium. Results revealed that in addition to expected growth phase-associated metabolic changes, several putative virulence factors were dramatically regulated in a growth phase-dependent manner. Because a common feature between the two most severe types of A. baumannii infection, pneumonia and septicemia, includes the organism's dissemination to visceral organs via the circulatory system, microarray studies were expanded to define the expression properties of A. baumannii during growth in human serum. Growth in serum significantly upregulated iron acquisition systems, genes associated with epithelial cell adherence and DNA uptake, as well as numerous putative drug efflux pumps. Antibiotic susceptibility testing verified that the organism exhibits increased antibiotic tolerance when cultured in human serum, as compared to LB medium. Collectively, these studies provide researchers with a comprehensive database of A. baumannii's expression properties in LB medium and serum and identify biological processes that may contribute to the organism's virulence and antibiotic resistance.

  12. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii

    PubMed Central

    Wan, Guoqing; Ruan, Lingao; Yin, Yu; Yang, Tian; Ge, Mei; Cheng, Xiaodong

    2016-01-01

    Acinetobacter baumannii resistance to carbapenem antibiotics is a serious clinical challenge. As a newly developed technology, silver nanoparticles (AgNPs) show some excellent characteristics compared to older treatments, and are a candidate for combating A. baumannii infection. However, its mechanism of action remains unclear. In this study, we combined AgNPs with antibiotics to treat carbapenem-resistant A. baumannii (aba1604). Our results showed that single AgNPs completely inhibited A. baumannii growth at 2.5 μg/mL. AgNP treatment also showed synergistic effects with the antibiotics polymixin B and rifampicin, and an additive effect with tigecyline. In vivo, we found that AgNPs–antibiotic combinations led to better survival ratios in A. baumannii-infected mouse peritonitis models than that by single drug treatment. Finally, we employed different antisense RNA-targeted Escherichia coli strains to elucidate the synergistic mechanism involved in bacterial responses to AgNPs and antibiotics. PMID:27574420

  13. Modeling the impact of interventions against Acinetobacter baumannii transmission in intensive care units.

    PubMed

    Doan, Tan N; Kong, David C M; Marshall, Caroline; Kirkpatrick, Carl M J; McBryde, Emma S

    2016-01-01

    The efficacy of infection control interventions against Acinetobacter baumannii remains unclear, despite such information being critical for effective prevention of the transmission of this pathogen. Mathematical modeling offers an alternative to clinical trials, which may be prohibitively expensive, unfeasible or unethical, in predicting the impact of interventions. Furthermore, it allows the ability to ask key "what if" questions to evaluate which interventions have the most impact. We constructed a transmission dynamic model to quantify the effects of interventions on reducing A. baumannii prevalence and the basic reproduction ratio (R0) in intensive care units (ICUs). We distinguished between colonization and infection, and incorporated antibiotic exposure and transmission from free-living bacteria in the environment. Under the assumptions and parameterization in our model, 25% and 18% of patients are colonized and infected with A. baumannii, respectively; and R0 is 1.4. Improved compliance with hand hygiene (≥87%), enhanced environmental cleaning, reduced length of ICU stay of colonized patients (≤ 10 days), shorter durations of antibiotic treatment of A. baumannii (≤6 days), and isolation of infected patients combined with cleaning of isolation rooms are effective, reducing R0 to below unity. In contrast, expediting the recovery of the intestinal microbiota (e.g. use of probiotics) is not effective. This study represents a biologically realistic model of the transmission dynamics of A. baumannii, and the most comprehensive analysis of the effectiveness of interventions against this pathogen. Our study provides important data for designing effective infection control interventions.

  14. In Vitro Activity of Tigecycline Against Acinetobacter baumannii: Global Epidemiology and Resistance Mechanisms.

    PubMed

    Pournaras, Spyros; Koumaki, Vasiliki; Gennimata, Vasiliki; Kouskouni, Evangelia; Tsakris, Athanassios

    2016-01-01

    Acinetobacter baumannii is a pathogen of increasing concern, commonly causing outbreaks in the hospital environment. Of particular concern, A. baumannii strains exhibiting resistance to carbapenems, which were previously considered the treatment of choice for infected patients, have dramatically increased worldwide, leaving a few antibacterial choices. Tigecycline, a broad-spectrum modified minocycline derivative, isconsidered as a last resort drug against multidrug-resistant A. baumannii. Though, resistance to tigecycline has emerged and is growing notably following increasing tigecycline usage. Comparative evaluation of the tigecycline resistance rates reported worldwide is challenging due to the absence of official interpretative criteria for in vitro susceptibility testing and the discrepancies among the different susceptibility methodologies used, with broth microdilution being considered the reference method. Tigecycline resistance is mainly associated with resistance-nodulation-cell division (RND)-type transporters, mainly the AdeABC, AdeFGH and AdeIJK efflux pumps, but other resistance mechanisms have also been implicated. Tigecycline is still an attractive choice for A. baumannii, but further investigations are warranted so that treatment of MDR Α. baumannii could be guided by validated in vitro data.

  15. A multidrug resistance plasmid contains the molecular switch for type VI secretion in Acinetobacter baumannii

    PubMed Central

    Weber, Brent S.; Ly, Pek Man; Irwin, Joshua N.; Pukatzki, Stefan; Feldman, Mario F.

    2015-01-01

    Infections with Acinetobacter baumannii, one of the most troublesome and least studied multidrug-resistant superbugs, are increasing at alarming rates. A. baumannii encodes a type VI secretion system (T6SS), an antibacterial apparatus of Gram-negative bacteria used to kill competitors. Expression of the T6SS varies among different strains of A. baumannii, for which the regulatory mechanisms are unknown. Here, we show that several multidrug-resistant strains of A. baumannii harbor a large, self-transmissible resistance plasmid that carries the negative regulators for T6SS. T6SS activity is silenced in plasmid-containing, antibiotic-resistant cells, while part of the population undergoes frequent plasmid loss and activation of the T6SS. This activation results in T6SS-mediated killing of competing bacteria but renders A. baumannii susceptible to antibiotics. Our data show that a plasmid that has evolved to harbor antibiotic resistance genes plays a role in the differentiation of cells specialized in the elimination of competing bacteria. PMID:26170289

  16. Class 2 Integrons Dissemination Among Multidrug Resistance (MDR) Clones of Acinetobacter baumannii

    PubMed Central

    Ramírez, María Soledad; Morales, Amanda; Vilacoba, Elisabet; Márquez, Carolina

    2014-01-01

    Acinetobacter baumannii has emerged as a serious problem in the hospital environment at a global scale. Previous results from our laboratory showed a high frequency of class 2 integrons in A. baumannii strains from Argentina regarding the low rate of this element in A. baumannii isolates from the rest of the world. To reveal the current epidemiology of class 2 integrons, a molecular surveillance analyzing 78 multidrug resistant (MDR) A. baumannii isolates from Argentina and Uruguay was performed, exposing the presence of class 2 integron in the 36.61% of the isolates. Class 2 integron characterization showed that the typical Tn7::In2-7 array was present in 26 out of 27 intI2 positive isolates. All intI2 positive isolates contained at least one of the Tn7 transposition genes. In addition, we identified that 18 intI2 positive isolates possessed the Tn7::In2-7 within the attTn7 site. The molecular typing evidenced that clones I and IV that do not belong to widespread European clones I and II were found among the intI2 positive isolates. Our results exposed the widely dissemination of class 2 integron among MDR A. baumannii isolates from Argentina and Uruguay, also showing the persistence of two novel clones in our region, which could explain in part the high frequency of class 2 integron found in our region. PMID:22198473

  17. Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach

    PubMed Central

    Hua, Xiaoting; Liu, Lilin; Fang, Youhong; Shi, Qiucheng; Li, Xi; Chen, Qiong; Shi, Keren; Jiang, Yan; Zhou, Hua; Yu, Yunsong

    2017-01-01

    Acinetobacter baumannii has emerged as an important opportunistic pathogen due to its ability to acquire resistance to most currently available antibiotics. Colistin is often considered as the last line of therapy for infections caused by multidrug-resistant A. baumannii (MDRAB). However, colistin-resistant A. baumannii strain has recently been reported. To explore how multiple drug-resistant A. baumannii responded to colistin resistance, we compared the genomic, transcriptional and proteomic profile of A. baumannii MDR-ZJ06 to the induced colistin-resistant strain ZJ06-200P5-1. Genomic analysis showed that lpxC was inactivated by ISAba1 insertion, leading to LPS loss. Transcriptional analysis demonstrated that the colistin-resistant strain regulated its metabolism. Proteomic analysis suggested increased expression of the RND efflux pump system and down-regulation of FabZ and β-lactamase. These alterations were believed to be response to LPS loss. In summary, the lpxC mutation not only established colistin resistance but also altered global gene expression. PMID:28275586

  18. Acinetobacter baumannii outer membrane protein A modulates the biogenesis of outer membrane vesicles.

    PubMed

    Moon, Dong Chan; Choi, Chul Hee; Lee, Jung Hwa; Choi, Chi-Won; Kim, Hye-Yeon; Park, Jeong Soon; Kim, Seung Il; Lee, Je Chul

    2012-02-01

    Acinetobacter baumannii secretes outer membrane vesicles (OMVs) during both in vitro and in vivo growth, but the biogenesis mechanism by which A. baumannii produces OMVs remains undefined. Outer membrane protein A of A. baumannii (AbOmpA) is a major protein in the outer membrane and the C-terminus of AbOmpA interacts with diaminopimelate of peptidoglycan. This study investigated the role of AbOmpA in the biogenesis of A. baumannii OMVs. Quantitative and qualitative approaches were used to analyze OMV biogenesis in A. baumannii ATCC 19606T and an isogenic ΔAbOmpA mutant. OMV production was significantly increased in the ΔAbOmpA mutant compared to wild-type bacteria as demonstrated by quantitation of proteins and lipopolysaccharides (LPS) packaged in OMVs. LPS profiles prepared from OMVs from wild-type bacteria and the ΔAbOmpA mutant had identical patterns, but proteomic analysis showed different protein constituents in OMVs from wild-type bacteria compared to the ΔAbOmpA mutant. In conclusion, AbOmpA influences OMV biogenesis by controlling OMV production and protein composition.

  19. In vitro sensitivity of Acinetobacter baumannii and Pseudomonas aeruginosa to carbapenems among intensive care unit patients.

    PubMed

    Guzek, A; Korzeniewski, K; Nitsch-Osuch, Aneta; Rybicki, Z; Prokop, E

    2013-01-01

    Acinetobacter baumannii and Pseudomonas aeruginosa pathogens are the most common causes of fatal pneumonia among patients treated in Intensive Care Units (ICU). Carbapenems remain a group of antibiotics characterized by the highest effectiveness in treatment of heavy infections of the lower respiratory tract. This study compared in vitro sensitivity of A. baumannii and P. aeruginosa to three carbapenems: imipenem, meropenem and doripenem. The material was collected from 71 patients treated in the ICU from April 2009 to January 2010. Bronchial tree was the predominant source of samples. Fifty-four strains of A. baumannii and 17 strains of P. aeruginosa were analyzed. Sensitivity to carbapenems was interpreted in line with Clinical and Laboratory Standard Institute (CLSI) and European Committee for Antimicrobial Susceptibility Testing (EUCAST) criteria (imipenem and meropenem) or in compliance with the Food and Drug Administration (FDA) and CLSI guidelines (doripenem). We found that A. baumannii was significantly more often sensitive to imipenem than to doripenem and meropenem, but only according to the CLSI and FDA and not EUCAST criteria. The sensitivity of P. aeruginosa was higher to imipenem than to doripenem and meropenem, according to both CLSI and EUCAST criteria (64.7 %). We conclude that the EUCAST criteria demonstrate a higher rigor than those of CLSI and FDA in the determination of carbapenems sensitivity. Imipenem appears more effective than doripenem and meropenem in treatment of A. baumannii and P. aeruginosa infections.

  20. Acinetobacter baumannii Is Dependent on the Type II Secretion System and Its Substrate LipA for Lipid Utilization and In Vivo Fitness

    PubMed Central

    Johnson, Tanya L.; Waack, Ursula; Smith, Sara; Mobley, Harry

    2015-01-01

    ABSTRACT Gram-negative bacteria express a number of sophisticated secretion systems to transport virulence factors across the cell envelope, including the type II secretion (T2S) system. Genes for the T2S components GspC through GspN and PilD are conserved among isolates of Acinetobacter baumannii, an increasingly common nosocomial pathogen that is developing multidrug resistance at an alarming rate. In contrast to most species, however, the T2S genes are dispersed throughout the genome rather than linked into one or two operons. Despite this unique genetic organization, we show here that the A. baumannii T2S system is functional. Deletion of gspD or gspE in A. baumannii ATCC 17978 results in loss of secretion of LipA, a lipase that breaks down long-chain fatty acids. Due to a lack of extracellular lipase, the gspD mutant, the gspE mutant, and a lipA deletion strain are incapable of growth on long-chain fatty acids as a sole source of carbon, while their growth characteristics are indistinguishable from those of the wild-type strain in nutrient-rich broth. Genetic inactivation of the T2S system and its substrate, LipA, also has a negative impact on in vivo fitness in a neutropenic murine model for bacteremia. Both the gspD and lipA mutants are outcompeted by the wild-type strain as judged by their reduced numbers in spleen and liver following intravenous coinoculation. Collectively, our findings suggest that the T2S system plays a hitherto-unrecognized role in in vivo survival of A. baumannii by transporting a lipase that may contribute to fatty acid metabolism. IMPORTANCE Infections by multidrug-resistant Acinetobacter baumannii are a growing health concern worldwide, underscoring the need for a better understanding of the molecular mechanisms by which this pathogen causes disease. In this study, we demonstrated that A. baumannii expresses a functional type II secretion (T2S) system that is responsible for secretion of LipA, an extracellular lipase required for

  1. Multidrug-Resistant Acinetobacter baumannii in Veterinary Clinics, Germany

    PubMed Central

    Prenger-Berninghoff, Ellen; Weiss, Reinhard; van der Reijden, Tanny; van den Broek, Peterhans; Baljer, Georg; Dijkshoorn, Lenie

    2011-01-01

    An increase in prevalence of multidrug-resistant Acinetobacter spp. in hospitalized animals was observed at the Justus-Liebig-University (Germany). Genotypic analysis of 56 isolates during 2000–2008 showed 3 clusters that corresponded to European clones I–III. Results indicate spread of genotypically related strains within and among veterinary clinics in Germany. PMID:21888812

  2. A penicillin-binding protein inhibits selection of colistin-resistant, lipooligosaccharide-deficient Acinetobacter baumannii

    PubMed Central

    Boll, Joseph M.; Crofts, Alexander A.; Peters, Katharina; Cattoir, Vincent; Vollmer, Waldemar; Davies, Bryan W.; Trent, M. Stephen

    2016-01-01

    The Gram-negative bacterial outer membrane fortifies the cell against environmental toxins including antibiotics. Unique glycolipids called lipopolysaccharide/lipooligosaccharide (LPS/LOS) are enriched in the cell-surface monolayer of the outer membrane and promote antimicrobial resistance. Colistin, which targets the lipid A domain of LPS/LOS to lyse the cell, is the last-line treatment for multidrug-resistant Gram-negative infections. Lipid A is essential for the survival of most Gram-negative bacteria, but colistin-resistant Acinetobacter baumannii lacking lipid A were isolated after colistin exposure. Previously, strain ATCC 19606 was the only A. baumannii strain demonstrated to subsist without lipid A. Here, we show that other A. baumannii strains can also survive without lipid A, but some cannot, affording a unique model to study endotoxin essentiality. We assessed the capacity of 15 clinical A. baumannii isolates including 9 recent clinical isolates to develop colistin resistance through inactivation of the lipid A biosynthetic pathway, the products of which assemble the LOS precursor. Our investigation determined that expression of the well-conserved penicillin-binding protein (PBP) 1A, prevented LOS-deficient colony isolation. The glycosyltransferase activity of PBP1A, which aids in the polymerization of the peptidoglycan cell wall, was lethal to LOS-deficient A. baumannii. Global transcriptomic analysis of a PBP1A-deficient mutant and four LOS-deficient A. baumannii strains showed a concomitant increase in transcription of lipoproteins and their transporters. Examination of the LOS-deficient A. baumannii cell surface demonstrated that specific lipoproteins were overexpressed and decorated the cell surface, potentially compensating for LOS removal. This work expands our knowledge of lipid A essentiality and elucidates a drug resistance mechanism. PMID:27681618

  3. In Vivo Selection of Pan-Drug Resistant Acinetobacter baumannii during Antibiotic Treatment

    PubMed Central

    Kim, Yoonjung; Bae, Il Kwon; Yong, Dongeun; Lee, Kyungwon

    2015-01-01

    Purpose Colistin resistance in Acinetobacter baumannii (A. baumannii) is mediated by a complete loss of lipopolysaccharide production via mutations in lpxA, lpxC, and lpxD gene or lipid A modifications via mutations in the pmrA and pmrB genes. However, the exact mechanism of therapy-induced colistin resistance in A. baumannii is not well understood. Materials and Methods We investigated the genotypic and phenotypic changes that underlie pan-drug resistance mechanisms by determining differences between the alterations in extensively drug-resistant (XDR) A. baumannii (AB001 and AB002) isolates and a pan-drug resistant (PDR) counterpart (AB003) recovered from one patient before and after antibiotic treatment, respectively. Results All three clinical isolates shared an identical sequence type (ST138), belonging to the global epidemic clone, clonal complex 92, and all produced OXA-23 carbapenemase. The PDR AB003 showed two genetic differences, acquisition of armA gene and an amino acid substitution (Glu229Asp) in pmrB gene, relative to XDR isolates. No mutations were detected in the pmrA, pmrC, lpxA, lpxC, or lpxD genes in all three isolates. In matrix-assisted laser desorption ionization-time of flight analysis, the three isolates commonly showed two major peaks at 1728 m/z and 1912 m/z, but peaks at 2034 m/z, 2157 m/z, 2261 m/z, and 2384 m/z were detected only in the PDR A. baumannii AB003 isolate. Conclusion Our results show that changes in lipid A structure via a mutation in the pmrB gene and acquisition of armA gene might confer resistance to colistin and aminoglycosides to XDR A. baumannii strains, resulting in appearance of a PDR A. baumannii strain of ST138. PMID:26069113

  4. Resistant mechanisms and molecular epidemiology of imipenem-resistant Acinetobacter baumannii

    PubMed Central

    Xiao, Shu-Zhen; Chu, Hai-Qing; Han, Li-Zhong; Zhang, Zhe-Min; Li, Bing; Zhao, Lan; Xu, Liyun

    2016-01-01

    The aim of the study was to investigate the resistant mechanisms and homology of imipenem-resistant Acinetobacter baumannii (A. baumannii). A total of 46 non-duplicate imipenem-resistant A. baumannii clinical isolates were collected from three tertiary hospitals between July, 2011 and June, 2012. The minimal inhibitory concentrations (MICs) of antimicrobial agents were determined using the agar dilution method. Phenylalanine-arginine β-naphthylamide was used to detect the presence of the efflux pump-mediated resistant mechanism. Polymerase chain reaction was employed to amplify genes associated with drug resistance, including β-lactamase genes, efflux pump genes and outer membrane protein gene CarO. A few amplicons were randomly selected and sequenced. Multilocus sequence analysis (MLST) was employed in typing A. baumanni. A. baumannii was resistant to imipenem, simultaneously showing resistance to several other antimicrobials. In addition, 13 A. baumannii were found to mediate drug resistance through operation of the efflux pump. Of the various drug resistance genes tested, blaOXA-51 was present in 46 isolates, blaOXA-23 gene was present in 44 isolates and blaNDM gene was found in only one strain. Other drug resistant-associated genes, including blaKPC, blaIMP, blaOXA-24, blaOXA-58, blaSHV, blaGIM and blaVIM were not detected. Mutation of adeS and outer membrane protein gene CarO were found in a few of the imipenem-resistant isolates. The MLST analysis revealed that all 46 clinical isolates were clustered into 11 genotypes and the most frequent genotype was ST208. In conclusion, β-lactamase genes, genes involved in efflux pump and mutation of outer membrane protein encoding gene may be important in mediating imipenem resistance in A. baumannii. Of the 11 different genotypes, ST11 was shared by the majority of A. baumannii, which may be due to horizontal transfer of patients from hospitals. PMID:27485638

  5. Carbapenem-Resistant Acinetobacter baumannii: Concomitant Contamination of Air and Environmental Surfaces.

    PubMed

    Shimose, Luis A; Masuda, Eriko; Sfeir, Maroun; Berbel Caban, Ana; Bueno, Maria X; dePascale, Dennise; Spychala, Caressa N; Cleary, Timothy; Namias, Nicholas; Kett, Daniel H; Doi, Yohei; Munoz-Price, L Silvia

    2016-07-01

    OBJECTIVE To concomitantly determine the differential degrees of air and environmental contamination by Acinetobacter baumannii based on anatomic source of colonization and type of ICU layout (single-occupancy vs open layout). DESIGN Longitudinal prospective surveillance study of air and environmental surfaces in patient rooms. SETTING A 1,500-bed public teaching hospital in Miami, Florida. PATIENTS Consecutive A. baumannii-colonized patients admitted to our ICUs between October 2013 and February 2014. METHODS Air and environmental surfaces of the rooms of A. baumannii-colonized patients were sampled daily for up to 10 days. Pulsed-field gel electrophoresis (PFGE) was used to type and match the matching air, environmental, and clinical A. baumannii isolates. RESULTS A total of 25 A. baumannii-colonized patients were identified during the study period; 17 were colonized in the respiratory tract and 8 were colonized in the rectum. In rooms with rectally colonized patients, 38.3% of air samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 13.1% of air samples were positive (P=.0001). In rooms with rectally colonized patients, 15.5% of environmental samples were positive for A. baumannii; in rooms of patients with respiratory colonization, 9.5% of environmental samples were positive (P=.02). The rates of air contamination in the open-layout and single-occupancy ICUs were 17.9% and 21.8%, respectively (P=.5). Environmental surfaces were positive in 9.5% of instances in open-layout ICUs versus 13.4% in single-occupancy ICUs (P=.09). CONCLUSIONS Air and environmental surface contaminations were significantly greater among rectally colonized patients; however, ICU layout did not influence the rate of contamination. Infect Control Hosp Epidemiol 2016;37:777-781.

  6. Impact of a Cross-Kingdom Signaling Molecule of Candida albicans on Acinetobacter baumannii Physiology

    PubMed Central

    Kostoulias, Xenia; Murray, Gerald L.; Cerqueira, Gustavo M.; Kong, Jason B.; Bantun, Farkad; Mylonakis, Eleftherios; Khoo, Chen Ai

    2015-01-01

    Multidrug-resistant (MDR) Acinetobacter baumannii is an opportunistic human pathogen that has become highly problematic in the clinical environment. Novel therapies are desperately required. To assist in identifying new therapeutic targets, the antagonistic interactions between A. baumannii and the most common human fungal pathogen, Candida albicans, were studied. We have observed that the C. albicans quorum-sensing molecule, farnesol, has cross-kingdom interactions, affecting the viability of A. baumannii. To gain an understanding of its mechanism, the transcriptional profile of A. baumannii exposed to farnesol was examined. Farnesol caused dysregulation of a large number of genes involved in cell membrane biogenesis, multidrug efflux pumps (AcrAB-like and AdeIJK-like), and A. baumannii virulence traits such as biofilm formation (csuA, csuB, and ompA) and motility (pilZ and pilH). We also observed a strong induction in genes involved in cell division (minD, minE, ftsK, ftsB, and ftsL). These transcriptional data were supported by functional assays showing that farnesol disrupts A. baumannii cell membrane integrity, alters cell morphology, and impairs virulence characteristics such as biofilm formation and twitching motility. Moreover, we showed that A. baumannii uses efflux pumps as a defense mechanism against this eukaryotic signaling molecule. Owing to its effects on membrane integrity, farnesol was tested to see if it potentiated the activity of the membrane-acting polymyxin antibiotic colistin. When coadministered, farnesol increased sensitivity to colistin for otherwise resistant strains. These data provide mechanistic understanding of the antagonistic interactions between diverse pathogens and may provide important insights into novel therapeutic strategies. PMID:26482299

  7. Identifying More Epidemic Clones during a Hospital Outbreak of Multidrug-Resistant Acinetobacter baumannii

    PubMed Central

    Domenech de Cellès, Matthieu; Salomon, Jérôme; Marinier, Anne; Lawrence, Christine; Gaillard, Jean-Louis; Herrmann, Jean-Louis; Guillemot, Didier

    2012-01-01

    Infections caused by multidrug-resistant bacteria are a major concern in hospitals. Current infection-control practices legitimately focus on hygiene and appropriate use of antibiotics. However, little is known about the intrinsic abilities of some bacterial strains to cause outbreaks. They can be measured at a population level by the pathogen’s transmission rate, i.e. the rate at which the pathogen is transmitted from colonized hosts to susceptible hosts, or its reproduction number, counting the number of secondary cases per infected/colonized host. We collected data covering a 20-month surveillance period for carriage of multidrug-resistant Acinetobacter baumannii (MDRAB) in a surgery ward. All isolates were subjected to molecular fingerprinting, and a cluster analysis of profiles was performed to identify clonal groups. We then applied stochastic transmission models to infer transmission rates of MDRAB and each MDRAB clone. Molecular fingerprinting indicated that 3 clonal complexes spread in the ward. A first model, not accounting for different clones, quantified the level of in-ward cross-transmission, with an estimated transmission rate of 0.03/day (95% credible interval [0.012–0.049]) and a single-admission reproduction number of 0.61 [0.30–1.02]. The second model, accounting for different clones, suggested an enhanced transmissibility of clone 3 (transmission rate 0.047/day [0.018–0.091], with a single-admission reproduction number of 0.81 [0.30–1.56]). Clones 1 and 2 had comparable transmission rates (respectively, 0.016 [0.001–0.045], 0.014 [0.001–0.045]). The method used is broadly applicable to other nosocomial pathogens, as long as surveillance data and genotyping information are available. Building on these results, more epidemic clones could be identified, and could lead to follow-up studies dissecting the functional basis for variation in transmissibility of MDRAB lineages. PMID:23029226

  8. A Fatal Case of Multidrug Resistant Acinetobacter Necrotizing Fasciitis: The Changing Scary Face of Nosocomial Infection

    PubMed Central

    Niazi, Masooma

    2014-01-01

    Necrotizing fasciitis is an uncommon soft-tissue infection, associated with high morbidity and mortality. Early recognition and treatment are crucial for survival. Acinetobacter baumannii is rarely associated with necrotizing fasciitis. Wound infections due to A. baumannii have been described in association with severe trauma in soldiers. There are only sporadic reports of monomicrobial A. baumannii necrotizing fasciitis. We report a unique case of monomicrobial necrotizing fasciitis caused by multidrug resistant (MDR) A. baumannii, in absence of any preceding trauma, surgery, or any obvious breech in the continuity of skin or mucosa. A 48-year-old woman with history of HIV, asthma, hypertension, and tobacco and excocaine use presented with acute respiratory failure requiring mechanical ventilation. She was treated for pneumonia for 7 days and was successfully extubated. All septic work-up was negative. Two days later, she developed rapidly spreading nonblanching edema with bleb formation at the lateral aspect of right thigh. Emergent extensive debridement and fasciotomy were performed. Operative findings and histopathology were consistent with necrotizing fasciitis. Despite extensive debridement, she succumbed to septic shock in the next few hours. Blood, wound, and tissue cultures grew A. baumannii, sensitive only to amikacin and polymyxin. Histopathology was consistent with necrotizing fasciitis. PMID:25349748

  9. A fatal case of multidrug resistant acinetobacter necrotizing fasciitis: the changing scary face of nosocomial infection.

    PubMed

    Sinha, Nupur; Niazi, Masooma; Lvovsky, Dmitry

    2014-01-01

    Necrotizing fasciitis is an uncommon soft-tissue infection, associated with high morbidity and mortality. Early recognition and treatment are crucial for survival. Acinetobacter baumannii is rarely associated with necrotizing fasciitis. Wound infections due to A. baumannii have been described in association with severe trauma in soldiers. There are only sporadic reports of monomicrobial A. baumannii necrotizing fasciitis. We report a unique case of monomicrobial necrotizing fasciitis caused by multidrug resistant (MDR) A. baumannii, in absence of any preceding trauma, surgery, or any obvious breech in the continuity of skin or mucosa. A 48-year-old woman with history of HIV, asthma, hypertension, and tobacco and excocaine use presented with acute respiratory failure requiring mechanical ventilation. She was treated for pneumonia for 7 days and was successfully extubated. All septic work-up was negative. Two days later, she developed rapidly spreading nonblanching edema with bleb formation at the lateral aspect of right thigh. Emergent extensive debridement and fasciotomy were performed. Operative findings and histopathology were consistent with necrotizing fasciitis. Despite extensive debridement, she succumbed to septic shock in the next few hours. Blood, wound, and tissue cultures grew A. baumannii, sensitive only to amikacin and polymyxin. Histopathology was consistent with necrotizing fasciitis.

  10. Identification of Acinetobacter baumannii serum-associated antibiotic efflux pump inhibitors.

    PubMed

    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn; Dunman, Paul M

    2014-11-01

    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca(2+) channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  11. Identification of Acinetobacter baumannii Serum-Associated Antibiotic Efflux Pump Inhibitors

    PubMed Central

    Blanchard, Catlyn; Barnett, Pamela; Perlmutter, Jessamyn

    2014-01-01

    Adaptive antibiotic resistance is a newly described phenomenon by which Acinetobacter baumannii induces efflux pump activity in response to host-associated environmental cues that may, in part, account for antibiotic treatment failures against clinically defined susceptible strains. To that end, during adaptation to growth in human serum, the organism induces approximately 22 putative efflux-associated genes and displays efflux-mediated minocycline tolerance at antibiotic concentrations corresponding to patient serum levels. Here, we show that in addition to minocycline, growth in human serum elicits A. baumannii efflux-mediated tolerance to the antibiotics ciprofloxacin, meropenem, tetracycline, and tigecycline. Moreover, using a whole-cell high-throughput screen and secondary assays, we identified novel serum-associated antibiotic efflux inhibitors that potentiated the activities of antibiotics toward serum-grown A. baumannii. Two compounds, Acinetobacter baumannii efflux pump inhibitor 1 (ABEPI1) [(E)-4-((4-chlorobenzylidene)amino)benezenesulfonamide] and ABEPI2 [N-tert-butyl-2-(1-tert-butyltetrazol-5-yl)sulfanylacetamide], were shown to lead to minocycline accumulation within A. baumannii during serum growth and inhibit the efflux potential of the organism. While both compounds also inhibited the antibiotic efflux properties of the bacterial pathogen Pseudomonas aeruginosa, they did not display significant cytotoxicity toward human cells or mammalian Ca2+ channel inhibitory effects, suggesting that ABEPI1 and ABEPI2 represent promising structural scaffolds for the development of new classes of bacterial antibiotic efflux pump inhibitors that can be used to potentiate the activities of current and future antibiotics for the therapeutic intervention of Gram-negative bacterial infections. PMID:25114126

  12. Characterization and Testing the Efficiency of Acinetobacter baumannii Phage vB-GEC_Ab-M-G7 as an Antibacterial Agent

    PubMed Central

    Kusradze, Ia; Karumidze, Natia; Rigvava, Sophio; Dvalidze, Teona; Katsitadze, Malkhaz; Amiranashvili, Irakli; Goderdzishvili, Marina

    2016-01-01

    Acinetobacter baumannii is a gram-negative, non-motile bacterium that, due to its multidrug resistance, has become a major nosocomial pathogen. The increasing number of multidrug resistant (MDR) strains has renewed interest in phage therapy. The aim of our study was to assess the effectiveness of phage administration in Acinetobacter baumannii wound infections in an animal model to demonstrate phage therapy as non-toxic, safe and alternative antibacterial remedy. Using classical methods for the study of bacteriophage properties, we characterized phage vB-GEC_Ab-M-G7 as a dsDNA myovirus with a 90 kb genome size. Important characteristics of vB-GEC_Ab-M-G7include a short latent period and large burst size, wide host range, resistance to chloroform and thermal and pH stability. In a rat wound model, phage application effectively decreased the number of bacteria isolated from the wounds of successfully treated animals. This study highlights the effectiveness of the phage therapy and provides further insight into treating infections caused by MDR strains using phage administration. PMID:27757110

  13. Contribution of Resistance-Nodulation-Cell Division Efflux Systems to Antibiotic Resistance and Biofilm Formation in Acinetobacter baumannii

    PubMed Central

    Yoon, Eun-Jeong; Nait Chabane, Yassine; Goussard, Sylvie; Snesrud, Erik; Courvalin, Patrice; Dé, Emmanuelle

    2015-01-01

    ABSTRACT Acinetobacter baumannii is a nosocomial pathogen of increasing importance due to its multiple resistance to antibiotics and ability to survive in the hospital environment linked to its capacity to form biofilms. To fully characterize the contribution of AdeABC, AdeFGH, and AdeIJK resistance-nodulation-cell division (RND)-type efflux systems to acquired and intrinsic resistance, we constructed, from an entirely sequenced susceptible A. baumannii strain, a set of isogenic mutants overexpressing each system following introduction of a point mutation in their cognate regulator or a deletion for the pump by allelic replacement. Pairwise comparison of every derivative with the parental strain indicated that AdeABC and AdeFGH are tightly regulated and contribute to acquisition of antibiotic resistance when overproduced. AdeABC had a broad substrate range, including β-lactams, fluoroquinolones, tetracyclines-tigecycline, macrolides-lincosamides, and chloramphenicol, and conferred clinical resistance to aminoglycosides. Importantly, when combined with enzymatic resistance to carbapenems and aminoglycosides, this pump contributed in a synergistic fashion to the level of resistance of the host. In contrast, AdeIJK was expressed constitutively and was responsible for intrinsic resistance to the same major drug classes as AdeABC as well as antifolates and fusidic acid. Surprisingly, overproduction of AdeABC and AdeIJK altered bacterial membrane composition, resulting in decreased biofilm formation but not motility. Natural transformation and plasmid transfer were diminished in recipients overproducing AdeABC. It thus appears that alteration in the expression of efflux systems leads to multiple changes in the relationship between the host and its environment, in addition to antibiotic resistance. PMID:25805730

  14. Presence of OXA-23-producing isolates of Acinetobacter baumannii in wastewater from hospitals in southern Brazil.

    PubMed

    Ferreira, Alessandra E; Marchetti, Desirée P; De Oliveira, Lyvia M; Gusatti, Carolina S; Fuentefria, Daiane B; Corção, Gertrudes

    2011-06-01

    The aim of the study was to evaluate the dissemination of multiresistant isolates of Acinetobacter baumannii carrying resistance genes, by samples of wastewater from hospitals in Porto Alegre, Rio Grande do Sul, Brazil. We obtained 303 bacterial isolates from the wastewater of three hospitals in Porto Alegre, Rio Grande do Sul. For each isolate, we determined the profile of susceptibility to antimicrobials and the presence of the genes bla(OXA-23), bla(OXA-24), bla(OXA-51), bla(OXA-58), bla(SPM-1), bla(IMP), and bla(VIM.) The bla(OXA-51) gene was found in 56% of the isolates, indicating the presence of A. baumannii in this environment. Of these, three multiresistant isolates were positive for the bla(OXA-23) gene, in wastewater from two of the hospitals. The results obtained in this study indicate that isolates of A. baumannii which are multiresistant and carry resistance genes such as bla(OXA-51) and bla(OXA-23) are being released into the environment in the wastewater from the hospitals analyzed. Multiresistant Acinetobacter junii, the newly emerging pathogen, were also found among the multiresistant isolates. Hospital wastewater may be crucial to the development and dispersal of multiresistant bacteria, making waterbodies reservoirs of bacterial resistance.

  15. Characterisation of Pellicles Formed by Acinetobacter baumannii at the Air-Liquid Interface

    PubMed Central

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B.; Jouenne, Thierry; Dé, Emmanuelle

    2014-01-01

    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster’s Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen. PMID:25360550

  16. Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii.

    PubMed

    Zhang, J; Liu, X; Li, X-J

    2015-01-16

    The phages of Acinetobacter baumannii has drawn increasing attention because of the multi-drug resistance of A. baumanni. The aim of this study was to sequence Acinetobacter baumannii phage AB3 and conduct bioinformatic analysis to lay a foundation for genome remodeling and phage therapy. We isolated and sequenced A. baumannii phage AB3 and attempted to annotate and analyze its genome. The results showed that the genome is a double-stranded DNA with a total length of 31,185 base pairs (bp) and 97 open reading frames greater than 100 bp. The genome includes 28 predicted genes, of which 24 are homologous to phage AB1. The entire coding sequence is located on the negative strand, representing 90.8% of the total length. The G+C mol% was 39.18%, without areas of high G+C content over 200 bp in length. No GC island, tRNA gene, or repeated sequence was identified. Gene lengths were 120-3099 bp, with an average of 1011 bp. Six genes were found to be greater than 2000 bp in length. Genomic alignment and phylogenetic analysis of the RNA polymerase gene showed that similar to phage AB1, phage AB3 is a phiKMV-like virus in the T7 phage family.

  17. Characterisation of pellicles formed by Acinetobacter baumannii at the air-liquid interface.

    PubMed

    Nait Chabane, Yassine; Marti, Sara; Rihouey, Christophe; Alexandre, Stéphane; Hardouin, Julie; Lesouhaitier, Olivier; Vila, Jordi; Kaplan, Jeffrey B; Jouenne, Thierry; Dé, Emmanuelle

    2014-01-01

    The clinical importance of Acinetobacter baumannii is partly due to its natural ability to survive in the hospital environment. This persistence may be explained by its capacity to form biofilms and, interestingly, A. baumannii can form pellicles at the air-liquid interface more readily than other less pathogenic Acinetobacter species. Pellicles from twenty-six strains were morphologically classified into three groups: I) egg-shaped (27%); II) ball-shaped (50%); and III) irregular pellicles (23%). One strain representative of each group was further analysed by Brewster's Angle Microscopy to follow pellicle development, demonstrating that their formation did not require anchoring to a solid surface. Total carbohydrate analysis of the matrix showed three main components: Glucose, GlcNAc and Kdo. Dispersin B, an enzyme that hydrolyzes poly-N-acetylglucosamine (PNAG) polysaccharide, inhibited A. baumannii pellicle formation, suggesting that this exopolysaccharide contributes to pellicle formation. Also associated with the pellicle matrix were three subunits of pili assembled by chaperon-usher systems: the major CsuA/B, A1S_1510 (presented 45% of identity with the main pilin F17-A from enterotoxigenic Escherichia coli pili) and A1S_2091. The presence of both PNAG polysaccharide and pili systems in matrix of pellicles might contribute to the virulence of this emerging pathogen.

  18. The opportunistic human pathogen Acinetobacter baumannii senses and responds to light.

    PubMed

    Mussi, María A; Gaddy, Jennifer A; Cabruja, Matías; Arivett, Brock A; Viale, Alejandro M; Rasia, Rodolfo; Actis, Luis A

    2010-12-01

    Light is a ubiquitous environmental signal that many organisms sense and respond to by modulating their physiological responses accordingly. While this is an expected response among phototrophic microorganisms, the ability of chemotrophic prokaryotes to sense and react to light has become a puzzling and novel issue in bacterial physiology, particularly among bacterial pathogens. In this work, we show that the opportunistic pathogen Acinetobacter baumannii senses and responds to blue light. Motility and formation of biofilms and pellicles were observed only when bacterial cells were incubated in darkness. In contrast, the killing of Candida albicans filaments was enhanced when they were cocultured with bacteria under light. These bacterial responses depend on the expression of the A. baumannii ATCC 17978 A1S_2225 gene, which codes for an 18.6-kDa protein that contains an N-terminal blue-light-sensing-using flavin (BLUF) domain and lacks a detectable output domain(s). Spectral analyses of the purified recombinant protein showed its ability to sense light by a red shift upon illumination. Therefore, the A1S_2225 gene, which is present in several members of the Acinetobacter genus, was named blue-light-sensing A (blsA). Interestingly, temperature plays a role in the ability of A. baumannii to sense and respond to light via the BlsA photoreceptor protein.

  19. [Toxigenic effect of Acinetobacter baumannii isolated from children with acute diarrhoea].

    PubMed

    Polanco, Nina; Manzi, Lorna

    2008-03-01

    Diarrheal diseases with diarrhea are the most frequent cause of morbidity and mortality in children; however the causative agent cannot be identified always, which suggests the presence of unknown enteropathogens inducing diarrhea. The isolation of Acinetobacter sp. from feces of children with acute diarrhea, unrelated to known enteropathogens motivated this investigation to detect a possible enterotoxigenic effect on HT-29 cells. The study population comprised 150 children with an age range from 0 to 5 years old; 120 were assisted in the "Hospital Materno Infantil del Este'' with gastrointestinal syndrome and 30 healthy controls who went to the center for routine analysis. In 25% of symptomatic patients were diagnosed parasites and bacteria, identified routinely. From four symptomatic patients were isolated three Acinetobacter baumannii strains and two A. calcoaceticus strains. The strains were cultured in brain-heart infusion for 24 and 48 hrs, at 35 degrees C, and the supernatants were obtained by centrifugation and filtration and their activity tested on HT-29 cell monolayers. The supernatants of the three strains of A. baumannii induced alterations of the cell monolayer, showed by detachments of cell monolayers, cell segregation, cell rounding and swelling. These effects were more intense with the 48 h culture exoproducts of the 016 strain, which were higher than the positive control. This toxigenic effect of A. baumannii, could represent a pathogenic mechanism whose definition requires more studies to determine the possible role in the pathogenicity of this bacillus.

  20. Susceptibility Pattern and Distribution of Oxacillinases and blaPER-1 Genes among Multidrug Resistant Acinetobacter baumannii in a Teaching Hospital in Iran

    PubMed Central

    Bagheri Josheghani, Sareh; Moniri, Rezvan; Firoozeh, Farzaneh; Sehat, Mojtaba; Dasteh Goli, Yasaman

    2015-01-01

    Acinetobacter baumannii (A. baumannii) is an important nosocomial pathogen in healthcare institutions. β-Lactamase-mediated resistance is the most common mechanism for carbapenem resistance in A. baumannii. The aim of this study was to determine the antibiotic resistance pattern, to detect OXA encoding genes, class A, blaPER-1, and to detect the presence of ISAba1. A total of 124 A. baumannii isolates were collected from hospitalized patients in a teaching hospital in Kashan, Iran. The susceptibility of isolates to different antibiotics was determined by disk-diffusion method. PCR was used to detect blaPER-1, blaOXA-23, blaOXA-24, blaOXA-51, blaOXA-58, and ISAba1 genes. All isolates were resistant to ceftazidime, ceftriaxone, and cefotaxime. All of the isolates revealed susceptibility to polymyxin B and colistin. Ninety-six percent of the isolates were extensive drug resistance (XDR), 5.6% extended spectrum beta-lactamase (ESBL), and 54.8% metallo-beta-lactamase (MBL). All isolates were positive for blaOXA-51 and ISAba1. blaOXA-23,  blaOXA-24, and blaOXA-58 were found in 79.8%, 25%, and 3.2%, respectively. The frequency rate of blaPER-1 gene was 52.4%. Multidrug resistant A. baumannii isolates are increasing in our setting and extensively limit therapeutic options. The high rate presence of class D carbapenemase-encoding genes, mainly blaOXA-23 carbapenemases, is worrying and alarming as an emerging threat in our hospital. PMID:26881082

  1. Analyzing pmrA and pmrB genes in Acinetobacter baumannii resistant to colistin in Shahid Rajai Shiraz, Iran Hospital by PCR: First report in Iran.

    PubMed

    Sepahvand, Shahriar; Doudi, Monir; Davarpanah, Mohammad Ali; Bahador, Abbas; Ahmadi, Mehranoosh

    2016-07-01

    Acinetobacter baumanni is known as a worldwide emerging nosocomial infections and it is classified as one of the six dangerous microorganisms by Diseases Society of America. Multi drug-resistant strains of A. baumannii have been reported in recent decades, which may be a result of the high use of antimicrobial agents. Colistin is the last form of treatment against this organism. The presence of pmrA and pmrB genes in A. baumannii causes the resistance of this organism against Colistin. This cross-sectional study was performed on 100 samples of A. baumannii isolated from ulcer, urinary, respiratory, blood of patients admitted to the intensive care unit of Shahid Rajai Shiraz hospital within a 12-month period. The diagnosis was performed by microscopic and biochemical testing using microgen kits. Determining Colistin resistance was carried out by Diffusion Disc, Colistin antibiotic disc of MAST- England and E-test. The analysis of genes pmrA and pmrB genes was done by PCR. 100 A. baumannii samples were diagnosed out of which using diffusion disk 94 cases were sensitive to Colistin and 6 cases were resistant to it. The E-test results in resistant samples presented an MIC equal to 64 micrograms per milliliter. The PCR results in sensitive and resistant to Colistin samples presented the existence of pmrA and pmrB genes. The results indicated the presence of pmrA and pmrB genes that are the main reason of A. baumannii resistance against the last line of treatment of this organism to Colistin.

  2. Clinical and antimicrobial profile of Acinetobacter spp.: An emerging nosocomial superbug

    PubMed Central

    Tripathi, Purti C.; Gajbhiye, Sunita R.; Agrawal, Gopal Nandlal

    2014-01-01

    Background: Recently, Acinetobacter has emerged as significant hospital pathogen, notoriously known to acquire antibiotic resistance to most of the commonly prescribed antimicrobials. Many risk factors are associated with Acinetobacter infections, especially in patients in intensive care unit (ICU). This study aims to isolate Acinetobacter from various clinical specimens and to determine its antimicrobial sensitivity pattern. Materials and Methods: Identification, speciation and antimicrobial sensitivity testing were performed using the standard microbiological techniques. Slime production was also tested by microtiter plate and tube method. Results: From the processed clinical specimens, 107 Acinetobacter strains (1.02%) were isolated of which 76 (0.74%) isolates were from general wards and 31 (11.96%) were from ICU. Significantly higher percentage of Acinetobacter strains was found in ICU compared with general wards (P < 0.05). Most common Acinetobacter infection was abscess. Infections were more common in males and were associated with major risk factors such as post-surgical, diabetes mellitus, catheterization, extended hospital stay and prolonged antibiotic usage. Acinetobacter baumanii was the most common species isolated to cause abscess, wound infection, etc. 62.61% and 28.97% isolates produced slime by microtiter plate and tube method. Imipenem was most sensitive drug followed by amikacin. Ceftazidime, cefotaxime, piperacillin were most resistant. 43.00% isolates were IPM resistant. A. baumanii was more resistant to commonly used antimicrobials. Conclusion: Acinetobacter nosocomial infections resistant to most antimicrobials have emerged, especially in ICU. Early identification and continued surveillance of prevalent organism will help prevent the spread of Acinetobacter in hospital environment. PMID:24600597

  3. Pitfalls associated with evaluating enzymatic quorum quenching activity: the case of MomL and its effect on Pseudomonas aeruginosa and Acinetobacter baumannii biofilms

    PubMed Central

    Zhang, Yunhui; Brackman, Gilles

    2017-01-01

    Background The enzymatic degradation of quorums sensing (QS) molecules (called quorum quenching, QQ) has been considered as a promising anti-virulence therapy to treat biofilm-related infections and combat antibiotic resistance. The recently-discovered QQ enzyme MomL has been reported to efficiently degrade different N-acyl homoserine lactones (AHLs) of various Gram-negative pathogens. Here we investigated the effect of MomL on biofilms formed by two important nosocomial pathogens, Pseudomonas aeruginosa and Acinetobacter baumannii. Methods MomL was expressed in E.coli BL21 and purified. The activity of MomL on AHLs with hydroxyl substituent was tested. Biofilms of P. aeruginosa PAO1 and Acinetobacter strains were formed in 96-well microtiter plates. Biofilm formation was evaluated by crystal violet staining, plating and fluorescence microscopy. The effect of MomL on biofilm susceptibility to antibiotics was also tested. We further evaluated MomL in dual-species biofilms formed by P. aeruginosa and A. baumannii, and in biofilms formed in a wound model. The effect of MomL on virulence of A. baumannii was also tested in the Caenorhabditis elegans model. Results MomL reduced biofilm formation and increased biofilm susceptibility to different antibiotics in biofilms of P. aeruginosa PAO1 and A. baumannii LMG 10531 formed in microtiter plates in vitro. However, no significant differences were detected in the dual-species biofilm and in wound model biofilms. In addition, MomL did not affect virulence of A. baumannii in the C. elegans model. Finally, the effect of MomL on biofilm of Acinetobacter strains seems to be strain-dependent. Discussion Our results indicate that although MomL showed a promising anti-biofilm effect against P. aeruginosa and A. baumanii biofilms formed in microtiter plates, the effect on biofilm formation under conditions more likely to mimic the real-life situation was much less pronounced or even absent. Our data indicate that in order to obtain a

  4. Pitfalls associated with evaluating enzymatic quorum quenching activity: the case of MomL and its effect on Pseudomonas aeruginosa and Acinetobacter baumannii biofilms.

    PubMed

    Zhang, Yunhui; Brackman, Gilles; Coenye, Tom

    2017-01-01

    The enzymatic degradation of quorums sensing (QS) molecules (called quorum quenching, QQ) has been considered as a promising anti-virulence therapy to treat biofilm-related infections and combat antibiotic resistance. The recently-discovered QQ enzyme MomL has been reported to efficiently degrade different N-acyl homoserine lactones (AHLs) of various Gram-negative pathogens. Here we investigated the effect of MomL on biofilms formed by two important nosocomial pathogens, Pseudomonas aeruginosa and Acinetobacter baumannii. MomL was expressed in E.coli BL21 and purified. The activity of MomL on AHLs with hydroxyl substituent was tested. Biofilms of P. aeruginosa PAO1 and Acinetobacter strains were formed in 96-well microtiter plates. Biofilm formation was evaluated by crystal violet staining, plating and fluorescence microscopy. The effect of MomL on biofilm susceptibility to antibiotics was also tested. We further evaluated MomL in dual-species biofilms formed by P. aeruginosa and A. baumannii, and in biofilms formed in a wound model. The effect of MomL on virulence of A. baumannii was also tested in the Caenorhabditis elegans model. MomL reduced biofilm formation and increased biofilm susceptibility to different antibiotics in biofilms of P. aeruginosa PAO1 and A. baumannii LMG 10531 formed in microtiter plates in vitro. However, no significant differences were detected in the dual-species biofilm and in wound model biofilms. In addition, MomL did not affect virulence of A. baumannii in the C. elegans model. Finally, the effect of MomL on biofilm of Acinetobacter strains seems to be strain-dependent. Our results indicate that although MomL showed a promising anti-biofilm effect against P. aeruginosa and A. baumanii biofilms formed in microtiter plates, the effect on biofilm formation under conditions more likely to mimic the real-life situation was much less pronounced or even absent. Our data indicate that in order to obtain a better picture of potential

  5. The crystal structure of the D-alanine-D-alanine ligase from Acinetobacter baumannii suggests a flexible conformational change in the central domain before nucleotide binding.

    PubMed

    Huynh, Kim-Hung; Hong, Myoung-ki; Lee, Clarice; Tran, Huyen-Thi; Lee, Sang Hee; Ahn, Yeh-Jin; Cha, Sun-Shin; Kang, Lin-Woo

    2015-11-01

    Acinetobacter baumannii, which is emerging as a multidrug-resistant nosocomial pathogen, causes a number of diseases, including pneumonia, bacteremia, meningitis, and skin infections. With ATP hydrolysis, the D-alanine-D-alanine ligase (DDL) catalyzes the synthesis of D-alanyl-D-alanine, which is an essential component of bacterial peptidoglycan. In this study, we determined the crystal structure of DDL from A. baumannii (AbDDL) at a resolution of 2.2 Å. The asymmetric unit contained six protomers of AbDDL. Five protomers had a closed conformation in the central domain, while one protomer had an open conformation in the central domain. The central domain with an open conformation did not interact with crystallographic symmetry-related protomers and the conformational change of the central domain was not due to crystal packing. The central domain of AbDDL can have an ensemble of the open and closed conformations before the binding of substrate ATP. The conformational change of the central domain is important for the catalytic activity and the detail information will be useful for the development of inhibitors against AbDDL and putative antibacterial agents against A. baumannii. The AbDDL structure was compared with that of other DDLs that were in complex with potent inhibitors and the catalytic activity of AbDDL was confirmed using enzyme kinetics assays.

  6. Phenotypic characterization of Acinetobacter baumannii isolates from intensive care units at a tertiary-care hospital in Egypt.

    PubMed

    Nageeb, W; Kamel, M; Zakaria, S; Metwally, L

    2014-04-03

    Multi-drug resistant (MDR) strains of Acinetobacter baumannii are responsible for an increasing number of opportunistic infections in hospitals. This study determined the prevalence of MDR A. baumannii isolates from intensive care units in a large tertiary-care hospital in Ismailia, Egypt, and the occurrence of different beta-lactamases in these isolates. Biotyping and antimicrobial susceptibility profile was done for isolated strains. Respiratory, urine, burn wound and blood specimens were collected from 350 patients admitted to different units; 10 strains (2.9%) of A. baumannii were isolated. All isolates showed resistance to more than 3 classes of antibiotics. Among the isolates, 6 isolates were carbapenemase producers, 2 were AmpC beta-lactamase producers and no isolates were metallo-beta-lactamase producers. Despite the low prevalence of A. baumannii infection in this hospital, the antibiotic resistance profile suggests that prevention of health-care-associated transmission of MDR Acinetobacter spp. infection is essential.

  7. Molecular epidemiology and spatiotemporal analysis of hospital-acquired Acinetobacter baumannii infection in a tertiary care hospital in southern Thailand.

    PubMed

    Chusri, S; Chongsuvivatwong, V; Rivera, J I; Silpapojakul, K; Singkhamanan, K; McNeil, E; Doi, Y

    2017-01-01

    Acinetobacter baumannii is a major hospital-acquired pathogen in Thailand that has a negative effect on patient survival. The nature of its transmission is poorly understood. To investigate the genotypic and spatiotemporal pattern of A. baumannii infection at a hospital in Thailand. The medical records of patients infected with A. baumannii at an 800-bed tertiary care hospital in southern Thailand between January 2010 and December 2011 were reviewed retrospectively. A. baumannii was identified at the genomospecies level. Carbapenemase genes were identified among carbapenem-resistant isolates associated with A. baumannii infection. A spatiotemporal analysis was performed by admission ward, time of infection and pulsed-field gel electrophoresis (PFGE) groups of A. baumannii. Nine PFGE groups were identified among the 197 A. baumannii infections. All A. baumannii isolates were assigned to International Clonal Lineage II. blaOXA-23 was the most prevalent carbapenemase gene. Outbreaks were observed mainly in respiratory and intensive care units. The association between PFGE group and hospital unit was significant. Spatiotemporal analysis identified 20 clusters of single PFGE group infections. Approximately half of the clusters involved multiple hospital units simultaneously. A. baumannii transmitted both within and between hospital wards. Better understanding and control of the transmission of A. baumannii are needed. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  8. Bed rails and endotracheal tube connectors as possible sources for spreading Acinetobacter baumannii in ventilator-associated pneumonia patients.

    PubMed

    Chaladchalam, Suphawita; Diraphat, Pornphan; Utrarachkij, Fuangfa; Suthienkul, Orasa; Samakoses, Rudiwilai; Siripanichgon, Kanokrat

    2008-07-01

    This study aimed to determine molecular patterns of Acinetobacter baumannii using a PCR-based technique with REP-1, REP-2 and M13 primers to distinguish the patients' strains and the environmental strains (condensate, endotracheal tube connector, bed rail and nurses hands). There were 67 cases of ventilator-associated pneumonia (VAP) among 600 patients using mechanical ventilators in 10 wards from March to July 2006. The incidence of VAP was 11.2% or 8.9/1,000 ventilator days with a 54.5% fatality rate. Among 19 of 22 A. baumannii VAP patients, 68.4% (13/19) had their environmental samples contaminated with A. baumannii and the most common contaminated sites were bed rails and endotracheal tube connectors (36.8% each). Multidrug resistant (MDR) A. baumannii were involved in 77.3% of A. baumannii VAP. Molecular typing of 96 A. baumannii isolates was able to differentiate A. baumannii isolates into 7 types. Type 2 was the most common and found in 77.3% (17/22) of A. baumannii VAP patients admitted in 6 of 7 wards. Identical fingerprints were found in clinical isolates and their bed rails, endotracheal tube connectors and condensates of 5 patients. The results demonstrate that multiple clones of MDR A. baumannii were widely spread in the hospital. Bed rails and contaminated endotracheal tube connectors could be potential sources of A. baumannii spread.

  9. Evaluation of the ability of Acinetobacter baumannii to form biofilms on six different biomedical relevant surfaces.

    PubMed

    Greene, C; Wu, J; Rickard, A H; Xi, C

    2016-10-01

    The human opportunistic pathogen, Acinetobacter baumannii, has the propensity to form biofilms and frequently cause medical device-related infections in hospitals. However, the physio-chemical properties of medical surfaces, in addition to bacterial surface properties, will affect colonization and biofilm development. The objective of this study was to compare the ability of A. baumannii to form biofilms on six different materials common to the hospital environment: glass, porcelain, stainless steel, rubber, polycarbonate plastic and polypropylene plastic. Biofilms were developed on material coupons in a CDC biofilm reactor. Biofilms were visualized and quantified using fluorescent staining and imaged using confocal laser scanning microscopy (CLSM) and by direct viable cell counts. Image analysis of CLSM stacks indicated that the mean biomass values for biofilms grown on glass, rubber, porcelain, polypropylene, stainless steel and polycarbonate were 0·04, 0·26, 0·62, 1·00, 2·08 and 2·70 μm(3) /μm(2) respectively. Polycarbonate developed statistically more biofilm mass than glass, rubber, porcelain and polypropylene. Viable cell counts data were in agreement with the CLSM-derived data. In conclusion, polycarbonate was the most accommodating surface for A. baumannii ATCC 17978 to form biofilms while glass was least favourable. Alternatives to polycarbonate for use in medical and dental devices may need to be considered. In the hospital environment, Acinetobacter baumannii is one of the most persistent and difficult to control opportunistic pathogens. The persistence of A. baumannii is due, in part, to its ability to colonize surfaces and form biofilms. This study demonstrates that A. baumannii can form biofilms on a variety of different surfaces and develops substantial biofilms on polycarbonate - a thermoplastic material that is often used in the construction of medical devices. The findings highlight the need to further study the in

  10. Effect of carbapenem consumption patterns on the molecular epidemiology and carbapenem resistance of Acinetobacter baumannii.

    PubMed

    Mózes, Julianna; Ebrahimi, Fatemeh; Gorácz, Orsolya; Miszti, Cecília; Kardos, Gábor

    2014-12-01

    This study investigated the molecular epidemiology of Acinetobacter baumannii in the University of Debrecen in relation to antibiotic consumption. Overall and ward-specific antibiotic consumption was measured by the number of defined daily doses (DDD) per 100 bed-days between 2002 and 2012. Consumption was analysed against the number of A. baumannii positive patients per 100 bed-days, number of isolates per positive sample, and proportion of carbapenem resistant A. baumannii, using time-series analysis. Altogether 160 A. baumannii isolates from different wards were collected and analysed. Carbapenemase genes bla(OXA-23-like), bla(OXA-24-like), bla(OXA-48-like), bla(OXA-51-like), bla(OXA-58-like) and integrons were sought by PCR. Relatedness of isolates was assessed by PFGE. Prevalence and carbapenem resistance of A. baumannii were statistically associated with carbapenem consumption. Prevalence data followed carbapenem usage with three quarterly lags (r = 0.51-0.53, P<0.001), and meropenem and ertapenem, but not imipenem usage, affected prevalence. Colistin usage, in turn, lagged behind prevalence with one lag (r = 0.68-0.70, P<0.001). Six clusters were identified; the neurology ward with the lowest carbapenem consumption was associated with the carbapenem-susceptible cluster, as well as with the carbapenem-susceptible isolates in the cluster with variable susceptibility. Wards with high carbapenem usage almost exclusively harboured isolates from carbapenem-resistant clusters. All clusters were dominated by isolates of one or two wards, but most wards were represented in multiple clusters. Increases in prevalence and carbapenem resistance of A. baumannii were associated with usage of meropenem and ertapenem but not of imipenem, which led to the spread of multiple clones in the University.

  11. Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii

    PubMed Central

    Fiester, Steven E.; Schmidt, Robert E.; Beckett, Amber C.; Ticak, Tomislav; Carrier, Mary V.; Ghosh, Rajarshi; Ohneck, Emily J.; Metz, Maeva L.; Sellin Jeffries, Marlo K.; Actis, Luis A.

    2016-01-01

    Acinetobacter baumannii is an opportunistic Gram-negative pathogen that causes a wide range of infections including pneumonia, septicemia, necrotizing fasciitis and severe wound and urinary tract infections. Analysis of A. baumannii representative strains grown in Chelex 100-treated medium for hemolytic activity demonstrated that this pathogen is increasingly hemolytic to sheep, human and horse erythrocytes, which interestingly contain increasing amounts of phosphatidylcholine in their membranes. Bioinformatic, genetic and functional analyses of 19 A. baumannii isolates showed that the genomes of each strain contained two phosphatidylcholine-specific phospholipase C (PC-PLC) genes, which were named plc1 and plc2. Accordingly, all of these strains were significantly hemolytic to horse erythrocytes and their culture supernatants tested positive for PC-PLC activity. Further analyses showed that the transcriptional expression of plc1 and plc2 and the production of phospholipase and thus hemolytic activity increased when bacteria were cultured under iron-chelation as compared to iron-rich conditions. Testing of the A. baumannii ATCC 19606T plc1::aph-FRT and plc2::aph isogenic insertion derivatives showed that these mutants had a significantly reduced PC-PLC activity as compared to the parental strain, while testing of plc1::ermAM/plc2::aph demonstrated that this double PC-PLC isogenic mutant expressed significantly reduced cytolytic and hemolytic activity. Interestingly, only plc1 was shown to contribute significantly to A. baumannii virulence using the Galleria mellonella infection model. Taken together, our data demonstrate that both PLC1 and PLC2, which have diverged from a common ancestor, play a concerted role in hemolytic and cytolytic activities; although PLC1 seems to play a more critical role in the virulence of A. baumannii when tested in an invertebrate model. These activities would provide access to intracellular iron stores this pathogen could use during