Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

PubMed

Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

1995-12-01

Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

Predicting nuclear gene coalescence from mitochondrial data: the three-times rule.

PubMed

Palumbi, S R; Cipriano, F; Hare, M P

2001-05-01

Coalescence theory predicts when genetic drift at nuclear loci will result in fixation of sequence differences to produce monophyletic gene trees. However, the theory is difficult to apply to particular taxa because it hinges on genetically effective population size, which is generally unknown. Neutral theory also predicts that evolution of monophyly will be four times slower in nuclear than in mitochondrial genes primarily because genetic drift is slower at nuclear loci. Variation in mitochondrial DNA (mtDNA) within and between species has been studied extensively, but can these mtDNA data be used to predict coalescence in nuclear loci? Comparison of neutral theories of coalescence of mitochondrial and nuclear loci suggests a simple rule of thumb. The "three-times rule" states that, on average, most nuclear loci will be monophyletic when the branch length leading to the mtDNA sequences of a species is three times longer than the average mtDNA sequence diversity observed within that species. A test using mitochondrial and nuclear intron data from seven species of whales and dolphins suggests general agreement with predictions of the three-times rule. We define the coalescence ratio as the mitochondrial branch length for a species divided by intraspecific mtDNA diversity. We show that species with high coalescence ratios show nuclear monophyly, whereas species with low ratios have polyphyletic nuclear gene trees. As expected, species with intermediate coalescence ratios show a variety of patterns. Especially at very high or low coalescence ratios, the three-times rule predicts nuclear gene patterns that can help detect the action of selection. The three-times rule may be useful as an empirical benchmark for evaluating evolutionary processes occurring at multiple loci.

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

Treesearch

Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

2010-01-01

Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects.

PubMed

Zhang, De-Xing; Hewitt, Godfrey M

2003-03-01

Population-genetic studies have been remarkably productive and successful in the last decade following the invention of PCR technology and the introduction of mitochondrial and microsatellite DNA markers. While mitochondrial DNA has proven powerful for genealogical and evolutionary studies of animal populations, and microsatellite sequences are the most revealing DNA markers available so far for inferring population structure and dynamics, they both have important and unavoidable limitations. To obtain a fuller picture of the history and evolutionary potential of populations, genealogical data from nuclear loci are essential, and the inclusion of other nuclear markers, i.e. single copy nuclear polymorphic (scnp) sequences, is clearly needed. Four major uncertainties for nuclear DNA analyses of populations have been facing us, i.e. the availability of scnp markers for carrying out such analysis, technical laboratory hurdles for resolving haplotypes, difficulty in data analysis because of recombination, low divergence levels and intraspecific multifurcation evolution, and the utility of scnp markers for addressing population-genetic questions. In this review, we discuss the availability of highly polymorphic single copy DNA in the nuclear genome, describe patterns and rate of evolution of nuclear sequences, summarize past empirical and theoretical efforts to recover and analyse data from scnp markers, and examine the difficulties, challenges and opportunities faced in such studies. We show that although challenges still exist, the above-mentioned obstacles are now being removed. Recent advances in technology and increases in statistical power provide the prospect of nuclear DNA analyses becoming routine practice, allowing allele-discriminating characterization of scnp loci and microsatellite loci. This certainly will increase our ability to address more complex questions, and thereby the sophistication of genetic analyses of populations.

Biological Sexing of a 4000-Year-Old Egyptian Mummy Head to Assess the Potential of Nuclear DNA Recovery from the Most Damaged and Limited Forensic Specimens

PubMed Central

Loreille, Odile; Ratnayake, Shashikala; Stockwell, Timothy B.; Mallick, Swapan; Skoglund, Pontus; Onorato, Anthony J.; Bergman, Nicholas H.; Reich, David; Irwin, Jodi A.

2018-01-01

High throughput sequencing (HTS) has been used for a number of years in the field of paleogenomics to facilitate the recovery of small DNA fragments from ancient specimens. Recently, these techniques have also been applied in forensics, where they have been used for the recovery of mitochondrial DNA sequences from samples where traditional PCR-based assays fail because of the very short length of endogenous DNA molecules. Here, we describe the biological sexing of a ~4000-year-old Egyptian mummy using shotgun sequencing and two established methods of biological sex determination (RX and RY), by way of mitochondrial genome analysis as a means of sequence data authentication. This particular case of historical interest increases the potential utility of HTS techniques for forensic purposes by demonstrating that data from the more discriminatory nuclear genome can be recovered from the most damaged specimens, even in cases where mitochondrial DNA cannot be recovered with current PCR-based forensic technologies. Although additional work remains to be done before nuclear DNA recovered via these methods can be used routinely in operational casework for individual identification purposes, these results indicate substantial promise for the retrieval of probative individually identifying DNA data from the most limited and degraded forensic specimens. PMID:29494531

Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

USGS Publications Warehouse

Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

2003-01-01

The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

Diatom centromeres suggest a mechanism for nuclear DNA acquisition

DOE PAGES

Diner, Rachel E.; Noddings, Chari M.; Lian, Nathan C.; ...

2017-07-18

Centromeres are essential for cell division and growth in all eukaryotes, and knowledge of their sequence and structure guides the development of artificial chromosomes for functional cellular biology studies. Centromeric proteins are conserved among eukaryotes; however, centromeric DNA sequences are highly variable. We combined forward and reverse genetic approaches with chromatin immunoprecipitation to identify centromeres of the model diatom Phaeodactylum tricornutum. We observed 25 unique centromere sequences typically occurring once per chromosome, a finding that helps to resolve nuclear genome organization and indicates monocentric regional centromeres. Diatom centromere sequences contain low-GC content regions but lack repeats or other conserved sequencemore » features. Native and foreign sequences with similar GC content to P. tricornutum centromeres can maintain episomes and recruit the diatom centromeric histone protein CENH3, suggesting nonnative sequences can also function as diatom centromeres. Thus, simple sequence requirements may enable DNA from foreign sources to persist in the nucleus as extrachromosomal episomes, revealing a potential mechanism for organellar and foreign DNA acquisition.« less

Diatom centromeres suggest a mechanism for nuclear DNA acquisition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diner, Rachel E.; Noddings, Chari M.; Lian, Nathan C.

Centromeres are essential for cell division and growth in all eukaryotes, and knowledge of their sequence and structure guides the development of artificial chromosomes for functional cellular biology studies. Centromeric proteins are conserved among eukaryotes; however, centromeric DNA sequences are highly variable. We combined forward and reverse genetic approaches with chromatin immunoprecipitation to identify centromeres of the model diatom Phaeodactylum tricornutum. We observed 25 unique centromere sequences typically occurring once per chromosome, a finding that helps to resolve nuclear genome organization and indicates monocentric regional centromeres. Diatom centromere sequences contain low-GC content regions but lack repeats or other conserved sequencemore » features. Native and foreign sequences with similar GC content to P. tricornutum centromeres can maintain episomes and recruit the diatom centromeric histone protein CENH3, suggesting nonnative sequences can also function as diatom centromeres. Thus, simple sequence requirements may enable DNA from foreign sources to persist in the nucleus as extrachromosomal episomes, revealing a potential mechanism for organellar and foreign DNA acquisition.« less

Contrasting population structure from nuclear intron sequences and mtDNA of humpback whales.

PubMed

Palumbi, S R; Baker, C S

1994-05-01

Powerful analyses of population structure require information from multiple genetic loci. To help develop a molecular toolbox for obtaining this information, we have designed universal oligonucleotide primers that span conserved intron-exon junctions in a wide variety of animal phyla. We test the utility of exon-primed, intron-crossing amplifications by analyzing the variability of actin intron sequences from humpback, blue, and bowhead whales and comparing the results with mitochondrial DNA (mtDNA) haplotype data. Humpback actin introns fall into two major clades that exist in different frequencies in different oceanic populations. It is surprising that Hawaii and California populations, which are very distinct in mtDNAs, are similar in actin intron alleles. This discrepancy between mtDNA and nuclear DNA results may be due either to differences in genetic drift in mitochondrial and nuclear genes or to preferential movement of males, which do not transmit mtDNA to offspring, between separate breeding grounds. Opposing mtDNA and nuclear DNA results can help clarify otherwise hidden patterns of structure in natural populations.

Evolutionary relationships among Pinus (Pinaceae) subsections inferred from multiple low-copy nuclear loci.

Treesearch

John Syring; Ann Willyard; Richard Cronn; Aaron Liston

2005-01-01

Sequence data from nrITS and cpDNA have failed to fully resolve phylogenetic relationships among Pinus species. Four low-copy nuclear genes, developed from the screening of 73 mapped conifer anchor loci, were sequenced from 12 species representing all subsections. Individual loci do not uniformly support either the nrITS or cpDNA hypotheses and in...

Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris).

PubMed

Zhang, Wenping; Zhang, Zhihe; Shen, Fujun; Hou, Rong; Lv, Xiaoping; Yue, Bisong

2006-08-01

Using oligonucleotide primers designed to match hypervariable segments I (HVS-1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses indicated that the sequence of 287 bp was a D-loop-like nuclear mitochondrial sequence (Numts), indicating a nuclear transfer that occurred approximately 4.8-17 million years ago in the tiger and 4.6-16 million years ago in the leopard. Although the mtDNA D-loop sequence has a rapid rate of evolution, the 287-bp Numts are highly conserved; they are nearly identical in tiger subspecies and only 1.742% different between tiger and leopard. Thus, such sequences represent molecular 'fossils' that can shed light on evolution of the mitochondrial genome and may be the most appropriate outgroup for phylogenetic analysis. This is also proved by comparing the phylogenetic trees reconstructed using the D-loop sequence of snow leopard and the 287-bp Numts as outgroup.

Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

PubMed

El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

2013-07-01

Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

Complete mtDNA sequencing reveals mutations m.9185T>C and m.13513G>A in three patients with Leigh syndrome.

PubMed

Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna

2017-12-12

The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.

NMR studies on the structure and dynamics of lac operator DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.C.

Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less

Ultra-barcoding in cacao (Theobroma spp.; Malvaceae) using whole chloroplast genomes and nuclear ribosomal DNA.

PubMed

Kane, Nolan; Sveinsson, Saemundur; Dempewolf, Hannes; Yang, Ji Yong; Zhang, Dapeng; Engels, Johannes M M; Cronk, Quentin

2012-02-01

To reliably identify lineages below the species level such as subspecies or varieties, we propose an extension to DNA-barcoding using next-generation sequencing to produce whole organellar genomes and substantial nuclear ribosomal sequence. Because this method uses much longer versions of the traditional DNA-barcoding loci in the plastid and ribosomal DNA, we call our approach ultra-barcoding (UBC). We used high-throughput next-generation sequencing to scan the genome and generate reliable sequence of high copy number regions. Using this method, we examined whole plastid genomes as well as nearly 6000 bases of nuclear ribosomal DNA sequences for nine genotypes of Theobroma cacao and an individual of the related species T. grandiflorum, as well as an additional publicly available whole plastid genome of T. cacao. All individuals of T. cacao examined were uniquely distinguished, and evidence of reticulation and gene flow was observed. Sequence variation was observed in some of the canonical barcoding regions between species, but other regions of the chloroplast were more variable both within species and between species, as were ribosomal spacers. Furthermore, no single region provides the level of data available using the complete plastid genome and rDNA. Our data demonstrate that UBC is a viable, increasingly cost-effective approach for reliably distinguishing varieties and even individual genotypes of T. cacao. This approach shows great promise for applications where very closely related or interbreeding taxa must be distinguished.

Regional differences in mitochondrial DNA methylation in human post-mortem brain tissue.

PubMed

Devall, Matthew; Smith, Rebecca G; Jeffries, Aaron; Hannon, Eilis; Davies, Matthew N; Schalkwyk, Leonard; Mill, Jonathan; Weedon, Michael; Lunnon, Katie

2017-01-01

DNA methylation is an important epigenetic mechanism involved in gene regulation, with alterations in DNA methylation in the nuclear genome being linked to numerous complex diseases. Mitochondrial DNA methylation is a phenomenon that is receiving ever-increasing interest, particularly in diseases characterized by mitochondrial dysfunction; however, most studies have been limited to the investigation of specific target regions. Analyses spanning the entire mitochondrial genome have been limited, potentially due to the amount of input DNA required. Further, mitochondrial genetic studies have been previously confounded by nuclear-mitochondrial pseudogenes. Methylated DNA Immunoprecipitation Sequencing is a technique widely used to profile DNA methylation across the nuclear genome; however, reads mapped to mitochondrial DNA are often discarded. Here, we have developed an approach to control for nuclear-mitochondrial pseudogenes within Methylated DNA Immunoprecipitation Sequencing data. We highlight the utility of this approach in identifying differences in mitochondrial DNA methylation across regions of the human brain and pre-mortem blood. We were able to correlate mitochondrial DNA methylation patterns between the cortex, cerebellum and blood. We identified 74 nominally significant differentially methylated regions ( p  < 0.05) in the mitochondrial genome, between anatomically separate cortical regions and the cerebellum in matched samples ( N  = 3 matched donors). Further analysis identified eight significant differentially methylated regions between the total cortex and cerebellum after correcting for multiple testing. Using unsupervised hierarchical clustering analysis of the mitochondrial DNA methylome, we were able to identify tissue-specific patterns of mitochondrial DNA methylation between blood, cerebellum and cortex. Our study represents a comprehensive analysis of the mitochondrial methylome using pre-existing Methylated DNA Immunoprecipitation Sequencing data to identify brain region-specific patterns of mitochondrial DNA methylation.

A chromatin insulator determines the nuclear localization of DNA.

PubMed

Gerasimova, T I; Byrd, K; Corces, V G

2000-11-01

Chromatin insulators might regulate gene expression by controlling the subnuclear organization of DNA. We found that a DNA sequence normally located inside of the nucleus moved to the periphery when the gypsy insulator was placed within the sequence. The presence of the gypsy insulator also caused two sequences, normally found in different regions of the nucleus, to come together at a single location. Alterations in this subnuclear organization imposed by the gypsy insulator correlated with changes in gene expression that took place during the heat-shock response. These global changes in transcription were accompanied by dramatic alterations in the distribution of insulator proteins and DNA. The results suggest that the nuclear organization imposed by the gypsy insulator on the chromatin fiber is important for gene expression.

Hybridization and massive mtDNA unidirectional introgression between the closely related Neotropical toads Rhinella marina and R. schneideri inferred from mtDNA and nuclear markers

PubMed Central

2011-01-01

Background The classical perspective that interspecific hybridization in animals is rare has been changing due to a growing list of empirical examples showing the occurrence of gene flow between closely related species. Using sequence data from cyt b mitochondrial gene and three intron nuclear genes (RPL9, c-myc, and RPL3) we investigated patterns of nucleotide polymorphism and divergence between two closely related toad species R. marina and R. schneideri. By comparing levels of differentiation at nuclear and mtDNA levels we were able to describe patterns of introgression and infer the history of hybridization between these species. Results All nuclear loci are essentially concordant in revealing two well differentiated groups of haplotypes, corresponding to the morphologically-defined species R. marina and R. schneideri. Mitochondrial DNA analysis also revealed two well-differentiated groups of haplotypes but, in stark contrast with the nuclear genealogies, all R. schneideri sequences are clustered with sequences of R. marina from the right Amazon bank (RAB), while R. marina sequences from the left Amazon bank (LAB) are monophyletic. An Isolation-with-Migration (IM) analysis using nuclear data showed that R. marina and R. schneideri diverged at ≈ 1.69 Myr (early Pleistocene), while R. marina populations from LAB and RAB diverged at ≈ 0.33 Myr (middle Pleistocene). This time of divergence is not consistent with the split between LAB and RAB populations obtained with mtDNA data (≈ 1.59 Myr), which is notably similar to the estimate obtained with nuclear genes between R. marina and R. schneideri. Coalescent simulations of mtDNA phylogeny under the speciation history inferred from nuclear genes rejected the hypothesis of incomplete lineage sorting to explain the conflicting signal between mtDNA and nuclear-based phylogenies. Conclusions The cytonuclear discordance seems to reflect the occurrence of interspecific hybridization between these two closely related toad species. Overall, our results suggest a phenomenon of extensive mtDNA unidirectional introgression from the previously occurring R. schneideri into the invading R. marina. We hypothesize that climatic-induced range shifts during the Pleistocene/Holocene may have played an important role in the observed patterns of introgression. PMID:21939538

Genetic structure of Eurasian and North American Leymus (Triticeae) wildryes assessed by chloroplast DNA sequences and AFLP profiles

Treesearch

C. Mae Culumber; Steve R. Larson; Kevin B. Jensen; Thomas A. Jones

2011-01-01

Leymus is a genomically defined allopolyploid of genus Triticeae with two distinct subgenomes. Chloroplast DNA sequences of Eurasian and North American species are distinct and polyphyletic. However, phylogenies derived from chloroplast and nuclear DNA sequences are confounded by polyploidy and lack of polymorphism among many taxa. The AFLP technique can resolve...

Nuclear 28S rDNA phylogeny supports the basal placement of Noctiluca scintillans (Dinophyceae; Noctilucales) in dinoflagellates.

PubMed

Ki, Jang-Seu

2010-05-01

Noctiluca scintillans (Macartney) Kofoid et Swezy, 1921 is an unarmoured heterotrophic dinoflagellate with a global distribution, and has been considered as one of the ancestral taxa among dinoflagellates. Recently, 18S rDNA, actin, alpha-, beta-tubulin, and Hsp90-based phylogenies have shown the basal position of the noctilucids. However, the relationships of dinoflagellates in the basal lineages are still controversial. Although the nuclear rDNA (e.g. 18S, ITS-5.8S, and 28S) contains much genetic information, DNA sequences of N. scintillans rDNA molecules were insufficiently characterized as yet. Here the author sequenced a long-range nuclear rDNA, spanning from the 18S to the D5 region of the 28S rDNA, of N. scintillans. The present N. scintillans had a nearly identical genotype (>99.0% similarity) compared to other Noctiluca sequences from different geographic origins. Nucleotide divergence in the partial 28S rDNA was significantly high (p<0.05) as compared to the 18S rDNA, demonstrating that the information from 28S rDNA is more variable. The 28S rDNA phylogeny of 17 selected dinoflagellates, two perkinsids, and two apicomplexans as outgroups showed that N. scintillans and Oxyrrhis marina formed a clade that diverged separately from core dinoflagellates. Copyright (c) 2009 Elsevier GmbH. All rights reserved.

DNA capture and next-generation sequencing can recover whole mitochondrial genomes from highly degraded samples for human identification

PubMed Central

2013-01-01

Background Mitochondrial DNA (mtDNA) typing can be a useful aid for identifying people from compromised samples when nuclear DNA is too damaged, degraded or below detection thresholds for routine short tandem repeat (STR)-based analysis. Standard mtDNA typing, focused on PCR amplicon sequencing of the control region (HVS I and HVS II), is limited by the resolving power of this short sequence, which misses up to 70% of the variation present in the mtDNA genome. Methods We used in-solution hybridisation-based DNA capture (using DNA capture probes prepared from modern human mtDNA) to recover mtDNA from post-mortem human remains in which the majority of DNA is both highly fragmented (<100 base pairs in length) and chemically damaged. The method ‘immortalises’ the finite quantities of DNA in valuable extracts as DNA libraries, which is followed by the targeted enrichment of endogenous mtDNA sequences and characterisation by next-generation sequencing (NGS). Results We sequenced whole mitochondrial genomes for human identification from samples where standard nuclear STR typing produced only partial profiles or demonstrably failed and/or where standard mtDNA hypervariable region sequences lacked resolving power. Multiple rounds of enrichment can substantially improve coverage and sequencing depth of mtDNA genomes from highly degraded samples. The application of this method has led to the reliable mitochondrial sequencing of human skeletal remains from unidentified World War Two (WWII) casualties approximately 70 years old and from archaeological remains (up to 2,500 years old). Conclusions This approach has potential applications in forensic science, historical human identification cases, archived medical samples, kinship analysis and population studies. In particular the methodology can be applied to any case, involving human or non-human species, where whole mitochondrial genome sequences are required to provide the highest level of maternal lineage discrimination. Multiple rounds of in-solution hybridisation-based DNA capture can retrieve whole mitochondrial genome sequences from even the most challenging samples. PMID:24289217

A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

PubMed Central

Zock, C; Iselt, A; Doerfler, W

1993-01-01

Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

Molecular sled sequences are common in mammalian proteins.

PubMed

Xiong, Kan; Blainey, Paul C

2016-03-18

Recent work revealed a new class of molecular machines called molecular sleds, which are small basic molecules that bind and slide along DNA with the ability to carry cargo along DNA. Here, we performed biochemical and single-molecule flow stretching assays to investigate the basis of sliding activity in molecular sleds. In particular, we identified the functional core of pVIc, the first molecular sled characterized; peptide functional groups that control sliding activity; and propose a model for the sliding activity of molecular sleds. We also observed widespread DNA binding and sliding activity among basic polypeptide sequences that implicate mammalian nuclear localization sequences and many cell penetrating peptides as molecular sleds. These basic protein motifs exhibit weak but physiologically relevant sequence-nonspecific DNA affinity. Our findings indicate that many mammalian proteins contain molecular sled sequences and suggest the possibility that substantial undiscovered sliding activity exists among nuclear mammalian proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

PubMed

Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

2007-01-01

In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii.

The mitochondrial genome of Malus domestica and the import-driven hypothesis of mitochondrial genome expansion in seed plants.

PubMed

Goremykin, Vadim V; Lockhart, Peter J; Viola, Roberto; Velasco, Riccardo

2012-08-01

Mitochondrial genomes of spermatophytes are the largest of all organellar genomes. Their large size has been attributed to various factors; however, the relative contribution of these factors to mitochondrial DNA (mtDNA) expansion remains undetermined. We estimated their relative contribution in Malus domestica (apple). The mitochondrial genome of apple has a size of 396 947 bp and a one to nine ratio of coding to non-coding DNA, close to the corresponding average values for angiosperms. We determined that 71.5% of the apple mtDNA sequence was highly similar to sequences of its nuclear DNA. Using nuclear gene exons, nuclear transposable elements and chloroplast DNA as markers of promiscuous DNA content in mtDNA, we estimated that approximately 20% of the apple mtDNA consisted of DNA sequences imported from other cell compartments, mostly from the nucleus. Similar marker-based estimates of promiscuous DNA content in the mitochondrial genomes of other species ranged between 21.2 and 25.3% of the total mtDNA length for grape, between 23.1 and 38.6% for rice, and between 47.1 and 78.4% for maize. All these estimates are conservative, because they underestimate the import of non-functional DNA. We propose that the import of promiscuous DNA is a core mechanism for mtDNA size expansion in seed plants. In apple, maize and grape this mechanism contributed far more to genome expansion than did homologous recombination. In rice the estimated contribution of both mechanisms was found to be similar. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

A Highly Organized Structure Mediating Nuclear Localization of a Myb2 Transcription Factor in the Protozoan Parasite Trichomonas vaginalis ▿ †

PubMed Central

Chu, Chien-Hsin; Chang, Lung-Chun; Hsu, Hong-Ming; Wei, Shu-Yi; Liu, Hsing-Wei; Lee, Yu; Kuo, Chung-Chi; Indra, Dharmu; Chen, Chinpan; Ong, Shiou-Jeng; Tai, Jung-Hsiang

2011-01-01

Nuclear proteins usually contain specific peptide sequences, referred to as nuclear localization signals (NLSs), for nuclear import. These signals remain unexplored in the protozoan pathogen, Trichomonas vaginalis. The nuclear import of a Myb2 transcription factor was studied here using immunodetection of a hemagglutinin-tagged Myb2 overexpressed in the parasite. The tagged Myb2 was localized to the nucleus as punctate signals. With mutations of its polybasic sequences, 48KKQK51 and 61KR62, Myb2 was localized to the nucleus, but the signal was diffusive. When fused to a C-terminal non-nuclear protein, the Myb2 sequence spanning amino acid (aa) residues 48 to 143, which is embedded within the R2R3 DNA-binding domain (aa 40 to 156), was essential and sufficient for efficient nuclear import of a bacterial tetracycline repressor (TetR), and yet the transport efficiency was reduced with an additional fusion of a firefly luciferase to TetR, while classical NLSs from the simian virus 40 T-antigen had no function in this assay system. Myb2 nuclear import and DNA-binding activity were substantially perturbed with mutation of a conserved isoleucine (I74) in helix 2 to proline that altered secondary structure and ternary folding of the R2R3 domain. Disruption of DNA-binding activity alone by point mutation of a lysine residue, K51, preceding the structural domain had little effect on Myb2 nuclear localization, suggesting that nuclear translocation of Myb2, which requires an ordered structural domain, is independent of its DNA binding activity. These findings provide useful information for testing whether myriad Mybs in the parasite use a common module to regulate nuclear import. PMID:22021237

Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells.

PubMed

Ju, Young Seok; Tubio, Jose M C; Mifsud, William; Fu, Beiyuan; Davies, Helen R; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J; Tan, Benita K T; Aparicio, Samuel; Span, Paul N; Martens, John W M; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Myklebost, Ola; Flanagan, Adrienne M; Foster, Christopher; Neal, David E; Cooper, Colin; Eeles, Rosalind; Bova, Steven G; Lakhani, Sunil R; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L; Purdie, Colin A; Thompson, Alastair M; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J; Stratton, Michael R

2015-06-01

Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. © 2015 Ju et al.; Published by Cold Spring Harbor Laboratory Press.

Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells

PubMed Central

Ju, Young Seok; Tubio, Jose M.C.; Mifsud, William; Fu, Beiyuan; Davies, Helen R.; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S.; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R.; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J.; Tan, Benita K.T.; Aparicio, Samuel; Span, Paul N.; Martens, John W.M.; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Flanagan, Adrienne M.; Foster, Christopher; Neal, David E.; Cooper, Colin; Eeles, Rosalind; Lakhani, Sunil R.; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L.; Purdie, Colin A.; Thompson, Alastair M.; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J.; Stratton, Michael R.

2015-01-01

Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. PMID:25963125

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

PubMed

Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

2014-07-01

Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

Characterization of a linear DNA plasmid from the filamentous fungal plant pathogen Glomerella musae [Anamorph: Colletotrichum musae (Berk. and Curt.) arx.

USGS Publications Warehouse

Freeman, S.; Redman, R.S.; Grantham, G.; Rodriguez, R.J.

1997-01-01

A 7.4-kilobase (kb) DNA plasmid was isolated from Glomerella musae isolate 927 and designated pGML1. Exonuclease treatments indicated that pGML1 was a linear plasmid with blocked 5' termini. Cell-fractionation experiments combined with sequence-specific PCR amplification revealed that pGML1 resided in mitochondria. The pGML1 plasmid hybridized to cesium chloride-fractionated nuclear DNA but not to A + T-rich mitochondrial DNA. An internal 7.0-kb section of pGML1 was cloned and did not hybridize with either nuclear or mitochondrial DNA from G. musae. Sequence analysis revealed identical terminal inverted repeats (TIR) of 520 bp at the ends of the cloned 7.0-kb section of pGML1. The occurrence of pGML1 did not correspond with the pathogenicity of G. musae on banana fruit. Four additional isolates of G. musae possessed extrachromosomal DNA fragments similar in size and sequence to pGML1.

Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena

2002-02-15

Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (epsilon globin, p53 and gamma interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to alpha(lambda)mu(omicron)sigma(tau) 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed.

Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains

PubMed Central

Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena

2002-01-01

Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (ɛ globin, p53 and γ interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to αλµοστ 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed. PMID:11842122

Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.

PubMed Central

Benslimane, A A; Dron, M; Hartmann, C; Rode, A

1986-01-01

Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553

DNA and proteins of the nuclear matrix are the main targets of benzo[a]pyrene's action in rat hepatocytes.

PubMed

Widłak, P; Rzeszowska-Wolny, J

1993-01-01

The binding of [14C]benzo[a]pyrene (B[a]P) to DNA and proteins in total nuclei and subnuclear fractions of cultured rat hepatocytes was compared. The main targets of B[a]P were non-histone high molecular weight proteins of the nuclear matrix and DNA sequences attached to this structure. Following 24 h exposure to B[a]P the amounts of adducts in the nuclear matrix DNA and proteins were twice as high as in total nuclei. After withdrawal of the carcinogen containing medium the level of B[a]P-induced adducts gradually decreased but always remained the highest in the nuclear matrix proteins. Removal of adducts from the nuclear matrix DNA was more efficient than from the other DNA fractions, and 72 h after exposure to the carcinogen the level of DNA adducts in this fraction was similar to that in total nuclei.

Variations in Nuclear Localization Strategies Among Pol X Family Enzymes.

PubMed

Kirby, Thomas W; Pedersen, Lars C; Gabel, Scott A; Gassman, Natalie R; London, Robert E

2018-06-22

Despite the essential roles of pol X family enzymes in DNA repair, information about the structural basis of their nuclear import is limited. Recent studies revealed the unexpected presence of a functional NLS in DNA polymerase β, indicating the importance of active nuclear targeting, even for enzymes likely to leak into and out of the nucleus. The current studies further explore the active nuclear transport of these enzymes by identifying and structurally characterizing the functional NLS sequences in the three remaining human pol X enzymes: terminal deoxynucleotidyl transferase (TdT), DNA polymerase μ (pol μ), and DNA polymerase λ (pol λ). NLS identifications are based on Importin α (Impα) binding affinity determined by fluorescence polarization of fluorescein-labeled NLS peptides, X-ray crystallographic analysis of the Impα∆IBB•NLS complexes, and fluorescence-based subcellular localization studies. All three polymerases use NLS sequences located near their N-terminus; TdT and pol μ utilize monopartite NLS sequences, while pol λ utilizes a bipartite sequence, unique among the pol X family members. The pol μ NLS has relatively weak measured affinity for Impα, due in part to its proximity to the N-terminus that limits non-specific interactions of flanking residues preceding the NLS. However, this effect is partially mitigated by an N-terminal sequence unsupportive of Met1 removal by methionine aminopeptidase, leading to a 3-fold increase in affinity when the N-terminal methionine is present. Nuclear targeting is unique to each pol X family enzyme with variations dependent on the structure and unique functional role of each polymerase. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Analysis of plastid and mitochondrial DNA insertions in the nucleus (NUPTs and NUMTs) of six plant species: size, relative age and chromosomal localization.

PubMed

Michalovova, M; Vyskot, B; Kejnovsky, E

2013-10-01

We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.

The ability of human nuclear DNA to cause false positive low-abundance heteroplasmy calls varies across the mitochondrial genome.

PubMed

Albayrak, Levent; Khanipov, Kamil; Pimenova, Maria; Golovko, George; Rojas, Mark; Pavlidis, Ioannis; Chumakov, Sergei; Aguilar, Gerardo; Chávez, Arturo; Widger, William R; Fofanov, Yuriy

2016-12-12

Low-abundance mutations in mitochondrial populations (mutations with minor allele frequency ≤ 1%), are associated with cancer, aging, and neurodegenerative disorders. While recent progress in high-throughput sequencing technology has significantly improved the heteroplasmy identification process, the ability of this technology to detect low-abundance mutations can be affected by the presence of similar sequences originating from nuclear DNA (nDNA). To determine to what extent nDNA can cause false positive low-abundance heteroplasmy calls, we have identified mitochondrial locations of all subsequences that are common or similar (one mismatch allowed) between nDNA and mitochondrial DNA (mtDNA). Performed analysis revealed up to a 25-fold variation in the lengths of longest common and longest similar (one mismatch allowed) subsequences across the mitochondrial genome. The size of the longest subsequences shared between nDNA and mtDNA in several regions of the mitochondrial genome were found to be as low as 11 bases, which not only allows using these regions to design new, very specific PCR primers, but also supports the hypothesis of the non-random introduction of mtDNA into the human nuclear DNA. Analysis of the mitochondrial locations of the subsequences shared between nDNA and mtDNA suggested that even very short (36 bases) single-end sequencing reads can be used to identify low-abundance variation in 20.4% of the mitochondrial genome. For longer (76 and 150 bases) reads, the proportion of the mitochondrial genome where nDNA presence will not interfere found to be 44.5 and 67.9%, when low-abundance mutations at 100% of locations can be identified using 417 bases long single reads. This observation suggests that the analysis of low-abundance variations in mitochondria population can be extended to a variety of large data collections such as NCBI Sequence Read Archive, European Nucleotide Archive, The Cancer Genome Atlas, and International Cancer Genome Consortium.

Phylogenetic relationships and timing of diversification in gonorynchiform fishes inferred using nuclear gene DNA sequences (Teleostei: Ostariophysi).

PubMed

Near, Thomas J; Dornburg, Alex; Friedman, Matt

2014-11-01

The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating estimated ages of Kneriinae (Kneria, Parakneria, Cromeria, and Grasseichthys) and the two paedomorphic lineages, Cromeria and Grasseichthys, are considerably younger. Copyright © 2014 Elsevier Inc. All rights reserved.

Cytogenetic and Sequence Analyses of Mitochondrial DNA Insertions in Nuclear Chromosomes of Maize

PubMed Central

Lough, Ashley N.; Faries, Kaitlyn M.; Koo, Dal-Hoe; Hussain, Abid; Roark, Leah M.; Langewisch, Tiffany L.; Backes, Teresa; Kremling, Karl A. G.; Jiang, Jiming; Birchler, James A.; Newton, Kathleen J.

2015-01-01

The transfer of mitochondrial DNA (mtDNA) into nuclear genomes is a regularly occurring process that has been observed in many species. Few studies, however, have focused on the variation of nuclear-mtDNA sequences (NUMTs) within a species. This study examined mtDNA insertions within chromosomes of a diverse set of Zea mays ssp. mays (maize) inbred lines by the use of fluorescence in situ hybridization. A relatively large NUMT on the long arm of chromosome 9 (9L) was identified at approximately the same position in four inbred lines (B73, M825, HP301, and Oh7B). Further examination of the similarly positioned 9L NUMT in two lines, B73 and M825, indicated that the large size of these sites is due to the presence of a majority of the mitochondrial genome; however, only portions of this NUMT (∼252 kb total) were found in the publically available B73 nuclear sequence for chromosome 9. Fiber-fluorescence in situ hybridization analysis estimated the size of the B73 9L NUMT to be ∼1.8 Mb and revealed that the NUMT is methylated. Two regions of mtDNA (2.4 kb and 3.3 kb) within the 9L NUMT are not present in the B73 mitochondrial NB genome; however, these 2.4-kb and 3.3-kb segments are present in other Zea mitochondrial genomes, including that of Zea mays ssp. parviglumis, a progenitor of domesticated maize. PMID:26333837

Comprehensive Survey of Genetic Diversity in Chloroplast Genomes and 45S nrDNAs within Panax ginseng Species

PubMed Central

Kim, Kyunghee; Lee, Sang-Choon; Lee, Junki; Lee, Hyun Oh; Joh, Ho Jun; Kim, Nam-Hoon; Park, Hyun-Seung; Yang, Tae-Jin

2015-01-01

We report complete sequences of chloroplast (cp) genome and 45S nuclear ribosomal DNA (45S nrDNA) for 11 Panax ginseng cultivars. We have obtained complete sequences of cp and 45S nrDNA, the representative barcoding target sequences for cytoplasm and nuclear genome, respectively, based on low coverage NGS sequence of each cultivar. The cp genomes sizes ranged from 156,241 to 156,425 bp and the major size variation was derived from differences in copy number of tandem repeats in the ycf1 gene and in the intergenic regions of rps16-trnUUG and rpl32-trnUAG. The complete 45S nrDNA unit sequences were 11,091 bp, representing a consensus single transcriptional unit with an intergenic spacer region. Comparative analysis of these sequences as well as those previously reported for three Chinese accessions identified very rare but unique polymorphism in the cp genome within P. ginseng cultivars. There were 12 intra-species polymorphisms (six SNPs and six InDels) among 14 cultivars. We also identified five SNPs from 45S nrDNA of 11 Korean ginseng cultivars. From the 17 unique informative polymorphic sites, we developed six reliable markers for analysis of ginseng diversity and cultivar authentication. PMID:26061692

GENETIC STRUCTURE OF CREEK CHUB (SEMOTILUS ATROMACULATUS) POPULATIONS IN COAL MINING-IMPACTED AREAS OF THE EASTERN UNITED STATES, AS DETERMINED BY MTDNA SEQUENCING AND AFLP ANALYSIS

EPA Science Inventory

Analysis of intraspecific patterns in genetic diversity of stream fishes provides a potentially powerful method for assessing the status and trends in the condition of aquatic ecosystems. We analyzed mitochondrial DNA (mtDNA) sequences (590 bases of cytochrome B) and nuclear DNA...

Mitochondrial Genome Sequence of the Legume Vicia faba

PubMed Central

Negruk, Valentine

2013-01-01

The number of plant mitochondrial genomes sequenced exceeds two dozen. However, for a detailed comparative study of different phylogenetic branches more plant mitochondrial genomes should be sequenced. This article presents sequencing data and comparative analysis of mitochondrial DNA (mtDNA) of the legume Vicia faba. The size of the V. faba circular mitochondrial master chromosome of cultivar Broad Windsor was estimated as 588,000 bp with a genome complexity of 387,745 bp and 52 conservative mitochondrial genes; 32 of them encoding proteins, 3 rRNA, and 17 tRNA genes. Six tRNA genes were highly homologous to chloroplast genome sequences. In addition to the 52 conservative genes, 114 unique open reading frames (ORFs) were found, 36 without significant homology to any known proteins and 29 with homology to the Medicago truncatula nuclear genome and to other plant mitochondrial ORFs, 49 ORFs were not homologous to M. truncatula but possessed sequences with significant homology to other plant mitochondrial or nuclear ORFs. In general, the unique ORFs revealed very low homology to known closely related legumes, but several sequence homologies were found between V. faba, Beta vulgaris, Nicotiana tabacum, Vitis vinifera, and even the monocots Oryza sativa and Zea mays. Most likely these ORFs arose independently during angiosperm evolution (Kubo and Mikami, 2007; Kubo and Newton, 2008). Computational analysis revealed in total about 45% of V. faba mtDNA sequence being homologous to the Medicago truncatula nuclear genome (more than to any sequenced plant mitochondrial genome), and 35% of this homology ranging from a few dozen to 12,806 bp are located on chromosome 1. Apparently, mitochondrial rrn5, rrn18, rps10, ATP synthase subunit alpha, cox2, and tRNA sequences are part of transcribed nuclear mosaic ORFs. PMID:23675376

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiriyama, Takao; Hirano, Makito; Asai, Hirohide

Triple A syndrome is an autosomal recessive neurological disease, mimicking motor neuron disease, and is caused by mutant ALADIN, a nuclear-pore complex component. We recently discovered that the pathogenesis involved impaired nuclear import of DNA repair proteins, including DNA ligase I and the cerebellar ataxia causative protein aprataxin. Such impairment was overcome by fusing classical nuclear localization signal (NLS) and 137-aa downstream sequence of XRCC1, designated stretched NLS (stNLS). We report here that the minimum essential sequence of stNLS (mstNLS) is residues 239-276, downsized by more than 100 aa. mstNLS enabled efficient nuclear import of DNA repair proteins in patientmore » fibroblasts, functioned under oxidative stress, and reduced oxidative-stress-induced cell death, more effectively than stNLS. The stress-tolerability of mstNLS was also exerted in control fibroblasts and neuroblastoma cells. These findings may help develop treatments for currently intractable triple A syndrome and other oxidative-stress-related neurological diseases, and contribute to nuclear compartmentalization study.« less

Influence of structural variation on nuclear localization of DNA-binding polyamide-fluorophore conjugates.

PubMed

Edelson, Benjamin S; Best, Timothy P; Olenyuk, Bogdan; Nickols, Nicholas G; Doss, Raymond M; Foister, Shane; Heckel, Alexander; Dervan, Peter B

2004-01-01

A pivotal step forward in chemical approaches to controlling gene expression is the development of sequence-specific DNA-binding molecules that can enter live cells and traffic to nuclei unaided. DNA-binding polyamides are a class of programmable, sequence-specific small molecules that have been shown to influence a wide variety of protein-DNA interactions. We have synthesized over 100 polyamide-fluorophore conjugates and assayed their nuclear uptake profiles in 13 mammalian cell lines. The compiled dataset, comprising 1300 entries, establishes a benchmark for the nuclear localization of polyamide-dye conjugates. Compounds in this series were chosen to provide systematic variation in several structural variables, including dye composition and placement, molecular weight, charge, ordering of the aromatic and aliphatic amino-acid building blocks and overall shape. Nuclear uptake does not appear to be correlated with polyamide molecular weight or with the number of imidazole residues, although the positions of imidazole residues affect nuclear access properties significantly. Generally negative determinants for nuclear access include the presence of a beta-Ala-tail residue and the lack of a cationic alkyl amine moiety, whereas the presence of an acetylated 2,4-diaminobutyric acid-turn is a positive factor for nuclear localization. We discuss implications of these data on the design of polyamide-dye conjugates for use in biological systems.

Mitochondrial cytochrome c oxidase subunit 1 gene and nuclear rDNA regions of Enterobius vermicularis parasitic in captive chimpanzees with special reference to its relationship with pinworms in humans.

PubMed

Nakano, Tadao; Okamoto, Munehiro; Ikeda, Yatsukaho; Hasegawa, Hideo

2006-12-01

Sequences of mitochondrial cytochrome c oxidase subunit 1 (CO1) gene, nuclear internal transcribed spacer 2 (ITS2) region of ribosomal DNA (rDNA), and 5S rDNA of Enterobius vermicularis from captive chimpanzees in five zoos/institutions in Japan were analyzed and compared with those of pinworm eggs from humans in Japan. Three major types of variants appearing in both CO1 and ITS2 sequences, but showing no apparent connection, were observed among materials collected from the chimpanzees. Each one of them was also observed in pinworms in humans. Sequences of 5S rDNA were identical in the materials from chimpanzees and humans. Phylogenetic analysis of CO1 gene revealed three clusters with high bootstrap value, suggesting considerable divergence, presumably correlated with human evolution, has occurred in the human pinworms. The synonymy of E. gregorii with E. vermicularis is supported by the molecular evidence.

Micronuclear DNA of Oxytricha nova contains sequences with autonomously replicating activity in Saccharomyces cerevisiae.

PubMed Central

Colombo, M M; Swanton, M T; Donini, P; Prescott, D M

1984-01-01

Oxytricha nova is a hypotrichous ciliate with micronuclei and macronuclei. Micronuclei, which contain large, chromosomal-sized DNA, are genetically inert but undergo meiosis and exchange during cell mating. Macronuclei, which contain only small, gene-sized DNA molecules, provide all of the nuclear RNA needed to run the cell. After cell mating the macronucleus is derived from a micronucleus, a derivation that includes excision of the genes from chromosomes and elimination of the remaining DNA. The eliminated DNA includes all of the repetitious sequences and approximately 95% of the unique sequences. We cloned large restriction fragments from the micronucleus that confer replication ability on a replication-deficient plasmid in Saccharomyces cerevisiae. Sequences that confer replication ability are called autonomously replicating sequences. The frequency and effectiveness of autonomously replicating sequences in micronuclear DNA are similar to those reported for DNAs of other organisms introduced into yeast cells. Of the 12 micronuclear fragments with autonomously replicating sequence activity, 9 also showed homology to macronuclear DNA, indicating that they contain a macronuclear gene sequence. We conclude from this that autonomously replicating sequence activity is nonrandomly distributed throughout micronuclear DNA and is preferentially associated with those regions of micronuclear DNA that contain genes. Images PMID:6092934

Sequencing of whole plastid genomes and nuclear ribosomal DNA of Diospyros species (Ebenaceae) endemic to New Caledonia: many species, little divergence

PubMed Central

Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W.; Samuel, Rosabelle

2016-01-01

Background and Aims Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Methods Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. Key Results The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. Conclusions In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree because the total number of variable sites was much lower than in the entire plastid genome. The geographical clustering of the individuals against a background of overall low sequence divergence could indicate transfer of plastid genomes due to hybridization and introgression following secondary contact. PMID:27098088

A multi-locus analysis of phylogenetic relationships within grass subfamily Pooideae (Poaceae) inferred from sequences of nuclear single copy gene regions compared with plastid DNA.

PubMed

Hochbach, Anne; Schneider, Julia; Röser, Martin

2015-06-01

To investigate phylogenetic relationships within the grass subfamily Pooideae we studied about 50 taxa covering all recognized tribes, using one plastid DNA (cpDNA) marker (matK gene-3'trnK exon) and for the first time four nuclear single copy gene loci. DNA sequence information from two parts of the nuclear genes topoisomerase 6 (Topo6) spanning the exons 8-13 and 17-19, the exons 9-13 encoding plastid acetyl-CoA-carboxylase (Acc1) and the partial exon 1 of phytochrome B (PhyB) were generated. Individual and nuclear combined data were evaluated using maximum parsimony, maximum likelihood and Bayesian methods. All of the phylogenetic results show Brachyelytrum and the tribe Nardeae as earliest diverging lineages within the subfamily. The 'core' Pooideae (Hordeeae and the Aveneae/Poeae tribe complex) are also strongly supported, as well as the monophyly of the tribes Brachypodieae, Meliceae and Stipeae (except PhyB). The beak grass tribe Diarrheneae and the tribe Duthieeae are not monophyletic in some of the analyses. However, the combined nuclear DNA (nDNA) tree yields the highest resolution and the best delimitation of the tribes, and provides the following evolutionary hypothesis for the tribes: Brachyelytrum, Nardeae, Duthieeae, Meliceae, Stipeae, Diarrheneae, Brachypodieae and the 'core' Pooideae. Within the individual datasets, the phylogenetic trees obtained from Topo6 exon 8-13 shows the most interesting results. The divergent positions of some clone sequences of Ampelodesmos mauritanicus and Trikeraia pappiformis, for instance, may indicate a hybrid origin of these stipoid taxa. Copyright © 2015 Elsevier Inc. All rights reserved.

Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

PubMed

Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

2013-03-11

The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

PubMed

Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

1993-01-01

DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

PubMed

Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

2009-04-01

Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

The product of the Saccharomyces cerevisiae cell cycle gene DBF2 has homology with protein kinases and is periodically expressed in the cell cycle.

PubMed Central

Johnston, L H; Eberly, S L; Chapman, J W; Araki, H; Sugino, A

1990-01-01

Several Saccharomyces cerevisiae dbf mutants defective in DNA synthesis have been described previously. In this paper, one of them, dbf2, is characterized in detail. The DBF2 gene has been cloned and mapped, and its nucleotide sequence has been determined. This process has identified an open reading frame capable of encoding a protein of molecular weight 64,883 (561 amino acids). The deduced amino acid sequence contains all 11 conserved domains found in various protein kinases. DBF2 was periodically expressed in the cell cycle at a time that clearly differed from the time of expression of either the histone H2A or DNA polymerase I gene. Its first function was completed very near to initiation of DNA synthesis. However, DNA synthesis in the mutant was only delayed at 37 degrees C, and the cells blocked in nuclear division. Consistent with this finding, the execution point occurred about 1 h after DNA synthesis, and the nuclear morphology of the mutant at the restrictive temperature was that of cells blocked in late nuclear division. DBF2 is therefore likely to encode a protein kinase that may function in initiation of DNA synthesis and also in late nuclear division. Images PMID:2181271

Modular structural elements in the replication origin region of Tetrahymena rDNA.

PubMed Central

Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

1995-01-01

Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

Analysis of a library of macaque nuclear mitochondrial sequences confirms macaque origin of divergent sequences from old oral polio vaccine samples.

PubMed

Vartanian, Jean-Pierre; Wain-Hobson, Simon

2002-05-28

Nuclear mtDNA sequences (numts) are a widespread family of paralogs evolving as pseudogenes in chromosomal DNA [Zhang, D. E. & Hewitt, G. M. (1996) TREE 11, 247-251 and Bensasson, D., Zhang, D., Hartl, D. L. & Hewitt, G. M. (2001) TREE 16, 314-321]. When trying to identify the species origin of an unknown DNA sample by way of an mtDNA locus, PCR may amplify both mtDNA and numts. Indeed, occasionally numts dominate confounding attempts at species identification [Bensasson, D., Zhang, D. X. & Hewitt, G. M. (2000) Mol. Biol. Evol. 17, 406-415; Wallace, D. C., et al. (1997) Proc. Natl. Acad. Sci. USA 94, 14900-14905]. Rhesus and cynomolgus macaque mtDNA haplotypes were identified in a study of oral polio vaccine samples dating from the late 1950s [Blancou, P., et al. (2001) Nature (London) 410, 1045-1046]. They were accompanied by a number of putative numts. To confirm that these putative numts were of macaque origin, a library of numts corresponding to a small segment of 12S rDNA locus has been made by using DNA from a Chinese rhesus macaque. A broad distribution was found with up to 30% sequence variation. Phylogenetic analysis showed that the evolutionary trajectories of numts and bona fide mtDNA haplotypes do not overlap with the signal exception of the host species; mtDNA fragments are continually crossing over into the germ line. In the case of divergent mtDNA sequences from old oral polio vaccine samples [Blancou, P., et al. (2001) Nature (London) 410, 1045-1046], all were closely related to numts in the Chinese macaque library.

The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

PubMed

Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

2017-08-21

Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Massively parallel sequencing-enabled mixture analysis of mitochondrial DNA samples.

PubMed

Churchill, Jennifer D; Stoljarova, Monika; King, Jonathan L; Budowle, Bruce

2018-02-22

The mitochondrial genome has a number of characteristics that provide useful information to forensic investigations. Massively parallel sequencing (MPS) technologies offer improvements to the quantitative analysis of the mitochondrial genome, specifically the interpretation of mixed mitochondrial samples. Two-person mixtures with nuclear DNA ratios of 1:1, 5:1, 10:1, and 20:1 of individuals from different and similar phylogenetic backgrounds and three-person mixtures with nuclear DNA ratios of 1:1:1 and 5:1:1 were prepared using the Precision ID mtDNA Whole Genome Panel and Ion Chef, and sequenced on the Ion PGM or Ion S5 sequencer (Thermo Fisher Scientific, Waltham, MA, USA). These data were used to evaluate whether and to what degree MPS mixtures could be deconvolved. Analysis was effective in identifying the major contributor in each instance, while SNPs from the minor contributor's haplotype only were identified in the 1:1, 5:1, and 10:1 two-person mixtures. While the major contributor was identified from the 5:1:1 mixture, analysis of the three-person mixtures was more complex, and the mixed haplotypes could not be completely parsed. These results indicate that mixed mitochondrial DNA samples may be interpreted with the use of MPS technologies.

Comparison of Flow Injection MS, NMR, and DNA Sequencing: Methods for Identification and Authentication of Black Cohosh (Actaea racemosa)

USDA-ARS?s Scientific Manuscript database

Flow injection mass spectrometry (FIMS) and proton nuclear magnetic resonance spectrometry (1H-NMR), two metabolic fingerprinting methods, and DNA sequencing were used to identify and authenticate Actaea species. Initially, samples of Actaea racemosa L. from a single source were distinguished from ...

Applying DNA Barcodes to Identify Closely Related Species of Ferns: A Case Study of the Chinese Adiantum (Pteridaceae)

PubMed Central

Wen, Jun; Ebihara, Atsushi; Li, De-Zhu

2016-01-01

DNA barcoding is a fast-developing technique to identify species by using short and standard DNA sequences. Universal selection of DNA barcodes in ferns remains unresolved. In this study, five plastid regions (rbcL, matK, trnH-psbA, trnL-F and rps4-trnS) and eight nuclear regions (ITS, pgiC, gapC, LEAFY, ITS2, IBR3_2, DET1, and SQD1_1) were screened and evaluated in the fern genus Adiantum from China and neighboring areas. Due to low primer universality (matK) and/or the existence of multiple copies (ITS), the commonly used barcodes matK and ITS were not appropriate for Adiantum. The PCR amplification rate was extremely low in all nuclear genes except for IBR3_2. rbcL had the highest PCR amplification rate (94.33%) and sequencing success rate (90.78%), while trnH-psbA had the highest species identification rate (75%). With the consideration of discriminatory power, cost-efficiency and effort, the two-barcode combination of rbcL+ trnH-psbA seems to be the best choice for barcoding Adiantum, and perhaps basal polypod ferns in general. The nuclear IBR3_2 showed 100% PCR amplification success rate in Adiantum, however, it seemed that only diploid species could acquire clean sequences without cloning. With cloning, IBR3_2 can successfully distinguish cryptic species and hybrid species from their related species. Because hybridization and allopolyploidy are common in ferns, we argue for including a selected group of nuclear loci as barcodes, especially via the next-generation sequencing, as it is much more efficient to obtain single-copy nuclear loci without the cloning procedure. PMID:27603700

Rapid isolation of microsatellite DNAs and identification of polymorphic mitochondrial DNA regions in the fish rotan (Perccottus glenii) invading European Russia

USGS Publications Warehouse

King, Timothy L.; Eackles, Michael S.; Reshetnikov, Andrey N.

2015-01-01

Human-mediated translocations and subsequent large-scale colonization by the invasive fish rotan (Perccottus glenii Dybowski, 1877; Perciformes, Odontobutidae), also known as Amur or Chinese sleeper, has resulted in dramatic transformations of small lentic ecosystems. However, no detailed genetic information exists on population structure, levels of effective movement, or relatedness among geographic populations of P. glenii within the European part of the range. We used massively parallel genomic DNA shotgun sequencing on the semiconductor-based Ion Torrent Personal Genome Machine (PGM) sequencing platform to identify nuclear microsatellite and mitochondrial DNA sequences in P. glenii from European Russia. Here we describe the characterization of nine nuclear microsatellite loci, ascertain levels of allelic diversity, heterozygosity, and demographic status of P. glenii collected from Ilev, Russia, one of several initial introduction points in European Russia. In addition, we mapped sequence reads to the complete P. glenii mitochondrial DNA sequence to identify polymorphic regions. Nuclear microsatellite markers developed for P. glenii yielded sufficient genetic diversity to: (1) produce unique multilocus genotypes; (2) elucidate structure among geographic populations; and (3) provide unique perspectives for analysis of population sizes and historical demographics. Among 4.9 million filtered P. glenii Ion Torrent PGM sequence reads, 11,304 mapped to the mitochondrial genome (NC_020350). This resulted in 100 % coverage of this genome to a mean coverage depth of 102X. A total of 130 variable sites were observed between the publicly available genome from China and the studied composite mitochondrial genome. Among these, 82 were diagnostic and monomorphic between the mitochondrial genomes and distributed among 15 genome regions. The polymorphic sites (N = 48) were distributed among 11 mitochondrial genome regions. Our results also indicate that sequence reads generated from two three-hour runs on the Ion Torrent PGM can generate a sufficient number of nuclear and mitochondrial markers to improve understanding of the evolutionary and ecological dynamics of non-model and in particular, invasive species.

Detection and decay rates of prey and prey symbionts in the gut of a predator through metagenomics.

PubMed

Paula, Débora P; Linard, Benjamin; Andow, David A; Sujii, Edison R; Pires, Carmen S S; Vogler, Alfried P

2015-07-01

DNA methods are useful to identify ingested prey items from the gut of predators, but reliable detection is hampered by low amounts of degraded DNA. PCR-based methods can retrieve minute amounts of starting material but suffer from amplification biases and cross-reactions with the predator and related species genomes. Here, we use PCR-free direct shotgun sequencing of total DNA isolated from the gut of the harlequin ladybird Harmonia axyridis at five time points after feeding on a single pea aphid Acyrthosiphon pisum. Sequence reads were matched to three reference databases: Insecta mitogenomes of 587 species, including H. axyridis sequenced here; A. pisum nuclear genome scaffolds; and scaffolds and complete genomes of 13 potential bacterial symbionts. Immediately after feeding, multicopy mtDNA of A. pisum was detected in tens of reads, while hundreds of matches to nuclear scaffolds were detected. Aphid nuclear DNA and mtDNA decayed at similar rates (0.281 and 0.11 h(-1) respectively), and the detectability periods were 32.7 and 23.1 h. Metagenomic sequencing also revealed thousands of reads of the obligate Buchnera aphidicola and facultative Regiella insecticola aphid symbionts, which showed exponential decay rates significantly faster than aphid DNA (0.694 and 0.80 h(-1) , respectively). However, the facultative aphid symbionts Hamiltonella defensa, Arsenophonus spp. and Serratia symbiotica showed an unexpected temporary increase in population size by 1-2 orders of magnitude in the predator guts before declining. Metagenomics is a powerful tool that can reveal complex relationships and the dynamics of interactions among predators, prey and their symbionts. © 2014 John Wiley & Sons Ltd.

No genome barriers to promiscuous DNA

NASA Astrophysics Data System (ADS)

Lewin, R.

1984-06-01

Farrelly and Butow (1983) used the term 'promiscuous DNA' in their report of the apparent natural transfer of yeast mitochondrial DNA sequences into the nuclear genome. Ellis (1982) applied the same term in an editorial comment. It is pointed out since that time the subject of DNA's promiscuity has exploded with a series of reports. According to a report by Stern (1984), movement of DNA sequences between chloroplasts and mitochondria is not just a rare event but is a rampant process. It was recently concluded that 'the widespread presence of ctDNA sequences in plant mtDNA is best regarded as a dramatic demonstration of the dynamo nature of interactions between the chloroplast and the mitochondrion, similar to the ongoing process of interorganellar DNA transfer already documented between mitochondrion and nucleus and between chloroplast and nucleus'.

HYBRIDIZATION PROPERTIES OF DNA SEQUENCES DIRECTING THE SYNTHESIS OF MESSENGER RNA AND HETEROGENEOUS NUCLEAR RNA

PubMed Central

Greenberg, Jay R.; Perry, Robert P.

1971-01-01

The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767

Mitochondrial and nuclear DNA analysis revealed a cryptic species and genetic introgression in Littorina sitkana (Mollusca, Gastropoda).

PubMed

Azuma, Noriko; Yamazaki, Tomoyasu; Chiba, Susumu

2011-12-01

We investigated mitochondrial and nuclear DNA genotypes in nominal Littorina sitkana samples from 2 localities in Eastern Hokkaido, northern Japan. Our results indicated the existence of cryptic species. In the analysis of partial mitochondrial Cytchrome b gene sequences, haplotypes of L. sitkana samples were monophyletic in a phylogenetic tree with orthologous sequences from other Littorina species, but were apparently separated in 2 clades. One included typical L. sitkana (CBa clade) samples, which formed a clade with an allopatric species, L. horikawai. The other, CBb, was independent from CBa and L. horikawai. Haplotypes of the mitochondrial 16S rRNA gene also separated into 2 clades. We additionally examined intron sequence of the heat shock cognate 70 (HSC70) nuclear gene and identified 17 haplotypes. These were also separated into 2 clades, HSCa and HSCb. Among the examined Hokkaido samples, 60% of individuals were heterozygotes. However, each heterozygote consisted of haplotypes from the same clade, HSCa or HSCb, and no admixture of HSCa and HSCb haplotypes was observed. These results indicate reproductive isolation between the 2 clades. Among the genotyped Hokkaido samples, 93% of individuals had CBa + HSCa or CBb + HSCb genotypes, and 7% had CBb + HSCa genotypes. The discrepancy between the mtDNA and nuclear DNA haplotypes in a few individuals may have been caused by genetic introgression due to past hybridization.

DNA Barcoding in Fragaria L. (Strawberry) Species

USDA-ARS?s Scientific Manuscript database

DNA barcoding for species identification using a short DNA sequence has been successful in animals due to rapid mutation rates of the mitochondrial genome where the animal DNA barocode, cytochrome c oxidase 1 gene is located. The chloroplast PsbA-trnH spacer and the nuclear ribosomal internal transc...

The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

PubMed

Sengupta, P K; Lavelle, D E; DeSimone, J

1994-03-01

Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

Population Genetic Structure and Phylogeography of Camellia flavida (Theaceae) Based on Chloroplast and Nuclear DNA Sequences

PubMed Central

Wei, Su-Juan; Lu, Yong-Bin; Ye, Quan-Qing; Tang, Shao-Qing

2017-01-01

Camellia flavida is an endangered species of yellow camellia growing in limestone mountains in southwest China. The current classification of C. flavida into two varieties, var. flavida and var. patens, is controversial. We conducted a genetic analysis of C. flavida to determine its taxonomic structure. A total of 188 individual plants from 20 populations across the entire distribution range in southwest China were analyzed using two DNA fragments: a chloroplast DNA fragment from the small single copy region and a single-copy nuclear gene called phenylalanine ammonia-lyase (PAL). Sequences from both chloroplast and nuclear DNA were highly diverse; with high levels of genetic differentiation and restricted gene flow. This result can be attributed to the high habitat heterogeneity in limestone karst, which isolates C. flavida populations from each other. Our nuclear DNA results demonstrate that there are three differentiated groups within C. flavida: var. flavida 1, var. flavida 2, and var. patens. These genetic groupings are consistent with the morphological characteristics of the plants. We suggest that the samples included in this study constitute three taxa and the var. flavida 2 group is the genuine C. flavida. The three groups should be recognized as three management units for conservation concerns. PMID:28579991

First Molecular Identification and Phylogeny of Moroccan Anopheles sergentii (Diptera: Culicidae) Based on Second Internal Transcribed Spencer (ITS2) and Cytochrome c Oxidase I (COI) Sequences.

PubMed

Benabdelkrim Filali, Oumama; Kabine, Mostafa; El Hamouchi, Adil; Lemrani, Meryem; Debboun, Mustapha; Sarih, M'hammed

2018-06-05

Anopheles sergentii known as the "oasis vector" or the "desert malaria vector" is considered the main vector of malaria in the southern parts of Morocco. Its presence in Morocco is confirmed for the first time through sequencing of mitochondrial DNA (mDNA) cytochrome c oxidase subunit I (COI) barcodes and nuclear ribosomal DNA (rDNA) second internal transcribed spacer (ITS2) sequences and direct comparison with specimens of A. sergentii of other countries. The DNA barcodes (n = 39) obtained from A. sergentii collected in 2015 and 2016 showed more diversity with 10 haplotypes, compared with 3 haplotypes obtained from ITS2 sequences (n = 59). Moreover, the comparison using the ITS2 sequences showed closer evolutionary relationship between the Moroccan and Egyptian strains than the Iranian strain. Nevertheless, genetic differences due to geographical segregation were also observed. This study provides the first report on the sequence of rDNA-ITS2 and mtDNA COI, which could be used to better understand the biodiversity of A. sergentii.

A nuclear ribosomal DNA pseudogene in triatomines opens a new research field of fundamental and applied implications in Chagas disease.

PubMed

Zuriaga, María Angeles; Mas-Coma, Santiago; Bargues, María Dolores

2015-05-01

A pseudogene, designated as "ps(5.8S+ITS-2)", paralogous to the 5.8S gene and internal transcribed spacer (ITS)-2 of the nuclear ribosomal DNA (rDNA), has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2)" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2)" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control.

A phylogenetic study of Laeliinae (Orchidaceae) based on combined nuclear and plastid DNA sequences

PubMed Central

van den Berg, Cássio; Higgins, Wesley E.; Dressler, Robert L.; Whitten, W. Mark; Soto-Arenas, Miguel A.; Chase, Mark W.

2009-01-01

Background and Aims Laeliinae are a neotropical orchid subtribe with approx. 1500 species in 50 genera. In this study, an attempt is made to assess generic alliances based on molecular phylogenetic analysis of DNA sequence data. Methods Six DNA datasets were gathered: plastid trnL intron, trnL-F spacer, matK gene and trnK introns upstream and dowstream from matK and nuclear ITS rDNA. Data were analysed with maximum parsimony (MP) and Bayesian analysis with mixed models (BA). Key Results Although relationships between Laeliinae and outgroups are well supported, within the subtribe sequence variation is low considering the broad taxonomic range covered. Localized incongruence between the ITS and plastid trees was found. A combined tree followed the ITS trees more closely, but the levels of support obtained with MP were low. The Bayesian analysis recovered more well-supported nodes. The trees from combined MP and BA allowed eight generic alliances to be recognized within Laeliinae, all of which show trends in morphological characters but lack unambiguous synapomorphies. Conclusions By using combined plastid and nuclear DNA data in conjunction with mixed-models Bayesian inference, it is possible to delimit smaller groups within Laeliinae and discuss general patterns of pollination and hybridization compatibility. Furthermore, these small groups can now be used for further detailed studies to explain morphological evolution and diversification patterns within the subtribe. PMID:19423551

A protocol for isolating insect mitochondrial genomes: a case study of NUMT in Melipona flavolineata (Hymenoptera: Apidae).

PubMed

Françoso, Elaine; Gomes, Fernando; Arias, Maria Cristina

2016-07-01

Nuclear mitochondrial DNA insertions (NUMTs) are mitochondrial DNA sequences that have been transferred into the nucleus and are recognized by the presence of indels and stop codons. Although NUMTs have been identified in a diverse range of species, their discovery was frequently accidental. Here, our initial goal was to develop and standardize a simple method for isolating NUMTs from the nuclear genome of a single bee. Subsequently, we tested our new protocol by determining whether the indels and stop codons of the cytochrome c oxidase subunit I (COI) sequence of Melipona flavolineata are of nuclear origin. The new protocol successfully demonstrated the presence of a COI NUMT. In addition to NUMT investigations, the protocol described here will also be very useful for studying mitochondrial mutations related to diseases and for sequencing complete mitochondrial genomes with high read coverage by Next-Generation technology.

Characterization of Trichuris trichiura from humans and T. suis from pigs in China using internal transcribed spacers of nuclear ribosomal DNA.

PubMed

Liu, G H; Zhou, W; Nisbet, A J; Xu, M J; Zhou, D H; Zhao, G H; Wang, S K; Song, H Q; Lin, R Q; Zhu, X Q

2014-03-01

Trichuris trichiura and Trichuris suis parasitize (at the adult stage) the caeca of humans and pigs, respectively, causing trichuriasis. Despite these parasites being of human and animal health significance, causing considerable socio-economic losses globally, little is known of the molecular characteristics of T. trichiura and T. suis from China. In the present study, the entire first and second internal transcribed spacer (ITS-1 and ITS-2) regions of nuclear ribosomal DNA (rDNA) of T. trichiura and T. suis from China were amplified by polymerase chain reaction (PCR), the representative amplicons were cloned and sequenced, and sequence variation in the ITS rDNA was examined. The ITS rDNA sequences for the T. trichiura and T. suis samples were 1222-1267 bp and 1339-1353 bp in length, respectively. Sequence analysis revealed that the ITS-1, 5.8S and ITS-2 rDNAs of both whipworms were 600-627 bp and 655-661 bp, 154 bp, and 468-486 bp and 530-538 bp in size, respectively. Sequence variation in ITS rDNA within and among T. trichiura and T. suis was examined. Excluding nucleotide variations in the simple sequence repeats, the intra-species sequence variation in the ITS-1 was 0.2-1.7% within T. trichiura, and 0-1.5% within T. suis. For ITS-2 rDNA, the intra-species sequence variation was 0-1.3% within T. trichiura and 0.2-1.7% within T. suis. The inter-species sequence differences between the two whipworms were 60.7-65.3% for ITS-1 and 59.3-61.5% for ITS-2. These results demonstrated that the ITS rDNA sequences provide additional genetic markers for the characterization and differentiation of the two whipworms. These data should be useful for studying the epidemiology and population genetics of T. trichiura and T. suis, as well as for the diagnosis of trichuriasis in humans and pigs.

Plant DNA sequences from feces: potential means for assessing diets of wild primates.

PubMed

Bradley, Brenda J; Stiller, Mathias; Doran-Sheehy, Diane M; Harris, Tara; Chapman, Colin A; Vigilant, Linda; Poinar, Hendrik

2007-06-01

Analyses of plant DNA in feces provides a promising, yet largely unexplored, means of documenting the diets of elusive primates. Here we demonstrate the promise and pitfalls of this approach using DNA extracted from fecal samples of wild western gorillas (Gorilla gorilla) and black and white colobus monkeys (Colobus guereza). From these DNA extracts we amplified, cloned, and sequenced small segments of chloroplast DNA (part of the rbcL gene) and plant nuclear DNA (ITS-2). The obtained sequences were compared to sequences generated from known plant samples and to those in GenBank to identify plant taxa in the feces. With further optimization, this method could provide a basic evaluation of minimum primate dietary diversity even when knowledge of local flora is limited. This approach may find application in studies characterizing the diets of poorly-known, unhabituated primate species or assaying consumer-resource relationships in an ecosystem. (c) 2007 Wiley-Liss, Inc.

Multiple horizontal transfers of nuclear ribosomal genes between phylogenetically distinct grass lineages.

PubMed

Mahelka, Václav; Krak, Karol; Kopecký, David; Fehrer, Judith; Šafář, Jan; Bartoš, Jan; Hobza, Roman; Blavet, Nicolas; Blattner, Frank R

2017-02-14

The movement of nuclear DNA from one vascular plant species to another in the absence of fertilization is thought to be rare. Here, nonnative rRNA gene [ribosomal DNA (rDNA)] copies were identified in a set of 16 diploid barley ( Hordeum ) species; their origin was traceable via their internal transcribed spacer (ITS) sequence to five distinct Panicoideae genera, a lineage that split from the Pooideae about 60 Mya. Phylogenetic, cytogenetic, and genomic analyses implied that the nonnative sequences were acquired between 1 and 5 Mya after a series of multiple events, with the result that some current Hordeum sp. individuals harbor up to five different panicoid rDNA units in addition to the native Hordeum rDNA copies. There was no evidence that any of the nonnative rDNA units were transcribed; some showed indications of having been silenced via pseudogenization. A single copy of a Panicum sp. rDNA unit present in H. bogdanii had been interrupted by a native transposable element and was surrounded by about 70 kbp of mostly noncoding sequence of panicoid origin. The data suggest that horizontal gene transfer between vascular plants is not a rare event, that it is not necessarily restricted to one or a few genes only, and that it can be selectively neutral.

Joint Estimation of Contamination, Error and Demography for Nuclear DNA from Ancient Humans

PubMed Central

Slatkin, Montgomery

2016-01-01

When sequencing an ancient DNA sample from a hominin fossil, DNA from present-day humans involved in excavation and extraction will be sequenced along with the endogenous material. This type of contamination is problematic for downstream analyses as it will introduce a bias towards the population of the contaminating individual(s). Quantifying the extent of contamination is a crucial step as it allows researchers to account for possible biases that may arise in downstream genetic analyses. Here, we present an MCMC algorithm to co-estimate the contamination rate, sequencing error rate and demographic parameters—including drift times and admixture rates—for an ancient nuclear genome obtained from human remains, when the putative contaminating DNA comes from present-day humans. We assume we have a large panel representing the putative contaminant population (e.g. European, East Asian or African). The method is implemented in a C++ program called ‘Demographic Inference with Contamination and Error’ (DICE). We applied it to simulations and genome data from ancient Neanderthals and modern humans. With reasonable levels of genome sequence coverage (>3X), we find we can recover accurate estimates of all these parameters, even when the contamination rate is as high as 50%. PMID:27049965

Linear and Nonlinear Statistical Characterization of DNA

NASA Astrophysics Data System (ADS)

Norio Oiwa, Nestor; Goldman, Carla; Glazier, James

2002-03-01

We find spatial order in the distribution of protein-coding (including RNAs) and control segments of GenBank genomic sequences, irrespective of ATCG content. This is achieved by correlations, histograms, fractal dimensions and singularity spectra. Estimates of these quantities in complete nuclear genome indicate that coding sequences are long-range correlated and their disposition are self-similar (multifractal) for eukaryotes. These characteristics are absent in prokaryotes, where there are few noncoding sequences, suggesting the `junk' DNA play a relevant role to the genome structure and function. Concerning the genetic message of ATCG sequences, we build a random walk (Levy flight), using DNA symmetry arguments, where we associate A, T, C and G as left, right, down and up steps, respectively. Nonlinear analysis of mitochondrial DNA walks reveal multifractal pattern based on palindromic sequences, which fold in hairpins and loops.

Organization and evolution of highly repeated satellite DNA sequences in plant chromosomes.

PubMed

Sharma, S; Raina, S N

2005-01-01

A major component of the plant nuclear genome is constituted by different classes of repetitive DNA sequences. The structural, functional and evolutionary aspects of the satellite repetitive DNA families, and their organization in the chromosomes is reviewed. The tandem satellite DNA sequences exhibit characteristic chromosomal locations, usually at subtelomeric and centromeric regions. The repetitive DNA family(ies) may be widely distributed in a taxonomic family or a genus, or may be specific for a species, genome or even a chromosome. They may acquire large-scale variations in their sequence and copy number over an evolutionary time-scale. These features have formed the basis of extensive utilization of repetitive sequences for taxonomic and phylogenetic studies. Hybrid polyploids have especially proven to be excellent models for studying the evolution of repetitive DNA sequences. Recent studies explicitly show that some repetitive DNA families localized at the telomeres and centromeres have acquired important structural and functional significance. The repetitive elements are under different evolutionary constraints as compared to the genes. Satellite DNA families are thought to arise de novo as a consequence of molecular mechanisms such as unequal crossing over, rolling circle amplification, replication slippage and mutation that constitute "molecular drive". Copyright 2005 S. Karger AG, Basel.

Determination of the melon chloroplast and mitochondrial genome sequences reveals that the largest reported mitochondrial genome in plants contains a significant amount of DNA having a nuclear origin

PubMed Central

2011-01-01

Background The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb), which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. Results The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp) included 132 genes, with 98 single-copy genes dispersed between the small (SSC) and large (LSC) single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb). A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp) of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb), Cucurbita pepo (983 kb) and Cucumis melo (2,740 kb) share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Conclusions Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes, with a non-conserved structure both in gene number and organisation, as well as in the features of the noncoding DNA. The transfer of nuclear DNA to the melon mitochondrial genome and the high proportion of repetitive DNA appear to explain the size of the largest mitochondrial genome reported so far. PMID:21854637

Cyclosporin A and FK-506 both affect DNA binding of regulatory nuclear proteins to the human interleukin-2 promoter.

PubMed

Baumann, G; Geisse, S; Sullivan, M

1991-03-01

The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.

Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

PubMed Central

Hardman, Norman

1974-01-01

Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

IN SITU DEMONSTRATION OF DNA HYBRIDIZING WITH CHROMOSOMAL AND NUCLEAR SAP RNA IN CHIRONOMUS TENTANS

PubMed Central

Lambert, B.; Wieslander, L.; Daneholt, B.; Egyházi, E.; Ringborg, U.

1972-01-01

Cytological hybridization combined with microdissection of Chironomus tentans salivary gland cells was used to locate DNA complementary to newly synthesized RNA from chromosomes and nuclear sap and from a single chromosomal puff, the Balbiani ring 2 (BR 2). Salivary glands were incubated with tritiated nucleosides. The labeled RNA was extracted from microdissected nuclei and hybridized to denatured squash preparations of salivary gland cells under conditions which primarily allow repeated sequences to interact. The bound RNA, resistant to ribonuclease treatment, was detected radioautographically. It was found that BR 2 RNA hybridizes specifically with the BR 2 region of chromosome IV. Nuclear sap RNA was fractionated into high and low molecular-weight RNA; the former hybridizes with the BR 2 region of chromosome IV, the latter in a diffuse distribution over the whole chromosome set. RNA from chromosome I hybridizes diffusely with all chromosomes. Nucleolar RNA hybridizes specifically with the nucleolar organizers, contained in chromosomes II and III. It is concluded that the BR 2 region of chromosome IV contains repeated DNA sequences and that nuclear sap contains BR 2 RNA. PMID:5025107

Ancient genomics

PubMed Central

Der Sarkissian, Clio; Allentoft, Morten E.; Ávila-Arcos, María C.; Barnett, Ross; Campos, Paula F.; Cappellini, Enrico; Ermini, Luca; Fernández, Ruth; da Fonseca, Rute; Ginolhac, Aurélien; Hansen, Anders J.; Jónsson, Hákon; Korneliussen, Thorfinn; Margaryan, Ashot; Martin, Michael D.; Moreno-Mayar, J. Víctor; Raghavan, Maanasa; Rasmussen, Morten; Velasco, Marcela Sandoval; Schroeder, Hannes; Schubert, Mikkel; Seguin-Orlando, Andaine; Wales, Nathan; Gilbert, M. Thomas P.; Willerslev, Eske; Orlando, Ludovic

2015-01-01

The past decade has witnessed a revolution in ancient DNA (aDNA) research. Although the field's focus was previously limited to mitochondrial DNA and a few nuclear markers, whole genome sequences from the deep past can now be retrieved. This breakthrough is tightly connected to the massive sequence throughput of next generation sequencing platforms and the ability to target short and degraded DNA molecules. Many ancient specimens previously unsuitable for DNA analyses because of extensive degradation can now successfully be used as source materials. Additionally, the analytical power obtained by increasing the number of sequence reads to billions effectively means that contamination issues that have haunted aDNA research for decades, particularly in human studies, can now be efficiently and confidently quantified. At present, whole genomes have been sequenced from ancient anatomically modern humans, archaic hominins, ancient pathogens and megafaunal species. Those have revealed important functional and phenotypic information, as well as unexpected adaptation, migration and admixture patterns. As such, the field of aDNA has entered the new era of genomics and has provided valuable information when testing specific hypotheses related to the past. PMID:25487338

Baculovirus LEF-11 nuclear localization signal is important for viral DNA replication.

PubMed

Chen, Tingting; Dong, Zhanqi; Hu, Nan; Hu, Zhigang; Dong, Feifan; Jiang, Yaming; Li, Jun; Chen, Peng; Lu, Cheng; Pan, Minhui

2017-06-15

Baculovirus LEF-11 is a small nuclear protein that is involved in viral late gene transcription and DNA replication. However, the characteristics of its nuclear localization signal and its impact on viral DNA replication are unknown. In the present study, systemic bioinformatics analysis showed that the baculovirus LEF-11 contains monopartite and bipartite classical nuclear localization signal sequences (cNLSs), which were also detected in a few alphabaculovirus species. Localization of representative LEF-11 proteins of four baculovirus genera indicated that the nuclear localization characteristics of baculovirus LEF-11 coincided with the predicted results. Moreover, Bombyx mori nucleopolyhedrovirus (BmNPV) LEF-11 could be transported into the nucleus during viral infection in the absence of a cNLSs. Further investigations demonstrated that the NLS of BmNPV LEF-11 is important for viral DNA replication. The findings of the present study indicate that the characteristics of the baculovirus LEF-11 protein and the NLS is essential to virus DNA replication and nuclear transport mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.

A 28,000 Years Old Cro-Magnon mtDNA Sequence Differs from All Potentially Contaminating Modern Sequences

PubMed Central

Caramelli, David; Milani, Lucio; Vai, Stefania; Modi, Alessandra; Pecchioli, Elena; Girardi, Matteo; Pilli, Elena; Lari, Martina; Lippi, Barbara; Ronchitelli, Annamaria; Mallegni, Francesco; Casoli, Antonella; Bertorelle, Giorgio; Barbujani, Guido

2008-01-01

Background DNA sequences from ancient speciments may in fact result from undetected contamination of the ancient specimens by modern DNA, and the problem is particularly challenging in studies of human fossils. Doubts on the authenticity of the available sequences have so far hampered genetic comparisons between anatomically archaic (Neandertal) and early modern (Cro-Magnoid) Europeans. Methodology/Principal Findings We typed the mitochondrial DNA (mtDNA) hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23) and in all the people who had contact with the sample since its discovery in 2003. The Paglicci 23 sequence, determined through the analysis of 152 clones, is the Cambridge reference sequence, and cannot possibly reflect contamination because it differs from all potentially contaminating modern sequences. Conclusions/Significance: The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. Because all potential sources of modern DNA contamination are known, the Paglicci 23 sample will offer a unique opportunity to get insight for the first time into the nuclear genes of early modern Europeans. PMID:18628960

[Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

PubMed

Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

2002-06-01

Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.

PubMed

Ricchetti, M; Fairhead, C; Dujon, B

1999-11-04

The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process.

[Phylogenetic relationships among members of the subfamily sedoideae (Crassulaceae) inferred from the ITS region sequences of nuclear rDNA].

PubMed

Goncharova, S B; Artiukova, E V; Goncharov, A A

2006-06-01

Nucleotide sequences of the nuclear rDNA ITS regions were determined in 20 species of the subfamily Sedoideae (Crassulaceae). The phylogenetic relationships of these species with other members of the subfamily, occurring mainly in Southeast Asia, were analyzed. It was shown that the genus Orostachys was not monophyletic; its typical subsection was reliably included into the clade of the genus Hylotelephium. Synapomorphic substitutions and indels, specific for the subsection Orostachys, were detected in ITS1. Sister relationships were established between clades Aizopsis and Phedimus, based on which they can be recognized as isolated genera.

2000 Year-old ancient equids: an ancient-DNA lesson from pompeii remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Galderisi, Umberto; Cipollaro, Marilena

2004-11-15

Ancient DNA extracted from 2000 year-old equine bones was examined in order to amplify mitochondrial and nuclear DNA fragments. A specific equine satellite-type sequence representing 3.7%-11% of the entire equine genome, proved to be a suitable target to address the question of the presence of aDNA in ancient bones. The PCR strategy designed to investigate this specific target also allowed us to calculate the molecular weight of amplifiable DNA fragments. Sequencing of a 370 bp DNA fragment of mitochondrial control region allowed the comparison of ancient DNA sequences with those of modern horses to assess their genetic relationship. The 16S rRNA mitochondrial gene was also examined to unravel the post-mortem base modification feature and to test the status of Pompeian equids taxon on the basis of a Mae III restriction site polymorphism. Copyright 2004 Wiley-Liss, Inc.

DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

Treesearch

Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

2013-01-01

DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

Diversity of the Arabidopsis mitochondrial genome occurs via nuclear-controlled recombination activity.

PubMed

Arrieta-Montiel, Maria P; Shedge, Vikas; Davila, Jaime; Christensen, Alan C; Mackenzie, Sally A

2009-12-01

The plant mitochondrial genome is recombinogenic, with DNA exchange activity controlled to a large extent by nuclear gene products. One nuclear gene, MSH1, appears to participate in suppressing recombination in Arabidopsis at every repeated sequence ranging in size from 108 to 556 bp. Present in a wide range of plant species, these mitochondrial repeats display evidence of successful asymmetric DNA exchange in Arabidopsis when MSH1 is disrupted. Recombination frequency appears to be influenced by repeat sequence homology and size, with larger size repeats corresponding to increased DNA exchange activity. The extensive mitochondrial genomic reorganization of the msh1 mutant produced altered mitochondrial transcription patterns. Comparison of mitochondrial genomes from the Arabidopsis ecotypes C24, Col-0, and Ler suggests that MSH1 activity accounts for most or all of the polymorphisms distinguishing these genomes, producing ecotype-specific stoichiometric changes in each line. Our observations suggest that MSH1 participates in mitochondrial genome evolution by influencing the lineage-specific pattern of mitochondrial genetic variation in higher plants.

The determination of complete human mitochondrial DNA sequences in single cells: implications for the study of somatic mitochondrial DNA point mutations

PubMed Central

Taylor, Robert W.; Taylor, Geoffrey A.; Durham, Steve E.; Turnbull, Douglass M.

2001-01-01

Studies of single cells have previously shown intracellular clonal expansion of mitochondrial DNA (mtDNA) mutations to levels that can cause a focal cytochrome c oxidase (COX) defect. Whilst techniques are available to study mtDNA rearrangements at the level of the single cell, recent interest has focused on the possible role of somatic mtDNA point mutations in ageing, neurodegenerative disease and cancer. We have therefore developed a method that permits the reliable determination of the entire mtDNA sequence from single cells without amplifying contaminating, nuclear-embedded pseudogenes. Sequencing and PCR–RFLP analyses of individual COX-negative muscle fibres from a patient with a previously described heteroplasmic COX II (T7587C) mutation indicate that mutant loads as low as 30% can be reliably detected by sequencing. This technique will be particularly useful in identifying the mtDNA mutational spectra in age-related COX-negative cells and will increase our understanding of the pathogenetic mechanisms by which they occur. PMID:11470889

Genomic treasure troves: complete genome sequencing of herbarium and insect museum specimens.

PubMed

Staats, Martijn; Erkens, Roy H J; van de Vossenberg, Bart; Wieringa, Jan J; Kraaijeveld, Ken; Stielow, Benjamin; Geml, József; Richardson, James E; Bakker, Freek T

2013-01-01

Unlocking the vast genomic diversity stored in natural history collections would create unprecedented opportunities for genome-scale evolutionary, phylogenetic, domestication and population genomic studies. Many researchers have been discouraged from using historical specimens in molecular studies because of both generally limited success of DNA extraction and the challenges associated with PCR-amplifying highly degraded DNA. In today's next-generation sequencing (NGS) world, opportunities and prospects for historical DNA have changed dramatically, as most NGS methods are actually designed for taking short fragmented DNA molecules as templates. Here we show that using a standard multiplex and paired-end Illumina sequencing approach, genome-scale sequence data can be generated reliably from dry-preserved plant, fungal and insect specimens collected up to 115 years ago, and with minimal destructive sampling. Using a reference-based assembly approach, we were able to produce the entire nuclear genome of a 43-year-old Arabidopsis thaliana (Brassicaceae) herbarium specimen with high and uniform sequence coverage. Nuclear genome sequences of three fungal specimens of 22-82 years of age (Agaricus bisporus, Laccaria bicolor, Pleurotus ostreatus) were generated with 81.4-97.9% exome coverage. Complete organellar genome sequences were assembled for all specimens. Using de novo assembly we retrieved between 16.2-71.0% of coding sequence regions, and hence remain somewhat cautious about prospects for de novo genome assembly from historical specimens. Non-target sequence contaminations were observed in 2 of our insect museum specimens. We anticipate that future museum genomics projects will perhaps not generate entire genome sequences in all cases (our specimens contained relatively small and low-complexity genomes), but at least generating vital comparative genomic data for testing (phylo)genetic, demographic and genetic hypotheses, that become increasingly more horizontal. Furthermore, NGS of historical DNA enables recovering crucial genetic information from old type specimens that to date have remained mostly unutilized and, thus, opens up a new frontier for taxonomic research as well.

Identifying the North American plum species phylogenetic signal using nuclear, mitochondrial, and chloroplast DNA markers

USDA-ARS?s Scientific Manuscript database

Premise of the study: Prunus L. phylogeny has extensively studied using cpDNA sequences. CpDNA has a slow rate of evolution which is beneficial to determine species relationships at a deeper level. However, a limitation of the chloroplast based phylogenies is its transfer by interspecific hybridizat...

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

Spatial and temporal plasticity of chromatin during programmed DNA-reorganization in Stylonychia macronuclear development

PubMed Central

Postberg, Jan; Heyse, Katharina; Cremer, Marion; Cremer, Thomas; Lipps, Hans J

2008-01-01

Background: In this study we exploit the unique genome organization of ciliates to characterize the biological function of histone modification patterns and chromatin plasticity for the processing of specific DNA sequences during a nuclear differentiation process. Ciliates are single-cell eukaryotes containing two morphologically and functionally specialized types of nuclei, the somatic macronucleus and the germline micronucleus. In the course of sexual reproduction a new macronucleus develops from a micronuclear derivative. During this process specific DNA sequences are eliminated from the genome, while sequences that will be transcribed in the mature macronucleus are retained. Results: We show by immunofluorescence microscopy, Western analyses and chromatin immunoprecipitation (ChIP) experiments that each nuclear type establishes its specific histone modification signature. Our analyses reveal that the early macronuclear anlage adopts a permissive chromatin state immediately after the fusion of two heterochromatic germline micronuclei. As macronuclear development progresses, repressive histone modifications that specify sequences to be eliminated are introduced de novo. ChIP analyses demonstrate that permissive histone modifications are associated with sequences that will be retained in the new macronucleus. Furthermore, our data support the hypothesis that a PIWI-family protein is involved in a transnuclear cross-talk and in the RNAi-dependent control of developmental chromatin reorganization. Conclusion: Based on these data we present a comprehensive analysis of the spatial and temporal pattern of histone modifications during this nuclear differentiation process. Results obtained in this study may also be relevant for our understanding of chromatin plasticity during metazoan embryogenesis. PMID:19014664

Mechanisms and dynamics of nuclear lamina-genome interactions.

PubMed

Amendola, Mario; van Steensel, Bas

2014-06-01

The nuclear lamina (NL) interacts with the genomic DNA and is thought to influence chromosome organization and gene expression. Both DNA sequences and histone modifications are important for NL tethering of the genomic DNA. These interactions are dynamic in individual cells and can change during differentiation and development. Evidence is accumulating that the NL contributes to the repression of transcription. Advances in mapping, genome-editing and microscopy techniques are increasing our understanding of the molecular mechanisms involved in NL-genome interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.

Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

NASA Astrophysics Data System (ADS)

Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

2016-09-01

Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

Characterization of mtDNA variation in a cohort of South African paediatric patients with mitochondrial disease.

PubMed

van der Walt, Elizna M; Smuts, Izelle; Taylor, Robert W; Elson, Joanna L; Turnbull, Douglass M; Louw, Roan; van der Westhuizen, Francois H

2012-06-01

Mitochondrial disease can be attributed to both mitochondrial and nuclear gene mutations. It has a heterogeneous clinical and biochemical profile, which is compounded by the diversity of the genetic background. Disease-based epidemiological information has expanded significantly in recent decades, but little information is known that clarifies the aetiology in African patients. The aim of this study was to investigate mitochondrial DNA variation and pathogenic mutations in the muscle of diagnosed paediatric patients from South Africa. A cohort of 71 South African paediatric patients was included and a high-throughput nucleotide sequencing approach was used to sequence full-length muscle mtDNA. The average coverage of the mtDNA genome was 81±26 per position. After assigning haplogroups, it was determined that although the nature of non-haplogroup-defining variants was similar in African and non-African haplogroup patients, the number of substitutions were significantly higher in African patients. We describe previously reported disease-associated and novel variants in this cohort. We observed a general lack of commonly reported syndrome-associated mutations, which supports clinical observations and confirms general observations in African patients when using single mutation screening strategies based on (predominantly non-African) mtDNA disease-based information. It is finally concluded that this first extensive report on muscle mtDNA sequences in African paediatric patients highlights the need for a full-length mtDNA sequencing strategy, which applies to all populations where specific mutations is not present. This, in addition to nuclear DNA gene mutation and pathogenicity evaluations, will be required to better unravel the aetiology of these disorders in African patients.

Nuclear genomes distinguish cryptic species suggested by their DNA barcodes and ecology

PubMed Central

Janzen, Daniel H.; Burns, John M.; Cong, Qian; Hallwachs, Winnie; Dapkey, Tanya; Manjunath, Ramya; Hajibabaei, Mehrdad; Hebert, Paul D. N.; Grishin, Nick V.

2017-01-01

DNA sequencing brings another dimension to exploration of biodiversity, and large-scale mitochondrial DNA cytochrome oxidase I barcoding has exposed many potential new cryptic species. Here, we add complete nuclear genome sequencing to DNA barcoding, ecological distribution, natural history, and subtleties of adult color pattern and size to show that a widespread neotropical skipper butterfly known as Udranomia kikkawai (Weeks) comprises three different species in Costa Rica. Full-length barcodes obtained from all three century-old Venezuelan syntypes of U. kikkawai show that it is a rainforest species occurring from Costa Rica to Brazil. The two new species are Udranomia sallydaleyae Burns, a dry forest denizen occurring from Costa Rica to Mexico, and Udranomia tomdaleyi Burns, which occupies the junction between the rainforest and dry forest and currently is known only from Costa Rica. Whereas the three species are cryptic, differing but slightly in appearance, their complete nuclear genomes totaling 15 million aligned positions reveal significant differences consistent with their 0.00065-Mbp (million base pair) mitochondrial barcodes and their ecological diversification. DNA barcoding of tropical insects reared by a massive inventory suggests that the presence of cryptic species is a widespread phenomenon and that further studies will substantially increase current estimates of insect species richness. PMID:28716927

Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing.

PubMed

Hribová, Eva; Neumann, Pavel; Matsumoto, Takashi; Roux, Nicolas; Macas, Jirí; Dolezel, Jaroslav

2010-09-16

Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic diversity studies and in marker-assisted selection.

Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing

PubMed Central

2010-01-01

Background Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. Results In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. Conclusion A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic diversity studies and in marker-assisted selection. PMID:20846365

Unraveling systematic inventory of Echinops (Asteraceae) with special reference to nrDNA ITS sequence-based molecular typing of Echinops abuzinadianus.

PubMed

Ali, M A; Al-Hemaid, F M; Lee, J; Hatamleh, A A; Gyulai, G; Rahman, M O

2015-10-02

The present study explored the systematic inventory of Echinops L. (Asteraceae) of Saudi Arabia, with special reference to the molecular typing of Echinops abuzinadianus Chaudhary, an endemic species to Saudi Arabia, based on the internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) of nuclear ribosomal DNA. A sequence similarity search using BLAST and a phylogenetic analysis of the ITS sequence of E. abuzinadianus revealed a high level of sequence similarity with E. glaberrimus DC. (section Ritropsis). The novel primary sequence and the secondary structure of ITS2 of E. abuzinadianus could potentially be used for molecular genotyping.

Genome-wide mapping of nuclear mitochondrial DNA sequences links DNA replication origins to chromosomal double-strand break formation in Schizosaccharomyces pombe

PubMed Central

Lenglez, Sandrine; Hermand, Damien; Decottignies, Anabelle

2010-01-01

Chromosomal double-strand breaks (DSBs) threaten genome integrity and repair of these lesions is often mutagenic. How and where DSBs are formed is a major question conveniently addressed in simple model organisms like yeast. NUMTs, nuclear DNA sequences of mitochondrial origin, are present in most eukaryotic genomes and probably result from the capture of mitochondrial DNA (mtDNA) fragments into chromosomal breaks. NUMT formation is ongoing and was reported to cause de novo human genetic diseases. Study of NUMTs is likely to contribute to the understanding of naturally occurring chromosomal breaks. We show that Schizosaccharomyces pombe NUMTs are exclusively located in noncoding regions with no preference for gene promoters and, when located into promoters, do not affect gene transcription level. Strikingly, most noncoding regions comprising NUMTs are also associated with a DNA replication origin (ORI). Chromatin immunoprecipitation experiments revealed that chromosomal NUMTs are probably not acting as ORI on their own but that mtDNA insertions occurred directly next to ORIs, suggesting that these loci may be prone to DSB formation. Accordingly, induction of excessive DNA replication origin firing, a phenomenon often associated with human tumor formation, resulted in frequent nucleotide deletion events within ORI3001 subtelomeric chromosomal locus, illustrating a novel aspect of DNA replication-driven genomic instability. How mtDNA is fragmented is another important issue that we addressed by sequencing experimentally induced NUMTs. This highlighted regions of S. pombe mtDNA prone to breaking. Together with an analysis of human NUMTs, we propose that these fragile sites in mtDNA may correspond to replication pause sites. PMID:20688779

Inherited mitochondrial DNA variants can affect complement, inflammation and apoptosis pathways: insights into mitochondrial–nuclear interactions

PubMed Central

Cristina Kenney, M.; Chwa, Marilyn; Atilano, Shari R.; Falatoonzadeh, Payam; Ramirez, Claudio; Malik, Deepika; Tarek, Mohamed; Cáceres-del-Carpio, Javier; Nesburn, Anthony B.; Boyer, David S.; Kuppermann, Baruch D.; Vawter, Marquis; Michal Jazwinski, S.; Miceli, Michael; Wallace, Douglas C.; Udar, Nitin

2014-01-01

Age-related macular degeneration (AMD) is the leading cause of vision loss in developed countries. While linked to genetic polymorphisms in the complement pathway, there are many individuals with high risk alleles that do not develop AMD, suggesting that other ‘modifiers’ may be involved. Mitochondrial (mt) haplogroups, defined by accumulations of specific mtDNA single nucleotide polymorphisms (SNPs) which represent population origins, may be one such modifier. J haplogroup has been associated with high risk for AMD while the H haplogroup is protective. It has been difficult to assign biological consequences for haplogroups so we created human ARPE-19 cybrids (cytoplasmic hybrids), which have identical nuclei but mitochondria of either J or H haplogroups, to investigate their effects upon bioenergetics and molecular pathways. J cybrids have altered bioenergetic profiles compared with H cybrids. Q-PCR analyses show significantly lower expression levels for seven respiratory complex genes encoded by mtDNA. J and H cybrids have significantly altered expression of eight nuclear genes of the alternative complement, inflammation and apoptosis pathways. Sequencing of the entire mtDNA was carried out for all the cybrids to identify haplogroup and non-haplogroup defining SNPs. mtDNA can mediate cellular bioenergetics and expression levels of nuclear genes related to complement, inflammation and apoptosis. Sequencing data suggest that observed effects are not due to rare mtDNA variants but rather the combination of SNPs representing the J versus H haplogroups. These findings represent a paradigm shift in our concepts of mt–nuclear interactions. PMID:24584571

Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

NASA Technical Reports Server (NTRS)

Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

1992-01-01

We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

Revisiting Mendel and the Paradox of Gene Restoration

NASA Astrophysics Data System (ADS)

Lolle, Susan J.

2006-03-01

According to the laws of classical Mendelian genetics, genetic information contained in the nuclear genome is stably inherited and is transmitted from one generation to the next in a predictable manner. Several exceptions to the principle of stable inheritance are known but all represent specialized cases where the mechanisms have been relatively well defined. We have recently demonstrated that Arabidopsis plants can inherit specific DNA sequence information that was not present in the chromosomal genome of their parents. This process appears to occur throughout the nuclear genome. Based on our findings we propose that this process represents a completely novel and hitherto unknown mechanism for the maintenance and inheritance of DNA sequence information.

Conserved Sequences at the Origin of Adenovirus DNA Replication

PubMed Central

Stillman, Bruce W.; Topp, William C.; Engler, Jeffrey A.

1982-01-01

The origin of adenovirus DNA replication lies within an inverted sequence repetition at either end of the linear, double-stranded viral DNA. Initiation of DNA replication is primed by a deoxynucleoside that is covalently linked to a protein, which remains bound to the newly synthesized DNA. We demonstrate that virion-derived DNA-protein complexes from five human adenovirus serological subgroups (A to E) can act as a template for both the initiation and the elongation of DNA replication in vitro, using nuclear extracts from adenovirus type 2 (Ad2)-infected HeLa cells. The heterologous template DNA-protein complexes were not as active as the homologous Ad2 DNA, most probably due to inefficient initiation by Ad2 replication factors. In an attempt to identify common features which may permit this replication, we have also sequenced the inverted terminal repeated DNA from human adenovirus serotypes Ad4 (group E), Ad9 and Ad10 (group D), and Ad31 (group A), and we have compared these to previously determined sequences from Ad2 and Ad5 (group C), Ad7 (group B), and Ad12 and Ad18 (group A) DNA. In all cases, the sequence around the origin of DNA replication can be divided into two structural domains: a proximal A · T-rich region which is partially conserved among these serotypes, and a distal G · C-rich region which is less well conserved. The G · C-rich region contains sequences similar to sequences present in papovavirus replication origins. The two domains may reflect a dual mechanism for initiation of DNA replication: adenovirus-specific protein priming of replication, and subsequent utilization of this primer by host replication factors for completion of DNA synthesis. Images PMID:7143575

Triangulating the provenance of African elephants using mitochondrial DNA

PubMed Central

Ishida, Yasuko; Georgiadis, Nicholas J; Hondo, Tomoko; Roca, Alfred L

2013-01-01

African elephant mitochondrial (mt) DNA follows a distinctive evolutionary trajectory. As females do not migrate between elephant herds, mtDNA exhibits low geographic dispersal. We therefore examined the effectiveness of mtDNA for assigning the provenance of African elephants (or their ivory). For 653 savanna and forest elephants from 22 localities in 13 countries, 4258 bp of mtDNA was sequenced. We detected eight mtDNA subclades, of which seven had regionally restricted distributions. Among 108 unique haplotypes identified, 72% were found at only one locality and 84% were country specific, while 44% of individuals carried a haplotype detected only at their sampling locality. We combined 316 bp of our control region sequences with those generated by previous trans-national surveys of African elephants. Among 101 unique control region haplotypes detected in African elephants across 81 locations in 22 countries, 62% were present in only a single country. Applying our mtDNA results to a previous microsatellite-based assignment study would improve estimates of the provenance of elephants in 115 of 122 mis-assigned cases. Nuclear partitioning followed species boundaries and not mtDNA subclade boundaries. For taxa such as elephants in which nuclear and mtDNA markers differ in phylogeography, combining the two markers can triangulate the origins of confiscated wildlife products. PMID:23798975

Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

USGS Publications Warehouse

Hoy, Marshal S.; Rodriguez, Rusty J.

2013-01-01

Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

Coprolites as a source of information on the genome and diet of the cave hyena

PubMed Central

Bon, Céline; Berthonaud, Véronique; Maksud, Frédéric; Labadie, Karine; Poulain, Julie; Artiguenave, François; Wincker, Patrick; Aury, Jean-Marc; Elalouf, Jean-Marc

2012-01-01

We performed high-throughput sequencing of DNA from fossilized faeces to evaluate this material as a source of information on the genome and diet of Pleistocene carnivores. We analysed coprolites derived from the extinct cave hyena (Crocuta crocuta spelaea), and sequenced 90 million DNA fragments from two specimens. The DNA reads enabled a reconstruction of the cave hyena mitochondrial genome with up to a 158-fold coverage. This genome, and those sequenced from extant spotted (Crocuta crocuta) and striped (Hyaena hyaena) hyena specimens, allows for the establishment of a robust phylogeny that supports a close relationship between the cave and the spotted hyena. We also demonstrate that high-throughput sequencing yields data for cave hyena multi-copy and single-copy nuclear genes, and that about 50 per cent of the coprolite DNA can be ascribed to this species. Analysing the data for additional species to indicate the cave hyena diet, we retrieved abundant sequences for the red deer (Cervus elaphus), and characterized its mitochondrial genome with up to a 3.8-fold coverage. In conclusion, we have demonstrated the presence of abundant ancient DNA in the coprolites surveyed. Shotgun sequencing of this material yielded a wealth of DNA sequences for a Pleistocene carnivore and allowed unbiased identification of diet. PMID:22456883

Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A

PubMed Central

Kelly, Richard D. W.; Mahmud, Arsalan; McKenzie, Matthew; Trounce, Ian A.; St John, Justin C.

2012-01-01

DNA methylation is an essential mechanism controlling gene expression during differentiation and development. We investigated the epigenetic regulation of the nuclear-encoded, mitochondrial DNA (mtDNA) polymerase γ catalytic subunit (PolgA) by examining the methylation status of a CpG island within exon 2 of PolgA. Bisulphite sequencing identified low methylation levels (<10%) within exon 2 of mouse oocytes, blastocysts and embryonic stem cells (ESCs), while somatic tissues contained significantly higher levels (>40%). In contrast, induced pluripotent stem (iPS) cells and somatic nuclear transfer ESCs were hypermethylated (>20%), indicating abnormal epigenetic reprogramming. Real time PCR analysis of 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) immunoprecipitated DNA suggests active DNA methylation and demethylation within exon 2 of PolgA. Moreover, neural differentiation of ESCs promoted de novo methylation and demethylation at the exon 2 locus. Regression analysis demonstrates that cell-specific PolgA expression levels were negatively correlated with DNA methylation within exon 2 and mtDNA copy number. Finally, using chromatin immunoprecipitation (ChIP) against RNA polymerase II (RNApII) phosphorylated on serine 2, we show increased DNA methylation levels are associated with reduced RNApII transcriptional elongation. This is the first study linking nuclear DNA epigenetic regulation with mtDNA regulation during differentiation and cell specialization. PMID:22941637

Repetitive sequences in plant nuclear DNA: types, distribution, evolution and function.

PubMed

Mehrotra, Shweta; Goyal, Vinod

2014-08-01

Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150-400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as "tuning knobs" in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. Copyright © 2014 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

PubMed

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Nucleo-cytoplasmic shuttling of the endonuclease ankyrin repeats and LEM domain-containing protein 1 (Ankle1) is mediated by canonical nuclear export- and nuclear import signals.

PubMed

Zlopasa, Livija; Brachner, Andreas; Foisner, Roland

2016-06-01

Ankyrin repeats and LEM domain containing protein 1 (Ankle1) belongs to the LEM protein family, whose members share a chromatin-interacting LEM motif. Unlike most other LEM proteins, Ankle1 is not an integral protein of the inner nuclear membrane but shuttles between the nucleus and the cytoplasm. It contains a GIY-YIG-type nuclease domain, but its function is unknown. The mammalian genome encodes only one other GIY-YIG domain protein, termed Slx1. Slx1 has been described as a resolvase that processes Holliday junctions during homologous recombination-mediated DNA double strand break repair. Resolvase activity is regulated in a spatial and temporal manner during the cell cycle. We hypothesized that Ankle1 may have a similar function and its nucleo-cytoplasmic shuttling may contribute to the regulation of Ankle1 activity. Hence, we aimed at identifying the domains mediating Ankle1 shuttling and investigating whether cellular localization is affected during DNA damage response. Sequence analysis predicts the presence of two canonical nuclear import and export signals in Ankle1. Immunofluorescence microscopy of cells expressing wild-type and various mutated Ankle1-fusion proteins revealed a C-terminally located classical monopartite nuclear localization signal and a centrally located CRM1-dependent nuclear export signal that mediate nucleo-cytoplasmic shuttling of Ankle1. These sequences are also functional in heterologous proteins. The predominant localization of Ankle1 in the cytoplasm, however, does not change upon induction of several DNA damage response pathways throughout the cell cycle. We identified the domains mediating nuclear import and export of Ankle1. Ankle1's cellular localization was not affected following DNA damage.

Sunflower centromeres consist of a centromere-specific LINE and a chromosome-specific tandem repeat.

PubMed

Nagaki, Kiyotaka; Tanaka, Keisuke; Yamaji, Naoki; Kobayashi, Hisato; Murata, Minoru

2015-01-01

The kinetochore is a protein complex including kinetochore-specific proteins that plays a role in chromatid segregation during mitosis and meiosis. The complex associates with centromeric DNA sequences that are usually species-specific. In plant species, tandem repeats including satellite DNA sequences and retrotransposons have been reported as centromeric DNA sequences. In this study on sunflowers, a cDNA-encoding centromere-specific histone H3 (CENH3) was isolated from a cDNA pool from a seedling, and an antibody was raised against a peptide synthesized from the deduced cDNA. The antibody specifically recognized the sunflower CENH3 (HaCENH3) and showed centromeric signals by immunostaining and immunohistochemical staining analysis. The antibody was also applied in chromatin immunoprecipitation (ChIP)-Seq to isolate centromeric DNA sequences and two different types of repetitive DNA sequences were identified. One was a long interspersed nuclear element (LINE)-like sequence, which showed centromere-specific signals on almost all chromosomes in sunflowers. This is the first report of a centromeric LINE sequence, suggesting possible centromere targeting ability. Another type of identified repetitive DNA was a tandem repeat sequence with a 187-bp unit that was found only on a pair of chromosomes. The HaCENH3 content of the tandem repeats was estimated to be much higher than that of the LINE, which implies centromere evolution from LINE-based centromeres to more stable tandem-repeat-based centromeres. In addition, the epigenetic status of the sunflower centromeres was investigated by immunohistochemical staining and ChIP, and it was found that centromeres were heterochromatic.

Intra-isolate genome variation in arbuscular mycorrhizal fungi persists in the transcriptome.

PubMed

Boon, E; Zimmerman, E; Lang, B F; Hijri, M

2010-07-01

Arbuscular mycorrhizal fungi (AMF) are heterokaryotes with an unusual genetic makeup. Substantial genetic variation occurs among nuclei within a single mycelium or isolate. AMF reproduce through spores that contain varying fractions of this heterogeneous population of nuclei. It is not clear whether this genetic variation on the genome level actually contributes to the AMF phenotype. To investigate the extent to which polymorphisms in nuclear genes are transcribed, we analysed the intra-isolate genomic and cDNA sequence variation of two genes, the large subunit ribosomal RNA (LSU rDNA) of Glomus sp. DAOM-197198 (previously known as G. intraradices) and the POL1-like sequence (PLS) of Glomus etunicatum. For both genes, we find high sequence variation at the genome and transcriptome level. Reconstruction of LSU rDNA secondary structure shows that all variants are functional. Patterns of PLS sequence polymorphism indicate that there is one functional gene copy, PLS2, which is preferentially transcribed, and one gene copy, PLS1, which is a pseudogene. This is the first study that investigates AMF intra-isolate variation at the transcriptome level. In conclusion, it is possible that, in AMF, multiple nuclear genomes contribute to a single phenotype.

Overexpression of Nrp/b (nuclear restrict protein in brain) suppresses the malignant phenotype in the C6/ST1 glioma cell line.

PubMed

Degaki, Theri Leica; Demasi, Marcos Angelo Almeida; Sogayar, Mari Cleide

2009-11-01

Upon searching for glucocorticoid-regulated cDNA sequences associated with the transformed to normal phenotypic reversion of C6/ST1 rat glioma cells, we identified Nrp/b (nuclear restrict protein in brain) as a novel rat gene. Here we report on the identification and functional characterization of the complete sequence encoding the rat NRP/B protein. The cloned cDNA presented a 1767 nucleotides open-reading frame encoding a 589 amino acids residues sequence containing a BTB/POZ (broad complex Tramtrack bric-a-brac/Pox virus and zinc finger) domain in its N-terminal region and kelch motifs in its C-terminal region. Sequence analysis indicates that the rat Nrp/b displays a high level of identity with the equivalent gene orthologs from other organisms. Among rat tissues, Nrp/b expression is more pronounced in brain tissue. We show that overexpression of the Nrp/b cDNA in C6/ST1 cells suppresses anchorage independence in vitro and tumorigenicity in vivo, altering their malignant nature towards a more benign phenotype. Therefore, Nrp/b may be postulated as a novel tumor suppressor gene, with possible relevance for glioblastoma therapy.

The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.

2012-10-25

The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealedmore » that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.« less

Ecological niche modelling and nDNA sequencing support a new, morphologically cryptic beetle species unveiled by DNA barcoding.

PubMed

Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

2011-02-09

DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.

Ecological Niche Modelling and nDNA Sequencing Support a New, Morphologically Cryptic Beetle Species Unveiled by DNA Barcoding

PubMed Central

Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

2011-01-01

Background DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. Methodology/Principal Findings The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. Conclusion/Significance In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species. PMID:21347370

Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

PubMed

Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

1987-08-01

To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation.

PubMed

Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H; Proukakis, Christos

2017-01-01

Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array "waves", and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance.

DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation

PubMed Central

Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M.; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H.

2017-01-01

Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array “waves”, and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance. PMID:28683077

The nuclear higher-order structure defined by the set of topological relationships between DNA and the nuclear matrix is species-specific in hepatocytes.

PubMed

Silva-Santiago, Evangelina; Pardo, Juan Pablo; Hernández-Muñoz, Rolando; Aranda-Anzaldo, Armando

2017-01-15

During the interphase the nuclear DNA of metazoan cells is organized in supercoiled loops anchored to constituents of a nuclear substructure or compartment known as the nuclear matrix. The stable interactions between DNA and the nuclear matrix (NM) correspond to a set of topological relationships that define a nuclear higher-order structure (NHOS). Current evidence suggests that the NHOS is cell-type-specific. Biophysical evidence and theoretical models suggest that thermodynamic and structural constraints drive the actualization of DNA-NM interactions. However, if the topological relationships between DNA and the NM were the subject of any biological constraint with functional significance then they must be adaptive and thus be positively selected by natural selection and they should be reasonably conserved, at least within closely related species. We carried out a coarse-grained, comparative evaluation of the DNA-NM topological relationships in primary hepatocytes from two closely related mammals: rat and mouse, by determining the relative position to the NM of a limited set of target sequences corresponding to highly-conserved genomic regions that also represent a sample of distinct chromosome territories within the interphase nucleus. Our results indicate that the pattern of topological relationships between DNA and the NM is not conserved between the hepatocytes of the two closely related species, suggesting that the NHOS, like the karyotype, is species-specific. Copyright © 2016 Elsevier B.V. All rights reserved.

PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.

PubMed

Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q

2007-01-01

Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.

DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing.

PubMed

Castle, John C; Biery, Matthew; Bouzek, Heather; Xie, Tao; Chen, Ronghua; Misura, Kira; Jackson, Stuart; Armour, Christopher D; Johnson, Jason M; Rohl, Carol A; Raymond, Christopher K

2010-04-16

DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. The described assay outputs absolute copy number, outputs an error estimate (p-value), and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads.

DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing

PubMed Central

2010-01-01

Background DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. Results We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. Conclusion The described assay outputs absolute copy number, outputs an error estimate (p-value), and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads. PMID:20398377

Reconciling Apparent Conflicts between Mitochondrial and Nuclear Phylogenies in African Elephants

PubMed Central

Georgiadis, Nicholas J.; David, Victor A.; Zhao, Kai; Stephens, Robert M.; Kolokotronis, Sergios-Orestis; Roca, Alfred L.

2011-01-01

Conservation strategies for African elephants would be advanced by resolution of conflicting claims that they comprise one, two, three or four taxonomic groups, and by development of genetic markers that establish more incisively the provenance of confiscated ivory. We addressed these related issues by genotyping 555 elephants from across Africa with microsatellite markers, developing a method to identify those loci most effective at geographic assignment of elephants (or their ivory), and conducting novel analyses of continent-wide datasets of mitochondrial DNA. Results showed that nuclear genetic diversity was partitioned into two clusters, corresponding to African forest elephants (99.5% Cluster-1) and African savanna elephants (99.4% Cluster-2). Hybrid individuals were rare. In a comparison of basal forest “F” and savanna “S” mtDNA clade distributions to nuclear DNA partitions, forest elephant nuclear genotypes occurred only in populations in which S clade mtDNA was absent, suggesting that nuclear partitioning corresponds to the presence or absence of S clade mtDNA. We reanalyzed African elephant mtDNA sequences from 81 locales spanning the continent and discovered that S clade mtDNA was completely absent among elephants at all 30 sampled tropical forest locales. The distribution of savanna nuclear DNA and S clade mtDNA corresponded closely to range boundaries traditionally ascribed to the savanna elephant species based on habitat and morphology. Further, a reanalysis of nuclear genetic assignment results suggested that West African elephants do not comprise a distinct third species. Finally, we show that some DNA markers will be more useful than others for determining the geographic origins of illegal ivory. These findings resolve the apparent incongruence between mtDNA and nuclear genetic patterns that has confounded the taxonomy of African elephants, affirm the limitations of using mtDNA patterns to infer elephant systematics or population structure, and strongly support the existence of two elephant species in Africa. PMID:21701575

Genetic characterization of Common Eiders breeding in the Yukon-Kuskokwim Delta, Alaska

USGS Publications Warehouse

Sonsthagen, Sarah A.; Talbot, Sandra L.; McCracken, Kevin G.

2007-01-01

We assessed population genetic subdivision among four colonies of Common Eiders (Somateria mollissima v-nigrum) breeding in the Yukon-Kuskokwim Delta (YKD), Alaska, using microsatellite genotypes and DNA sequences with differing modes of inheritance. Significant, albeit low, levels of genetic differentiation were observed between mainland populations and Kigigak Island for nuclear intron lamin A and mitochondrial DNA (mtDNA) control region. Intercolony variation in haplotypic frequencies also was observed at mtDNA. Positive growth signatures assayed from microsatellites, nuclear introns, and mtDNA indicate recent colonization of the YKD, and may explain the low levels of structuring observed. Gene flow estimates based on microsatellites, nuclear introns, and mtDNA suggest asymmetrical gene flow between mainland colonies and Kigigak Island, with more individuals on average dispersing from mainland populations to Kigigak Island than vice versa. The directionality of gene flow observed may be explained by the colonization of the YKD from northern glacial refugia or by YKD metapopulation dynamics.

A novel method of genomic DNA extraction for Cactaceae1

PubMed Central

Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

2013-01-01

• Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

PubMed Central

Ridley, R G; Patel, H V; Gerber, G E; Morton, R C; Freeman, K B

1986-01-01

A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a targeting region must reside within the amino acid sequence of the mature protein. Images PMID:3012461

Intersectional gene flow between insular endemics of Ilex (Aquifoliaceae) on the Bonin Islands and the Ryukyu Islands.

PubMed

Setoguchi, H; Watanabe, I

2000-06-01

Hybridization and introgression play important roles in plant evolution, and their occurrence on the oceanic islands provides good examples of plant speciation and diversification. Restriction fragment length polymorphisms (RFLPs) and trnL (UAA) 3'exon-trnF (GAA) intergenic spacer (IGS) sequences of chloroplast DNA (cpDNA), and the sequences of internal transcribed spacer (ITS) of nuclear ribosomal DNA were examined to investigate the occurrence of gene transfer in Ilex species on the Bonin Islands and the Ryukyu Islands in Japan. A gene phylogeny for the plastid genome is in agreement with the morphologically based taxonomy, whereas the nuclear genome phylogeny clusters putatively unrelated endemics both on the Bonin and the Ryukyu Islands. Intersectional hybridization and nuclear gene flow were independently observed in insular endemics of Ilex on both sets of islands without evidence of plastid introgression. Gene flow observed in these island systems can be explained by ecological features of insular endemics, i.e., limits of distribution range or sympatric distribution in a small land area.

The problems and promise of DNA barcodes for species diagnosis of primate biomaterials

PubMed Central

Lorenz, Joseph G; Jackson, Whitney E; Beck, Jeanne C; Hanner, Robert

2005-01-01

The Integrated Primate Biomaterials and Information Resource (www.IPBIR.org) provides essential research reagents to the scientific community by establishing, verifying, maintaining, and distributing DNA and RNA derived from primate cell cultures. The IPBIR uses mitochondrial cytochrome c oxidase subunit I sequences to verify the identity of samples for quality control purposes in the accession, cell culture, DNA extraction processes and prior to shipping to end users. As a result, IPBIR is accumulating a database of ‘DNA barcodes’ for many species of primates. However, this quality control process is complicated by taxon specific patterns of ‘universal primer’ failure, as well as the amplification or co-amplification of nuclear pseudogenes of mitochondrial origins. To overcome these difficulties, taxon specific primers have been developed, and reverse transcriptase PCR is utilized to exclude these extraneous sequences from amplification. DNA barcoding of primates has applications to conservation and law enforcement. Depositing barcode sequences in a public database, along with primer sequences, trace files and associated quality scores, makes this species identification technique widely accessible. Reference DNA barcode sequences should be derived from, and linked to, specimens of known provenance in web-accessible collections in order to validate this system of molecular diagnostics. PMID:16214744

Evolutionary dynamics of emblematic Araucaria species (Araucariaceae) in New Caledonia: nuclear and chloroplast markers suggest recent diversification, introgression, and a tight link between genetics and geography within species.

PubMed

Gaudeul, Myriam; Gardner, Martin F; Thomas, Philip; Ennos, Richard A; Hollingsworth, Pete M

2014-09-05

New Caledonia harbours a highly diverse and endemic flora, and 13 (out of the 19 worldwide) species of Araucaria are endemic to this territory. Their phylogenetic relationships remain largely unresolved. Using nuclear microsatellites and chloroplast DNA sequencing, we focused on five closely related Araucaria species to investigate among-species relationships and the distribution of within-species genetic diversity across New Caledonia. The species could be clearly distinguished here, except A. montana and A. laubenfelsii that were not differentiated and, at most, form a genetic cline. Given their apparent morphological and ecological similarity, we suggested that these two species may be considered as a single evolutionary unit. We observed cases of nuclear admixture and incongruence between nuclear and chloroplast data, probably explained by introgression and shared ancestral polymorphism. Ancient hybridization was evidenced between A. biramulata and A. laubenfelsii in Mt Do, and is strongly suspected between A. biramulata and A. rulei in Mt Tonta. In both cases, extensive asymmetrical backcrossing eliminated the influence of one parent in the nuclear DNA composition. Shared ancestral polymorphism was also observed for cpDNA, suggesting that species diverged recently, have large effective sizes and/or that cpDNA experienced slow rates of molecular evolution. Within-species genetic structure was pronounced, probably because of low gene flow and significant inbreeding, and appeared clearly influenced by geography. This may be due to survival in distinct refugia during Quaternary climatic oscillations. The study species probably diverged recently and/or are characterized by a slow rate of cpDNA sequence evolution, and introgression is strongly suspected. Within-species genetic structure is tightly linked with geography. We underline the conservation implications of our results, and highlight several perspectives.

Molecular phylogeny and character evolution in terete-stemmed Andean opuntias (Cactaceae-Opuntioideae).

PubMed

Ritz, C M; Reiker, J; Charles, G; Hoxey, P; Hunt, D; Lowry, M; Stuppy, W; Taylor, N

2012-11-01

The cacti of tribe Tephrocacteae (Cactaceae-Opuntioideae) are adapted to diverse climatic conditions over a wide area of the southern Andes and adjacent lowlands. They exhibit a range of life forms from geophytes and cushion-plants to dwarf shrubs, shrubs or small trees. To confirm or challenge previous morphology-based classifications and molecular phylogenies, we sampled DNA sequences from the chloroplast trnK/matK region and the nuclear low copy gene phyC and compared the resulting phylogenies with previous data gathered from nuclear ribosomal DNA sequences. The here presented chloroplast and nuclear low copy gene phylogenies were mutually congruent and broadly coincident with the classification based on gross morphology and seed micro-morphology and anatomy. Reconstruction of hypothetical ancestral character states suggested that geophytes and cushion-forming species probably evolved several times from dwarf shrubby precursors. We also traced an increase of embryo size at the expense of the nucellus-derived storage tissue during the evolution of the Tephrocacteae, which is thought to be an evolutionary advantage because nutrients are then more rapidly accessible for the germinating embryo. In contrast to these highly concordant phylogenies, nuclear ribosomal DNA data sampled by a previous study yielded conflicting phylogenetic signals. Secondary structure predictions of ribosomal transcribed spacers suggested that this phylogeny is strongly influenced by the inclusion of paralogous sequence probably arisen by genome duplication during the evolution of this plant group. Copyright © 2012 Elsevier Inc. All rights reserved.

DNA sequence-dependent compartmentalization and silencing of chromatin at the nuclear lamina.

PubMed

Zullo, Joseph M; Demarco, Ignacio A; Piqué-Regi, Roger; Gaffney, Daniel J; Epstein, Charles B; Spooner, Chauncey J; Luperchio, Teresa R; Bernstein, Bradley E; Pritchard, Jonathan K; Reddy, Karen L; Singh, Harinder

2012-06-22

A large fraction of the mammalian genome is organized into inactive chromosomal domains along the nuclear lamina. The mechanism by which these lamina associated domains (LADs) are established remains to be elucidated. Using genomic repositioning assays, we show that LADs, spanning the developmentally regulated IgH and Cyp3a loci contain discrete DNA regions that associate chromatin with the nuclear lamina and repress gene activity in fibroblasts. Lamina interaction is established during mitosis and likely involves the localized recruitment of Lamin B during late anaphase. Fine-scale mapping of LADs reveals numerous lamina-associating sequences (LASs), which are enriched for a GAGA motif. This repeated motif directs lamina association and is bound by the transcriptional repressor cKrox, in a complex with HDAC3 and Lap2β. Knockdown of cKrox or HDAC3 results in dissociation of LASs/LADs from the nuclear lamina. These results reveal a mechanism that couples nuclear compartmentalization of chromatin domains with the control of gene activity. Copyright © 2012 Elsevier Inc. All rights reserved.

From cheek swabs to consensus sequences: an A to Z protocol for high-throughput DNA sequencing of complete human mitochondrial genomes

PubMed Central

2014-01-01

Background Next-generation DNA sequencing (NGS) technologies have made huge impacts in many fields of biological research, but especially in evolutionary biology. One area where NGS has shown potential is for high-throughput sequencing of complete mtDNA genomes (of humans and other animals). Despite the increasing use of NGS technologies and a better appreciation of their importance in answering biological questions, there remain significant obstacles to the successful implementation of NGS-based projects, especially for new users. Results Here we present an ‘A to Z’ protocol for obtaining complete human mitochondrial (mtDNA) genomes – from DNA extraction to consensus sequence. Although designed for use on humans, this protocol could also be used to sequence small, organellar genomes from other species, and also nuclear loci. This protocol includes DNA extraction, PCR amplification, fragmentation of PCR products, barcoding of fragments, sequencing using the 454 GS FLX platform, and a complete bioinformatics pipeline (primer removal, reference-based mapping, output of coverage plots and SNP calling). Conclusions All steps in this protocol are designed to be straightforward to implement, especially for researchers who are undertaking next-generation sequencing for the first time. The molecular steps are scalable to large numbers (hundreds) of individuals and all steps post-DNA extraction can be carried out in 96-well plate format. Also, the protocol has been assembled so that individual ‘modules’ can be swapped out to suit available resources. PMID:24460871

Mitochondrial sequence analysis for forensic identification using pyrosequencing technology.

PubMed

Andréasson, H; Asp, A; Alderborn, A; Gyllensten, U; Allen, M

2002-01-01

Over recent years, requests for mtDNA analysis in the field of forensic medicine have notably increased, and the results of such analyses have proved to be very useful in forensic cases where nuclear DNA analysis cannot be performed. Traditionally, mtDNA has been analyzed by DNA sequencing of the two hypervariable regions, HVI and HVII, in the D-loop. DNA sequence analysis using the conventional Sanger sequencing is very robust but time consuming and labor intensive. By contrast, mtDNA analysis based on the pyrosequencing technology provides fast and accurate results from the human mtDNA present in many types of evidence materials in forensic casework. The assay has been developed to determine polymorphic sites in the mitochondrial D-loop as well as the coding region to further increase the discrimination power of mtDNA analysis. The pyrosequencing technology for analysis of mtDNA polymorphisms has been tested with regard to sensitivity, reproducibility, and success rate when applied to control samples and actual casework materials. The results show that the method is very accurate and sensitive; the results are easily interpreted and provide a high success rate on casework samples. The panel of pyrosequencing reactions for the mtDNA polymorphisms were chosen to result in an optimal discrimination power in relation to the number of bases determined.

Phylogeny and temporal diversification of darters (Percidae: Etheostomatinae).

PubMed

Near, Thomas J; Bossu, Christen M; Bradburd, Gideon S; Carlson, Rose L; Harrington, Richard C; Hollingsworth, Phillip R; Keck, Benjamin P; Etnier, David A

2011-10-01

Discussions aimed at resolution of the Tree of Life are most often focused on the interrelationships of major organismal lineages. In this study, we focus on the resolution of some of the most apical branches in the Tree of Life through exploration of the phylogenetic relationships of darters, a species-rich clade of North American freshwater fishes. With a near-complete taxon sampling of close to 250 species, we aim to investigate strategies for efficient multilocus data sampling and the estimation of divergence times using relaxed-clock methods when a clade lacks a fossil record. Our phylogenetic data set comprises a single mitochondrial DNA (mtDNA) gene and two nuclear genes sampled from 245 of the 248 darter species. This dense sampling allows us to determine if a modest amount of nuclear DNA sequence data can resolve relationships among closely related animal species. Darters lack a fossil record to provide age calibration priors in relaxed-clock analyses. Therefore, we use a near-complete species-sampled phylogeny of the perciform clade Centrarchidae, which has a rich fossil record, to assess two distinct strategies of external calibration in relaxed-clock divergence time estimates of darters: using ages inferred from the fossil record and molecular evolutionary rate estimates. Comparison of Bayesian phylogenies inferred from mtDNA and nuclear genes reveals that heterospecific mtDNA is present in approximately 12.5% of all darter species. We identify three patterns of mtDNA introgression in darters: proximal mtDNA transfer, which involves the transfer of mtDNA among extant and sympatric darter species, indeterminate introgression, which involves the transfer of mtDNA from a lineage that cannot be confidently identified because the introgressed haplotypes are not clearly referable to mtDNA haplotypes in any recognized species, and deep introgression, which is characterized by species diversification within a recipient clade subsequent to the transfer of heterospecific mtDNA. The results of our analyses indicate that DNA sequences sampled from single-copy nuclear genes can provide appreciable phylogenetic resolution for closely related animal species. A well-resolved near-complete species-sampled phylogeny of darters was estimated with Bayesian methods using a concatenated mtDNA and nuclear gene data set with all identified heterospecific mtDNA haplotypes treated as missing data. The relaxed-clock analyses resulted in very similar posterior age estimates across the three sampled genes and methods of calibration and therefore offer a viable strategy for estimating divergence times for clades that lack a fossil record. In addition, an informative rank-free clade-based classification of darters that preserves the rich history of nomenclature in the group and provides formal taxonomic communication of darter clades was constructed using the mtDNA and nuclear gene phylogeny. On the whole, the appeal of mtDNA for phylogeny inference among closely related animal species is diminished by the observations of extensive mtDNA introgression and by finding appreciable phylogenetic signal in a modest sampling of nuclear genes in our phylogenetic analyses of darters.

Nuclear targeting of viral and non-viral DNA.

PubMed

Chowdhury, E H

2009-07-01

The nuclear envelope presents a major barrier to transgene delivery and expression using a non-viral vector. Virus is capable of overcoming the barrier to deliver their genetic materials efficiently into the nucleus by virtue of the specialized protein components with the unique amino acid sequences recognizing cellular nuclear transport machinery. However, considering the safety issues in the clinical gene therapy for treating critical human diseases, non-viral systems are highly promising compared with their viral counterparts. This review summarizes the progress on exploring the nuclear traffic mechanisms for the prominent viral vectors and the technological innovations for the nuclear delivery of non-viral DNA by mimicking those natural processes evolved for the viruses as well as for many cellular proteins.

Quantitation of heteroplasmy of mtDNA sequence variants identified in a population of AD patients and controls by array-based resequencing.

PubMed

Coon, Keith D; Valla, Jon; Szelinger, Szabolics; Schneider, Lonnie E; Niedzielko, Tracy L; Brown, Kevin M; Pearson, John V; Halperin, Rebecca; Dunckley, Travis; Papassotiropoulos, Andreas; Caselli, Richard J; Reiman, Eric M; Stephan, Dietrich A

2006-08-01

The role of mitochondrial dysfunction in the pathogenesis of Alzheimer's disease (AD) has been well documented. Though evidence for the role of mitochondria in AD seems incontrovertible, the impact of mitochondrial DNA (mtDNA) mutations in AD etiology remains controversial. Though mutations in mitochondrially encoded genes have repeatedly been implicated in the pathogenesis of AD, many of these studies have been plagued by lack of replication as well as potential contamination of nuclear-encoded mitochondrial pseudogenes. To assess the role of mtDNA mutations in the pathogenesis of AD, while avoiding the pitfalls of nuclear-encoded mitochondrial pseudogenes encountered in previous investigations and showcasing the benefits of a novel resequencing technology, we sequenced the entire coding region (15,452 bp) of mtDNA from 19 extremely well-characterized AD patients and 18 age-matched, unaffected controls utilizing a new, reliable, high-throughput array-based resequencing technique, the Human MitoChip. High-throughput, array-based DNA resequencing of the entire mtDNA coding region from platelets of 37 subjects revealed the presence of 208 loci displaying a total of 917 sequence variants. There were no statistically significant differences in overall mutational burden between cases and controls, however, 265 independent sites of statistically significant change between cases and controls were identified. Changed sites were found in genes associated with complexes I (30.2%), III (3.0%), IV (33.2%), and V (9.1%) as well as tRNA (10.6%) and rRNA (14.0%). Despite their statistical significance, the subtle nature of the observed changes makes it difficult to determine whether they represent true functional variants involved in AD etiology or merely naturally occurring dissimilarity. Regardless, this study demonstrates the tremendous value of this novel mtDNA resequencing platform, which avoids the pitfalls of erroneously amplifying nuclear-encoded mtDNA pseudogenes, and our proposed analysis paradigm, which utilizes the availability of raw signal intensity values for each of the four potential alleles to facilitate quantitative estimates of mtDNA heteroplasmy. This information provides a potential new target for burgeoning diagnostics and therapeutics that could truly assist those suffering from this devastating disorder.

The Neandertal genome and ancient DNA authenticity

PubMed Central

Green, Richard E; Briggs, Adrian W; Krause, Johannes; Prüfer, Kay; Burbano, Hernán A; Siebauer, Michael; Lachmann, Michael; Pääbo, Svante

2009-01-01

Recent advances in high-thoughput DNA sequencing have made genome-scale analyses of genomes of extinct organisms possible. With these new opportunities come new difficulties in assessing the authenticity of the DNA sequences retrieved. We discuss how these difficulties can be addressed, particularly with regard to analyses of the Neandertal genome. We argue that only direct assays of DNA sequence positions in which Neandertals differ from all contemporary humans can serve as a reliable means to estimate human contamination. Indirect measures, such as the extent of DNA fragmentation, nucleotide misincorporations, or comparison of derived allele frequencies in different fragment size classes, are unreliable. Fortunately, interim approaches based on mtDNA differences between Neandertals and current humans, detection of male contamination through Y chromosomal sequences, and repeated sequencing from the same fossil to detect autosomal contamination allow initial large-scale sequencing of Neandertal genomes. This will result in the discovery of fixed differences in the nuclear genome between Neandertals and current humans that can serve as future direct assays for contamination. For analyses of other fossil hominins, which may become possible in the future, we suggest a similar ‘boot-strap' approach in which interim approaches are applied until sufficient data for more definitive direct assays are acquired. PMID:19661919

SINE sequences detect DNA fingerprints in salmonid fishes.

PubMed

Spruell, P; Thorgaard, G H

1996-04-01

DNA probes homologous to two previously described salmonid short interspersed nuclear elements (SINEs) detected DNA fingerprint patterns in 14 species of salmonid fishes. The probes showed more homology to some species than to others and little homology to three nonsalmonid fishes. The DNA fingerprint patterns derived from the SINE probes are individual-specific and inherited in a Mendelian manner. Probes derived from different regions of the same SINE detect only partially overlapping banding patterns, reflecting a more complex SINE structure than has been previously reported. Like the human Alu sequence, the SINEs found in salmonids could provide useful genetic markers and primer sites for PCR-based techniques. These elements may be more desirable for some applications than traditional DNA fingerprinting probes that detect tandemly repeated arrays.

Purification and partial sequencing of the nuclear autoantigen RA33 shows that it is indistinguishable from the A2 protein of the heterogeneous nuclear ribonucleoprotein complex.

PubMed Central

Steiner, G; Hartmuth, K; Skriner, K; Maurer-Fogy, I; Sinski, A; Thalmann, E; Hassfeld, W; Barta, A; Smolen, J S

1992-01-01

RA33 is a nuclear autoantigen with an apparent molecular mass of 33 kD. Autoantibodies against RA33 are found in about 30% of sera from RA patients, but only occasionally in sera from patients with other connective tissue diseases. To characterize RA33, the antigen was purified from HeLa cell nuclear extracts to more than 90% homogeneity by affinity chromatography on heparin-Sepharose and by chromatofocusing. Sequence analysis of five tryptic peptides revealed that their sequences matched corresponding sequences of the A2 protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. Furthermore, RA33 was shown to be present in the 40S hnRNP complex and to behave indistinguishably from A2 in binding to single stranded DNA. In summary, these data strongly indicate that RA33 and A2 are the same protein, and thus identify on a molecular level a new autoantigen. Images PMID:1522214

Sequence analysis of the 5.8S ribosomal DNA and internal transcribed spacers (ITS1 and ITS2) from five species of the Oxalis tuberosa alliance.

PubMed

Tosto, D S; Hopp, H E

1996-01-01

The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.

Elucidating polyploidization of bermudagrasses as assessed by organelle and nuclear DNA markers.

PubMed

Gulsen, Osman; Ceylan, Ahmet

2011-12-01

Clarification of relationships among ploidy series of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to elucidate polyploidization among Cynodon accessions with different ploidy series collected from Turkey based on chloroplast and nuclear DNA. Forty Cynodon accessions including 7 diploids, 3 triploids, 10 tetraploids, 11 pentaploids, and 9 hexaploids were analyzed using chloroplast DNA restriction fragment-length polymorphism (cpDNA RFLP), chloroplast DNA simple sequence repeat (cpDNA SSR), and nuclear DNA markers based on neighbor-joining (NJ) and principle component analyses (PCA). All three-marker systems with two statistical algorithms clustered the diploids apart from the other ploidy levels. Assuming autopolyploidy, spontaneous polyploidization followed by rapid diversification among the higher ploidy levels than the diploids is likely in Cynodon's evolution. Few tetraploid and hexaploid accessions were clustered with or closely to the group of diploids, supporting the hypothesis above. Eleven haplotypes as estimated by cpDNA RFLP and SSR markers were detected. This study indicated that the diploids had different organelle genome from the rest of the ploidy series and provided valuable insight into relationships among ploidy series of Cynodon accessions based on cp and nuclear DNAs.

Mitochondrial Genetic Background Modulates Bioenergetics and Susceptibility to Acute Cardiac Volume – Overload

PubMed Central

Fetterman, Jessica L.; Zelickson, Blake R.; Johnson, Larry W.; Moellering, Douglas R.; Westbrook, David G.; Pompilius, Melissa; Sammy, Melissa J.; Johnson, Michelle; Dunham-Snary, Kimberly J.; Cao, Xuemei; Bradley, Wayne E.; Zhang, Jinju; Wei, Chih-Chang; Chacko, Balu; Schurr, Theodore G.; Kesterson, Robert A.; Dell’Italia, Louis J.; Darley-Usmar, Victor M.; Welch, Danny R.; Ballinger, Scott W.

2013-01-01

Synopsis Dysfunctional bioenergetics has emerged as a key feature in many chronic pathologies such as diabetes and cardiovascular disease. This has led to the mitochondrial paradigm in which it has been proposed that mitochondrial DNA (mtDNA) sequence variation contributes to disease susceptibility. In this study we present a novel animal model of mtDNA polymorphisms, the mitochondrial nuclear exchange mouse (MNX), in which the mtDNA from C3H/HeN mouse has been inserted onto the C57/BL6 nuclear background and vice versa to test this concept. Our data show a major contribution of the C57/BL6 mtDNA to the susceptibility to the pathological stress of cardiac volume overload which is independent of the nuclear background. Mitochondria harboring the C57/BL6J mtDNA generate more reactive oxygen species (ROS) and have a higher mitochondrial membrane potential relative to those having the C3H/HeN mtDNA, independent of nuclear background. We propose this is the primary mechanism associated with increased bioenergetic dysfunction in response to volume overload. In summary, these studies support the “mitochondrial paradigm” for the development of disease susceptibility, and show that the mtDNA modulates, cellular bioenergetics, mitochondrial reactive oxygen species generation and susceptibility to cardiac stress. PMID:23924350

Multi-locus DNA sequence data reveal a history of deep cryptic vicariance and habitat-driven convergence in the desert night lizard Xantusia vigilis species complex (Squamata: Xantusiidae).

PubMed

Leavitt, Dean H; Bezy, Robert L; Crandall, Keith A; Sites, Jack W

2007-11-01

The lizard genus Xantusia of southwestern North America has received recent attention in relation to delimiting species. Using more than 500 lizards from 156 localities, we further test hypothesized species boundaries and clarify phylogeographical patterns, particularly in regions of potential secondary contact. We sequenced the entire mitochondrial cytochrome b gene for every lizard in the study, plus a second mitochondrial DNA (mtDNA) region and two nuclear introns for subsets of the total sample. Phylogenetic analyses of the mtDNA recover a well-resolved, novel hypothesis for species in the Xantusia vigilis complex. The nuclear DNA (nDNA) data provide independent support for the recognition of X. arizonae, X. bezyi and X. wigginsi. Differences between the respective mtDNA and nDNA topologies result from either the effects of lineage sorting or ancient introgression. Nuclear data confirm the inference that some populations of X. vigilis in northwestern Arizona converged on rock-crevice-dwelling morphology and are not X. arizonae with an introgressed X. vigilis mtDNA genome. The historical independence of ancient cryptic lineages of Xantusia in southern California is also corroborated, though limited introgression is detected. Our proposed biogeographical scenario indicates that diversification of this group was driven by vicariance beginning in the late Miocene. Additionally, Pleistocene climatical changes influenced Xantusia distribution, and the now inhospitable Colorado Desert previously supported night lizard presence. The current taxonomy of the group likely underestimates species diversity within the group, and our results collectively show that while convergence on the rock-crevice-dwelling morphology is one hallmark of Xantusia evolution, morphological stasis is paradoxically another.

Resolving the phylogenetic position of Darwin's extinct ground sloth (Mylodon darwinii) using mitogenomic and nuclear exon data.

PubMed

Delsuc, Frédéric; Kuch, Melanie; Gibb, Gillian C; Hughes, Jonathan; Szpak, Paul; Southon, John; Enk, Jacob; Duggan, Ana T; Poinar, Hendrik N

2018-05-16

Mylodon darwinii is the extinct giant ground sloth named after Charles Darwin, who first collected its remains in South America. We have successfully obtained a high-quality mitochondrial genome at 99-fold coverage using an Illumina shotgun sequencing of a 12 880-year-old bone fragment from Mylodon Cave in Chile. Low level of DNA damage showed that this sample was exceptionally well preserved for an ancient subfossil, probably the result of the dry and cold conditions prevailing within the cave. Accordingly, taxonomic assessment of our shotgun metagenomic data showed a very high percentage of endogenous DNA with 22% of the assembled metagenomic contigs assigned to Xenarthra. Additionally, we enriched over 15 kb of sequence data from seven nuclear exons, using target sequence capture designed against a wide xenarthran dataset. Phylogenetic and dating analyses of the mitogenomic dataset including all extant species of xenarthrans and the assembled nuclear supermatrix unambiguously place Mylodon darwinii as the sister-group of modern two-fingered sloths, from which it diverged around 22 million years ago. These congruent results from both the mitochondrial and nuclear data support the diphyly of the two modern sloth lineages, implying the convergent evolution of their unique suspensory behaviour as an adaption to arboreality. Our results offer promising perspectives for whole-genome sequencing of this emblematic extinct taxon. © 2018 The Authors.

Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

PubMed

Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

2011-10-01

Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All rights reserved.

New mitogenome and nuclear evidence on the phylogeny and taxonomy of the highly zoonotic tapeworm Echinococcus granulosus sensu stricto.

PubMed

Kinkar, Liina; Laurimäe, Teivi; Sharbatkhori, Mitra; Mirhendi, Hossein; Kia, Eshrat Beigom; Ponce-Gordo, Francisco; Andresiuk, Vanessa; Simsek, Sami; Lavikainen, Antti; Irshadullah, Malik; Umhang, Gérald; Oudni-M'rad, Myriam; Acosta-Jamett, Gerardo; Rehbein, Steffen; Saarma, Urmas

2017-08-01

Cystic echinococcosis, a zoonotic disease caused by Echinococcus granulosus sensu lato (s. l.), is a significant global public health concern. Echinococcus granulosus s. l. is currently divided into numerous genotypes (G1-G8 and G10) of which G1-G3 are the most frequently implicated genotypes in human infections. Although it has been suggested that G1-G3 could be regarded as a distinct species E. granulosus sensu stricto (s. s.), the evidence to support this is inconclusive. Most importantly, data from nuclear DNA that provide means to investigate the exchange of genetic material between G1-G3 is lacking as none of the published nuclear DNA studies have explicitly included G2 or G3. Moreover, the commonly used relatively short mtDNA sequences, including the complete cox1 gene, have not allowed unequivocal differentiation of genotypes G1-G3. Therefore, significantly longer mtDNA sequences are required to distinguish these genotypes with confidence. The main aim of this study was to evaluate the phylogenetic relations and taxonomy of genotypes G1-G3 using sequences of nearly complete mitogenomes (11,443bp) and three nuclear loci (2984bp). A total of 23 G1-G3 samples were analysed, originating from 5 intermediate host species in 10 countries. The mtDNA data demonstrate that genotypes G1 and G3 are distinct mitochondrial genotypes (separated by 37 mutations), whereas G2 is not a separate genotype or even a monophyletic cluster, but belongs to G3. Nuclear data revealed no genetic separation of G1 and G3, suggesting that these genotypes form a single species due to ongoing gene flow. We conclude that: (a) in the taxonomic sense, genotypes G1 and G3 can be treated as a single species E. granulosus s. s.; (b) genotypes G1 and G3 should be regarded as distinct genotypes only in the context of mitochondrial data; (c) we recommend excluding G2 from the genotype list. Copyright © 2017 Elsevier B.V. All rights reserved.

In vitro excision of adeno-associated virus DNA from recombinant plasmids: Isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gottlieb, J.; Muzyczka, N.

1988-06-01

When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less

Extremely low nucleotide polymorphism in Pinus krempfii Lecomte, a unique flat needle pine endemic to Vietnam

PubMed Central

Wang, Baosheng; Khalili Mahani, Marjan; Ng, Wei Lun; Kusumi, Junko; Phi, Hai Hong; Inomata, Nobuyuki; Wang, Xiao-Ru; Szmidt, Alfred E

2014-01-01

Pinus krempfii Lecomte is a morphologically and ecologically unique pine, endemic to Vietnam. It is regarded as vulnerable species with distribution limited to just two provinces: Khanh Hoa and Lam Dong. Although a few phylogenetic studies have included this species, almost nothing is known about its genetic features. In particular, there are no studies addressing the levels and patterns of genetic variation in natural populations of P. krempfii. In this study, we sampled 57 individuals from six natural populations of P. krempfii and analyzed their sequence variation in ten nuclear gene regions (approximately 9 kb) and 14 mitochondrial (mt) DNA regions (approximately 10 kb). We also analyzed variation at seven chloroplast (cp) microsatellite (SSR) loci. We found very low haplotype and nucleotide diversity at nuclear loci compared with other pine species. Furthermore, all investigated populations were monomorphic across all mitochondrial DNA (mtDNA) regions included in our study, which are polymorphic in other pine species. Population differentiation at nuclear loci was low (5.2%) but significant. However, structure analysis of nuclear loci did not detect genetically differentiated groups of populations. Approximate Bayesian computation (ABC) using nuclear sequence data and mismatch distribution analysis for cpSSR loci suggested recent expansion of the species. The implications of these findings for the management and conservation of P. krempfii genetic resources were discussed. PMID:25360263

The evolutionary history of Saccharomyces species inferred from completed mitochondrial genomes and revision in the ‘yeast mitochondrial genetic code’

PubMed Central

Szabóová, Dana; Bielik, Peter; Poláková, Silvia; Šoltys, Katarína; Jatzová, Katarína; Szemes, Tomáš

2017-01-01

Abstract The yeast Saccharomyces are widely used to test ecological and evolutionary hypotheses. A large number of nuclear genomic DNA sequences are available, but mitochondrial genomic data are insufficient. We completed mitochondrial DNA (mtDNA) sequencing from Illumina MiSeq reads for all Saccharomyces species. All are circularly mapped molecules decreasing in size with phylogenetic distance from Saccharomyces cerevisiae but with similar gene content including regulatory and selfish elements like origins of replication, introns, free-standing open reading frames or GC clusters. Their most profound feature is species-specific alteration in gene order. The genetic code slightly differs from well-established yeast mitochondrial code as GUG is used rarely as the translation start and CGA and CGC code for arginine. The multilocus phylogeny, inferred from mtDNA, does not correlate with the trees derived from nuclear genes. mtDNA data demonstrate that Saccharomyces cariocanus should be assigned as a separate species and Saccharomyces bayanus CBS 380T should not be considered as a distinct species due to mtDNA nearly identical to Saccharomyces uvarum mtDNA. Apparently, comparison of mtDNAs should not be neglected in genomic studies as it is an important tool to understand the origin and evolutionary history of some yeast species. PMID:28992063

Nuclear DNA sequences from the Middle Pleistocene Sima de los Huesos hominins.

PubMed

Meyer, Matthias; Arsuaga, Juan-Luis; de Filippo, Cesare; Nagel, Sarah; Aximu-Petri, Ayinuer; Nickel, Birgit; Martínez, Ignacio; Gracia, Ana; Bermúdez de Castro, José María; Carbonell, Eudald; Viola, Bence; Kelso, Janet; Prüfer, Kay; Pääbo, Svante

2016-03-24

A unique assemblage of 28 hominin individuals, found in Sima de los Huesos in the Sierra de Atapuerca in Spain, has recently been dated to approximately 430,000 years ago. An interesting question is how these Middle Pleistocene hominins were related to those who lived in the Late Pleistocene epoch, in particular to Neanderthals in western Eurasia and to Denisovans, a sister group of Neanderthals so far known only from southern Siberia. While the Sima de los Huesos hominins share some derived morphological features with Neanderthals, the mitochondrial genome retrieved from one individual from Sima de los Huesos is more closely related to the mitochondrial DNA of Denisovans than to that of Neanderthals. However, since the mitochondrial DNA does not reveal the full picture of relationships among populations, we have investigated DNA preservation in several individuals found at Sima de los Huesos. Here we recover nuclear DNA sequences from two specimens, which show that the Sima de los Huesos hominins were related to Neanderthals rather than to Denisovans, indicating that the population divergence between Neanderthals and Denisovans predates 430,000 years ago. A mitochondrial DNA recovered from one of the specimens shares the previously described relationship to Denisovan mitochondrial DNAs, suggesting, among other possibilities, that the mitochondrial DNA gene pool of Neanderthals turned over later in their history.

Tissue specificity of the hormonal response in sex accessory tissues is associated with nuclear matrix protein patterns.

PubMed

Getzenberg, R H; Coffey, D S

1990-09-01

The DNA of interphase nuclei have very specific three-dimensional organizations that are different in different cell types, and it is possible that this varying DNA organization is responsible for the tissue specificity of gene expression. The nuclear matrix organizes the three-dimensional structure of the DNA and is believed to be involved in the control of gene expression. This study compares the nuclear structural proteins between two sex accessory tissues in the same animal responding to the same androgen stimulation by the differential expression of major tissue-specific secretory proteins. We demonstrate here that the nuclear matrix is tissue specific in the rat ventral prostate and seminal vesicle, and undergoes characteristic alterations in its protein composition upon androgen withdrawal. Three types of nuclear matrix proteins were observed: 1) nuclear matrix proteins that are different and tissue specific in the rat ventral prostate and seminal vesicle, 2) a set of nuclear matrix proteins that either appear or disappear upon androgen withdrawal, and 3) a set of proteins that are common to both the ventral prostate and seminal vesicle and do not change with the hormonal state of the animal. Since the nuclear matrix is known to bind androgen receptors in a tissue- and steroid-specific manner, we propose that the tissue specificity of the nuclear matrix arranges the DNA in a unique conformation, which may be involved in the specific interaction of transcription factors with DNA sequences, resulting in tissue-specific patterns of secretory protein expression.

Investigation of genetic divergence and polymorphism of nuclear DNA in species and populations of domestic and wild sheep

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mel`nikova, M.N.; Grechko, V.V.; Mednikov, B.M.

1995-08-01

Genetic divergence in repetitive sequences of nuclear DNA of wild and domestic sheep was studied by general restriction endonuclease mapping (i.e., the taxonoprint method). The PCR RAPD method with one and two arbitrary primers was also used to analyze the nuclear DNA polymorphism in some other regions. The taxonoprint method, performed using six endonucleases, showed specificity and virtually complete similarity in the patterns of repetitive DNA sequences of two wild forms, argali and moufflon, and five domestic sheep breeds. Central Asian breeds, Kazakh fine-fleeced, karakuk, ghissar, and eadeelbay, and an English breed, Lincoln, were examined. The results confirm the opinionmore » that wild and domestic sheep may be considered one polytypic species. The PCR-RAPD method, both with one and two arbitrary primers, revealed a closer similarity of all the sheep breeds examined when aragali, rather than with moufflon, was used. These results indicate that the domestication area of sheep was much more broader than was earlier presumed. Otherwise, hybridizations of domestic and wild forms could occasionally occur in the area of their coexistence. The amplification patterns of PCR-RAPD products are the most promising population genetic markers. 27 refs., 4 figs., 7 tabs.« less

Taxonomic confirmation of mud crab species (genus Scylla) in Bangladesh by nuclear and mitochondrial DNA markers.

PubMed

Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru

2017-11-01

Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.

Repetitive transpositions of mitochondrial DNA sequences to the nucleus during the radiation of horseshoe bats (Rhinolophus, Chiroptera).

PubMed

Shi, Huizhen; Dong, Ji; Irwin, David M; Zhang, Shuyi; Mao, Xiuguang

2016-05-01

Transposition of mitochondrial DNA into the nucleus, which gives rise to nuclear mitochondrial DNAs (NUMTs), has been well documented in eukaryotes. However, very few studies have assessed the frequency of these transpositions during the evolutionary history of a specific taxonomic group. Here we used the horseshoe bats (Rhinolophus) as a case study to determine the frequency and relative timing of nuclear transfers of mitochondrial control region sequences. For this, phylogenetic and coalescent analyzes were performed on NUMTs and authentic mtDNA sequences generated from eight horseshoe bat species. Our results suggest at least three independent transpositions, including two ancient and one more recent, during the evolutionary history of Rhinolophus. The two ancient transpositions are represented by the NUMT-1 and -2 clades, with each clade consisting of NUMTs from almost all studied species but originating from different portions of the mtDNA genome. Furthermore, estimates of the most recent common ancestor for each clade corresponded to the time of the initial diversification of this genus. The recent transposition is represented by NUMT-3, which was discovered only in a specific subgroup of Rhinolophus and exhibited a close relationship to its mitochondrial counterpart. Our similarity searches of mtDNA in the R. ferrumequinum genome confirmed the presence of NUMT-1 and NUMT-2 clade sequences and, for the first time, assessed the extent of NUMTs in a bat genome. To our knowledge, this is the first study to report on the frequency of transpositions of mtDNA occurring before the common ancestry of a genus. Copyright © 2016 Elsevier B.V. All rights reserved.

Revisiting the phylogeny of Ocellularieae, the second largest tribe within Graphidaceae (lichenized Ascomycota: Ostropales)

Treesearch

Ekaphan Kraichak; Sittiporn Parnmen; Robert Lücking; Eimy Rivas Plata; Andre Aptroot; Marcela E.S. Caceres; Damien Ertz; Armin Mangold; Joel A. Mercado-Diaz; Khwanruan Papong; Dries Van der Broeck; Gothamie Weerakoon; H. Thorsten Lumbsch; NO-VALUE

2014-01-01

We present an updated 3-locus molecular phylogeny of tribe Ocellularieae, the second largest tribe within subfamily Graphidoideae in the Graphidaceae. Adding 165 newly generated sequences from the mitochondrial small subunit rDNA (mtSSU), the nuclear large subunit rDNA (nuLSU), and the second largest subunit of the DNA-directed RNA polymerase II (RPB2), we currently...

Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.

PubMed

Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar

2018-05-22

Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

Detection of sequence variation in parasite ribosomal DNA by electrophoresis in agarose gels supplemented with a DNA-intercalating agent.

PubMed

Zhu, X Q; Chilton, N B; Gasser, R B

1998-05-01

This study evaluated the use of a commercially available DNA intercalating agent (Resolver Gold) in agarose gels for the direct detection of sequence variation in ribosomal DNA (rDNA). This agent binds preferentially to AT sequence motifs in DNA. Regions of nuclear rDNA, known to provide genetic markers for the identification of species of parasitic ascarid nematodes (order Ascaridida), were amplified by polymerase chain reaction (PCR) and subjected to electrophoresis in standard agarose gels versus gels supplemented with Resolver Gold. Individual taxa examined could not be distinguished reliably based on the size of their amplicons in standard agarose gels, whereas they could be readily delineated based on mobility using Resolver Gold-supplemented gels. The latter was achieved because of differences (approximately 0.1-8.2%) in the AT content of the fragments among different taxa, which were associated with significant interspecific differences (approximately 11-39%) in the rDNA sequences employed. There was a tendency for fragments with higher AT content to migrate slower in supplemented agarose gels compared with those of lower AT content. The results indicate the usefulness of this electrophoretic approach to rapidly screen for sequence variability within or among PCR-amplified rDNA fragments of similar sizes but differing AT contents. Although evaluated on rDNA of parasites, the approach has potential to be applied to a range of genes of different groups of infectious organisms.

Mitochondrial DNA transfer to the nucleus generates extensive insertion site variation in maize.

PubMed

Lough, Ashley N; Roark, Leah M; Kato, Akio; Ream, Thomas S; Lamb, Jonathan C; Birchler, James A; Newton, Kathleen J

2008-01-01

Mitochondrial DNA (mtDNA) insertions into nuclear chromosomes have been documented in a number of eukaryotes. We used fluorescence in situ hybridization (FISH) to examine the variation of mtDNA insertions in maize. Twenty overlapping cosmids, representing the 570-kb maize mitochondrial genome, were individually labeled and hybridized to root tip metaphase chromosomes from the B73 inbred line. A minimum of 15 mtDNA insertion sites on nine chromosomes were detectable using this method. One site near the centromere on chromosome arm 9L was identified by a majority of the cosmids. To examine variation in nuclear mitochondrial DNA sequences (NUMTs), a mixture of labeled cosmids was applied to chromosome spreads of ten diverse inbred lines: A188, A632, B37, B73, BMS, KYS, Mo17, Oh43, W22, and W23. The number of detectable NUMTs varied dramatically among the lines. None of the tested inbred lines other than B73 showed the strong hybridization signal on 9L, suggesting that there is a recent mtDNA insertion at this site in B73. Different sources of B73 and W23 were examined for NUMT variation within inbred lines. Differences were detectable, suggesting either that mtDNA is being incorporated or lost from the maize nuclear genome continuously. The results indicate that mtDNA insertions represent a major source of nuclear chromosomal variation.

Mito-nuclear discord in six congeneric lineages of Holarctic ducks (genus Anas).

PubMed

Peters, Jeffrey L; Winker, Kevin; Millam, Kendra C; Lavretsky, Philip; Kulikova, Irina; Wilson, Robert E; Zhuravlev, Yuri N; McCracken, Kevin G

2014-06-01

Many species have Holarctic distributions that extend across Europe, Asia and North America. Most genetics research on these species has examined only mitochondrial (mt) DNA, which has revealed wide variance in divergence between Old World (OW) and New World (NW) populations, ranging from shallow, unstructured genealogies to deeply divergent lineages. In this study, we sequenced 20 nuclear introns to test for concordant patterns of OW-NW differentiation between mtDNA and nuclear (nu) DNA for six lineages of Holarctic ducks (genus Anas). Genetic differentiation for both marker types varied widely among these lineages (idiosyncratic population histories), but mtDNA and nuDNA divergence within lineages was not significantly correlated. Moreover, compared with the association between mtDNA and nuDNA divergence observed among different species, OW-NW nuDNA differentiation was generally lower than mtDNA divergence, at least for lineages with deeply divergent mtDNA. Furthermore, coalescent estimates indicated significantly higher rates of gene flow for nuDNA than mtDNA for four of the six lineages. Thus, Holarctic ducks show prominent mito-nuclear discord between OW and NW populations, and we reject differences in sorting rates as the sole cause of the within-species discord. Male-mediated intercontinental gene flow is likely a leading contributor to this discord, although selection could also cause increased mtDNA divergence relative to weak nuDNA differentiation. The population genetics of these ducks contribute to growing evidence that mtDNA can be an unreliable indicator of stage of speciation and that more holistic approaches are needed for species delimitation. © 2014 John Wiley & Sons Ltd.

Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

PubMed Central

Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

1987-01-01

To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

Efficiency of ITS Sequences for DNA Barcoding in Passiflora (Passifloraceae)

PubMed Central

Giudicelli, Giovanna Câmara; Mäder, Geraldo; de Freitas, Loreta Brandão

2015-01-01

DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using “best match” and “best close match” methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1) region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species. PMID:25837628

Mitochondrial genetic background modulates bioenergetics and susceptibility to acute cardiac volume overload.

PubMed

Fetterman, Jessica L; Zelickson, Blake R; Johnson, Larry W; Moellering, Douglas R; Westbrook, David G; Pompilius, Melissa; Sammy, Melissa J; Johnson, Michelle; Dunham-Snary, Kimberly J; Cao, Xuemei; Bradley, Wayne E; Zhang, Jinju; Wei, Chih-Chang; Chacko, Balu; Schurr, Theodore G; Kesterson, Robert A; Dell'italia, Louis J; Darley-Usmar, Victor M; Welch, Danny R; Ballinger, Scott W

2013-10-15

Dysfunctional bioenergetics has emerged as a key feature in many chronic pathologies such as diabetes and cardiovascular disease. This has led to the mitochondrial paradigm in which it has been proposed that mtDNA sequence variation contributes to disease susceptibility. In the present study we show a novel animal model of mtDNA polymorphisms, the MNX (mitochondrial-nuclear exchange) mouse, in which the mtDNA from the C3H/HeN mouse has been inserted on to the C57/BL6 nuclear background and vice versa to test this concept. Our data show a major contribution of the C57/BL6 mtDNA to the susceptibility to the pathological stress of cardiac volume overload which is independent of the nuclear background. Mitochondria harbouring the C57/BL6J mtDNA generate more ROS (reactive oxygen species) and have a higher mitochondrial membrane potential relative to those with C3H/HeN mtDNA, independent of nuclear background. We propose this is the primary mechanism associated with increased bioenergetic dysfunction in response to volume overload. In summary, these studies support the 'mitochondrial paradigm' for the development of disease susceptibility, and show that the mtDNA modulates cellular bioenergetics, mitochondrial ROS generation and susceptibility to cardiac stress.

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Visualization of chromatin domains created by the gypsy insulator of Drosophila.

PubMed

Byrd, Keith; Corces, Victor G

2003-08-18

Insulators might regulate gene expression by establishing and maintaining the organization of the chromatin fiber within the nucleus. Biochemical fractionation and in situ high salt extraction of lysed cells show that two known protein components of the gypsy insulator are present in the nuclear matrix. Using FISH with DNA probes located between two endogenous Su(Hw) binding sites, we show that the intervening DNA is arranged in a loop, with the two insulators located at the base. Mutations in insulator proteins, subjecting the cells to a brief heat shock, or destruction of the nuclear matrix lead to disruption of the loop. Insertion of an additional gypsy insulator in the center of the loop results in the formation of paired loops through the attachment of the inserted sequences to the nuclear matrix. These results suggest that the gypsy insulator might establish higher-order domains of chromatin structure and regulate nuclear organization by tethering the DNA to the nuclear matrix and creating chromatin loops.

The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

PubMed

Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

2007-03-01

Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

PubMed Central

Evers, R; Grummt, I

1995-01-01

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

Nuclear markers confirm taxonomic status and relationships among highly endangered and closely related right whale species

PubMed Central

Gaines, C.A; Hare, M.P; Beck, S.E; Rosenbaum, H.C

2005-01-01

Right whales (genus: Eubalaena) are among the most endangered mammals, yet their taxonomy and phylogeny have been questioned. A phylogenetic hypothesis based on mitochondrial DNA (mtDNA) variation recently prompted a taxonomic revision, increasing the number of right whale species to three. We critically evaluated this hypothesis using sequence data from 13 nuclear DNA (nuDNA) loci as well as the mtDNA control region. Fixed diagnostic characters among the nuclear markers strongly support the hypothesis of three genetically distinct species, despite the lack of any diagnostic morphological characters. A phylogenetic analysis of all data produced a strict consensus cladogram with strong support at nodes that define each right whale species as well as relationships among species. Results showed very little conflict among the individual partitions as well as congruence between the mtDNA and nuDNA datasets. These data clearly demonstrate the strength of using numerous independent genetic markers during a phylogenetic analysis of closely related species. In evaluating phylogenetic support contributed by individual loci, 11 of the 14 loci provided support for at least one of the nodes of interest to this study. Only a single marker (mtDNA control region) provided support at all four nodes. A study using any single nuclear marker would have failed to support the proposed phylogeny, and a strong phylogenetic hypothesis was only revealed by the simultaneous analysis of many nuclear loci. In addition, nuDNA and mtDNA data provided complementary levels of support at nodes of different evolutionary depth indicating that the combined use of mtDNA and nuDNA data is both practical and desirable. PMID:15846869

Species delimitation in the Central African herbs Haumania (Marantaceae) using georeferenced nuclear and chloroplastic DNA sequences.

PubMed

Ley, A C; Hardy, O J

2010-11-01

Species delimitation is a fundamental biological concept which is frequently discussed and altered to integrate new insights. These revealed that speciation is not a one step phenomenon but an ongoing process and morphological characters alone are not sufficient anymore to properly describe the results of this process. Here we want to assess the degree of speciation in two closely related lianescent taxa from the tropical African genus Haumania which display distinct vegetative traits despite a high similarity in reproductive traits and a partial overlap in distribution area which might facilitate gene flow. To this end, we combined phylogenetic and phylogeographic analyses using nuclear (nr) and chloroplast (cp) DNA sequences in comparison to morphological species descriptions. The nuclear dataset unambiguously supports the morphological species concept in Haumania. However, the main chloroplastic haplotypes are shared between species and, although a geographic analysis of cpDNA diversity confirms that individuals from the same taxon are more related than individuals from distinct taxa, cp-haplotypes display correlated geographic distributions between species. Hybridization is the most plausible reason for this pattern. A scenario involving speciation in geographic isolation followed by range expansion is outlined. The study highlights the gain of information on the speciation process in Haumania by adding georeferenced molecular data to the morphological characteristics. It also shows that nr and cp sequence data might provide different but complementary information, questioning the reliability of the unique use of chloroplast data for species recognition by DNA barcoding. Copyright © 2010 Elsevier Inc. All rights reserved.

ENVIRONMENTAL INFLUENCES ON GENETIC DIVERSITY OF CREEK CHUBS IN THE MID-ATLANTIC REGION OF THE USA

EPA Science Inventory

Analysis of genetic diversity within and among populations of stream fishes may provide a powerful method for assessing the status and trends in the condition of aquatic ecosystems. We analyzed mitochondrial DNA sequences (590 bases of cytochrome B) and nuclear DNA loci (109 amp...

Phylogeographic patterns of Armillaria ostoyae in the western United States

Treesearch

J. W. Hanna; N. B. Klopfenstein; M. -S. Kim; G. I. McDonald; J. A. Moore

2007-01-01

Nuclear ribosomal DNA regions (i.e. large subunit, internal transcribed spacer, 5.8S and intergenic spacer) were sequenced using a direct-polymerase chain reaction method from Armillaria ostoyae genets collected from the western USA. Many of the A. ostoyae genets contained heterogeneity among rDNA repeats, indicating intragenomic variation and likely intraspecific...

Comment on "Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage".

PubMed

Nakagome, Shigeki; Mano, Shuhei; Hasegawa, Masami

2013-03-29

Based on nuclear and mitochondrial DNA, Hailer et al. (Reports, 20 April 2012, p. 344) suggested early divergence of polar bears from a common ancestor with brown bears and subsequent introgression. Our population genetic analysis that traces each of the genealogies in the independent nuclear loci does not support the evolutionary model proposed by the authors.

Mitochondrial DNA and retroviral RNA analyses of archival oral polio vaccine (OPV CHAT) materials: evidence of macaque nuclear sequences confirms substrate identity.

PubMed

Berry, Neil; Jenkins, Adrian; Martin, Javier; Davis, Clare; Wood, David; Schild, Geoffrey; Bottiger, Margareta; Holmes, Harvey; Minor, Philip; Almond, Neil

2005-02-25

Inoculation of live experimental oral poliovirus vaccines (OPV CHAT) during the 1950s in central Africa has been proposed to account for the introduction of HIV into human populations. For this to have occurred, it would have been necessary for chimpanzee rather than macaque kidney epithelial cells to have been included in the preparation of early OPV materials. Theoretically, this could have led to contamination with a progenitor of HIV-1 derived from a related simian immunodeficiency virus of chimpanzees (SIVCPZ). In this article we present further detailed analyses of two samples of OPV, CHAT 10A-11 and CHAT 6039/Yugo, which were used in early human trials of poliovirus vaccination. Recovery of poliovirus by culture techniques confirmed the biological viability of the vaccines and sequence analysis of poliovirus RNA specifically identified the presence of the CHAT strain. Independent nested sets of oligonucleotide primers specific for HIV-1/SIVCPZ and HIV-2/SIVMAC/SIVSM phylogenetic lineages, respectively, indicated no evidence of HIV/SIV RNA in either vaccine preparation, at a sensitivity of 100 RNA equivalents/ml. Analysis of cellular substrate by the amplification of two distinct regions of mitochondrial DNA (D-loop control region and 12S ribosomal sequences) revealed no evidence of chimpanzee cellular sequences. However, this approach positively identified rhesus and cynomolgus macaque DNA for the CHAT 10A-11 and CHAT 6039/Yugo vaccine preparations, respectively. Analysis of multiple clones of mtDNA 12S rDNA indicated a relatively high number of nuclear mitochondrial DNA sequences (numts) in the CHAT 10A-11 material, but confirmed the macaque origin of cellular substrate used in vaccine preparation. These data reinforce earlier findings on this topic providing no evidence to support the contention that poliovirus vaccination was responsible for the introduction of HIV into humans and sparking the AIDS pandemic.

Behavioral vs. molecular sources of conflict between nuclear and mitochondrial DNA: The role of male-biased dispersal in a Holarctic sea duck

USGS Publications Warehouse

Peters, Jeffrey L.; Bolender, Kimberly A.; Pearce, John M.

2012-01-01

Genetic studies of waterfowl (Anatidae) have observed the full spectrum of mitochondrial (mt) DNA population divergence, from apparent panmixia to deep, reciprocally monophyletic lineages. Yet, these studies often found weak or no nuclear (nu) DNA structure, which was often attributed to male-biased gene flow, a common behaviour within this family. An alternative explanation for this ‘conflict’ is that the smaller effective population size and faster sorting rate of mtDNA relative to nuDNA lead to different signals of population structure. We tested these alternatives by sequencing 12 nuDNA introns for a Holarctic pair of waterfowl subspecies, the European goosander (Mergus merganser merganser) and the North American common merganser (M. m. americanus), which exhibit strong population structure in mtDNA. We inferred effective population sizes, gene flow and divergence times from published mtDNA sequences and simulated expected differentiation for nuDNA based on those histories. Between Europe and North America, nuDNA ФST was 3.4-fold lower than mtDNA ФST, a result consistent with differences in sorting rates. However, despite geographically structured and monophyletic mtDNA lineages within continents, nuDNA ФST values were generally zero and significantly lower than predicted. This between- and within-continent contrast held when comparing mtDNA and nuDNA among published studies of ducks. Thus, male-mediated gene flow is a better explanation than slower sorting rates for limited nuDNA differentiation within continents, which is also supported by nonmolecular data. This study illustrates the value of quantitatively testing discrepancies between mtDNA and nuDNA to reject the null hypothesis that conflict simply reflects different sorting rates.

The DL1 repeats in the genome of Diphyllobothrium latum.

PubMed

Usmanova, Nadezhda M; Kazakov, Vasiliy I

2010-07-01

Diphyllobothrium latum is a widespread intestinal parasite, which has a great clinical relevance, but there are no sequences of its nuclear genome. In this paper, a repetitive element in the D. latum genome is firstly described. The adult D. latum was obtained in the result of expulsion from intestinum of a patient suffering from diphyllobothriasis. Genomic DNA was isolated from several proglottids of this individual. PstI restriction products of D. latum genomic DNA were sequenced. Polymerase chain reaction (PCR) amplification of these products using genomic DNA and selected primers was carried out. Thereby a cluster of a repetitive element, called DL1, was discovered. For precise identification of a beginning and an end of the repeat, a product of PCR amplification of D. latum genomic DNA with one specific primer was sequenced. In discussion, several evidences that DL1 repeat is a member of the SINE family of retroposons were adduced.

The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

PubMed

Chan, Y L; Paz, V; Olvera, J; Wool, I G

1993-04-30

The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

Complete chloroplast genome and 45S nrDNA sequences of the medicinal plant species Glycyrrhiza glabra and Glycyrrhiza uralensis.

PubMed

Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun

2017-10-06

Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.

Periodic expression of nuclear and mitochondrial DNA replication genes during the trypanosomatid cell cycle.

PubMed

Pasion, S G; Brown, G W; Brown, L M; Ray, D S

1994-12-01

In trypanosomatids, DNA replication in the nucleus and in the single mitochondrion (or kinetoplast) initiates nearly simultaneously, suggesting that the DNA synthesis (S) phases of the nucleus and the mitochondrion are coordinately regulated. To investigate the basis for the temporal link between nuclear and mitochondrial DNA synthesis phases the expression of the genes encoding DNA ligase I, the 51 and 28 kDa subunits of replication protein A, dihydrofolate reductase and the mitochondrial type II topoisomerase were analyzed during the cell cycle progression of synchronous cultures of Crithidia fasciculata. These DNA replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures. A plasmid clone (pdN-1) in which TOP2, the gene encoding the mitochondrial topoisomerase, was disrupted by the insertion of a NEO drug-resistance cassette was found to express both a truncated TOP2 mRNA and a truncated topoisomerase polypeptide. The truncated mRNA was also expressed periodically coordinate with the expression of the endogenous TOP2 mRNA indicating that cis elements necessary for periodic expression are contained within cloned sequences. The expression of both TOP2 and nuclear DNA replication genes at the G1/S boundary suggests that regulated expression of these genes may play a role in coordinating nuclear and mitochondrial S phases in trypanosomatids.

Genetic characterization of Zostera asiatica on the Pacific Coast of North America

USGS Publications Warehouse

Talbot, S.L.; Wyllie-Echeverria, S.; Ward, D.H.; Rearick, J.R.; Sage, G.K.; Chesney, B.; Phillips, R.C.

2006-01-01

We gathered sequence information from the nuclear 5.8S rDNA gene and associated internal transcribed spacers, ITS-1 and ITS-2 (5.8S rDNA/ITS), and the chloroplast maturase K (matK) gene, from Zostera samples collected from subtidal habitats in Monterey and Santa Barbara (Isla Vista) bays, California, to test the hypothesis that these plants are conspecific with Z. asiatica Miki of Asia. Sequences from approximately 520 base pairs of the nuclear 5.8S rDNA/ITS obtained from the subtidal Monterey and Isla Vista Zostera samples were identical to homologous sequences obtained from Z. marina collected from intertidal habitats in Japan, Alaska, Oregon and California. Similarly, sequences from the matK gene from the subtidal Zostera samples were identical to matK sequences obtained from Z. marina collected from intertidal habitats in Japan, Alaska, Oregon and California, but differed from Z. asiatica sequences accessioned into GenBank. This suggests the subtidal plants are conspecific with Z. marina, not Z. asiatica. However, we found that herbarium samples accessioned into the Kyoto University Herbarium, determined to be Z. asiatica, yielded 5.8S rDNA/ITS sequences consistent with either Z. japonica, in two cases, or Z. marina, in one case. Similar results were observed for the chloroplast matK gene; we found haplotypes that were inconsistent with published matK sequences from Z. asiatica collected from Japan. These results underscore the need for closer examination of the relationship between Z. marina along the Pacific Coast of North America, and Z. asiatica of Asia, for the retention and verification of specimens examined in scientific studies, and for assessment of the usefulness of morphological characters in the determination of taxonomic relationships within Zosteraceae.

Efficient DNA binding and nuclear uptake by distamycin derivatives conjugated to octa-arginine sequences.

PubMed

Vázquez, Olalla; Blanco-Canosa, Juan B; Vázquez, M Eugenio; Martínez-Costas, Jose; Castedo, Luis; Mascareñas, José L

2008-11-24

Efficient targeting of DNA by designed molecules requires not only careful fine-tuning of their DNA-recognition properties, but also appropriate cell internalization of the compounds so that they can reach the cell nucleus in a short period of time. Previous observations in our group on the relatively high affinity displayed by conjugates between distamycin derivatives and bZIP basic regions for A-rich DNA sites, led us to investigate whether the covalent attachment of a positively charged cell-penetrating peptide to a distamycin-like tripyrrole might yield high affinity DNA binders with improved cell internalization properties. Our work has led to the discovery of synthetic tripyrrole-octa-arginine conjugates that are capable of targeting specific DNA sites that contain A-rich tracts with low nanomolar affinity; they simultaneously exhibit excellent membrane and nuclear translocation properties in living HeLa cells.

Enhancing Electrotransfection Efficiency through Improvement in Nuclear Entry of Plasmid DNA.

PubMed

Cervia, Lisa D; Chang, Chun-Chi; Wang, Liangli; Mao, Mao; Yuan, Fan

2018-06-01

The nuclear envelope is a physiological barrier to electrogene transfer. To understand different mechanisms of the nuclear entry for electrotransfected plasmid DNA (pDNA), the current study investigated how manipulation of the mechanisms could affect electrotransfection efficiency (eTE), transgene expression level (EL), and cell viability. In the investigation, cells were first synchronized at G2-M phase prior to electrotransfection so that the nuclear envelope breakdown (NEBD) occurred before pDNA entered the cells. The NEBD significantly increased the eTE and the EL while the cell viability was not compromised. In the second experiment, the cells were treated with a nuclear pore dilating agent (i.e., trans-1,2-cyclohexanediol). The treatment could increase the EL, but had only minor effects on eTE. Furthermore, the treatment was more cytotoxic, compared with the cell synchronization. In the third experiment, a nuclear targeting sequence (i.e., SV40) was incorporated into the pDNA prior to electrotransfection. The incorporation was more effective than the cell synchronization for enhancing the EL, but not the eTE, and the effectiveness was cell type dependent. Taken together, the data described above suggested that synchronization of the NEBD could be a practical approach to improving electrogene transfer in all dividing cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Characterization of Fasciola samples by ITS of rDNA sequences revealed the existence of Fasciola hepatica and Fasciola gigantica in Yunnan Province, China.

PubMed

Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai

2012-08-01

On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.

Telling plant species apart with DNA: from barcodes to genomes

PubMed Central

Li, De-Zhu; van der Bank, Michelle

2016-01-01

Land plants underpin a multitude of ecosystem functions, support human livelihoods and represent a critically important component of terrestrial biodiversity—yet many tens of thousands of species await discovery, and plant identification remains a substantial challenge, especially where material is juvenile, fragmented or processed. In this opinion article, we tackle two main topics. Firstly, we provide a short summary of the strengths and limitations of plant DNA barcoding for addressing these issues. Secondly, we discuss options for enhancing current plant barcodes, focusing on increasing discriminatory power via either gene capture of nuclear markers or genome skimming. The former has the advantage of establishing a defined set of target loci maximizing efficiency of sequencing effort, data storage and analysis. The challenge is developing a probe set for large numbers of nuclear markers that works over sufficient phylogenetic breadth. Genome skimming has the advantage of using existing protocols and being backward compatible with existing barcodes; and the depth of sequence coverage can be increased as sequencing costs fall. Its non-targeted nature does, however, present a major informatics challenge for upscaling to large sample sets. This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481790

Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data.

PubMed

Stanford, A M; Harden, R; Parks, C R

2000-06-01

We investigated phylogenetic and biogeographic relationships within Juglans (walnuts), a Tertiary disjunct genus, using 15 species of Juglans and related (Juglandaceae) outgroups. The relationships were analyzed using nucleotide sequences of the chloroplast gene matK and its flanking spacers and of the internal transcribed spacers (ITS) and 5.8S gene of the nuclear ribosomal DNA. The DNA sequences provided 246 informative characters for parsimony analysis. ITS data supported as monophyletic groups the four generic sections, Cardiocaryon, Dioscaryon, Rhysocaryon, and Trachycaryon. Within Rhysocaryon, the temperate black walnuts and the tropical black walnuts were supported as monophyletic groups. When the two data sets were combined, J. cinerea was nested within Cardiocaryon. Combined analysis with published nuclear DNA restriction site data placed J. cinerea in a monophyletic group with Cardiocaryon. These analyses consistently supported Juglans as a monophyletic group and as the sister group to the genus Pterocarya. The results of this work are consistent with the known geological history of Juglans. The fossil record suggests that the butternuts had evolved by the early Oligocene in North America. The presence of butternuts in Eurasia could be the result of migration from North America to Eurasia during the warming trend of the mid Oligocene.

Recognition of the CDEI motif GTCACATG by mouse nuclear proteins and interference with the early development of the mouse embryo.

PubMed Central

Blangy, A; Léopold, P; Vidal, F; Rassoulzadegan, M; Cuzin, F

1991-01-01

We have reported previously (1) two unexpected consequences of the microinjection into fertilized mouse eggs of a recombinant plasmid designated p12B1, carrying a 343 bp insert of non-repetitive mouse DNA. Injected at very low concentrations, this plasmid could be established as an extrachromosomal genetic element. When injected in greater concentration, an early arrest of embryonic development resulted. In the present work, we have studied this toxic effect in more detail by microinjecting short synthetic oligonucleotides with sequences from the mouse insert. Lethality was associated with the nucleotide sequence GTCACATG, identical with the CDEl element of yeast centromeres. Development of injected embryos was arrested between the one-cell and the early morula stages, with abnormal structures and DNA contents. Electrophoretic mobility shift and DNAse foot-printing assays demonstrated the binding of mouse nuclear protein(s) to the CDEl-like box. Base changes within the CDEl sequence prevented both the toxic effects in embryos and the formation of protein complex in vitro, suggesting that protein binding at such sites in chromosomal DNA plays an important role in early development. Images PMID:1766880

Fascioliasis transmission by Lymnaea neotropica confirmed by nuclear rDNA and mtDNA sequencing in Argentina.

PubMed

Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores

2009-12-03

Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix, Galba truncatula and L. neotropica. It also poses a problem with regard to the use, for lymnaeid vector species discrimination, of several molecular techniques which do not show sufficient accuracy, as those relying on the 18S rRNA gene or parts of it, because both L. neotropica and L. viatrix present identical 18S sequence.

Comparative performance of the BGISEQ-500 vs Illumina HiSeq2500 sequencing platforms for palaeogenomic sequencing

PubMed Central

Mak, Sarah Siu Tze; Gopalakrishnan, Shyam; Carøe, Christian; Geng, Chunyu; Liu, Shanlin; Sinding, Mikkel-Holger S; Kuderna, Lukas F K; Zhang, Wenwei; Fu, Shujin; Vieira, Filipe G; Germonpré, Mietje; Bocherens, Hervé; Fedorov, Sergey; Petersen, Bent; Sicheritz-Pontén, Thomas; Marques-Bonet, Tomas; Zhang, Guojie; Jiang, Hui; Gilbert, M Thomas P

2017-01-01

Abstract Ancient DNA research has been revolutionized following development of next-generation sequencing platforms. Although a number of such platforms have been applied to ancient DNA samples, the Illumina series are the dominant choice today, mainly because of high production capacities and short read production. Recently a potentially attractive alternative platform for palaeogenomic data generation has been developed, the BGISEQ-500, whose sequence output are comparable with the Illumina series. In this study, we modified the standard BGISEQ-500 library preparation specifically for use on degraded DNA, then directly compared the sequencing performance and data quality of the BGISEQ-500 to the Illumina HiSeq2500 platform on DNA extracted from 8 historic and ancient dog and wolf samples. The data generated were largely comparable between sequencing platforms, with no statistically significant difference observed for parameters including level (P = 0.371) and average sequence length (P = 0718) of endogenous nuclear DNA, sequence GC content (P = 0.311), double-stranded DNA damage rate (v. 0.309), and sequence clonality (P = 0.093). Small significant differences were found in single-strand DNA damage rate (δS; slightly lower for the BGISEQ-500, P = 0.011) and the background rate of difference from the reference genome (θ; slightly higher for BGISEQ-500, P = 0.012). This may result from the differences in amplification cycles used to polymerase chain reaction–amplify the libraries. A significant difference was also observed in the mitochondrial DNA percentages recovered (P = 0.018), although we believe this is likely a stochastic effect relating to the extremely low levels of mitochondria that were sequenced from 3 of the samples with overall very low levels of endogenous DNA. Although we acknowledge that our analyses were limited to animal material, our observations suggest that the BGISEQ-500 holds the potential to represent a valid and potentially valuable alternative platform for palaeogenomic data generation that is worthy of future exploration by those interested in the sequencing and analysis of degraded DNA. PMID:28854615

Testing deep reticulate evolution in Amaryllidaceae Tribe Hippeastreae (Asparagales) with ITS and chloroplast sequence data

USDA-ARS?s Scientific Manuscript database

The phylogeny of Amaryllidaceae tribe Hippeastreae was inferred using chloroplast (3’ycf1, ndhF, trnL-F) and nuclear (ITS rDNA) sequence data under maximum parsimony and maximum likelihood frameworks. Network analyses were applied to resolve conflicting signals among data sets and putative scenarios...

A Novel Model System to Examine Agents Used in Breast Cancer Therapy.

DTIC Science & Technology

1995-07-01

We have recently characterized a multiprotein DNA replication complex (MRC) that was purified from NODA NIB 468 human breast cancer cells by a series...proliferating cell nuclear antigen (PCNA), RE-C RP-A and DNA topoisomerase I. Based upon its requirements for DNA replication activity and its...SV4O) origin sequences, the MRC executes all of the steps required for the in vitro, bidirectional replication of the SV4O genome. Several of the DNA

Lineage-specific evolutionary rate in plants: Contributions of a screening for Cereus (Cactaceae).

PubMed

Romeiro-Brito, Monique; Moraes, Evandro M; Taylor, Nigel P; Zappi, Daniela C; Franco, Fernando F

2016-01-01

Predictable chloroplast DNA (cpDNA) sequences have been listed for the shallowest taxonomic studies in plants. We investigated whether plastid regions that vary between closely allied species could be applied for intraspecific studies and compared the variation of these plastid segments with two nuclear regions. We screened 16 plastid and two nuclear intronic regions for species of the genus Cereus (Cactaceae) at three hierarchical levels (species from different clades, species of the same clade, and allopatric populations). Ten plastid regions presented interspecific variation, and six of them showed variation at the intraspecific level. The two nuclear regions showed both inter- and intraspecific variation, and in general they showed higher levels of variability in almost all hierarchical levels than the plastid segments. Our data suggest no correspondence between variation of plastid regions at the interspecific and intraspecific level, probably due to lineage-specific variation in cpDNA, which appears to have less effect in nuclear data. Despite the heterogeneity in evolutionary rates of cpDNA, we highlight three plastid segments that may be considered in initial screenings in plant phylogeographic studies.

Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

PubMed

Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

2011-09-01

Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

A Heterogeneous Nuclear Ribonucleoprotein A/B-Related Protein Binds to Single-Stranded DNA near the 5′ End or within the Genome of Feline Parvovirus and Can Modify Virus Replication

PubMed Central

Wang, Dai; Parrish, Colin R.

1999-01-01

Phage display of cDNA clones prepared from feline cells was used to identify host cell proteins that bound to DNA-containing feline panleukopenia virus (FPV) capsids but not to empty capsids. One gene found in several clones encoded a heterogeneous nuclear ribonucleoprotein (hnRNP)-related protein (DBP40) that was very similar in sequence to the A/B-type hnRNP proteins. DBP40 bound specifically to oligonucleotides representing a sequence near the 5′ end of the genome which is exposed on the outside of the full capsid but did not bind most other terminal sequences. Adding purified DBP40 to an in vitro fill-in reaction using viral DNA as a template inhibited the production of the second strand after nucleotide (nt) 289 but prior to nt 469. DBP40 bound to various regions of the viral genome, including a region between nt 295 and 330 of the viral genome which has been associated with transcriptional attenuation of the parvovirus minute virus of mice, which is mediated by a stem-loop structure of the DNA and cellular proteins. Overexpression of the protein in feline cells from a plasmid vector made them largely resistant to FPV infection. Mutagenesis of the protein binding site within the 5′ end viral genome did not affect replication of the virus. PMID:10438866

A long PCR–based approach for DNA enrichment prior to next-generation sequencing for systematic studies1

PubMed Central

Uribe-Convers, Simon; Duke, Justin R.; Moore, Michael J.; Tank, David C.

2014-01-01

• Premise of the study: We present an alternative approach for molecular systematic studies that combines long PCR and next-generation sequencing. Our approach can be used to generate templates from any DNA source for next-generation sequencing. Here we test our approach by amplifying complete chloroplast genomes, and we present a set of 58 potentially universal primers for angiosperms to do so. Additionally, this approach is likely to be particularly useful for nuclear and mitochondrial regions. • Methods and Results: Chloroplast genomes of 30 species across angiosperms were amplified to test our approach. Amplification success varied depending on whether PCR conditions were optimized for a given taxon. To further test our approach, some amplicons were sequenced on an Illumina HiSeq 2000. • Conclusions: Although here we tested this approach by sequencing plastomes, long PCR amplicons could be generated using DNA from any genome, expanding the possibilities of this approach for molecular systematic studies. PMID:25202592

Mitochondrial and nuclear genetic relationships of deer (Odocoileus spp.) in western North America

USGS Publications Warehouse

Cronin, Matthew A.

1991-01-01

Odocoileus hemionus (mule deer and black-tailed deer) and Odocoileus virginanus (white-tailed deer) are sympatric in western North America and are characterized by distinct morphology, behavior, and allozyme allele frequencies. However, there is discordance among nuclear and mitochondrial genetic relationships, as mule deer (O. h. hemionus) and white-tailed deer have similar mitochondrial DNA (mtDNA) which is very different from that of black-tailed deer (O. h. columbianus, O. h. sitkensis). I expanded previous studies to clarify the genetic relationships of these groups by determining mtDNA haplotype and allozyme genotypes for 667 deer from several locations in northwestern North America. Different mtDNA haplotypes in mule deer, black-tailed deer, and white-tailed deer indicate that mitochondrial gene flow is restricted. Allozyme allele frequencies indicate that there is also restriction of nuclear gene flow between O. virginianus and O. hemionus, and to a lesser extent between mule deer and black-tailed deer. There is a low level of introgressive hybridization of mtDNA from mule deer and black-tailed deer into white-tailed deer populations and considerable interbreeding of mule deer and black-tailed deer in a contact zone. The discordance of mitochondrial and nuclear genomes is apparent only if mtDNA sequence divergences, and not haplotype frequencies, are considered.

A phylogenetic overview of the antrodia clade (Basidiomycota, Polyporales)

Treesearch

Beatriz Ortiz-Santana; Daniel L. Lindner; Otto Miettinen; Alfredo Justo; David S. Hibbett

2013-01-01

Phylogenetic relationships among members of the antrodia clade were investigated with molecular data from two nuclear ribosomal DNA regions, LSU and ITS. A total of 123 species representing 26 genera producing a brown rot were included in the present study. Three DNA datasets (combined LSU-ITS dataset, LSU dataset, ITS dataset) comprising sequences of 449 isolates were...

A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

PubMed

Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

2017-11-01

Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Chloroplast variation is incongruent with classification of the Australian bloodwood eucalypts (genus Corymbia, family Myrtaceae)

PubMed Central

Schuster, Tanja M.; Setaro, Sabrina D.; Tibbits, Josquin F. G.; Batty, Erin L.; Fowler, Rachael M.; McLay, Todd G. B.; Wilcox, Stephen; Ades, Peter K.

2018-01-01

Previous molecular phylogenetic analyses have resolved the Australian bloodwood eucalypt genus Corymbia (~100 species) as either monophyletic or paraphyletic with respect to Angophora (9–10 species). Here we assess relationships of Corymbia and Angophora using a large dataset of chloroplast DNA sequences (121,016 base pairs; from 90 accessions representing 55 Corymbia and 8 Angophora species, plus 33 accessions of related genera), skimmed from high throughput sequencing of genomic DNA, and compare results with new analyses of nuclear ITS sequences (119 accessions) from previous studies. Maximum likelihood and maximum parsimony analyses of cpDNA resolve well supported trees with most nodes having >95% bootstrap support. These trees strongly reject monophyly of Corymbia, its two subgenera (Corymbia and Blakella), most taxonomic sections (Abbreviatae, Maculatae, Naviculares, Septentrionales), and several species. ITS trees weakly indicate paraphyly of Corymbia (bootstrap support <50% for maximum likelihood, and 71% for parsimony), but are highly incongruent with the cpDNA analyses, in that they support monophyly of both subgenera and some taxonomic sections of Corymbia. The striking incongruence between cpDNA trees and both morphological taxonomy and ITS trees is attributed largely to chloroplast introgression between taxa, because of geographic sharing of chloroplast clades across taxonomic groups. Such introgression has been widely inferred in studies of the related genus Eucalyptus. This is the first report of its likely prevalence in Corymbia and Angophora, but this is consistent with previous morphological inferences of hybridisation between species. Our findings (based on continent-wide sampling) highlight a need for more focussed studies to assess the extent of hybridisation and introgression in the evolutionary history of these genera, and that critical testing of the classification of Corymbia and Angophora requires additional sequence data from nuclear genomes. PMID:29668710

Analyses of the population structure in a global collection of Phytophthora nicotianae isolates inferred from mitochondrial and nuclear DNA sequences

USDA-ARS?s Scientific Manuscript database

Genetic variation within the heterothallic cosmopolitan plant pathogen Phytophthora nicotianae was determined in 96 isolates from a wide range of hosts and geographic locations by characterizing four mitochondrial (10% of the genome) and three nuclear loci. Fifty-two SNPs ( average of 1 every 58 bp)...

Genealogy of the nuclear beta-fibrinogen locus in a highly structured lizard species: comparison with mtDNA and evidence for intragenic recombination in the hybrid zone.

PubMed

Godinho, R; Mendonça, B; Crespo, E G; Ferrand, N

2006-06-01

The study of nuclear genealogies in natural populations of nonmodel organisms is expected to provide novel insights into the evolutionary history of populations, especially when developed in the framework of well-established mtDNA phylogeographical scenarios. In the Iberian Peninsula, the endemic Schreiber's green lizard Lacerta schreiberi exhibits two highly divergent and allopatric mtDNA lineages that started to split during the late Pliocene. In this work, we performed a fine-scale analysis of the putative mtDNA contact zone together with a global analysis of the patterns of variation observed at the nuclear beta-fibrinogen intron 7 (beta-fibint7). Using a combination of DNA sequencing with single-strand conformational polymorphism (SSCP) analysis, we show that the observed genealogy at the beta-fibint7 locus reveals extensive admixture between two formerly isolated lizard populations while the two mtDNA lineages remain essentially allopatric. In addition, a private beta-fibint7 haplotype detected in the single population where both mtDNA lineages were found in sympatry is probably the result of intragenic recombination between the two more common and divergent beta-fibint7 haplotypes. Our results suggest that the progressive incorporation of nuclear genealogies in investigating the ancient demography and admixture dynamics of divergent genomes will be necessary to obtain a more comprehensive picture of the evolutionary history of organisms.

Molecular Diagnosis of Infantile Mitochondrial Disease with Targeted Next-Generation Sequencing

PubMed Central

Calvo, Sarah E.; Compton, Alison G.; Hershman, Steven G.; Lim, Sze Chern; Lieber, Daniel S.; Tucker, Elena J.; Laskowski, Adrienne; Garone, Caterina; Liu, Shangtao; Jaffe, David B.; Christodoulou, John; Fletcher, Janice M.; Bruno, Damien L; Goldblatt, Jack; DiMauro, Salvatore; Thorburn, David R.; Mootha, Vamsi K.

2012-01-01

Advances in next-generation sequencing (NGS) promise to facilitate diagnosis of inherited disorders. While in research settings NGS has pinpointed causal alleles using segregation in large families, the key challenge for clinical diagnosis is application to single individuals. To explore its diagnostic utility, we performed targeted NGS in 42 unrelated infants with clinical and biochemical evidence of mitochondrial oxidative phosphorylation disease, who were refractory to traditional molecular diagnosis. These devastating mitochondrial disorders are characterized by phenotypic and genetic heterogeneity, with over 100 causal genes identified to date. We performed “MitoExome” sequencing of the mitochondrial DNA (mtDNA) and exons of ~1000 nuclear genes encoding mitochondrial proteins and prioritized rare mutations predicted to disrupt function. Since patients and controls harbored a comparable number of such heterozygous alleles, we could not prioritize dominant acting genes. However, patients showed a five-fold enrichment of genes with two such mutations that could underlie recessive disease. In total, 23/42 (55%) patients harbored such recessive genes or pathogenic mtDNA variants. Firm diagnoses were enabled in 10 patients (24%) who had mutations in genes previously linked to disease. 13 patients (31%) had mutations in nuclear genes never linked to disease. The pathogenicity of two such genes, NDUFB3 and AGK, was supported by cDNA complementation and evidence from multiple patients, respectively. The results underscore the immediate potential and challenges of deploying NGS in clinical settings. PMID:22277967

The genome of Eimeria spp., with special reference to Eimeria tenella--a coccidium from the chicken.

PubMed

Shirley, M W

2000-04-10

Eimeria spp. contain at least four genomes. The nuclear genome is best studied in the avian species Eimeria tenella and comprises about 60 Mbp DNA contained within ca. 14 chromosomes; other avian and lupine species appear to possess a nuclear genome of similar size. In addition, sequence data and hybridisation studies have provided direct evidence for extrachromosomal mitochondrial and plastid DNA genomes, and double-stranded RNA segments have also been described. The unique phenotype of "precocious" development that characterises some selected lines of Eimeria spp. not only provides the basis for the first generation of live attenuated vaccines, but offers a significant entrée into studies on the regulation of an apicomplexan life-cycle. With a view to identifying loci implicated in the trait of precocious development, a genetic linkage map of the genome of E. tenella is being constructed in this laboratory from analyses of the inheritance of over 400 polymorphic DNA markers in the progeny of a cross between complementary drug-resistant and precocious parents. Other projects that impinge directly or indirectly on the genome and/or genetics of Eimeria spp. are currently in progress in several laboratories, and include the derivation of expressed sequence tag data and the development of ancillary technologies such as transfection techniques. No large-scale genomic DNA sequencing projects have been reported.

Science and technology review, July/August 1997

DOE Office of Scientific and Technical Information (OSTI.GOV)

Upadhye, R.

This month`s issues are entitled Assuring the Safety of Nuclear Power; The Microtechnology Center, When Smaller is Better; Speeding the Gene Hunt: High Speed DNA Sequencing; and Microbial Treatments of High Explosives.

Evolutionary Origin of OwlRep, a Megasatellite DNA Associated with Adaptation of Owl Monkeys to Nocturnal Lifestyle

PubMed Central

Nishihara, Hidenori; Stanyon, Roscoe; Kusumi, Junko; Hirai, Hirohisa

2018-01-01

Abstract Rod cells of many nocturnal mammals have a “non-standard” nuclear architecture, which is called the inverted nuclear architecture. Heterochromatin localizes to the central region of the nucleus. This leads to an efficient light transmission to the outer segments of photoreceptors. Rod cells of diurnal mammals have the conventional nuclear architecture. Owl monkeys (genus Aotus) are the only taxon of simian primates that has a nocturnal or cathemeral lifestyle, and this adaptation is widely thought to be secondary. Their rod cells were shown to exhibit an intermediate chromatin distribution: a spherical heterochromatin block was found in the central region of the nucleus although it was less complete than that of typical nocturnal mammals. We recently demonstrated that the primary DNA component of this heterochromatin block was OwlRep, a megasatellite DNA consisting of 187-bp-long repeat units. However, the origin of OwlRep was not known. Here we show that OwlRep was derived from HSAT6, a simple repeat sequence found in the centromere regions of human chromosomes. HSAT6 occurs widely in primates, suggesting that it was already present in the last common ancestor of extant primates. Notably, Strepsirrhini and Tarsiformes apparently carry a single HSAT6 copy, whereas many species of Simiiformes contain multiple copies. Comparison of nucleotide sequences of these copies revealed the entire process of the OwlRep formation. HSAT6, with or without flanking sequences, was segmentally duplicated in New World monkeys. Then, in the owl monkey linage after its divergence from other New World monkeys, a copy of HSAT6 was tandemly amplified, eventually forming a megasatellite DNA. PMID:29294004

The DNA of ciliated protozoa.

PubMed Central

Prescott, D M

1994-01-01

Ciliates contain two types of nuclei: a micronucleus and a macronucleus. The micronucleus serves as the germ line nucleus but does not express its genes. The macronucleus provides the nuclear RNA for vegetative growth. Mating cells exchange haploid micronuclei, and a new macronucleus develops from a new diploid micronucleus. The old macronucleus is destroyed. This conversion consists of amplification, elimination, fragmentation, and splicing of DNA sequences on a massive scale. Fragmentation produces subchromosomal molecules in Tetrahymena and Paramecium cells and much smaller, gene-sized molecules in hypotrichous ciliates to which telomere sequences are added. These molecules are then amplified, some to higher copy numbers than others. rDNA is differentially amplified to thousands of copies per macronucleus. Eliminated sequences include transposonlike elements and sequences called internal eliminated sequences that interrupt gene coding regions in the micronuclear genome. Some, perhaps all, of these are excised as circular molecules and destroyed. In at least some hypotrichs, segments of some micronuclear genes are scrambled in a nonfunctional order and are recorded during macronuclear development. Vegetatively growing ciliates appear to possess a mechanism for adjusting copy numbers of individual genes, which corrects gene imbalances resulting from random distribution of DNA molecules during amitosis of the macronucleus. Other distinctive features of ciliate DNA include an altered use of the conventional stop codons. Images PMID:8078435

Does CTCF mediate between nuclear organization and gene expression?

PubMed

Ohlsson, Rolf; Lobanenkov, Victor; Klenova, Elena

2010-01-01

The multifunctional zinc-finger protein CCCTC-binding factor (CTCF) is a very strong candidate for the role of coordinating the expression level of coding sequences with their three-dimensional position in the nucleus, apparently responding to a "code" in the DNA itself. Dynamic interactions between chromatin fibers in the context of nuclear architecture have been implicated in various aspects of genome functions. However, the molecular basis of these interactions still remains elusive and is a subject of intense debate. Here we discuss the nature of CTCF-DNA interactions, the CTCF-binding specificity to its binding sites and the relationship between CTCF and chromatin, and we examine data linking CTCF with gene regulation in the three-dimensional nuclear space. We discuss why these features render CTCF a very strong candidate for the role and propose a unifying model, the "CTCF code," explaining the mechanistic basis of how the information encrypted in DNA may be interpreted by CTCF into diverse nuclear functions.

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.

PubMed

Takahashi, Tetsumi; Moreno, Edmundo

2015-12-01

The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.

Asymmetric single-strand polymorphism: an accurate and cost-effective method to amplify and sequence allelic variants

USDA-ARS?s Scientific Manuscript database

We needed to obtain an alternative to conventional cloning to generate high-quality DNA sequences from a variety of nuclear orthologs for phylogenetic studies in potato, to save time and money and to avoid problems typically encountered in cloning. We tested a variety of SSCP protocols to include pu...

A phylogenetic hypothesis for passerine birds: taxonomic and biogeographic implications of an analysis of nuclear DNA sequence data.

PubMed Central

Barker, F Keith; Barrowclough, George F; Groth, Jeff G

2002-01-01

Passerine birds comprise over half of avian diversity, but have proved difficult to classify. Despite a long history of work on this group, no comprehensive hypothesis of passerine family-level relationships was available until recent analyses of DNA-DNA hybridization data. Unfortunately, given the value of such a hypothesis in comparative studies of passerine ecology and behaviour, the DNA-hybridization results have not been well tested using independent data and analytical approaches. Therefore, we analysed nucleotide sequence variation at the nuclear RAG-1 and c-mos genes from 69 passerine taxa, including representatives of most currently recognized families. In contradiction to previous DNA-hybridization studies, our analyses suggest paraphyly of suboscine passerines because the suboscine New Zealand wren Acanthisitta was found to be sister to all other passerines. Additionally, we reconstructed the parvorder Corvida as a basal paraphyletic grade within the oscine passerines. Finally, we found strong evidence that several family-level taxa are misplaced in the hybridization results, including the Alaudidae, Irenidae, and Melanocharitidae. The hypothesis of relationships we present here suggests that the oscine passerines arose on the Australian continental plate while it was isolated by oceanic barriers and that a major northern radiation of oscines (i.e. the parvorder Passerida) originated subsequent to dispersal from the south. PMID:11839199

A phylogenetic hypothesis for passerine birds: taxonomic and biogeographic implications of an analysis of nuclear DNA sequence data.

PubMed

Barker, F Keith; Barrowclough, George F; Groth, Jeff G

2002-02-07

Passerine birds comprise over half of avian diversity, but have proved difficult to classify. Despite a long history of work on this group, no comprehensive hypothesis of passerine family-level relationships was available until recent analyses of DNA-DNA hybridization data. Unfortunately, given the value of such a hypothesis in comparative studies of passerine ecology and behaviour, the DNA-hybridization results have not been well tested using independent data and analytical approaches. Therefore, we analysed nucleotide sequence variation at the nuclear RAG-1 and c-mos genes from 69 passerine taxa, including representatives of most currently recognized families. In contradiction to previous DNA-hybridization studies, our analyses suggest paraphyly of suboscine passerines because the suboscine New Zealand wren Acanthisitta was found to be sister to all other passerines. Additionally, we reconstructed the parvorder Corvida as a basal paraphyletic grade within the oscine passerines. Finally, we found strong evidence that several family-level taxa are misplaced in the hybridization results, including the Alaudidae, Irenidae, and Melanocharitidae. The hypothesis of relationships we present here suggests that the oscine passerines arose on the Australian continental plate while it was isolated by oceanic barriers and that a major northern radiation of oscines (i.e. the parvorder Passerida) originated subsequent to dispersal from the south.

Molecular characterization of a nuclear topoisomerase II from Nicotiana tabacum that functionally complements a temperature-sensitive topoisomerase II yeast mutant.

PubMed

Singh, B N; Mudgil, Yashwanti; Sopory, S K; Reddy, M K

2003-07-01

We have successfully expressed enzymatically active plant topoisomerase II in Escherichia coli for the first time, which has enabled its biochemical characterization. Using a PCR-based strategy, we obtained a full-length cDNA and the corresponding genomic clone of tobacco topoisomerase II. The genomic clone has 18 exons interrupted by 17 introns. Most of the 5' and 3' splice junctions follow the typical canonical consensus dinucleotide sequence GU-AG present in other plant introns. The position of introns and phasing with respect to primary amino acid sequence in tobacco TopII and Arabidopsis TopII are highly conserved, suggesting that the two genes are evolved from the common ancestral type II topoisomerase gene. The cDNA encodes a polypeptide of 1482 amino acids. The primary amino acid sequence shows a striking sequence similarity, preserving all the structural domains that are conserved among eukaryotic type II topoisomerases in an identical spatial order. We have expressed the full-length polypeptide in E. coli and purified the recombinant protein to homogeneity. The full-length polypeptide relaxed supercoiled DNA and decatenated the catenated DNA in a Mg(2+)- and ATP-dependent manner, and this activity was inhibited by 4'-(9-acridinylamino)-3'-methoxymethanesulfonanilide (m-AMSA). The immunofluorescence and confocal microscopic studies, with antibodies developed against the N-terminal region of tobacco recombinant topoisomerase II, established the nuclear localization of topoisomerase II in tobacco BY2 cells. The regulated expression of tobacco topoisomerase II gene under the GAL1 promoter functionally complemented a temperature-sensitive TopII(ts) yeast mutant.

Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

PubMed

Calvet, J P; Meyer, L M; Pederson, T

1982-07-30

Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

Timing major conflict between mitochondrial and nuclear genes in species relationships of Polygonia butterflies (Nymphalidae: Nymphalini)

PubMed Central

Wahlberg, Niklas; Weingartner, Elisabet; Warren, Andrew D; Nylin, Sören

2009-01-01

Background Major conflict between mitochondrial and nuclear genes in estimating species relationships is an increasingly common finding in animals. Usually this is attributed to incomplete lineage sorting, but recently the possibility has been raised that hybridization is important in generating such phylogenetic patterns. Just how widespread ancient and/or recent hybridization is in animals and how it affects estimates of species relationships is still not well-known. Results We investigate the species relationships and their evolutionary history over time in the genus Polygonia using DNA sequences from two mitochondrial gene regions (COI and ND1, total 1931 bp) and four nuclear gene regions (EF-1α, wingless, GAPDH and RpS5, total 2948 bp). We found clear, strongly supported conflict between mitochondrial and nuclear DNA sequences in estimating species relationships in the genus Polygonia. Nodes at which there was no conflict tended to have diverged at the same time when analyzed separately, while nodes at which conflict was present diverged at different times. We find that two species create most of the conflict, and attribute the conflict found in Polygonia satyrus to ancient hybridization and conflict found in Polygonia oreas to recent or ongoing hybridization. In both examples, the nuclear gene regions tended to give the phylogenetic relationships of the species supported by morphology and biology. Conclusion Studies inferring species-level relationships using molecular data should never be based on a single locus. Here we show that the phylogenetic hypothesis generated using mitochondrial DNA gives a very different interpretation of the evolutionary history of Polygonia species compared to that generated from nuclear DNA. We show that possible cases of hybridization in Polygonia are not limited to sister species, but may be inferred further back in time. Furthermore, we provide more evidence that Haldane's effect might not be as strong a process in preventing hybridization in butterflies as has been previously thought. PMID:19422691

NADH:ubiquinone oxidoreductase from bovine heart mitochondria. cDNA sequences of the import precursors of the nuclear-encoded 39 kDa and 42 kDa subunits.

PubMed Central

Fearnley, I M; Finel, M; Skehel, J M; Walker, J E

1991-01-01

The 39 kDa and 42 kDa subunits of NADH:ubiquinone oxidoreductase from bovine heart mitochondria are nuclear-coded components of the hydrophobic protein fraction of the enzyme. Their amino acid sequences have been deduced from the sequences of overlapping cDNA clones. These clones were amplified from total bovine heart cDNA by means of the polymerase chain reaction, with the use of complex mixtures of oligonucleotide primers based upon fragments of protein sequence determined at the N-terminals of the proteins and at internal sites. The protein sequences of the 39 kDa and 42 kDa subunits are 345 and 320 amino acid residues long respectively, and their calculated molecular masses are 39,115 Da and 36,693 Da. Both proteins are predominantly hydrophilic, but each contains one or two hydrophobic segments that could possibly be folded into transmembrane alpha-helices. The bovine 39 kDa protein sequence is related to that of a 40 kDa subunit from complex I from Neurospora crassa mitochondria; otherwise, it is not related significantly to any known sequence, including redox proteins and two polypeptides involved in import of proteins into mitochondria, known as the mitochondrial processing peptidase and the processing-enhancing protein. Therefore the functions of the 39 kDa and 42 kDa subunits of complex I are unknown. The mitochondrial gene product, ND4, a hydrophobic component of complex I with an apparent molecular mass of about 39 kDa, has been identified in preparations of the enzyme. This subunit stains faintly with Coomassie Blue dye, and in many gel systems it is not resolved from the nuclearcoded 36 kDa subunit. Images Fig. 1. PMID:1832859

The comet assay in human biomonitoring.

PubMed

Anderson, Diana; Dhawan, Alok; Laubenthal, Julian

2013-01-01

Human biomonitoring studies aim to identify potential exposures to environmental, occupational, or lifestyle toxicants in human populations and are commonly used by public health decision makers to predict disease risk. The Comet assay measures changes in genomic stability and is one of the most reliable biomarkers to indicate early biological effects, and therefore accepted by various governmental regulatory agencies. The appeal of the Comet assay lies in its relative simplicity, rapidity, sensitivity, and economic efficiency. Furthermore, the assay is known for its broad versatility, as it can be applied to virtually any human cell and easily adapted in order to detect particular biomarkers of interest, such as DNA repair capacity or single- and double-strand breaks. In a standard experiment, isolated single cells are first embedded in agarose, and then lysed in high-salt solutions in order to remove all cellular contents except the DNA attached to a nuclear scaffold. Subsequent electrophoresis results in accumulation of undamaged DNA sequences at the proximity of the nuclear scaffold, while damaged sequences migrate towards the anode. When visualized with fluorochromes, these migrated DNA fragments resemble a comet tail and can be quantified for their intensity and shape according to internationally drafted guidelines.

p67SRF is a constitutive nuclear protein implicated in the modulation of genes required throughout the G1 period.

PubMed Central

Gauthier-Rouvière, C; Cavadore, J C; Blanchard, J M; Lamb, N J; Fernandez, A

1991-01-01

Indirect immunofluorescence analysis, using antibodies directed against peptide sequences outside the DNA-binding domain of the 67-kDa serum response factor (p67SRF), revealed a punctuated nuclear staining, constant throughout the cell cycle and in all different cell lines tested. p67SRF was also tightly associated with chromatin through all stages of mitosis. Inhibition of p67SRF activity in vivo, through microinjection of anti-p67SRF antibodies, specifically suppressed DNA synthesis induced after serum addition or ras microinjection, suggesting that these antibodies were effective in preventing expression of serum response element (SRE)-regulated genes. A similar inhibition was also obtained in cells injected with oligonucleotides corresponding to the DNA binding sequence for p67SRF protein, SRE. Moreover, this inhibition of DNA synthesis by anti-p67SRF or SRE injection was still observed in cells injected during late G1, well after c-fos induction. These data imply that genes regulated by p67SRF are continuously involved in the proliferation pathway throughout G1 and that p67SRF forms an integral component of mammalian cell transcriptional control. Images PMID:1782216

Consequences of Normalizing Transcriptomic and Genomic Libraries of Plant Genomes Using a Duplex-Specific Nuclease and Tetramethylammonium Chloride

PubMed Central

Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard

2013-01-01

Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce. PMID:23409088

Consequences of normalizing transcriptomic and genomic libraries of plant genomes using a duplex-specific nuclease and tetramethylammonium chloride.

PubMed

Matvienko, Marta; Kozik, Alexander; Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard

2013-01-01

Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce.

Morphometric and molecular characterization of fungus Pestalotiopsis using nuclear ribosomal DNA analysis.

PubMed

Gehlot, Praveen; Singh, S K; Pathak, Rakesh

2012-09-01

Taxonomy of the fungus Pestalotiopsis based on morphological characters has been equivocal. Molecular characterization often Pestalotiopsis species was done based on nuclear ribosomal DNA internal transcribed spacer (ITS) amplifications. Results of the analyses showed that species of genus Pestalotiopsis are monophyletic. We report ITS length variations, single nucleotide polymorphisms (SNPs) and insertions/ deletions (INDELS) among ten species of Pestalotiopsis that did not cause any phylogenetic error at either genus or species designation levels. New gene sequences have been assigned (Gen Accession numbers from HM 190146 to HM 190155) by the National Centre for Biotechnology Information, USA.

Comparative Analysis of the Complete Chloroplast Genome of Four Endangered Herbals of Notopterygium

PubMed Central

Yang, Jiao; Yue, Ming; Niu, Chuan; Ma, Xiong-Feng; Li, Zhong-Hu

2017-01-01

Notopterygium H. de Boissieu (Apiaceae) is an endangered perennial herb endemic to China. A good knowledge of phylogenetic evolution and population genomics is conducive to the establishment of effective management and conservation strategies of the genus Notopterygium. In this study, the complete chloroplast (cp) genomes of four Notopterygium species (N. incisum C. C. Ting ex H. T. Chang, N. oviforme R. H. Shan, N. franchetii H. de Boissieu and N. forrestii H. Wolff) were assembled and characterized using next-generation sequencing. We investigated the gene organization, order, size and repeat sequences of the cp genome and constructed the phylogenetic relationships of Notopterygium species based on the chloroplast DNA and nuclear internal transcribed spacer (ITS) sequences. Comparative analysis of plastid genome showed that the cp DNA are the standard double-stranded molecule, ranging from 157,462 bp (N. oviforme) to 159,607 bp (N. forrestii) in length. The circular DNA each contained a large single-copy (LSC) region, a small single-copy (SSC) region, and a pair of inverted repeats (IRs). The cp DNA of four species contained 85 protein-coding genes, 37 transfer RNA (tRNA) genes and 8 ribosomal RNA (rRNA) genes, respectively. We determined the marked conservation of gene content and sequence evolutionary rate in the cp genome of four Notopterygium species. Three genes (psaI, psbI and rpoA) were possibly under positive selection among the four sampled species. Phylogenetic analysis showed that four Notopterygium species formed a monophyletic clade with high bootstrap support. However, the inconsistent interspecific relationships with the genus Notopterygium were identified between the cp DNA and ITS markers. The incomplete lineage sorting, convergence evolution or hybridization, gene infiltration and different sampling strategies among species may have caused the incongruence between the nuclear and cp DNA relationships. The present results suggested that Notopterygium species may have experienced a complex evolutionary history and speciation process. PMID:28422071

Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

PubMed

Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

2009-02-05

The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

Population structure of the giant garter snake, Thamnophis gigas

USGS Publications Warehouse

Paquin, M.M.; Wylie, G.D.; Routman, E.J.

2006-01-01

The giant garter snake, Thamnophis gigas, is a threatened species endemic to California's Central Valley. We tested the hypothesis that current watershed boundaries have caused genetic differentiation among populations of T. gigas. We sampled 14 populations throughout the current geographic range of T. gigas and amplified 859 bp from the mitochondrial gene ND4 and one nuclear microsatellite locus. DNA sequence variation from the mitochondrial gene indicates there is some genetic structuring of the populations, with high F ST values and unique haplotypes occurring at high frequency in several populations. We found that clustering populations by watershed boundary results in significant between-region genetic variance for mtDNA. However, analysis of allele frequencies at the microsatellite locus NSU3 reveals very low F ST values and little between-region variation in allele frequencies. The discordance found between mitochondrial and microsatellite data may be explained by aspects of molecular evolution and/or T. gigas life history characteristics. Differences in effective population size between mitochondrial and nuclear DNA, or male-biased gene flow, result in a lower migration rate of mitochondrial haplotypes relative to nuclear alleles. However, we cannot exclude homoplasy as one explanation for homogeneity found for the single microsatellite locus. The mitochondrial nucleotide sequence data supports conservation practices that identify separate management units for T. gigas. ?? Springer 2006.

Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae).

PubMed

Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel

2008-09-01

Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.

Evolutionary rates of mitochondrial genomes correspond to diversification rates and to contemporary species richness in birds and reptiles

PubMed Central

Eo, Soo Hyung; DeWoody, J. Andrew

2010-01-01

Rates of biological diversification should ultimately correspond to rates of genome evolution. Recent studies have compared diversification rates with phylogenetic branch lengths, but incomplete phylogenies hamper such analyses for many taxa. Herein, we use pairwise comparisons of confamilial sauropsid (bird and reptile) mitochondrial DNA (mtDNA) genome sequences to estimate substitution rates. These molecular evolutionary rates are considered in light of the age and species richness of each taxonomic family, using a random-walk speciation–extinction process to estimate rates of diversification. We find the molecular clock ticks at disparate rates in different families and at different genes. For example, evolutionary rates are relatively fast in snakes and lizards, intermediate in crocodilians and slow in turtles and birds. There was also rate variation across genes, where non-synonymous substitution rates were fastest at ATP8 and slowest at CO3. Family-by-gene interactions were significant, indicating that local clocks vary substantially among sauropsids. Most importantly, we find evidence that mitochondrial genome evolutionary rates are positively correlated with speciation rates and with contemporary species richness. Nuclear sequences are poorly represented among reptiles, but the correlation between rates of molecular evolution and species diversification also extends to 18 avian nuclear genes we tested. Thus, the nuclear data buttress our mtDNA findings. PMID:20610427

Molecular systematics of Indian Alysicarpus (Fabaceae) based on analyses of nuclear ribosomal DNA sequences.

PubMed

Gholami, Akram; Subramaniam, Shweta; Geeta, R; Pandey, Arun K

2017-06-01

Alysicarpus Necker ex Desvaux (Fabaceae, Desmodieae) consists of ~30 species that are distributed in tropical and subtropical regions of theworld. In India, the genus is represented by ca. 18 species, ofwhich seven are endemic. Sequences of the nuclear Internal transcribed spacer from38 accessions representing 16 Indian specieswere subjected to phylogenetic analyses. The ITS sequence data strongly support the monophyly of the genus Alysicarpus. Analyses revealed four major well-supported clades within Alysicarpus. Ancestral state reconstructions were done for two morphological characters, namely calyx length in relation to pod (macrocalyx and microcalyx) and pod surface ornamentation (transversely rugose and nonrugose). The present study is the first report on molecular systematics of Indian Alysicarpus.

Sequence and characterization of cytoplasmic nuclear protein import factor p97

PubMed Central

1995-01-01

Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630

Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

PubMed

Kang, J J; Yokoi, T J; Holland, M J

1995-12-01

The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

Deciphering amphibian diversity through DNA barcoding: chances and challenges.

PubMed

Vences, Miguel; Thomas, Meike; Bonett, Ronald M; Vieites, David R

2005-10-29

Amphibians globally are in decline, yet there is still a tremendous amount of unrecognized diversity, calling for an acceleration of taxonomic exploration. This process will be greatly facilitated by a DNA barcoding system; however, the mitochondrial population structure of many amphibian species presents numerous challenges to such a standardized, single locus, approach. Here we analyse intra- and interspecific patterns of mitochondrial variation in two distantly related groups of amphibians, mantellid frogs and salamanders, to determine the promise of DNA barcoding with cytochrome oxidase subunit I (cox1) sequences in this taxon. High intraspecific cox1 divergences of 7-14% were observed (18% in one case) within the whole set of amphibian sequences analysed. These high values are not caused by particularly high substitution rates of this gene but by generally deep mitochondrial divergences within and among amphibian species. Despite these high divergences, cox1 sequences were able to correctly identify species including disparate geographic variants. The main problems with cox1 barcoding of amphibians are (i) the high variability of priming sites that hinder the application of universal primers to all species and (ii) the observed distinct overlap of intraspecific and interspecific divergence values, which implies difficulties in the definition of threshold values to identify candidate species. Common discordances between geographical signatures of mitochondrial and nuclear markers in amphibians indicate that a single-locus approach can be problematic when high accuracy of DNA barcoding is required. We suggest that a number of mitochondrial and nuclear genes may be used as DNA barcoding markers to complement cox1.

The confounding effects of hybridization on phylogenetic estimation in the New Zealand cicada genus Kikihia.

PubMed

Banker, Sarah E; Wade, Elizabeth J; Simon, Chris

2017-11-01

Phylogenetic studies of multiple independently inherited nuclear genes considered in combination with patterns of inheritance of organelle DNA have provided considerable insight into the history of species evolution. In particular, investigations of cicadas in the New Zealand genus Kikihia have identified interesting cases where mitochondrial DNA (mtDNA) crosses species boundaries in some species pairs but not others. Previous phylogenetic studies focusing on mtDNA largely corroborated Kikihia species groups identified by song, morphology and ecology with the exception of a unique South Island mitochondrial haplotype clade-the Westlandica group. This newly identified group consists of diverse taxa previously classified as belonging to three different sub-generic clades. We sequenced five nuclear loci from multiple individuals from every species of Kikihia to assess the nuclear gene concordance for this newly-identified mtDNA lineage. Bayes Factor analysis of the constrained phylogeny suggests some support for the mtDNA-based hypotheses, despite the fact that neither concatenation nor multiple species tree methods resolve the Westlandica group as monophyletic. The nuclear analyses suggest a geographic distinction between clearly defined monophyletic North Island clades and unresolved South Island clades. We suggest that more extreme habitat modification on South Island during the Pliocene and Pleistocene resulted in secondary contact and hybridization between species pairs and a series of mitochondrial capture events followed by subsequent lineage evolution. Copyright © 2017 Elsevier Inc. All rights reserved.

Sequence Effect on the Formation of DNA Minidumbbells.

PubMed

Liu, Yuan; Lam, Sik Lok

2017-11-16

The DNA minidumbbell (MDB) is a recently identified non-B structure. The reported MDBs contain two TTTA, CCTG, or CTTG type II loops. At present, the knowledge and understanding of the sequence criteria for MDB formation are still limited. In this study, we performed a systematic high-resolution nuclear magnetic resonance (NMR) and native gel study to investigate the effect of sequence variations in tandem repeats on the formation of MDBs. Our NMR results reveal the importance of hydrogen bonds, base-base stacking, and hydrophobic interactions from each of the participating residues. We conclude that in the MDBs formed by tandem repeats, C-G loop-closing base pairs are more stabilizing than T-A loop-closing base pairs, and thymine residues in both the second and third loop positions are more stabilizing than cytosine residues. The results from this study enrich our knowledge on the sequence criteria for the formation of MDBs, paving a path for better exploring their potential roles in biological systems and DNA nanotechnology.

Identification of a maize nucleic acid-binding protein (NBP) belonging to a family of nuclear-encoded chloroplast proteins.

PubMed Central

Cook, W B; Walker, J C

1992-01-01

A cDNA encoding a nuclear-encoded chloroplast nucleic acid-binding protein (NBP) has been isolated from maize. Identified as an in vitro DNA-binding activity, NBP belongs to a family of nuclear-encoded chloroplast proteins which share a common domain structure and are thought to be involved in posttranscriptional regulation of chloroplast gene expression. NBP contains an N-terminal chloroplast transit peptide, a highly acidic domain and a pair of ribonucleoprotein consensus sequence domains. NBP is expressed in a light-dependent, organ-specific manner which is consistent with its involvement in chloroplast biogenesis. The relationship of NBP to the other members of this protein family and their possible regulatory functions are discussed. Images PMID:1346929

Genome Size, Molecular Phylogeny, and Evolutionary History of the Tribe Aquilarieae (Thymelaeaceae), the Natural Source of Agarwood

PubMed Central

Farah, Azman H.; Lee, Shiou Yih; Gao, Zhihui; Yao, Tze Leong; Madon, Maria; Mohamed, Rozi

2018-01-01

The tribe Aquilarieae of the family Thymelaeaceae consists of two genera, Aquilaria and Gyrinops, with a total of 30 species, distributed from northeast India, through southeast Asia and the south of China, to Papua New Guinea. They are an important botanical resource for fragrant agarwood, a prized product derived from injured or infected stems of these species. The aim of this study was to estimate the genome size of selected Aquilaria species and comprehend the evolutionary history of Aquilarieae speciation through molecular phylogeny. Five non-coding chloroplast DNA regions and a nuclear region were sequenced from 12 Aquilaria and three Gyrinops species. Phylogenetic trees constructed using combined chloroplast DNA sequences revealed relationships of the studied 15 members in Aquilarieae, while nuclear ribosomal DNA internal transcribed spacer (ITS) sequences showed a paraphyletic relationship between Aquilaria species from Indochina and Malesian. We exposed, for the first time, the estimated divergence time for Aquilarieae speciation, which was speculated to happen during the Miocene Epoch. The ancestral split and biogeographic pattern of studied species were discussed. Results showed no large variation in the 2C-values for the five Aquilaria species (1.35–2.23 pg). Further investigation into the genome size may provide additional information regarding ancestral traits and its evolution history. PMID:29896211

Iron-Inducible Nuclear Translocation of a Myb3 Transcription Factor in the Protozoan Parasite Trichomonas vaginalis

PubMed Central

Hsu, Hong-Ming; Lee, Yu; Indra, Dharmu; Wei, Shu-Yi; Liu, Hsing-Wei; Chang, Lung-Chun; Chen, Chinpan; Ong, Shiou-Jeng

2012-01-01

In Trichomonas vaginalis, a novel nuclear localization signal spanning the folded R2R3 DNA-binding domain of a Myb2 protein was previously identified. To study whether a similar signal is used for nuclear translocation by other Myb proteins, nuclear translocation of Myb3 was examined in this report. When overexpressed, hemagglutinin-tagged Myb3 was localized to nuclei of transfected cells, with a cellular distribution similar to that of endogenous Myb3. Fusion to a bacterial tetracycline repressor, R2R3, of Myb3 that spans amino acids (aa) 48 to 156 was insufficient for nuclear translocation of the fusion protein, unless its C terminus was extended to aa 167. The conserved isoleucine in helix 2 of R2R3, which is important for Myb2's structural integrity in maintaining DNA-binding activity and nuclear translocation, was also vital for the former activity of Myb3, but less crucial for the latter. Sequential nuclear influx and efflux of Myb3, which require further extension of the nuclear localization signal to aa 180, were immediately induced after iron repletion. Sequence elements that regulate nuclear translocation with cytoplasmic retention, nuclear influx, and nuclear efflux were identified within the C-terminal tail. These results suggest that the R2R3 DNA-binding domain also serves as a common module for the nuclear translocation of both Myb2 and Myb3, but there are intrinsic differences between the two nuclear localization signals. PMID:23042127

Coordination of tRNA transcription with export at nuclear pore complexes in budding yeast.

PubMed

Chen, Miao; Gartenberg, Marc R

2014-05-01

tRNAs are encoded by RNA polymerase III-transcribed genes that reside at seemingly random intervals along the chromosomes of budding yeast. Existing evidence suggests that the genes congregate together at the nucleolus and/or centromeres. In this study, we re-examined spatial and temporal aspects of tRNA gene (tDNA) expression. We show that tDNA transcription fluctuates during cell cycle progression. In M phase, when tRNA synthesis peaks, tDNAs localize at nuclear pore complexes (NPCs). Docking of a tDNA requires the DNA sequence of the contacted gene, nucleoporins Nup60 and Nup2, and cohesin. Characterization of mutants that block NPC localization revealed that docking is a consequence of elevated tDNA transcription. NPC-tDNA contact falters in the absence of the principal exportin of nascent tRNA, Los1, and genetic assays indicate that gating of tDNAs at NPCs favors cytoplasmic accumulation of functional tRNA. Collectively, the data suggest that tDNAs associate with NPCs to coordinate RNA polymerase III transcription with the nuclear export of pre-tRNA. The M-phase specificity of NPC contact reflects a regulatory mechanism that may have evolved, in part, to avoid collisions between DNA replication forks and transcribing RNA polymerase III machinery at NPCs.

Coordination of tRNA transcription with export at nuclear pore complexes in budding yeast

PubMed Central

Chen, Miao; Gartenberg, Marc R.

2014-01-01

tRNAs are encoded by RNA polymerase III-transcribed genes that reside at seemingly random intervals along the chromosomes of budding yeast. Existing evidence suggests that the genes congregate together at the nucleolus and/or centromeres. In this study, we re-examined spatial and temporal aspects of tRNA gene (tDNA) expression. We show that tDNA transcription fluctuates during cell cycle progression. In M phase, when tRNA synthesis peaks, tDNAs localize at nuclear pore complexes (NPCs). Docking of a tDNA requires the DNA sequence of the contacted gene, nucleoporins Nup60 and Nup2, and cohesin. Characterization of mutants that block NPC localization revealed that docking is a consequence of elevated tDNA transcription. NPC–tDNA contact falters in the absence of the principal exportin of nascent tRNA, Los1, and genetic assays indicate that gating of tDNAs at NPCs favors cytoplasmic accumulation of functional tRNA. Collectively, the data suggest that tDNAs associate with NPCs to coordinate RNA polymerase III transcription with the nuclear export of pre-tRNA. The M-phase specificity of NPC contact reflects a regulatory mechanism that may have evolved, in part, to avoid collisions between DNA replication forks and transcribing RNA polymerase III machinery at NPCs. PMID:24788517

Basal jawed vertebrate phylogeny inferred from multiple nuclear DNA-coded genes

PubMed Central

Kikugawa, Kanae; Katoh, Kazutaka; Kuraku, Shigehiro; Sakurai, Hiroshi; Ishida, Osamu; Iwabe, Naoyuki; Miyata, Takashi

2004-01-01

Background Phylogenetic analyses of jawed vertebrates based on mitochondrial sequences often result in confusing inferences which are obviously inconsistent with generally accepted trees. In particular, in a hypothesis by Rasmussen and Arnason based on mitochondrial trees, cartilaginous fishes have a terminal position in a paraphyletic cluster of bony fishes. No previous analysis based on nuclear DNA-coded genes could significantly reject the mitochondrial trees of jawed vertebrates. Results We have cloned and sequenced seven nuclear DNA-coded genes from 13 vertebrate species. These sequences, together with sequences available from databases including 13 jawed vertebrates from eight major groups (cartilaginous fishes, bichir, chondrosteans, gar, bowfin, teleost fishes, lungfishes and tetrapods) and an outgroup (a cyclostome and a lancelet), have been subjected to phylogenetic analyses based on the maximum likelihood method. Conclusion Cartilaginous fishes have been inferred to be basal to other jawed vertebrates, which is consistent with the generally accepted view. The minimum log-likelihood difference between the maximum likelihood tree and trees not supporting the basal position of cartilaginous fishes is 18.3 ± 13.1. The hypothesis by Rasmussen and Arnason has been significantly rejected with the minimum log-likelihood difference of 123 ± 23.3. Our tree has also shown that living holosteans, comprising bowfin and gar, form a monophyletic group which is the sister group to teleost fishes. This is consistent with a formerly prevalent view of vertebrate classification, although inconsistent with both of the current morphology-based and mitochondrial sequence-based trees. Furthermore, the bichir has been shown to be the basal ray-finned fish. Tetrapods and lungfish have formed a monophyletic cluster in the tree inferred from the concatenated alignment, being consistent with the currently prevalent view. It also remains possible that tetrapods are more closely related to ray-finned fishes than to lungfishes. PMID:15070407

Lineage-specific evolutionary rate in plants: Contributions of a screening for Cereus (Cactaceae)1

PubMed Central

Romeiro-Brito, Monique; Moraes, Evandro M.; Taylor, Nigel P.; Zappi, Daniela C.; Franco, Fernando F.

2016-01-01

Premise of the study: Predictable chloroplast DNA (cpDNA) sequences have been listed for the shallowest taxonomic studies in plants. We investigated whether plastid regions that vary between closely allied species could be applied for intraspecific studies and compared the variation of these plastid segments with two nuclear regions. Methods: We screened 16 plastid and two nuclear intronic regions for species of the genus Cereus (Cactaceae) at three hierarchical levels (species from different clades, species of the same clade, and allopatric populations). Results: Ten plastid regions presented interspecific variation, and six of them showed variation at the intraspecific level. The two nuclear regions showed both inter- and intraspecific variation, and in general they showed higher levels of variability in almost all hierarchical levels than the plastid segments. Discussion: Our data suggest no correspondence between variation of plastid regions at the interspecific and intraspecific level, probably due to lineage-specific variation in cpDNA, which appears to have less effect in nuclear data. Despite the heterogeneity in evolutionary rates of cpDNA, we highlight three plastid segments that may be considered in initial screenings in plant phylogeographic studies. PMID:26819857

Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

PubMed Central

Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

2006-01-01

As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome, we expect our report eventually to shed light on the evolution of the hymenopteran genome within higher insects, particularly regarding the relative maintenance of conserved rDNA genes, related variable spacer regions and retrotransposable elements. PMID:17069639

Biosystematics and Conservation: A Case Study with Two Enigmatic and Uncommon Species of Crassula from New Zealand

PubMed Central

De Lange, P. J.; Heenan, P. B.; Keeling, D. J.; Murray, B. G.; Smissen, R.; Sykes, W. R.

2008-01-01

Background and Aims Crassula hunua and C. ruamahanga have been taxonomically controversial. Here their distinctiveness is assessed so that their taxonomic and conservation status can be clarified. Methods Populations of these two species were analysed using morphological, chromosomal and DNA sequence data. Key Results It proved impossible to differentiate between these two species using 12 key morphological characters. Populations were found to be chromosomally variable with 11 different chromosome numbers ranging from 2n = 42 to 2n = 100. Meiotic behaviour and levels of pollen stainability were both variable. Phylogenetic analyses showed that differences exist in both nuclear and plastid DNA sequences between individual plants, sometimes from the same population. Conclusions The results suggest that these plants are a species complex that has evolved through interspecific hybridization and polyploidy. Their high levels of chromosomal and DNA sequence variation present a problem for their conservation. PMID:18055560

Insights into the phylogeny of Northern Hemisphere Armillaria: Neighbor-net and Bayesian analyses of translation elongation factor 1-α gene sequences

Treesearch

Ned B. Klopfenstein; Jane E. Stewart; Yuko Ota; John W. Hanna; Bryce A. Richardson; Amy L. Ross-Davis; Ruben D. Elias-Roman; Kari Korhonen; Nenad Keca; Eugenia Iturritxa; Dionicio Alvarado-Rosales; Halvor Solheim; Nicholas J. Brazee; Piotr Lakomy; Michelle R. Cleary; Eri Hasegawa; Taisei Kikuchi; Fortunato Garza-Ocanas; Panaghiotis Tsopelas; Daniel Rigling; Simone Prospero; Tetyana Tsykun; Jean A. Berube; Franck O. P. Stefani; Saeideh Jafarpour; Vladimir Antonin; Michal Tomsovsky; Geral I. McDonald; Stephen Woodward; Mee-Sook Kim

2017-01-01

Armillaria possesses several intriguing characteristics that have inspired wide interest in understanding phylogenetic relationships within and among species of this genus. Nuclear ribosomal DNA sequence–based analyses of Armillaria provide only limited information for phylogenetic studies among widely divergent taxa. More recent studies have shown that translation...

Complete cpDNA genome sequence of Smilax china and phylogenetic placement of Liliales--influences of gene partitions and taxon sampling.

PubMed

Liu, Juan; Qi, Zhe-Chen; Zhao, Yun-Peng; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun

2012-09-01

The complete nucleotide sequence of the chloroplast genome (cpDNA) of Smilax china L. (Smilacaceae) is reported. It is the first complete cp genome sequence in Liliales. Genomic analyses were conducted to examine the rate and pattern of cpDNA genome evolution in Smilax relative to other major lineages of monocots. The cpDNA genomic sequences were combined with those available for Lilium to evaluate the phylogenetic position of Liliales and to investigate the influence of taxon sampling, gene sampling, gene function, natural selection, and substitution rate on phylogenetic inference in monocots. Phylogenetic analyses using sequence data of gene groups partitioned according to gene function, selection force, and total substitution rate demonstrated evident impacts of these factors on phylogenetic inference of monocots and the placement of Liliales, suggesting potential evolutionary convergence or adaptation of some cpDNA genes in monocots. Our study also demonstrated that reduced taxon sampling reduced the bootstrap support for the placement of Liliales in the cpDNA phylogenomic analysis. Analyses of sequences of 77 protein genes with some missing data and sequences of 81 genes (all protein genes plus the rRNA genes) support a sister relationship of Liliales to the commelinids-Asparagales clade, consistent with the APG III system. Analyses of 63 cpDNA protein genes for 32 taxa with few missing data, however, support a sister relationship of Liliales (represented by Smilax and Lilium) to Dioscoreales-Pandanales. Topology tests indicated that these two alignments do not significantly differ given any of these three cpDNA genomic sequence data sets. Furthermore, we found no saturation effect of the data, suggesting that the cpDNA genomic sequence data used in the study are appropriate for monocot phylogenetic study and long-branch attraction is unlikely to be the cause to explain the result of two well-supported, conflict placements of Liliales. Further analyses using sufficient nuclear data remain necessary to evaluate these two phylogenetic hypotheses regarding the position of Liliales and to address the causes of signal conflict among genes and partitions. Copyright © 2012 Elsevier Inc. All rights reserved.

Pleistocene climate change and the origin of two desert plant species, Pugionium cornutum and Pugionium dolabratum (Brassicaceae), in northwest China.

PubMed

Wang, Qian; Abbott, Richard J; Yu, Qiu-Shi; Lin, Kao; Liu, Jian-Quan

2013-07-01

Pleistocene climate change has had an important effect in shaping intraspecific genetic variation in many species; however, its role in driving speciation is less clear. We examined the possibility of a Pleistocene origin of the only two representatives of the genus Pugionium (Brassicaceae), Pugionium cornutum and Pugionium dolabratum, which occupy different desert habitats in northwest China. We surveyed sequence variation for internal transcribed spacer (ITS), three chloroplast (cp) DNA fragments, and eight low-copy nuclear genes among individuals sampled from 11 populations of each species across their geographic ranges. One ITS mutation distinguished the two species, whereas mutations in cpDNA and the eight low-copy nuclear gene sequences were not species-specific. Although interspecific divergence varied greatly among nuclear gene sequences, in each case divergence was estimated to have occurred within the Pleistocene when deserts expanded in northwest China. Our findings point to the importance of Pleistocene climate change, in this case an increase in aridity, as a cause of speciation in Pugionium as a result of divergence in different habitats that formed in association with the expansion of deserts in China. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada.

PubMed

Kuzmina, Maria L; Braukmann, Thomas W A; Fazekas, Aron J; Graham, Sean W; Dewaard, Stephanie L; Rodrigues, Anuar; Bennett, Bruce A; Dickinson, Timothy A; Saarela, Jeffery M; Catling, Paul M; Newmaster, Steven G; Percy, Diana M; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R; Zakharov, Evgeny V; Hebert, Paul D N

2017-12-01

Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa.

Using herbarium-derived DNAs to assemble a large-scale DNA barcode library for the vascular plants of Canada1

PubMed Central

Kuzmina, Maria L.; Braukmann, Thomas W. A.; Fazekas, Aron J.; Graham, Sean W.; Dewaard, Stephanie L.; Rodrigues, Anuar; Bennett, Bruce A.; Dickinson, Timothy A.; Saarela, Jeffery M.; Catling, Paul M.; Newmaster, Steven G.; Percy, Diana M.; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P.; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R.; Zakharov, Evgeny V.; Hebert, Paul D. N.

2017-01-01

Premise of the study: Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Methods: Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Results: Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Discussion: Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa. PMID:29299394

Intraisolate mitochondrial genetic polymorphism and gene variants coexpression in arbuscular mycorrhizal fungi.

PubMed

Beaudet, Denis; de la Providencia, Ivan Enrique; Labridy, Manuel; Roy-Bolduc, Alice; Daubois, Laurence; Hijri, Mohamed

2014-12-19

Arbuscular mycorrhizal fungi (AMF) are multinucleated and coenocytic organisms, in which the extent of the intraisolate nuclear genetic variation has been a source of debate. Conversely, their mitochondrial genomes (mtDNAs) have appeared to be homogeneous within isolates in all next generation sequencing (NGS)-based studies. Although several lines of evidence have challenged mtDNA homogeneity in AMF, extensive survey to investigate intraisolate allelic diversity has not previously been undertaken. In this study, we used a conventional polymerase chain reaction -based approach on selected mitochondrial regions with a high-fidelity DNA polymerase, followed by cloning and Sanger sequencing. Two isolates of Rhizophagus irregularis were used, one cultivated in vitro for several generations (DAOM-197198) and the other recently isolated from the field (DAOM-242422). At different loci in both isolates, we found intraisolate allelic variation within the mtDNA and in a single copy nuclear marker, which highlighted the presence of several nonsynonymous mutations in protein coding genes. We confirmed that some of this variation persisted in the transcriptome, giving rise to at least four distinct nad4 transcripts in DAOM-197198. We also detected the presence of numerous mitochondrial DNA copies within nuclear genomes (numts), providing insights to understand this important evolutionary process in AMF. Our study reveals that genetic variation in Glomeromycota is higher than what had been previously assumed and also suggests that it could have been grossly underestimated in most NGS-based AMF studies, both in mitochondrial and nuclear genomes, due to the presence of low-level mutations. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Cryptic Diversity within the Major Trypanosomiasis Vector Glossina fuscipes Revealed by Molecular Markers

PubMed Central

Choi, Kwang-Shik; Darby, Alistair C.; Causse, Sandrine; Kapitano, Berisha; Hall, Martin J. R.; Steen, Keith; Lutumba, Pascal; Madinga, Joules; Torr, Steve J.; Okedi, Loyce M.; Lehane, Michael J.; Donnelly, Martin J.

2011-01-01

Background The tsetse fly Glossina fuscipes s.l. is responsible for the transmission of approximately 90% of cases of human African trypanosomiasis (HAT) or sleeping sickness. Three G. fuscipes subspecies have been described, primarily based upon subtle differences in the morphology of their genitalia. Here we describe a study conducted across the range of this important vector to determine whether molecular evidence generated from nuclear DNA (microsatellites and gene sequence information), mitochondrial DNA and symbiont DNA support the existence of these taxa as discrete taxonomic units. Principal Findings The nuclear ribosomal Internal transcribed spacer 1 (ITS1) provided support for the three subspecies. However nuclear and mitochondrial sequence data did not support the monophyly of the morphological subspecies G. f. fuscipes or G. f. quanzensis. Instead, the most strongly supported monophyletic group was comprised of flies sampled from Ethiopia. Maternally inherited loci (mtDNA and symbiont) also suggested monophyly of a group from Lake Victoria basin and Tanzania, but this group was not supported by nuclear loci, suggesting different histories of these markers. Microsatellite data confirmed strong structuring across the range of G. fuscipes s.l., and was useful for deriving the interrelationship of closely related populations. Conclusion/Significance We propose that the morphological classification alone is not used to classify populations of G. fuscipes for control purposes. The Ethiopian population, which is scheduled to be the target of a sterile insect release (SIT) programme, was notably discrete. From a programmatic perspective this may be both positive, given that it may reflect limited migration into the area or negative if the high levels of differentiation are also reflected in reproductive isolation between this population and the flies to be used in the release programme. PMID:21858237

Evolutionary analysis of a large mtDNA translocation (numt) into the nuclear genome of the Panthera genus species

PubMed Central

Kim, Jae-Heup; Antunes, Agostinho; Luo, Shu-Jin; Menninger, Joan; Nash, William G.; O’Brien, Stephen J.; Johnson, Warren E.

2006-01-01

Translocation of cymtDNA into the nuclear genome, also referred to as numt, has been reported in many species, including several closely related to the domestic cat (Felis catus). We describe the recent transposition of 12,536 bp of the 17 kb mitochondrial genome into the nucleus of the common ancestor of the five Panthera genus species: tiger, P. tigris; snow leopard, P. uncia; jaguar, P. onca; leopard, P. pardus; and lion, P. leo. This nuclear integration, representing 74% of the mitochondrial genome, is one of the largest to be reported in eukaryotes. The Panthera genus numt differs from the numt previously described in the Felis genus in: (1) chromosomal location (F2 – telomeric region vs. D2 – centromeric region), (2) gene make up (from the ND5 to the ATP8 vs. from the CR to the COII), (3) size (12.5 kb vs. 7.9 kb), and (4) structure (single monomer vs. tandemly repeated in Felis). These distinctions indicate that the origin of this large numt fragment in the nuclear genome of the Panthera species is an independent insertion from that of the domestic cat lineage, which has been further supported by phylogenetic analyses. The tiger cymtDNA shared around 90% sequence identity with the homologous numt sequence, suggesting an origin for the Panthera numt at around 3.5 million years ago, prior to the radiation of the five extant Panthera species. PMID:16380222

Evolutionary analysis of a large mtDNA translocation (numt) into the nuclear genome of the Panthera genus species.

PubMed

Kim, Jae-Heup; Antunes, Agostinho; Luo, Shu-Jin; Menninger, Joan; Nash, William G; O'Brien, Stephen J; Johnson, Warren E

2006-02-01

Translocation of cymtDNA into the nuclear genome, also referred to as numt, has been reported in many species, including several closely related to the domestic cat (Felis catus). We describe the recent transposition of 12,536 bp of the 17 kb mitochondrial genome into the nucleus of the common ancestor of the five Panthera genus species: tiger, P. tigris; snow leopard, P. uncia; jaguar, P. onca; leopard, P. pardus; and lion, P. leo. This nuclear integration, representing 74% of the mitochondrial genome, is one of the largest to be reported in eukaryotes. The Panthera genus numt differs from the numt previously described in the Felis genus in: (1) chromosomal location (F2-telomeric region vs. D2-centromeric region), (2) gene make up (from the ND5 to the ATP8 vs. from the CR to the COII), (3) size (12.5 vs. 7.9 kb), and (4) structure (single monomer vs. tandemly repeated in Felis). These distinctions indicate that the origin of this large numt fragment in the nuclear genome of the Panthera species is an independent insertion from that of the domestic cat lineage, which has been further supported by phylogenetic analyses. The tiger cymtDNA shared around 90% sequence identity with the homologous numt sequence, suggesting an origin for the Panthera numt at around 3.5 million years ago, prior to the radiation of the five extant Panthera species.

Horizontal transfer of DNA from the mitochondrial to the plastid genome and its subsequent evolution in milkweeds (Apocynaceae)

Treesearch

Shannon C.K. Straub; Richard C. Cronn; Christopher Edwards; Mark Fishbein; Aaron Liston

2013-01-01

Horizontal gene transfer (HGT) of DNA from the plastid to the nuclear and mitochondrial genomes of higher plants is a common phenomenon; however, plastid genomes (plastomes) are highly conserved and have generally been regarded as impervious to HGT. We sequenced the 158 kb plastome and the 690 kb mitochondrial genome of common milkweed (Asclepias syriaca [Apocynaceae...

DNA mismatch repair proteins MLH1 and PMS2 can be imported to the nucleus by a classical nuclear import pathway.

PubMed

de Barros, Andrea C; Takeda, Agnes A S; Dreyer, Thiago R; Velazquez-Campoy, Adrian; Kobe, Boštjan; Fontes, Marcos R M

2018-03-01

MLH1 and PMS2 proteins form the MutLα heterodimer, which plays a major role in DNA mismatch repair (MMR) in humans. Mutations in MMR-related proteins are associated with cancer, especially with colon cancer. The N-terminal region of MutLα comprises the N-termini of PMS2 and MLH1 and, similarly, the C-terminal region of MutLα is composed by the C-termini of PMS2 and MLH1, and the two are connected by linker region. The nuclear localization sequences (NLSs) necessary for the nuclear transport of the two proteins are found in this linker region. However, the exact NLS sequences have been controversial, with different sequences reported, particularly for MLH1. The individual components are not imported efficiently, presumably due to their C-termini masking their NLSs. In order to gain insights into the nuclear transport of these proteins, we solved the crystal structures of importin-α bound to peptides corresponding to the supposed NLSs of MLH1 and PMS2 and performed isothermal titration calorimetry to study their binding affinities. Both putative MLH1 and PMS2 NLSs can bind to importin-α as monopartite NLSs, which is in agreement with some previous studies. However, MLH1-NLS has the highest affinity measured by a natural NLS peptide, suggesting a major role of MLH1 protein in nuclear import compared to PMS2. Finally, the role of MLH1 and PMS2 in the nuclear transport of the MutLα heterodimer is discussed. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Light-modulated abundance of an mRNA encoding a calmodulin-regulated, chromatin-associated NTPase in pea

NASA Technical Reports Server (NTRS)

Hsieh, H. L.; Tong, C. G.; Thomas, C.; Roux, S. J.

1996-01-01

A CDNA encoding a 47 kDa nucleoside triphosphatase (NTPase) that is associated with the chromatin of pea nuclei has been cloned and sequenced. The translated sequence of the cDNA includes several domains predicted by known biochemical properties of the enzyme, including five motifs characteristic of the ATP-binding domain of many proteins, several potential casein kinase II phosphorylation sites, a helix-turn-helix region characteristic of DNA-binding proteins, and a potential calmodulin-binding domain. The deduced primary structure also includes an N-terminal sequence that is a predicted signal peptide and an internal sequence that could serve as a bipartite-type nuclear localization signal. Both in situ immunocytochemistry of pea plumules and immunoblots of purified cell fractions indicate that most of the immunodetectable NTPase is within the nucleus, a compartment proteins typically reach through nuclear pores rather than through the endoplasmic reticulum pathway. The translated sequence has some similarity to that of human lamin C, but not high enough to account for the earlier observation that IgG against human lamin C binds to the NTPase in immunoblots. Northern blot analysis shows that the NTPase MRNA is strongly expressed in etiolated plumules, but only poorly or not at all in the leaf and stem tissues of light-grown plants. Accumulation of NTPase mRNA in etiolated seedlings is stimulated by brief treatments with both red and far-red light, as is characteristic of very low-fluence phytochrome responses. Southern blotting with pea genomic DNA indicates the NTPase is likely to be encoded by a single gene.

Drosophila nuclear factor DREF regulates the expression of the mitochondrial DNA helicase and mitochondrial transcription factor B2 but not the mitochondrial translation factor B1

PubMed Central

Fernández-Moreno, Miguel A.; Hernández, Rosana; Adán, Cristina; Roberti, Marina; Bruni, Francesco; Polosa, Paola Loguercio; Cantatore, Palmiro; Matsushima, Yuichi; Kaguni, Laurie S.; Garesse, Rafael

2016-01-01

DREF [DRE (DNA replication-related element)-binding factor] controls the transcription of numerous genes in Drosophila, many involved in nuclear DNA (nDNA) replication and cell proliferation, three in mitochondrial DNA (mtDNA) replication and two in mtDNA transcription termination. In this work, we have analysed the involvement of DREF in the expression of the known remaining genes engaged in the minimal mtDNA replication (d-mtDNA helicase) and transcription (the activator d-mtTFB2) machineries and of a gene involved in mitochondrial mRNA translation (d-mtTFB1). We have identified their transcriptional initiation sites and DRE sequences in their promoter regions. Gel-shift and chromatin immunoprecipitation assays demonstrate that DREF interacts in vitro and in vivo with the d-mtDNA helicase and d-mtTFB2, but not with the d-mtTFB1 promoters. Transient transfection assays in Drosophila S2 cells with mutated DRE motifs and truncated promoter regions show that DREF controls the transcription of d-mtDNA helicase and d-mtTFB2, but not that of d-mtTFB1. RNA interference of DREF in S2 cells reinforces these results showing a decrease in the mRNA levels of d-mtDNA helicase and d-mtTFB2 and no changes in those of the d-mtTFB1. These results link the genetic regulation of nuclear DNA replication with the genetic control of mtDNA replication and transcriptional activation in Drosophila. PMID:23916463

Investigation of the mechanism of meiotic DNA cleavage by VMA1-derived endonuclease uncovers a meiotic alteration in chromatin structure around the target site.

PubMed

Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

2006-06-01

VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation.

Investigation of the Mechanism of Meiotic DNA Cleavage by VMA1-Derived Endonuclease Uncovers a Meiotic Alteration in Chromatin Structure around the Target Site

PubMed Central

Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

2006-01-01

VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation. PMID:16757746

U6 small nuclear RNA is transcribed by RNA polymerase III.

PubMed Central

Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T

1986-01-01

A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970

Searching for nuclear export elements in hepatitis D virus RNA.

PubMed

Freitas, Natália; Cunha, Celso

2013-08-12

To search for the presence of cis elements in hepatitis D virus (HDV) genomic and antigenomic RNA capable of promoting nuclear export. We made use of a well characterized chloramphenicol acetyl-transferase reporter system based on plasmid pDM138. Twenty cDNA fragments corresponding to different HDV genomic and antigenomic RNA sequences were inserted in plasmid pDM138, and used in transfection experiments in Huh7 cells. The relative amounts of HDV RNA in nuclear and cytoplasmic fractions were then determined by real-time polymerase chain reaction and Northern blotting. The secondary structure of the RNA sequences that displayed nuclear export ability was further predicted using a web interface. Finally, the sensitivity to leptomycin B was assessed in order to investigate possible cellular pathways involved in HDV RNA nuclear export. Analysis of genomic RNA sequences did not allow identifying an unequivocal nuclear export element. However, two regions were found to promote the export of reporter mRNAs with efficiency higher than the negative controls albeit lower than the positive control. These regions correspond to nucleotides 266-489 and 584-920, respectively. In addition, when analyzing antigenomic RNA sequences a nuclear export element was found in positions 214-417. Export mediated by the nuclear export element of HDV antigenomic RNA is sensitive to leptomycin B suggesting a possible role of CRM1 in this transport pathway. A cis-acting nuclear export element is present in nucleotides 214-417 of HDV antigenomic RNA.

Exploring Pandora's Box: Potential and Pitfalls of Low Coverage Genome Surveys for Evolutionary Biology

PubMed Central

Leese, Florian; Mayer, Christoph; Agrawal, Shobhit; Dambach, Johannes; Dietz, Lars; Doemel, Jana S.; Goodall-Copstake, William P.; Held, Christoph; Jackson, Jennifer A.; Lampert, Kathrin P.; Linse, Katrin; Macher, Jan N.; Nolzen, Jennifer; Raupach, Michael J.; Rivera, Nicole T.; Schubart, Christoph D.; Striewski, Sebastian; Tollrian, Ralph; Sands, Chester J.

2012-01-01

High throughput sequencing technologies are revolutionizing genetic research. With this “rise of the machines”, genomic sequences can be obtained even for unknown genomes within a short time and for reasonable costs. This has enabled evolutionary biologists studying genetically unexplored species to identify molecular markers or genomic regions of interest (e.g. micro- and minisatellites, mitochondrial and nuclear genes) by sequencing only a fraction of the genome. However, when using such datasets from non-model species, it is possible that DNA from non-target contaminant species such as bacteria, viruses, fungi, or other eukaryotic organisms may complicate the interpretation of the results. In this study we analysed 14 genomic pyrosequencing libraries of aquatic non-model taxa from four major evolutionary lineages. We quantified the amount of suitable micro- and minisatellites, mitochondrial genomes, known nuclear genes and transposable elements and searched for contamination from various sources using bioinformatic approaches. Our results show that in all sequence libraries with estimated coverage of about 0.02–25%, many appropriate micro- and minisatellites, mitochondrial gene sequences and nuclear genes from different KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways could be identified and characterized. These can serve as markers for phylogenetic and population genetic analyses. A central finding of our study is that several genomic libraries suffered from different biases owing to non-target DNA or mobile elements. In particular, viruses, bacteria or eukaryote endosymbionts contributed significantly (up to 10%) to some of the libraries analysed. If not identified as such, genetic markers developed from high-throughput sequencing data for non-model organisms may bias evolutionary studies or fail completely in experimental tests. In conclusion, our study demonstrates the enormous potential of low-coverage genome survey sequences and suggests bioinformatic analysis workflows. The results also advise a more sophisticated filtering for problematic sequences and non-target genome sequences prior to developing markers. PMID:23185309

EF-1α DNA Sequences Indicate Multiple Origins of Introduced Populations of Essigella californica (Hemiptera: Aphididae).

PubMed

Théry, Thomas; Brockerhoff, Eckehard G; Carnegie, Angus J; Chen, Rui; Elms, Stephen R; Hullé, Maurice; Glatz, Richard; Ortego, Jaime; Qiao, Ge-Xia; Turpeau, Évelyne; Favret, Colin

2017-06-01

Aphids in the pine-feeding Nearctic genus Essigella (Sternorrhyncha, Aphididae, Lachninae) have been introduced in Europe, North Africa, Oceania, and South America. Mitochondrial, nuclear, and endosymbiont DNA sequences of 12 introduced populations from three continents confirm they all belong to Essigella californica (Essig, 1909). Intron sequence variation of the nuclear gene EF-1α has revealed the existence of four distinct groups. Group I gathers one population from China, where the species is newly reported, and several from Europe (France and Italy); Group II is represented by one population from Argentina; Group III includes two populations from Southern Australia with one from New Zealand; and Group IV corresponds to five populations from Eastern and South-Eastern Australia. These results indicate that introduced populations of E. californica have at least four source populations. They also show that intron variation of EF-1α can be a method to discriminate populations of asexually reproducing aphids. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Nuclear and mitochondrial rDNA variability in Crinipellis perniciosa from different geographic origins and hosts.

PubMed

de Arruda, Maricília C C; Ferreira, Marisa A S V; Miller, Robert N G; Resende, Mário Lúcio V; Felipe, Maria Sueli S

2003-01-01

Genetic variability in Crinipellis perniciosa, the causal organism of witches' broom disease in Theobroma cacao, was determined in strains originating from T. cacao and other susceptible host species Heteropterys acutifolia and Solanum lycocarpum in Brazil, in order to clarify host specificity and geographical variability. RFLP analysis of the ribosomal DNA ITS regions (rDNA ITS), and the mitochondrial DNA small subunit ribosomal DNA gene (mtDNA SSU rDNA) did not reveal any genetic variability in 120 tested strains, possibly serving only as species level markers. Genetic variability was observed in the ribosomal DNA IGS spacer region, in terms of IGS size, RFLPs and sequence data. Phylogenetic analyses (using CLUSTAL W, PHYLIP and TREEVIEW) indicated considerable differences between C. perniciosa strains from T. cacao and those from H. acutifolia (85-86%) and S. lycocarpum (95-96%). Sequence differences also indicated that C. perniciosa from T. cacao in Bahia is less variable (98%) when compared to the pathogen on T. cacao in Amazonas (97-98%), perhaps reflecting a recent introduction to T. cacao in Bahia.

DNA barcode analysis: a comparison of phylogenetic and statistical classification methods.

PubMed

Austerlitz, Frederic; David, Olivier; Schaeffer, Brigitte; Bleakley, Kevin; Olteanu, Madalina; Leblois, Raphael; Veuille, Michel; Laredo, Catherine

2009-11-10

DNA barcoding aims to assign individuals to given species according to their sequence at a small locus, generally part of the CO1 mitochondrial gene. Amongst other issues, this raises the question of how to deal with within-species genetic variability and potential transpecific polymorphism. In this context, we examine several assignation methods belonging to two main categories: (i) phylogenetic methods (neighbour-joining and PhyML) that attempt to account for the genealogical framework of DNA evolution and (ii) supervised classification methods (k-nearest neighbour, CART, random forest and kernel methods). These methods range from basic to elaborate. We investigated the ability of each method to correctly classify query sequences drawn from samples of related species using both simulated and real data. Simulated data sets were generated using coalescent simulations in which we varied the genealogical history, mutation parameter, sample size and number of species. No method was found to be the best in all cases. The simplest method of all, "one nearest neighbour", was found to be the most reliable with respect to changes in the parameters of the data sets. The parameter most influencing the performance of the various methods was molecular diversity of the data. Addition of genetically independent loci--nuclear genes--improved the predictive performance of most methods. The study implies that taxonomists can influence the quality of their analyses either by choosing a method best-adapted to the configuration of their sample, or, given a certain method, increasing the sample size or altering the amount of molecular diversity. This can be achieved either by sequencing more mtDNA or by sequencing additional nuclear genes. In the latter case, they may also have to modify their data analysis method.

Is radon emission in caves causing deletions in satellite DNA sequences of cave-dwelling crickets?

PubMed

Allegrucci, Giuliana; Sbordoni, Valerio; Cesaroni, Donatella

2015-01-01

The most stable isotope of radon, 222Rn, represents the major source of natural radioactivity in confined environments such as mines, caves and houses. In this study, we explored the possible radon-related effects on the genome of Dolichopoda cave crickets (Orthoptera, Rhaphidophoridae) sampled in caves with different concentrations of radon. We analyzed specimens from ten populations belonging to two genetically closely related species, D. geniculata and D. laetitiae, and explored the possible association between the radioactivity dose and the level of genetic polymorphism in a specific family of satellite DNA (pDo500 satDNA). Radon concentration in the analyzed caves ranged from 221 to 26,000 Bq/m3. Specimens coming from caves with the highest radon concentration showed also the highest variability estimates in both species, and the increased sequence heterogeneity at pDo500 satDNA level can be explained as an effect of the mutation pressure induced by radon in cave. We discovered a specific category of nuclear DNA, the highly repetitive satellite DNA, where the effects of the exposure at high levels of radon-related ionizing radiation are detectable, suggesting that the satDNA sequences might be a valuable tool to disclose harmful effects also in other organisms exposed to high levels of radon concentration.

Detection of Cytosine methylation in ancient DNA from five native american populations using bisulfite sequencing.

PubMed

Smith, Rick W A; Monroe, Cara; Bolnick, Deborah A

2015-01-01

While cytosine methylation has been widely studied in extant populations, relatively few studies have analyzed methylation in ancient DNA. Most existing studies of epigenetic marks in ancient DNA have inferred patterns of methylation in highly degraded samples using post-mortem damage to cytosines as a proxy for cytosine methylation levels. However, this approach limits the inference of methylation compared with direct bisulfite sequencing, the current gold standard for analyzing cytosine methylation at single nucleotide resolution. In this study, we used direct bisulfite sequencing to assess cytosine methylation in ancient DNA from the skeletal remains of 30 Native Americans ranging in age from approximately 230 to 4500 years before present. Unmethylated cytosines were converted to uracils by treatment with sodium bisulfite, bisulfite products of a CpG-rich retrotransposon were pyrosequenced, and C-to-T ratios were quantified for a single CpG position. We found that cytosine methylation is readily recoverable from most samples, given adequate preservation of endogenous nuclear DNA. In addition, our results indicate that the precision of cytosine methylation estimates is inversely correlated with aDNA preservation, such that samples of low DNA concentration show higher variability in measures of percent methylation than samples of high DNA concentration. In particular, samples in this study with a DNA concentration above 0.015 ng/μL generated the most consistent measures of cytosine methylation. This study presents evidence of cytosine methylation in a large collection of ancient human remains, and indicates that it is possible to analyze epigenetic patterns in ancient populations using direct bisulfite sequencing approaches.

Allosteric Pathways in the PPARγ-RXRα nuclear receptor complex

NASA Astrophysics Data System (ADS)

Ricci, Clarisse G.; Silveira, Rodrigo L.; Rivalta, Ivan; Batista, Victor S.; Skaf, Munir S.

2016-01-01

Understanding the nature of allostery in DNA-nuclear receptor (NR) complexes is of fundamental importance for drug development since NRs regulate the transcription of a myriad of genes in humans and other metazoans. Here, we investigate allostery in the peroxisome proliferator-activated/retinoid X receptor heterodimer. This important NR complex is a target for antidiabetic drugs since it binds to DNA and functions as a transcription factor essential for insulin sensitization and lipid metabolism. We find evidence of interdependent motions of Ω-loops and PPARγ-DNA binding domain with contacts susceptible to conformational changes and mutations, critical for regulating transcriptional functions in response to sequence-dependent DNA dynamics. Statistical network analysis of the correlated motions, observed in molecular dynamics simulations, shows preferential allosteric pathways with convergence centers comprised of polar amino acid residues. These findings are particularly relevant for the design of allosteric modulators of ligand-dependent transcription factors.

Differential mitochondrial DNA and gene expression in inherited retinal dysplasia in miniature Schnauzer dogs.

PubMed

Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H

2006-05-01

To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that the pathogenesis of the disorder may arise from a lowered energy supply to the retina and RPE.

Mitochondrial Mutations in Subjects with Psychiatric Disorders

PubMed Central

Magnan, Christophe; van Oven, Mannis; Baldi, Pierre; Myers, Richard M.; Barchas, Jack D.; Schatzberg, Alan F.; Watson, Stanley J.; Akil, Huda; Bunney, William E.; Vawter, Marquis P.

2015-01-01

A considerable body of evidence supports the role of mitochondrial dysfunction in psychiatric disorders and mitochondrial DNA (mtDNA) mutations are known to alter brain energy metabolism, neurotransmission, and cause neurodegenerative disorders. Genetic studies focusing on common nuclear genome variants associated with these disorders have produced genome wide significant results but those studies have not directly studied mtDNA variants. The purpose of this study is to investigate, using next generation sequencing, the involvement of mtDNA variation in bipolar disorder, schizophrenia, major depressive disorder, and methamphetamine use. MtDNA extracted from multiple brain regions and blood were sequenced (121 mtDNA samples with an average of 8,800x coverage) and compared to an electronic database containing 26,850 mtDNA genomes. We confirmed novel and rare variants, and confirmed next generation sequencing error hotspots by traditional sequencing and genotyping methods. We observed a significant increase of non-synonymous mutations found in individuals with schizophrenia. Novel and rare non-synonymous mutations were found in psychiatric cases in mtDNA genes: ND6, ATP6, CYTB, and ND2. We also observed mtDNA heteroplasmy in brain at a locus previously associated with schizophrenia (T16519C). Large differences in heteroplasmy levels across brain regions within subjects suggest that somatic mutations accumulate differentially in brain regions. Finally, multiplasmy, a heteroplasmic measure of repeat length, was observed in brain from selective cases at a higher frequency than controls. These results offer support for increased rates of mtDNA substitutions in schizophrenia shown in our prior results. The variable levels of heteroplasmic/multiplasmic somatic mutations that occur in brain may be indicators of genetic instability in mtDNA. PMID:26011537

NUREBASE: database of nuclear hormone receptors.

PubMed

Duarte, Jorge; Perrière, Guy; Laudet, Vincent; Robinson-Rechavi, Marc

2002-01-01

Nuclear hormone receptors are an abundant class of ligand activated transcriptional regulators, found in varying numbers in all animals. Based on our experience of managing the official nomenclature of nuclear receptors, we have developed NUREBASE, a database containing protein and DNA sequences, reviewed protein alignments and phylogenies, taxonomy and annotations for all nuclear receptors. The reviewed NUREBASE is completed by NUREBASE_DAILY, automatically updated every 24 h. Both databases are organized under a client/server architecture, with a client written in Java which runs on any platform. This client, named FamFetch, integrates a graphical interface allowing selection of families, and manipulation of phylogenies and alignments. NUREBASE sequence data is also accessible through a World Wide Web server, allowing complex queries. All information on accessing and installing NUREBASE may be found at http://www.ens-lyon.fr/LBMC/laudet/nurebase.html.

Origins of domestication and polyploidy in oca (Oxalis tuberosa : Oxalidaceae): nrDNA ITS data.

PubMed

Emshwiller, E; Doyle, J

1998-07-01

As part of a study aimed at elucidating the origins of the octoploid tuber crop "oca," Oxalis tuberosa, DNA sequences of the internal trancribed spacer of nuclear ribosomal DNA (nrDNA ITS) were determined for oca and several wild Oxalis species, mostly from Bolivia. Phylogenetic analysis of these data supports a group of these species as being close relatives of oca, in agreement with morphology and cytology, but at odds with traditional infrageneric taxonomy. Variation in ITS sequences within this group is quite low (0-7 substitutions in the entire ITS region), contrasting with the highly divergent (unalignable in some cases) sequences within the genus overall. Some groups of morphologically differentiated species were found to have identical sequences, notably a group that includes oca, wild populations of Oxalis that bear small tubers, and several other clearly distinct species. The presence of a second, minor sequence type in at least some oca accessions suggests a possible contribution from a second genome donor, also from within this same species group. ITS data lack sufficient variation to elucidate the origins of oca precisely, but have identified a pool of candidate species and so can be used as a tool to screen yet unsampled species for possible progenitors.

Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

PubMed

Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

2011-01-01

DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

Comparing COI and ITS as DNA Barcode Markers for Mushrooms and Allies (Agaricomycotina)

PubMed Central

Dentinger, Bryn T. M.; Didukh, Maryna Y.; Moncalvo, Jean-Marc

2011-01-01

DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (∼450 bp) representing ∼100 morphospecies from ∼650 collections of Agaricomycotina using several sets of new primers. Large introns (∼1500 bp) at variable locations were detected in ∼5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (∼30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms. PMID:21966418

Image Analysis of DNA Fiber and Nucleus in Plants.

PubMed

Ohmido, Nobuko; Wako, Toshiyuki; Kato, Seiji; Fukui, Kiichi

2016-01-01

Advances in cytology have led to the application of a wide range of visualization methods in plant genome studies. Image analysis methods are indispensable tools where morphology, density, and color play important roles in the biological systems. Visualization and image analysis methods are useful techniques in the analyses of the detailed structure and function of extended DNA fibers (EDFs) and interphase nuclei. The EDF is the highest in the spatial resolving power to reveal genome structure and it can be used for physical mapping, especially for closely located genes and tandemly repeated sequences. One the other hand, analyzing nuclear DNA and proteins would reveal nuclear structure and functions. In this chapter, we describe the image analysis protocol for quantitatively analyzing different types of plant genome, EDFs and interphase nuclei.

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

PubMed Central

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

DNA recombination protein-dependent mechanism of homoplasmy and its proposed functions.

PubMed

Shibata, Takehiko; Ling, Feng

2007-01-01

Homoplasmy is a basic genetic state of mitochondria, in which all of the hundreds to thousands of mitochondrial (mt)DNA copies within a cell or an individual have the same nucleotide-sequence. It was recently found that "vegetative segregation" to generate homoplasmic cells is an active process under genetic control. In the yeast Saccharomyces cerevisiae, the Mhr1 protein which catalyzes a key reaction in mtDNA homologous recombination, plays a pivotal role in vegetative segregation. Conversely, within the nuclear genome, homologous DNA recombination causes genetic diversity. Considering these contradictory roles of this key reaction in DNA recombination, possible functions of homoplasmy are discussed.

Chloroplast and nuclear DNA studies in a few members of the Brassica oleracea L. group using PCR-RFLP and ISSR-PCR markers: a population genetic analysis.

PubMed

Panda, S; Martín, J P; Aguinagalde, I

2003-04-01

A population genetic analysis of chloroplast and nuclear DNA was performed covering nine wild populations of Brassica oleracea. Three members of the n = 9 group, all close to B. oleracea, Brassica alboglabra Bailey, Brassica bourgeaui (Webb) O. Kuntze and Brassica montana Pourret, were also studied to better understand their relationship with B. oleracea. Chloroplast DNA was analysed using the PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism) method. The ISSR-PCR (inter-simple sequence repeat - polymerase chain reaction) technique was adopted to study nuclear DNA. Twelve primer pairs of chloroplast DNA showed very good amplification. The amplified product of each primer pair, digested by three restriction enzymes, revealed no variation of cpDNA among the taxa studied. This indicates they may have the same chloroplast genotype. Seven selected ISSR primers have detected genetic variation, both within and among the populations/taxa surveyed. The information obtained on the intra- and inter-populational genetic diversity of wild populations of B. oleracea neatly defined the individual plants. It could provide important guidelines for backing management and conservation strategies in this species. The study confirms a close relationship between B. alboglabra, B. bourgeaui and B. montana, which is parallel to their morphological similitude.

Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

PubMed Central

Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof

2011-01-01

Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130

Statistical physics of nucleosome positioning and chromatin structure

NASA Astrophysics Data System (ADS)

Morozov, Alexandre

2012-02-01

Genomic DNA is packaged into chromatin in eukaryotic cells. The fundamental building block of chromatin is the nucleosome, a 147 bp-long DNA molecule wrapped around the surface of a histone octamer. Arrays of nucleosomes are positioned along DNA according to their sequence preferences and folded into higher-order chromatin fibers whose structure is poorly understood. We have developed a framework for predicting sequence-specific histone-DNA interactions and the effective two-body potential responsible for ordering nucleosomes into regular higher-order structures. Our approach is based on the analogy between nucleosomal arrays and a one-dimensional fluid of finite-size particles with nearest-neighbor interactions. We derive simple rules which allow us to predict nucleosome occupancy solely from the dinucleotide content of the underlying DNA sequences.Dinucleotide content determines the degree of stiffness of the DNA polymer and thus defines its ability to bend into the nucleosomal superhelix. As expected, the nucleosome positioning rules are universal for chromatin assembled in vitro on genomic DNA from baker's yeast and from the nematode worm C.elegans, where nucleosome placement follows intrinsic sequence preferences and steric exclusion. However, the positioning rules inferred from in vivo C.elegans chromatin are affected by global nucleosome depletion from chromosome arms relative to central domains, likely caused by the attachment of the chromosome arms to the nuclear membrane. Furthermore, intrinsic nucleosome positioning rules are overwritten in transcribed regions, indicating that chromatin organization is actively managed by the transcriptional and splicing machinery.

The Budding Yeast Nucleus

PubMed Central

Taddei, Angela; Schober, Heiko; Gasser, Susan M.

2010-01-01

The budding yeast nucleus, like those of other eukaryotic species, is highly organized with respect to both chromosomal sequences and enzymatic activities. At the nuclear periphery interactions of nuclear pores with chromatin, mRNA, and transport factors promote efficient gene expression, whereas centromeres, telomeres, and silent chromatin are clustered and anchored away from pores. Internal nuclear organization appears to be function-dependent, reflecting localized sites for tRNA transcription, rDNA transcription, ribosome assembly, and DNA repair. Recent advances have identified new proteins involved in the positioning of chromatin and have allowed testing of the functional role of higher-order chromatin organization. The unequal distribution of silent information regulatory factors and histone modifying enzymes, which arises in part from the juxtaposition of telomeric repeats, has been shown to influence chromatin-mediated transcriptional repression. Other localization events suppress unwanted recombination. These findings highlight the contribution budding yeast genetics and cytology have made to dissecting the functional role of nuclear structure. PMID:20554704

Assessing the potential of RAD-sequencing to resolve phylogenetic relationships within species radiations: The fly genus Chiastocheta (Diptera: Anthomyiidae) as a case study.

PubMed

Suchan, Tomasz; Espíndola, Anahí; Rutschmann, Sereina; Emerson, Brent C; Gori, Kevin; Dessimoz, Christophe; Arrigo, Nils; Ronikier, Michał; Alvarez, Nadir

2017-09-01

Determining phylogenetic relationships among recently diverged species has long been a challenge in evolutionary biology. Cytoplasmic DNA markers, which have been widely used, notably in the context of molecular barcoding, have not always proved successful in resolving such phylogenies. However, with the advent of next-generation-sequencing technologies and associated techniques of reduced genome representation, phylogenies of closely related species have been resolved at a much higher detail in the last couple of years. Here we examine the potential and limitations of one of such techniques-Restriction-site Associated DNA (RAD) sequencing, a method that produces thousands of (mostly) anonymous nuclear markers, in disentangling the phylogeny of the fly genus Chiastocheta (Diptera: Anthomyiidae). In Europe, this genus encompasses seven species of seed predators, which have been widely studied in the context of their ecological and evolutionary interactions with the plant Trollius europaeus (Ranunculaceae). So far, phylogenetic analyses using mitochondrial markers failed to resolve monophyly of most of the species from this recently diversified genus, suggesting that their taxonomy may need a revision. However, relying on a single, non-recombining marker and ignoring potential incongruences between mitochondrial and nuclear loci may provide an incomplete account of the lineage history. In this study, we applied both classical Sanger sequencing of three mtDNA regions and RAD-sequencing, for reconstructing the phylogeny of the genus. Contrasting with results based on mitochondrial markers, RAD-sequencing analyses retrieved the monophyly of all seven species, in agreement with the morphological species assignment. We found robust nuclear-based species assignment of individual samples, and low levels of estimated contemporary gene flow among them. However, despite recovering species' monophyly, interspecific relationships varied depending on the set of RAD loci considered, producing contradictory topologies. Moreover, coalescence-based phylogenetic analyses revealed low supports for most of the interspecific relationships. Our results indicate that despite the higher performance of RAD-sequencing in terms of species trees resolution compared to cytoplasmic markers, reconstructing inter-specific relationships among recently-diverged lineages may lie beyond the possibilities offered by large sets of RAD-sequencing markers in cases of strong gene tree incongruence. Copyright © 2017 Elsevier Inc. All rights reserved.

Phylogeny and evolutionary histories of Pyrus L. revealed by phylogenetic trees and networks based on data from multiple DNA sequences.

PubMed

Zheng, Xiaoyan; Cai, Danying; Potter, Daniel; Postman, Joseph; Liu, Jing; Teng, Yuanwen

2014-11-01

Reconstructing the phylogeny of Pyrus has been difficult due to the wide distribution of the genus and lack of informative data. In this study, we collected 110 accessions representing 25 Pyrus species and constructed both phylogenetic trees and phylogenetic networks based on multiple DNA sequence datasets. Phylogenetic trees based on both cpDNA and nuclear LFY2int2-N (LN) data resulted in poor resolution, especially, only five primary species were monophyletic in the LN tree. A phylogenetic network of LN suggested that reticulation caused by hybridization is one of the major evolutionary processes for Pyrus species. Polytomies of the gene trees and star-like structure of cpDNA networks suggested rapid radiation is another major evolutionary process, especially for the occidental species. Pyrus calleryana and P. regelii were the earliest diverged Pyrus species. Two North African species, P. cordata, P. spinosa and P. betulaefolia were descendent of primitive stock Pyrus species and still share some common molecular characters. Southwestern China, where a large number of P. pashia populations are found, is probably the most important diversification center of Pyrus. More accessions and nuclear genes are needed for further understanding the evolutionary histories of Pyrus. Copyright © 2014 Elsevier Inc. All rights reserved.

Global diversity and oceanic divergence of humpback whales (Megaptera novaeangliae).

PubMed

Jackson, Jennifer A; Steel, Debbie J; Beerli, P; Congdon, Bradley C; Olavarría, Carlos; Leslie, Matthew S; Pomilla, Cristina; Rosenbaum, Howard; Baker, C Scott

2014-07-07

Humpback whales (Megaptera novaeangliae) annually undertake the longest migrations between seasonal feeding and breeding grounds of any mammal. Despite this dispersal potential, discontinuous seasonal distributions and migratory patterns suggest that humpbacks form discrete regional populations within each ocean. To better understand the worldwide population history of humpbacks, and the interplay of this species with the oceanic environment through geological time, we assembled mitochondrial DNA control region sequences representing approximately 2700 individuals (465 bp, 219 haplotypes) and eight nuclear intronic sequences representing approximately 70 individuals (3700 bp, 140 alleles) from the North Pacific, North Atlantic and Southern Hemisphere. Bayesian divergence time reconstructions date the origin of humpback mtDNA lineages to the Pleistocene (880 ka, 95% posterior intervals 550-1320 ka) and estimate radiation of current Northern Hemisphere lineages between 50 and 200 ka, indicating colonization of the northern oceans prior to the Last Glacial Maximum. Coalescent analyses reveal restricted gene flow between ocean basins, with long-term migration rates (individual migrants per generation) of less than 3.3 for mtDNA and less than 2 for nuclear genomic DNA. Genetic evidence suggests that humpbacks in the North Pacific, North Atlantic and Southern Hemisphere are on independent evolutionary trajectories, supporting taxonomic revision of M. novaeangliae to three subspecies. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

Global diversity and oceanic divergence of humpback whales (Megaptera novaeangliae)

PubMed Central

Jackson, Jennifer A.; Steel, Debbie J.; Beerli, P.; Congdon, Bradley C.; Olavarría, Carlos; Leslie, Matthew S.; Pomilla, Cristina; Rosenbaum, Howard; Baker, C. Scott

2014-01-01

Humpback whales (Megaptera novaeangliae) annually undertake the longest migrations between seasonal feeding and breeding grounds of any mammal. Despite this dispersal potential, discontinuous seasonal distributions and migratory patterns suggest that humpbacks form discrete regional populations within each ocean. To better understand the worldwide population history of humpbacks, and the interplay of this species with the oceanic environment through geological time, we assembled mitochondrial DNA control region sequences representing approximately 2700 individuals (465 bp, 219 haplotypes) and eight nuclear intronic sequences representing approximately 70 individuals (3700 bp, 140 alleles) from the North Pacific, North Atlantic and Southern Hemisphere. Bayesian divergence time reconstructions date the origin of humpback mtDNA lineages to the Pleistocene (880 ka, 95% posterior intervals 550–1320 ka) and estimate radiation of current Northern Hemisphere lineages between 50 and 200 ka, indicating colonization of the northern oceans prior to the Last Glacial Maximum. Coalescent analyses reveal restricted gene flow between ocean basins, with long-term migration rates (individual migrants per generation) of less than 3.3 for mtDNA and less than 2 for nuclear genomic DNA. Genetic evidence suggests that humpbacks in the North Pacific, North Atlantic and Southern Hemisphere are on independent evolutionary trajectories, supporting taxonomic revision of M. novaeangliae to three subspecies. PMID:24850919

Limited performance of DNA barcoding in a diverse community of tropical butterflies

PubMed Central

Elias, Marianne; Hill, Ryan I; Willmott, Keith R; Dasmahapatra, Kanchon K; Brower, Andrew V.Z; Mallet, James; Jiggins, Chris D

2007-01-01

DNA ‘barcoding’ relies on a short fragment of mitochondrial DNA to infer identification of specimens. The method depends on genetic diversity being markedly lower within than between species. Closely related species are most likely to share genetic variation in communities where speciation rates are rapid and effective population sizes are large, such that coalescence times are long. We assessed the applicability of DNA barcoding (here the 5′ half of the cytochrome c oxidase I) to a diverse community of butterflies from the upper Amazon, using a group with a well-established morphological taxonomy to serve as a reference. Only 77% of species could be accurately identified using the barcode data, a figure that dropped to 68% in species represented in the analyses by more than one geographical race and at least one congener. The use of additional mitochondrial sequence data hardly improved species identification, while a fragment of a nuclear gene resolved issues in some of the problematic species. We acknowledge the utility of barcodes when morphological characters are ambiguous or unknown, but we also recommend the addition of nuclear sequence data, and caution that species-level identification rates might be lower in the most diverse habitats of our planet. PMID:17785265

Characterizing DNA preservation in degraded specimens of Amara alpina (Carabidae: Coleoptera).

PubMed

Heintzman, Peter D; Elias, Scott A; Moore, Karen; Paszkiewicz, Konrad; Barnes, Ian

2014-05-01

DNA preserved in degraded beetle (Coleoptera) specimens, including those derived from dry-stored museum and ancient permafrost-preserved environments, could provide a valuable resource for researchers interested in species and population histories over timescales from decades to millenia. However, the potential of these samples as genetic resources is currently unassessed. Here, using Sanger and Illumina shotgun sequence data, we explored DNA preservation in specimens of the ground beetle Amara alpina, from both museum and ancient environments. Nearly all museum specimens had amplifiable DNA, with the maximum amplifiable fragment length decreasing with age. Amplification of DNA was only possible in 45% of ancient specimens. Preserved mitochondrial DNA fragments were significantly longer than those of nuclear DNA in both museum and ancient specimens. Metagenomic characterization of extracted DNA demonstrated that parasite-derived sequences, including Wolbachia and Spiroplasma, are recoverable from museum beetle specimens. Ancient DNA extracts contained beetle DNA in amounts comparable to museum specimens. Overall, our data demonstrate that there is great potential for both museum and ancient specimens of beetles in future genetic studies, and we see no reason why this would not be the case for other orders of insect. © 2013 John Wiley & Sons Ltd.

Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.

PubMed

Silva, M V; Pasternack, L B; Kearns, D R

1997-12-15

Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.

Evolutionary history of tall fescue morphotypes inferred from molecular phylogenetics of the Lolium-Festuca species complex

PubMed Central

2010-01-01

Background The agriculturally important pasture grass tall fescue (Festuca arundinacea Schreb. syn. Lolium arundinaceum (Schreb.) Darbysh.) is an outbreeding allohexaploid, that may be more accurately described as a species complex consisting of three major (Continental, Mediterranean and rhizomatous) morphotypes. Observation of hybrid infertility in some crossing combinations between morphotypes suggests the possibility of independent origins from different diploid progenitors. This study aims to clarify the evolutionary relationships between each tall fescue morphotype through phylogenetic analysis using two low-copy nuclear genes (encoding plastid acetyl-CoA carboxylase [Acc1] and centroradialis [CEN]), the nuclear ribosomal DNA internal transcribed spacer (rDNA ITS) and the chloroplast DNA (cpDNA) genome-located matK gene. Other taxa within the closely related Lolium-Festuca species complex were also included in the study, to increase understanding of evolutionary processes in a taxonomic group characterised by multiple inter-specific hybridisation events. Results Putative homoeologous sequences from both nuclear genes were obtained from each polyploid species and compared to counterparts from 15 diploid taxa. Phylogenetic reconstruction confirmed F. pratensis and F. arundinacea var. glaucescens as probable progenitors to Continental tall fescue, and these species are also likely to be ancestral to the rhizomatous morphotype. However, these two morphotypes are sufficiently distinct to be located in separate clades based on the ITS-derived data set. All four of the generated data sets suggest independent evolution of the Mediterranean and Continental morphotypes, with minimal affinity between cognate sequence haplotypes. No obvious candidate progenitor species for Mediterranean tall fescues were identified, and only two putative sub-genome-specific haplotypes were identified for this morphotype. Conclusions This study describes the first phylogenetic analysis of the Festuca genus to include representatives of each tall fescue morphotype, and to use low copy nuclear gene-derived sequences to identify putative progenitors of the polyploid species. The demonstration of distinct tall fescue lineages has implications for both taxonomy and molecular breeding strategies, and may facilitate the generation of morphotype and/or sub-genome-specific molecular markers. PMID:20937141

A Short Interspersed Nuclear Element (SINE)-Based Real-Time PCR Approach to Detect and Quantify Porcine Component in Meat Products.

PubMed

Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning

2015-01-01

Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.

Phylogeography of the endangered Cathaya argyrophylla (Pinaceae) inferred from sequence variation of mitochondrial and nuclear DNA.

PubMed

Wang, Hong-Wei; Ge, Song

2006-11-01

Cathaya argyrophylla is an endangered conifer restricted to subtropical mountains of China. To study phylogeographical pattern and demographic history of C. argyrophylla, species-wide genetic variation was investigated using sequences of maternally inherited mtDNA and biparentally inherited nuclear DNA. Of 15 populations sampled from all four distinct regions, only three mitotypes were detected at two loci, without single region having a mixed composition (G(ST) = 1). Average nucleotide diversity (theta(ws) = 0.0024; pi(s) = 0.0029) across eight nuclear loci is significantly lower than those found for other conifers (theta(ws) = 0.003 approximately 0.015; pi(s) = 0.002 approximately 0.012) based on estimates of multiple loci. Because of its highest diversity among the eight nuclear loci and evolving neutrally, one locus (2009) was further used for phylogeographical studies and eight haplotypes resulting from 12 polymorphic sites were obtained from 98 individuals. All the four distinct regions had at least four haplotypes, with the Dalou region (DL) having the highest diversity and the Bamian region (BM) the lowest, paralleling the result of the eight nuclear loci. An AMOVA revealed significant proportion of diversity attributable to differences among regions (13.4%) and among populations within regions (8.9%). F(ST) analysis also indicated significantly high differentiation among populations (F(ST) = 0.22) and between regions (F(ST) = 0.12-0.38). Non-overlapping distribution of mitotypes and high genetic differentiation among the distinct geographical groups suggest the existence of at least four separate glacial refugia. Based on network and mismatch distribution analyses, we do not find evidence of long distance dispersal and population expansion in C. argyrophylla. Ex situ conservation and artificial crossing are recommended for the management of this endangered species.

Nuclear scaffold attachment stimulates, but is not essential for ARS activity in Saccharomyces cerevisiae: analysis of the Drosophila ftz SAR.

PubMed Central

Amati, B; Pick, L; Laroche, T; Gasser, S M

1990-01-01

Nuclei isolated from eukaryotic cells can be depleted of histones and most soluble nuclear proteins to isolate a structural framework called the nuclear scaffold. This structure maintains specific interactions with genomic DNA at sites known as scaffold attached regions (SARs), which are thought to be the bases of DNA loops. In both Saccharomyces cerevisiae and Schizosaccharomyces pombe, genomic ARS elements are recovered as SARs. In addition, SARs from Drosophila melanogaster bind to yeast nuclear scaffolds in vitro and a subclass of these promotes autonomous replication of plasmids in yeast. In the present report, we present fine mapping studies of the Drosophila ftz SAR, which has both SAR and ARS activities in yeast. The data establish a close relationship between the sequences involved in ARS activity and scaffold binding: ARS elements that can bind the nuclear scaffold in vitro promote more efficient plasmid replication in vivo, but scaffold association is not a strict prerequisite for ARS function. Efficient interaction with nuclear scaffolds from both yeast and Drosophila requires a minimal length of SAR DNA that contains reiteration of a narrow minor groove structure of the double helix. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. PMID:2123454

Molecular systematics of Gagea and Lloydia (Liliaceae; Liliales): implications of analyses of nuclear ribosomal and plastid DNA sequences for infrageneric classification

PubMed Central

Zarrei, M.; Wilkin, P.; Fay, M. F.; Ingrouille, M. J.; Zarre, S.; Chase, M. W.

2009-01-01

Background and Aims Gagea is a Eurasian genus of petaloid monocots, with a few species in North Africa, comprising between 70 and approximately 275 species depending on the author. Lloydia (thought to be the closest relative of Gagea) consists of 12–20 species that have a mostly eastern Asian distribution. Delimitation of these genera and their subdivisions are unresolved questions in Liliaceae taxonomy. The objective of this study is to evaluate generic and infrageneric circumscription of Gagea and Lloydia using DNA sequence data. Methods A phylogenetic study of Gagea and Lloydia (Liliaceae) was conducted using sequences of nuclear ribosomal internal transcribed spacer (ITS) and plastid (rpl16 intron, trnL intron, trnL-F spacer, matK and the psbA-trnH spacer) DNA regions. This included 149 accessions (seven as outgroups), with multiple accessions of some taxa; 552 sequences were included, of which 393 were generated as part of this research. Key Results A close relationship of Gagea and Lloydia was confirmed in analyses using different datasets, but neither Gagea nor Lloydia forms a monophyletic group as currently circumscribed; however, the ITS and plastid analyses did not produce congruent results for the placement of Lloydia relative to the major groups within Gagea. Gagea accessions formed five moderately to strongly supported clades in all trees, with most Lloydia taxa positioned at the basal nodes; in the strict consensus trees from the combined data a basal polytomy occurs. There is limited congruence between the classical, morphology-derived infrageneric taxonomy in Gagea (including Lloydia) and clades in the present phylogenetic analyses. Conclusions The analyses support monophyly of Gagea/Lloydia collectively, and they clearly comprise a single lineage, as some previous authors have hypothesized. The results provide the basis for a new classification of Gagea that has support from some morphological features. Incongruence between plastid and nuclear ITS results is interpreted as potentially due to ancient hybridization and/or paralogy of ITS rDNA. PMID:19451146

Epigenomics.

PubMed

Gomase, Virendra S; Tagore, Somnath

2008-03-01

'Epigenomics' can be termed as the study of the effects of chromatin structure, including the higher order of chromatin folding and attachment to the nuclear matrix, packaging of DNA around nucleosomes, covalent modifications of histone tails and DNA methylation. This has evolved to include any process that alters gene activity without changing the DNA sequence, and leads to modifications that can be transmitted to daughter cells. It also leads to a better knowledge of the changes in the regulation of genes and genomes that occur in major psychosis. It may also aid in understanding why the same gene sequence may predispose an individual to schizophrenia or bipolar disorder and in other cases does not, and elucidate the molecular mechanisms of how harmful; environmental factors interact with the genome. Results from the work may further lead to new diagnostics and effective therapies.

Billions of basepairs of recently expanded, repetitive sequences are eliminated from the somatic genome during copepod development.

PubMed

Sun, Cheng; Wyngaard, Grace; Walton, D Brian; Wichman, Holly A; Mueller, Rachel Lockridge

2014-03-11

Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution--some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 - 75 Gb, 12-74 Gb of which are lost from pre-somatic cell lineages at germline--soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms.

Billions of basepairs of recently expanded, repetitive sequences are eliminated from the somatic genome during copepod development

PubMed Central

2014-01-01

Background Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution — some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 – 75 Gb, 12–74 Gb of which are lost from pre-somatic cell lineages at germline – soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Results Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Conclusions Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms. PMID:24618421

Chromosome Evolution in Connection with Repetitive Sequences and Epigenetics in Plants.

PubMed

Li, Shu-Fen; Su, Ting; Cheng, Guang-Qian; Wang, Bing-Xiao; Li, Xu; Deng, Chuan-Liang; Gao, Wu-Jun

2017-10-24

Chromosome evolution is a fundamental aspect of evolutionary biology. The evolution of chromosome size, structure and shape, number, and the change in DNA composition suggest the high plasticity of nuclear genomes at the chromosomal level. Repetitive DNA sequences, which represent a conspicuous fraction of every eukaryotic genome, particularly in plants, are found to be tightly linked with plant chromosome evolution. Different classes of repetitive sequences have distinct distribution patterns on the chromosomes. Mounting evidence shows that repetitive sequences may play multiple generative roles in shaping the chromosome karyotypes in plants. Furthermore, recent development in our understanding of the repetitive sequences and plant chromosome evolution has elucidated the involvement of a spectrum of epigenetic modification. In this review, we focused on the recent evidence relating to the distribution pattern of repetitive sequences in plant chromosomes and highlighted their potential relevance to chromosome evolution in plants. We also discussed the possible connections between evolution and epigenetic alterations in chromosome structure and repatterning, such as heterochromatin formation, centromere function, and epigenetic-associated transposable element inactivation.

A protein that interacts with members of the nuclear hormone receptor family: identification and cDNA cloning.

PubMed Central

Zeiner, M; Gehring, U

1995-01-01

In search of proteins which interact with activated steroid hormone receptors, we screened a human liver lambda gt11 expression library with the glucocorticoid receptor. We identified and cloned a cDNA sequence of 1322 bp that encodes a protein of 274 aa. This protein consists predominantly of hydrophilic amino acids and contains a putative bipartite nuclear localization signal. The in vitro translated receptor-associating protein runs in SDS/polyacrylamide gels with an apparent molecular mass of 46 kDa. By use of the bacterially expressed fusion protein with glutathione S-transferase we have found that interaction is not limited to the glucocorticoid receptor but included other nuclear receptors--most notably, the estrogen and thyroid receptors. Binding also occurs with the glucocorticoid receptor complexed with the antiglucocorticoid RU 38486, with the estrogen receptor complexed with the antiestrogen 4-hydroxytamoxifen or ICI 164,384, and even with receptors not complexed with ligand. Association with steroid hormone receptors depends on prior receptor activation--i.e., release from heat shock proteins. The sequence identified here appears to be a general partner protein for nuclear hormone receptors, with the gene being expressed in a variety of mammalian tissues. Images Fig. 2 Fig. 3 Fig. 4 PMID:8524784

Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes

PubMed Central

Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P.

2016-01-01

Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes. PMID:27574114

Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes.

PubMed

Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P

2016-08-30

Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes.

Genetic Diversity in Endangered Guizhou Snub-Nosed Monkeys (Rhinopithecus brelichi): Contrasting Results from Microsatellite and Mitochondrial DNA Data

PubMed Central

Kolleck, Jakob; Yang, Mouyu; Zinner, Dietmar; Roos, Christian

2013-01-01

To evaluate the conservation status of a species or population it is necessary to gain insight into its ecological requirements, reproduction, genetic population structure, and overall genetic diversity. In our study we examined the genetic diversity of Rhinopithecus brelichi by analyzing microsatellite data and compared them with already existing data derived from mitochondrial DNA, which revealed that R. brelichi exhibits the lowest mitochondrial diversity of all so far studied Rhinopithecus species. In contrast, the genetic diversity of nuclear DNA is high and comparable to other Rhinopithecus species, i.e. the examined microsatellite loci are similarly highly polymorphic as in other species of the genus. An explanation for these differences in mitochondrial and nuclear genetic diversity could be a male biased dispersal. Females most likely stay within their natal band and males migrate between bands, thus mitochondrial DNA will not be exchanged between bands but nuclear DNA via males. A Bayesian Skyline Plot based on mitochondrial DNA sequences shows a strong decrease of the female effective population size (Nef) starting about 3,500 to 4,000 years ago, which concurs with the increasing human population in the area and respective expansion of agriculture. Given that we found no indication for a loss of nuclear DNA diversity in R. brelichi it seems that this factor does not represent the most prominent conservation threat for the long-term survival of the species. Conservation efforts should therefore focus more on immediate threats such as development of tourism and habitat destruction. PMID:24009761

Rate heterogeneity in six protein-coding genes from the holoparasite Balanophora (Balanophoraceae) and other taxa of Santalales

PubMed Central

Su, Huei-Jiun; Hu, Jer-Ming

2012-01-01

Background and Aims The holoparasitic flowering plant Balanophora displays extreme floral reduction and was previously found to have enormous rate acceleration in the nuclear 18S rDNA region. So far, it remains unclear whether non-ribosomal, protein-coding genes of Balanophora also evolve in an accelerated fashion and whether the genes with high substitution rates retain their functionality. To tackle these issues, six different genes were sequenced from two Balanophora species and their rate variation and expression patterns were examined. Methods Sequences including nuclear PI, euAP3, TM6, LFY and RPB2 and mitochondrial matR were determined from two Balanophora spp. and compared with selected hemiparasitic species of Santalales and autotrophic core eudicots. Gene expression was detected for the six protein-coding genes and the expression patterns of the three B-class genes (PI, AP3 and TM6) were further examined across different organs of B. laxiflora using RT-PCR. Key Results Balanophora mitochondrial matR is highly accelerated in both nonsynonymous (dN) and synonymous (dS) substitution rates, whereas the rate variation of nuclear genes LFY, PI, euAP3, TM6 and RPB2 are less dramatic. Significant dS increases were detected in Balanophora PI, TM6, RPB2 and dN accelerations in euAP3. All of the protein-coding genes are expressed in inflorescences, indicative of their functionality. PI is restrictively expressed in tepals, synandria and floral bracts, whereas AP3 and TM6 are widely expressed in both male and female inflorescences. Conclusions Despite the observation that rates of sequence evolution are generally higher in Balanophora than in hemiparasitic species of Santalales and autotrophic core eudicots, the five nuclear protein-coding genes are functional and are evolving at a much slower rate than 18S rDNA. The mechanism or mechanisms responsible for rapid sequence evolution and concomitant rate acceleration for 18S rDNA and matR are currently not well understood and require further study in Balanophora and other holoparasites. PMID:23041381

Complete sequences of organelle genomes from the medicinal plant Rhazya stricta (Apocynaceae) and contrasting patterns of mitochondrial genome evolution across asterids.

PubMed

Park, Seongjun; Ruhlman, Tracey A; Sabir, Jamal S M; Mutwakil, Mohammed H Z; Baeshen, Mohammed N; Sabir, Meshaal J; Baeshen, Nabih A; Jansen, Robert K

2014-05-28

Rhazya stricta is native to arid regions in South Asia and the Middle East and is used extensively in folk medicine to treat a wide range of diseases. In addition to generating genomic resources for this medicinally important plant, analyses of the complete plastid and mitochondrial genomes and a nuclear transcriptome from Rhazya provide insights into inter-compartmental transfers between genomes and the patterns of evolution among eight asterid mitochondrial genomes. The 154,841 bp plastid genome is highly conserved with gene content and order identical to the ancestral organization of angiosperms. The 548,608 bp mitochondrial genome exhibits a number of phenomena including the presence of recombinogenic repeats that generate a multipartite organization, transferred DNA from the plastid and nuclear genomes, and bidirectional DNA transfers between the mitochondrion and the nucleus. The mitochondrial genes sdh3 and rps14 have been transferred to the nucleus and have acquired targeting presequences. In the case of rps14, two copies are present in the nucleus; only one has a mitochondrial targeting presequence and may be functional. Phylogenetic analyses of both nuclear and mitochondrial copies of rps14 across angiosperms suggests Rhazya has experienced a single transfer of this gene to the nucleus, followed by a duplication event. Furthermore, the phylogenetic distribution of gene losses and the high level of sequence divergence in targeting presequences suggest multiple, independent transfers of both sdh3 and rps14 across asterids. Comparative analyses of mitochondrial genomes of eight sequenced asterids indicates a complicated evolutionary history in this large angiosperm clade with considerable diversity in genome organization and size, repeat, gene and intron content, and amount of foreign DNA from the plastid and nuclear genomes. Organelle genomes of Rhazya stricta provide valuable information for improving the understanding of mitochondrial genome evolution among angiosperms. The genomic data have enabled a rigorous examination of the gene transfer events. Rhazya is unique among the eight sequenced asterids in the types of events that have shaped the evolution of its mitochondrial genome. Furthermore, the organelle genomes of R. stricta provide valuable genomic resources for utilizing this important medicinal plant in biotechnology applications.

nrDNA:mtDNA copy number ratios as a comparative metric for evolutionary and conservation genetics.

PubMed

Goodall-Copestake, William Paul

2018-05-12

Identifying genetic cues of functional relevance is key to understanding the drivers of evolution and increasingly important for the conservation of biodiversity. This study introduces nuclear ribosomal DNA (nrDNA) to mitochondrial DNA (mtDNA) copy number ratios as a metric with which to screen for this functional genetic variation prior to more extensive omics analyses. To illustrate the metric, quantitative PCR was used to estimate nrDNA (18S) to mtDNA (16S) copy number ratios in muscle tissue from samples of two zooplankton species: Salpa thompsoni caught near Elephant Island (Southern Ocean) and S. fusiformis sampled off Gough Island (South Atlantic). Average 18S:16S ratios in these samples were 9:1 and 3:1, respectively. nrDNA 45S arrays and mitochondrial genomes were then deep sequenced to uncover the sources of intra-individual genetic variation underlying these 18S:16S copy number differences. The deep sequencing profiles obtained were consistent with genetic changes resulting from adaptive processes, including an expansion of nrDNA and damage to mtDNA in S. thompsoni, potentially in response to the polar environment. Beyond this example from zooplankton, nrDNA:mtDNA copy number ratios offer a promising metric to help identify genetic variation of functional relevance in animals more broadly.

[Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

PubMed

Li, Chun-Xiang; Yang, Qun

2003-03-01

DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

Identification of the skeletal remains of a murder victim by DNA analysis.

PubMed

Hagelberg, E; Gray, I C; Jeffreys, A J

1991-08-01

There is considerable anthropological and forensic interest in the possibility of DNA typing skeletal remains. Trace amounts of DNA can be recovered even from 5,500-year-old bones and multicopy human mitochondrial DNA sequences can frequently be amplified from such DNA using the polymerase chain reaction (PCR). But given the sensitivity of PCR, it is very difficult to exclude contaminating material. We now report the successful identification of the 8-year-old skeletal remains of a murder victim, by comparative typing of nuclear microsatellite markers in the remains and in the presumptive parents of the victim. This analysis establishes the authenticity of the bone DNA and the feasibility of bone DNA typing in forensic investigations.

The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

PubMed Central

Oliviero, S; Cortese, R

1989-01-01

Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

Description of a new planktonic mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. from the coastal waters off Western Korea: morphology, pigments, and ribosomal DNA gene sequence.

PubMed

Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Øjvind; Shin, Woongghi; Nam, Seung Won; Park, Jae Yeon; De Salas, Miguel F; Kim, Ki Woo; Noh, Jae Hoon

2010-01-01

The mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. is described from living cells and from cells prepared by light, scanning electron, and transmission electron microscopy. In addition, sequences of the small subunit (SSU) and large subunit (LSU) rDNA and photosynthetic pigments are reported. The episome is conical, while the hyposome is hemispherical. Cells are covered with polygonal amphiesmal vesicles arranged in 16 rows and containing a very thin plate-like component. There is neither an apical groove nor apical line of narrow plates. Instead, there is a sulcal extension-like furrow. The cingulum is as wide as 0.2-0.3 x cell length and displaced by 0.2-0.3 x cell length. Cell length and width of live cells fed Amphidinium carterae were 8.4-19.3 and 6.1-16.0 microm, respectively. Paragymnodinium shiwhaense does not have a nuclear envelope chamber nor a nuclear fibrous connective (NFC). Cells contain chloroplasts, nematocysts, trichocysts, and peduncle, though eyespots, pyrenoids, and pusules are absent. The main accessory pigment is peridinin. The sequence of the SSU rDNA of this dinoflagellate (GenBank AM408889) is 4% different from that of Gymnodinium aureolum, Lepidodinium viride, and Gymnodinium catenatum, the three closest species, while the LSU rDNA was 17-18% different from that of G. catenatum, Lepidodinium chlorophorum, and Gymnodinium nolleri. The phylogenetic trees show that this dinoflagellate belongs within the Gymnodinium sensu stricto clade. However, in contrast to Gymnodinium spp., cells lack nuclear envelope chambers, NFC, and an apical groove. Unlike Polykrikos spp., which have a taeniocyst-nematocyst complex, P. shiwhaense has nematocysts without taeniocysts. In addition, P. shiwhaense does not have ocelloids in contrast to Warnowia spp. and Nematodinium spp. Therefore, based on morphological and molecular analyses, we suggest that this taxon is a new species, also within a new genus.

Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.

PubMed

Cui, Chenghua; Shu, Wei; Li, Peining

2016-01-01

Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.

Genomes Behave as Social Entities: Alien Chromatin Minorities Evolve Through Specificities Reduction

USDA-ARS?s Scientific Manuscript database

Hybridization and chromosome doubling entailed by allopolyploidization requires genetic and epigenetic modifications, resulting in the adjustment of different genomes to the same nuclear environment. Recently, the main role of retrotransposon/microsatellite-rich regions of the genome in DNA sequenc...

Mitochondrial and nuclear sequence polymorphisms reveal geographic structuring in Amazonian populations of Echinococcus vogeli (Cestoda: Taeniidae).

PubMed

Santos, Guilherme B; Soares, Manoel do C P; de F Brito, Elisabete M; Rodrigues, André L; Siqueira, Nilton G; Gomes-Gouvêa, Michele S; Alves, Max M; Carneiro, Liliane A; Malheiros, Andreza P; Póvoa, Marinete M; Zaha, Arnaldo; Haag, Karen L

2012-12-01

To date, nothing is known about the genetic diversity of the Echinococcus neotropical species, Echinococcus vogeli and Echinococcus oligarthrus. Here we used mitochondrial and nuclear DNA sequence polymorphisms to uncover the genetic structure, transmission and history of E. vogeli in the Brazilian Amazon, based on a sample of 38 isolates obtained from human and wild animal hosts. We confirm that the parasite is partially synanthropic and show that its populations are diverse. Furthermore, significant geographical structuring is found, with western and eastern populations being genetically divergent. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafaye, Céline; Barbier, Ewa; Miscioscia, Audrey

2014-03-28

Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied thismore » strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis.« less

A Delicate Balance Between Repair and Replication Factors Regulates Recombination Between Divergent DNA Sequences in Saccharomyces cerevisiae

PubMed Central

Chakraborty, Ujani; George, Carolyn M.; Lyndaker, Amy M.; Alani, Eric

2016-01-01

Single-strand annealing (SSA) is an important homologous recombination mechanism that repairs DNA double strand breaks (DSBs) occurring between closely spaced repeat sequences. During SSA, the DSB is acted upon by exonucleases to reveal complementary sequences that anneal and are then repaired through tail clipping, DNA synthesis, and ligation steps. In baker’s yeast, the Msh DNA mismatch recognition complex and the Sgs1 helicase act to suppress SSA between divergent sequences by binding to mismatches present in heteroduplex DNA intermediates and triggering a DNA unwinding mechanism known as heteroduplex rejection. Using baker’s yeast as a model, we have identified new factors and regulatory steps in heteroduplex rejection during SSA. First we showed that Top3-Rmi1, a topoisomerase complex that interacts with Sgs1, is required for heteroduplex rejection. Second, we found that the replication processivity clamp proliferating cell nuclear antigen (PCNA) is dispensable for heteroduplex rejection, but is important for repairing mismatches formed during SSA. Third, we showed that modest overexpression of Msh6 results in a significant increase in heteroduplex rejection; this increase is due to a compromise in Msh2-Msh3 function required for the clipping of 3′ tails. Thus 3′ tail clipping during SSA is a critical regulatory step in the repair vs. rejection decision; rejection is favored before the 3′ tails are clipped. Unexpectedly, Msh6 overexpression, through interactions with PCNA, disrupted heteroduplex rejection between divergent sequences in another recombination substrate. These observations illustrate the delicate balance that exists between repair and replication factors to optimize genome stability. PMID:26680658

DOE Office of Scientific and Technical Information (OSTI.GOV)

Do, Minhwa; Jang, Won-Gu; Hwang, Jeong Hee

Highlights: Black-Right-Pointing-Pointer We success serial SCNT through the third generation using pig fibroblasts. Black-Right-Pointing-Pointer Donor-specific mtDNA in the recloned pigs was detected. Black-Right-Pointing-Pointer SCNT affect mtDNA mounts. -- Abstract: Somatic cell nuclear transfer (SCNT) has been established for the transmission of specific nuclear DNA. However, the fate of donor mitochondrial DNA (mtDNA) remains unclear. Here, we examined the fate of donor mtDNA in recloned pigs through third generations. Fibroblasts of recloned pigs were obtained from offspring of each generation produced by fusion of cultured fibroblasts from a Minnesota miniature pig (MMP) into enucleated oocytes of a Landrace pig. The D-loopmore » regions from the mtDNA of donor and recipient differ at nucleotide sequence positions 16050 (A{yields}T), 16062 (T{yields}C), and 16135 (G{yields}A). In order to determine the fate of donor mtDNA in recloned pigs, we analyzed the D-loop region of the donor's mtDNA by allele-specific PCR (AS-PCR) and real-time PCR. Donor mtDNA was successfully detected in all recloned offspring (F1, F2, and F3). These results indicate that heteroplasmy that originate from donor and recipient mtDNA is maintained in recloned pigs, resulting from SCNT, unlike natural reproduction.« less

An ultrasensitive label-free biosensor for assaying of sequence-specific DNA-binding protein based on amplifying fluorescent conjugated polymer.

PubMed

Liu, Xingfen; Ouyang, Lan; Cai, Xiaohui; Huang, Yanqin; Feng, Xiaomiao; Fan, Quli; Huang, Wei

2013-03-15

Sensitive, reliable, and simple detection of sequence-specific DNA-binding proteins (DBP) is of paramount importance in the area of proteomics, genomics, and biomedicine. We describe herein a novel fluorescent-amplified strategy for ultrasensitive, visual, quantitative, and "turn-on" detection of DBP. A Förster resonance energy transfer (FRET) assay utilizing a cationic conjugated polymer (CCP) and an intercalating dye was designed to detect a key transcription factor, nuclear factor-kappa B (NF-κB), the model target. A series of label-free DNA probes bearing one or two protein-binding sites (PBS) were used to identify the target protein specifically. The binding DBP protects the probe from digestion by exonuclease III, resulting in high efficient FRET due to the high affinity between the intercalating dye and duplex DNA, as well as strong electrostatic interactions between the CCP and DNA probe. By using label-free hairpin DNA or double-stranded DNA containing two PBS as probe, we could detect as low as 1 pg/μL of NF-κB in HeLa nuclear extracts, which is 10000-fold more sensitive than the previously reported methods. The approach also allows naked-eye detection by observing fluorescent color of solutions with the assistance of a hand-held UV lamp. Additionally, a less than 10% relative standard deviation was obtained, which offers a new platform for superior precision, low-cost, and simple detection of DBP. The features of our optical biosensor shows promising potential for early diagnosis of many diseases and high-throughput screening of new drugs targeted to DNA-binding proteins. Copyright © 2012 Elsevier B.V. All rights reserved.

Detection of somatic mutations in the mitochondrial DNA control region D-loop in brain tumors: The first report in Malaysian patients.

PubMed

Mohamed Yusoff, Abdul Aziz; Mohd Nasir, Khairol Naaim; Haris, Khalilah; Mohd Khair, Siti Zulaikha Nashwa; Abdul Ghani, Abdul Rahman Izaini; Idris, Zamzuri; Abdullah, Jafri Malin

2017-11-01

Although the role of nuclear-encoded gene alterations has been well documented in brain tumor development, the involvement of the mitochondrial genome in brain tumorigenesis has not yet been fully elucidated and remains controversial. The present study aimed to identify mutations in the mitochondrial DNA (mtDNA) control region D-loop in patients with brain tumors in Malaysia. A mutation analysis was performed in which DNA was extracted from paired tumor tissue and blood samples obtained from 49 patients with brain tumors. The D-loop region DNA was amplified using the PCR technique, and genetic data from DNA sequencing analyses were compared with the published revised Cambridge sequence to identify somatic mutations. Among the 49 brain tumor tissue samples evaluated, 25 cases (51%) had somatic mutations of the mtDNA D-loop, with a total of 48 mutations. Novel mutations that had not previously been identified in the D-loop region (176 A-deletion, 476 C>A, 566 C>A and 16405 A-deletion) were also classified. No significant associations between the D-loop mutation status and the clinicopathological parameters were observed. To the best of our knowledge, the current study presents the first evidence of alterations in the mtDNA D-loop regions in the brain tumors of Malaysian patients. These results may provide an overview and data regarding the incidence of mitochondrial genome alterations in Malaysian patients with brain tumors. In addition to nuclear genome aberrations, these specific mitochondrial genome alterations may also be considered as potential cancer biomarkers for the diagnosis and staging of brain cancers.

Variation of partial transferrin sequences and phylogenetic relationships among hares (Lepus capensis, Lagomorpha) from Tunisia.

PubMed

Awadi, Asma; Suchentrunk, Franz; Makni, Mohamed; Ben Slimen, Hichem

2016-10-01

North African hares are currently included in cape hares, Lepus capensis sensu lato, a taxon that may be considered a superspecies or a complex of closely related species. The existing molecular data, however, are not unequivocal, with mtDNA control region sequences suggesting a separate species status and nuclear loci (allozymes, microsatellites) revealing conspecificity of L. capensis and L. europaeus. Here, we study sequence variation in the intron 6 (468 bp) of the transferrin nuclear gene, of 105 hares with different coat colour from different regions in Tunisia with respect to genetic diversity and differentiation, as well as their phylogenetic status. Forty-six haplotypes (alleles) were revealed and compared phylogenetically to all available TF haplotypes of various Lepus species retrieved from GenBank. Maximum Likelihood, neighbor joining and median joining network analyses concordantly grouped all currently obtained haplotypes together with haplotypes belonging to six different Chinese hare species and the African scrub hare L. saxatilis. Moreover, two Tunisian haploypes were shared with L. capensis, L timidus, L. sinensis, L. yarkandensis, and L. hainanus from China. These results indicated the evolutionary complexity of the genus Lepus with the mixing of nuclear gene haplotypes resulting from introgressive hybridization or/and shared ancestral polymorphism. We report the presence of shared ancestral polymorphism between North African and Chinese hares. This has not been detected earlier in the mtDNA sequences of the same individuals. Genetic diversity of the TF sequences from the Tunisian populations was relatively high compared to other hare populations. However, genetic differentiation and gene flow analyses (AMOVA, F ST , Nm) indicated little divergence with the absence of geographically meaningful phylogroups and lack of clustering with coat colour types. These results confirm the presence of a single hare species in Tunisia, but a sound inference on its phylogenetic position would require additional nuclear markers and numerous geographically meaningful samples from Africa and Eurasia.

Migration of mitochondrial DNA in the nuclear genome of colorectal adenocarcinoma.

PubMed

Srinivasainagendra, Vinodh; Sandel, Michael W; Singh, Bhupendra; Sundaresan, Aishwarya; Mooga, Ved P; Bajpai, Prachi; Tiwari, Hemant K; Singh, Keshav K

2017-03-29

Colorectal adenocarcinomas are characterized by abnormal mitochondrial DNA (mtDNA) copy number and genomic instability, but a molecular interaction between mitochondrial and nuclear genome remains unknown. Here we report the discovery of increased copies of nuclear mtDNA (NUMT) in colorectal adenocarcinomas, which supports link between mtDNA and genomic instability in the nucleus. We name this phenomenon of nuclear occurrence of mitochondrial component as numtogenesis. We provide a description of NUMT abundance and distribution in tumor versus matched blood-derived normal genomes. Whole-genome sequence data were obtained for colon adenocarcinoma and rectum adenocarcinoma patients participating in The Cancer Genome Atlas, via the Cancer Genomics Hub, using the GeneTorrent file acquisition tool. Data were analyzed to determine NUMT proportion and distribution on a genome-wide scale. A NUMT suppressor gene was identified by comparing numtogenesis in other organisms. Our study reveals that colorectal adenocarcinoma genomes, on average, contains up to 4.2-fold more somatic NUMTs than matched normal genomes. Women colorectal tumors contained more NUMT than men. NUMT abundance in tumor predicted parallel abundance in blood. NUMT abundance positively correlated with GC content and gene density. Increased numtogenesis was observed with higher mortality. We identified YME1L1, a human homolog of yeast YME1 (yeast mitochondrial DNA escape 1) to be frequently mutated in colorectal tumors. YME1L1 was also mutated in tumors derived from other tissues. We show that inactivation of YME1L1 results in increased transfer of mtDNA in the nuclear genome. Our study demonstrates increased somatic transfer of mtDNA in colorectal tumors. Our study also reveals sex-based differences in frequency of NUMT occurrence and that NUMT in blood reflects NUMT in tumors, suggesting NUMT may be used as a biomarker for tumorigenesis. We identify YME1L1 as the first NUMT suppressor gene in human and demonstrate that inactivation of YME1L1 induces migration of mtDNA to the nuclear genome. Our study reveals that numtogenesis plays an important role in the development of cancer.

Targeted exome sequencing of suspected mitochondrial disorders

PubMed Central

Lieber, Daniel S.; Calvo, Sarah E.; Shanahan, Kristy; Slate, Nancy G.; Liu, Shangtao; Hershman, Steven G.; Gold, Nina B.; Chapman, Brad A.; Thorburn, David R.; Berry, Gerard T.; Schmahmann, Jeremy D.; Borowsky, Mark L.; Mueller, David M.; Sims, Katherine B.

2013-01-01

Objective: To evaluate the utility of targeted exome sequencing for the molecular diagnosis of mitochondrial disorders, which exhibit marked phenotypic and genetic heterogeneity. Methods: We considered a diverse set of 102 patients with suspected mitochondrial disorders based on clinical, biochemical, and/or molecular findings, and whose disease ranged from mild to severe, with varying age at onset. We sequenced the mitochondrial genome (mtDNA) and the exons of 1,598 nuclear-encoded genes implicated in mitochondrial biology, mitochondrial disease, or monogenic disorders with phenotypic overlap. We prioritized variants likely to underlie disease and established molecular diagnoses in accordance with current clinical genetic guidelines. Results: Targeted exome sequencing yielded molecular diagnoses in established disease loci in 22% of cases, including 17 of 18 (94%) with prior molecular diagnoses and 5 of 84 (6%) without. The 5 new diagnoses implicated 2 genes associated with canonical mitochondrial disorders (NDUFV1, POLG2), and 3 genes known to underlie other neurologic disorders (DPYD, KARS, WFS1), underscoring the phenotypic and biochemical overlap with other inborn errors. We prioritized variants in an additional 26 patients, including recessive, X-linked, and mtDNA variants that were enriched 2-fold over background and await further support of pathogenicity. In one case, we modeled patient mutations in yeast to provide evidence that recessive mutations in ATP5A1 can underlie combined respiratory chain deficiency. Conclusion: The results demonstrate that targeted exome sequencing is an effective alternative to the sequential testing of mtDNA and individual nuclear genes as part of the investigation of mitochondrial disease. Our study underscores the ongoing challenge of variant interpretation in the clinical setting. PMID:23596069

Concurrent speciation in the eastern woodland salamanders (Genus Plethodon):DNA sequences of the complete albumin nuclear and partialmitochondrial 12s genes

USGS Publications Warehouse

Highton, Richard; Hastings, Amy Picard; Palmer, Catherine; Watts, Richard; Hass, Carla A.; Culver, Melanie; Arnold, Stevan

2012-01-01

Salamanders of the North American plethodontid genus Plethodon are important model organisms in a variety of studies that depend on a phylogenetic framework (e.g., chemical communication, ecological competition, life histories, hybridization, and speciation), and consequently their systematics has been intensively investigated over several decades. Nevertheless, we lack a synthesis of relationships among the species. In the analyses reported here we use new DNA sequence data from the complete nuclear albumin gene (1818 bp) and the 12s mitochondrial gene (355 bp), as well as published data for four other genes (Wiens et al., 2006), up to a total of 6989 bp, to infer relationships. We relate these results to past systematic work based on morphology, allozymes, and DNA sequences. Although basal relationships show a strong consensus across studies, many terminal relationships remain in flux despite substantial sequencing and other molecular and morphological studies. This systematic instability appears to be a consequence of contemporaneous bursts of speciation in the late Miocene and Pliocene, yielding many closely related extant species in each of the four eastern species groups. Therefore we conclude that many relationships are likely to remain poorly resolved in the face of additional sequencing efforts. On the other hand, the current classification of the 45 eastern species into four species groups is supported. The Plethodon cinereus group (10 species) is the sister group to the clade comprising the other three groups, but these latter groups (Plethodon glutinosus [28 species], Plethodon welleri [5 species], and Plethodon wehrlei [2 species]) probably diverged from each other at approximately the same time.

Linkage and homology analysis divides the eight genes for the small subunit of petunia ribulose 1,5-bisphosphate carboxylase into three gene families

PubMed Central

Dean, Caroline; van den Elzen, Peter; Tamaki, Stanley; Dunsmuir, Pamela; Bedbrook, John

1985-01-01

Twenty-six λ phage clones with homology to coding sequences of the small subunit (SSU) of ribulose 1,5-bisphosphate carboxylase have been isolated from an EMBL3 λ phage bank of Petunia (Mitchell) DNA. Restriction mapping of the phage inserts shows that the clones were obtained from five nonoverlapping regions of petunia DNA that carry seven SSU genes. Comparison of the HindIII genomic fragments of petunia DNA with the HindIII restriction fragments of the isolated phage indicates that petunia nuclear DNA encodes eight SSU genes, seven of which are present in the phage clones. Two incomplete genes, which contain only the 3′ end of an SSU gene, were also found in the phage clones. We demonstrate that the eight SSU genes of petunia can be divided into three gene families based on homology to three petunia cDNA clones. Two gene families contain single SSU genes and the third contains six genes, four of which are closely linked within petunia nuclear DNA. Images PMID:16593584

Comparative genomics and repetitive sequence divergence in the species of diploid Nicotiana section Alatae.

PubMed

Lim, K Yoong; Kovarik, Ales; Matyasek, Roman; Chase, Mark W; Knapp, Sandra; McCarthy, Elizabeth; Clarkson, James J; Leitch, Andrew R

2006-12-01

Combining phylogenetic reconstructions of species relationships with comparative genomic approaches is a powerful way to decipher evolutionary events associated with genome divergence. Here, we reconstruct the history of karyotype and tandem repeat evolution in species of diploid Nicotiana section Alatae. By analysis of plastid DNA, we resolved two clades with high bootstrap support, one containing N. alata, N. langsdorffii, N. forgetiana and N. bonariensis (called the n = 9 group) and another containing N. plumbaginifolia and N. longiflora (called the n = 10 group). Despite little plastid DNA sequence divergence, we observed, via fluorescent in situ hybridization, substantial chromosomal repatterning, including altered chromosome numbers, structure and distribution of repeats. Effort was focussed on 35S and 5S nuclear ribosomal DNA (rDNA) and the HRS60 satellite family of tandem repeats comprising the elements HRS60, NP3R and NP4R. We compared divergence of these repeats in diploids and polyploids of Nicotiana. There are dramatic shifts in the distribution of the satellite repeats and complete replacement of intergenic spacers (IGSs) of 35S rDNA associated with divergence of the species in section Alatae. We suggest that sequence homogenization has replaced HRS60 family repeats at sub-telomeric regions, but that this process may not occur, or occurs more slowly, when the repeats are found at intercalary locations. Sequence homogenization acts more rapidly (at least two orders of magnitude) on 35S rDNA than 5S rDNA and sub-telomeric satellite sequences. This rapid rate of divergence is analogous to that found in polyploid species, and is therefore, in plants, not only associated with polyploidy.

Developmental validation of a Nextera XT mitogenome Illumina MiSeq sequencing method for high-quality samples.

PubMed

Peck, Michelle A; Sturk-Andreaggi, Kimberly; Thomas, Jacqueline T; Oliver, Robert S; Barritt-Ross, Suzanne; Marshall, Charla

2018-05-01

Generating mitochondrial genome (mitogenome) data from reference samples in a rapid and efficient manner is critical to harnessing the greater power of discrimination of the entire mitochondrial DNA (mtDNA) marker. The method of long-range target enrichment, Nextera XT library preparation, and Illumina sequencing on the MiSeq is a well-established technique for generating mitogenome data from high-quality samples. To this end, a validation was conducted for this mitogenome method processing up to 24 samples simultaneously along with analysis in the CLC Genomics Workbench and utilizing the AQME (AFDIL-QIAGEN mtDNA Expert) tool to generate forensic profiles. This validation followed the Federal Bureau of Investigation's Quality Assurance Standards (QAS) for forensic DNA testing laboratories and the Scientific Working Group on DNA Analysis Methods (SWGDAM) validation guidelines. The evaluation of control DNA, non-probative samples, blank controls, mixtures, and nonhuman samples demonstrated the validity of this method. Specifically, the sensitivity was established at ≥25 pg of nuclear DNA input for accurate mitogenome profile generation. Unreproducible low-level variants were observed in samples with low amplicon yields. Further, variant quality was shown to be a useful metric for identifying sequencing error and crosstalk. Success of this method was demonstrated with a variety of reference sample substrates and extract types. These studies further demonstrate the advantages of using NGS techniques by highlighting the quantitative nature of heteroplasmy detection. The results presented herein from more than 175 samples processed in ten sequencing runs, show this mitogenome sequencing method and analysis strategy to be valid for the generation of reference data. Copyright © 2018 Elsevier B.V. All rights reserved.

Initiation and termination of DNA replication during S phase in relation to cyclins D1, E and A, p21WAF1, Cdt1 and the p12 subunit of DNA polymerase δ revealed in individual cells by cytometry

PubMed Central

Darzynkiewicz, Zbigniew; Zhao, Hong; Zhang, Sufang; Marietta, Y.W.T. Lee; Ernest, Y.C. Lee; Zhang, Zhongtao

2015-01-01

During our recent studies on mechanism of the regulation of human DNA polymerase δ in preparation for DNA replication or repair, multiparameter imaging cytometry as exemplified by laser scanning cytometry (LSC) has been used to assess changes in expression of the following nuclear proteins associated with initiation of DNA replication: cyclin A, PCNA, Ki-67, p21WAF1, DNA replication factor Cdt1 and the smallest subunit of DNA polymerase δ, p12. In the present review, rather than focusing on Pol δ, we emphasize the application of LSC in these studies and outline possibilities offered by the concurrent differential analysis of DNA replication in conjunction with expression of the nuclear proteins. A more extensive analysis of the data on a correlation between rates of EdU incorporation, likely reporting DNA replication, and expression of these proteins, is presently provided. New data, specifically on the expression of cyclin D1 and cyclin E with respect to EdU incorporation as well as on a relationship between expression of cyclin A vs. p21WAF1 and Ki-67 vs. Cdt1, are also reported. Of particular interest is the observation that this approach makes it possible to assess the temporal sequence of degradation of cyclin D1, p21WAF1, Cdt1 and p12, each with respect to initiation of DNA replication and with respect to each other. Also the sequence or reappearance of these proteins in G2 after termination of DNA replication is assessed. The reviewed data provide a more comprehensive presentation of potential markers, whose presence or absence marks the DNA replicating cells. Discussed is also usefulness of these markers as indicators of proliferative activity in cancer tissues that may bear information on tumor progression and have a prognostic value. PMID:26059433

Initiation and termination of DNA replication during S phase in relation to cyclins D1, E and A, p21WAF1, Cdt1 and the p12 subunit of DNA polymerase δ revealed in individual cells by cytometry.

PubMed

Darzynkiewicz, Zbigniew; Zhao, Hong; Zhang, Sufang; Lee, Marietta Y W T; Lee, Ernest Y C; Zhang, Zhongtao

2015-05-20

During our recent studies on mechanism of the regulation of human DNA polymerase δ in preparation for DNA replication or repair, multiparameter imaging cytometry as exemplified by laser scanning cytometry (LSC) has been used to assess changes in expression of the following nuclear proteins associated with initiation of DNA replication: cyclin A, PCNA, Ki-67, p21(WAF1), DNA replication factor Cdt1 and the smallest subunit of DNA polymerase δ, p12. In the present review, rather than focusing on Pol δ, we emphasize the application of LSC in these studies and outline possibilities offered by the concurrent differential analysis of DNA replication in conjunction with expression of the nuclear proteins. A more extensive analysis of the data on a correlation between rates of EdU incorporation, likely reporting DNA replication, and expression of these proteins, is presently provided. New data, specifically on the expression of cyclin D1 and cyclin E with respect to EdU incorporation as well as on a relationship between expression of cyclin A vs. p21(WAF1) and Ki-67 vs. Cdt1, are also reported. Of particular interest is the observation that this approach makes it possible to assess the temporal sequence of degradation of cyclin D1, p21(WAF1), Cdt1 and p12, each with respect to initiation of DNA replication and with respect to each other. Also the sequence or reappearance of these proteins in G2 after termination of DNA replication is assessed. The reviewed data provide a more comprehensive presentation of potential markers, whose presence or absence marks the DNA replicating cells. Discussed is also usefulness of these markers as indicators of proliferative activity in cancer tissues that may bear information on tumor progression and have a prognostic value.

What Is Peromyscus? Evidence from nuclear and mitochondrial DNA sequences suggests the need for a new classification

PubMed Central

Platt, Roy N.; Amman, Brian R.; Keith, Megan S.; Thompson, Cody W.; Bradley, Robert D.

2015-01-01

The evolutionary relationships between Peromyscus, Habromys, Isthmomys, Megadontomys, Neotomodon, Osgoodomys, and Podomys are poorly understood. In order to further explore the evolutionary boundaries of Peromyscus and compare potential taxonomic solutions for this diverse group and its relatives, we conducted phylogenetic analyses of DNA sequence data from alcohol dehydrogenase (Adh1-I2), beta fibrinogen (Fgb-I7), interphotoreceptor retinoid-binding protein (Rbp3), and cytochrome-b (Cytb). Phylogenetic analyses of mitochondrial and nuclear genes produced similar topologies although levels of nodal support varied. The best-supported topology was obtained by combining nuclear and mitochondrial sequences. No monophyletic Peromyscus clade was supported. Instead, support was found for a clade containing Habromys, Megadontomys, Neotomodon, Osgoodomys, Podomys, and Peromyscus suggesting paraphyly of Peromyscus and confirming previous observations. Our analyses indicated an early divergence of Isthmomys from Peromyscus (approximately 8 million years ago), whereas most other peromyscine taxa emerged within the last 6 million years. To recover a monophyletic taxonomy from Peromyscus and affiliated lineages, we detail 3 taxonomic options in which Habromys, Megadontomys, Neotomodon, Osgoodomys, and Podomys are retained as genera, subsumed as subgenera, or subsumed as species groups within Peromyscus. Each option presents distinct taxonomic challenges, and the appropriate taxonomy must reflect the substantial levels of morphological divergence that characterize this group while maintaining the monophyletic relationships obtained from genetic data. PMID:26937047

What Is Peromyscus? Evidence from nuclear and mitochondrial DNA sequences suggests the need for a new classification.

PubMed

Platt, Roy N; Amman, Brian R; Keith, Megan S; Thompson, Cody W; Bradley, Robert D

2015-08-03

The evolutionary relationships between Peromyscus , Habromys , Isthmomys , Megadontomys , Neotomodon , Osgoodomys , and Podomys are poorly understood. In order to further explore the evolutionary boundaries of Peromyscus and compare potential taxonomic solutions for this diverse group and its relatives, we conducted phylogenetic analyses of DNA sequence data from alcohol dehydrogenase ( Adh 1-I2), beta fibrinogen ( Fgb -I7), interphotoreceptor retinoid-binding protein ( Rbp 3), and cytochrome- b ( Cytb ). Phylogenetic analyses of mitochondrial and nuclear genes produced similar topologies although levels of nodal support varied. The best-supported topology was obtained by combining nuclear and mitochondrial sequences. No monophyletic Peromyscus clade was supported. Instead, support was found for a clade containing Habromys , Megadontomys , Neotomodon , Osgoodomys , Podomys , and Peromyscus suggesting paraphyly of Peromyscus and confirming previous observations. Our analyses indicated an early divergence of Isthmomys from Peromyscus (approximately 8 million years ago), whereas most other peromyscine taxa emerged within the last 6 million years. To recover a monophyletic taxonomy from Peromyscus and affiliated lineages, we detail 3 taxonomic options in which Habromys , Megadontomys , Neotomodon , Osgoodomys , and Podomys are retained as genera, subsumed as subgenera, or subsumed as species groups within Peromyscus . Each option presents distinct taxonomic challenges, and the appropriate taxonomy must reflect the substantial levels of morphological divergence that characterize this group while maintaining the monophyletic relationships obtained from genetic data.

The fanconi anemia proteins FANCA and FANCG stabilize each other and promote the nuclear accumulation of the Fanconi anemia complex.

PubMed

Garcia-Higuera, I; Kuang, Y; Denham, J; D'Andrea, A D

2000-11-01

Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with 8 complementation groups. Four of the FA genes have been cloned, and at least 3 of the encoded proteins, FANCA, FANCC, and FANCG/XRCC9, interact in a multisubunit protein complex. The FANCG protein binds directly to the amino terminal nuclear localization sequence (NLS) of FANCA, suggesting that FANCG plays a role in regulating FANCA nuclear accumulation. In the current study the functional consequences of FANCG/FANCA binding were examined. Correction of an FA-G cell line with the FANCG complementary DNA (cDNA) resulted in FANCA/FANCG binding, prolongation of the cellular half-life of FANCA, and an increase in the nuclear accumulation of the FA protein complex. Similar results were obtained upon correction of an FA-A cell line, with a reciprocal increase in the half-life of FANCG. Patient-derived mutant forms of FANCA, containing an intact NLS sequence but point mutations in the carboxy-terminal leucine zipper region, bound FANCG in the cytoplasm. The mutant forms failed to translocate to the nucleus of transduced cells, thereby suggesting a model of coordinated binding and nuclear translocation. These results demonstrate that the FANCA/FANCG interaction is required to maintain the cellular levels of both proteins. Moreover, at least one function of FANCG and FANCA is to regulate the nuclear accumulation of the FA protein complex. Failure to accumulate the nuclear FA protein complex results in the characteristic spectrum of clinical and cellular abnormalities observed in FA.

Structure of the dimeric exonuclease TREX1 in complex with DNA displays a proline-rich binding site for WW Domains.

PubMed

Brucet, Marina; Querol-Audí, Jordi; Serra, Maria; Ramirez-Espain, Ximena; Bertlik, Kamila; Ruiz, Lidia; Lloberas, Jorge; Macias, Maria J; Fita, Ignacio; Celada, Antonio

2007-05-11

TREX1 is the most abundant mammalian 3' --> 5' DNA exonuclease. It has been described to form part of the SET complex and is responsible for the Aicardi-Goutières syndrome in humans. Here we show that the exonuclease activity is correlated to the binding preferences toward certain DNA sequences. In particular, we have found three motifs that are selected, GAG, ACA, and CTGC. To elucidate how the discrimination occurs, we determined the crystal structures of two murine TREX1 complexes, with a nucleotide product of the exonuclease reaction, and with a single-stranded DNA substrate. Using confocal microscopy, we observed TREX1 both in nuclear and cytoplasmic subcellular compartments. Remarkably, the presence of TREX1 in the nucleus requires the loss of a C-terminal segment, which we named leucine-rich repeat 3. Furthermore, we detected the presence of a conserved proline-rich region on the surface of TREX1. This observation points to interactions with proline-binding domains. The potential interacting motif "PPPVPRPP" does not contain aromatic residues and thus resembles other sequences that select SH3 and/or Group 2 WW domains. By means of nuclear magnetic resonance titration experiments, we show that, indeed, a polyproline peptide derived from the murine TREX1 sequence interacted with the WW2 domain of the elongation transcription factor CA150. Co-immunoprecipitation studies confirmed this interaction with the full-length TREX1 protein, thereby suggesting that TREX1 participates in more functional complexes than previously thought.

The coding region of the UFGT gene is a source of diagnostic SNP markers that allow single-locus DNA genotyping for the assessment of cultivar identity and ancestry in grapevine (Vitis vinifera L.)

PubMed Central

2013-01-01

Background Vitis vinifera L. is one of society’s most important agricultural crops with a broad genetic variability. The difficulty in recognizing grapevine genotypes based on ampelographic traits and secondary metabolites prompted the development of molecular markers suitable for achieving variety genetic identification. Findings Here, we propose a comparison between a multi-locus barcoding approach based on six chloroplast markers and a single-copy nuclear gene sequencing method using five coding regions combined with a character-based system with the aim of reconstructing cultivar-specific haplotypes and genotypes to be exploited for the molecular characterization of 157 V. vinifera accessions. The analysis of the chloroplast target regions proved the inadequacy of the DNA barcoding approach at the subspecies level, and hence further DNA genotyping analyses were targeted on the sequences of five nuclear single-copy genes amplified across all of the accessions. The sequencing of the coding region of the UFGT nuclear gene (UDP-glucose: flavonoid 3-0-glucosyltransferase, the key enzyme for the accumulation of anthocyanins in berry skins) enabled the discovery of discriminant SNPs (1/34 bp) and the reconstruction of 130 V. vinifera distinct genotypes. Most of the genotypes proved to be cultivar-specific, and only few genotypes were shared by more, although strictly related, cultivars. Conclusion On the whole, this technique was successful for inferring SNP-based genotypes of grapevine accessions suitable for assessing the genetic identity and ancestry of international cultivars and also useful for corroborating some hypotheses regarding the origin of local varieties, suggesting several issues of misidentification (synonymy/homonymy). PMID:24298902

Isolation of Onchocerca lupi in Dogs and Black Flies, California, USA

PubMed Central

Hassan, Hassan K.; Bolcen, Shanna; Kubofcik, Joseph; Nutman, Thomas B.; Eberhard, Mark L.; Middleton, Kelly; Wekesa, Joseph Wakoli; Ruedas, Gimena; Nelson, Kimberly J.; Dubielzig, Richard; De Lombaert, Melissa; Silverman, Bruce; Schorling, Jamie J.; Adler, Peter H.; Beeler, Emily S.

2015-01-01

In southern California, ocular infections caused by Onchocerca lupi were diagnosed in 3 dogs (1 in 2006, 2 in 2012). The infectious agent was confirmed through morphologic analysis of fixed parasites in tissues and by PCR and sequencing of amplicons derived from 2 mitochondrially encoded genes and 1 nuclear-encoded gene. A nested PCR based on the sequence of the cytochrome oxidase subunit 1 gene of the parasite was developed and used to screen Simulium black flies collected from southern California for O. lupi DNA. Six (2.8%; 95% CI 0.6%–5.0%) of 213 black flies contained O. lupi DNA. Partial mitochondrial16S rRNA gene sequences from the infected flies matched sequences derived from black fly larvae cytotaxonomically identified as Simulium tribulatum. These data implicate S. tribulatum flies as a putative vector for O. lupi in southern California. PMID:25897954

The genomes of many yam species contain transcriptionally active endogenous geminiviral sequences that may be functionally expressed

PubMed Central

Filloux, Denis; Murrell, Sasha; Koohapitagtam, Maneerat; Golden, Michael; Julian, Charlotte; Galzi, Serge; Uzest, Marilyne; Rodier-Goud, Marguerite; D’Hont, Angélique; Vernerey, Marie Stephanie; Wilkin, Paul; Peterschmitt, Michel; Winter, Stephan; Murrell, Ben; Martin, Darren P.; Roumagnac, Philippe

2015-01-01

Endogenous viral sequences are essentially ‘fossil records’ that can sometimes reveal the genomic features of long extinct virus species. Although numerous known instances exist of single-stranded DNA (ssDNA) genomes becoming stably integrated within the genomes of bacteria and animals, there remain very few examples of such integration events in plants. The best studied of these events are those which yielded the geminivirus-related DNA elements found within the nuclear genomes of various Nicotiana species. Although other ssDNA virus-like sequences are included within the draft genomes of various plant species, it is not entirely certain that these are not contaminants. The Nicotiana geminivirus-related DNA elements therefore remain the only definitively proven instances of endogenous plant ssDNA virus sequences. Here, we characterize two new classes of endogenous plant virus sequence that are also apparently derived from ancient geminiviruses in the genus Begomovirus. These two endogenous geminivirus-like elements (EGV1 and EGV2) are present in the Dioscorea spp. of the Enantiophyllum clade. We used fluorescence in situ hybridization to confirm that the EGV1 sequences are integrated in the D. alata genome and showed that one or two ancestral EGV sequences likely became integrated more than 1.4 million years ago during or before the diversification of the Asian and African Enantiophyllum Dioscorea spp. Unexpectedly, we found evidence of natural selection actively favouring the maintenance of EGV-expressed replication-associated protein (Rep) amino acid sequences, which clearly indicates that functional EGV Rep proteins were probably expressed for prolonged periods following endogenization. Further, the detection in D. alata of EGV gene transcripts, small 21–24 nt RNAs that are apparently derived from these transcripts, and expressed Rep proteins, provides evidence that some EGV genes are possibly still functionally expressed in at least some of the Enantiophyllum clade species. PMID:27774276

A molecular phylogenetic study of Graptopetalum (Crassulaceae) based on ETS, ITS, RPL16, and TRNL-F nucleotide sequences.

PubMed

Acevedo-Rosas, Raúl; Cameron, Kenneth; Sosa, Victoria; Pell, Susan

2004-07-01

Nuclear ETS and ITS, as well as plastid rpl16 and trnL-F DNA sequences were used to determine relationships among species of Graptopetalum (Crassulaceae) and closely related genera. Graptopetalum is member of a group of taxa restricted to North America, one of the centers of diversity of Crassulaceae; however, their phylogenetic relationships are not yet understood. Nineteen species of Graptopetalum and 24 species from nine other genera of Crassulaceae were sampled for use in three separate parsimony analyses: ITS alone, ETS alone, and a combined nuclear + plastid DNA analysis using all four gene regions. The ETS data set had the highest number of parsimony-informative sites, about 30% more than in ITS, but the most fully resolved tree resulted when the four DNA regions were combined. Only four subclades of the tree received moderate to strong bootstrap support, one of which includes all species of Graptopetalum having a single whorl of stamens. However, Graptopetalum is not monophyletic. Instead, Tacitus bellus and select species of Cremnophila, Sedum, and Echeveria are interspersed among species of Graptopetalum and show evidence of grouping according to geographical range of distribution more so than habit or floral morphology.

Nuclear and mtDNA phylogenetic analyses clarify the evolutionary history of two species of native Hawaiian bats and the taxonomy of Lasiurini (Mammalia: Chiroptera).

PubMed

Baird, Amy B; Braun, Janet K; Engstrom, Mark D; Holbert, Ashlyn C; Huerta, Maritza G; Lim, Burton K; Mares, Michael A; Patton, John C; Bickham, John W

2017-01-01

Previous studies on genetics of hoary bats produced differing conclusions on the timing of their colonization of the Hawaiian Islands and whether or not North American (Aeorestes cinereus) and Hawaiian (A. semotus) hoary bats are distinct species. One study, using mtDNA COI and nuclear Rag2 and CMA1, concluded that hoary bats colonized the Hawaiian Islands no more than 10,000 years ago based on indications of population expansion at that time using Extended Bayesian Skyline Plots. The other study, using 3 mtDNA and 1 Y-chromosome locus, concluded that the Hawaiian Islands were colonized about 1 million years ago. To address the marked inconsistencies between those studies, we examined DNA sequences from 4 mitochondrial and 2 nuclear loci in lasiurine bats to investigate the timing of colonization of the Hawaiian Islands by hoary bats, test the hypothesis that Hawaiian and North American hoary bats belong to different species, and further investigate the generic level taxonomy within the tribe. Phylogenetic analysis and dating of the nodes of mtDNA haplotypes and of nuclear CMA1 alleles show that A. semotus invaded the Hawaiian Islands approximately 1.35 Ma and that multiple arrivals of A. cinereus occurred much more recently. Extended Bayesian Skyline plots show population expansion at about 20,000 years ago in the Hawaiian Islands, which we conclude does not represent the timing of colonization of the Hawaiian Islands given the high degree of genetic differentiation among A. cinereus and A. semotus (4.2% divergence at mtDNA Cytb) and the high degree of genetic diversity within A. semotus. Rather, population expansion 20,000 years ago could have resulted from colonization of additional islands, expansion after a bottleneck, or other factors. New genetic data also support the recognition of A. semotus and A. cinereus as distinct species, a finding consistent with previous morphological and behavioral studies. The phylogenetic analysis of CMA1 alleles shows the presence of 2 clades that are primarily associated with A. semotus mtDNA haplotypes, and are unique to the Hawaiian Islands. There is evidence for low levels of hybridization between A. semotus and A. cinereus on the Hawaiian Islands, but it is not extensive (<15% of individuals are of hybrid origin), and clearly each species is able to maintain its own genetic distinctiveness. Both mtDNA and nuclear DNA sequences show deep divergence between the 3 groups (genera) of lasiurine bats that correspond to the previously recognized morphological differences between them. We show that the Tribe Lasiurini contains the genera Aeorestes (hoary bats), Lasiurus (red bats), and Dasypterus (yellow bats).

Nuclear and mtDNA phylogenetic analyses clarify the evolutionary history of two species of native Hawaiian bats and the taxonomy of Lasiurini (Mammalia: Chiroptera)

PubMed Central

Braun, Janet K.; Engstrom, Mark D.; Holbert, Ashlyn C.; Huerta, Maritza G.; Lim, Burton K.; Mares, Michael A.; Patton, John C.

2017-01-01

Previous studies on genetics of hoary bats produced differing conclusions on the timing of their colonization of the Hawaiian Islands and whether or not North American (Aeorestes cinereus) and Hawaiian (A. semotus) hoary bats are distinct species. One study, using mtDNA COI and nuclear Rag2 and CMA1, concluded that hoary bats colonized the Hawaiian Islands no more than 10,000 years ago based on indications of population expansion at that time using Extended Bayesian Skyline Plots. The other study, using 3 mtDNA and 1 Y-chromosome locus, concluded that the Hawaiian Islands were colonized about 1 million years ago. To address the marked inconsistencies between those studies, we examined DNA sequences from 4 mitochondrial and 2 nuclear loci in lasiurine bats to investigate the timing of colonization of the Hawaiian Islands by hoary bats, test the hypothesis that Hawaiian and North American hoary bats belong to different species, and further investigate the generic level taxonomy within the tribe. Phylogenetic analysis and dating of the nodes of mtDNA haplotypes and of nuclear CMA1 alleles show that A. semotus invaded the Hawaiian Islands approximately 1.35 Ma and that multiple arrivals of A. cinereus occurred much more recently. Extended Bayesian Skyline plots show population expansion at about 20,000 years ago in the Hawaiian Islands, which we conclude does not represent the timing of colonization of the Hawaiian Islands given the high degree of genetic differentiation among A. cinereus and A. semotus (4.2% divergence at mtDNA Cytb) and the high degree of genetic diversity within A. semotus. Rather, population expansion 20,000 years ago could have resulted from colonization of additional islands, expansion after a bottleneck, or other factors. New genetic data also support the recognition of A. semotus and A. cinereus as distinct species, a finding consistent with previous morphological and behavioral studies. The phylogenetic analysis of CMA1 alleles shows the presence of 2 clades that are primarily associated with A. semotus mtDNA haplotypes, and are unique to the Hawaiian Islands. There is evidence for low levels of hybridization between A. semotus and A. cinereus on the Hawaiian Islands, but it is not extensive (<15% of individuals are of hybrid origin), and clearly each species is able to maintain its own genetic distinctiveness. Both mtDNA and nuclear DNA sequences show deep divergence between the 3 groups (genera) of lasiurine bats that correspond to the previously recognized morphological differences between them. We show that the Tribe Lasiurini contains the genera Aeorestes (hoary bats), Lasiurus (red bats), and Dasypterus (yellow bats). PMID:29020097

Genetic Diversity of Sheep Breeds from Albania, Greece, and Italy Assessed by Mitochondrial DNA and Nuclear Polymorphisms (SNPs)

PubMed Central

Pariset, Lorraine; Mariotti, Marco; Gargani, Maria; Joost, Stephane; Negrini, Riccardo; Perez, Trinidad; Bruford, Michael; Ajmone Marsan, Paolo; Valentini, Alessio

2011-01-01

We employed mtDNA and nuclear SNPs to investigate the genetic diversity of sheep breeds of three countries of the Mediterranean basin: Albania, Greece, and Italy. In total, 154 unique mtDNA haplotypes were detected by means of D-loop sequence analysis. The major nucleotide diversity was observed in Albania. We identified haplogroups, A, B, and C in Albanian and Greek samples, while Italian individuals clustered in groups A and B. In general, the data show a pattern reflecting old migrations that occurred in postneolithic and historical times. PCA analysis on SNP data differentiated breeds with good correspondence to geographical locations. This could reflect geographical isolation, selection operated by local sheep farmers, and different flock management and breed admixture that occurred in the last centuries. PMID:22125424

An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

PubMed

Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

2004-01-21

We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

The occurrence of Toxocara malaysiensis in cats in China, confirmed by sequence-based analyses of ribosomal DNA.

PubMed

Li, Ming-Wei; Zhu, Xing-Quan; Gasser, Robin B; Lin, Rui-Qing; Sani, Rehana A; Lun, Zhao-Rong; Jacobs, Dennis E

2006-10-01

Non-isotopic polymerase chain reaction (PCR)-based single-strand conformation polymorphism and sequence analyses of the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) were utilized to genetically characterise ascaridoids from dogs and cats from China by comparison with those from other countries. The study showed that Toxocara canis, Toxocara cati, and Toxascaris leonina from China were genetically the same as those from other geographical origins. Specimens from cats from Guangzhou, China, which were morphologically consistent with Toxocara malaysiensis, were the same genetically as those from Malaysia, with the exception of a polymorphism in the ITS-2 but no unequivocal sequence difference. This is the first report of T. malaysiensis in cats outside of Malaysia (from where it was originally described), supporting the proposal that this species has a broader geographical distribution. The molecular approach employed provides a powerful tool for elucidating the biology, epidemiology, and zoonotic significance of T. malaysiensis.

Molecular diversification of Trichuris spp. from Sigmodontinae (Cricetidae) rodents from Argentina based on mitochondrial DNA sequences.

PubMed

Callejón, Rocío; Robles, María Del Rosario; Panei, Carlos Javier; Cutillas, Cristina

2016-08-01

A molecular phylogenetic hypothesis is presented for the genus Trichuris based on sequence data from mitochondrial cytochrome c oxidase 1 (cox1) and cytochrome b (cob). The taxa consisted of nine populations of whipworm from five species of Sigmodontinae rodents from Argentina. Bayesian Inference, Maximum Parsimony, and Maximum Likelihood methods were used to infer phylogenies for each gene separately but also for the combined mitochondrial data and the combined mitochondrial and nuclear dataset. Phylogenetic results based on cox1 and cob mitochondrial DNA (mtDNA) revealed three clades strongly resolved corresponding to three different species (Trichuris navonae, Trichuris bainae, and Trichuris pardinasi) showing phylogeographic variation, but relationships among Trichuris species were poorly resolved. Phylogenetic reconstruction based on concatenated sequences had greater phylogenetic resolution for delimiting species and populations intra-specific of Trichuris than those based on partitioned genes. Thus, populations of T. bainae and T. pardinasi could be affected by geographical factors and co-divergence parasite-host.

H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

PubMed

Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

1989-11-01

Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

Target capture enrichment of nuclear SNP markers for massively parallel sequencing of degraded and mixed samples.

PubMed

Bose, Nikhil; Carlberg, Katie; Sensabaugh, George; Erlich, Henry; Calloway, Cassandra

2018-05-01

DNA from biological forensic samples can be highly fragmented and present in limited quantity. When DNA is highly fragmented, conventional PCR based Short Tandem Repeat (STR) analysis may fail as primer binding sites may not be present on a single template molecule. Single Nucleotide Polymorphisms (SNPs) can serve as an alternative type of genetic marker for analysis of degraded samples because the targeted variation is a single base. However, conventional PCR based SNP analysis methods still require intact primer binding sites for target amplification. Recently, probe capture methods for targeted enrichment have shown success in recovering degraded DNA as well as DNA from ancient bone samples using next-generation sequencing (NGS) technologies. The goal of this study was to design and test a probe capture assay targeting forensically relevant nuclear SNP markers for clonal and massively parallel sequencing (MPS) of degraded and limited DNA samples as well as mixtures. A set of 411 polymorphic markers totaling 451 nuclear SNPs (375 SNPs and 36 microhaplotype markers) was selected for the custom probe capture panel. The SNP markers were selected for a broad range of forensic applications including human individual identification, kinship, and lineage analysis as well as for mixture analysis. Performance of the custom SNP probe capture NGS assay was characterized by analyzing read depth and heterozygote allele balance across 15 samples at 25 ng input DNA. Performance thresholds were established based on read depth ≥500X and heterozygote allele balance within ±10% deviation from 50:50, which was observed for 426 out of 451 SNPs. These 426 SNPs were analyzed in size selected samples (at ≤75 bp, ≤100 bp, ≤150 bp, ≤200 bp, and ≤250 bp) as well as mock degraded samples fragmented to an average of 150 bp. Samples selected for ≤75 bp exhibited 99-100% reportable SNPs across varied DNA amounts and as low as 0.5 ng. Mock degraded samples at 1 ng and 10 ng exhibited >90% reportable SNPs. Finally, two-person male-male mixtures were tested at 10 ng in contributor varying ratios. Overall, 85-100% of alleles unique to the minor contributor were observed at all mixture ratios. Results from these studies using the SNP probe capture NGS system demonstrates proof of concept for application to forensically relevant degraded and mixed DNA samples. Copyright © 2018 Elsevier B.V. All rights reserved.

Rapid Mitochondrial Genome Evolution through Invasion of Mobile Elements in Two Closely Related Species of Arbuscular Mycorrhizal Fungi

PubMed Central

Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

2013-01-01

Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers. PMID:23637766

Rapid mitochondrial genome evolution through invasion of mobile elements in two closely related species of arbuscular mycorrhizal fungi.

PubMed

Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed

2013-01-01

Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers.

G-rich telomeric and ribosomal DNA sequences from the fission yeast genome form stable G-quadruplex DNA structures in vitro and are unwound by the Pfh1 DNA helicase

PubMed Central

Wallgren, Marcus; Mohammad, Jani B.; Yan, Kok-Phen; Pourbozorgi-Langroudi, Parham; Ebrahimi, Mahsa; Sabouri, Nasim

2016-01-01

Certain guanine-rich sequences have an inherent propensity to form G-quadruplex (G4) structures. G4 structures are e.g. involved in telomere protection and gene regulation. However, they also constitute obstacles during replication if they remain unresolved. To overcome these threats to genome integrity, organisms harbor specialized G4 unwinding helicases. In Schizosaccharomyces pombe, one such candidate helicase is Pfh1, an evolutionarily conserved Pif1 homolog. Here, we addressed whether putative G4 sequences in S. pombe can adopt G4 structures and, if so, whether Pfh1 can resolve them. We tested two G4 sequences, derived from S. pombe ribosomal and telomeric DNA regions, and demonstrated that they form inter- and intramolecular G4 structures, respectively. Also, Pfh1 was enriched in vivo at the ribosomal G4 DNA and telomeric sites. The nuclear isoform of Pfh1 (nPfh1) unwound both types of structure, and although the G4-stabilizing compound Phen-DC3 significantly enhanced their stability, nPfh1 still resolved them efficiently. However, stable G4 structures significantly inhibited adenosine triphosphate hydrolysis by nPfh1. Because ribosomal and telomeric DNA contain putative G4 regions conserved from yeasts to humans, our studies support the important role of G4 structure formation in these regions and provide further evidence for a conserved role for Pif1 helicases in resolving G4 structures. PMID:27185885

Development and characterization of 79 nuclear markers amplifying in viviparous and oviparous clades of the European common lizard.

PubMed

Horreo, J L; Peláez, M L; Suárez, T; Fitze, P S

2018-02-01

The European common lizard (Zootoca vivipara) is a widely distributed species across Europe and Asia exhibiting two reproductive modes (oviparity/viviparity), six major lineages and several sublineages. It has been used to tackle a large variety of research questions, nevertheless, few nuclear DNA sequence markers have been developed for this species. Here we developed 79 new nuclear DNA sequence markers using a clonation protocol. These markers were amplified in several oviparous and viviparous specimens including samples of all extant clades, to test the amplification success and their diversity. 49.4% of the markers were polymorphic and of those, 51.3% amplified in all and 94.9% amplified in 5-7 of the extant Z. vivipara clades. These new markers will be very useful for the study of the population structure, population dynamics, and micro/macro evolution of Z. vivipara. Cross-species amplification in four lizard species (Psammodromus edwardsianus, Podarcis muralis, Lacerta bilineata, and Takydromus sexlineatus) was positive in several of the markers, and six makers amplified in all five species. The large genetic distance between P. edwardsianus and Z. vivipara further suggests that these markers may as well be employed in many other species.

DR-78, a novel Drosophila melanogaster genomic DNA fragment highly homologous to the DNA-binding domain of thyroid hormone-retinoic acid-vitamin D receptor subfamily.

PubMed

Martín-Blanco, E; Kornberg, T B

1993-11-16

Degenerate oligodeoxyribonucleotides were designed for both ends of the DNA-binding domain of members of the nuclear receptor superfamily. PCR amplified Drosophila melanogaster DNA was purified and cloned (DR plasmids). Genomic lambda DASH clones were identified at high stringency with an amplified DR-78 plasmid DNA and isolated. The partial sequence shows a very probable open reading frame which would encode a peptide highly homologous to members of the thyroid hormone-retinoic acid-vitamin D receptor subfamily. The fragment corresponds to a single copy gene and was mapped at position 78D of chromosome three by in situ hybridization.

Adenovirus core protein VII contains distinct sequences that mediate targeting to the nucleus and nucleolus, and colocalization with human chromosomes.

PubMed

Lee, Tim W R; Blair, G Eric; Matthews, David A

2003-12-01

During adenovirus infection, following capsid dissociation, core protein VII enters the host cell nucleus complexed with adenovirus DNA. In order to determine whether protein VII may have an active role in this nuclear import, regions of the preVII gene were amplified by PCR, and further oligonucleotide mutants were designed with site-directed mutation of codons for the basic amino acids arginine and lysine. Fragments were cloned into a mammalian expression plasmid to express the peptides as N-terminal fusions to enhanced green fluorescent protein. Results demonstrate that preVII protein contains both nuclear and nucleolar targeting sequences. Such signals may be important in the delivery of adenovirus DNA to the host cell nucleus during adenovirus infection. Furthermore, the data suggest that protein VII may bind to human chromosomes by means of two distinct domains, one sharing homology with the N-terminal regulatory tail of histone H3.

Species trees for the tree swallows (Genus Tachycineta): an alternative phylogenetic hypothesis to the mitochondrial gene tree.

PubMed

Dor, Roi; Carling, Matthew D; Lovette, Irby J; Sheldon, Frederick H; Winkler, David W

2012-10-01

The New World swallow genus Tachycineta comprises nine species that collectively have a wide geographic distribution and remarkable variation both within- and among-species in ecologically important traits. Existing phylogenetic hypotheses for Tachycineta are based on mitochondrial DNA sequences, thus they provide estimates of a single gene tree. In this study we sequenced multiple individuals from each species at 16 nuclear intron loci. We used gene concatenated approaches (Bayesian and maximum likelihood) as well as coalescent-based species tree inference to reconstruct phylogenetic relationships of the genus. We examined the concordance and conflict between the nuclear and mitochondrial trees and between concatenated and coalescent-based inferences. Our results provide an alternative phylogenetic hypothesis to the existing mitochondrial DNA estimate of phylogeny. This new hypothesis provides a more accurate framework in which to explore trait evolution and examine the evolution of the mitochondrial genome in this group. Copyright © 2012 Elsevier Inc. All rights reserved.

[Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1997-05-01

The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

NASA Astrophysics Data System (ADS)

Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

2014-09-01

Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

PubMed Central

Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

2014-01-01

Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

Structure of the highly repeated, long interspersed DNA family (LINE or L1Rn) of the rat.

PubMed Central

D'Ambrosio, E; Waitzkin, S D; Witney, F R; Salemme, A; Furano, A V

1986-01-01

We present the DNA sequence of a 6.7-kilobase member of the rat long interspersed repeated DNA family (LINE or L1Rn). This member (LINE 3) is flanked by a perfect 14-base-pair (bp) direct repeat and is a full-length, or close-to-full-length, member of this family. LINE 3 contains an approximately 100-bp A-rich right end, a number of long (greater than 400-bp) open reading frames, and a ca. 200-bp G + C-rich (ca. 60%) cluster near each terminus. Comparison of the LINE 3 sequence with the sequence of about one-half of another member, which we also present, as well as restriction enzyme analysis of the genomic copies of this family, indicates that in length and overall structure LINE 3 is quite typical of the 40,000 or so other genomic members of this family which would account for as much as 10% of the rat genome. Therefore, the rat LINE family is relatively homogeneous, which contrasts with the heterogeneous LINE families in primates and mice. Transcripts corresponding to the entire LINE sequence are abundant in the nuclear RNA of rat liver. The characteristics of the rat LINE family are discussed with respect to the possible function and evolution of this family of DNA sequences. Images PMID:3023845

Evolution of nuclear rDNA ITS sequences in the Cladophora albida/sericea clade (Chlorophyta).

PubMed

Bakker, F T; Olsen, J L; Stam, W T

1995-06-01

Ribosomal DNA ITS sequences were compared among 13 different species and biogeographic isolates from the monophyletic "albida/sericea clade" in the green algal genus Cladophora. Six distinct ITS sequence types were found, characterized by multiple insertions and deletions and high levels of nucleotide substitution. Conserved domains within the ITS regions indicate the presence of ITS secondary structure. Low transition/transversion ratios among the six types and nearly symmetrical tree-length frequency distributions indicate some saturation, and low phylogenetic signal. Although branching order among five of the six ITS sequence types could not be resolved, estimates of ITS sequence divergence as compared with 18S divergence in a subset of the taxa suggests that the origin of the different ITS types is probably in the mid-Miocene (12 Ma ago) but that biogeographic isolates within a single ITS type (including both Pacific and Atlantic representatives) have probably dispersed on a time scale of thousands rather than millions of years.

Phylogenetic study of Oryzoideae species and related taxa of the Poaceae based on atpB-rbcL and ndhF DNA sequences.

PubMed

Zeng, Xu; Yuan, Zhengrong; Tong, Xin; Li, Qiushi; Gao, Weiwei; Qin, Minjian; Liu, Zhihua

2012-05-01

Oryzoideae (Poaceae) plants have economic and ecological value. However, the phylogenetic position of some plants is not clear, such as Hygroryza aristata (Retz.) Nees. and Porteresia coarctata (Roxb.) Tateoka (syn. Oryza coarctata). Comprehensive molecular phylogenetic studies have been carried out on many genera in the Poaceae. The different DNA sequences, including nuclear and chloroplast sequences, had been extensively employed to determine relationships at both higher and lower taxonomic levels in the Poaceae. Chloroplast DNA ndhF gene and atpB-rbcL spacer were used to construct phylogenetic trees and estimate the divergence time of Oryzoideae, Bambusoideae, Panicoideae, Pooideae and so on. Complete sequences of atpB-rbcL and ndhF were generated for 17 species representing six species of the Oryzoideae and related subfamilies. Nicotiana tabacum L. was the outgroup species. The two DNA datasets were analyzed, using Maximum Parsimony and Bayesian analysis methods. The molecular phylogeny revealed that H. aristata (Retz.) Nees was the sister to Chikusichloa aquatica Koidz. Moreover, P. coarctata (Roxb.) Tateoka was in the genus Oryza. Furthermore, the result of evolution analysis, which based on the ndhF marker, indicated that the time of origin of Oryzoideae might be 31 million years ago.

Blastocele fluid from in vitro- and in vivo-produced equine embryos contains nuclear DNA.

PubMed

Herrera, C; Morikawa, M I; Castex, C Baca; Pinto, M R; Ortega, N; Fanti, T; Garaguso, R; Franco, M J; Castañares, M; Castañeira, C; Losinno, L; Miragaya, M H; Mutto, A A

2015-02-01

Normal mammalian early embryonic development involves apoptosis of blastomeres as a remodeling process during differentiation, starting at the blastocyst stage. Genomic DNA has been recently detected in the blastocele fluid of human embryos and has been amplified by real-time polymerase chain reaction (PCR) to diagnose the sex of in vitro-produced human embryos. This new approach varies from conventional preimplantation genetic diagnosis in that no cells are extracted from the embryo and only the blastocele fluid is aspirated and used as a DNA sample for diagnosis. In the present work, we investigated whether the blastocele fluid of equine preimplantation embryos contains nuclear DNA and whether this DNA could be used to diagnose the sex of the embryos by conventional PCR, using specific primers that target the TSPY and AMEL equine genes. The sex of 11 of 13 in vivo-produced embryos and of four of five in vitro-produced embryos was successfully diagnosed. The PCR amplification product was analyzed using genetic sequencing reporting that the DNA present in blastocele fluid was genomic. Additionally, after polyacrylamide gel electrophoresis and silver staining, the blastocele fluid from three different embryos produced a ladder pattern characteristic of DNA fragmented during apoptosis. Therefore, the results presented in this work report that blastocele fluid from in vivo- and in vitro-produced equine embryos contains nuclear DNA which is probably originated by apoptosis of embryonic cells, and this DNA could be used to diagnose the sex of preimlpantation embryos by conventional PCR. Copyright © 2015 Elsevier Inc. All rights reserved.

Fungal endophyte diversity in Sarracenia.

PubMed

Glenn, Anthony; Bodri, Michael S

2012-01-01

Fungal endophytes were isolated from 4 species of the carnivorous pitcher plant genus Sarracenia: S. minor, S. oreophila, S. purpurea, and S. psittacina. Twelve taxa of fungi, 8 within the Ascomycota and 4 within the Basidiomycota, were identified based on PCR amplification and sequencing of the internal transcribed spacer sequences of nuclear ribosomal DNA (ITS rDNA) with taxonomic identity assigned using the NCBI nucleotide megablast search tool. Endophytes are known to produce a large number of metabolites, some of which may contribute to the protection and survival of the host. We speculate that endophyte-infected Sarracenia may benefit from their fungal associates by their influence on nutrient availability from within pitchers and, possibly, by directly influencing the biota within pitchers.

The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

PubMed

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.

The Paramecium Germline Genome Provides a Niche for Intragenic Parasitic DNA: Evolutionary Dynamics of Internal Eliminated Sequences

PubMed Central

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448

Positive contribution of pathogenic mutations in the mitochondrial genome to the promotion of cancer by prevention from apoptosis.

PubMed

Shidara, Yujiro; Yamagata, Kumi; Kanamori, Takashi; Nakano, Kazutoshi; Kwong, Jennifer Q; Manfredi, Giovanni; Oda, Hideaki; Ohta, Shigeo

2005-03-01

The role of mitochondrial dysfunction in cancer has been a subject of great interest and much ongoing investigation. Although most cancer cells harbor somatic mutations in mitochondrial DNA (mtDNA), the question of whether such mutations contribute to the promotion of carcinomas remains unsolved. Here we used trans-mitochondrial hybrids (cybrids) containing a common HeLa nucleus and mtDNA of interest to compare the role of mtDNA against the common nuclear background. We constructed cybrids with or without a homoplasmic pathogenic point mutation at nucleotide position 8,993 or 9,176 in the mtDNA ATP synthase subunit 6 gene (MTATP6) derived from patients with mitochondrial encephalomyopathy. When the cybrids were transplanted into nude mice, the MTATP6 mutations conferred an advantage in the early stage of tumor growth. The mutant cybrids also increased faster than wild type in culture. To complement the mtDNA mutations, we transfected a wild-type nuclear version of MTATP, whose codons were converted to the universal genetic codes containing a mitochondrial target sequence, into the nucleus of cybrids carrying mutant MTATP6. The restoration of MTATP slowed down the growth of tumor in transplantation. Conversely, expression of a mutant nuclear version of MTATP6 in the wild-type cybrids declined respiration and accelerated the tumor growth. These findings showed that the advantage in tumor growth depended upon the MTATP6 function but was not due to secondary nuclear mutations caused by the mutant mitochondria. Because apoptosis occurred less frequently in the mutant versus wild-type cybrids in cultures and tumors, the pathogenic mtDNA mutations seem to promote tumors by preventing apoptosis.

A Contribution to the Taxonomy of Rhizochaete (Polyporales, Basidiomycota)

Treesearch

Karen K. Nakasone; Kymberly R. Draeger; Beatriz Ortiz-Santana

2017-01-01

Rhizochaete is a small genus of crust fungi that is closely related to Phanerochaete. A new species Rhizochaete belizensis is described, and three new combinations are proposed. Morphological studies and molecular sequence data from two nuclear ribosomal DNA regions (ITS and LSU) support the recognition of...

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

The utility of DNA sequences of an intron from the beta-fibrinogen gene in phylogenetic analysis of woodpeckers (Aves: Picidae).

PubMed

Prychitko, T M; Moore, W S

1997-10-01

Estimating phylogenies from DNA sequence data has become the major methodology of molecular phylogenetics. To date, molecular phylogenetics of the vertebrates has been very dependent on mtDNA, but studies involving mtDNA are limited because the several genes comprising the mt-genome are inherited as a single linkage group. The only apparent solution to this problem is to sequence additional genes, each representing a distinct linkage group, so that the resultant gene trees provide independent estimates of the species tree. There exists the need to find novel gene sequences which contain enough phylogenetic information to resolve relationships between closely related species. A possible source is the nuclear-encoded introns, because they evolve more rapidly than exons. We designed primers to amplify and sequence the 7 intron from the beta-fibrinogen gene for a recently evolved group, the woodpeckers. We sequenced the entire intron for 10 specimens representing five species. Nucleotide substitutions are randomly distributed along the length of the intron, suggesting selective neutrality. A preliminary analysis indicates that the phylogenetic signal in the intron is as strong as that in the mitochondrial encoded cytochrome b (cyt b) gene. The topology of the beta-fibrinogen tree is identical to that of the cyt b tree. This analysis demonstrates the ability of the 7 intron of beta-fibrinogen to provide well resolved, independent gene trees for recently evolved groups and establishes it as a source of sequences to be used in other phylogenetic studies. Copyright 1997 Academic Press

DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

PubMed

Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

2009-01-01

* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

Nucleolar Association and Transcriptional Inhibition through 5S rDNA in Mammals

PubMed Central

Fedoriw, Andrew M.; Starmer, Joshua; Yee, Della; Magnuson, Terry

2012-01-01

Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals. PMID:22275877

Genetic characterization and phylogenetic analysis of Eimeria arloingi in Iranian native kids.

PubMed

Khodakaram-Tafti, A; Hashemnia, M; Razavi, S M; Sharifiyazdi, H; Nazifi, S

2013-09-01

Among the 16 species of Eimeria from goats, Eimeria arloingi and Eimeria ninakohlyakimovae are regarded as the most pathogenic species in the world and cause clinical caprine coccidiosis. E. arloingi is known to be an important cause of coccidiosis in Iranian kids. Molecular analyses of two portions of nuclear ribosomal DNA (internal transcribed spacer1 (ITS1) and 18S rDNA) were used for the genetic characterization of the E. arloingi. Comparison of the sequencing data of E. arloingi obtained in the present study (ITS1: KC507793 and 18S rDNA: KC507792) with other Eimeria species in the GenBank database revealed a particularly close relationship between E. arloingi and Eimeria spp. from the cattle and sheep. The phylogram based on the ITS1 sequences shows that the E. arloingi, Eimeria bovis, and Eimeria zuernii formed a distinct group separate from the other remaining Eimeria spp. in cattle and poultry. In pairwise alignment, 18S rDNA sequence derived from E. arloingi showed 99% similarity to Eimeria ahsata with differences observed at only three nucleotides. This study showed that the ITS1 and 18S rDNA gene are useful genetic markers for the specific identification and differentiation of Eimeria spp. in ruminants.

New universal ITS2 primers for high-resolution herbivory analyses using DNA metabarcoding in both tropical and temperate zones.

PubMed

Moorhouse-Gann, Rosemary J; Dunn, Jenny C; de Vere, Natasha; Goder, Martine; Cole, Nik; Hipperson, Helen; Symondson, William O C

2018-06-04

DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187-387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.

Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

PubMed

Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

2001-01-24

We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

Deciphering the origin of mito-nuclear discordance in two sibling caddisfly species.

PubMed

Weigand, Hannah; Weiss, Martina; Cai, Huimin; Li, Yongping; Yu, Lili; Zhang, Christine; Leese, Florian

2017-10-01

An increasing number of phylogenetic studies have reported discordances among nuclear and mitochondrial markers. These discrepancies are highly relevant to widely used biodiversity assessment approaches, such as DNA barcoding, that rely almost exclusively on mitochondrial markers. Although the theoretical causes of mito-nuclear discordances are well understood, it is often extremely challenging to determine the principal underlying factor in a given study system. In this study, we uncovered significant mito-nuclear discordances in a pair of sibling caddisfly species. Application of genome sequencing, ddRAD and DNA barcoding revealed ongoing hybridization, as well as historical hybridization in Pleistocene refugia, leading us to identify introgression as the ultimate cause of the observed discordance pattern. Our novel genomic data, the discovery of a European-wide hybrid zone and the availability of established techniques for laboratory breeding make this species pair an ideal model system for studying species boundaries with ongoing gene flow. © 2017 John Wiley & Sons Ltd.

Development of novel low-copy nuclear markers for Hieraciinae (Asteraceae) and their perspective for other tribes.

PubMed

Krak, Karol; Alvarez, Inés; Caklová, Petra; Costa, Andrea; Chrtek, Jindrich; Fehrer, Judith

2012-02-01

The development of three low-copy nuclear markers for low taxonomic level phylogenies in Asteraceae with emphasis on the subtribe Hieraciinae is reported. Marker candidates were selected by comparing a Lactuca complementary DNA (cDNA) library with public DNA sequence databases. Interspecific variation and phylogenetic signal of the selected genes were investigated for diploid taxa from the subtribe Hieraciinae and compared to a reference phylogeny. Their ability to cross-amplify was assessed for other Asteraceae tribes. All three markers had higher variation (2.1-4.5 times) than the internal transcribed spacer (ITS) in Hieraciinae. Cross-amplification was successful in at least seven other tribes of the Asteraceae. Only three cases indicating the presence of paralogs or pseudogenes were detected. The results demonstrate the potential of these markers for phylogeny reconstruction in the Hieraciinae as well as in other Asteraceae tribes, especially for very closely related species.

Recombination of mitochondrial DNA without selection pressure among compatible strains of the Aspergillus niger species aggregate.

PubMed

Tóth, B; Hamari, Z; Ferenczy, L; Varga, J; Kevei, F

1998-03-01

Previous mitochondrial transmission experiments between oligomycin-resistant and oligomycin-sensitive incompatible strains of the A. niger aggregate bearing various mtDNA RFLP profiles resulted in a great variety of mitochondrial recombinants under selection pressure. Apart from the recombinant mtDNAs, resistant clones harbouring unchanged RFLP profiles of resistant donor mtDNAs with the recipient nuclear backgrounds were rarely isolated. These strains were anastomosed with nuclearly isogenic oligomycin-sensitive recipient partners and the mitochondria of the resulting progeny were examined under non-selective conditions. These experiments provide insights into events which are possibly similar to those occurring in nature. The heterokaryons obtained formed both oligomycin-resistant and -sensitive sectors, most of which were found to be homoplasmons. Progenies harbouring oligomycin-resistant and -sensitive mtDNAs may originate either from individual recombination events or be due to parental segregation. MtDNA recombination might take place in the heterokaryons without selection by oligomycin. The most frequent recombinant types of mtDNA RFLP profiles were indistinguishable from those recombinant mtDNAs which were frequently obtained under selection pressure from directed transfer experiments between incompatible strains. We present evidence that mixed mitochondrial populations may influence the compatibility reactions in the presence of an isogenic nuclear background, that recombination may take place without selection pressure, and that the process does not require specific nuclear sequences of both parental strains.

Phylogenetics of Pinus (Pinaceae) based on nuclear ribosomal DNA internal transcribed spacer region sequences.

PubMed

Liston, A; Robinson, W A; Piñero, D; Alvarez-Buylla, E R

1999-02-01

A 650-bp portion of the nuclear ribosomal DNA internal transcribed spacer region was sequenced in 47 species of Pinus, representing all recognized subsections of the genus, and 2 species of Picea and Cathaya as outgroups. Parsimony analyses of these length variable sequences were conducted using a manual alignment, 13 different automated alignments, elision of the automated alignments, and exclusion of all alignment ambiguous sites. High and moderately supported clades were consistently resolved across the different analyses, while poorly supported clades were inconsistently recovered. Comparison of the topologies highlights taxa of particularly problematic placement including Pinus nelsonii and P. aristata. Within subgenus Pinus, there is moderate support for the monophyly of a narrowly circumscribed subsect. Pinus (=subsect. Sylvestres) and strong support for a clade of North and Central American hard pines. The Himalayan P. roxburghii may be sister species to these "New World hard pines," which have two well-supported subgroups, subsect. Ponderosae and a clade of the remaining five subsections. The position of subsect. Contortae conflicts with its placement in a chloroplast DNA restriction site study. Within subgenus Strobus there is consistent support for the monophyly of a broadly circumscribed subsect. Strobi (including P. krempfii and a polyphyletic subsect. Cembrae) derived from a paraphyletic grade of the remaining soft pines. Relationships among subsects. Gerardianae, Cembroides, and Balfourianae are poorly resolved. Support for the monophyly of subgenus Pinus and subgenus Strobus is not consistently obtained. Copyright 1999 Academic Press.

The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern

PubMed Central

Bellizzi, Dina; D'Aquila, Patrizia; Scafone, Teresa; Giordano, Marco; Riso, Vincenzo; Riccio, Andrea; Passarino, Giuseppe

2013-01-01

DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question. PMID:23804556

Genetic divergence and phylogeographic history of two closely related species (Leucomeris decora and Nouelia insignis) across the 'Tanaka Line' in Southwest China.

PubMed

Zhao, Yu-Juan; Gong, Xun

2015-07-08

Leucomeris decora and Nouelia insignis (Asteraceae) are narrowly and allopatrically distributed species, separated by the important biogeographic boundary Tanaka Line in Southwest China. Previous morphological, cytogenetic and molecular studies suggested that L. decora is sister to N. insignis. However, it is less clear how the two species diverged, whether in full isolation or occurring gene flow across the Tanaka Line. Here, we performed a molecular study at the population level to characterize genetic differentiation and decipher phylogeographic history in two closely related species based on variation examined in plastid and nuclear DNAs using a coalescent-based approach. These morphologically distinct species share plastid DNA (cpDNA) haplotypes. In contrast, Bayesian analysis of nuclear DNA (nDNA) uncovered two distinct clusters corresponding to L. decora and N. insignis. Based on the IMa analysis, no strong indication of migration was detected based on both cpDNA and nDNA sequences. The molecular data pointed to a major west-east split in nuclear DNA between the two species corresponding with the Tanaka Line. The coalescent time estimate for all cpDNA haplotypes dated to the Mid-Late Pleistocene. The estimated demographic parameters showed that the population size of L. decora was similar to that of N. insignis and both experienced limited demographic fluctuations recently. The study revealed comprehensive species divergence and phylogeographic histories of N. insignis and L. decora divided by the Tanaka Line. The phylogeographic pattern inferred from cpDNA reflected ancestrally shared polymorphisms without post-divergence gene flow between species. The marked genealogical lineage divergence in nDNA provided some indication of Tanaka Line for its role as a barrier to plant dispersal, and lent support to its importance in promoting strong population structure and allopatric divergence.

Mitochondrial and nuclear DNA reveals reticulate evolution in hares (Lepus spp., Lagomorpha, Mammalia) from Ethiopia

PubMed Central

Bekele, Endashaw; Tesfaye, Kassahun; Ben Slimen, Hichem; Valqui, Juan; Getahun, Abebe; Hartl, Günther B.; Suchentrunk, Franz

2017-01-01

For hares (Lepus spp., Leporidae, Lagomorpha, Mammalia) from Ethiopia no conclusive molecular phylogenetic data are available. To provide a first molecular phylogenetic model for the Abyssinian Hare (Lepus habessinicus), the Ethiopian Hare (L. fagani), and the Ethiopian Highland Hare (L. starcki) and their evolutionary relationships to hares from Africa, Eurasia, and North America, we phylogenetically analysed mitochondrial ATPase subunit 6 (ATP6; n = 153 / 416bp) and nuclear transferrin (TF; n = 155 / 434bp) sequences of phenotypically determined individuals. For the hares from Ethiopia, genotype composition at twelve microsatellite loci (n = 107) was used to explore both interspecific gene pool separation and levels of current hybridization, as has been observed in some other Lepus species. For phylogenetic analyses ATP6 and TF sequences of Lepus species from South and North Africa (L. capensis, L. saxatilis), the Anatolian peninsula and Europe (L. europaeus, L. timidus) were also produced and additional TF sequences of 18 Lepus species retrieved from GenBank were included as well. Median joining networks, neighbour joining, maximum likelihood analyses, as well as Bayesian inference resulted in similar models of evolution of the three species from Ethiopia for the ATP6 and TF sequences, respectively. The Ethiopian species are, however, not monophyletic, with signatures of contemporary uni- and bidirectional mitochondrial introgression and/ or shared ancestral polymorphism. Lepus habessinicus carries mtDNA distinct from South African L. capensis and North African L. capensis sensu lato; that finding is not in line with earlier suggestions of its conspecificity with L. capensis. Lepus starcki has mtDNA distinct from L. capensis and L. europaeus, which is not in line with earlier suggestions to include it either in L. capensis or L. europaeus. Lepus fagani shares mitochondrial haplotypes with the other two species from Ethiopia, despite its distinct phenotypic and microsatellite differences; moreover, it is not represented by a species-specific mitochondrial haplogroup, suggesting considerable mitochondrial capture by the other species from Ethiopia or species from other parts of Africa. Both mitochondrial and nuclear sequences indicate close phylogenetic relationships among all three Lepus species from Ethiopia, with L. fagani being surprisingly tightly connected to L. habessinicus. TF sequences suggest close evolutionary relationships between the three Ethiopian species and Cape hares from South and North Africa; they further suggest that hares from Ethiopia hold a position ancestral to many Eurasian and North American species. PMID:28767659

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

PubMed

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

PubMed Central

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

2011-01-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

Evidence implicating Thamnostylum lucknowense as an etiological agent of Rhino-orbital Mucormycosis

USDA-ARS?s Scientific Manuscript database

In this report, we present a case of rhino-orbital mucormycosis in a 57-year-old female with poorly controlled diabetes mellitus. The causal agent was cultured from a specimen of the nasal crust and identified phenotypically and independently using nuclear ribosomal DNA sequence data as Thamnostylum...

Multigene molecular phylogenetics reveals true morels (Morchella) are especially species-rich in China

USDA-ARS?s Scientific Manuscript database

The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...

Morphological, molecular and ecological aspects of the South American hypogeous fungi Alpova austroalnicola sp. nov.

Treesearch

Eduardo R. Nouhra; Laura S. Domínguez; Alejandra G. Becerra; James M. Trappe

2005-01-01

Field studies in Argentina's Yunga District revealed Alpova austroalnicola sp. nov., a hypogeous fungus associated with Alnus acuminata ssp, acuminata. Morphological and molecular studies based on amplification and sequencing of the nuclear LSU rDNA gene showed its unique identity within ...

Genetic differentiation of Ganaspis brasiliensis (Hymenoptera: Figitidae) from East and Southeast Asia

USDA-ARS?s Scientific Manuscript database

This study aims to clarify genetic differentiation of the Drosophila parasitoid Ganaspis brasiliensis (Hymenoptera; Figitidae; Eucoilinae) based on the nucleotide sequences of the cytochrome oxidase subunit 1 (CO1) and three nuclear DNA regions, the inter-transcribed spacers 1 and 2 (ITS1 and ITS2) ...

Molecular phylogeny of Laetiporus and other brown rot polypore genera in North America

Treesearch

Daniel L. Lindner; Mark T. Banik

2008-01-01

Phylogenetic relationships were investigated among North American species of Laetiporus, Leptoporus, Phaeolus, Pycnoporellus, and Wolfiporia using ITS, nuclear large subunit and mitochondrial small subunit rDNA sequences. Members of these genera have poroid hymenophores, simple septate hyphae and cause brown rots in a variety of...

A multigene molecular phylogenetic assessment of true morels (Morchella) in turkey

USDA-ARS?s Scientific Manuscript database

A collection of 247 true morels (Morchella spp.) primarily from the Mediterranean and Aegean Regions of Southern Turkey, were analyzed for species diversity using partial RNA polymerase I (RPB1) and nuclear ribosomal large subunit (LSU) rDNA gene sequences. Based on the result of this initial scree...

Chromosome Evolution in Connection with Repetitive Sequences and Epigenetics in Plants

PubMed Central

Li, Shu-Fen; Su, Ting; Cheng, Guang-Qian; Wang, Bing-Xiao; Li, Xu; Deng, Chuan-Liang; Gao, Wu-Jun

2017-01-01

Chromosome evolution is a fundamental aspect of evolutionary biology. The evolution of chromosome size, structure and shape, number, and the change in DNA composition suggest the high plasticity of nuclear genomes at the chromosomal level. Repetitive DNA sequences, which represent a conspicuous fraction of every eukaryotic genome, particularly in plants, are found to be tightly linked with plant chromosome evolution. Different classes of repetitive sequences have distinct distribution patterns on the chromosomes. Mounting evidence shows that repetitive sequences may play multiple generative roles in shaping the chromosome karyotypes in plants. Furthermore, recent development in our understanding of the repetitive sequences and plant chromosome evolution has elucidated the involvement of a spectrum of epigenetic modification. In this review, we focused on the recent evidence relating to the distribution pattern of repetitive sequences in plant chromosomes and highlighted their potential relevance to chromosome evolution in plants. We also discussed the possible connections between evolution and epigenetic alterations in chromosome structure and repatterning, such as heterochromatin formation, centromere function, and epigenetic-associated transposable element inactivation. PMID:29064432

A fourth Denisovan individual

PubMed Central

Slon, Viviane; Viola, Bence; Renaud, Gabriel; Gansauge, Marie-Theres; Benazzi, Stefano; Sawyer, Susanna; Hublin, Jean-Jacques; Shunkov, Michael V.; Derevianko, Anatoly P.; Kelso, Janet; Prüfer, Kay; Meyer, Matthias; Pääbo, Svante

2017-01-01

The presence of Neandertals in Europe and Western Eurasia before the arrival of anatomically modern humans is well supported by archaeological and paleontological data. In contrast, fossil evidence for Denisovans, a sister group of Neandertals recently identified on the basis of DNA sequences, is limited to three specimens, all of which originate from Denisova Cave in the Altai Mountains (Siberia, Russia). We report the retrieval of DNA from a deciduous lower second molar (Denisova 2), discovered in a deep stratigraphic layer in Denisova Cave, and show that this tooth comes from a female Denisovan individual. On the basis of the number of “missing substitutions” in the mitochondrial DNA determined from the specimen, we find that Denisova 2 is substantially older than two of the other Denisovans, reinforcing the view that Denisovans were likely to have been present in the vicinity of Denisova Cave over an extended time period. We show that the level of nuclear DNA sequence diversity found among Denisovans is within the lower range of that of present-day human populations. PMID:28695206

The vestigial olfactory receptor subgenome of odontocete whales: phylogenetic congruence between gene-tree reconciliation and supermatrix methods.

PubMed

McGowen, Michael R; Clark, Clay; Gatesy, John

2008-08-01

The macroevolutionary transition of whales (cetaceans) from a terrestrial quadruped to an obligate aquatic form involved major changes in sensory abilities. Compared to terrestrial mammals, the olfactory system of baleen whales is dramatically reduced, and in toothed whales is completely absent. We sampled the olfactory receptor (OR) subgenomes of eight cetacean species from four families. A multigene tree of 115 newly characterized OR sequences from these eight species and published data for Bos taurus revealed a diverse array of class II OR paralogues in Cetacea. Evolution of the OR gene superfamily in toothed whales (Odontoceti) featured a multitude of independent pseudogenization events, supporting anatomical evidence that odontocetes have lost their olfactory sense. We explored the phylogenetic utility of OR pseudogenes in Cetacea, concentrating on delphinids (oceanic dolphins), the product of a rapid evolutionary radiation that has been difficult to resolve in previous studies of mitochondrial DNA sequences. Phylogenetic analyses of OR pseudogenes using both gene-tree reconciliation and supermatrix methods yielded fully resolved, consistently supported relationships among members of four delphinid subfamilies. Alternative minimizations of gene duplications, gene duplications plus gene losses, deep coalescence events, and nucleotide substitutions plus indels returned highly congruent phylogenetic hypotheses. Novel DNA sequence data for six single-copy nuclear loci and three mitochondrial genes (> 5000 aligned nucleotides) provided an independent test of the OR trees. Nucleotide substitutions and indels in OR pseudogenes showed a very low degree of homoplasy in comparison to mitochondrial DNA and, on average, provided more variation than single-copy nuclear DNA. Our results suggest that phylogenetic analysis of the large OR superfamily will be effective for resolving relationships within Cetacea whether supermatrix or gene-tree reconciliation procedures are used.

Serine phosphorylation by SYK is critical for nuclear localization and transcription factor function of Ikaros

PubMed Central

Uckun, Fatih M.; Ma, Hong; Zhang, Jian; Ozer, Zahide; Dovat, Sinisa; Mao, Cheney; Ishkhanian, Rita; Goodman, Patricia; Qazi, Sanjive

2012-01-01

Ikaros is a zinc finger-containing DNA-binding protein that plays a pivotal role in immune homeostasis through transcriptional regulation of the earliest stages of lymphocyte ontogeny and differentiation. Functional deficiency of Ikaros has been implicated in the pathogenesis of acute lymphoblastic leukemia, the most common form of childhood cancer. Therefore, a stringent regulation of Ikaros activity is considered of paramount importance, but the operative molecular mechanisms responsible for its regulation remain largely unknown. Here we provide multifaceted genetic and biochemical evidence for a previously unknown function of spleen tyrosine kinase (SYK) as a partner and posttranslational regulator of Ikaros. We demonstrate that SYK phoshorylates Ikaros at unique C-terminal serine phosphorylation sites S358 and S361, thereby augmenting its nuclear localization and sequence-specific DNA binding activity. Mechanistically, we establish that SYK-induced Ikaros activation is essential for its nuclear localization and optimal transcription factor function. PMID:23071339

Molecular characterization of Fasciola spp. from the endemic area of northern Iran based on nuclear ribosomal DNA sequences.

PubMed

Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

2011-07-01

Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic differentiation of Fasciola spp., providing bases for further studies on F. hepatica, F. gigantica and their intermediate forms in the endemic areas in Asia. Copyright © 2011 Elsevier Inc. All rights reserved.

Genetic polymorphisms of Echinococcus tapeworms in China as determined by mitochondrial and nuclear DNA sequences ✩

PubMed Central

Nakao, Minoru; Li, Tiaoying; Han, Xiumin; Ma, Xiumin; Xiao, Ning; Qiu, Jiamin; Wang, Hu; Yanagida, Tetsuya; Mamuti, Wulamu; Wen, Hao; Moro, Pedro L.; Giraudoux, Patrick; Craig, Philip S.; Ito, Akira

2009-01-01

The genetic polymorphisms of Echinococcus spp. in the eastern Tibetan Plateau and the Xinjiang Uyghur Autonomous Region were evaluated by DNA sequencing analyses of genes for mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear elongation factor-1 alpha (ef1a). We collected 68 isolates of Echinococcus granulosus sensu stricto (s.s.) from Xinjiang and 113 isolates of E. granulosus s. s., 49 isolates of Echinococcus multilocularis and 34 isolates of Echinococcus shiquicus from the Tibetan Plateau. The results of molecular identification by mitochondrial and nuclear markers were identical, suggesting the infrequency of introgressive hybridization. A considerable intraspecific variation was detected in mitochondrial cox1 sequences. The parsimonious network of cox1 haplotypes showed star-like features in E. granulosus s. s. and E. multilocularis, but a divergent feature in E. shiquicus. The cox1 neutrality indexes computed by Tajima's D and Fu's Fs tests showed high negative values in E. granulosus s. s. and E. multilocularis, indicating significant deviations from neutrality. In contrast, the low positive values of both tests were obtained in E. shiquicus. These results suggest the following hypotheses: (i) recent founder effects arose in E. granulosus and E. multilocularis after introducing particular individuals into the endemic areas by anthropogenic movement or natural migration of host mammals, and (ii) the ancestor of E. shiquicus was segregated into the Tibetan Plateau by colonizing alpine mammals and its mitochondrial locus has evolved without bottleneck effects. PMID:19800346

From America to Eurasia: a multigenomes history of the genus Abies.

PubMed

Semerikova, Svetlana A; Khrunyk, Yuliya Y; Lascoux, Martin; Semerikov, Vladimir L

2018-03-15

The origin of conifer genera, the main components of mountain temperate and boreal forests, was deemed to arise in the Mesozoic, although paleontological records and molecular data point to a recent diversification, presumably related to Neogene cooling. The geographical area(s) where the modern lines of conifers emerged remains uncertain, as is the sequence of events leading to their present distribution. To gain further insights into the biogeography of firs (Abies), we conducted phylogenetic analyses of chloroplast, mitochondrial and nuclear markers. The species tree, generated from ten single-copy nuclear genes, yielded probably the best phylogenetic hypothesis available for Abies. The tree obtained from five regions of chloroplast DNA largely corresponded to the nuclear species tree. Ancestral area reconstructions based on fossil calibrated chloroplast DNA and nuclear DNA trees pointed to repeated intercontinental migrations. The mitochondrial DNA haplotype tree, however, disagreed with nuclear and chloroplast DNA trees. It consisted of two clusters: one included mainly American haplotypes, while the other was composed of only Eurasian haplotypes. Presumably, this conflict is due to inter-continental migrations and introgressive hybridization, accompanied by the capture of the mitotypes from aboriginal species by the invading firs. Given that several species inhabiting Northeastern Asia carry American mitotypes and mutations typical for the American cluster, whereas no Asian mitotypes were detected within the American species, we hypothesize that Abies migrated from America to Eurasia, but not in the opposite direction. The direction and age of intercontinental migrations in firs are congruent with other conifers, such as spruces and pines of subsection Strobus, suggesting that these events had the same cause. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular Analysis and Genomic Organization of Major DNA Satellites in Banana (Musa spp.)

PubMed Central

Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

2013-01-01

Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa. PMID:23372772

Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp.).

PubMed

Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

2013-01-01

Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

A test of the transcription model for biased inheritance of yeast mitochondrial DNA.

PubMed

Lorimer, H E; Brewer, B J; Fangman, W L

1995-09-01

Two strand-specific origins of replication appear to be required for mammalian mitochondrial DNA (mtDNA) replication. Structural equivalents of these origins are found in the rep sequences of Saccharomyces cerevisiae mtDNA. These striking similarities have contributed to a universal model for the initiation of mtDNA replication in which a primer is created by cleavage of an origin region transcript. Consistent with this model are the properties of deletion mutants of yeast mtDNA ([rho-]) with a high density of reps (HS [rho-]). These mutant mtDNAs are preferentially inherited by the progeny resulting from the mating of HS [rho-] cells with cells containing wild-type mtDNA ([rho+]). This bias is presumed to result from a replication advantage conferred on HS [rho-] mtDNA by the high density of rep sequences acting as origins. To test whether transcription is indeed required for the preferential inheritance of HS [rho-] mtDNA, we deleted the nuclear gene (RPO41) for the mitochondrial RNA polymerase, reducing transcripts by at least 1000-fold. Since [rho-] genomes, but not [rho+] genomes, are stable when RPO41 is deleted, we examined matings between HS [rho-] and neutral [rho-] cells. Neutral [rho-] mtDNAs lack rep sequences and are not preferentially inherited in [rho-] x [rho+] crosses. In HS [rho-] x neutral [rho-] matings, the HS [rho-] mtDNA was preferentially inherited whether both parents were wild type or both were deleted for RPO41. Thus, transcription from the rep promoter does not appear to be necessary for biased inheritance. Our results, and analysis of the literature, suggest that priming by transcription is not a universal mechanism for mtDNA replication initiation.

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Practical aspects of genetic identification of hallucinogenic and other poisonous mushrooms for clinical and forensic purposes

PubMed Central

Kowalczyk, Marek; Sekuła, Andrzej; Mleczko, Piotr; Olszowy, Zofia; Kujawa, Anna; Zubek, Szymon; Kupiec, Tomasz

2015-01-01

Aim To assess the usefulness of a DNA-based method for identifying mushroom species for application in forensic laboratory practice. Methods Two hundred twenty-one samples of clinical forensic material (dried mushrooms, food remains, stomach contents, feces, etc) were analyzed. ITS2 region of nuclear ribosomal DNA (nrDNA) was sequenced and the sequences were compared with reference sequences collected from the National Center for Biotechnology Information gene bank (GenBank). Sporological identification of mushrooms was also performed for 57 samples of clinical material. Results Of 221 samples, positive sequencing results were obtained for 152 (69%). The highest percentage of positive results was obtained for samples of dried mushrooms (96%) and food remains (91%). Comparison with GenBank sequences enabled identification of all samples at least at the genus level. Most samples (90%) were identified at the level of species or a group of closely related species. Sporological and molecular identification were consistent at the level of species or genus for 30% of analyzed samples. Conclusion Molecular analysis identified a larger number of species than sporological method. It proved to be suitable for analysis of evidential material (dried hallucinogenic mushrooms) in forensic genetic laboratories as well as to complement classical methods in the analysis of clinical material. PMID:25727040

The campaign to DNA barcode all fishes, FISH-BOL.

PubMed

Ward, R D; Hanner, R; Hebert, P D N

2009-02-01

FISH-BOL, the Fish Barcode of Life campaign, is an international research collaboration that is assembling a standardized reference DNA sequence library for all fishes. Analysis is targeting a 648 base pair region of the mitochondrial cytochrome c oxidase I (COI) gene. More than 5000 species have already been DNA barcoded, with an average of five specimens per species, typically vouchers with authoritative identifications. The barcode sequence from any fish, fillet, fin, egg or larva can be matched against these reference sequences using BOLD; the Barcode of Life Data System (http://www.barcodinglife.org). The benefits of barcoding fishes include facilitating species identification, highlighting cases of range expansion for known species, flagging previously overlooked species and enabling identifications where traditional methods cannot be applied. Results thus far indicate that barcodes separate c. 98 and 93% of already described marine and freshwater fish species, respectively. Several specimens with divergent barcode sequences have been confirmed by integrative taxonomic analysis as new species. Past concerns in relation to the use of fish barcoding for species discrimination are discussed. These include hybridization, recent radiations, regional differentiation in barcode sequences and nuclear copies of the barcode region. However, current results indicate these issues are of little concern for the great majority of specimens.

Practical aspects of genetic identification of hallucinogenic and other poisonous mushrooms for clinical and forensic purposes.

PubMed

Kowalczyk, Marek; Sekuła, Andrzej; Mleczko, Piotr; Olszowy, Zofia; Kujawa, Anna; Zubek, Szymon; Kupiec, Tomasz

2015-02-01

To assess the usefulness of a DNA-based method for identifying mushroom species for application in forensic laboratory practice. Two hundred twenty-one samples of clinical forensic material (dried mushrooms, food remains, stomach contents, feces, etc) were analyzed. ITS2 region of nuclear ribosomal DNA (nrDNA) was sequenced and the sequen-ces were compared with reference sequences collected from the National Center for Biotechnology Information gene bank (GenBank). Sporological identification of mushrooms was also performed for 57 samples of clinical material. Of 221 samples, positive sequencing results were obtained for 152 (69%). The highest percentage of positive results was obtained for samples of dried mushrooms (96%) and food remains (91%). Comparison with GenBank sequences enabled identification of all samples at least at the genus level. Most samples (90%) were identified at the level of species or a group of closely related species. Sporological and molecular identification were consistent at the level of species or genus for 30% of analyzed samples. Molecular analysis identified a larger number of species than sporological method. It proved to be suitable for analysis of evidential material (dried hallucinogenic mushrooms) in forensic genetic laboratories as well as to complement classical methods in the analysis of clinical material.

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

PubMed Central

Martin, William F.

2017-01-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

Cytophotometric and biochemical analyses of DNA in pentaploid and diploid Agave species.

PubMed

Cavallini, A; Natali, L; Cionini, G; Castorena-Sanchez, I

1996-04-01

Nuclear DNA content, chromatin structure, and DNA composition were investigated in four Agave species: two diploid, Agave tequilana Weber and Agave angustifolia Haworth var. marginata Hort., and two pentaploid, Agave fourcroydes Lemaire and Agave sisalana Perrine. It was determined that the genome size of pentaploid species is nearly 2.5 times that of diploid ones. Cytophotometric analyses of chromatin structure were performed following Feulgen or DAPI staining to determine optical density profiles of interphase nuclei. Pentaploid species showed higher frequencies of condensed chromatin (heterochromatin) than diploid species. On the other hand, a lower frequency of A-T rich (DAPI stained) heterochromatin was found in pentaploid species than in diploid ones, indicating that heterochromatin in pentaploid species is made up of sequences with base compositions different from those of diploid species. Since thermal denaturation profiles of extracted DNA showed minor variations in the base composition of the genomes of the four species, it is supposed that, in pentaploid species, the large heterochromatin content is not due to an overrepresentation of G-C repetitive sequences but rather to the condensation of nonrepetitive sequences, such as, for example, redundant gene copies switched off in the polyploid complement. It is suggested that speciation in the genus Agave occurs through point mutations and minor DNA rearrangements, as is also indicated by the relative stability of the karyotype of this genus. Key words : Agave, DNA cytophotometry, DNA melting profiles, chromatin structure, genome size.

Cospeciation of Psyllids and Their Primary Prokaryotic Endosymbionts

PubMed Central

Thao, MyLo L.; Moran, Nancy A.; Abbot, Patrick; Brennan, Eric B.; Burckhardt, Daniel H.; Baumann, Paul

2000-01-01

Psyllids are plant sap-feeding insects that harbor prokaryotic endosymbionts in specialized cells within the body cavity. Four-kilobase DNA fragments containing 16S and 23S ribosomal DNA (rDNA) were amplified from the primary (P) endosymbiont of 32 species of psyllids representing three psyllid families and eight subfamilies. In addition, 0.54-kb fragments of the psyllid nuclear gene wingless were also amplified from 26 species. Phylogenetic trees derived from 16S-23S rDNA and from the host wingless gene are very similar, and tests of compatibility of the data sets show no significant conflict between host and endosymbiont phylogenies. This result is consistent with a single infection of a shared psyllid ancestor and subsequent cospeciation of the host and the endosymbiont. In addition, the phylogenies based on DNA sequences generally agreed with psyllid taxonomy based on morphology. The 3′ end of the 16S rDNA of the P endosymbionts differs from that of other members of the domain Bacteria in the lack of a sequence complementary to the mRNA ribosome binding site. The rate of sequence change in the 16S-23S rDNA of the psyllid P endosymbiont was considerably higher than that of other bacteria, including other fast-evolving insect endosymbionts. The lineage consisting of the P endosymbionts of psyllids was given the designation Candidatus Carsonella (gen. nov.) with a single species, Candidatus Carsonella ruddii (sp. nov.). PMID:10877784

Phylogeny and taxonomy of the genus Gliocephalotrichum.

PubMed

Lombard, L; Serrato-Diaz, L M; Cheewangkoon, R; French-Monar, R D; Decock, C; Crous, P W

2014-06-01

Species in the genus Gliocephalotrichum (= Leuconectria) (Hypocreales, Nectriaceae) are soilborne fungi, associated with post-harvest fruit spoilage of several important tropical fruit crops. Contemporary taxonomic studies of these fungi have relied on morphology and DNA sequence comparisons of the internal transcribed spacer region of the nuclear rDNA (ITS) and the β-tubulin gene regions. Employing DNA sequence data from four loci (β-tubulin, histone H3, ITS, and translation elongation factor 1-alpha) and morphological comparisons, the taxonomic status of the genus Gliocephalotrichum was re-evaluated. As a result five species are newly described, namely G. humicola (Taiwan, soil), G. mexicanum (rambutan fruit from Mexico), G. nephelii (rambutan fruit from Guatemala), G. queenslandicum (Australia, endophytic isolations) and G. simmonsii (rambutan fruit from Guatemala). Although species of Gliocephalotrichum are generally not regarded as important plant pathogens, their ability to cause post-harvest fruit rot could have an impact on fruit export and storage.

[Polymorphic loci and polymorphism analysis of short tandem repeats within XNP gene].

PubMed

Liu, Qi-Ji; Gong, Yao-Qin; Guo, Chen-Hong; Chen, Bing-Xi; Li, Jiang-Xia; Guo, Yi-Shou

2002-01-01

To select polymorphic short tandem repeat markers within X-linked nuclear protein (XNP) gene, genomic clones which contain XNP gene were recognized by homologous analysis with XNP cDNA. By comparing the cDNA with genomic DNA, non-exonic sequences were identified, and short tandem repeats were selected from non-exonic sequences by using BCM search Launcher. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five short tandem repeats were identified from XNP gene, two of which were polymorphic. Four and 11 alleles were observed in Chinese population for XNPSTR1 and XNPSTR4, respectively. Heterozygosities were 47% for XNPSTR1 and 70% for XNPSTR4. XNPSTR1 and XNPSTR4 localized within 3' end and intron 10, respectively. Two polymorphic short tandem repeats have been identified within XNP gene and will be useful for linkage analysis and gene diagnosis of XNP gene.

Properties of a U1 RNA enhancer-like sequence.

PubMed Central

Ciliberto, G; Palla, F; Tebb, G; Mattaj, I W; Philipson, L

1987-01-01

The properties of a X.laevis U1B snRNA gene enhancer have been studied by microinjection in Xenopus oocytes. The enhancer-like sequence, defined as a short DNA stretch that is able to activate transcription in an orientation independent manner, is interchangeable between different U snRNA genes. The enhancer sequence alone does not, however, efficiently activate transcription from an SV40 pol II promoter but regains its activity when combined with the U-gene specific proximal sequence element. DNase I protection experiments show that the X.laevis U1B enhancer can interact specifically with a nuclear factor present in mammalian cells. Images PMID:3031597

Phylogeny of five species of Nusuttodinium gen. nov. (Dinophyceae), a genus of unarmoured kleptoplastidic dinoflagellates.

PubMed

Takano, Yoshihito; Yamaguchi, Haruyo; Inouye, Isao; Moestrup, Øjvind; Horiguchi, Takeo

2014-12-01

Cells of five unarmoured kleptoplastidic dinoflagellates, Amphidinium latum, Amphidinium poecilochroum, Gymnodinium amphidinioides, Gymnodinium acidotum and Gymnodinium aeruginosum were observed under light and/or scanning electron microscopy and subjected to single-cell PCR. The SSU rDNA and the partial LSU rDNA of all the examined species were sequenced, and the SSU rDNA of G. myriopyrenoides was sequenced. Phylogenetic analyses revealed that the unarmoured kleptoplastidic species formed a monophyletic clade within the Gymnodinium-clade sensu Daugbjerg et al. (2000). The sister taxa for this clade were Gymnodinium palustre and Spiniferodinium galeiforme, both of which possess brown-coloured chloroplasts. The results indicated that acquisition of kleptoplastidy in these unarmoured dinoflagellates was a single event and that these unarmoured kleptoplastidic dinoflagellates may have evolved from a form with permanent chloroplasts. Molecular trees suggested that the acquisition of kleptoplastidy took place in a marine habitat and later some species colonized the freshwater habitat. Because these unarmoured kleptoplastidic dinoflagellates are monophyletic and characterized by distinct morphological and cytological features (including the presence of the same type of apical groove, absence of nuclear chambers in the nuclear envelope, absence of genuine chloroplasts, and the possession of kleptochloroplasts), we propose the establishment of a new genus, Nusuttodinium, to accommodate all these dinoflagellates. Copyright © 2014 Elsevier GmbH. All rights reserved.

More reliable estimates of divergence times in Pan using complete mtDNA sequences and accounting for population structure.

PubMed

Stone, Anne C; Battistuzzi, Fabia U; Kubatko, Laura S; Perry, George H; Trudeau, Evan; Lin, Hsiuman; Kumar, Sudhir

2010-10-27

Here, we report the sequencing and analysis of eight complete mitochondrial genomes of chimpanzees (Pan troglodytes) from each of the three established subspecies (P. t. troglodytes, P. t. schweinfurthii and P. t. verus) and the proposed fourth subspecies (P. t. ellioti). Our population genetic analyses are consistent with neutral patterns of evolution that have been shaped by demography. The high levels of mtDNA diversity in western chimpanzees are unlike those seen at nuclear loci, which may reflect a demographic history of greater female to male effective population sizes possibly owing to the characteristics of the founding population. By using relaxed-clock methods, we have inferred a timetree of chimpanzee species and subspecies. The absolute divergence times vary based on the methods and calibration used, but relative divergence times show extensive uniformity. Overall, mtDNA produces consistently older times than those known from nuclear markers, a discrepancy that is reduced significantly by explicitly accounting for chimpanzee population structures in time estimation. Assuming the human-chimpanzee split to be between 7 and 5 Ma, chimpanzee time estimates are 2.1-1.5, 1.1-0.76 and 0.25-0.18 Ma for the chimpanzee/bonobo, western/(eastern + central) and eastern/central chimpanzee divergences, respectively.

Cell cycle dependent intracellular distribution of two spliced isoforms of TCP/ILF3 proteins.

PubMed

Xu, You Hai; Leonova, Tatyana; Grabowski, Gregory A

2003-12-01

TCP80 is an approximately 80kDa mammalian cytoplasmic protein that binds to a set of mRNAs and inhibits their translation in vitro and ex vivo. This protein has high sequence similarity to interleukin-2 enhancer-binding factors (NF90/ILF3) and the M-phase phosphoprotein (MPP4)/DRBP76. A 110kDa immunologic isoform of TCP80/NF90/MPP4/DRBP76, termed TCP110, also is present in cytoplasm and nuclei of many types of cells. A cDNA sequence coding for TCP110 was derived by 5(')RACE. The TCP110 sequence is identical to ILF3. The gene coding for TCP110/ILF3 mapped to human chromosome 19 and the gene organization was analyzed using TCP80 and TCP110/ILF3 cDNA sequences. The TCP/ILF3 gene spans >34.8kb and contains 21 exons. At least one alternatively spliced product involving exons 19-21 exists and predicts the formation of either TCP80 or TCP110/ILF3. However, the functional relationships of TCP80 and TCP110/ILF3 required elucidation. The metabolic turnover rates and subcellular distribution of TCP80 and TCP110/ILF3 during the cell cycle showed TCP80 to be relatively stable (t(1/2)=5 days) in the cytoplasmic compartment. In comparison, TCP110/ILF3 migrated between the cytoplasmic and nuclear compartments during the cell cycle. The TCP110 C-terminal segment contains an additional nuclear localizing signal that plays a role in its nuclear translocation. This study indicates that the multiple cellular functions, i.e., translation control, interleukin-2 enhancer binding, or cell division, of TCP/ILF3 are fulfilled by alternatively spliced isoforms.

Mitochondrial heteroplasmy and DNA barcoding in Hawaiian Hylaeus (Nesoprosopis) bees (Hymenoptera: Colletidae).

PubMed

Magnacca, Karl N; Brown, Mark J F

2010-06-11

The past several years have seen a flurry of papers seeking to clarify the utility and limits of DNA barcoding, particularly in areas such as species discovery and paralogy due to nuclear pseudogenes. Heteroplasmy, the coexistence of multiple mitochondrial haplotypes in a single organism, has been cited as a potentially serious problem for DNA barcoding but its effect on identification accuracy has not been tested. In addition, few studies of barcoding have tested a large group of closely-related species with a well-established morphological taxonomy. In this study we examine both of these issues, by densely sampling the Hawaiian Hylaeus bee radiation. Individuals from 21 of the 49 a priori morphologically-defined species exhibited coding sequence heteroplasmy at levels of 1-6% or more. All homoplasmic species were successfully identified by COI using standard methods of analysis, but only 71% of heteroplasmic species. The success rate in identifying heteroplasmic species was increased to 86% by treating polymorphisms as character states rather than ambiguities. Nuclear pseudogenes (numts) were also present in four species, and were distinguishable from heteroplasmic sequences by patterns of nucleotide and amino acid change. Heteroplasmy significantly decreased the reliability of species identification. In addition, the practical issue of dealing with large numbers of polymorphisms- and resulting increased time and labor required - makes the development of DNA barcode databases considerably more complex than has previously been suggested. The impact of heteroplasmy on the utility of DNA barcoding as a bulk specimen identification tool will depend upon its frequency across populations, which remains unknown. However, DNA barcoding is still likely to remain an important identification tool for those species that are difficult or impossible to identify through morphology, as is the case for the ecologically important solitary bee fauna.

Mitochondrial heteroplasmy and DNA barcoding in Hawaiian Hylaeus (Nesoprosopis) bees (Hymenoptera: Colletidae)

PubMed Central

2010-01-01

Background The past several years have seen a flurry of papers seeking to clarify the utility and limits of DNA barcoding, particularly in areas such as species discovery and paralogy due to nuclear pseudogenes. Heteroplasmy, the coexistence of multiple mitochondrial haplotypes in a single organism, has been cited as a potentially serious problem for DNA barcoding but its effect on identification accuracy has not been tested. In addition, few studies of barcoding have tested a large group of closely-related species with a well-established morphological taxonomy. In this study we examine both of these issues, by densely sampling the Hawaiian Hylaeus bee radiation. Results Individuals from 21 of the 49 a priori morphologically-defined species exhibited coding sequence heteroplasmy at levels of 1-6% or more. All homoplasmic species were successfully identified by COI using standard methods of analysis, but only 71% of heteroplasmic species. The success rate in identifying heteroplasmic species was increased to 86% by treating polymorphisms as character states rather than ambiguities. Nuclear pseudogenes (numts) were also present in four species, and were distinguishable from heteroplasmic sequences by patterns of nucleotide and amino acid change. Conclusions Heteroplasmy significantly decreased the reliability of species identification. In addition, the practical issue of dealing with large numbers of polymorphisms- and resulting increased time and labor required - makes the development of DNA barcode databases considerably more complex than has previously been suggested. The impact of heteroplasmy on the utility of DNA barcoding as a bulk specimen identification tool will depend upon its frequency across populations, which remains unknown. However, DNA barcoding is still likely to remain an important identification tool for those species that are difficult or impossible to identify through morphology, as is the case for the ecologically important solitary bee fauna. PMID:20540728

Missing genes, multiple ORFs, and C-to-U type RNA editing in Acrasis kona (Heterolobosea, Excavata) mitochondrial DNA.

PubMed

Fu, Cheng-Jie; Sheikh, Sanea; Miao, Wei; Andersson, Siv G E; Baldauf, Sandra L

2014-08-21

Discoba (Excavata) is an ancient group of eukaryotes with great morphological and ecological diversity. Unlike the other major divisions of Discoba (Jakobida and Euglenozoa), little is known about the mitochondrial DNAs (mtDNAs) of Heterolobosea. We have assembled a complete mtDNA genome from the aggregating heterolobosean amoeba, Acrasis kona, which consists of a single circular highly AT-rich (83.3%) molecule of 51.5 kb. Unexpectedly, A. kona mtDNA is missing roughly 40% of the protein-coding genes and nearly half of the transfer RNAs found in the only other sequenced heterolobosean mtDNAs, those of Naegleria spp. Instead, over a quarter of A. kona mtDNA consists of novel open reading frames. Eleven of the 16 protein-coding genes missing from A. kona mtDNA were identified in its nuclear DNA and polyA RNA, and phylogenetic analyses indicate that at least 10 of these 11 putative nuclear-encoded mitochondrial (NcMt) proteins arose by direct transfer from the mitochondrion. Acrasis kona mtDNA also employs C-to-U type RNA editing, and 12 homologs of DYW-type pentatricopeptide repeat (PPR) proteins implicated in plant organellar RNA editing are found in A. kona nuclear DNA. A mapping of mitochondrial gene content onto a consensus phylogeny reveals a sporadic pattern of relative stasis and rampant gene loss in Discoba. Rampant loss occurred independently in the unique common lineage leading to Heterolobosea + Tsukubamonadida and later in the unique lineage leading to Acrasis. Meanwhile, mtDNA gene content appears to be remarkably stable in the Acrasis sister lineage leading to Naegleria and in their distant relatives Jakobida. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

The virome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals the first report of DNA fragments corresponding to replicating non-retroviral RNA viruses in fungi.

PubMed

Turina, Massimo; Ghignone, Stefano; Astolfi, Nausicaa; Silvestri, Alessandro; Bonfante, Paola; Lanfranco, Luisa

2018-02-02

Arbuscular Mycorrhizal Fungi (AMF) are key components of the plant microbiota. AMF genetic complexity is increased by the presence of endobacteria, which live inside many species. A further component of such complexity is the virome associated to AMF, whose knowledge is still very limited. Here, by exploiting transcriptomic data we describe the virome of Gigaspora margarita. A BLAST search for viral RNA-dependent RNA polymerases sequences allowed the identification of four mitoviruses, one Ourmia-like narnavirus, one Giardia-like virus, and two sequences related to Fusarium graminearum mycoviruses. Northern blot and RT-PCR confirmed the authenticity of all the sequences with the exception of the F. graminearum-related ones. All the mitoviruses are replicative and functional since both positive strand and negative strand RNA are present. The abundance of the viral RNA molecules is not regulated by the presence or absence of Candidatus Glomeribacter gigasporarum, the endobacterium hosted by G. margarita, with the exception of the Ourmia-like sequence which is absent in bacteria-cured spores. In addition, we report, for the first time, DNA fragments corresponding to mitovirus sequences associated to the presence of viral RNA. These sequences are not integrated in the mitochondrial DNA and preliminary evidence seems to exclude integration in the nuclear genome. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

Molecular Genetic and Gene Therapy Studies of the Musculoskeletal System

DTIC Science & Technology

2009-09-01

C 1999 Sequence requirements for plasmid nuclear import. Exp Cell Res 253(2):713- 22 . 8). Young J L, Benoit J N, Dean D A 2003 Effect of a DNA nuclear...31. Culig Z (2004) Androgen receptor cross-talk with cell signaling pathways. Growth Factors 22 :179–184 382 X. Wang et al.: Effect of Leptin on Bone... Cell Biol. 2003:13:435-446 43. Watanabe N, Higashida C. Formins: processive cappers of growing actin filaments. Exp. Cell Res. 2004:301:16- 22 44

Mapping Flagellar Genes in Chlamydomonas Using Restriction Fragment Length Polymorphisms

PubMed Central

Ranum, LPW.; Thompson, M. D.; Schloss, J. A.; Lefebvre, P. A.; Silflow, C. D.

1988-01-01

To correlate cloned nuclear DNA sequences with previously characterized mutations in Chlamydomonas and, to gain insight into the organization of its nuclear genome, we have begun to map molecular markers using restriction fragment length polymorphisms (RFLPs). A Chlamydomonas reinhardtii strain (CC-29) containing phenotypic markers on nine of the 19 linkage groups was crossed to the interfertile species Chlamydomonas smithii. DNA from each member of 22 randomly selected tetrads was analyzed for the segregation of RFLPs associated with cloned genes detected by hybridization with radioactive DNA probes. The current set of markers allows the detection of linkage to new molecular markers over approximately 54% of the existing genetic map. This study focused on mapping cloned flagellar genes and genes whose transcripts accumulate after deflagellation. Twelve different molecular clones have been assigned to seven linkage groups. The α-1 tubulin gene maps to linkage group III and is linked to the genomic sequence homologous to pcf6-100, a cDNA clone whose corresponding transcript accumulates after deflagellation. The α-2 tubulin gene maps to linkage group IV. The two β-tubulin genes are linked, with the β-1 gene being approximately 12 cM more distal from the centromere than the β-2 gene. A clone corresponding to a 73-kD dynein protein maps to the opposite arm of the same linkage group. The gene corresponding to the cDNA clone pcf6-187, whose mRNA accumulates after deflagellation, maps very close to the tightly linked pf-26 and pf-1 mutations on linkage group V. PMID:2906025

A partial nuclear genome of the Jomons who lived 3000 years ago in Fukushima, Japan

PubMed Central

Kanzawa-Kiriyama, Hideaki; Kryukov, Kirill; Jinam, Timothy A; Hosomichi, Kazuyoshi; Saso, Aiko; Suwa, Gen; Ueda, Shintaroh; Yoneda, Minoru; Tajima, Atsushi; Shinoda, Ken-ichi; Inoue, Ituro; Saitou, Naruya

2017-01-01

The Jomon period of the Japanese Archipelago, characterized by cord-marked ‘jomon' potteries, has yielded abundant human skeletal remains. However, the genetic origins of the Jomon people and their relationships with modern populations have not been clarified. We determined a total of 115 million base pair nuclear genome sequences from two Jomon individuals (male and female each) from the Sanganji Shell Mound (dated 3000 years before present) with the Jomon-characteristic mitochondrial DNA haplogroup N9b, and compared these nuclear genome sequences with those of worldwide populations. We found that the Jomon population lineage is best considered to have diverged before diversification of present-day East Eurasian populations, with no evidence of gene flow events between the Jomon and other continental populations. This suggests that the Sanganji Jomon people descended from an early phase of population dispersals in East Asia. We also estimated that the modern mainland Japanese inherited <20% of Jomon peoples' genomes. Our findings, based on the first analysis of Jomon nuclear genome sequence data, firmly demonstrate that the modern mainland Japanese resulted from genetic admixture of the indigenous Jomon people and later migrants. PMID:27581845

Fungal Endophyte Diversity in Sarracenia

PubMed Central

Glenn, Anthony; Bodri, Michael S.

2012-01-01

Fungal endophytes were isolated from 4 species of the carnivorous pitcher plant genus Sarracenia: S. minor, S. oreophila, S. purpurea, and S. psittacina. Twelve taxa of fungi, 8 within the Ascomycota and 4 within the Basidiomycota, were identified based on PCR amplification and sequencing of the internal transcribed spacer sequences of nuclear ribosomal DNA (ITS rDNA) with taxonomic identity assigned using the NCBI nucleotide megablast search tool. Endophytes are known to produce a large number of metabolites, some of which may contribute to the protection and survival of the host. We speculate that endophyte-infected Sarracenia may benefit from their fungal associates by their influence on nutrient availability from within pitchers and, possibly, by directly influencing the biota within pitchers. PMID:22427921

Population structure of wild bananas, Musa balbisiana, in China determined by SSR fingerprinting and cpDNA PCR-RFLP.

PubMed

Ge, X J; Liu, M H; Wang, W K; Schaal, B A; Chiang, T Y

2005-04-01

Both demographic history and dispersal mechanisms influence the apportionment of genetic diversity among plant populations across geographical regions. In this study, phylogeography and population structure of wild banana, Musa balbisiana, one of the progenitors of cultivated bananas and plantains in China were investigated by an analysis of genetic diversity of simple sequence repeat (SSR) fingerprint markers and cpDNA PCR-RFLP. A chloroplast DNA (cpDNA) genealogy of 21 haplotypes identified two major clades, which correspond to two geographical regions separated by the Beijiang and Xijiang rivers, suggesting a history of vicariance. Significant genetic differentiation was detected among populations with cpDNA markers, a result consistent with limited seed dispersal in wild banana mediated by foraging of rodents. Nuclear SSR data also revealed significant geographical structuring in banana populations. In western China, however, there was no detected phylogeograpahical pattern, possibly due to frequent pollen flow via fruit bats. In contrast, populations east of the Beijiang River and the population of Hainan Island, where long-range soaring pollinators are absent, are genetically distinct. Colonization-extinction processes may have influenced the evolution of Musa populations, which have a metapopulation structure and are connected by migrating individuals. Effective gene flow via pollen, estimated from the nuclear SSR data, is 3.65 times greater than gene flow via seed, estimated from cpDNA data. Chloroplast and nuclear DNAs provide different insights into phylogeographical patterns of wild banana populations and, taken together, can inform conservation practices.

Tziminema unachi n. gen., n. sp. (Nematoda: Strongylidae: Strongylinae) parasite of Baird's tapir Tapirus bairdii from Mexico.

PubMed

Güiris-Andrade, D M; Oceguera-Figueroa, A; Osorio-Sarabia, D; Pérez-Escobar, M E; Nieto-López, M G; Rojas-Hernández, N M; García-Prieto, L

2017-11-20

A new genus and species of nematode, Tziminema unachi n. gen., n. sp. is described from the caecum and colon of Baird's tapir Tapirus bairdii (Gill, 1865), found dead in the Reserva de la Biósfera El Triunfo, Chiapas State, in the Neotropical realm of Mexico. Tziminema n. gen. differs from the other nine genera included in the Strongylinae by two main characteristics: having 7-9 posteriorly directed tooth-like structures at the anterior end of the buccal capsule, and the external surface of the buccal capsule being heavily striated. Phylogenetic analyses of the DNA sequences of the mitochondrial cytochrome c oxidase and nuclear DNA, including a partial sequence of the internal transcribed spacer 1, 5.8S and a partial sequence of the internal transcribed spacer 2 of the new taxon, confirmed its inclusion in Strongylinae and its rank as a new genus.

The yeast Pif1 helicase prevents genomic instability caused by G-quadruplex-forming CEB1 sequences in vivo.

PubMed

Ribeyre, Cyril; Lopes, Judith; Boulé, Jean-Baptiste; Piazza, Aurèle; Guédin, Aurore; Zakian, Virginia A; Mergny, Jean-Louis; Nicolas, Alain

2009-05-01

In budding yeast, the Pif1 DNA helicase is involved in the maintenance of both nuclear and mitochondrial genomes, but its role in these processes is still poorly understood. Here, we provide evidence for a new Pif1 function by demonstrating that its absence promotes genetic instability of alleles of the G-rich human minisatellite CEB1 inserted in the Saccharomyces cerevisiae genome, but not of other tandem repeats. Inactivation of other DNA helicases, including Sgs1, had no effect on CEB1 stability. In vitro, we show that CEB1 repeats formed stable G-quadruplex (G4) secondary structures and the Pif1 protein unwinds these structures more efficiently than regular B-DNA. Finally, synthetic CEB1 arrays in which we mutated the potential G4-forming sequences were no longer destabilized in pif1Delta cells. Hence, we conclude that CEB1 instability in pif1Delta cells depends on the potential to form G-quadruplex structures, suggesting that Pif1 could play a role in the metabolism of G4-forming sequences.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

The mitochondrial genome sequence of Enterobius vermicularis (Nematoda: Oxyurida)--an idiosyncratic gene order and phylogenetic information for chromadorean nematodes.

PubMed

Kang, Seokha; Sultana, Tahera; Eom, Keeseon S; Park, Yung Chul; Soonthornpong, Nathan; Nadler, Steven A; Park, Joong-Ki

2009-01-15

The complete mitochondrial genome sequence was determined for the human pinworm Enterobius vermicularis (Oxyurida: Nematoda) and used to infer its phylogenetic relationship to other major groups of chromadorean nematodes. The E. vermicularis genome is a 14,010-bp circular DNA molecule that encodes 36 genes (12 proteins, 22 tRNAs, and 2 rRNAs). This mtDNA genome lacks atp8, as reported for almost all other nematode species investigated. Phylogenetic analyses (maximum parsimony, maximum likelihood, neighbor joining, and Bayesian inference) of nucleotide sequences for the 12 protein-coding genes of 25 nematode species placed E. vermicularis, a representative of the order Oxyurida, as sister to the main Ascaridida+Rhabditida group. Tree topology comparisons using statistical tests rejected an alternative hypothesis favoring a closer relationship among Ascaridida, Spirurida, and Oxyurida, which has been supported from most studies based on nuclear ribosomal DNA sequences. Unlike the relatively conserved gene arrangement found for most chromadorean taxa, E. vermicularis mtDNA gene order is very unique, not sharing similarity to any other nematode species reported to date. This lack of gene order similarity may represent idiosyncratic gene rearrangements unique to this specific lineage of the oxyurids. To more fully understand the extent of gene rearrangement and its evolutionary significance within the nematode phylogenetic framework, additional mitochondrial genomes representing a greater evolutionary diversity of species must be characterized.

Use of DNA barcodes to identify flowering plants.

PubMed

Kress, W John; Wurdack, Kenneth J; Zimmer, Elizabeth A; Weigt, Lee A; Janzen, Daniel H

2005-06-07

Methods for identifying species by using short orthologous DNA sequences, known as "DNA barcodes," have been proposed and initiated to facilitate biodiversity studies, identify juveniles, associate sexes, and enhance forensic analyses. The cytochrome c oxidase 1 sequence, which has been found to be widely applicable in animal barcoding, is not appropriate for most species of plants because of a much slower rate of cytochrome c oxidase 1 gene evolution in higher plants than in animals. We therefore propose the nuclear internal transcribed spacer region and the plastid trnH-psbA intergenic spacer as potentially usable DNA regions for applying barcoding to flowering plants. The internal transcribed spacer is the most commonly sequenced locus used in plant phylogenetic investigations at the species level and shows high levels of interspecific divergence. The trnH-psbA spacer, although short ( approximately 450-bp), is the most variable plastid region in angiosperms and is easily amplified across a broad range of land plants. Comparison of the total plastid genomes of tobacco and deadly nightshade enhanced with trials on widely divergent angiosperm taxa, including closely related species in seven plant families and a group of species sampled from a local flora encompassing 50 plant families (for a total of 99 species, 80 genera, and 53 families), suggest that the sequences in this pair of loci have the potential to discriminate among the largest number of plant species for barcoding purposes.

Phylogeography, intraspecific structure and sex-biased dispersal of Dall's porpoise, Phocoenoides dalli, revealed by mitochondrial and microsatellite DNA analyses.

PubMed

Escorza-Treviño, S; Dizon, A E

2000-08-01

Mitochondrial DNA (mtDNA) control-region sequences and microsatellite loci length polymorphisms were used to estimate phylogeographical patterns (historical patterns underlying contemporary distribution), intraspecific population structure and gender-biased dispersal of Phocoenoides dalli dalli across its entire range. One-hundred and thirteen animals from several geographical strata were sequenced over 379 bp of mtDNA, resulting in 58 mtDNA haplotypes. Analysis using F(ST) values (based on haplotype frequencies) and phi(ST) values (based on frequencies and genetic distances between haplotypes) yielded statistically significant separation (bootstrap values P < 0.05) among most of the stocks currently used for management purposes. A minimum spanning network of haplotypes showed two very distinctive clusters, differentially occupied by western and eastern populations, with some common widespread haplotypes. This suggests some degree of phyletic radiation from west to east, superimposed on gene flow. Highly male-biased migration was detected for several population comparisons. Nuclear microsatellite DNA markers (119 individuals and six loci) provided additional support for population subdivision and gender-biased dispersal detected in the mtDNA sequences. Analysis using F(ST) values (based on allelic frequencies) yielded statistically significant separation between some, but not all, populations distinguished by mtDNA analysis. R(ST) values (based on frequencies of and genetic distance between alleles) showed no statistically significant subdivision. Again, highly male-biased dispersal was detected for all population comparisons, suggesting, together with morphological and reproductive data, the existence of sexual selection. Our molecular results argue for nine distinct dalli-type populations that should be treated as separate units for management purposes.

New insights into the origin and the genetic status of the Balkan donkey from Serbia.

PubMed

Stanisic, L J; Aleksic, J M; Dimitrijevic, V; Simeunovic, P; Glavinic, U; Stevanovic, J; Stanimirovic, Z

2017-10-01

The Balkan donkey (Equus asinus L.) is commonly regarded as a large-sized, unselected, unstructured and traditionally managed donkey breed. We assessed the current genetic status of the three largest E. asinus populations in the central Balkans (Serbia) by analysing the variability of nuclear microsatellites and the mitochondrial (mtDNA) control region of 77 and 49 individuals respectively. We further analysed our mtDNA dataset along with 209 published mtDNA sequences of ancient and modern individuals from 19 European and African populations to provide new insights into the origin and the history of the Balkan donkey. Serbian donkey populations are highly genetically diverse at both the nuclear and mtDNA levels despite severe population decline. Traditional Balkan donkeys in Serbia are rather heterogeneous; we found two groups of individuals with similar phenotypic features, somewhat distinct nuclear backgrounds and different proportions of mtDNA haplotypes belonging to matrilineal Clades 1 and 2. Another group, characterized by larger body size, different coat colour, distinct nuclear gene pool and predominantly Clade 2 haplotypes, was delineated as the Banat donkey breed. The maternal landscape of the large Balkan donkey population is highly heterogeneous and more complex than previously thought. Given the two independent domestication events in donkeys, multiple waves of introductions into the Balkans from Greece are hypothesized. Clade 2 donkeys probably appeared in Greece prior to those belonging to Clade 1, whereas expansion and diversification of Clade 1 donkeys within the Balkans predated that of Clade 2 donkeys. © 2017 Stichting International Foundation for Animal Genetics.

Ancestral Polymorphisms and Sex-Biased Migration Shaped the Demographic History of Brown Bears and Polar Bears

PubMed Central

Nakagome, Shigeki; Mano, Shuhei; Hasegawa, Masami

2013-01-01

Recent studies have reported discordant gene trees in the evolution of brown bears and polar bears. Genealogical histories are different among independent nuclear loci and between biparentally inherited autosomal DNA (aDNA) and matrilineal mitochondrial DNA (mtDNA). Based on multi-locus genomic sequences from aDNA and mtDNA, we inferred the population demography of brown and polar bears and found that brown bears have 6 times (aDNA) or more than 14 times (mtDNA) larger population sizes than polar bears and that polar bear lineage is derived from within brown bear diversity. In brown bears, the effective population size ratio of mtDNA to aDNA was at least 0.62, which deviated from the expected value of 0.25, suggesting matriarchal population due to female philopatry and male-biased migration. These results emphasize that ancestral polymorphisms and sex-biased migration may have contributed to conflicting branching patterns in brown and polar bears across aDNA genes and mtDNA. PMID:24236053

Ancestral polymorphisms and sex-biased migration shaped the demographic history of brown bears and polar bears.

PubMed

Nakagome, Shigeki; Mano, Shuhei; Hasegawa, Masami

2013-01-01

Recent studies have reported discordant gene trees in the evolution of brown bears and polar bears. Genealogical histories are different among independent nuclear loci and between biparentally inherited autosomal DNA (aDNA) and matrilineal mitochondrial DNA (mtDNA). Based on multi-locus genomic sequences from aDNA and mtDNA, we inferred the population demography of brown and polar bears and found that brown bears have 6 times (aDNA) or more than 14 times (mtDNA) larger population sizes than polar bears and that polar bear lineage is derived from within brown bear diversity. In brown bears, the effective population size ratio of mtDNA to aDNA was at least 0.62, which deviated from the expected value of 0.25, suggesting matriarchal population due to female philopatry and male-biased migration. These results emphasize that ancestral polymorphisms and sex-biased migration may have contributed to conflicting branching patterns in brown and polar bears across aDNA genes and mtDNA.

A mutation screening of oncogenes, tumor suppressor gene TP53 and nuclear encoded mitochondrial complex I genes in oncocytic thyroid tumors.

PubMed

Evangelisti, Cecilia; de Biase, Dario; Kurelac, Ivana; Ceccarelli, Claudio; Prokisch, Holger; Meitinger, Thomas; Caria, Paola; Vanni, Roberta; Romeo, Giovanni; Tallini, Giovanni; Gasparre, Giuseppe; Bonora, Elena

2015-03-21

Thyroid neoplasias with oncocytic features represent a specific phenotype in non-medullary thyroid cancer, reflecting the unique biological phenomenon of mitochondrial hyperplasia in the cytoplasm. Oncocytic thyroid cells are characterized by a prominent eosinophilia (or oxyphilia) caused by mitochondrial abundance. Although disruptive mutations in the mitochondrial DNA (mtDNA) are the most significant hallmark of such tumors, oncocytomas may be envisioned as heterogeneous neoplasms, characterized by multiple nuclear and mitochondrial gene lesions. We investigated the nuclear mutational profile of oncocytic tumors to pinpoint the mutations that may trigger the early oncogenic hit. Total DNA was extracted from paraffin-embedded tissues from 45 biopsies of oncocytic tumors. High-resolution melting was used for mutation screening of mitochondrial complex I subunits genes. Specific nuclear rearrangements were investigated by RT-PCR (RET/PTC) or on isolated nuclei by interphase FISH (PAX8/PPARγ). Recurrent point mutations were analyzed by direct sequencing. In our oncocytic tumor samples, we identified rare TP53 mutations. The series of analyzed cases did not include poorly- or undifferentiated thyroid carcinomas, and none of the TP53 mutated cases had significant mitotic activity or high-grade features. Thus, the presence of disruptive TP53 mutations was completely unexpected. In addition, novel mutations in nuclear-encoded complex I genes were identified. These findings suggest that nuclear genetic lesions altering the bioenergetics competence of thyroid cells may give rise to an aberrant mitochondria-centered compensatory mechanism and ultimately to the oncocytic phenotype.

Ulva and Enteromorpha (Ulvaceae, Chlorophyta) from two sides of the Yellow Sea: analysis of nuclear rDNA ITS and plastid rbcL sequence data

NASA Astrophysics Data System (ADS)

Wang, Jinfeng; Li, Nan; Jiang, Peng; Boo, Sung Min; Lee, Wook Jae; Cui, Yulin; Lin, Hanzhi; Zhao, Jin; Liu, Zhengyi; Qin, Song

2010-07-01

Ulvacean green seaweeds are common worldwide; they formed massive green tides in the Yellow Sea in recent years, which caused marine ecological problems as well as a social issue. We investigated two major genera of the Ulvaceae, Ulva and Enteromorpha, and collected the plastid rbcL and nuclear ITS sequences of specimens of the genera in two sides of the Yellow Sea and analyzed them. Phylogenetic trees of rbcL data show the occurrence of five species of Enteromorpha ( E. compressa, E. flexuosa, E. intestinalis, E. linza and E. prolifera) and three species of Ulva ( U. pertusa, U. rigida and U. ohnoi). However, we found U. ohnoi, which is known as a subtropical to tropical species, at two sites on Jeju Island, Korea. Four ribotypes in partial sequences of 5.8S rDNA and ITS2 from E. compressa were also found. Ribotype network analysis revealed that the common ribotype, occurring in China, Korea and Europe, is connected with ribotypes from Europe and China/Japan. Although samples of the same species were collected from both sides of the Yellow Sea, intraspecific genetic polymorphism of each species was low among samples collected worldwide.

DNA methylation patterns in tissues from mid-gestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming.

PubMed

Couldrey, Christine; Lee, Rita Sf

2010-03-07

Cloning of cattle by somatic cell nuclear transfer (SCNT) is associated with a high incidence of pregnancy failure characterized by abnormal placental and foetal development. These abnormalities are thought to be due, in part, to incomplete re-setting of the epigenetic state of DNA in the donor somatic cell nucleus to a state that is capable of driving embryonic and foetal development to completion. Here, we tested the hypothesis that DNA methylation patterns were not appropriately established during nuclear reprogramming following SCNT. A panel of imprinted, non-imprinted genes and satellite repeat sequences was examined in tissues collected from viable and failing mid-gestation SCNT foetuses and compared with similar tissues from gestation-matched normal foetuses generated by artificial insemination (AI). Most of the genomic regions examined in tissues from viable and failing SCNT foetuses had DNA methylation patterns similar to those in comparable tissues from AI controls. However, statistically significant differences were found between SCNT and AI at specific CpG sites in some regions of the genome, particularly those associated with SNRPN and KCNQ1OT1, which tended to be hypomethylated in SCNT tissues. There was a high degree of variation between individuals in methylation levels at almost every CpG site in these two regions, even in AI controls. In other genomic regions, methylation levels at specific CpG sites were tightly controlled with little variation between individuals. Only one site (HAND1) showed a tissue-specific pattern of DNA methylation. Overall, DNA methylation patterns in tissues of failing foetuses were similar to apparently viable SCNT foetuses, although there were individuals showing extreme deviant patterns. These results show that SCNT foetuses that had developed to mid-gestation had largely undergone nuclear reprogramming and that the epigenetic signature at this stage was not a good predictor of whether the foetus would develop to term or not.

DNA methylation patterns in tissues from mid-gestation bovine foetuses produced by somatic cell nuclear transfer show subtle abnormalities in nuclear reprogramming

PubMed Central

2010-01-01

Background Cloning of cattle by somatic cell nuclear transfer (SCNT) is associated with a high incidence of pregnancy failure characterized by abnormal placental and foetal development. These abnormalities are thought to be due, in part, to incomplete re-setting of the epigenetic state of DNA in the donor somatic cell nucleus to a state that is capable of driving embryonic and foetal development to completion. Here, we tested the hypothesis that DNA methylation patterns were not appropriately established during nuclear reprogramming following SCNT. A panel of imprinted, non-imprinted genes and satellite repeat sequences was examined in tissues collected from viable and failing mid-gestation SCNT foetuses and compared with similar tissues from gestation-matched normal foetuses generated by artificial insemination (AI). Results Most of the genomic regions examined in tissues from viable and failing SCNT foetuses had DNA methylation patterns similar to those in comparable tissues from AI controls. However, statistically significant differences were found between SCNT and AI at specific CpG sites in some regions of the genome, particularly those associated with SNRPN and KCNQ1OT1, which tended to be hypomethylated in SCNT tissues. There was a high degree of variation between individuals in methylation levels at almost every CpG site in these two regions, even in AI controls. In other genomic regions, methylation levels at specific CpG sites were tightly controlled with little variation between individuals. Only one site (HAND1) showed a tissue-specific pattern of DNA methylation. Overall, DNA methylation patterns in tissues of failing foetuses were similar to apparently viable SCNT foetuses, although there were individuals showing extreme deviant patterns. Conclusion These results show that SCNT foetuses that had developed to mid-gestation had largely undergone nuclear reprogramming and that the epigenetic signature at this stage was not a good predictor of whether the foetus would develop to term or not. PMID:20205951

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klucevsek, K.; Daley, J.; Darshan, M.S.

We have investigated the nuclear import strategies of high-risk HPV18 L2 minor capsid protein. HPV18 L2 interacts with Kap {alpha}{sub 2} adapter, and Kap {beta}{sub 2} and Kap {beta}{sub 3} nuclear import receptors. Moreover, binding of RanGTP to either Kap {beta}{sub 2} or Kap {beta}{sub 3} inhibits their interaction with L2, suggesting that these Kap {beta}/L2 complexes are import competent. Mapping studies show that HPV18 L2 contains two NLSs: in the N-terminus (nNLS) and in the C-terminus (cNLS), both of which can independently mediate nuclear import. Both nNLS and cNLS form a complex with Kap {alpha}{sub 2}{beta}{sub 1} heterodimer andmore » mediate nuclear import via a classical pathway. The nNLS is also essential for the interaction of HPV18 L2 with Kap {beta}{sub 2} and Kap {beta}{sub 3}. Interestingly, both nNLS and cNLS interact with the viral DNA and this DNA binding occurs without nucleotide sequence specificity. Together, the data suggest that HPV18 L2 can interact via its NLSs with several Kaps and the viral DNA and may enter the nucleus via multiple import pathways mediated by Kap {alpha}{sub 2}{beta}{sub 1} heterodimers, Kap {beta}{sub 2} and Kap {beta}{sub 3}.« less

Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences.

PubMed

Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

2017-01-26

The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.

Diagnosis of mitochondrial disorders by concomitant next-generation sequencing of the exome and mitochondrial genome

PubMed Central

Dinwiddie, Darrell L.; Smith, Laurie D.; Miller, Neil A.; Atherton, Andrea M.; Farrow, Emily G.; Strenk, Meghan E.; Soden, Sarah E.; Saunders, Carol J.; Kingsmore, Stephen F.

2015-01-01

Mitochondrial diseases are notoriously difficult to diagnose due to extreme locus and allelic heterogeneity, with both nuclear and mitochondrial genomes potentially liable. Using exome sequencing we demonstrate the ability to rapidly and cost effectively evaluate both the nuclear and mitochondrial genomes to obtain a molecular diagnosis for four patients with three distinct mitochondrial disorders. One patient was found to have Leigh syndrome due to a mutation in MT-ATP6, two affected siblings were discovered to be compound heterozygous for mutations in the NDUFV1 gene, which causes mitochondrial complex I deficiency, and one patient was found to have coenzyme Q10 deficiency due to compound heterozygous mutations in COQ2. In all cases conventional diagnostic testing failed to identify a molecular diagnosis. We suggest that additional studies should be conducted to evaluate exome sequencing as a primary diagnostic test for mitochondrial diseases, including those due to mtDNA mutations. PMID:23631824

Next generation sequencing analysis reveals a relationship between rDNA unit diversity and locus number in Nicotiana diploids

PubMed Central

2012-01-01

Background Tandemly arranged nuclear ribosomal DNA (rDNA), encoding 18S, 5.8S and 26S ribosomal RNA (rRNA), exhibit concerted evolution, a pattern thought to result from the homogenisation of rDNA arrays. However rDNA homogeneity at the single nucleotide polymorphism (SNP) level has not been detailed in organisms with more than a few hundred copies of the rDNA unit. Here we study rDNA complexity in species with arrays consisting of thousands of units. Methods We examined homogeneity of genic (18S) and non-coding internally transcribed spacer (ITS1) regions of rDNA using Roche 454 and/or Illumina platforms in four angiosperm species, Nicotiana sylvestris, N. tomentosiformis, N. otophora and N. kawakamii. We compared the data with Southern blot hybridisation revealing the structure of intergenic spacer (IGS) sequences and with the number and distribution of rDNA loci. Results and Conclusions In all four species the intragenomic homogeneity of the 18S gene was high; a single ribotype makes up over 90% of the genes. However greater variation was observed in the ITS1 region, particularly in species with two or more rDNA loci, where >55% of rDNA units were a single ribotype, with the second most abundant variant accounted for >18% of units. IGS heterogeneity was high in all species. The increased number of ribotypes in ITS1 compared with 18S sequences may reflect rounds of incomplete homogenisation with strong selection for functional genic regions and relaxed selection on ITS1 variants. The relationship between the number of ITS1 ribotypes and the number of rDNA loci leads us to propose that rDNA evolution and complexity is influenced by locus number and/or amplification of orphaned rDNA units at new chromosomal locations. PMID:23259460

Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features

NASA Astrophysics Data System (ADS)

Vernon, Matthew Martin

Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.

Development and validation of a D-loop mtDNA SNP assay for the screening of specimens in forensic casework.

PubMed

Chemale, Gustavo; Paneto, Greiciane Gaburro; Menezes, Meiga Aurea Mendes; de Freitas, Jorge Marcelo; Jacques, Guilherme Silveira; Cicarelli, Regina Maria Barretto; Fagundes, Paulo Roberto

2013-05-01

Mitochondrial DNA (mtDNA) analysis is usually a last resort in routine forensic DNA casework. However, it has become a powerful tool for the analysis of highly degraded samples or samples containing too little or no nuclear DNA, such as old bones and hair shafts. The gold standard methodology still constitutes the direct sequencing of polymerase chain reaction (PCR) products or cloned amplicons from the HVS-1 and HVS-2 (hypervariable segment) control region segments. Identifications using mtDNA are time consuming, expensive and can be very complex, depending on the amount and nature of the material being tested. The main goal of this work is to develop a less labour-intensive and less expensive screening method for mtDNA analysis, in order to aid in the exclusion of non-matching samples and as a presumptive test prior to final confirmatory DNA sequencing. We have selected 14 highly discriminatory single nucleotide polymorphisms (SNPs) based on simulations performed by Salas and Amigo (2010) to be typed using SNaPShot(TM) (Applied Biosystems, Foster City, CA, USA). The assay was validated by typing more than 100 HVS-1/HVS-2 sequenced samples. No differences were observed between the SNP typing and DNA sequencing when results were compared, with the exception of allelic dropouts observed in a few haplotypes. Haplotype diversity simulations were performed using 172 mtDNA sequences representative of the Brazilian population and a score of 0.9794 was obtained when the 14 SNPs were used, showing that the theoretical prediction approach for the selection of highly discriminatory SNPs suggested by Salas and Amigo (2010) was confirmed in the population studied. As the main goal of the work is to develop a screening assay to skip the sequencing of all samples in a particular case, a pair-wise comparison of the sequences was done using the selected SNPs. When both HVS-1/HVS-2 SNPs were used for simulations, at least two differences were observed in 93.2% of the comparisons performed. The assay was validated with casework samples. Results show that the method is straightforward and can be used for exclusionary purposes, saving time and laboratory resources. The assay confirms the theoretic prediction suggested by Salas and Amigo (2010). All forensic advantages, such as high sensitivity and power of discrimination, as also the disadvantages, such as the occurrence of allele dropouts, are discussed throughout the article. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

G-quadruplex-interacting compounds alter latent DNA replication and episomal persistence of KSHV

PubMed Central

Madireddy, Advaitha; Purushothaman, Pravinkumar; Loosbroock, Christopher P.; Robertson, Erle S.; Schildkraut, Carl L.; Verma, Subhash C.

2016-01-01

Kaposi's sarcoma associated herpesvirus (KSHV) establishes life-long latent infection by persisting as an extra-chromosomal episome in the infected cells and by maintaining its genome in dividing cells. KSHV achieves this by tethering its epigenome to the host chromosome by latency associated nuclear antigen (LANA), which binds in the terminal repeat (TR) region of the viral genome. Sequence analysis of the TR, a GC-rich DNA element, identified several potential Quadruplex G-Rich Sequences (QGRS). Since quadruplexes have the tendency to obstruct DNA replication, we used G-quadruplex stabilizing compounds to examine their effect on latent DNA replication and the persistence of viral episomes. Our results showed that these G-quadruplex stabilizing compounds led to the activation of dormant origins of DNA replication, with preferential bi-directional pausing of replications forks moving out of the TR region, implicating the role of the G-rich TR in the perturbation of episomal DNA replication. Over time, treatment with PhenDC3 showed a loss of viral episomes in the infected cells. Overall, these data show that G-quadruplex stabilizing compounds retard the progression of replication forks leading to a reduction in DNA replication and episomal maintenance. These results suggest a potential role for G-quadruplex stabilizers in the treatment of KSHV-associated diseases. PMID:26837574

Phylogenetic relationships of Cranichidinae and Prescottiinae (Orchidaceae, Cranichideae) inferred from plastid and nuclear DNA sequences

PubMed Central

Salazar, Gerardo A.; Cabrera, Lidia I.; Madriñán, Santiago; Chase, Mark W.

2009-01-01

Background and Aims Phylogenetic relationships of subtribes Cranichidinae and Prescottiinae, two diverse groups of neotropical terrestrial orchids, are not satisfactorily understood. A previous molecular phylogenetic study supported monophyly for Cranichidinae, but Prescottiinae consisted of two clades not sister to one another. However, that analysis included only 11 species and eight genera of these subtribes. Here, plastid and nuclear DNA sequences are analysed for an enlarged sample of genera and species of Cranichidinae and Prescottiinae with the aim of clarifying their relationships, evaluating the phylogenetic position of the monospecific genera Exalaria, Ocampoa and Pseudocranichis and examining the value of various structural traits as taxonomic markers. Methods Approx. 6000 bp of nucleotide sequences from nuclear ribosomal (ITS) and plastid DNA (rbcL, matK-trnK and trnL-trnF) were analysed with cladistic parsimony and Bayesian inference for 45 species/14 genera of Cranichidinae and Prescottiinae (plus suitable outgroups). The utility of flower orientation, thickenings of velamen cell walls, hamular viscidium and pseudolabellum to mark clades recovered by the molecular analysis was assessed by tracing these characters on the molecular trees. Key Results Spiranthinae, Cranichidinae, paraphyletic Prescottia (with Pseudocranichis embedded), and a group of mainly Andean ‘prescottioid’ genera (the ‘Stenoptera clade’) were strongly supported. Relationships among these clades were unresolved by parsimony but the Bayesian tree provided moderately strong support for the resolution (Spiranthinae–(Stenoptera clade-(Prescottia/Pseudocranichis–Cranichidinae))). Three of the four structural characters mark clades on the molecular trees, but the possession of a pseudolabellum is variable in the polyphyletic Ponthieva. Conclusions No evidence was found for monophyly of Prescottiinae and the reinstatement of Cranichidinae s.l. (including the genera of ‘Prescottiinae’) is favoured. Cranichidinae s.l. are diagnosed by non-resupinate flowers. Lack of support from parsimony for relationships among the major clades of core spiranthids is suggestive of a rapid morphological radiation or a slow rate of molecular evolution. PMID:19136493

MtDNA mutations are a common cause of severe disease phenotypes in children with Leigh syndrome.

PubMed

Naess, Karin; Freyer, Christoph; Bruhn, Helene; Wibom, Rolf; Malm, Gunilla; Nennesmo, Inger; von Döbeln, Ulrika; Larsson, Nils-Göran

2009-05-01

Leigh syndrome is a common clinical manifestation in children with mitochondrial disease and other types of inborn errors of metabolism. We characterised clinical symptoms, prognosis, respiratory chain function and performed extensive genetic analysis of 25 Swedish children suffering from Leigh syndrome with the aim to obtain insights into the molecular pathophysiology and to provide a rationale for genetic counselling. We reviewed the clinical history of all patients and used muscle biopsies in order to perform molecular, biochemical and genetic investigations, including sequencing the entire mitochondrial DNA (mtDNA), the mitochondrial DNA polymerase (POLGA) gene and the surfeit locus protein 1 (SURF1) gene. Respiratory chain enzyme activity measurements identified five patients with isolated complex I deficiency and five with combined enzyme deficiencies. No patient presented with isolated complex IV deficiency. Seven patients had a decreased ATP production rate. Extensive sequence analysis identified eight patients with pathogenic mtDNA mutations and one patient with mutations in POLGA. Mutations of mtDNA are a common cause of LS and mtDNA analysis should always be included in the diagnosis of LS patients, whereas SURF1 mutations are not a common cause of LS in Sweden. Unexpectedly, age of onset, clinical symptoms and prognosis did not reveal any clear differences in LS patients with mtDNA or nuclear DNA mutations.

Proteomic analysis of the nuclear matrix in the early stages of rat liver carcinogenesis: Identification of differentially expressed and MAR-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barboro, Paola; D'Arrigo, Cristina; Repaci, Erica

Tumor progression is characterized by definite changes in the protein composition of the nuclear matrix (NM). The interactions of chromatin with the NM occur via specific DNA sequences called MARs (matrix attachment regions). In the present study, we applied a proteomic approach along with a Southwestern assay to detect both differentially expressed and MAR-binding NM proteins, in persistent hepatocyte nodules (PHN) in respect with normal hepatocytes (NH). In PHN, the NM undergoes changes both in morphology and in protein composition. We detected over 500 protein spots in each two dimensional map and 44 spots were identified. Twenty-three proteins were differentiallymore » expressed; among these, 15 spots were under-expressed and 8 spots were over-expressed in PHN compared to NH. These changes were synchronous with several modifications in both NM morphology and the ability of NM proteins to bind nuclear RNA and/or DNA containing MARs sequences. In PHN, we observed a general decrease in the expression of the basic proteins that bound nuclear RNA and the over-expression of two species of Mw 135 kDa and 81 kDa and pI 6.7-7.0 and 6.2-7.4, respectively, which exclusively bind to MARs. These results suggest that the deregulated expression of these species might be related to large-scale chromatin reorganization observed in the process of carcinogenesis by modulating the interaction between MARs and the scaffold structure.« less

TOPICAL REVIEW: The physics of chromatin

NASA Astrophysics Data System (ADS)

Schiessel, Helmut

2003-05-01

Recent progress has been made in the understanding of the physical properties of chromatin - the dense complex of DNA and histone proteins that occupies the nuclei of plant and animal cells. Here I will focus on the two lowest levels of the hierarchy of DNA folding into the chromatin complex. (i) The nucleosome, the chromatin repeating unit consisting of a globular aggregate of eight histone proteins with the DNA wrapped around it: its overcharging, the DNA unwrapping transition, the 'sliding' of the octamer along the DNA. (ii) The 30 nm chromatin fibre, the necklace-like structure of nucleosomes connected via linker DNA: its geometry, its mechanical properties under stretching and its response to changing ionic conditions. I will stress that chromatin combines two seemingly contradictory features: (1) high compaction of DNA within the nuclear envelope and, at the same time, (2) accessibility to genes, promoter regions and gene regulatory sequences.

The protective function of noncoding DNA in genome defense of eukaryotic male germ cells.

PubMed

Qiu, Guo-Hua; Huang, Cuiqin; Zheng, Xintian; Yang, Xiaoyan

2018-04-01

Peripheral and abundant noncoding DNA has been hypothesized to protect the genome and the central protein-coding sequences against DNA damage in somatic genome. In the cytosol, invading exogenous nucleic acids may first be deactivated by small RNAs encoded by noncoding DNA via mechanisms similar to the prokaryotic CRISPR-Cas system. In the nucleus, the radicals generated by radiation in the cytosol, radiation energy and invading exogenous nucleic acids are absorbed, blocked and/or reduced by peripheral heterochromatin, and damaged DNA in heterochromatin is removed and excluded from the nucleus to the cytoplasm through nuclear pore complexes. To further strengthen the hypothesis, this review summarizes the experimental evidence supporting the protective function of noncoding DNA in the genome of male germ cells. Based on these data, this review provides evidence supporting the protective role of noncoding DNA in the genome defense of sperm genome through similar mechanisms to those of the somatic genome.

Molecular phylogenetics of the family Cyprinidae (Actinopterygii: Cypriniformes) as evidenced by sequence variation in the first intron of S7 ribosomal protein-coding gene: further evidence from a nuclear gene of the systematic chaos in the family.

PubMed

He, Shunping; Mayden, Richard L; Wang, Xuzheng; Wang, Wei; Tang, Kevin L; Chen, Wei-Jen; Chen, Yiyu

2008-03-01

The family Cyprinidae is the largest freshwater fish group in the world, including over 200 genera and 2100 species. The phylogenetic relationships of major clades within this family are simply poorly understood, largely because of the overwhelming diversity of the group; however, several investigators have advanced different hypotheses of relationships that pre- and post-date the use of shared-derived characters as advocated through phylogenetic systematics. As expected, most previous investigations used morphological characters. Recently, mitochondrial DNA (mtDNA) sequences and combined morphological and mtDNA investigations have been used to explore and advance our understanding of species relationships and test monophyletic groupings. Limitations of these studies include limited taxon sampling and a strict reliance upon maternally inherited mtDNA variation. The present study is the first endeavor to recover the phylogenetic relationships of the 12 previously recognized monophyletic subfamilies within the Cyprinidae using newly sequenced nuclear DNA (nDNA) for over 50 species representing members of the different previously hypothesized subfamily and family groupings within the Cyprinidae and from other cypriniform families as outgroup taxa. Hypothesized phylogenetic relationships are constructed using maximum parsimony and Basyesian analyses of 1042 sites, of which 971 sites were variable and 790 were phylogenetically informative. Using other appropriate cypriniform taxa of the families Catostomidae (Myxocyprinus asiaticus), Gyrinocheilidae (Gyrinocheilus aymonieri), and Balitoridae (Nemacheilus sp. and Beaufortia kweichowensis) as outgroups, the Cyprinidae is resolved as a monophyletic group. Within the family the genera Raiamas, Barilius, Danio, and Rasbora, representing many of the tropical cyprinids, represent basal members of the family. All other species can be classified into variably supported and resolved monophyletic lineages, depending upon analysis, that are consistent with or correspond to Barbini and Leuciscini. The Barbini includes taxa traditionally aligned with the subfamily Cyprininae sensu previous morphological revisionary studies by Howes (Barbinae, Labeoninae, Cyprininae and Schizothoracinae). The Leuciscini includes six other subfamilies that are mainly divided into three separate lineages. The relationships among genera and subfamilies are discussed as well as the possible origins of major lineages.

Molecular and Cytogenetic Characterization of Wild Musa Species

PubMed Central

Čížková, Jana; Hřibová, Eva; Christelová, Pavla; Van den Houwe, Ines; Häkkinen, Markku; Roux, Nicolas; Swennen, Rony; Doležel, Jaroslav

2015-01-01

The production of bananas is threatened by rapid spreading of various diseases and adverse environmental conditions. The preservation and characterization of banana diversity is essential for the purposes of crop improvement. The world's largest banana germplasm collection maintained at the Bioversity International Transit Centre (ITC) in Belgium is continuously expanded by new accessions of edible cultivars and wild species. Detailed morphological and molecular characterization of the accessions is necessary for efficient management of the collection and utilization of banana diversity. In this work, nuclear DNA content and genomic distribution of 45S and 5S rDNA were examined in 21 diploid accessions recently added to ITC collection, representing both sections of the genus Musa. 2C DNA content in the section Musa ranged from 1.217 to 1.315 pg. Species belonging to section Callimusa had 2C DNA contents ranging from 1.390 to 1.772 pg. While the number of 45S rDNA loci was conserved in the section Musa, it was highly variable in Callimusa species. 5S rRNA gene clusters were found on two to eight chromosomes per diploid cell. The accessions were genotyped using a set of 19 microsatellite markers to establish their relationships with the remaining accessions held at ITC. Genetic diversity done by SSR genotyping platform was extended by phylogenetic analysis of ITS region. ITS sequence data supported the clustering obtained by SSR analysis for most of the accessions. High level of nucleotide diversity and presence of more than two types of ITS sequences in eight wild diploids pointed to their origin by hybridization of different genotypes. This study significantly expands the number of wild Musa species where nuclear genome size and genomic distribution of rDNA loci is known. SSR genotyping identified Musa species that are closely related to the previously characterized accessions and provided data to aid in their classification. Sequence analysis of ITS region provided further information about evolutionary relationships between individual accessions and suggested that some of analyzed accessions were interspecific hybrids and/or backcross progeny. PMID:26252482

Structural and calorimetric studies demonstrate that the hepatocyte nuclear factor 1β (HNF1β) transcription factor is imported into the nucleus via a monopartite NLS sequence.

PubMed

Wiedmann, Mareike M; Aibara, Shintaro; Spring, David R; Stewart, Murray; Brenton, James D

2016-09-01

The transcription factor hepatocyte nuclear factor 1β (HNF1β) is ubiquitously overexpressed in ovarian clear cell carcinoma (CCC) and is a potential therapeutic target. To explore potential approaches that block HNF1β transcription we have identified and characterised extensively the nuclear localisation signal (NLS) for HNF1β and its interactions with the nuclear protein import receptor, Importin-α. Pull-down assays demonstrated that the DNA binding domain of HNF1β interacted with a spectrum of Importin-α isoforms and deletion constructs tagged with eGFP confirmed that the HNF1β (229)KKMRRNR(235) sequence was essential for nuclear localisation. We further characterised the interaction between the NLS and Importin-α using complementary biophysical techniques and have determined the 2.4Å resolution crystal structure of the HNF1β NLS peptide bound to Importin-α. The functional, biochemical, and structural characterisation of the nuclear localisation signal present on HNF1β and its interaction with the nuclear import protein Importin-α provide the basis for the development of compounds targeting transcription factor HNF1β via its nuclear import pathway. Copyright © 2016. Published by Elsevier Inc.

Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage.

PubMed

Hailer, Frank; Kutschera, Verena E; Hallström, Björn M; Klassert, Denise; Fain, Steven R; Leonard, Jennifer A; Arnason, Ulfur; Janke, Axel

2012-04-20

Recent studies have shown that the polar bear matriline (mitochondrial DNA) evolved from a brown bear lineage since the late Pleistocene, potentially indicating rapid speciation and adaption to arctic conditions. Here, we present a high-resolution data set from multiple independent loci across the nuclear genomes of a broad sample of polar, brown, and black bears. Bayesian coalescent analyses place polar bears outside the brown bear clade and date the divergence much earlier, in the middle Pleistocene, about 600 (338 to 934) thousand years ago. This provides more time for polar bear evolution and confirms previous suggestions that polar bears carry introgressed brown bear mitochondrial DNA due to past hybridization. Our results highlight that multilocus genomic analyses are crucial for an accurate understanding of evolutionary history.

Mitochondrial and nuclear phylogenetic analysis with Sanger and next-generation sequencing shows that, in Área de Conservación Guanacaste, northwestern Costa Rica, the skipper butterfly named Urbanus belli (family Hesperiidae) comprises three morphologically cryptic species

PubMed Central

2014-01-01

Background Skipper butterflies (Hesperiidae) are a relatively well-studied family of Lepidoptera. However, a combination of DNA barcodes, morphology, and natural history data has revealed several cryptic species complexes within them. Here, we investigate three DNA barcode lineages of what has been identified as Urbanus belli (Hesperiidae, Eudaminae) in Área de Conservación Guanacaste (ACG), northwestern Costa Rica. Results Although no morphological traits appear to distinguish among the three, congruent nuclear and mitochondrial lineage patterns show that “Urbanus belli” in ACG is a complex of three sympatric species. A single strain of Wolbachia present in two of the three cryptic species indicates that Urbanus segnestami Burns (formerly Urbanus belliDHJ01), Urbanus bernikerni Burns (formerly Urbanus belliDHJ02), and Urbanus ehakernae Burns (formerly Urbanus belliDHJ03) may be biologically separated by Wolbachia, as well as by their genetics. Use of parallel sequencing through 454-pyrosequencing improved the utility of ITS2 as a phylogenetic marker and permitted examination of the intra- and interlineage relationships of ITS2 variants within the species complex. Interlineage, intralineage and intragenomic compensatory base pair changes were discovered in the secondary structure of ITS2. Conclusion These findings corroborate the existence of three cryptic species. Our confirmation of a novel cryptic species complex, initially suggested by DNA barcode lineages, argues for using a multi-marker approach coupled with next-generation sequencing for exploration of other suspected species complexes. PMID:25005355

Methylation Pattern of Radish (Raphanus sativus) Nuclear Ribosomal RNA Genes 1

PubMed Central

Delseny, Michel; Laroche, Monique; Penon, Paul

1984-01-01

The methylation pattern of radish Raphanus sativus nuclear rDNA has been investigated using the Hpa II, Msp I, and Hha I restriction enzymes. The presence of numerous target sites for these enzymes has been shown using cloned rDNA fragments. A large fraction of the numerous rDNA units are heavily methylated, being completely resistant to Hpa II and Hpa I. However, specific sites are constantly available in another fraction of the units and are therefore unmethylated. The use of different probes allowed us to demonstrate that hypomethylated sites are present in different regions. Major hypomethylated Hha I sites have been mapped in the 5′ portion of 25S rRNA coding sequence. Among the hypomethylated fraction, different methylation patterns coexist. It has been possible to demonstrate that methylation patterns are specific for particular units. The Hha I pattern of rDNA in tissues of different developmental stages was analyzed. Evidence for possible tissue specific differences in the methylation pattern is reported. Images Fig. 2 Fig. 3 Fig. 5 PMID:16663896

Nuclear and mitochondrial patterns of population structure in North Pacific false killer whales (Pseudorca crassidens).

PubMed

Martien, Karen K; Chivers, Susan J; Baird, Robin W; Archer, Frederick I; Gorgone, Antoinette M; Hancock-Hanser, Brittany L; Mattila, David; McSweeney, Daniel J; Oleson, Erin M; Palmer, Carol; Pease, Victoria L; Robertson, Kelly M; Schorr, Gregory S; Schultz, Mark B; Webster, Daniel L; Taylor, Barbara L

2014-01-01

False killer whales (Pseudorca crassidens) are large delphinids typically found in deep water far offshore. However, in the Hawaiian Archipelago, there are 2 resident island-associated populations of false killer whales, one in the waters around the main Hawaiian Islands (MHI) and one in the waters around the Northwestern Hawaiian Islands (NWHI). We use mitochondrial DNA (mtDNA) control region sequences and genotypes from 16 nuclear DNA (nucDNA) microsatellite loci from 206 individuals to examine levels of differentiation among the 2 island-associated populations and offshore animals from the central and eastern North Pacific. Both mtDNA and nucDNA exhibit highly significant differentiation between populations, confirming limited gene flow in both sexes. The mtDNA haplotypes exhibit a strong pattern of phylogeographic concordance, with island-associated populations sharing 3 closely related haplotypes not found elsewhere in the Pacific. However, nucDNA data suggest that NWHI animals are at least as differentiated from MHI animals as they are from offshore animals. The patterns of differentiation revealed by the 2 marker types suggest that the island-associated false killer whale populations likely share a common colonization history, but have limited contemporary gene flow. Published by Oxford University Press on behalf of the American Genetic Association 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

DNA Fingerprinting of Pearls to Determine Their Origins

PubMed Central

Meyer, Joana B.; Cartier, Laurent E.; Pinto-Figueroa, Eric A.; Krzemnicki, Michael S.; Hänni, Henry A.; McDonald, Bruce A.

2013-01-01

We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay in the internal transcribed spacer (ITS) region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry. PMID:24130725

DNA fingerprinting of pearls to determine their origins.

PubMed

Meyer, Joana B; Cartier, Laurent E; Pinto-Figueroa, Eric A; Krzemnicki, Michael S; Hänni, Henry A; McDonald, Bruce A

2013-01-01

We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay in the internal transcribed spacer (ITS) region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

Sox2 regulatory region 2 sequence works as a DNA nuclear targeting sequence enhancing the efficiency of an exogenous gene expression in ES cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako

2010-10-01

Research highlights: {yields} SV40-DTS worked as a DTS in ES cells as well as other types of cells. {yields} Sox2 regulatory region 2 worked as a DTS in ES cells and thus was termed as SRR2-DTS. {yields} SRR2-DTS was suggested as an ES cell-specific DTS. -- Abstract: In this report, the effects of two DNA nuclear targeting sequence (DTS) candidates on the gene expression efficiency in ES cells were investigated. Reporter plasmids containing the simian virus 40 (SV40) promoter/enhancer sequence (SV40-DTS), a DTS for various types of cells but not being reported yet for ES cells, and the 81 basemore » pairs of Sox2 regulatory region 2 (SRR2) where two transcriptional factors in ES cells, Oct3/4 and Sox2, are bound (SRR2-DTS), were introduced into cytoplasm in living cells by femtoinjection. The gene expression efficiencies of each plasmid in mouse insulinoma cell line MIN6 cells and mouse ES cells were then evaluated. Plasmids including SV40-DTS and SRR2-DTS exhibited higher gene expression efficiency comparing to plasmids without these DTSs, and thus it was concluded that both sequences work as a DTS in ES cells. In addition, it was suggested that SRR2-DTS works as an ES cell-specific DTS. To the best of our knowledge, this is the first report to confirm the function of DTSs in ES cells.« less

Internet-accessible DNA sequence database for identifying fusaria from human and animal infections.

PubMed

O'Donnell, Kerry; Sutton, Deanna A; Rinaldi, Michael G; Sarver, Brice A J; Balajee, S Arunmozhi; Schroers, Hans-Josef; Summerbell, Richard C; Robert, Vincent A R G; Crous, Pedro W; Zhang, Ning; Aoki, Takayuki; Jung, Kyongyong; Park, Jongsun; Lee, Yong-Hwan; Kang, Seogchan; Park, Bongsoo; Geiser, David M

2010-10-01

Because less than one-third of clinically relevant fusaria can be accurately identified to species level using phenotypic data (i.e., morphological species recognition), we constructed a three-locus DNA sequence database to facilitate molecular identification of the 69 Fusarium species associated with human or animal mycoses encountered in clinical microbiology laboratories. The database comprises partial sequences from three nuclear genes: translation elongation factor 1α (EF-1α), the largest subunit of RNA polymerase (RPB1), and the second largest subunit of RNA polymerase (RPB2). These three gene fragments can be amplified by PCR and sequenced using primers that are conserved across the phylogenetic breadth of Fusarium. Phylogenetic analyses of the combined data set reveal that, with the exception of two monotypic lineages, all clinically relevant fusaria are nested in one of eight variously sized and strongly supported species complexes. The monophyletic lineages have been named informally to facilitate communication of an isolate's clade membership and genetic diversity. To identify isolates to the species included within the database, partial DNA sequence data from one or more of the three genes can be used as a BLAST query against the database which is Web accessible at FUSARIUM-ID (http://isolate.fusariumdb.org) and the Centraalbureau voor Schimmelcultures (CBS-KNAW) Fungal Biodiversity Center (http://www.cbs.knaw.nl/fusarium). Alternatively, isolates can be identified via phylogenetic analysis by adding sequences of unknowns to the DNA sequence alignment, which can be downloaded from the two aforementioned websites. The utility of this database should increase significantly as members of the clinical microbiology community deposit in internationally accessible culture collections (e.g., CBS-KNAW or the Fusarium Research Center) cultures of novel mycosis-associated fusaria, along with associated, corrected sequence chromatograms and data, so that the sequence results can be verified and isolates are made available for future study.

DNA Barcoding in the Cycadales: Testing the Potential of Proposed Barcoding Markers for Species Identification of Cycads

PubMed Central

Sass, Chodon; Little, Damon P.; Stevenson, Dennis Wm.; Specht, Chelsea D.

2007-01-01

Barcodes are short segments of DNA that can be used to uniquely identify an unknown specimen to species, particularly when diagnostic morphological features are absent. These sequences could offer a new forensic tool in plant and animal conservation—especially for endangered species such as members of the Cycadales. Ideally, barcodes could be used to positively identify illegally obtained material even in cases where diagnostic features have been purposefully removed or to release confiscated organisms into the proper breeding population. In order to be useful, a DNA barcode sequence must not only easily PCR amplify with universal or near-universal reaction conditions and primers, but also contain enough variation to generate unique identifiers at either the species or population levels. Chloroplast regions suggested by the Plant Working Group of the Consortium for the Barcode of Life (CBoL), and two alternatives, the chloroplast psbA-trnH intergenic spacer and the nuclear ribosomal internal transcribed spacer (nrITS), were tested for their utility in generating unique identifiers for members of the Cycadales. Ease of amplification and sequence generation with universal primers and reaction conditions was determined for each of the seven proposed markers. While none of the proposed markers provided unique identifiers for all species tested, nrITS showed the most promise in terms of variability, although sequencing difficulties remain a drawback. We suggest a workflow for DNA barcoding, including database generation and management, which will ultimately be necessary if we are to succeed in establishing a universal DNA barcode for plants. PMID:17987130

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

PubMed

Hazkani-Covo, Einat; Martin, William F

2017-05-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells.

PubMed

Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

2018-01-01

Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. © 2018 Han et al.; Published by Cold Spring Harbor Laboratory Press.

SIDR: simultaneous isolation and parallel sequencing of genomic DNA and total RNA from single cells

PubMed Central

Han, Kyung Yeon; Kim, Kyu-Tae; Joung, Je-Gun; Son, Dae-Soon; Kim, Yeon Jeong; Jo, Areum; Jeon, Hyo-Jeong; Moon, Hui-Sung; Yoo, Chang Eun; Chung, Woosung; Eum, Hye Hyeon; Kim, Sangmin; Kim, Hong Kwan; Lee, Jeong Eon; Ahn, Myung-Ju; Lee, Hae-Ock; Park, Donghyun; Park, Woong-Yang

2018-01-01

Simultaneous sequencing of the genome and transcriptome at the single-cell level is a powerful tool for characterizing genomic and transcriptomic variation and revealing correlative relationships. However, it remains technically challenging to analyze both the genome and transcriptome in the same cell. Here, we report a novel method for simultaneous isolation of genomic DNA and total RNA (SIDR) from single cells, achieving high recovery rates with minimal cross-contamination, as is crucial for accurate description and integration of the single-cell genome and transcriptome. For reliable and efficient separation of genomic DNA and total RNA from single cells, the method uses hypotonic lysis to preserve nuclear lamina integrity and subsequently captures the cell lysate using antibody-conjugated magnetic microbeads. Evaluating the performance of this method using real-time PCR demonstrated that it efficiently recovered genomic DNA and total RNA. Thorough data quality assessments showed that DNA and RNA simultaneously fractionated by the SIDR method were suitable for genome and transcriptome sequencing analysis at the single-cell level. The integration of single-cell genome and transcriptome sequencing by SIDR (SIDR-seq) showed that genetic alterations, such as copy-number and single-nucleotide variations, were more accurately captured by single-cell SIDR-seq compared with conventional single-cell RNA-seq, although copy-number variations positively correlated with the corresponding gene expression levels. These results suggest that SIDR-seq is potentially a powerful tool to reveal genetic heterogeneity and phenotypic information inferred from gene expression patterns at the single-cell level. PMID:29208629

Supervised DNA Barcodes species classification: analysis, comparisons and results

PubMed Central

2014-01-01

Background Specific fragments, coming from short portions of DNA (e.g., mitochondrial, nuclear, and plastid sequences), have been defined as DNA Barcode and can be used as markers for organisms of the main life kingdoms. Species classification with DNA Barcode sequences has been proven effective on different organisms. Indeed, specific gene regions have been identified as Barcode: COI in animals, rbcL and matK in plants, and ITS in fungi. The classification problem assigns an unknown specimen to a known species by analyzing its Barcode. This task has to be supported with reliable methods and algorithms. Methods In this work the efficacy of supervised machine learning methods to classify species with DNA Barcode sequences is shown. The Weka software suite, which includes a collection of supervised classification methods, is adopted to address the task of DNA Barcode analysis. Classifier families are tested on synthetic and empirical datasets belonging to the animal, fungus, and plant kingdoms. In particular, the function-based method Support Vector Machines (SVM), the rule-based RIPPER, the decision tree C4.5, and the Naïve Bayes method are considered. Additionally, the classification results are compared with respect to ad-hoc and well-established DNA Barcode classification methods. Results A software that converts the DNA Barcode FASTA sequences to the Weka format is released, to adapt different input formats and to allow the execution of the classification procedure. The analysis of results on synthetic and real datasets shows that SVM and Naïve Bayes outperform on average the other considered classifiers, although they do not provide a human interpretable classification model. Rule-based methods have slightly inferior classification performances, but deliver the species specific positions and nucleotide assignments. On synthetic data the supervised machine learning methods obtain superior classification performances with respect to the traditional DNA Barcode classification methods. On empirical data their classification performances are at a comparable level to the other methods. Conclusions The classification analysis shows that supervised machine learning methods are promising candidates for handling with success the DNA Barcoding species classification problem, obtaining excellent performances. To conclude, a powerful tool to perform species identification is now available to the DNA Barcoding community. PMID:24721333

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

Geography has a greater effect than Wolbachia infection on population genetic structure in the spider mite, Tetranychus pueraricola.

PubMed

Chen, Y-T; Zhang, Y-K; Du, W-X; Jin, P-Y; Hong, X-Y

2016-10-01

Wolbachia is an intracellular symbiotic bacterium that infects various spider mite species and is associated with alterations in host reproduction, which indicates the potential role in mite evolution. However, studies of Wolbachia infections in the spider mite Tetranychus pueraricola, a major agricultural pest, are limited. Here, we used multilocus sequence typing to determine Wolbachia infection status and examined the relationship between Wolbachia infection status and mitochondrial diversity in T. pueraricola from 12 populations in China. The prevalence of Wolbachia ranged from 2.8 to 50%, and three strains (wTpue1, wTpue2, and wTpue3) were identified. We also found double infections (wTpue1 + wTpue3) within the same individuals. Furthermore, the wTpue1 strain caused weak cytoplasmic incompatibility (CI) (egg hatchability ~55%), whereas another widespread strain, wTpue3, did not induce CI. There was no reduction in mitochondrial DNA (mtDNA) or nuclear DNA diversity among infected individuals, and mtDNA haplotypes did not correspond to specific Wolbachia strains. Phylogenetic analysis and analysis of molecular variance revealed that the distribution of mtDNA and nuclear DNA haplotypes were significantly associated with geography. These findings indicate that Wolbachia infection in T. pueraricola is complex, but T. pueraricola genetic differentiation likely resulted from substantial geographic isolation.

[A new herbs traceability method based on DNA barcoding-origin-morphology analysis--an example from an adulterant of 'Heiguogouqi'].

PubMed

Gu, Xuan; Zhang, Xiao-qin; Song, Xiao-na; Zang, Yi-mei; Li Yan-peng; Ma, Chang-hua; Zhao, Bai-xiao; Liu, Chun-sheng

2014-12-01

The fruit of Lycium ruthenicum is a common folk medicine in China. Now it is popular for its antioxidative effect and other medical functions. The adulterants of the herb confuse consumers. In order to identify a new adulterant of L. ruthenicum, a research was performed based on NCBI Nucleotide Database ITS Sequence, combined analysis of the origin and morphology of the adulterant to traceable varieties. Total genomic DNA was isolated from the materials, and nuclear DNA ITS sequences were amplified and sequenced; DNA fragments were collated and matched by using ContingExpress. Similarity identification of BLAST analysis was performed. Besides, the distribution of plant origin and morphology were considered to further identification and verification. Families and genera were identified by molecular identification method. The adulterant was identified as plant belonging to Berberis. Origin analysis narrowed the range of sample identification. Seven different kinds of plants in Berberis were potential sources of the sample. Adulterants variety was traced by morphological analysis. The united molecular identification-origin-morphology research proves to be a preceding way to medical herbs traceability with time-saving and economic advantages and the results showed the new adulterant of L. ruthenicum was B. kaschgarica. The main differences between B. kaschgarica and L. ruthenicum are as follows: in terms of the traits, the surface of B. kaschgarica is smooth and crispy, and that of L. ruthenicum is shrinkage, solid and hard. In microscopic characteristics, epicarp cells of B. aschgarica thickening like a string of beads, stone cells as the rectangle, and the stone cell walls of L. ruthenicum is wavy, obvious grain layer. In molecular sequences, the length of ITS sequence of B. kaschgarica is 606 bp, L. ruthenicum is 654 bp, the similarity of the two sequences is 53.32%.

Interspecific Introgression in Cetaceans: DNA Markers Reveal Post-F1 Status of a Pilot Whale

PubMed Central

Miralles, Laura; Lens, Santiago; Rodríguez-Folgar, Antonio; Carrillo, Manuel; Martín, Vidal; Mikkelsen, Bjarni; Garcia-Vazquez, Eva

2013-01-01

Visual species identification of cetacean strandings is difficult, especially when dead specimens are degraded and/or species are morphologically similar. The two recognised pilot whale species (Globicephala melas and Globicephala macrorhynchus) are sympatric in the North Atlantic Ocean. These species are very similar in external appearance and their morphometric characteristics partially overlap; thus visual identification is not always reliable. Genetic species identification ensures correct identification of specimens. Here we have employed one mitochondrial (D-Loop region) and eight nuclear loci (microsatellites) as genetic markers to identify six stranded pilot whales found in Galicia (Northwest Spain), one of them of ambiguous phenotype. DNA analyses yielded positive amplification of all loci and enabled species identification. Nuclear microsatellite DNA genotypes revealed mixed ancestry for one individual, identified as a post-F1 interspecific hybrid employing two different Bayesian methods. From the mitochondrial sequence the maternal species was Globicephala melas. This is the first hybrid documented between Globicephala melas and G. macrorhynchus, and the first post-F1 hybrid genetically identified between cetaceans, revealing interspecific genetic introgression in marine mammals. We propose to add nuclear loci to genetic databases for cetacean species identification in order to detect hybrid individuals. PMID:23990883

Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

PubMed

Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

2017-11-01

In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

Whole-exome/genome sequencing and genomics.

PubMed

Grody, Wayne W; Thompson, Barry H; Hudgins, Louanne

2013-12-01

As medical genetics has progressed from a descriptive entity to one focused on the functional relationship between genes and clinical disorders, emphasis has been placed on genomics. Genomics, a subelement of genetics, is the study of the genome, the sum total of all the genes of an organism. The human genome, which is contained in the 23 pairs of nuclear chromosomes and in the mitochondrial DNA of each cell, comprises >6 billion nucleotides of genetic code. There are some 23,000 protein-coding genes, a surprisingly small fraction of the total genetic material, with the remainder composed of noncoding DNA, regulatory sequences, and introns. The Human Genome Project, launched in 1990, produced a draft of the genome in 2001 and then a finished sequence in 2003, on the 50th anniversary of the initial publication of Watson and Crick's paper on the double-helical structure of DNA. Since then, this mass of genetic information has been translated at an ever-increasing pace into useable knowledge applicable to clinical medicine. The recent advent of massively parallel DNA sequencing (also known as shotgun, high-throughput, and next-generation sequencing) has brought whole-genome analysis into the clinic for the first time, and most of the current applications are directed at children with congenital conditions that are undiagnosable by using standard genetic tests for single-gene disorders. Thus, pediatricians must become familiar with this technology, what it can and cannot offer, and its technical and ethical challenges. Here, we address the concepts of human genomic analysis and its clinical applicability for primary care providers.

Xylopsora canopeorum (Umbilicariaceae), a new lichen species from the canopy of Sequoia sempervirens.

PubMed

Bendiksby, Mika; Næsborg, Rikke Reese; Timdal, Einar

2018-01-01

Xylopsora canopeorum Timdal, Reese Næsborg & Bendiksby is described as a new species occupying the crowns of large Sequoia sempervirens trees in California, USA. The new species is supported by morphology, anatomy, secondary chemistry and DNA sequence data. While similar in external appearance to X. friesii , it is distinguished by forming smaller, partly coralloid squamules, by the occurrence of soralia and, in some specimens, by the presence of thamnolic acid in addition to friesiic acid in the thallus. Molecular phylogenetic results are based on nuclear (ITS and LSU) as well as mitochondrial (SSU) ribosomal DNA sequence alignments. Phylogenetic hypotheses obtained using Bayesian Inference, Maximum Likelihood and Maximum Parsimony all support X. canopeorum as a distinct evolutionary lineage belonging to the X. caradocensis - X. friesii clade.

Xylopsora canopeorum (Umbilicariaceae), a new lichen species from the canopy of Sequoia sempervirens

PubMed Central

Bendiksby, Mika; Næsborg, Rikke Reese; Timdal, Einar

2018-01-01

Abstract Xylopsora canopeorum Timdal, Reese Næsborg & Bendiksby is described as a new species occupying the crowns of large Sequoia sempervirens trees in California, USA. The new species is supported by morphology, anatomy, secondary chemistry and DNA sequence data. While similar in external appearance to X. friesii, it is distinguished by forming smaller, partly coralloid squamules, by the occurrence of soralia and, in some specimens, by the presence of thamnolic acid in addition to friesiic acid in the thallus. Molecular phylogenetic results are based on nuclear (ITS and LSU) as well as mitochondrial (SSU) ribosomal DNA sequence alignments. Phylogenetic hypotheses obtained using Bayesian Inference, Maximum Likelihood and Maximum Parsimony all support X. canopeorum as a distinct evolutionary lineage belonging to the X. caradocensis–X. friesii clade. PMID:29559828

Quantitative analyses of the 3D nuclear landscape recorded with super-resolved fluorescence microscopy.

PubMed

Schmid, Volker J; Cremer, Marion; Cremer, Thomas

2017-07-01

Recent advancements of super-resolved fluorescence microscopy have revolutionized microscopic studies of cells, including the exceedingly complex structural organization of cell nuclei in space and time. In this paper we describe and discuss tools for (semi-) automated, quantitative 3D analyses of the spatial nuclear organization. These tools allow the quantitative assessment of highly resolved different chromatin compaction levels in individual cell nuclei, which reflect functionally different regions or sub-compartments of the 3D nuclear landscape, and measurements of absolute distances between sites of different chromatin compaction. In addition, these tools allow 3D mapping of specific DNA/RNA sequences and nuclear proteins relative to the 3D chromatin compaction maps and comparisons of multiple cell nuclei. The tools are available in the free and open source R packages nucim and bioimagetools. We discuss the use of masks for the segmentation of nuclei and the use of DNA stains, such as DAPI, as a proxy for local differences in chromatin compaction. We further discuss the limitations of 3D maps of the nuclear landscape as well as problems of the biological interpretation of such data. Copyright © 2017 Elsevier Inc. All rights reserved.

GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

2012-01-01

T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

Saturnia jonasii Butler, 1877 on Jejudo Island, a new saturnid moth of South Korea with DNA data and morphology (Lepidoptera: Saturniidae).

PubMed

Kim, Min Jee; Choi, Sei-Woong; Kim, Iksoo

2015-04-10

Saturnia (Rinaca) jonasii Butler, 1877 is distributed in Japan, including Tsushima Island and Taiwan, whereas S. boisduvalii Eversmann, 1846 is distributed in northern areas, such as China, Russia, and South Korea. In the present study we found that the specimens from Mt. Hallasan on Jejudo, a southern remote offshore island, were S. jonasii, rather than S. boisduvalii based on morphology, DNA barcode, and nuclear elongation factor 1 alpha (EF-1α) sequences. The major morphological differences between the two species included the shape of wing pattern elements of fore- and hindwings and male and female genitalia. A DNA barcode analysis of the sequences of the Jejudo specimens and S. boisduvalii, along with those of Saturnia species obtained from a public database showed a minimum sequence divergence of 4.26% (28 bp). A phylogenetic analysis also showed clustering of the Jejudo specimens with S. jonasii, separating S. boisduvalii (Bayesian posterior probability = 0.99). The EF-1α-based sequence and phylogenetic analyses of the two species from Jejudo Island and the Korean mainland showed the uniqueness of the Jejudo specimens from S. boisduvalii collected on the Korean mainland, indicating distribution of S. jonasii on Jejudo Island in South Korea, instead of S. boisduvalii.

Molecular systematics of European Hyalodaphnia: the role of contemporary hybridization in ancient species.

PubMed Central

Schwenk, K; Posada, D; Hebert, P D

2000-01-01

We examined phylogenetic relationships among Daphnia using mitochondrial DNA (mtDNA) sequences from the small subunit ribosomal RNA (12S), cytochrome c oxidase subunit I and nuclear DNA sequences from the first and second internal transcribed spacer representing 1612 base positions. Phylogenetic analyses using several species of the three main Daphnia subgenera, Ctenodaphnia, Hyalodaphnia and Daphnia, revealed that the Hyalodaphnia are a monophyletic sister group of the Daphnia. Most Hyalodaphnia species occur on one continent, whereas only three are found in North America and Europe. Endemicity of species is associated with variation in thermal tolerance and habitat differentiation. Although many species of the Hyalodaphnia are known to hybridize in nature, mtDNA divergence is relatively high ca. 9%) compared to other hybridizing arthropods (ca. 3%). Reproductive isolation in Daphnia seems to evolve significantly slower than genetic isolation. We related these findings to what is known about the ecology and genetics of Daphnia in order to better understand the evolutionary diversification of lineages. The relationship of these data to phylogenetic patterns is discussed in the context of speciation processes in Daphnia. PMID:11052533

The region of CQQQKPQRRP of PGC-1{alpha} interacts with the DNA-binding complex of FXR/RXR{alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanaya, Eiko; Jingami, Hisato

2006-04-14

PGC-1{alpha} co-activates transcription by several nuclear receptors. To study the interaction among PGC-1{alpha}, RXR{alpha}/FXR, and DNA, we performed electrophoresis mobility shift assays. The RXR{alpha}/FXR proteins specifically bound to DNA containing the IR-1 sequence in the absence of ligand. When the fusion protein of GST-PGC-1{alpha} was added to the mixture of RXR{alpha}/FXR/DNA, the ligand-influenced retardation of the mobility was observed. The ligand for RXR{alpha} (9-cis-retinoic acid) was necessary for this retardation, whereas, the ligand for FXR, chenodeoxycholic acid, barely had an effect. The results obtained using truncated PGC-1{alpha} proteins suggested that two regions are necessary for PGC-1{alpha} to interact with themore » DNA-binding complex of RXR{alpha}/FXR. One is the region of the second leucine-rich motif, and the other is that of the amino acid sequence CQQQKPQRRP, present between the second and third leucine-rich motifs. The results obtained with the SPQSS mutation for KPQRR suggested that the basic amino acids are important for the interaction.« less

The phylogeny of termites (Dictyoptera: Isoptera) based on mitochondrial and nuclear markers: Implications for the evolution of the worker and pseudergate castes, and foraging behaviors.

PubMed

Legendre, Frédéric; Whiting, Michael F; Bordereau, Christian; Cancello, Eliana M; Evans, Theodore A; Grandcolas, Philippe

2008-08-01

A phylogenetic hypothesis of termite relationships was inferred from DNA sequence data. Seven gene fragments (12S rDNA, 16S rDNA, 18S rDNA, 28S rDNA, cytochrome oxidase I, cytochrome oxidase II and cytochrome b) were sequenced for 40 termite exemplars, representing all termite families and 14 outgroups. Termites were found to be monophyletic with Mastotermes darwiniensis (Mastotermitidae) as sister group to the remainder of the termites. In this remainder, the family Kalotermitidae was sister group to other families. The families Kalotermitidae, Hodotermitidae and Termitidae were retrieved as monophyletic whereas the Termopsidae and Rhinotermitidae appeared paraphyletic. All of these results were very stable and supported with high bootstrap and Bremer values. The evolution of worker caste and foraging behavior were discussed according to the phylogenetic hypothesis. Our analyses suggested that both true workers and pseudergates ("false workers") were the result of at least two different origins. Our data support a traditional hypothesis of foraging behavior, in which the evolutionary transition from a one-piece type to a separate life type occurred through an intermediate behavioral form.

Genetic diversity and population structure of sickleweed (Falcaria vulgaris; Apiaceae) in the upper Midwest USA

Treesearch

Sarbottam Piya; Madhav P. Nepal; Jack L. Butler; Gary E. Larson; Achal Neupane

2014-01-01

Sickleweed (Falcaria vulgaris), an introduced species native to Europe and Asia, grows as an aggressive weed in some areas of the upper Midwest in the United States. We are reporting genetic diversity and population structure of sickleweed populations using microsatellite markers and nuclear and chloroplast DNA sequences. Populations showed high genetic differentiation...

Host race evolution in Schizaphis graminum (Hemiptera: Aphididae): nuclear DNA sequences

USDA-ARS?s Scientific Manuscript database

The greenbug aphid, Schizaphis graminum (Rondani) was introduced into the US in the late 1880s and it established quickly as a pest on wheat, oat and barley. Sorghum was also a host, but it was not until 1968 that greenbug became a serious pest on it. The most effective control method is the plant...

Population genetic analysis reveals ancient evolution and recent migration of P. ramorum

Treesearch

Erica M. Goss; Meg Larsen; Ignazio Carbone; Donald R. Givens; Gary A. Chastagner; Niklaus J. Gr& uuml; nwald

2010-01-01

Phytophthora ramorum populations in North America and Europe are comprised of three clonal lineages based on several different genetic marker systems (Ivors and others 2006, Martin 2008). Whether these lineages are ancient or a recent artifact of introduction has been unclear. We analyzed DNA sequence variation at five nuclear loci in order to...

Evidence of Tamarix hybrids in South Africa, as inferred by nuclear ITS and plastid trnS-trnG DNA sequences

USDA-ARS?s Scientific Manuscript database

Tamarix usneoides (Tamaricaceae) is a species native to southern Africa where it is currently being used in the mines for phytoremediation. However, Tamarix aphylla, T. ramosissima, T. chinensis, and T. parviflora have been reported as exotic species in South Africa, with T. ramosissima declared inv...

Evaluating manta ray mucus as an alternative DNA source for population genetics study: underwater-sampling, dry-storage and PCR success.

PubMed

Kashiwagi, Tom; Maxwell, Elisabeth A; Marshall, Andrea D; Christensen, Ana B

2015-01-01

Sharks and rays are increasingly being identified as high-risk species for extinction, prompting urgent assessments of their local or regional populations. Advanced genetic analyses can contribute relevant information on effective population size and connectivity among populations although acquiring sufficient regional sample sizes can be challenging. DNA is typically amplified from tissue samples which are collected by hand spears with modified biopsy punch tips. This technique is not always popular due mainly to a perception that invasive sampling might harm the rays, change their behaviour, or have a negative impact on tourism. To explore alternative methods, we evaluated the yields and PCR success of DNA template prepared from the manta ray mucus collected underwater and captured and stored on a Whatman FTA™ Elute card. The pilot study demonstrated that mucus can be effectively collected underwater using toothbrush. DNA stored on cards was found to be reliable for PCR-based population genetics studies. We successfully amplified mtDNA ND5, nuclear DNA RAG1, and microsatellite loci for all samples and confirmed sequences and genotypes being those of target species. As the yields of DNA with the tested method were low, further improvements are desirable for assays that may require larger amounts of DNA, such as population genomic studies using emerging next-gen sequencing.

Evaluating manta ray mucus as an alternative DNA source for population genetics study: underwater-sampling, dry-storage and PCR success

PubMed Central

Maxwell, Elisabeth A.; Marshall, Andrea D.; Christensen, Ana B.

2015-01-01

Sharks and rays are increasingly being identified as high-risk species for extinction, prompting urgent assessments of their local or regional populations. Advanced genetic analyses can contribute relevant information on effective population size and connectivity among populations although acquiring sufficient regional sample sizes can be challenging. DNA is typically amplified from tissue samples which are collected by hand spears with modified biopsy punch tips. This technique is not always popular due mainly to a perception that invasive sampling might harm the rays, change their behaviour, or have a negative impact on tourism. To explore alternative methods, we evaluated the yields and PCR success of DNA template prepared from the manta ray mucus collected underwater and captured and stored on a Whatman FTA™ Elute card. The pilot study demonstrated that mucus can be effectively collected underwater using toothbrush. DNA stored on cards was found to be reliable for PCR-based population genetics studies. We successfully amplified mtDNA ND5, nuclear DNA RAG1, and microsatellite loci for all samples and confirmed sequences and genotypes being those of target species. As the yields of DNA with the tested method were low, further improvements are desirable for assays that may require larger amounts of DNA, such as population genomic studies using emerging next-gen sequencing. PMID:26413431

Screening and Characterization of RAPD Markers in Viscerotropic Leishmania Parasites

PubMed Central

Mkada–Driss, Imen; Talbi, Chiraz; Guerbouj, Souheila; Driss, Mehdi; Elamine, Elwaleed M.; Cupolillo, Elisa; Mukhtar, Moawia M.; Guizani, Ikram

2014-01-01

Visceral leishmaniasis (VL) is mainly due to the Leishmania donovani complex. VL is endemic in many countries worldwide including East Africa and the Mediterranean region where the epidemiology is complex. Taxonomy of these pathogens is under controversy but there is a correlation between their genetic diversity and geographical origin. With steady increase in genome knowledge, RAPD is still a useful approach to identify and characterize novel DNA markers. Our aim was to identify and characterize polymorphic DNA markers in VL Leishmania parasites in diverse geographic regions using RAPD in order to constitute a pool of PCR targets having the potential to differentiate among the VL parasites. 100 different oligonucleotide decamers having arbitrary DNA sequences were screened for reproducible amplification and a selection of 28 was used to amplify DNA from 12 L. donovani, L. archibaldi and L. infantum strains having diverse origins. A total of 155 bands were amplified of which 60.65% appeared polymorphic. 7 out of 28 primers provided monomorphic patterns. Phenetic analysis allowed clustering the parasites according to their geographical origin. Differentially amplified bands were selected, among them 22 RAPD products were successfully cloned and sequenced. Bioinformatic analysis allowed mapping of the markers and sequences and priming sites analysis. This study was complemented with Southern-blot to confirm assignment of markers to the kDNA. The bioinformatic analysis identified 16 nuclear and 3 minicircle markers. Analysis of these markers highlighted polymorphisms at RAPD priming sites with mainly 5′ end transversions, and presence of inter– and intra– taxonomic complex sequence and microsatellites variations; a bias in transitions over transversions and indels between the different sequences compared is observed, which is however less marked between L. infantum and L. donovani. The study delivers a pool of well-documented polymorphic DNA markers, to develop molecular diagnostics assays to characterize and differentiate VL causing agents. PMID:25313833

Ribosomal Internal Transcribed Spacer of Prototheca wickerhamii Has Characteristic Structure Useful for Identification and Genotyping

PubMed Central

Hirose, Noriyuki; Nishimura, Kazuko; Inoue-Sakamoto, Maki; Masuda, Michiaki

2013-01-01

Prototheca species are achlorophyllous algae ubiquitous in nature and known to cause localized and systemic infection both in humans and animals. Although identification of the Prototheca species in clinical specimens is a challenge, there are an increasing number of cases in which molecular techniques have successfully been used for diagnosis of protothecosis. In this study, we characterized nuclear ribosomal DNA (rDNA) of a strain of Prototheca (FL11-0001) isolated from a dermatitis patient in Japan for its species identification. When nuclear rDNA of FL11-0001 and that of various other Prototheca strains were compared by polymerase chain reaction (PCR), the results indicated that the sizes of ribosomal internal transcribed spacer (ITS) were different in a species-dependent manner, suggesting that the variation might be useful for differentiation of Prototheca spp. Especially, ITS of P. wickerhamii, the most common cause of human protothecosis, was distinctively larger than that of other Prototheca spp. FL11-0001, whose ITS was comparably large, could easily be identified as P. wickerhamii. The usefulness of the PCR analysis of ITS was also demonstrated by the discovery that one of the clinical isolates that had previously been designated as P. wickerhamii was likely a novel species. Furthermore, our data demonstrated that nucleotide sequences of P. wickerhamii ITS are heterogenous between different rDNA copies in each strain and also polymorphic between strains. Phylogenetic analysis suggested that the ITS sequences could be classified to four clades, based on which P. wickerhamii strains might be grouped into at least two genotypes. Comprehensive characterization of Prototheca rDNA may provide valuable insights into diagnosis and epidemiology of protothecosis, as well as evolution and taxonomy of Prototheca and related organisms. PMID:24312279

Ribosomal internal transcribed spacer of Prototheca wickerhamii has characteristic structure useful for identification and genotyping.

PubMed

Hirose, Noriyuki; Nishimura, Kazuko; Inoue-Sakamoto, Maki; Masuda, Michiaki

2013-01-01

Prototheca species are achlorophyllous algae ubiquitous in nature and known to cause localized and systemic infection both in humans and animals. Although identification of the Prototheca species in clinical specimens is a challenge, there are an increasing number of cases in which molecular techniques have successfully been used for diagnosis of protothecosis. In this study, we characterized nuclear ribosomal DNA (rDNA) of a strain of Prototheca (FL11-0001) isolated from a dermatitis patient in Japan for its species identification. When nuclear rDNA of FL11-0001 and that of various other Prototheca strains were compared by polymerase chain reaction (PCR), the results indicated that the sizes of ribosomal internal transcribed spacer (ITS) were different in a species-dependent manner, suggesting that the variation might be useful for differentiation of Prototheca spp. Especially, ITS of P. wickerhamii, the most common cause of human protothecosis, was distinctively larger than that of other Prototheca spp. FL11-0001, whose ITS was comparably large, could easily be identified as P. wickerhamii. The usefulness of the PCR analysis of ITS was also demonstrated by the discovery that one of the clinical isolates that had previously been designated as P. wickerhamii was likely a novel species. Furthermore, our data demonstrated that nucleotide sequences of P. wickerhamii ITS are heterogenous between different rDNA copies in each strain and also polymorphic between strains. Phylogenetic analysis suggested that the ITS sequences could be classified to four clades, based on which P. wickerhamii strains might be grouped into at least two genotypes. Comprehensive characterization of Prototheca rDNA may provide valuable insights into diagnosis and epidemiology of protothecosis, as well as evolution and taxonomy of Prototheca and related organisms.

Mitochondrial pathology in inclusion body myositis.

PubMed

Lindgren, Ulrika; Roos, Sara; Hedberg Oldfors, Carola; Moslemi, Ali-Reza; Lindberg, Christopher; Oldfors, Anders

2015-04-01

Inclusion body myositis (IBM) is usually associated with a large number of cytochrome c oxidase (COX)-deficient muscle fibers and acquired mitochondrial DNA (mtDNA) deletions. We studied the number of COX-deficient fibers and the amount of mtDNA deletions, and if variants in nuclear genes involved in mtDNA maintenance may contribute to the occurrence of mtDNA deletions in IBM muscle. Twenty-six IBM patients were included. COX-deficient fibers were assayed by morphometry and mtDNA deletions by qPCR. POLG was analyzed in all patients by Sanger sequencing and C10orf2 (Twinkle), DNA2, MGME1, OPA1, POLG2, RRM2B, SLC25A4 and TYMP in six patients by next generation sequencing. Patients with many COX-deficient muscle fibers had a significantly higher proportion of mtDNA deletions than patients with few COX-deficient fibers. We found previously unreported variants in POLG and C10orf2 and IBM patients had a significantly higher frequency of an RRM2B variant than controls. POLG variants appeared more common in IBM patients with many COX-deficient fibers, but the difference was not statistically significant. We conclude that COX-deficient fibers in inclusion body myositis are associated with multiple mtDNA deletions. In IBM patients we found novel and also previously reported variants in genes of importance for mtDNA maintenance that warrants further studies. Copyright © 2014 Elsevier B.V. All rights reserved.

Epstein-Barr virus origin of lytic replication mediates association of replicating episomes with promyelocytic leukaemia protein nuclear bodies and replication compartments.

PubMed

Amon, Wolfgang; White, Robert E; Farrell, Paul J

2006-05-01

Epstein-Barr virus (EBV) establishes a latent persistence from which it can be reactivated to undergo lytic replication. Late lytic-cycle gene expression is linked to lytic DNA replication, as it is sensitive to the same inhibitors that block lytic replication, and it has recently been shown that the viral origin of lytic replication (ori lyt) is required in cis for late-gene expression. During the lytic cycle, the viral genome forms replication compartments, which are usually adjacent to promyelocytic leukaemia protein (PML) nuclear bodies. A tetracycline repressor DNA-binding domain-enhanced green fluorescent protein fusion was used to visualize replicating plasmids carrying a tetracycline operator sequence array. ori lyt mediated the production of plasmid replication compartments that were associated with PML nuclear bodies. Plasmids carrying ori lyt and EBV itself were visualized in the same cells and replicated in similar regions of the nucleus, further supporting the validity of the plasmids for studying late-gene regulation.